sort by

482 publications mentioning hsa-mir-143 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-143. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 471
The number of invading cells was determined and is depicted in the bar graph (*** P < 0.001; Student’s t test) ITGA6 is a direct target gene of miR-143-3pTo explore the molecular mechanisms by which miR-143-3p regulates GBC cell growth and angiogenesis, three miRNA target-prediction programmes (TargetScan, PicTar and miRDB) were used to predict the target sites of miR-143-3p (Fig.   5a). [score:11]
The PLGF mRNA and protein expression levels were determined by qRT- PCR and western blot, and the results indicated that miR-143-3p inhibited the expression of PLGF at the transcriptional level (Fig.   4d, e), while silencing of miR-143-3p enhanced the expression of PLGF (Fig.   4d, e). [score:9]
Because miR-143-3p inhibits tube formation and invasion, we assessed whether inhibition of angiogenesis occurred via downregulation of PLGF. [score:8]
miR-143-3p inhibited the function of integrin α6 (ITGA6), a direct target of miR-143-3p, which induced tumour angiogenesis through the MAPK and PI3K/AKT pathways and enhanced the expression of PLGF. [score:8]
To determine the target of miR-143-3p that was relevant to inhibition of angiogenesis, an angiogenesis antibody array was performed, and the results indicated that several pro-angiogenesis cytokines were downregulated by miR-143-3p, including CXCL5, uPAR, VEGFR2, VEGFR3, VEGFA, MMP-9, ANGPT1, TGF-β and PLGF. [score:8]
ITGA6 expression is upregulated and negatively associated with miR-143-3p expression in GBC. [score:8]
The number of invading cells was determined and is depicted in the bar graph (*** P < 0.001; Student’s t test) To explore the molecular mechanisms by which miR-143-3p regulates GBC cell growth and angiogenesis, three miRNA target-prediction programmes (TargetScan, PicTar and miRDB) were used to predict the target sites of miR-143-3p (Fig.   5a). [score:8]
Liu X Gong J Xu B miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasionInt. [score:8]
Thus, the antiangiogenic functions of miR-143-3p are indirectly executed by inhibiting its indirect target, PLGF. [score:7]
d, e PLGF expression in the mimic (inhibitor) NC and miR-143-3p mimics (inhibitors) -transfected GBC cells was analysed by western blot and qRT-PCR analysis. [score:7]
ITGA6 overexpression could markedly reverse the inhibitory effects of miR-143-3p on GBC cell proliferation and angiogenesis and on PLGF expression. [score:7]
a Potential miR-143-3p targets predicted by the three miRNA target-prediction programmes (TargetScan, PicTar and miRDB). [score:7]
The nuclei were counterstained with DAPI a Potential miR-143-3p targets predicted by the three miRNA target-prediction programmes (TargetScan, PicTar and miRDB). [score:7]
miR-143-3p downregulates PLGF expression through the ITGA6/PI3K/AKT /STAT3 pathways. [score:6]
g Western blot for the ITGA6 and PLGF proteins in GBC cells that were co -transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6 miR-143-3p downregulates PLGF expression through the ITGA6/PI3K/AKT /STAT3 pathways ITGA6 activates multiple signal transduction cascades, including PI3K/AKT and MAPK/ERK [20]. [score:6]
Therefore, these findings suggest that miR-143-3p downregulates the expression of PLGF through the ITGA6/PI3K/AKT pathways (Fig.   8c). [score:6]
Thus, ITGA6 overexpression can reverse downregulation of PLGF by miR-143-3p. [score:6]
c Working mo del of the miR-143-3p regulatory axis in GBC a Western blot analysis of relevant proteins in the MAPK/ERK and PI3K/AKT pathways in GBC cells that were transfected with mimic (inhibitor) NC or miR-143-3p mimics (inhibitors). [score:6]
The nuclei were counterstained with DAPI ITGA6 expression is upregulated and negatively associated with miR-143-3p expression in GBCTo further evaluate the correlation between ITGA6 and miR-143-3p in GBC tissues, we examined the levels of ITGA6 mRNA in the same 49 pairs of GBC tissues and their corresponding NATs. [score:6]
Therefore, a bioinformatics prediction system (TargetScan, PicTar and miRDB) was used to predict the target of miR-143-3p. [score:5]
However, the proliferation rate of GBC cells transfected with the miR-143-3p inhibitors was significantly increased relative to the inhibitor NC group (Fig.   2e and Supplementary Figure  1d). [score:5]
Conversely, HMVECs formed more branch points in the group of GBC cells transfected with the miR-143-3p inhibitors than in the inhibitor negative control (NC) group. [score:5]
miR-143-3p inhibits expression of PLGF. [score:5]
Conversely, expression of the ITGA6 reporter containing the mutated sequence of the same fragment was not affected by the miR-143-3p mimics or inhibitors (Fig.   5e). [score:5]
Here, we first determined the inhibitory role of miR-143-3p in GBC growth and angiogenesis and then demonstrated the potential use of miR-143-3p as a targeted therapy and as a prognostic indicator for patients with GBC. [score:5]
Our results further indicated that miR-143-3p inactivated the MAPK/ERK and PI3K/AKT/STAT3 pathways in GBC cells by directly targeting ITGA6, resulting in a decrease in PLGF and the development of GBC angiogenesis and tumour growth. [score:5]
a Western blot analysis of relevant proteins in the MAPK/ERK and PI3K/AKT pathways in GBC cells that were transfected with mimic (inhibitor) NC or miR-143-3p mimics (inhibitors). [score:5]
c, d Invasion of HMVECs through the Matrigel chambers after incubation with conditioned medium from miR-143-3p -overexpressing or miR-143-3p -inhibited GBC cells for 48 h. Scale bar, 100 µm. [score:5]
miR-143-3p expression was calculated and expressed as the miR-143-3p/U6 expression ratio (2 [−ΔCT]). [score:5]
The results showed that overexpression of ITGA6 partially reversed the phenotype caused by overexpression of miR-143-3p (Fig.   7a−e). [score:5]
Wei J miR-143 inhibits cell proliferation by targeting autophagy-related 2B in non-small cell lung cancer H1299 cellsMol. [score:5]
f Expression of ITGA6 in GBC cells infected with the miR-143-3p mimic or inhibitor and corresponding control was examined by immunofluorescence. [score:5]
Fig. 7Overexpression of ITGA6 attenuates the inhibitory effects of miR-143-3p on GBC cells. [score:5]
c Representative IHC micrographs showing ITGA6 protein expression in GBC tissues with high or low miR-143-3p expression. [score:5]
The expression levels of p-ERK1/2, p-MEK1/2, PIK3CA, p-AKT and p-STAT3 were decreased when miR-143-3p was overexpressed (Fig.   8a left). [score:5]
qRT- PCR and western blot analyses confirmed that miR-143-3p suppressed the endogenous expression of ITGA6 at the mRNA and protein levels (Fig.   5c, d). [score:5]
Overexpression of ITGA6 attenuates the inhibitory effects of miR-143-3p on GBC cells. [score:5]
A statistical plot of the average tumour weights in the subcutaneous xenograft mo del (** P < 0.01, *** P < 0.001, n = 5) miR-143-3p inhibits PLGF -induced angiogenesisTo determine the role of miR-143-3p in angiogenesis, an angiogenesis antibody array was performed to assess differences in expression of angiogenesis-related cytokines between the conditional medium of NOZ cells transfected with either the mimic NC or miR-143-3p mimics. [score:5]
The mean survival time in the low miR-143-3p expression group was 9.86 months, whereas the mean survival time in the high miR-143-3p expression group was 26.92 months. [score:5]
The dual-luciferase activity assays showed that expression of the ITGA6 reporter was significantly reduced by the miR-143-3p mimics and increased by the miR-143-3p inhibitors. [score:4]
According to the results, ITGA6 was a direct target of miR-143-3p and was associated with angiogenesis. [score:4]
Wu D MicroRNA-143 inhibits cell migration and invasion by targeting matrix metalloproteinase 13 in prostate cancerMol. [score:4]
These results indicate that ITGA6 is a direct downstream target of miR-143-3p. [score:4]
Downregulation of miR-143-3p is associated with an unfavourable prognosis in GBC patients. [score:4]
The Kaplan−Meier analysis revealed that high miR-143-3p expression was associated with better overall survival compared with lower expression levels (P < 0.001) (Fig.   1d). [score:4]
We presumed that miR-143-3p decreased the expression of PLGF by interacting with an upstream regulator of PLGF. [score:4]
No binding sites were found in the 3′UTR of PLGF, indicating that PLGF was not a direct target of miR-143-3p. [score:4]
ITGA6 is a direct target gene of miR-143-3p. [score:4]
c Working mo del of the miR-143-3p regulatory axis in GBC Accumulative evidence indicates that miRNAs serve as oncogenes or tumour suppressors that act as pivotal players in tumourigenesis and tumour progression. [score:4]
According to our miRNA profiling results [1], we found that miR-143-3p was significantly downregulated. [score:4]
Downregulation of miR-143-3p is correlated with poor clinical outcomes in GBC patients. [score:4]
c Working mo del of the miR-143-3p regulatory axis in GBC According to our previous microarray results [1], miR-143-3p was dramatically downregulated in GBC tissues compared with NATs (Fig.   1a). [score:4]
Fig. 5 ITGA6 is a direct target gene of miR-143-3p. [score:4]
c, d Overexpression of miR-143-3p attenuates ITGA6 protein and mRNA expression in NOZ and GBC-SD cells compared with the miRNA-NC group. [score:4]
For the construction of cell lines stably expressing miR-143-3p, miR-143-3p and negative control sequence were synthesized and inserted into PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-puromycin-WPRE lentiviral vector. [score:3]
The result showed that fewer vessels were formed in the miR-143-3p overexpression group (Lv-miR-143-3p) than in the NC group (Lv-miR-NC) (Fig.   3a). [score:3]
Therefore, our results reveal a leading mechanism by which miR-143-3p suppresses angiogenesis in GBC. [score:3]
Collectively, our results indicate that miR-143-3p and its target ITGA6 may be effective prognostic indicators. [score:3]
miR-143-3p inhibits PLGF -induced angiogenesis. [score:3]
Recombinant lentiviruses expressing miR-143-3p or negative control (Lv-miR-143-3p and Lv-miR-NC, respectively) were produced by Genomeditech (Shanghai, China). [score:3]
The expression levels of miR-143-3p were significantly lower in the tumour tissues than in the corresponding adjacent noncancerous tissues (P = 0.0021, Fig.   1b, c). [score:3]
b Scatterplots of the relative expression levels of miR-143-3p in the GBC tissues and their corresponding NATs. [score:3]
Conversely, the expression levels of p-ERK1/2, p-MEK1/2, PIK3CA, p-AKT and p-STAT3 were increased when miR-143-3p was silenced (Fig.   8a right). [score:3]
ITGA6 overexpression rescues the effects of miR-143-3p on GBC cell proliferation and angiogenesis. [score:3]
Generation of stable cell lines with overexpression of miR-143-3p. [score:3]
Additionally, higher invasive activity was evident in HMVECs treated with the conditional medium of GBC cells transfected with the miR-143-3p inhibitors (Fig.   2a−d right). [score:3]
d Scatterplots of the average staining scores of ITGA6 expression in the miR-143-3p -high or miR-143-3p-low tissues (** P < 0.01, n = 25 for miR-143-3p-low group; n = 24 for miR-143-3p high group). [score:3]
Moreover, we performed rescue, western blot and ELISA analyses to confirm that miR-143-3p decreased the expression levels of PLGF by interacting with ITGA6. [score:3]
A total of 1×10 [6] NOZ cells stably expression miR-143-3p or negative control (Lv-miR-143-3p or Lv-miR-NC) were inoculated subcutaneously into the ventral areas of the mice (n = 5 per group). [score:3]
Additionally, more studies of miR-143-3p and ITGA6 should be conducted so that new approaches for molecular therapeutics that specifically target miR-143-3 and ITGA6 in GBC patients can be developed. [score:3]
P = 0.0021. c Comparison of the miR-143-3p expression levels between the GBC tissues and their corresponding NATs. [score:3]
A statistical plot of the average tumour weights in the subcutaneous xenograft mo del (** P < 0.01, *** P < 0.001, n = 5) To determine the role of miR-143-3p in angiogenesis, an angiogenesis antibody array was performed to assess differences in expression of angiogenesis-related cytokines between the conditional medium of NOZ cells transfected with either the mimic NC or miR-143-3p mimics. [score:3]
Inhibition of miR-143-3p reversed this phenotype (Fig.   5f). [score:3]
The Spearman correlation analysis clearly showed a negative correlation between ITGA6 and miR-143-3p expression in the GBC tissues (Fig.   6b). [score:3]
P < 0.001 We first assessed the expression levels of miR-143-3p in five human GBC cell lines (NOZ, GBC-SD, SGC996, OCUG-1 and EHGB-1). [score:3]
d Kaplan−Meier overall survival curve of GBC patients based on miR-143-3p expression. [score:3]
To further evaluate the negative correlation between ITGA6 and miR-143-3p, immunohistochemical staining of the tissues with high and low levels of miR-143-3p was performed, and the results showed that the tissues with high miR-143-3p expression had weaker ITGA6 staining than the tissues with low miR-143-3p expression (Fig.   6c). [score:3]
miR-143-3p acts as a tumour suppressor in various cancers, including lung cancer, colorectal cancer, prostate cancer and hepatocellular carcinoma 26– 29. [score:3]
miR-143-3p inhibits GBC cell proliferation and angiogenesis in vivo. [score:3]
According to a previous study, miR-143-3p is dramatically downregulated in GBC tissues compared with non-tumour adjacent tissues (NATs) 1, 18, 19. [score:3]
Cells were co -transfected with 50 nM miR-143-3p mimic, the inhibitor or the cognate controls and 0.5 μg of pmirGLO- ITGA6-3′UTR-WT/pmirGLO- ITGA6-3′UTR-MUT vector. [score:3]
In the survival analysis, 49 GBC patients were divided into two groups (miR-143-3p-low, n = 25; miR-143-3p -high, n = 24) by setting the cut-off value to the median miR-143-3p expression level. [score:3]
e The relative luciferase activity of the wild-type or mutant ITGA6 3′UTR in 293T cells after transfections with the miR-143-3p mimic or inhibitor and corresponding control (* P < 0.05, NS no significant). [score:3]
Consistent with the angiogenesis antibody array data, the PLGF level was significantly downregulated in the miR-143-3p mimics group compared with the mimic NC group in both NOZ and GBC-SD cells (Fig.   4c). [score:3]
Low expression of miR-143-3p is associated with a poor clinical outcome. [score:3]
miR-143-3p inhibits GBC cell angiogenesis and proliferation in vivo. [score:3]
The results showed that the volumes and weights of xenografted tumours were smaller and lower, respectively, in the miR-143-3p overexpression group (Lv-miR-143-3p) than in the NC group (Lv-miR-NC) (Fig.   3d−f). [score:3]
b The correlation between the expression levels of miR-143-3p and ITGA6 was determined using a linear regression analysis and a paired t test with the same samples used (P < 0.001, r = −0.2177, n = 49; Pearson’s correlation). [score:3]
We found that the expression level of miR-143-3p was significantly lower in GBC tissues than in the NAT counterparts. [score:3]
According to our previous microarray results [1], miR-143-3p was dramatically downregulated in GBC tissues compared with NATs (Fig.   1a). [score:3]
Therefore, we hypothesized that miR-143-3p decreased the expression of PLGF by interacting with ITGA6. [score:3]
miR-143-3p inhibits GBC cell proliferation and angiogenesis in vitro. [score:3]
These changes were partially recovered by overexpression of ITGA6, indicating that miR-143-3p/ ITGA6 functions as a key mediator of angiogenesis via the MAPK/ERKand PI3K/AKT /STAT3 signalling pathways. [score:3]
These findings suggest that miR-143-3p suppresses GBC cell proliferation and angiogenesis in vitro. [score:3]
Additionally, the average staining score for ITGA6 expression was higher in the miR-143-3p-low group than in the miR-143-3p -high group (** P < 0.01; Fig.   6d). [score:3]
The expression of miR-143-3p in the stable cell lines and xenograft tumour was validated by qRT–PCR analysis. [score:3]
The miR-143-3p expression levels were lowest in NOZ cells and highest in GBC-SD cells among five GBC cell lines (Supplementary Figure  S1a). [score:3]
Additionally, immunofluorescence assays showed that the expression levels of ITGA6 in the miR-143-3p mimic -transfected cells were weaker than in the miR-NC -transfected cells. [score:2]
Silencing of miR-143-3p promotes ITGA6 protein and mRNA expression in NOZ and GBC-SD cells compared with the miRNA-NC group. [score:2]
Through gain- and loss-of-function miR-143-3p assays in GBC cells, we uncovered that miR-143-3p could efficiently weaken in vitro invasion and capillary tube formation of HMVECs and suppress tumour growth and angiogenesis in nude mice. [score:2]
Our results indicate that miR-143-3p is a novel antiangiogenesis miRNA. [score:1]
a Human angiogenesis array analysis of the conditional medium from NOZ -mimic-NC and NOZ-miR-143-3p mimic cells. [score:1]
Furthermore, immunostaining of the CD31 protein in the Matrigel plugs of the Lv-miR-143-3p group was remarkably weaker than in the Lv-miR-NC group (Fig.   3b). [score:1]
Lentivirus-miR-143-3p and lentivirus-miR-NC were purchased from Genomeditech (Shanghai, China). [score:1]
NOZ and GBC-SD cells were co -transfected with miR-NC or the miR-143-3p mimics together with an empty vector or ITGA6 vector. [score:1]
A clinicopathological association study of the 49 GBCs showed that miR-143-3p was significantly associated with tumour size (P = 0.016) (Table  1) and tumour invasion (P = 0.023) (Table  1). [score:1]
To investigate the biological functions of miR-143-3p in GBC angiogenesis, we performed a gain- and loss-of-function analysis using miR-143-3p mimics and inhibitors. [score:1]
To validate our previous miRNA profiling data, we evaluated miR-143-3p expression in 49 paired clinical GBC specimens. [score:1]
The triple digoxigenin -labelled antisense locked nucleic acid (LNA) -modified probes for miR-143-3p were synthesized by Boster Biotech (Wuhan, China). [score:1]
However, the precise molecular mechanism through which miR-143-3p influences the progression of GBC remains unknown. [score:1]
f, g Endothelial tube formation estimation after incubation of HMVECs with conditioned medium from mimic NC or miR-143-3p cancer cells with or without PLGF. [score:1]
To further confirm that miR-143-3p interacted with the 3′-UTR regions of the ITGA6 mRNA at the predicted seed sequence binding sites, we constructed a dual-luciferase reporter plasmid containing a fragment of the ITGA6 3′-UTR across the conserved miR-143-3p binding sites (Fig.   5b). [score:1]
To investigate the molecular mechanism underlying the angiogenesis controlled by miR-143-3p/ ITGA6, we examined the expression levels of relevant proteins in the MAPK/ERK and PI3K/AKT pathways. [score:1]
Fig. 3 a Matrigel containing 20 U of heparin and NOZ cells transfected with Lv-miR-NC or Lv-miR-143-3p was subcutaneously implanted in 4−6-week-old male BALB/c athymic nude mice. [score:1]
b Western blot analysis of relevant proteins in the MAPK/ERK and PI3K/AKT pathways in GBC cells that were co -transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6. [score:1]
In summary, our study demonstrated the antiangiogenic effects of miR-143-3p on GBC cells. [score:1]
However, the precise molecular mechanisms by which miR-143-3p influences various physiological processes of GBC remain unknown. [score:1]
h, i Invasion of HMVECs through the Matrigel chambers after incubation with conditioned medium from mimic NC or miR-143-3p cancer cells with or without PLGF. [score:1]
f PLGF in the supernatants from NOZ and GBC-SD cells that were co -transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6 was quantified by ELISA (n = 3; * P < 0.05, *** P < 0.001; Student’s ttest). [score:1]
g Western blot for the ITGA6 and PLGF proteins in GBC cells that were co -transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6 ITGA6 activates multiple signal transduction cascades, including PI3K/AKT and MAPK/ERK [20]. [score:1]
b, d Invasion of HMVECs through the Matrigel chambers after incubation with conditioned medium from GBC cells co -transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6 for 48−72 h. Scale bar, 100 µm. [score:1]
Additionally, we found that miR-143-3p played vital roles in GBC angiogenesis and growth. [score:1]
A total of 1×10 [5] NOZ cells transfected with mimic NC or miR-143-3p mimics were seeded onto a six-well plate with 1 ml of serum-free medium. [score:1]
NOZ cells were infected with a negative control lentivirus or a mir-143-3p lentivirus (Lv-miR-NC or Lv-miR-143-3p) and were selected with 0.5 µg/ml of puromycin for 10 days. [score:1]
As a result, the culture medium from the NOZ and GBC-SD cells transfected with the miR-143-3p mimics significantly impaired capillary tube formation and decreased the invasive abilities of HMVECs (Fig.   2a−d left). [score:1]
c PLGF in the supernatants of the NOZ and GBC-SD cells that were transfected with mimic NC or the miR-143-3p mimics were quantified by ELISA (n = 3; * P < 0.05, ** P < 0.01; Student’s t test). [score:1]
To determine whether miR-143-3p directly bound to PLGF, we compared the miR-143-3p sequence with the PLGF 3′UTR and found no binding site. [score:1]
g Western blot for the ITGA6 and PLGF proteins in GBC cells that were co -transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6 a, c Endothelial tube formation was estimated following incubation of HMVECs with conditioned medium from GBC cells transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6. [score:1]
a, c Endothelial tube formation was estimated following incubation of HMVECs with conditioned medium from GBC cells transfected with mimic NC or miR-143-3p mimic and empty vector or ITGA6. [score:1]
To date, biological functions for miR-143-3p have been reported mainly in areas of proliferation and metastasis, while the impact of miR-143-3p on angiogenesis is not well understood. [score:1]
The 1990−1997 region of the ITGA6 3′-UTR contains a conserved miR-143-3p binding site (Fig.   5b). [score:1]
A statistical plot of the average tumour weights in the subcutaneous xenograft mo del (** P < 0.01, *** P < 0.001, n = 5) a Matrigel containing 20 U of heparin and NOZ cells transfected with Lv-miR-NC or Lv-miR-143-3p was subcutaneously implanted in 4−6-week-old male BALB/c athymic nude mice. [score:1]
The results showed that the addition of recombinant PLGF protein significantly increased HMVEC tube formation and invasion, whereas no significant differences were observed between the mimic NC+IgG and miR-143-3p+ PLGF groups (Fig.   4f−i). [score:1]
The vessel densities were lower in the Lv-miR-143-3p plugs than in the Lv-miR-NC plugs (Fig.   3c). [score:1]
The number of invading cells was determined and is depicted in the bar graph (*** P < 0.001; Student’s t test) a Human angiogenesis array analysis of the conditional medium from NOZ -mimic-NC and NOZ-miR-143-3p mimic cells. [score:1]
b The wild-type or mutant ITGA6 3′UTRs to determine the miR-143-3p binding site. [score:1]
The GBC cells transfected with the miR-143-3p mimics clearly grew more slowly than the mimic NC group. [score:1]
[1 to 20 of 137 sentences]
2
[+] score: 465
This observation supports that miR-143 could target and repress HK2 expression in-vivo and that HK2 expression could be upregulated in a subset of tumors due to lower levels of miR-143. [score:10]
This target identification approach provides a way to indentify functionally relevant miRNA targets in colon cancer cells without any assumption concerning the conservation of miR-143 binding sites, but by means of detecting expression changes of potential miR-143 targets at the transcript level. [score:9]
This is in agreement with a study of miR-143 in liposarcoma that also did not identify ERK5 as a miR-143 target, but did observe a down-regulation of HK2 in response to miR-143 overexpression [22]. [score:8]
As a further confirmation of this strategy to identify miRNA targets, we observed a highly significant enrichment of miR-143 seed sites in the 3'UTRs of genes down-regulated upon miR-143 overexpression. [score:8]
As miR-143 possesses a tumor-suppressor function, we would expect a down-regulation of oncogenes and genes promoting cell proliferation upon miR-143 overexpression. [score:8]
Potential miR-143 targets were identified as genes containing miR-143 seed sites in the 3'UTRs that were down-regulated upon miR-143 overexpression. [score:8]
Here, we reported the identification of HK2 as a target of miR-143, confirming the down-regulation of HK2 upon miR-143 overexpression of transcript cells as well as protein level in both DLD-1 and HCT116 colon cancer cell lines. [score:8]
Putative miR-143 targets, defined as genes down-regulated upon miR-143 overexpression with a FC < −1.1 and containing either a least one 7mer, 7mer-1A or 8mer seed site in their 3'UTR are listed in Additional file 4: Table S3. [score:8]
Furthermore, miR-143 overexpression has been demonstrated to have a growth inhibitory effect in several cell lines, indicating that loss of miR-143 expression could contribute to the development of cancer [13- 15, 18, 22, 23]. [score:8]
Using a microarray based experimental approach we have identified a number of putative miR-143 targets that are down-regulated at the transcript level by miR-143 overexpression and contain miR-143 seed sites in their 3'UTRs. [score:8]
We verified HK2 as a direct target of miR-143 and show that miR-143 mediated down-regulation of HK2 results in a decreased lactate secretion. [score:7]
]10 [-9]N-Glycan biosynthesis0002Base excision repair0.002Vibrio cholerae infection0.003p53 signaling pathway0.003Huntington's disease0.004Lysine degradation0.004Regulation of actin cytoskeleton0.007Wnt signaling pathway0.008Biosynthesis of unsaturated fatty acids0.008 Glycolysis / Gluconeogenesis 0.01 Table 2 Enriched BioCarta pathways among miR-143 down-regulated gene sets BioCarta Pathway P-valueHIV-I Nef: negative effector of Fas and TNF2.42 [. [score:7]
However, this might be explained by the more efficient down-regulation of HK2 mediated by the HK2 siRNA than by overexpression of miR-143. [score:6]
The 7mer and the 7mer-1A seed sites of miR-143 were identified as the most significantly enriched 7mer words in the 3'UTRs of transcripts down-regulated after miR-143 overexpression (Figure 2B). [score:6]
miR-143 mediated down-regulation of one or more of the above mentioned genes in colon cancer cells could account for the growth inhibitory effect of miR-143. [score:6]
As expected, transcripts down-regulated upon miR-143 overexpression had a significant enrichment of miR-143 seed sites in their 3'UTRs. [score:6]
List of putative miR-143 targets (defined as down-regulated transcripts with at least one miR-143 7mer, 7mer-1A or 8mer seed site in their 3'UTRs). [score:6]
Considering miR-143 down-regulated genes in our study, including both direct and potential secondary effects, we found an enrichment of genes involved in cell cycle regulation as well as cellular metabolism. [score:6]
However, the tumor suppressive function of miR-143 is likely a result of the combined effect of miR-143 -mediated down-regulation of several genes rather than a single gene. [score:6]
KRAS was also found down-regulated in the microarray analysis but because it had a borderline logFC of −0.14, it is not included in our list of potential miR-143 targets as listed in Additional file 4: Table S3. [score:6]
Importantly, a decrease in the lactate secretion was also observed upon miR-143 overexpression (Figure 4D), confirming that miR-143 downregulation of HK2 has a functional effect on the glucose metabolism. [score:6]
Western blot analysis further confirmed that miR-143 overexpression lead to a down-regulation of HK2 protein levels in both DLD-1 and HCT116 colon cancer cells (Figure 3C). [score:6]
com) and MSigDB [32] databases for the down-regulated gene sets after over -expressing miR-143. [score:6]
However the degree of down-regulation was above the logFC of −1.1 used to define our set of putative miR-143 target. [score:6]
In accordance with numerous reports of miR-143 down-regulation in cancer, we observed low or undetectable expression levels of miR-143 in human cancer cell lines. [score:6]
Here, we report that miR-143 targets and down-regulates the glycolytic enzyme hexokinase 2 (HK2) in colon cancer cell lines. [score:6]
Notably the endogenous protein level of HK2 in DLD-1 cells is considerably higher than in HCT116 cells, but nevertheless miR-143 overexpression lead to a downregulation of HK2 protein levels in both cell lines. [score:6]
In accordance with previous reports we also find KRAS downregulated upon miR-143 overexpression (Figure 2D) [15]. [score:6]
In addition we also observed a reduced expression of the glycolytic enzyme hexokinase 2 (HK2) upon miR-143 overexpression. [score:5]
This suggests that miR-143 targets genes involved in a number of cellular pathways, including pathways controlling cell growth and metabolism which mediates downstream gene expression changes of genes in these pathways. [score:5]
We further showed that inhibition of HK2 results in a reduction in cellular proliferation of DLD-1 colon cancer cells, an effect that resembles the effect of miR-143 overexpression. [score:5]
By mutation of the miR-143 binding site in the 3'UTR of HK2 we showed that the target interaction between miR-143 and HK2 is direct. [score:5]
In vascular smooth muscle cells miR-143 inhibition was found to increase the proliferative potential 2-fold, but by itself miR-143 overexpression was not able to induce vascular smooth muscle differentiation [26]. [score:5]
This suggests that additional miR-143 targets besides HK2 may also be responsible for the growth inhibitory effect of miR-143. [score:5]
The observed decrease in lactate secretion caused by miR-143 overexpression is less pronounced than for HK2 siRNA mediated inhibition. [score:5]
Three of these genes have also been predicted as miR-143 targets by an independent miRNA target prediction algorithm [45]. [score:5]
Linear Pearson correlation between miR-143 expression and HK2 expression in 184 colon and rectum adenocarcinoma samples. [score:5]
Here we report the identification of Hexokinase 2 (HK2) as a direct target of miR-143. [score:4]
We chose to focus our study on colon cancer, since miR-143 has been frequently reported as down-regulated in colon cancers [14, 15, 17, 18, 20]. [score:4]
As seen in Figure 2C the overrepresentation scores of the miR-143 7mer seed site are highest among 3'UTRs of down-regulated transcripts (black line). [score:4]
This suggests that miR-143 may normally function to restrict the proliferative potential of differentiated cells, explaining why down-regulation or loss of miR-143 can contribute to the formation and/or growth of cancer. [score:4]
The p-values for the enrichment of miR-143 seed sites (including 7mer, 7mer-1A and 8mer sites) were 3.4·10 [−19] when considering the down-regulated transcripts vs. [score:4]
]10 [-3] In addition we also performed a search for enriched transcription factor and miR-143 binding motifs among miR-143 down-regulated genes. [score:4]
We chose to focus on HK2 as a potential target of miR-143 for further functional analysis, because we hypothesized that miR-143 mediated regulation of HK2 may account for the changes in glucose metabolism observed in many cancer cells. [score:4]
Similarly, a 6mer word analysis indentified the miR-143 6mer seed site as the most enriched 6mer word in 3'UTRs of down-regulated transcripts (Additional file 2: Figure S4). [score:4]
We speculate that loss of miR-143 in cancer cells might promote the metabolic shift towards aerobic glycolysis due to up-regulation of HK2. [score:4]
However, the decrease in lactate secretion as a result of miR-143 overexpression is not as marked as the decrease observed upon HK2 siRNA mediated knockdown. [score:4]
To determine whether genes down-regulated by miR-143 were related to specific cellular functions, we performed a search for enriched functional annotations as derived from KEGG and BioCarta pathway databases. [score:4]
Enriched motifs among miR-143 down-regulated genes. [score:4]
This adds supportive evidence that these genes are direct targets of miR-143 beyond a simple seed match search. [score:4]
Due to HK2’s reported role in promoting tumor growth we wanted to investigate if the tumorsuppressor function of miR-143 can in part be accounted for due to its down-regulation of HK2. [score:4]
Interestingly, the decreased cell proliferation observed upon HK2 siRNA -mediated knockdown was not as strong as for miR-143 overexpression. [score:4]
As a validation of the microarray data we selected 7 transcripts identified as down-regulated by miR-143 in the microarray analysis for Q-PCR validation. [score:4]
Among the down-regulated genes containing miR-143 seed sites in their 3'UTRs we found a number of genes that have previously been implicated in tumorigenesis. [score:4]
Other miR-143 responsive genes with a miR-143 seed site in their 3'UTR were SEMA5A, SLC35B2 and KLF5 which have all been shown to be up-regulated in cancers and to promote cell proliferation [38- 41]. [score:4]
The second most significantly enriched motif in the down-regulated gene set was the miR-143 seed site (p-value = 7·10 [−10]), while the most significantly enriched motif was binding site of the transcription factor E2F (Additional file 3: Table S2). [score:4]
Figure 3 miR-143 downregulates HK2. [score:4]
miR-143 is located at a fragile site on chromosome 5 frequently deleted in cancer, and has been reported to be down-regulated in several cancers including colon cancer. [score:4]
We found that, in a similar manner to miR-143 overexpression, HK2 siRNA mediated knockdown also resulted in a reduced cell proliferation (Figure 4C). [score:4]
In our study we also observed down-regulation of KRAS upon miR-143 transfection. [score:4]
The overrepresentation of miR-143 seed sites in 3'UTRs of down-regulated transcripts can be visualized by plotting the running sum of the overrepresentation scores of the seed sites in transcripts ranked according to their logFC. [score:4]
miR-143 is located at a fragile site often deleted in cancers [12] and has accordingly been found down-regulated in a number of cancers [13- 22]. [score:4]
Seed site enrichment analysis of seed sites present in the 3'UTRs of transcripts showed a very significant enrichment of miR-143 seed sites among the down-regulated transcripts (Figure 2A). [score:4]
During development miR-143 expression has been reported to be induced during differentiation of adipocytes and vascular smooth muscle cells [24- 26]. [score:4]
Furthermore, our results indicate that miR-143 mediated down-regulation of HK2 affects glucose metabolism in colon cancer cells. [score:4]
Figure 4 Knockdown of HK2 as well as miR-143 overexpression results in decreased lactate secretion. [score:4]
Furthermore we show, that re-introduction of miR-143 leads to a decrease in lactate secretion, indicating that miR-143 -mediated downregulation of HK2 impairs the rate of glycolysis. [score:4]
This regulation was alleviated when two nucleotides in the seed site had been mutated (Figure 3B), indicating that the miR-143 directly regulates HK2. [score:4]
To further strengthen the connection between miR-143 and HK2 we surveyed the expression levels of both miR-143 and HK2 in data from The Cancer Genome Atlas (TCGA) consortium. [score:3]
We next sought to identify functionally relevant targets that could explain the underlying role of miR-143 in cancer. [score:3]
Among the putative miR-143 targets we found a number of genes known to promote cell proliferation, including SRD5A1, RQCD1, RAB11FIP1, SEMA5A, KLF5, USP22, SLC35B2 and HK2. [score:3]
To determine if miR-143 directly regulates HK2 through binding to its 3'UTR, 3'UTR luciferase reporter constructs were cloned containing 789 base-pair UTR fragments. [score:3]
Among the putative miR-143 targets we also found the deubiquitinating enzyme USP22, which have been reported to be associated with a poor prognosis of colorectal cancer [42] and invasive breast cancer [43]. [score:3]
Figure 1 miR-143 overexpression reduces the proliferative potential of DLD-1 cells. [score:3]
The analysis was based on expression fold changes between miR-143 and mock transfection of all genes on the array without any cutoffs, and p-value less than 0.01 was used for statistical significance. [score:3]
Previous studies have identified ERK5 and KRAS as miR-143 targets in colon cancer [14, 15]. [score:3]
Figure 2 Microarray based identification of miR-143 targets. [score:3]
Overexpression of miR-143 resulted in a significant decrease of the luciferase activity (p-value < 0.002) of a construct holding the wild-type 3'UTR of HK2 (Figure 3B). [score:3]
Here, we have identified a number of putative miR-143 targets in colon cancer cells. [score:3]
D, Lactate secretion of DLD-1 cells is decreased upon miR-143 overexpression or HK2 knockdown compared to mock transfected cells. [score:3]
Overexpression of miR-143 was achieved by transient transfection with a miR-143 duplex that mimics the mature miR-143 duplex (PM10883; Ambion, Austin, TX, USA). [score:3]
As expected, the expression levels of miR-143 were extremely low or undetectable in all tested cancer cell lines. [score:3]
To gain insight into the role of miR-143 in colon cancer, we used a microarray -based approach in combination with seed site enrichment analysis to identify miR-143 targets. [score:3]
We found a significant negative correlation between miR-143 and HK2 (P = 0.002, r = −0.22, Pearson correlation) in 184 public TCGA colorectal adenocarcinoma tumor samples with miRNA and mRNA expression data available (Figure 3D). [score:3]
In order to identify miR-143 targets we used a microarray -based approach. [score:3]
This was in contrast to non-tumorigenic fibroblast cell lines, which had a relatively high expression level of miR-143. [score:3]
We have identified and validated HK2 as a miR-143 target. [score:3]
In addition, we confirmed the growth inhibitory effect of miR-143 reported by others in DLD-1 colon cancer cells [14, 15, 18]. [score:3]
To investigate the expression level of miR-143 in established cell lines, we profiled miR-143 expression level using Q-PCR in a number of selected cancer cell lines as well as non-tumourigenic cell lines (Additional file 2: Figure S1). [score:3]
To investigate the role of miR-143 mediated regulation of HK2, we firstly wanted to determine whether HK2 is a direct target of miR-143. [score:3]
In support of miR-143’s role in glucose metabolism we showed that overexpression of miR-143 in DLD-1 cells leads to a reduced lactate secretion. [score:3]
To investigate the function of miR-143 as a putative tumorsuppressor, we sought to understand the mechanistic basis for the involvement of miR-143 in cancer by the identification of miR-143 targets. [score:3]
We chose to focus our further studies on the human colon cancer cell line DLD-1 since miR-143 expression was virtually absent from this cell line and thus mimics the situation reported in colon cancer tumors. [score:3]
Next, to determine if downregulation of HK2 mediated by miR-143 resulted in an impairment of glycolysis, lactate production was measured in mock transfected cells and cells transfected with miR-143 duplex or HK2 siRNA. [score:2]
As demonstrated by cell growth assays, overexpression of miR-143 resulted in a decreased cell proliferation (Figure 1). [score:2]
C, An example of the unbiased word analysis (based on the 1241 genes left after non-specific filtering) showing the running sum of the overrepresentation score for the miR-143 7mer seed site TCATCTC in the list of 3′UTR sequences ranked according to their fold-change (black line) compared to permutations of the ranked gene list (grey lines). [score:1]
Briefly, cells were co -transfected with indicated luciferase reporters and a Renilla normalization control, pRL-TK (E2241, Promega, Madison, WI, USA) vector alone or with miR-143 duplex or a scrambled negative control. [score:1]
The miR-143 luciferase reporter vector was cloned by inserting a site with perfect complementarity to miR-143 into HindIII/SpeI sites of pMIR-REPORT (AM5795, Applied Biosystems). [score:1]
The primer sequences used for PCR amplification were as follows (restriction sites indicated in lower case): HK2 3'UTR BglII FW: 5'-GGGagatctGGAGGGATGAGAGTGGCTTA-3' HK2 3'UTR XhoI RV: 5'-GGGctcgagAATGACAACATCTTCACTAGACTGAG-3' The miR-143 8mer seed site, TCATCTCA, in the 3'UTR of HK2 was converted into TCAT GACA using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). [score:1]
DLD-1 cells were transfected with miR-143 duplex or mock transfected in four biological replicates. [score:1]
We hypothesize that loss of miR-143 -mediated repression of HK2 can promote glucose metabolism in cancer cells, contributing to the shift towards aerobic glycolysis observed in many tumors. [score:1]
The effect of miR-143 overexpression in HCT116 cells measured by a miR-143 luciferase reporter was similar to that observed in DLD-1 cells (Additional file 2: Figure S2B). [score:1]
The 3'UTR of HK2 contain a 8mer seed site for miR-143 (Figure 3A). [score:1]
A, Sequence alignment of the miR-143 seed region and HK2 3′UTR. [score:1]
The effect of miR-143 duplex transfection in DLD-1 cells was confirmed by co-transfection of a luciferase reporter containing a perfect complementary site to the mature miR-143 (Additional file 2: Figure S2). [score:1]
This might be explained by the fact that miR-143 only mediates a relatively moderate reduction of HK2 protein level compared with the siRNA mediated knockdown of HK2. [score:1]
C, Western blot analysis of DLD-1 and HCT116 cells transfected with miR-143 duplex or mock transfected cells blotted for HK2. [score:1]
The primer sequences used for PCR amplification were as follows (restriction sites indicated in lower case): HK2 3'UTR BglII FW: 5'-GGGagatctGGAGGGATGAGAGTGGCTTA-3' HK2 3'UTR XhoI RV: 5'-GGGctcgagAATGACAACATCTTCACTAGACTGAG-3'The miR-143 8mer seed site, TCATCTCA, in the 3'UTR of HK2 was converted into TCAT GACA using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). [score:1]
D, miR-143 and HK2 are negatively correlated in TCGA colorectal adenocarcinoma. [score:1]
All other miR-143 responsive genes contain at least one 7mer seed site in their 3′UTR. [score:1]
DLD-1 cells were co -transfected with firefly luciferase reporters along with a Renilla luciferase transfection control plasmid either alone (mock) or with miR-143 duplex and scrambled duplex as a negative control. [score:1]
Antisense and sense oligonucleotide sequences (with restriction overhangs indicated in lower case) are as follows: miR-143 AS: 5'-ctagtGAGCTACAGTGCTTCATCTCAGCTCAGCA-3', miR-143 S: 5'-agcttGCTGAGCTGAGATGAAGCACTGTAGCTCA-3',3' UTR fragment of HK2 was PCR amplified from DLD-1 genomic DNA and cloned into the pGL3+ vector described previously [28]. [score:1]
The 3′UTRs of ABHD5 and TAF10 do not contain any miR-143 seed matches, but both genes contain a 8mer seed match in their coding region. [score:1]
We show that re-introduction of miR-143 in the colon cancer cell line DLD-1 results in a decreased lactate secretion. [score:1]
DLD-1 cells were transfected with miR-143 duplex or mock transfected and total RNA harvested 24 h post-transfection. [score:1]
To achieve this, DLD-1 cells were transfected with miR-143 duplex or mock transfected. [score:1]
Antisense and sense oligonucleotide sequences (with restriction overhangs indicated in lower case) are as follows: miR-143 AS: 5'-ctagtGAGCTACAGTGCTTCATCTCAGCTCAGCA-3', miR-143 S: 5'-agcttGCTGAGCTGAGATGAAGCACTGTAGCTCA-3', 3' UTR fragment of HK2 was PCR amplified from DLD-1 genomic DNA and cloned into the pGL3+ vector described previously [28]. [score:1]
Sequence variations of the miR-143 seed site were also among the highest scoring words. [score:1]
To confirm previous findings that miR-143 inhibits cell growth we investigated the cell proliferation upon transient transfections with a miR-143 duplex. [score:1]
[1 to 20 of 119 sentences]
3
[+] score: 367
Then, we will ask several important questions in this study: (1) what are the roles of miR-143 in tumor growth and angiogenesis; (2) what is the potential direct target of miR-143 that may be associated with cancer development; and (3) whether miR-143 overexpression inhibits AKT, ERK1/2, and NF-κB signaling pathways via its direct target; (4) What role of miR-143 and underlying mechanisms in glioma resistance to TMZ treatment. [score:12]
However, the expression levels of p65 were higher in cytoplasmic extracts of miR-143 -overexpressing stable cell lines than in miR-NC cells, while expression of p65 were lower in nuclear extracts; more interestingly, overexpression of N-RAS rescued the accumulation of p65 in nucleus inhibited by miR-143 (Figure 4B). [score:11]
Consistent with our previous study, phosphorylation of AKT (p-AKT) and ERK1/2 (p-ERK1/2) was significantly inhibited by treatment with miR-143, therefore inhibited the expression of HIF-1α and VEGF; nevertheless, overexpression of N-RAS restored miR-143 -inhibited cellular levels of p-AKT,p-ERK1/2, HIF-1α and VEGF. [score:11]
To further explore whether the overexpression of N-RAS influence the expression of p-AKT, p-ERK1/2, HIF-1α and VEGF, U87 cells were cotransfected with or without pCMV6-N-RAS cDNA, these data provide evidence that miR-143 inhibits AKT and ERK1/2 pathways as well as the expression of HIF-1α and VEGF via targeting N-RAS (Figure 3D and E). [score:11]
Thus, our results suggest that overexpression of miR-143 suppresses glioma cell proliferation, migration, invasion and angiogenesis by inhibiting its target N-RAS. [score:9]
Overexpression of miR-143 suppresses cell proliferation, migration, invasion,and angiogenesis in vitroGiven the important role of N-RAS in regulation of cell proliferation, migration and invasion [36, 37], miR-143 -overexpressing U87 cells were used to analyze cell growth and invasion. [score:8]
Secondly, N-RAS expression was significantly abolished in glioma cells which miR-143 stablely-expressed andincreased in glioma cells which miR-143 inhibited. [score:7]
Taken together, the present study provides the first evidence that miR-143 is significant in suppressing glioma cell growth through inhibition of N-RAS translation. [score:7]
Overexpression of miR-143 increases chemosensitivity of glioma cells to TMZ by inhibiting its target N-RAS. [score:7]
To fully understand the mechanisms of miR-143 in glioma, TargetScan search program was used to predict targets of miR-143, which N-RAS has been thought to be putative target of miR-143 (Figure 2A). [score:7]
Among them, miR-143 has been demonstrated to function as a tumor suppressor, and loss of miR-143 expression has been reported in many cancer types, restoration of miR-143 expression has been shown to abrogate tumorigenesis [14]. [score:7]
Forced expression of miR-143 also markedly reduced the wound-healing rate, and overexpression of N-RAS reverses the inhibitory effects of miR-143. [score:7]
Finally, inhibition of N-RAS expression by miR-143 inhibits constitutive phosphorylation of AKT and ERK1/2. [score:7]
Taken together, these results further support the notion that miR-143 functions as a tumor suppressor in glioma and inhibits NF-κB signaling pathway in vitro by targeting N-RAS. [score:7]
As shown in Figure 3C, miR-143 inhibited the pMAP11WT reporter activity in U87 and U251 cells, but not pMAP11Mut reporter activity, which indicating that miR-143 inhibits the expression of VEGF through HIF-1α. [score:7]
Here, we observed that HIF-1α and VEGF levels in miR-143 -expressing U87 and U251 cells were both downregulated (Figure 3A and B). [score:6]
MiR-143 inhibits AKT and ERK1/2 pathways as well as the expression of HIF-1α and VEGF via targeting N-RAS. [score:6]
Then, Western blotting analysis was conducted to measure the levels of N-RAS protein, we found that the expression of N-RAS protein was downregulated in miR-143 treated cells, but increased in cells transfected with anti-miR-143 inhibitor (Figure 2C). [score:6]
Similarly, we found the expression levels of p65 in miR-143 -overexpressing stable cell lines were lower than that of miR-NC group associated with N-RAS group in nucleus by immunofluorescence stain, which indicated that miR-143 may attenuate the accumulation of p65 in nucleus in an N-RAS dependent manner (Figure 4C). [score:5]
To determine whether miR-143 inhibits VEGF expression through HIF-1α DNA binding site of VEGF promoter, we analyzed the effects of miR-143 on a pMAP11WT VEGF promoter reporter plasmid containing the HIF-1α binding site, and a pMAP11Mut plasmid which 3 bp substitution at the HIF-1α binding site. [score:5]
Moreover, overexpression of miR-143 significantly inhibited glioma cell migration, invasion, and tumor growth. [score:5]
Figure3(A) The expression levels of phosphorylated AKT (p-AKT), phosphorylated ERK1/2 (p-ERK1/2) and HIF-1α were decreased in cells with miR-143 overexpression detected by immunoblotting, while AKT and ERK1/2 protein levels were not changed. [score:5]
Figure5(A) Overexpression of miR-143 arrested cell proliferation, but this was rescued upon coexpression of exogenous N-RAS in U87 cells. [score:5]
We showed that forced expression of N-RAS restored miR-143 -inhibited cell proliferation and migration (Figure 5A and B). [score:5]
Taken together, these results suggest that miR-143 inhibits tumor growth and angiogenesis in vivo through targeting N-RAS and other downstream signaling molecules. [score:5]
MiR-143 expression was downregulated in glioma. [score:5]
Overexpression of N-RAS reverses the inhibitory effects of miR-143. [score:5]
Furthermore, quantitative microvascular density (MVD) analysis showed significant suppression in miR-143 overexpression group, inferring that miR-143 represses angiogenesis in xenografts. [score:5]
In this study, we found that the expression of miR-143 is downregulated in glioma samples compared with normal brain tissues. [score:5]
MiR-143 overexpression led to reduced phosphorylation of IKKα and elevated IκBα, but the expression of p65, a member of NF-κB family did not changed in U87/miR-143 cells. [score:5]
Overexpression of N-RAS rescued the accumulation of p65 in nucleus inhibited by miR-143. [score:5]
Overexpression of miR-143 suppresses cell proliferation, migration, invasion,and angiogenesis in vitro. [score:5]
As expected, forced expression of N-RAS reversed miR-143 -mediated suppression of cell invasion and angiogenesis. [score:5]
Given the important role of N-RAS in regulation of cell proliferation, migration and invasion [36, 37], miR-143 -overexpressing U87 cells were used to analyze cell growth and invasion. [score:4]
In the present study, we demonstrated that miR-143 was downregulated in human glioma. [score:4]
N-RAS is a direct target of miR-143. [score:4]
These results suggest that miR-143 directly targets N-RAS by binding its seed region to their 3'-UTRs in glioma cells. [score:4]
The results showed that cell growth and migration were attenuated in miR-143 -overexpressing U87 cells compared with U87 cells expressing miR-NC (Figure 5A and B). [score:4]
MiR-143 inhibits tumor growth and angiogenesis in vivoIn order to test whether miR-143 attenuates progression of glioma in vivo, we engineered U87 cells to stably express miR-NC or miR-143, which were subsequently implanted into both posterior flanks of immunodeficient mice, and tumor sizes were measured after 2 weeks. [score:3]
Overexpression of miR-143 in glioma cells led to reduced tube formation, number of microvessels in vivo, and then impaired tumor growth in tumor xenograft. [score:3]
The combination of miR-143 and TMZ treatment significantly induced cell apoptosis, whereas forced expression of N-RAS partially abolished the effect induced by miR-143 plus TMZ treatment (Figure 6C). [score:3]
In this study, we found that forced overexpression of miR-143 promoted the effects of TMZ. [score:3]
Then, we determine the correlation between N-RAS levels and miR-143 expression levels in the same glioma tissues. [score:3]
But the levels of miR-143 expression among high grade tumors (WHO Grades III and IV) showed no significantly difference to those in low grade tumors (WHO Grade II) (Figure 1B). [score:3]
These results indicate that miR-143 may attenuate the accumulation of p65 in nuclear by targeting N-RAS. [score:3]
U87 cells stably expressing miR-143 or miR-NC were injected subcutaneously into both flanks of nude mice (5×10 [6] cells in 100 μl). [score:3]
Consistent with our previous studies, we showed that miR-143 inhibited tumor growth via anti-angiogenesis function. [score:3]
It was also confirmed that VEGF expression in xenograft tumors were significantly decreased by miR-143. [score:3]
In our study, N-RAS oncogene has been experimentally validated as the novel target of miR-143 not only in vitro, but also in vivo. [score:3]
To further study whether miR-143 and its target N-RAS play a role in cell apoptosis in the presence of TMZ treatment, FACS analysis was performed to detect cell apoptosis rates. [score:3]
Figure1(A)Relative miR-143 expression levels were analyzed by qRT-PCR in 6 normal brain tissues and 24 glioma tissues. [score:3]
Figure7MiR-143 inhibits tumor growth and angiogenesis in vivo(A, B,C) Effect of miR-143 on the growth of U87 cells inoculated into nude mice. [score:3]
Our results showed that overexpression of miR-143 in U87 cells significantly increased chemosensitivity to treatment of TMZ (Figure 6A). [score:3]
IHC staining revealed that the expression levels of VEGF and CD31 were significantly repressed by miR-143 inglioma tissues (Figure 7E). [score:3]
Taken together, our study highlighted the key role of miR-143 in growth of glioma and suggested that miR-143 could be an ideal target for glioma therapy. [score:3]
As shown in Figure 4A, the luciferase activity of the NF-κB reporter decreased in miR-143-overexpression cells, suggesting that miR-143 contributes to NF-κB inactivation. [score:3]
Recent studies have been reported that miR-143 plays a potential role as a tumor suppressor in many kinds of cancers [12, 13, 36]. [score:3]
To date, some genes have been identified as miR-143 target genes, including K-RAS, ELK1, MYO6, Bcl-2, ERK5 and IGF-IR, that are involved in pathogenesis of cancers [15- 21]. [score:3]
As shown in Figure 2E, Spearman's rank correlation analysis showed that the expression levels of N-RAS and miR-143 in 24 glioma specimens were inversely correlated (Spearman's correlation r=−0.4757). [score:3]
Moreover, some downstream pathway proteins, such as p-AKT, p-ERK1/2 and HIF-1α were significantly suppressed by miR-143 in glioma tissues (Figure 7D). [score:3]
Restoration of miR-143 dramatically inhibited the normally strong invasive capacity of U87 cells (Figure 5C). [score:3]
These results indicated that miR-143 renders glioma cells more sensitive to TMZ treatment, miR-143 and TMZ combination induced apoptotic effect through targeting N-RAS in glioma cells. [score:3]
By dividing all glioma samples into Grade II, Grade III, and Grade IV according to WHO classification, we found that miR-143 levels were downregulated in these 3 groups compared to the normal brain group. [score:3]
The results showed that the expression levels of miR-143 were consistently lower in the glioma tissues than in normal brain tissues. [score:3]
It has been revealed that K-RAS gene is a target of miR-143 in colorectal cancer [17]. [score:3]
The correlation between miR-143 expression and N-RAS levels in glioma tissues were analyzed using Spearman's rank test. [score:3]
K-RAS has been reported to be a target of miR-143 in colorectal cancer cell. [score:3]
Cellular levels of p-AKT and p-ERK1/2 were significantly decreased in U87 and U251 cells stably expressing miR-143 compared with miR-NC, while no statistically significant reduction of AKT and ERK1/2 was detected (Figure 3A). [score:2]
Simultaneously, tube formation assay showed that miR-143 -transfected group HUVECs presented less tube length, indicating angiogenesis was suppressed (Figure 5D). [score:2]
Here, we found that miR-143 functions as an anti-angiogenic regulator in gliomatumorigenesis. [score:2]
MiR-143 markedly suppressed luciferase activity in N-RAS3′-UTR (WT) reporter constructs. [score:2]
MiR-143 overexpression causes a decrease in tumor volume and weight. [score:2]
In agreement with in vitro studies, the levels of N-RAS from the tumor tissues of miR-143 expressing group were lower than that of miR-NC group by immunoblotting assay (Figure 7D). [score:2]
MiR-143 inhibits tumor growth and angiogenesis in vivo. [score:2]
Flow Cytometer Assay demonstrated that U87 cells with miR-143 stable expression have TMZ higher sensitiveness to apoptosis. [score:2]
MiR-143 stable -expressing cells generated xenografts that were statistically significantly smaller than control (Figure 7B). [score:2]
Figure6(A)U87 cells stably expressing miR-NC or miR-143 were pretreated with various concentration of TMZ for 48 h, and subjected to CCK8 Assay. [score:2]
However, the molecular mechanism of miR-143 repression in glioma has not been determined. [score:1]
Firstly, luciferase reporter assay confirmed that miR-143 directly recognize the 3′-UTR of N-RAS transcripts. [score:1]
From the 2 [nd] to 4 [th] week, miR-NC -injected group developed significantly larger tumors than miR-143 group (Figure 7A). [score:1]
Our results indicated that the loss of miR-143 might be an early event in gliomagenesis. [score:1]
Male BALB/c nude mice were subcutaneously injected with 5×10 [6] U87 cells infected with lentiviruses harboring miR-NC or miR-143. [score:1]
analysis of IKKα, IκBα, p65 and GAPDH in U87/miR-NC and U87/miR-143 cells. [score:1]
For its mutagenesis, the sequences complementary to the binding site of miR-143 in the 3′-UTR (N-RAS:TTCATCTC) was replaced by TACTTGAC. [score:1]
Cells were transfected with miR-143 followed by N-RAS transfection. [score:1]
Thus, it is important that a miR-143 restoration approach may offer a new modulation strategy to overcome chemoresistance to TMZ treatment in giloma. [score:1]
Furthermore, cell growth rate in the presence of TMZ (100μM) was assayed by CCK-8 proliferation assay at different time points, then forced expression of N-RAS reversed miR-143 -induced glioma chemosentivity to TMZ (Figure 6B). [score:1]
To determine the effects of miR-143 on transcriptional activation of VEGF, VEGF reporter plasmid pMAP11-WT or pMAP11-mut [52]was cotransfected into U87 cells with pRL-TK plasmid and equal amounts of miR-143 or miR-NC. [score:1]
Meanwhile,the final tumor weight of miR-NC group was much heavier than miR-143 group (Figure 7C). [score:1]
Lentivirus carrying hsa-miR-143 or hsa-miR -negative control (miR-NC) was packaged following the manufacturer's manual. [score:1]
Figure2(A)Sequence of the miR-143 -binding site within the human N-RAS 3′-UTR and a schematic diagram of the reporter construct showing the entire N-RAS 3′-UTR sequence and the mutated N-RAS 3′-UTR sequence. [score:1]
To determine the effects of miR-143 on growth of glioma cells, cells were seeded in 96-well plates at confluence of 2000 cells per well. [score:1]
In summary, we have identified a link between miR-143 and N-RAS that is a novel constituent of glioma tumorigenesis. [score:1]
As shown in Figure 2B, luciferase activities were significantly reduced in those cells transfected with the wild sequence and miR-143, but not in the cells with the mutant sequence and miR-143. [score:1]
Then, we examined whether miR-143 affects NF-κB pathway. [score:1]
Thirdly, an inverse correlation between N-RAS protein and miR-143 in clinical samples was found. [score:1]
After cultured overnight, cells were cotransfected with the wild-type or mutated plasmid, pRL-TK plasmid, and equal amounts of miR-143 or miR-NC. [score:1]
In order to test whether miR-143 attenuates progression of glioma in vivo, we engineered U87 cells to stably express miR-NC or miR-143, which were subsequently implanted into both posterior flanks of immunodeficient mice, and tumor sizes were measured after 2 weeks. [score:1]
However, there are no results referring to the role of miR-143 in glioma at present. [score:1]
[1 to 20 of 99 sentences]
4
[+] score: 327
Other miRNAs from this paper: hsa-mir-17, hsa-mir-34a, hsa-mir-145, hsa-mir-34b, hsa-mir-34c
A gross analysis of protein expression variation between samples showed that approximately 30% of proteins displayed altered abundance both in miR-143 and miR-145 overexpressing cells, from a total of 83 differentially expressed proteins in miR-143 overexpressing versus Empty cells and 112 in miR-145 overexpressing versus Empty cells. [score:11]
SOD1, although not predicted as a direct target of miR-143 or miR-145 in bioinformatics analysis (miRanda MiRBase, Target Scan and MiRDB), was reduced after miR-143 and miR-145 overexpression in human colon cancer cells, thus suggesting indirect targeting. [score:11]
Moreover, within the protein-protein network obtained for miR-143 overexpressing cells, a group of 6 proteins was identified, and found to be involved in the response to ROS (q-value < 0.001) (Biological Process GO pathway number 0000302), including SOD1, PRDX2, PRDX6, ANXA1, underexpressed in miR-143 overexpressing cells relative to Empty cells, and P4HB and HSPD1, overexpressed in miR-143 overexpressing cells relative to Empty cells (Fig 2). [score:11]
Also, the EGFR signalling pathway suppresses miR-143/145 in colonic cells, while overexpression of these miRNAs suppresses EGFR -induced colon cancer cell growth [41]. [score:7]
Proteomic analysis revealed a total of 83 differentially expressed proteins in miR-143 overexpressing cells and 112 in miR-145 overexpressing cells. [score:7]
Red arrows represent proteins that were down-regulated in miR-143 or miR-145 2-DE patterns, while green arrows represent proteins that were up-regulated in miR-143 or miR-145 2-DE patterns. [score:7]
From the total altered proteins, showing a differential fold expression < 0.7 or > 2 between each test sample and the control, we identified 45 proteins in miR-143 overexpressing cells, and 48 proteins in miR-145 overexpressing cells (S2 Table). [score:7]
In this study, comparative proteomic analysis of HCT116 colon cancer cells with stable miR-143 or miR-145 overexpression identified several differentially expressed proteins associated with the regulation of protein folding, cell death and response to oxidative stress. [score:6]
Among the interacting proteins in miR-143 overexpressing cells, 31% of these proteins are involved in the regulation of apoptotic processes (q-value < 0.001) (Biological Process GO pathway number 0042981), including superoxide dismutase [Cu-Zn] (SODC/SOD1), peroxiredoxin-2 (PRDX2), peroxiredoxin-6 (PRDX6), heat shock protein 90 kDa beta member 1 (HSP90B1/ENPL/GRP94), T-complex protein 1 subunit alpha (TCP1), Rho GDP-dissociation inhibitor 1 (GDIR1/ARHGDIA) and calrecticulin (CALR), and annexin II (ANXA2). [score:6]
SOD1, GRP94 and ANXA2 proteins are among those whose steady state levels were downregulated by miR-143 or miR-145 overexpression. [score:6]
RREB1 repressed miR-143/145 modulates KRAS signaling through downregulation of multiple targets. [score:6]
Validation of differentially expressed proteins in miR-143 or miR-145 overexpressing cells. [score:5]
Protein-protein interaction network analysis revealed a significant interaction between 35 proteins in miR-143 overexpressing HCT116 cells (S3A Fig), and 40 proteins in miR-145 overexpressing HCT116 cells (S3B Fig and Table 1) (p < 0.001). [score:5]
Particularly, expression of the antioxidant enzyme superoxide dismutase 1 (SOD1) was reduced in cells overexpressing miR-143 or miR-145. [score:5]
In this study, using two-dimension gel electrophoresis and mass spectrometry we analysed protein expression patterns of HCT116 colon cancer cells overexpressing either miR-143 or miR-145. [score:5]
This study identified differentially expressed proteins in miR-143 and miR-145 overexpressing cells using proteomic analysis, further validated for three candidate proteins related to carcinogenesis. [score:5]
miR-143 and miR-145 overexpression reduce SOD1, GRP94 and ANXA2 protein expression in human colon cancer cells. [score:5]
Our data demonstrate that miR-143 overexpression induces high ROS generation in cells treated with oxaliplatin, which translates into a functional increase in apoptosis. [score:5]
Moreover, 50 protein spots were present only in the 2-DE protein patterns of cells overexpressing miR-143, and 142 spots were identified only in cells overexpressing miR-145. [score:5]
In line with these observations, pharmacological inhibition of ROS with antioxidant NAC abrogated ROS production in miR-143 overexpressing cells treated with oxaliplatin (p < 0.001) (Fig 4C, bottom). [score:5]
Protein-protein network with altered expression in HCT116 human colon cancer cells overexpressing miR-143 relative to Empty vector. [score:5]
Consistent with the proteomic data, SOD1 was downregulated in HCT116 cells with stable miR-143 or miR-145 overexpression compared to control cells, as confirmed by Western blotting (p < 0.05) (Fig 3A, top). [score:5]
In addition, combination of miR-143 and miR-145 overexpression inhibited colon cancer cell line proliferation and migration in vitro, decreasing in vivo tumour growth [24]. [score:5]
Importantly, our results showed that ROS levels in miR-143 overexpressing cells, but not in miR-145 overexpressing cells, were greater than in control cells, and re-introducing SOD1 abrogated miR-143 -induced ROS production. [score:5]
Identification of differentially expressed proteins in miR-143 or miR-145 overexpressing cells. [score:5]
One-way ANOVA test with Turkey’s post-test analysis for comparison between the 3 conditions (HCT116 Empty cells, HCT116 overexpressing miR-143 cells, and HCT116 overexpressing miR-145 cells) retrieved a p-value < 0.0001. [score:5]
Both miR-143 and miR-145 are broadly described as downregulated in numerous solid tumours, including colon cancer [14]. [score:4]
In addition, SOD1 overexpression partially blocked cell death induced by oxaliplatin in miR-143 overexpressing cells, as shown by caspase activity (p < 0.01) (Fig 5C, top) and annexin V/7-AAD (p < 0.05) (Fig 5C, bottom) assays. [score:4]
In turn, KRAS and RREB1 are miR-143 and miR-145 direct targets, respectively, potentiating KRAS -mediated tumourigenesis [42]. [score:4]
Others have also reported that miR-143 overexpression sensitizes colon cancer cells to oxaliplatin through classical caspase-3 -dependent apoptosis [19]. [score:3]
Average and standard deviation of the % volume of proteins in at least three independent 2-DE maps of HCT116 human colon cancer cells stably overexpressing miR-143, miR-145 or Empty vector. [score:3]
Caspase-3/7 activity and annexin V/7-AAD assays also showed that combined overexpression of miR-143 and miR-145 did not induce further changes after oxaliplatin treatment as compared with overexpression of individual miRNAs (S4 Fig). [score:3]
The KEGG pathway enrichment analysis revealed considerable enrichment of proteins involved in processing in the endoplasmic reticulum (q-value < 0.001), pathways in cancer (q-value < 0.001), and miRNAs in cancer (q-value < 0.001) (restricted to miR-143 overexpression). [score:3]
This is demonstrated in cardiomyocytes, in which miR-143 has been reported to be increased under oxidative stress conditions, with miR-143 inhibition rescuing cells from oxidative stress -induced apoptosis [47]. [score:3]
Further, miR-143 overexpression increased reactive oxygen species (ROS) generation, which was abrogated by reintroduction of SOD1. [score:3]
In turn, GRP94 and ANXA2 steady-state levels were reduced in HCT116 cells with stable miR-143 or miR-145 overexpression (p < 0.05) (Fig 3B). [score:3]
Functional proteomic analysis also indicated that regulation of apoptosis might be a biological process regulated by both miR-143 and miR-145. [score:3]
Although miR-143 and miR-145 have targets in common, they play distinct roles in cellular function. [score:3]
Forced expression of miR-143 or miR-145 in HCT116 cells resulted in increased proteins in the 2-DE patterns. [score:3]
We generated miR-143 and miR-145 stably overexpressing HCT116 cells as previously described [25]. [score:3]
Fold variance of common proteins between HCT116 human colon cancer cells overexpressing miR-143, miR-145 or Empty vector. [score:3]
HCT116 cells stably expressing miR-143 or miR-145, and empty control cells, were seeded for 48 h. Then, attached cells were washed with PBS to remove detached cells, fixed with 4% paraformaldehyde in PBS for 20 min, washed with PBS, and stained with 5 μg/ml Hoechst 33258 (Sigma-Aldrich) in PBS for 15 min at room temperature, protected from light. [score:3]
Our results showed that proteins found to be significantly modulated in miR-143 or miR-145 overexpressing cells are involved in cell death pathways, response to oxidative stress and protein processing in endoplasmic reticulum. [score:3]
Protein-protein network in HCT116 human colon cancer cells overexpressing miR-143 or miR-145, relative to Empty vector. [score:3]
miR-143 and miR-145 overexpression increases sensitivity to oxaliplatin -mediated apoptosis in human colon cancer cells. [score:3]
NAC exposure, in turn, decreased apoptosis induced by miR-143 or miR-145 overexpression and oxaliplatin treatment, as shown by a significant reduction in caspase activity (p < 0.05) (Fig 5D, top) and in apoptotic cells (p < 0.01) (Fig 5D, bottom). [score:3]
miR-143 or miR-145 overexpression increases cetuximab -mediated antibody -dependent cellular cytotoxicity in human colon cancer cells. [score:3]
In miR-143 overexpressing cells this effect was triggered by ROS generation. [score:3]
HCT116 cells overexpressing miR-143 and miR-145, and Empty control cells, were seeded, allowed to grow for 72 h and processed for total protein extraction. [score:3]
Two-dimensional gel electrophoresis analysis of HCT116 human colon cancer cells overexpressing miR-143, miR-145, or Empty vector. [score:3]
For SOD1, GRP94 and ANXA2 expression protein analysis, at the time of platting, cells were transfected with 40 nM of specific miR-143 or miR-145 precursors (premiR-143, AM17100; premiR-145, AM11480) alone or in combination, or with a pre-miR negative control (premiR-C, AM17110), using Lipofectamine 3000 (Thermo Fisher Scientific), according to the manufacturer’s protocol, and collected 72 h later. [score:3]
While 211 protein spots were identified in the control, 244 and 349 proteins were identified in HCT116 cells overexpressing miR-143 and miR-145, respectively (Fig 1A). [score:3]
HCT116 cells with stable overexpression of miR-143 and miR-145 and empty control cells, were seeded and allowed to grow to confluence. [score:3]
Protein expression was also evaluated in HCT116, HT29 and SW620 cells with transient miR-143 or miR-145 overexpression (Fig 3C). [score:3]
Protein extracts from HCT116 human colon cancer cells stably overexpressing miR-143 or miR-145, and from HCT116 Empty control cells (S1 Fig) were subjected to proteomic analysis to hint at molecular players involved in colon cancer control by miR-143 and miR-145. [score:3]
We have shown that miR-143 overexpression reduces colon tumour growth and proliferation in vivo, with increased apoptosis [20]. [score:3]
S1 Fig miR-143 and miR-145 expression in HCT116 (a, b), HT29 (c), and SW620 (b) human colon cancer cells. [score:3]
In miR-143 overexpressing cells, ROS generation and the resulting oxidative stress mediate oxaliplatin -induced apoptosis. [score:3]
miR-143 -induced oxidative stress is abrogated by SOD1 overexpression. [score:3]
We selected SOD1, GRP94 and ANXA2 to validate differential protein expression and evaluated steady state levels by immunoblotting in cells with stable or transient miR-143 or miR-145 overexpression (S1 Fig). [score:3]
and protein extraction for two-dimensional electrophoresis HCT116 cells overexpressing miR-143 and miR-145, and Empty control cells, were seeded, allowed to grow for 72 h and processed for total protein extraction. [score:3]
After oxaliplatin treatment, miR-143 and miR-145 overexpression increased caspase-3/7 activity as well as apoptotic cells (Fig 5C and 5D). [score:3]
Only pathways common to miR-143 or miR-145 overexpressing HCT116 cells are indicated. [score:3]
In prostate cancer, oncogenic KRAS signalling led to suppression of miR-143/145 cluster by activating Ras-responsive element -binding protein 1 (REBB1). [score:3]
Briefly, HCT116 cells were transduced with retroviral particles carrying MSCV-Neo constructs overexpressing miR-143, miR-145 or Empty vector, followed by selection with 1 mg/ml neomycin. [score:3]
Cell growth profiles showed that miR-143 and miR-145 overexpression reduced HCT116 cell proliferation by up to 20 and 40% (p < 0.01) at 96 h, respectively, compared to empty vector control cells (Fig 5A). [score:2]
In agreement with these results, treatment with the platinum -based agent oxaliplatin, known to generate high levels of ROS, promote DNA damage and induce apoptosis [38– 40] resulted in a 2-fold increase in intracellular ROS levels in miR-143 overexpressing cells, compared to Empty -treated cells (p < 0.05) (Fig 4C, top). [score:2]
In addition, overexpression of miR-143 or miR-145 enhanced nuclear fragmentation (Fig 5B, top), and decreased cell migration (Fig 5B, bottom), as compared to empty control cells. [score:2]
Our functional proteomic data suggested that increased levels of miR-143 regulate response to oxidative stress, consistent with reduced levels of the antioxidant enzymes SOD1, PRDX2 and PRDX6 in these cells (Fig 2 and S2 Table). [score:2]
GO biological processes altered in miR-143 or miR-145 overexpressing HCT116 human colon cancer cells compared to Empty control cells with False Discovery Rate < 0.05.. [score:2]
The expression of miR-143 and miR-145 was analysed by quantitative reverse transcription PCR (qRT-PCR) by TaqMan MicroRNA Reverse Transcription Kit and TaqMan MicroRNA assays for hsa-miR-143, hsa-miR-145, and human RNU6B for normalization to endogenous control. [score:2]
0191607.g005 Fig 5(a) The growth profiles of HCT116 cells transiently expressing miR-143 (premiR-143), miR-145 (premiR-145), or control (premiR-C) precursors were monitored by MTS metabolism assay at 4, 24, 48, 72 and 96 h after plating. [score:2]
Cells with miR-143 overexpression display increased ROS production compared to Empty cells (p < 0.05). [score:2]
Therefore, increased oxidative stress generated by miR-143 might be an important mechanism to circumvent resistance of colon cancer cells to oxaliplatin. [score:1]
0191607.g004 Fig 4HCT116 cells stably transduced with miR-143, miR-145, or Empty vector were transfected with pCI-neo (pCI) or pCI-neo-SOD1 (pCI-SOD1) plasmids, or exposed to NAC and treated with oxaliplatin (Ox). [score:1]
Accumulating evidence shows that miR-143 reduces anti-apoptotic protein Bcl-2 [17], and sensitizes cells to Fas -induced apoptosis [51]. [score:1]
Next, we evaluated the endogenous production of ROS in cells overexpressing miR-143 or miR-145 (Fig 4B). [score:1]
HCT116 and SW620 cells may thus be more susceptible to miR-143 and miR-145 effects. [score:1]
HCT116 cells stably transduced with miR-143, miR-145, or Empty vector were transfected with pCI-neo (pCI) or pCI-neo-SOD1 (pCI-SOD1) plasmids, or exposed to NAC and treated with oxaliplatin (Ox). [score:1]
The relative amount of miR-143 or miR-145 was determined by the threshold cycle (2 [−ΔΔCT]) method, where ΔΔCT = (CT [miRNA]−CT [RNU6B]) sample − (CT [miRNA]−CT [RNU6B]) calibrator. [score:1]
0191607.g003 Fig 3HCT116 cells were stably transduced with miR-143, miR-145, or Empty vector. [score:1]
Subsequently, we investigated the effects of miR-143 and miR-145 overexpression in colon cancer cell proliferation. [score:1]
In addition, both miR-143 and miR-145 reduce cell proliferation and migration, and enhanced apoptosis during cetuximab -dependent cellular cytotoxicity by increasing caspase-3/7 activity and PARP cleavage, and by reducing Bcl-2 protein levels [25]. [score:1]
Importantly, we have previously shown that miR-143 acts as a sensitizer to 5-fluouracil [17], and either miR-143 or miR-145 induce tumour cell sensitization to cetuximab -mediated cellular cytotoxicity [25]. [score:1]
miR-143 and miR-145 impact on cell proliferation and morphology and sensitize to oxaliplatin -induced apoptosis. [score:1]
In this regard, our results strongly suggest that enhanced oxidative stress generated by miR-143 might be an important mechanism to sensitize colon cancer cells to the cytotoxic effects of oxaliplatin. [score:1]
This highlights the chemosensitizing effects of miR-143 in colon cancer cells, reinforcing its potential to circumvent resistance to anticancer therapy. [score:1]
To further investigate the role of SOD1 in miR-143 or miR-145 -induced oxidative stress, we transfected cells with either a vector overexpressing human wild-type SOD1 or the respective control vector (Fig 4A). [score:1]
The delivery of miR-143 and miR-145 in experimental cancer mo dels appears to be beneficial as a potential cancer therapy [15, 16]. [score:1]
S4 FigHCT116 cells transiently transfected with miR-143 (premiR-143), miR-145 (premiR-145), or control (premiR-C) precursors were treated with oxaliplatin (Ox). [score:1]
The miR-143/miR-145 cluster is composed of two co-transcribed miRNAs, miR-143 and miR-145, which have distinct roles in cellular function [12, 13]. [score:1]
HCT116, HT29 and SW620 cells were transiently transfected with miR-143 (premiR-143), miR-145 (premiR-145), or control (premiR-C) precursors. [score:1]
SOD1 gain-of-function and NAC exposure counteract miR-143 -induced oxidative stress in HCT116 human colon cancer cells. [score:1]
HCT116 cells were stably transduced with miR-143, miR-145, or Empty vector. [score:1]
SOD1, in turn, was inversely correlated with miR-143 -induced oxidative stress. [score:1]
miR-143 and miR-145 impact on cell proliferation and morphology and miR-143 -induced oxidative stress contributes to oxaliplatin -mediated apoptosis in HCT116 human colon cancer cells. [score:1]
Our data also show that miR-143 and miR-145 reduced cell proliferation and migration and increased apoptosis in HCT116 cells treated with oxaliplatin. [score:1]
Interestingly, re-introduction of SOD1 completely abrogated miR-143 -induced ROS production (p < 0.01). [score:1]
Moreover, miR-143 and miR-145 sensitized colon cancer cells to oxaliplatin treatment by increasing apoptosis. [score:1]
Together, these findings suggest that miR-143 and miR-145 play an important role in colon cancer onset and sensitization to anti-cancer therapy, which highlights their potential as a miRNA -based therapeutic approach. [score:1]
Mechanisms of miR-143 and miR-145 ROS -mediated cell death in cancer are not fully explored. [score:1]
Therefore, to better understand the involvement of these miRNAs in oxidative stress -induced cell death in colon cancer cells, we evaluated the levels of ROS in miR-143 and miR-145 overexpressing cells treated with the chemotherapeutic drug oxaliplatin. [score:1]
HCT116 cells stably transduced with miR-143, miR-145, and Empty vector were treated with oxaliplatin (Ox) and transfected with pCI-neo (pCI) or pCI-neo-SOD1 (pCI-SOD1) plasmids (c), or exposed to NAC (d). [score:1]
To identify the differences between protein patterns across samples, the fold variation between HCT116 cells overexpressing miR-143, miR-145 or Empty vector control was calculated (S2 Table). [score:1]
[1 to 20 of 104 sentences]
5
[+] score: 326
As we expected, we detected a strong negative correlation between miR-143 and HK2 in oral tumor tissues: the expression of HK2, which is associated with tumor aggressiveness [17] was up-regulated in high metastasis oral tumor species (Figure 6D) compared with low metastasis tumors, indicating that HK2 may be associated with metastasis in OSCC; in contrast, the expressions of miR-143 were significantly down-regulated in high metastasis tumors (Figure 6E), indicating miR-143 might be a therapeutic target for the treatments of metastasis OSCC tumor by targeting HK2. [score:14]
Restoration of HK2 rescues the miR-143 -mediated inhibitory effects on OSCC cellsTo validate whether the tumor-suppressive function of miR-143 was through direct inhibition of HK2 in OSCC cells, an HK2 ectopic expression vector was transfected into Tca8113 cells which were pre -transfected with pre- miR-143. [score:10]
Invert correlation between miR-143 and HK2 expressions in human OSCC tissuesIn light of our observation that overexpression of miR-143 led to the down-regulation of HK2 in OSCC cells, we postulated an inverse correlation between miR-143 expression and HK2 in metastasis oral tumor tissues. [score:10]
miR-143 suppresses glucose metabolism and HK2 expression in a xenograft mouse tumor mo delTo further support the above in vitro results that miR-143 suppresses oral cancer cells glucose metabolism through targeting HK2, we performed in vivo xenograft experiments. [score:9]
To validate whether the tumor-suppressive function of miR-143 was through direct inhibition of HK2 in OSCC cells, an HK2 ectopic expression vector was transfected into Tca8113 cells which were pre -transfected with pre- miR-143. [score:8]
Overexpression of miR-143 inhibited cancer cells proliferation, migration, invasion, and glucose metabolism through direct targeting HK2. [score:8]
In light of our observation that overexpression of miR-143 led to the down-regulation of HK2 in OSCC cells, we postulated an inverse correlation between miR-143 expression and HK2 in metastasis oral tumor tissues. [score:8]
HK2 is a direct target of miR-143 in OSCC cellsTo investigate the mechanisms by which miR-143 suppresses OSCC cells proliferation, invasion and glucose metabolism, we searched the potential targets of miR-143 by the web -based target analysis tools www. [score:8]
Overexpression of miR-143 significantly suppressed luciferase activity of 3′-UTR of the wild-type HK2 reporter constructs in both OECM-1 and Tca8113 cells (Figure 3F), while the suppressive effect of miR-143 mimic was abrogated with mutant HK2 3′-UTR. [score:7]
Our results showed overexpression of miR-143 inhibited HK2 protein and mRNA levels and inhibition of miR-143 could increase HK2 protein and mRNA levels (Figure 3C–E). [score:7]
miR-143 suppresses OSCC cells migration, invasion and glucose metabolismIn addition, the invasive abilities of oral cancer cells were significantly inhibited by miR-143 but promoted by miR-143 inhibitor (Figure 2A–C). [score:7]
Consistently, the glucose metabolism was attenuated by overexpression of miR-143 but activated by miR-143 inhibition (Figure 2D), supporting the above results that miR-143 may play a suppressive role in oral cancer. [score:7]
miR-143 levels are significantly down-regulated in human OSCC tumorsPrevious studies revealed that miR-143 possesses tumor-suppression function in multiple tumor types [9– 14]. [score:6]
Taken together, the above data further supported that miR-143 inhibited OSCC cellular proliferation, invasion and glucose metabolism through direct targeting HK2. [score:6]
miR-143 is downregulated in patient OSCC species and suppress oral cancer cells growth. [score:6]
As shown in Figure 6A, injection of miR-143 mimic significantly down-regulated HK2 expression in nude mice. [score:6]
Figure 1 miR-143 is downregulated in patient OSCC species and suppress oral cancer cells growth(A) Expression level of miR-143 in each individual case of OSCCs and adjacent normal tissues was measured by. [score:6]
We identified HK2 as a direct target of miR-143 in oral cancer cells and tumor patients, suggesting inhibition of HK2 by miR-143 might be a new therapeutic approach for the treatments of oral cancer. [score:6]
Figure 2 miR-143 inhibits in vitro migration, invasion, and glucose metabolism of oral cancer cells(A) OECM-1 and Tac8113 cells were transfected with negative control or miR-143 inhibitor for 48 h, the expression of miR-143 was measured by. [score:5]
However, the roles of miR-143 and its target gene in regulating human OSCC development are poorly understood. [score:5]
In the present study, we reported the glycolysis rate was suppressed by miR-143, supporting the tumor suppressive roles of miR-143 in oral cancer cells. [score:5]
miR-143 suppresses glucose metabolism and HK2 expression in a xenograft mouse tumor mo del. [score:5]
As we expected, the expression levels of miR-143 in OSCC tumor species were significantly lower than that in normal oral tissues (Figure 1A), suggesting miR-143 act as a tumor suppressor in OSCC. [score:5]
To further support the above in vitro results that miR-143 suppresses oral cancer cells glucose metabolism through targeting HK2, we performed in vivo xenograft experiments. [score:5]
Taken together, these in vivo results further support that miR-143 is a tumor suppressor through suppression of glucose metabolism. [score:5]
To determine whether miR-143 could target HK2 in endothelial cells, we transfected control miRNA, miR-143 mimic or miR-143 inhibitor into OECM-1 and Tca8113 cells. [score:5]
In addition, the invasive abilities of oral cancer cells were significantly inhibited by miR-143 but promoted by miR-143 inhibitor (Figure 2A–C). [score:5]
Restored HK2 expression in miR-143 overexpressing cells exhibited oncogenic effects in vitro. [score:5]
In addition, overexpression of miR-143 suppressed oral cancer cell proliferation, migration, and invasion. [score:5]
To investigate the mechanisms by which miR-143 suppresses OSCC cells proliferation, invasion and glucose metabolism, we searched the potential targets of miR-143 by the web -based target analysis tools www. [score:5]
miR-143 levels are significantly down-regulated in human OSCC tumors. [score:4]
The colony formation assay demonstrated that overexpression of miR-143 significantly suppressed colony of OCEM-1 and Tca8113 (Figure 1E). [score:4]
In addition, the binding of miR-143 on HK2 3′-UTR is conserved in multiple species (Figure 3B), further supporting our results that miR-143 directly targets HK2 and this binding has important functions. [score:4]
Overexpression of miR-143 markedly suppressed the proliferation ratios of these two oral cancer cell lines (Figure 1C) compared with negative miRNA transfection. [score:4]
miR-143 directly targets HK2 in oral cancer cells. [score:4]
These results demonstrated that HK2 was indeed a direct downstream target of miR-143 in human OSCC cells. [score:4]
Consistently, knockdown of HK2 in Tca8113 cells significantly suppressed cells proliferation (Figure 4B), invasion (Figure 4C) and glucose metabolism (Figure 4D) compared with control siRNA transfection, indicating deregulation of HK2 by miR-143 might be a therapeutic approach for OSCC tumor treatments. [score:4]
Figure 3 miR-143 directly targets HK2 in oral cancer cells(A) The predicted complimentary binding of miR-143 on the 3′-UTR of HK2 by microRNA. [score:4]
Currently, there is no publication reported that HK2 was a miR-143 direct target in OSCC cells. [score:4]
The migration ability of Tca8113 cells with miR-143 inhibitor transfection was significantly higher than the Tca8113 cells with control mimic transfection at 16 h. (C) Transwell assay showed the cell invasion abilities of Tca8113 (left) and OECM-1 were significantly inhibited by miR-143 mimic transfection. [score:4]
We found miR-143 was significantly down-regulated in oral cancer patient specimens and oral cancer cell lines. [score:4]
The potential target of miR-143 and the regulator mechanisms of miR-143 in oral cancer proliferation, invasion, and metabolism will be assessed. [score:4]
HK2 is a direct target of miR-143 in OSCC cells. [score:4]
miR-143 has been reported as an under-expressed miRNA in various tumors [9– 14, 17– 20]. [score:3]
In summary, we report a tumor suppressive role of miR-143 in human oral cancer cells and oral tumor patients. [score:3]
Previous studies revealed that miR-143 possesses tumor-suppression function in multiple tumor types [9– 14]. [score:3]
Moreover, we found overexpression of miR-143 caused a cell cycle arrest of oral cancer cells in G [1]-phase (Figure 1D). [score:3]
Briefly, sections of miR-143 low or high expression were deparaffinized in xylene. [score:3]
miR-143 suppresses OSCC cells proliferation, cell cycle and colony formation, promotes apoptosisTo further validate the tumor-suppression functions of miR-143 in OSCC, the effects of miR-143 on cell invasion, glucose metabolism, and tumor proliferation were measured. [score:3]
Restoration of HK2 rescues the miR-143 -mediated inhibitory effects on OSCC cells. [score:3]
miR-143 suppresses OSCC cells proliferation, cell cycle and colony formation, promotes apoptosis. [score:3]
miR-143 suppresses OSCC cells migration, invasion and glucose metabolism. [score:3]
As we expected, rescue of HK2 in miR-143 overexpressing cells led to marked enhancement of the cellular proliferation (Figure 5B), invasion (Figure 5C) and tumor glucose metabolism (Figure 5D). [score:3]
In the current study, we identified a tumor suppressive role of miR-143 in human OSCC. [score:3]
The analysis software predicted that HK2 might be a target for miR-143 and the 3′-UTR of HK2 contains a highly conserved binding site for miR-143 (Figure 3A). [score:3]
In particular, miR-143 has been extensively studied as a tumor suppressor in several cancers such as breast cancer [9], colon cancer [10], lung cancer [11], pancreatic cancer [12], brain tumor [13], and melanoma [14]. [score:3]
After 48 h following transfection, the expression of miR-143 was detected by quantitative-reverse transcription polymerase chain reaction (qRT-PCR), and the expression of hexokinase was measured by. [score:3]
miR-143 inhibits in vitro migration, invasion, and glucose metabolism of oral cancer cells. [score:3]
In addition, we demonstrated restoration of HK2 in miR-143 overexpressing oral cancer cells could increase the tumorigenesis and invasion of oral cancer cells in vitro. [score:3]
Invert correlation between miR-143 and HK2 expressions in human OSCC tissues. [score:3]
To investigate whether the miR-143 mediated OSCC cell suppression through HK2, we specifically knocked down HK2 by siRNA (Figure 4A). [score:2]
Our data suggest an important role of the miR-143 mediated glycolysis in the development of gene therapy for OSCC. [score:2]
After tumor development, the mice were randomly divided into two groups: control miRNA and miR-143 mimic injection. [score:2]
Figure 5(A) Tca8113 cells were transfected with control, miR-143 mimic or miR-143 mimic plus HK2 for 48 h followed by Western blot analysis. [score:1]
To evaluate the function of miR-143 in human oral tumor tissues, we analyzed the expressions of miR-143 from 15 human normal health oral tissues and 15 human oral cancer tissues using real-time PCR. [score:1]
Figure 6Invert correlation of miR-143 and HK2 in OSCC patient speciesThe mice tumors from xenograft experiments were collected and subjected to (A) Western blot analysis, (B) measurements of the mRNA expressions of LDHA and (C) LDH activity. [score:1]
The restoration of HK2 in miR-143 overexpressing cells was measured by Western blot (Figure 5A). [score:1]
Moreover, the mRNA levels of LDHA (Figure 6B) and activity of LDH (Figure 6C) were consistently decreased in the miR-143 -injected mice tumors. [score:1]
To further validate the tumor-suppression functions of miR-143 in OSCC, the effects of miR-143 on cell invasion, glucose metabolism, and tumor proliferation were measured. [score:1]
However, the mechanisms for the HK2 -mediated tumor migration and invasion are still under investigation and more functional targets of miR-143 in OSCC require further discovery. [score:1]
We transiently transfected miR-143 mimic into two human OSCC cell lines, OECM-1 and Tca8113 (Figure 1B). [score:1]
The cancer cells were transfected with miR-143 mimic, or control mimic for 48 h. Cells were then seeded in a 96-well plate, at a density of 3000 cells/well for overnight incubation. [score:1]
A reporter plasmid harboring a mutated miR-143 binding site was used as a control. [score:1]
The apoptosis was induced by miR-143 (Figure 1F). [score:1]
To further validate targeting of HK2 by miR-143, we investigated whether miR-143 directly interacted with the 3′-UTR of HK2 using a dual-luciferase reporter assay. [score:1]
miR-143 mimic and control mimic were obtained from ThermoFisher Scientific (Waltham, MA, U. S. A. ). [score:1]
The 3′-UTR luciferase vector was constructed using the pMIR-report luciferase vector containing wild-type or mutant 3′-UTR of HK2 mRNA, which carries a putative miR-143 complementary site. [score:1]
Invert correlation of miR-143 and HK2 in OSCC patient species. [score:1]
After tumors formed, miR-143 mimic or control miRNA was injected into the tumors twice a week for 2 weeks. [score:1]
Cells were transfected with 0.5 μg of the 3′-UTR luciferase vector and 50 nM miR-143 mimics or negative control using Lipofectamine RNAiMAX (Invitrogen). [score:1]
Our results are consistent with the previously described functions of miR-143 in human cancers. [score:1]
[1 to 20 of 81 sentences]
6
[+] score: 301
miR-143 downregulates the expression of c-Myc, cyclin D1 and c-jun through inhibiting ERK5 expression, and upregulates miR-145, probably by elevating the common transcript of endogenous pri-miR-143/pri-miR-145. [score:13]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor DevelopmentTo express miR-143 ubiquitously in whole body, we made a construct which carried ∼300 bp human pri-miR-143 fragment under the CAG regulatory unit, composed of CMV enhancer and chicken β-actin promoter, and injected it into the fertilized mice eggs [17] (Fig. 1A). [score:11]
Since Sachdeva et al. recently revealed that miR-145 when activated by p53 directly suppressed c-Myc expression, it is likely that miR-143 and miR-145 complement each other to downregulate c-Myc expression in our experimental systems [24]. [score:11]
The data of our transfection experiments, together with these previous studies, suggest that miR-143 probably inhibits tumor development by downregulating c-Myc expression in cooperation with miR-145 in our transgenic mice. [score:9]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor Development. [score:8]
As shown in Fig. 5B (3 [rd] panel), miR-145 mimic inhibited p72 expression, while neither miR-143 mimic nor siRNA for ERK5 seemed to have significant effect, which data demonstrate that the downregulation of p72 in the small intestine tumors of Tg/APC may be mainly elicited by miR-145. [score:8]
Effect of miR-143 and miR-145 converge on the repression of c-Myc, leading to the decrease of p68 expression, while miR-145 directly inhibits p72 expression. [score:8]
Corresponding to the miR-143 expression, ERK5 expression in the small intestine tumors of Tg/APC was downregulated compared to W/APC, whereas no significant difference was observed in the colon (Fig. 4A). [score:7]
These findings suggest that miR-143 and miR-145 might act in concert to inhibit both ERK5/c-Myc and p68/p72/β-catenin signaling, and thereby suppress the expression of cyclin D1, c-jun and c-Myc itself. [score:7]
Moreover, Suzuki et al. reported that the processing of pri-miR-143 and pri-miR-145 required the interaction of the tumor suppressor p53 and the Drosha complex through the association with p68/p72 in colon cancer cells, suggesting that the full expression of miR-143 and miR-145 might be involved in tumor suppressing signaling driven by p53 [14]. [score:7]
These data implied that failure of suppression of p68 expression by mimics of miR-143 and miR-145 in colon cancer cells might be due to insufficient c-Myc inhibition. [score:7]
Figure 3B indicated that both of pri-miR-143 and pri-miR-145 expression was upregulated in the small intestine tumors of Tg/APC. [score:6]
Indeed, this notion was supported by the following studies, which revealed that the downregulation of miR-143 and miR-145 could be involved in B-cell malignancy [5] and that colon tumor cell proliferation was suppressed by transfection with miR-143 [6]. [score:6]
Michael et al. initially reported that the expression of miR-143 and miR-145 was downregulated in many colorectal neoplasms, suggesting their potential action as tumorsuppresors [4]. [score:6]
We also present that the expression of c-Myc and p72 is downregulated by miR-143/miR-145 and miR-145, respectively, in a human colon cancer cell lines, DLD-1 and Lovo cells. [score:6]
It should be noted that miR-143 mimic significantly downregulated the expression of ERK5 although it was weaker than the effect of siRNA for ERK5 (Fig. 5B 2 [nd] panel). [score:6]
Here, we present that forced expression of miR-143, which is in vivo processed from pri-miRNA, induces miR-145 expression and represses the small intestine tumor formation in Apc [Min/+] mice. [score:5]
These data suggested that forced expression of miR-143 should be sufficient for ERK5 repression, but that miR-145 induction might be a crucial event for full inhibition of cyclin D1, c-jun and c-Myc through retardation of 68/p72/β-catenin signaling. [score:5]
c-Myc expression was not significantly suppressed by either miR-143 or miR-145 mimic when individually transfected. [score:5]
To examine whether miR-143 induces the miR-145 expression in human colon tumor cells, we introduced miR-143 mimic into DLD-1 cells and Lovo cells, and analyzed the miR-145 expression by qRT-PCR. [score:5]
As far as we examined, none of miR-143 and miR-145 mimics significantly inhibited p68 expression in DLD-1 cells and Lovo cells (Fig. 5B, 4 [th] panel, Fig. S3B, 3 [rd] panel). [score:5]
Thus, the forced expression of miR-143 in the small intestine tumors may induce the transcription of a bicistronic pri-miR-143/miR-145 to promote the expression of miR-145, and possibly miR-143. [score:5]
However as most of these studies used synthetic miR-143 and miR-145 mimics, their expression was transient and usually far beyond the level normally expressed in living organisms. [score:5]
As shown in Fig. 3A, miR-143 was highly expressed in the small intestines tumors of Tg/APC whereas the colon tumors generally expressed lower. [score:5]
In summary, miR-143 and miR-145 likely work together to inhibit at least two signaling pathways involving ERK5/c-Myc and p68/p72/β-catenin in the intestine tumors of Apc [Min/+] mice, and thereby suppress their common downstream effectors. [score:5]
Thus, a significant level of miR-143 expression might be necessary for ERK suppression, or colon cells might have low sensitivity of ERK5 to miR-143. [score:5]
To express miR-143 ubiquitously in whole body, we made a construct which carried ∼300 bp human pri-miR-143 fragment under the CAG regulatory unit, composed of CMV enhancer and chicken β-actin promoter, and injected it into the fertilized mice eggs [17] (Fig. 1A). [score:4]
This synergistic effect of miR-143 and miR-145 on c-Myc downregulation was also observed in another human colon cancer cell line, Lovo (Fig. S3B, 1 [st] panel). [score:4]
Consistent with the results of MEK5 transfection, siRNA for ERK5 clearly repressed c-Myc expression (Fig. 5B, 1 [st] and 2 [nd] panels), suggesting that ERK5 could be one of the molecules through which miR-143 regulates c-Myc. [score:4]
Thus, the sufficient expression of miR-143 appears to restrain tumor development in living animals. [score:4]
Next, we tried to identify the direct target molecule of miR-143 which would contribute the retardation of small intestine tumors. [score:4]
In contrast, we detected only little enhancement of miR-145 in Tg/APC colon tumors even though one of the tumors examined strongly expressed miR-143 (see Fig. 3A #13). [score:3]
Next, we examined the effect of miR-143, miR-145 or siRNA for ERK5 on c-Myc expression in DLD-1 cells. [score:3]
Thus, it is possible that p68 and c-Myc might form a positive feedback loop, which suggests that miR-143 and miR-145 might inhibit p68 in part through the repression of c-Myc. [score:3]
These data implicated that suppression of c-Myc might be at least partly involved in the elevation of miR-145 and probably of miR-143 in the transgenic intestine tumors. [score:3]
To examine whether the upregulation of miR-145 in Tg/APC tumors was due to the increase of pri-miRNA, we performed qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 with two sets of primers covering each pre-miRNA region. [score:3]
0042137.g003 Figure 3 A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
Hence, given qRT-PCR analysis of pri-miR-143/145 and Western blot analysis of transgenic tumors, forced -expression of miR-143 might trigger c-Myc/pri-miR-145 signal more easily in the small intestine tumors than in the colon tumors. [score:3]
As far as we are aware, this is the first report that miR-143 suppresses tumors spontaneously developing in living organisms. [score:3]
The incidence of transgenic colon tumor development, which exhibited poor miR-143 expression, unexpectedly increased compared to non-transgenic littermates. [score:3]
The expression of mouse pri-miR-143 and pri-miR-145 of the small intestine tumors from Tg/APC (gray bars, n = 5) and their non-transgenic littermates (W/APC) (open bars, n = 4) was examined. [score:3]
miR-143 and miR-145 have emerged as tumor suppressing miRNAs, particularly for colon cancers. [score:3]
Hence, we examined the effect of miR-143 and miR-145 on p68/p72 expression in DLD-1 cells. [score:3]
Here, we establish transgenic mice in which miR-143 is ubiquitously expressed in a variety of organs. [score:3]
So far, several candidates for miR-143 targets in cancer cells have been identified. [score:3]
Moreover, miR143 expression also increased by c-Myc siRNA (Fig. 5G). [score:3]
The expression of mouse pri-miR-143 and pri-miR-145 of tumors from Tg/APC (gray bars, n = 3) and their non-transgenic littermates (W/APC) (open bars, n = 3) was examined in the same way as B). [score:3]
The 4 [th] panel represents quantitative analysis of miR-143 expression in the 1 [st] panel. [score:3]
Interestingly, the level of c-Myc was closely related to that of ERK5 (Fig. 4B 3 [rd] and 4 [th] panels), strongly implicating that c-Myc was one of the major downstream targets of miR-143 through ERK5. [score:3]
Unexpectedly, the expression of miR-145 of transgenic small intestine tumors also increased in proportion to that of miR-143 (Fig. 3A). [score:3]
A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
Indeed, although miR-143 was strongly expressed in one colon tumor of transgenic mice, the induction of miR-145 was poor (Fig. 3A #13). [score:3]
Recently, ERK5 was found to be a target of miR-143 in adipocytes [19]. [score:3]
Hence, additional events other than miR-143 expression seemed necessary for substantial induction of miR-145 in colon cancer cells. [score:3]
Since only one strain (Line C) strongly expressed miR-143, we used this strain for further analysis (Fig. 1B and Fig. S1A). [score:3]
Repression of p68/p72 may impair β-catenin signaling to repress the expression of c-Myc, cyclin D1 and c-jun, and concurrently retard the processing of pri-miR-143/miR-145 to prevent the overproduction of miR-143 and miR-145. [score:3]
Nonetheless, our study with their report indicates that regulatory circuits between miR-143 and miR-145 might exert anti-tumor effect in a variety of neoplasms in living animals. [score:2]
Since no techniques, however, have been available to discriminate the human and the mouse mature miR-143, we could not confirm an auto-regulatory loop of miR-143. [score:2]
Since KRAS mutation is not a usual event in tumors of Apc [Min/+] mice [9], [10], the induction of miR-145 by miR-143 in our transgenic mice would be dependent on a molecular mechanism distinct from KRAS-RREB1 signaling. [score:2]
Schematic mo del of the regulation of APC signaling by miR-143 in the small intestine tumors. [score:2]
Other investigators recently reported that a positive feedback circuit between miR-143 and miR-145 could work through suppressing KRAS-RREB1 signaling in pancreatic cancer cells, although they did not mention the cross-regulation at the mature miRNA levels [36]. [score:2]
Establishment of CAG/miR-143 transgenic mice and Northern blot analysis. [score:1]
To construct CAG/EGFP, the insert fragment of pMXs-puro-EGFP -miR-145/miR-143 [39] was subcloned into XhoI site of pCAGGS vector, and pri-miR-145 fragment was excised by ClaI and NotI. [score:1]
0042137.g006 Figure 6 The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
On the other hand, neither of pri-miR-143 nor pri-miR-145 significantly increased in the transgenic colon tumors (Figure 3C). [score:1]
Tumor incidence in Apc [Min/+] mice with or without CAG/miR-143 transgene. [score:1]
The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
0042137.g002 Figure 2Tumor incidence in Apc [Min/+] mice with or without CAG/miR-143 transgene. [score:1]
F) qRT-PCR of miR-145 (F), miR-143 (G) and pri-miR-145 (H) in DLD-1 cells and Lovo cells. [score:1]
The expression of mature miR-143 and miR-145 was assayed with the Taqman MicroRNA Assays (Applied Biosystems) specific for hsa-miR-143 (P/N: 4395360) and hsa-miR-145 (P/N: 4395389), respectively. [score:1]
A SalI and HindIII fragment of CAG/miR-143 was purified from agarose gels with ELUTIP-D (GE Healthcare UK Ltd. [score:1]
DEAD-box RNA helicase subunits p68/p72, which are components of Microprocessor, promote the processing of pri-miR-143 and pri-miR-145 [13], [14]. [score:1]
∼2.6 kb SalI and HindIII fragment of CAG/miR-143 was injected to mice eggs. [score:1]
miR-143 and miR-145 were transcribed as a bicistronic unit, a common pri-miRNA, in DGCR8 -null embryo bodies [18]. [score:1]
miRNA mimics of miR-143, miR-145, miR-34a and miR-26a were purchased from Qiagen GmbH (Hilden, Germany), and miR-206 mimic was obtained from Ambion. [score:1]
10 p mol of each miRNA mimic was transfected for a combination of miR-143 and miR-145. [score:1]
The membrane was hybridized with the probes for miR-143(1 [st] panel), miR-145 (2 [nd] panel) and 5S rRNA (3 [rd] panel). [score:1]
B) Quantitative Real-Time PCR (qRT-PCR) analysis of the mouse endogenous pri-miR-143 and pri-miR-145. [score:1]
The membrane was hybridized with the probes for miR-143(upper panel), miR-145 (middle panel) and 5S rRNA (lower panel). [score:1]
For making the CAG/miR-143, ∼300 bp human pri-miR-143 fragment was subcloned into the EcoRI site of pCAGGS vector. [score:1]
C) qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 of the colon tumors. [score:1]
[1 to 20 of 81 sentences]
7
[+] score: 299
Other miRNAs from this paper: hsa-mir-21, mmu-mir-143, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Interestingly, ERK5 is the most wi dely reported direct target of miR-143, which is downregulated by miR-143 overexpression [11], [12]. [score:9]
Similar to the effects we reported after exposure of HCT116 colon cancer cells overexpressing miR-143 to 5-fluorouracil [12], exposure of MDA-MB-231 breast cancer cells to genistein induced cell growth suppression and induction of apoptosis, with down-regulation of ERK5, p-ERK5, NF-κB and Bcl-2 steady state levels. [score:8]
Furthermore, miR-143 may be involved in apoptosis proceeding via the intrinsic and/or extrinsic pathways, since it down-regulates anti-apoptotic protein Bcl-2, and is up-regulated after Fas -mediated apoptosis. [score:7]
However, a recent report in ulcerative colitis patients, which are at increased risk for development of colorectal cancer, demonstrated that miR-143 expression is downregulated up to 20-fold, compared to normal colon [37]. [score:6]
miR-143 directly regulates the expression of several proteins involved in crucial biological processes, whose deregulation is commonly associated with cancer. [score:6]
Importantly, transient overexpression of miR-143 mimetics in HCT116 [12], SW480 and DLD-1 [11] colon cancer cell lines has been shown to down-regulate ERK5 steady-state levels. [score:6]
Increased expression of mature miR-143 was found to occur following p53 up-regulation by doxorubicin in HCT116 colon cancer cells [22], and also in response to 5-FU exposure [12]. [score:6]
miR-143 expression has been reported as down-regulated in colon cancer, both in adenomas [9], [10] and colon carcinomas [6], [9], as well as in colon cancer cell lines [11], [12]. [score:6]
These results further expand previous reports of miR-143 -mediated ERK5 expression knockdown in colon cancer cell lines in vitro [11], [12], and are in agreement with reduced ERK5 expression following repeated (3x) miR-143 intratumoral injection and in vivo electroporation in prostate cancer cell tumor xenografts [20]. [score:6]
In addition, miR-143 is considered a pivotal regulator of gene expression, since it directly targets multiple mRNAs coding for proteins involved in cell proliferation, differentiation, survival and apoptosis, including KRAS [22], [23], DNMT3A [24], ELK1 [25], MYO6 [26], Bcl-2 [17] and ERK5 [27]. [score:6]
All reported effects were similar in both overexpression cell lines as compared to controls, with no marked changes in the effects from the miR-143 overexpression single clone cell line to the miR-143 overexpression cell population. [score:6]
To further validate the experimental mo del, cells were co -transfected with anti-miR inhibitors, by adding 50 nM anti-miR-143 or anti-miR-control inhibitors (Applied Biosystems, Foster City, CA) to the vector mixture described above. [score:5]
In our previous in vitro studies, we have used a single clone with miR-143 overexpression in parallel with a miR-143 overexpressing cell population [12], similar to the one used in the present study. [score:5]
miR-143 overexpression decreases ERK5 expression and activation in tumor xenografts. [score:5]
Further, we and others have previously demonstrated that miR-143 expression is reduced in human colon cancer [6], [7], [10], and also that miR-143 overexpression markedly reduces the viability of several colon cancer cell lines in vitro [11], [12]. [score:5]
ERK5 is the most wi dely reported miR-143 direct target in colon cancer, and ERK5 signaling is involved in the regulation of cell survival, differentiation, proliferation and apoptosis. [score:5]
Thus, miR-143 overexpression induces apoptosis and reduces proliferation of human colon carcinoma cells xenografted in mice, further re-enforcing the potential deleterious effects arising from loss of miR-143 expression in human colon cancer. [score:5]
Mature miR-143 overexpression increases cell growth inhibition. [score:5]
Our results demonstrate that miR-143 overexpression increased colon tumor cell growth inhibition in vitro, and decreased the growth of tumor cells xenografted in mice. [score:5]
In addition, miR-143 overexpression in human tumor xenografts in mice leads to significantly reduced NF-κB activation, and ERK5 expression and activation. [score:5]
Our results clearly demonstrate that miR-143 overexpression in colon cancer cells, delays xenografted tumor growth, highlighting the relevance of miR-143 as a putative therapeutic agent for the treatment of this disease. [score:5]
This was performed by co-transfection of pCR3-pri-miR-143 (miR-143 expression vector), a firefly luciferase miR-143 reporter for mature miR-143 detection (miR-143 sensor), and with either miR-143 specific inhibitor (anti-miR-143), or control (anti-miR-control). [score:5]
To evaluate the in vivo effect of miR-143 overexpression on colon cancer tumor xenograft growth, we next created HCT116-derived stable miR-143 overexpressing cells, and confirmed in at least three independent batches evaluated at multiple random selection times that miR-143 expression was consistently highly increased in Over-143 versus Empty cells, attesting to the robustness of miR-143 overexpression in our cell mo del. [score:5]
This suggests that miR-143 overexpression diminishes ERK5 expression and activation, which in turn may lead to reduced NF-κB activation, thus reducing tumor cell proliferation and growth in this in vivo tumor mo del. [score:5]
In addition, modulating mature miR-143 levels by transient co-tranfection of miR-143 mimetics and inhibitors regulates ERK5 protein [12]. [score:4]
Further, miR-143 relevance as a putative cancer biomarker is growing, as it is down-regulated in various other human cancers, including B-cell malignancies [13], non-small cell lung cancer [14], esophageal squamous cell carcinoma [15], esophageal adenocarcinoma [16], osteosarcoma [17], bladder [18], cervical [19], prostate [20], and gastric [21] cancer. [score:4]
Specifically, miRNA-143 (miR-143) is down-regulated in human colon cancer. [score:4]
Initially, we demonstrated transient miR-143 overexpression from pCR3-pri-miR-143 in HCT116 cells, which significantly increased cell growth inhibition as compared to pCR3-empty transfection, in accordance with our previous results [12]. [score:4]
In addition to colon cancer, miR-143 has been reported down-regulated in oesophageal squamous cell carcinoma [15], oesophageal adenocarcinoma [16], and gastric cancer [21]. [score:4]
This suggests that miR-143 overexpression in colon cancer cells may be an important strategy to reduce tumor growth and aggressiveness, and increase chemotherapy response. [score:3]
miR-143 increases HCT116 cell growth inhibition. [score:3]
Interestingly, genistein exposure markedly reduced NF-κB DNA binding activity, via MEK5/ERK5 pathway inhibition [46], which raises the possibility that miR-143 may also be involved in genistein mechanism of cytotoxicity. [score:3]
Here, we show that Over-143 versus Empty xenografts displayed decreased steady-state levels of Bcl-2, and increased caspase-3 activation and PARP processing, suggesting that miR-143 overexpressing xenografts may present higher levels of tumor cell apoptosis. [score:3]
miR-143 overexpression resulted in reduced tumor xenograft growth, with tumors presenting decreased proliferation and increased apoptosis. [score:3]
Real-time PCR was performed to determine the expression level of mature miR-143, as previously described [12]. [score:3]
Such a high differential expression has not been reported before for miR-143 in human colon cancer samples. [score:3]
Twenty-four hours after plating, cells were transfected with 4 µg of miR-143 expression vector (pCR3-pri-mir-143) [48] or 4 µg of the respective empty vector control (pCR3-empty), using lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions, to originate Over-143 and Empty cell lines, respectively. [score:3]
miR-143 overexpressing tumor xenografts display reduced ERK5 steady-state levels, and NF-κB nuclear translocation. [score:3]
This suggests that in human colon cancer cell tumor xenografts, ERK5 is targeted by miR-143, leading to reduced protein steady-state levels and activation. [score:3]
HCT116 cells were transiently transfected with miR-143 overexpression vector, coding for the miR-143 precursor (pCR3-pri-miR-143), and miR-143 sensor, comprising two sequences complementary to mature miR-143 sequence (pGL3-miR-143 sensor) [48]. [score:3]
miR-143 overexpression decreases the growth of HCT116 human colon carcinoma cells xenografted in mice. [score:3]
miR-143 overexpression decreases NF-κB nuclear translocation in tumor xenografts. [score:3]
In the following week, the impairment of tumor growth in result of miR-143 overexpression was already evident, becoming statistically significant 9 days later, at 23 days after cell implantation. [score:3]
To our knowledge, this is the first demonstration that miR-143 overexpression induces apoptosis in human colon tumor cells xenografted in mice, and are in agreement with reported decreased proliferation ratio of LNCaP and C4-2 prostate cancer xenograft tumors injected with miR-143 and electroporated in vivo [20]. [score:3]
B, Total RNA was extracted from Over-143 and Empty cells prior to implantation into animals (t = 0 days) and from snap frozen tumor xenograft samples (t = 40 days), and used to quantify mature miR-143 expression. [score:3]
miR-143 overexpression reduces Bcl-2, and increases caspase-3 processing and PARP cleavage in tumor xenografts. [score:3]
miR-143 was confirmed to be significantly overexpressed in Over-143 versus Empty xenografts, by TaqMan® Real-time PCR (p<0.05). [score:3]
The early loss of miR-143 expression in the transition of normal colon to adenoma [9], may be a key event in colon cancer tumorigenesis by allowing unchecked cell proliferation, and this may also contribute to tumor growth and progression. [score:3]
Transfection of miR-143 vectors and anti-miR-143 inhibitor. [score:3]
We initially confirmed the production of mature miR-143 from the pCR3-pri-miR-143 vector, and the effect of transient miR-143 overexpression from this DNA vector on HCT116 colon carcinoma cell growth. [score:3]
Generation of HCT116 cells with stable expression of miR-143. [score:3]
Forty-eight hours after release from dual-thymidine block, 5×10 [5] miR-143 overexpressing (Over-143), or control (Empty) cells, were s. c. injected into the flanks of nude mice. [score:3]
In this regard, it has been demonstrated that miR-143 overexpression significantly decreases the steady-state levels of anti-apoptotic protein Bcl-2 [12], [17], inducing apoptosis and sensitization to Fas -induced apoptosis [27]. [score:3]
miR-143 overexpression and control cell lines were prepared from HCT116 cells as previously described [12]. [score:3]
miR-143 overexpressing tumor xenografts display increased apoptosis and reduced proliferation. [score:3]
To evaluate the impact of miR-143 overexpression on the growth of human colon cancer cells xenografted in mice, we next produced HCT116 cells with stable miR-143 overexpression (Over-143) and control cell lines (Empty), by transfection with pCR3-pri-miR-143 or pCR3-empty, respectively, followed by selection and propagation of stably transfected cells with G418. [score:3]
miR-143 overexpression decreases human colon carcinoma cell tumor xenograft growth in nude mice. [score:3]
miR-143 overexpression increases apoptosis and decreases proliferation in tumor xenografts. [score:3]
In addition, we have recently demonstrated that miR-143 overexpression significantly increases in vitro HCT116 colon cancer cell sensitivity to 5-FU, with a marked decrease in ERK5, NF-κB, and Bcl-2 steady-state levels [12]. [score:3]
0023787.g002 Figure 2Forty-eight hours after release from dual-thymidine block, 5×10 [5] miR-143 overexpressing (Over-143), or control (Empty) cells, were s. c. injected into the flanks of nude mice. [score:3]
The n-fold change in miR-143 expression was obtained using the formula: 2-ΔΔC t. Total protein extracts were prepared from tumor xenograft tissues and cell lines. [score:3]
Mature miR-143 expression. [score:3]
Importantly, miR-143 overexpression significantly increased apoptosis, and decreased proliferation, which is consistent with the marked reduction in tumor growth. [score:3]
Importantly, our results show that high and stable mature miR-143 expression was consistently obtained in Over-143, as compared to Empty cells (Figure 1B) (p<0.01). [score:2]
Stable miR-143 overexpression significantly decreased the rate of xenografted tumor growth, as clearly evidenced by the reduced Over-143 tumor xenograft volumes as compared to Empty. [score:2]
Importantly, we have also shown that miR-143 expression is 100-fold lower in SW480 as compared to HCT116 cells [12]. [score:2]
In addition, miR-143 overexpresion reduced ERK5 steady-state levels, ERK5 activation, and NF-κB nuclear translocation, suggesting regulation of colon cancer cell survival, and proliferation capabilities. [score:2]
Collectively, these data underscore the relevance of ERK5/NF-κB signaling for xenografted tumor proliferation and growth, and highlight the pivotal role of miR-143 in the regulation of this molecular signaling pathway. [score:2]
Importantly, after 40 days of xenograft growth in vivo, Over-143 xenografts still presented a significant increase in mature miR-143 expression compared to Empty xenografts (p<0.05) (Figure 2B). [score:2]
Our results clearly show that mature miR-143 was expressed from pCR3-pri-miR-143, since reduction of mature miR-143 bioavailability via anti-miR-143 co-transfection led to a significant increase in firefly activity (Figure 1A, left panel, middle bar), as compared to controls (p<0.05). [score:2]
Additional studies are needed to further explore the re-introduction of miR-143 in colon cancer cells, as this may prove to be a valid a therapeutic approach for colon cancer treatment. [score:1]
This data re-enforce the notion that induction of apoptosis is part of the in vivo mechanism of action of miR-143 in this xenografted tumor mo del. [score:1]
HCT116 cells with stable miR-143 overexpression (Over-143) and control (Empty) cells were subcutaneously injected into the flanks of nude mice, and tumor growth was evaluated over time. [score:1]
In addition, we have also shown that miR-143 induces sensitization of HCT116 colon cancer cell line to 5-fluorouracil -induced apoptosis [12], which in turn is Fas -dependent in this cell type [28]. [score:1]
Interestingly, this is in agreement with a recent study using prostate cancer cell lines, in which repeated xenograft intratumoral injection (3x) of miR-143 mimetics at 5000 nM, followed by in vivo electroporation, resulted in tumor growth abrogation or decrease, in mice grafted with LNCaP and C4-2 prostate cancer cells, respectively [20]. [score:1]
Our results are also in line with another recent study where liposome entrapped 3′ -modified miR-143 mimetics were administered by intravenous injection following a regimen of weekly administration (5x), in mice xenografted with human DLD-1 colon cancer tumors [9]. [score:1]
In particular, miR-143 is gaining increasing relevance as putative cancer biomarker and therapeutic tool in human cancer. [score:1]
Finally, growing evidence supports an anti-proliferative, pro-apoptotic and chemosensitizer role for miR-143 in colon cancer, since it reduces cell viability and increases sensitivity to 5-fluorouracil (5-FU), the drug of choice in colorectal cancer treatment and a known inducer of apoptosis in colon cancer cell lines [28], [29]. [score:1]
After three weeks of selection, miR-143 expression was evaluated by TaqMan® Real-time RT-PCR; after confirming miR-143 overexpression in Over-143, cells were xenografted in mice for evaluation of tumor growth in an in vivo mo del. [score:1]
The mechanism of miR-143 action in this mo del is suggested to involve modulation of ERK5/NF-κB signaling pathways. [score:1]
Another important aspect of miR-143 allowing the control of tumor growth may be its putative pro-apoptotic role. [score:1]
Collectively, our data re-enforces the notion that miR-143 loss may be a pivotal event in colon cancer, suggesting an important function for miR-143 in the control of tumor progression in vivo. [score:1]
In the present study, we evaluated the role of miR-143 overexpression on the growth of human colon carcinoma cells xenografted in nude mice (immunodeficient mouse strain: N: NIH [(s)] II- nu/nu). [score:1]
RNAs were then used to evaluate mature miR-143 expression. [score:1]
These results underscore the relevance of miR-143 in colon cancer, suggesting an important role in the control of tumor progression in vivo, and expanding its anti-proliferative, pro-apoptotic and chemosensitizer role that we had previously demonstrated in vitro. [score:1]
Our results suggest that reduced tumor volume in Over-143 versus Empty xenografts may result from increased apoptosis and decreased proliferation induced by miR-143. [score:1]
miR-143 expression levels in different samples were calculated on the basis of ΔΔC [t] method. [score:1]
The results presented herein provide additional knowledge on miR-143 mechanism of action in human colon tumor cells xenografted in mice. [score:1]
Importantly, transient miR-143 overexpression significantly increased cell growth inhibition (Figure 1A, right panel, middle bar), compared to empty vector transfected cells (p<0.05), as evaluated by the MTS metabolism assay. [score:1]
Here, we demonstrate that we are able to maintain higher levels of mature miR-143 expression throughout the xenografted tumor growth evaluation period, by transfecting HCT116 cells in vitro and selecting with G418 prior to subcutaneous injection, which resulted in a marked decrease in colon cancer xenograft tumor growth. [score:1]
In the present study, we evaluated the effect of miR-143 overexpression on HCT116 human colon cancer tumor xenograft growth in nude mice. [score:1]
Having validated our cell mo del in vitro, we next evaluated the in vivo effect of miR-143 overexpression on HCT116 tumor xenograft growth. [score:1]
Our results show that miR-143 markedly reduces human colon cancer cell xenograft growth in vivo, causing increased tumor cell apoptosis and decreased proliferation. [score:1]
B, HCT116 cells were transfected with pCR3-pri-miR-143 and pCR3-empty and selected with G418, to generate Over-143 and Empty cells, respectively. [score:1]
miR-143 expression levels were calculated by the ãã C [t] method, using Empty cells as calibrator. [score:1]
In the present study, we evaluated the role of miR-143 overexpression on growth of HCT116 human colon carcinoma cells xenografted in mice, and the putative involvement of apoptosis and proliferation on miR-143 mechanism of action. [score:1]
[1 to 20 of 96 sentences]
8
[+] score: 293
The expression of miR-143 was clearly up-regulated by CCAT1 suppression and down-regulated by CCAT1 overexpression in FTC-133 cells (P<0.05 or P<0.01; Figure 3A). [score:13]
Conversely, CCAT1 knockdown down-regulated p-P13K, p85, p-AKT, and p-MAPKAP Kinase 2 expressions, while their expressions were further increased after miR-143 suppression. [score:11]
The results (Figure 6A and B) displayed that the levels of p-P13K p85, p-AKT, and p-MAPKAP kinase 2 were all obviously up-regulated after CCAT1 overexpression, and then miR-143 overexpression inhibited these increases. [score:10]
Similarly, miR-143 overexpression inhibited the increases of cell migration and invasion induced by CCAT1 overexpression; on the contrary, miR-143 knockdown enhanced the reduction of migration and invasion induced by CCAT1 suppression (all P<0.05; Figure 5A to D). [score:10]
Our results suggested that CCAT1 overexpression increased the expression of proteins associated with these pathways, whereas miR-143 overexpression inhibited these effects. [score:9]
For example, Tuo et al. reported that lncRNA UCA1 was up-regulated and could regulate cell proliferation and apoptosis in breast cancer by down-regulation of miR-143 (9). [score:8]
CCAT1 overexpression promoted vascular endothelial growth factor (VEGF) expression in FTC-133 cells via down-regulation of miR-143. [score:8]
CCAT1 overexpression up-regulated miR-143 -mediated VEGF expression, indicating that CCAT1 might promote angiogenesis in thyroid carcinoma. [score:8]
Figure 3G and H suggested that the mRNA and protein levels of VEGF were reduced in miR-143 mimic -treated cells, while miR-143 inhibitor up-regulated the expression of VEGF (P<0.05 or P<0.01). [score:8]
Firstly, we found that CCAT1 overexpression down-regulated the expression of miR-143. [score:8]
In previous studies, miR-143 was found to be highly expressed in several cancers and was mainly identified as tumor suppressor by inhibiting tumor growth (17, 18). [score:7]
CCAT1 overexpression plus miR-143 overexpression decreased cell viability and proliferation relative to only CCAT1 overexpression (both P<0.05; Figure 4A to D). [score:7]
Figure 3. CCAT1 promoted the up-regulation of VEGF via inhibition of miR-143. [score:6]
As shown in Figure 3F, efficiency of miR-143 up-regulation and inhibition was confirmed by using qRT-PCR. [score:6]
CCAT1 overexpression increased cell viability, proliferation, migration, and invasion in FTC-133 cells by down -regulating miR-143 expression. [score:6]
CCAT1 promoted the up-regulation of VEGF via inhibition of miR-143. [score:6]
CCAT1 overexpression activated PI3K/AKT and MAPK signaling pathways via down-regulation of miR-143. [score:6]
CCAT1 overexpression enhanced cell viability, proliferation, migration, and invasion, as well as reduced apoptosis by down-regulation of miR-143. [score:6]
As shown in Figure 5E and F, apoptosis, Bax, and cleaved caspase-3/9 expressions were significantly reduced; Bcl-2 expression was simultaneously increased in sh-CCAT1+miR-143 inhibitor group compared with sh-CCAT1+NC group (P<0.05). [score:6]
Cell viability and proliferation were increased after CCAT1 suppression plus miR-143 knockdown relative to only CCAT1 suppression (both P<0.05). [score:6]
FTC-133 cells were transfected with CCAT1 expressing vector, CCAT1 shRNA, miR-143 mimic, or miR-143 inhibitor. [score:5]
Further, the mRNA and protein level of VEGF were increased with CCAT1 overexpression or miR-143 suppression. [score:5]
Wang et al. (32) showed that miR-143 overexpression inhibited PI3K/AKT signaling pathway in glioma and other RAS -driven cancers. [score:5]
To further explore the relationship between miR-143 and VEGF in FTC-133 cells, we analyzed VEGF expression in cells transfected with miR-143 mimic or inhibitor. [score:5]
As CCAT1 was up-regulated in FTC-133 cells, the regulatory relationship of CCAT1 and miR-143 in FTC-133 cells were analyzed and the effects of CCAT1-miR-143 axis on FTC-133 cells were also explored. [score:5]
In addition, we also detected expressions of apoptosis and apoptosis-related proteins by the treatments of miR-143 silence combined with CCAT1 suppression. [score:5]
In addition, we also found that CCAT1 activated PI3K/AKT and MAPK signaling pathways by inhibiting miR-143 expression. [score:5]
However, the results of our study revealed that overexpression of miR-143 inhibited increases of cell viability, proliferation, migration, invasion, and the reduction of apoptosis in FTC-133 cells. [score:5]
CCAT1 could activate PI3K/AKT and MAPK signaling pathways by inhibiting miR-143 expression. [score:5]
Therefore, we speculated that miR-143 was a tumor suppressor for thyroid cancer and upstream regulated CCAT1. [score:4]
Moreover, a previous study reported that miR-143 is down-regulated in thyroid cancer (18). [score:4]
In summary, our study demonstrated that CCAT1 exhibited a cancer-promoting function potentially via down-regulation of miR-143 and activation of PI3K/AKT and MAPK signal pathways in FTC-133 cells. [score:4]
CCAT1 was closely related with colon cancer genesis, and down-regulation of miR-143 was a well-known potential marker for colon cancer and played an important role in carcinogenesis (22, 23). [score:4]
In the current study, we found that CCAT1 positively and miR-143 negatively regulated VEGF expression. [score:4]
Figure 4. CCAT1 enhanced cell viability and proliferation via the inhibition of miR-143. [score:3]
Therefore, miR-143 and VEGF exhibited the negative regulatory relationship, which explained the positive regulation of CCAT1 on VEGF. [score:3]
Only one study reported that miR-143 expression was decreased in thyroid cancer and B-cell malignancies (18). [score:3]
Figure 5. CCAT1 enhanced cell migration and invasion via the inhibition of miR-143. [score:3]
F, G, mRNA levels of miR-143 and VEGF with miR-143 mimic or inhibitor were tested using qRT-PCR. [score:3]
H, The protein level of VEGF with miR-143 mimic or inhibitor were detected using western blot analysis. [score:3]
The Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix II (both from Applied Biosystems, USA) were used to detect the level of miR-143 expression. [score:3]
CCAT1 activated PI3K/AKT and MAPK signaling pathways via the inhibition of miR-143. [score:3]
Figure 6. CCAT1 activated PI3K/AKT and MAPK signaling pathways via the inhibition of miR-143. [score:3]
Pagliuca et al. (31) reported that Kirsten rat sarcoma 2 viral oncogene homolog (KRAS) and v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) were targeted by miR-143. [score:3]
CCAT1 enhanced cell viability and proliferation via the inhibition of miR-143. [score:3]
A, mRNA expression of miR-143 was detected in FTC-133 cells using qRT-PCR. [score:3]
CCAT1 enhanced cell migration and invasion via the inhibition of miR-143. [score:3]
Moreover, the primary mediators of miR-143 in inhibiting tumors are genes belonging to the growth factor receptor-mitogen-activated protein kinase (MAPK) network. [score:3]
miR-143 mimic, inhibitor, and their respective NCs were synthesized and transfected into FTC-133 cells in this study (GenePharma). [score:3]
Figure 3B showed that CCAT1 had binding sites for miR-143, which might better explain the negative regulatory relationship between CCAT1 and miR-143. [score:2]
Thus, we explored the regulatory relationship between CCAT1 and miR-143 in this study. [score:2]
Therefore, we aimed to explore the molecular mechanism of lncRNA CCAT1 to reveal its potential in thyroid cancer therapy by focusing on the regulation between CCAT1 and miR-143. [score:2]
The sequences of qRT-PCR primers were as follows: lncRNA CCAT1, 5′-AGAAACACTATCACCTACGC-3′ (Forward) and 5′-CTTAACAGGGCATTGCTAATCT-3′ (Reverse); miR-143, 5′-AAGCTTAAGGTCAAGGTTTGGTCCT-3 (Forward) and 5′-CTCGAGTGCTAAGATGGACACACTGG-3′ (Reverse); U6, 5′-CGCTTCGGCAGCACATATACTA-3′ (Forward) and 5′-CGCTTCACGAATTTGCGTGTCA-3′ (Reverse); GAPDH, 5′-TGTTGCCATCAATGACCCCTT-3′ (Forward) and 5′-CTCCACGACGTACTCAGCG-3′ (Reverse); sh-CCAT1, 5′-CCTGGCCCTCTCATCAGAGACTTGACTTA-3′; miR-143 mimic, 5′-GGUGCAGUGCUGCAUCUCUGGU-3′ (mimics sense) and 5′-CAGAGAUGCAGCACUGCACCUU-3′ (mimics antisense); and miR-143 inhibitor, 5′-ACCAGAGAUGCAGCACUGCACC-3′. [score:2]
Considering the context, we deduced that CCAT1 could act as a molecular sponge in regulating the biological functions of miR-143. [score:2]
The regulatory relationship between CCAT1 and miR-143 was detected using qRT-PCR and dual-luciferase reporter assay. [score:1]
Our study suggested that CCAT1 might act as a competing endogenous RNA (ceRNA) for miR-143. [score:1]
As shown in Figure 3I, there was a binding site for miR-143 in VEGF. [score:1]
Then, relative luciferase activity was lower in cells co -transfected with CCAT1-wt and miR-143 mimic. [score:1]
Furthermore, the mechanism of CCAT1 was investigated by detecting activations of PI3K/AKT and MAPK signaling pathways after altering expressions of CCAT1 and miR-143. [score:1]
The GAPDH and U6 were used in this study for normalizing CCAT1 and miR-143 levels. [score:1]
The relative luciferase activity in FTC-133 cells that were co -transfected with CCAT1-wt and miR-143 mimic was lower than the cells co -transfected with CCAT1-mt and NC (P<0.05; Figure 3C). [score:1]
B, The predicated miR-143 binding site of CCAT1 (CCAT1-wt) and the designed CCAT1-mt are indicated. [score:1]
Importantly, there was a binding site of VEGF in the sequence of miR-143 and the dual-luciferase reporter assay further confirmed their positive regulatory relationship. [score:1]
The relative luciferase activity in FTC-133 cells co -transfected with VEGF 3UTR-wt and miR-143 mimic was lower than cells co -transfected with VEGF 3UTR-mt and NC (P<0.05, Figure 3J). [score:1]
I, The predicted miR-143 binding site of VEGF 3′UTR (VEGF 3′UTR-wt) and the designed VEGF 3′UTR-mt are indicated. [score:1]
The effects of CCAT1 in combination with miR-143 were further studied on FTC-133 cells. [score:1]
Then, miR-143 mimics were individually co -transfected with the reporter vector CCAT1-wild-type (CCAT1-wt) or CCAT1-mutated-type (CCAT1-mt) into FTC-133 cells. [score:1]
miR-143 mimics were individually co -transfected with the reporter vector VEGF 3′UTR-wild-type (VEGF 3′UTR-wt) or VEGF 3′UTR-mutated-type (VEGF 3′UTR-mt) into FTC-133 cells. [score:1]
miR-143 has been reported to decrease prostate cancer cells' proliferation and migration (25). [score:1]
There was a binding site of miR-143 in the sequence of CCAT1. [score:1]
Therefore, we suspected that CCAT1 might be working as a competitive endogenous RNA (ceRNA) for miR-143. [score:1]
Therefore, we analyzed the binding site of CCAT1 and miR-143. [score:1]
[1 to 20 of 72 sentences]
9
[+] score: 287
In the H [2]O [2] injury group, Bcl-2 expression decreased, while Bax expression increased in both the up-regulation and down-regulation of miR143. [score:11]
To study the effect of miRNA143 in oxidative stress injury, we up- and down-regulated miRNA143 by transfecting miR143 mimics, miR143 inhibitors, a negative control (NC), or an miRNA inhibitor negative control (inhibitor NC, GenePharma). [score:10]
In addition, down-regulation and up-regulation of miR143 expression and hydrogen peroxide induced hypoxia injury were carried out on L02 cells to study the role of miR143. [score:9]
We also down-regulated and up-regulated miR143 expression to study the effect of miR143 on apoptosis, cell cycle, mitochondrial membrane potential (MMP), and cell viability in L02 cells. [score:9]
However, a much greater decrease of Bcl-2 expression levels and increase of Bax levels were observed with the up-regulation of miR143, compared with miR143 down-regulation. [score:8]
Hence, the major findings of our study are that H [2]O [2] injury and miR143 over -expression decreased ADRB1 expression, but this was restored following MSC-CM treatment and miR143 down-regulation. [score:8]
The RT-PCR analysis demonstrated that miR143 inhibitors significantly down regulate miR143 expression in L02 cells compared with inhibitor NC and NC. [score:7]
All values were expressed as mean ± SD of ten independent experiments Meanwhile, over -expression of miR143 also resulted in a marked increase in the percentage of the cell population in the G0/G1 phase and a sharp decrease in the S + G2/M phase as compared to the down-regulation of miR143 after transfection for 60 h (Fig.   10c– d, P < 0.05). [score:7]
All values were expressed as mean ± SD of ten independent experiments Meanwhile, over -expression of miR143 also resulted in a marked increase in the percentage of the cell population in the G0/G1 phase and a sharp decrease in the S + G2/M phase as compared to the down-regulation of miR143 after transfection for 60 h (Fig.   10c– d, P < 0.05). [score:7]
Furthermore, decreased expression of predicted miR143 target proteins, HK2 and ADRB1, and reduced Bcl-2/Bax ratio were observed upon miR143 over -expression. [score:7]
To further study the regulatory mechanism of miR143 in H [2]O [2]injury, we used the bioinformatics tools miRbase, TargetScan, and PicTar to predict target genes. [score:6]
These results indicate that miR143 may directly target the 3’-UTR of HK2, thereby suppressing glucose consumption, lactate production, cellular G6P and ATP levels, and cell proliferation of liver cells under H [2]O [2] injury. [score:6]
These results provide new evidence that hypoxia participates in the regulation of miR143 expression, indicating that reduction of HK2 and ADRB1 expression is responsible for the change of miR143 under H [2]O [2] injury. [score:6]
Moreover down-regulation of miR143 protects L02 cells from apoptosis and initiates an adaptive process by adjusting the expression of HK2 ADRB1 and apoptosis-related proteins. [score:6]
In this study, we found that both H [2]O [2] injury and up-regulation of miR143 can increase the expression level of miR143 but decrease the levels of HK2 and ADRB1. [score:6]
Over -expression or down-regulation of miR143 aggravated or alleviated hepatocyte apoptosis induced by H [2]O [2], respectively. [score:6]
Moreover over -expression or down-regulation of miR143 aggravated or alleviated hepatocyte apoptosis respectively. [score:6]
On the other hand, miR143 mimics significantly up regulated miR143 expression, and there was no difference between inhibitor NC and NC. [score:6]
According to the microarray analysis, 19 disparately expressed miRNAs were selected for RT-PCR and miR143 identified as having significant differential expression in MSC-CM against oxidative stress injury. [score:5]
The results of the present study demonstrated that miR143 is often up regulated and expression of HK2 is down regulated in L02 cells under H [2]O [2] injury. [score:5]
Interestingly, miR143, via adjusting downstream target proteins, was also involved in the molecular mechanism underlying the therapeutic effect of MSC-CM on oxidative stress injury by adjusting the expression of HK2 and ADRB1. [score:5]
On the other hand, Bcl-2 expression was significantly decreased in the miR143 mimics + H [2]O [2] group compared to that in the NC + H [2]O [2] and H [2]O [2] groups, whereas it was significantly higher in the inhibitor + H [2]O [2] group compared to that in the inhibitor NC + H [2]O [2] and H [2]O [2] groups. [score:5]
We postulate that miR143 inhibits Bcl-2 expression and activates Bax and caspase-9 and thereby the endogenous mitochondrial pathway, which promotes cell apoptosis. [score:5]
Briefly, after transfection with miR143 mimics, inhibitors, or scrambled oligonucleotides (miRNA negative control-NC and miRNA inhibitor NC; 33 nM; Gene Pharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), the cells were incubated with 0.8 mM H [2]O [2] for 2 h, then 10 μl CCK-8 was added. [score:5]
It is worth mentioning that the difference in HK2 and ADRB1 expression levels between the miR143 mimics group and the inhibitor group markedly increased under H [2]O [2] injury. [score:5]
Notably, recent studies found that miR143 is an essential regulator of cancer glycolysis via targeting HK2 in lung [32], liver [33], and breast [34] cancer, and glioblastoma multiform cells [35]. [score:4]
All values were expressed as mean ± SD of ten independent experiments According to the flow cytometric analysis with AnnexinV/PI staining, the percentage of apoptotic cells was higher in the miR143 mimics group compared to the inhibitor group (28.59% ± 2.36% vs. [score:4]
ADRB1 (beta-1-adrenergic receptor) and HK2 (Hexokinase 2) were identified as candidate target genes of miR143 and had the highest predicted context score percentiles and association with glycometabolism and inflammation regulation. [score:4]
The expression levels of HK2 and ADRB1 regulated by miR143 and Bcl-2 decreased under H [2]O [2] treatment but were restored following MSC-CM treatment. [score:4]
a- b. miR143 overexpression accelerated L02 apoptosis, down regulated miR143 protected L02 cells from apoptosis (The lower left quadrant represents normal cells). [score:4]
In addition to increased apoptosis, reduced cell proliferation and cell cycle progression were observed in L02 cells over -expressing miR143 after H [2]O [2] injury. [score:3]
Subsequently, the predicted target proteins of miR143 were selected by bioinformatics software, and verified by western blot. [score:3]
The expression of miR143 was increased following oxidative stress injury whereas it decreased after MSC-CM treatment. [score:3]
Effects of miR143 on HK2 and ADRB1 expression. [score:3]
Bax expression was significantly increased in the miR143 mimics + H [2]O [2] group, and was low in the control group and NC + H [2]O [2] group. [score:3]
Furthermore, the levels of HK2 and ADRB1 decreased in the miR143 mimics group, but increased in the inhibitor group for the L02 cells under normal incubation (Fig. 6d and f, P < 0.05) and the cells incubated with 0.8 mM H [2]O [2] for 2 h after miRNA transfection for 60 h (Fig. 6e and g, P < 0.05). [score:3]
Nineteen chip hybridization-screened miRNAs were verified to show significant changes in expression during this process, from which miR143 was verified by quantitative PCR. [score:3]
In the case of H [2]O [2] induced injury, the percentage of apoptotic cells reached 54.98% ± 5.05% and 75.47% ± 9.43% in the miR143 inhibitor and miR143 mimics groups, respectively. [score:3]
Furthermore, the percentage of cells in the S + G2/M phase in the miR143 mimics group was significantly lower than that in the inhibitor group under oxidative stress injury (Fig.   10e– f, P < 0.05). [score:3]
On the other hand, the rates of occurrence of G0/G1 and S + G2/M stages were significantly different between the miR143 inhibitor and mimics groups under H [2]O [2] injury (Fig.   10d– e, P < 0.05). [score:3]
According to the analysis of RT-PCR, miR143 was transfected and differently expressed into L02 cell successfully (Fig.   6c). [score:3]
For comparisons between miR143 mimics and inhibitor group under H [2]O [2] injury, independent two sample t-tests were performed. [score:3]
Zhang’s research indicated that Bcl-2 might be a target gene of miR143 [29]. [score:3]
Prominently, we speculated that miR143 exerts its glycometabolism function in hepatocyte injury by specifically targeting HK2. [score:3]
However, it has been identified that miR143 suppresses tumor cell growth and migration, silencing the KRAS (V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) gene, and adjusting glucose metabolism via the miR143/HK2 axis [30, 31]. [score:3]
The predicted target proteins of miR143 were detected by bioinformatics algorithms, and then verified by western blot. [score:3]
In addition, miR143 may target HK2 [30] and ADRB1 and play an important role in proliferation and apoptosis during H [2]O [2] induced injury. [score:3]
RT-PCR was applied to screen differentially expressed miRNA, and miR143 was selected. [score:3]
The predicted target proteins of miR143, HK2 and ADRB1, were analyzed by three bioinformatics algorithms, and verified by western blot. [score:3]
H [2]O [2] group To further explore the role of miR143 predicted downstream target proteins HK2 and ADRB1 in MSC-CM amelioration of H [2]O [2] injury (1 mM H [2]O [2] for 3 h), western blot analysis was applied. [score:3]
de/) to predict the corresponding downstream target genes of the miRNA143. [score:3]
Alternatively, JC-1 staining showed the percent of cells with mitochondrial membrane potential depolarization was 3.85% ± 0.15% in the miR143 inhibitor group, while it was 36.78% ± 1.15% in the miR143 mimics group (Fig. 7c– d, P < 0.05). [score:3]
Verification of miR143 and prediction of downstream target genes of miR143. [score:3]
c. The expression of miR143 in transfected group. [score:3]
In short, the mechanism of promoting hepatic L02 cell proliferation by regulating the miR143/HK2 axis in the MSC-CM protected group is consistent with previous studies. [score:2]
After H [2]O [2] injury, a significant increase in the percentage of the cell population in G0/G1 phase was observed in the miR143 mimics group, when compared with the miR143 inhibitor. [score:2]
NC+ H [2]O [2] group According to the CCK-8 analysis, 11.21% ± 3.76% of the L02 cells were viable in the miR143 inhibitor group as compared to the mimics group at 60 h after transfection (Fig.   10a, P < 0.05). [score:2]
In addition, the viability of L02 cells increased by 14.5% ± 3.17% and 18.9% ± 3.94% at 48 and 60 h respectively in the miR143 inhibitor group as compared to the mimics group, when subjected to H [2]O [2] injury (0.8 mM H [2]O [2] for 2 h) following transfection (Fig.   10b, P < 0.05). [score:2]
Furthermore, the Bcl-2/Bax ratio was significantly reduced in the miR143 mimics group compared to the inhibitor group (Fig.   9a– b, P < 0.05). [score:2]
These results indicated that miR143 was associated with apoptosis. [score:1]
However, the function of miR143 in glycolysis in liver cells during hypoxia has not been fully understood. [score:1]
Cell transfection and miR143 treatment. [score:1]
Bioinformatics of miR143. [score:1]
In order to further investigate the function of miR143, expression levels of Bcl-2 and Bax were detected in the miR143 -transfected group with H [2]O [2]injury (0.8 mM H [2]O [2] for 2 h). [score:1]
b. Effects of miR143 on cell proliferation and analysis under H [2]O [2] injury (H [2]O [2] group = 1, # P < 0.05 vs. [score:1]
c- d. miR143 aggravated L02 MMP depolarization examined by JC-1 staining and flow cytometry. [score:1]
Quantitative RT-PCR analysis of miRNAs and miR143 selection. [score:1]
L02 cells were incubated at 37 °C for 36, 48, and 60 h. CCK8 was used to find miR143 transfected time. [score:1]
Fig. 10Effects of miR143 on L02 cell proliferation and cell cycle. [score:1]
According to the analysis of CCK8, the optimal miR143 transfection time was 60 h. All cell experiments were replicated a minimum of five times. [score:1]
Effects of miR143 on L02 apoptosis after transfection for 60 h. Effects of miR143 on L02 cells proliferation and cell cycle. [score:1]
According to the results, we speculated that miR143 attenuates H [2]O [2] -induced hepatocyte injury following MSC-CM treatment through specifically activating ADRB1. [score:1]
As shown in Fig.   5, miR143 level was significantly increased in the H [2]O [2] group and decreased in the H [2]O [2] + MSC-CM group. [score:1]
The results indicated that miR143 induces cell cycle arrest, which is in accordance with the alteration of cell cycle in H [2]O [2] injury and MSC-CM treatment. [score:1]
We speculate that miR143 alleviates H [2]O [2] -induced apoptosis through specifically activating ADRB1 under hypoxia. [score:1]
Quantitative data are presented as the mean ± standard deviation of a minimum of five independent replicates for of H [2]O [2] injury, MSC-CM treatment, and miR143 transfection. [score:1]
Fig. 7miR143 promotes L02 apoptosis after transfection for 60 h. a- b. miR143 accelerated L02 apoptosis examined by Annexin V/PI double staining and flow cytometry. [score:1]
a Effects of miR143 on cell proliferation and analysis (NC group = 1, αα P < 0.01 vs. [score:1]
[1 to 20 of 78 sentences]
10
[+] score: 279
Using a qRT-PCR assay, we detected miR-143 -induced down-regulation of TLR2 mRNA expression in SW620 and HCT116 cells, and a blockage of endogenous miR-143 up-regulated expression of TLR2 mRNA in SW620 and HCT116 cells (Figures  4C and Additional file 4: Figure S4C). [score:10]
It was also important to note that miR-143 was more effective than siRNA (siTLR2) in inhibiting SW620 and HCT116 cell invasion and migration (Figures  2C, 2D, and 4E), despite the finding that the down-regulation of TLR2 translation by miR-143 was not more effective than siRNA (siTLR2) (Figures  2A and 4A). [score:8]
The expression of miR-143 was significantly lower in 4 CRC cells with high TLR2 expression levels (Figure  3B and Additional file 3: Figure S3A), especially in the poorly differentiated tumour cells SW620 and HCT116, showing that miR-143 levels are inversely correlated with the levels of TLR2 expression. [score:7]
In this study, we identified a putative tumour suppressor miRNA, miR-143, that is frequently down-regulated in CRC. [score:6]
Our study provides strong evidence that TLR2 may be targeted by miR-143 to overcome chronic inflammation and down-regulate tumour invasion and migration. [score:6]
We also found that miR-143, a putative tumour suppressor that is down-regulated in CRC tissues, reduces the invasion and migration of CRC cells primarily via TLR2. [score:6]
The results presented here are the first line of evidence in support of the hypothesis that over -expression of TLR2 in CRC may result from under -expression of a specific miRNA molecule, miR-143; thus, our results demonstrate a new regulatory mechanism for CRC cell invasion and migration. [score:6]
We demonstrated both in vivo and in vitro that miR-143 causes TLR2 down-regulation and subsequently inhibits cancer cell invasion and migration. [score:6]
To examine the down-regulatory effect of miR-143 on TLR2 expression, we performed a western blot analysis 48 h after transfecting SW620 and HCT116 cells with the miR-143 mimic (100 nM) or Anti-miR-143 (100 nM). [score:6]
Importantly, re -expression of TLR2 abolished the miR-143 -induced inhibition of cell invasion and migration (Figures  5B and 5D), indicating that TLR2 is a critical mediator of the anti-invasive and anti-migration effects of miR-143 in human CRC cells. [score:5]
These results indicate that re -expression of miR-143 dramatically decreases cell invasion and migration in TLR2 -expressing CRC cells. [score:5]
Using nonparametric tests, we found a significant inverse correlation between TLR2 expression and miR-143 expression in CRC tissues (R [2] = 0.4486, p = 0.000 for TLR2 and miR-143) (Figure  3A; Table  1). [score:5]
Utilising a xenograft mouse mo del, we demonstrated that re -expression of miR-143 inhibits CRC cell colonisation in vivo. [score:5]
Next, we demonstrated that restoration of high miR-143 expression levels in CRC cells (SW620 and HCT116) is associated with decreased TLR2 expression. [score:5]
These findings suggest that TLR2 is a novel member of numerous targets for miR-143 and that different targets can mediate the specific effects of miR-143. [score:5]
SW620 and HCT116 cells, which express very little mature miR-143, were transfected with a miRNA mimic (miR-143 mimic) and its inhibitor (Anti-miR-143). [score:5]
We demonstrated that miR-143 can directly regulate TLR2 expression in CRC cells. [score:5]
These findings suggest that other miR-143 targets may also play an important role in inhibiting cellular invasion and migration in CRC cells, such as DNMT3A [41], CD44, KLF5, KRAS and BRAF [40]. [score:5]
The amount of target (TLR2/miR-143), normalised to the endogenous housekeeping gene GAPDH and relative to a reference sample, is given by the following equation: amount of target =2 [-△△CT]. [score:5]
To further investigate the causes of high TLR2 expression, we found a significant inverse correlation between TLR2 expression and miR-143 expression in CRC tissues using bioinformatics methods and nonparametric tests. [score:5]
miR-143 is particularly interesting because it possesses tumour suppressive activity and its expression is substantially reduced in several cancer types, especially in CRC [36, 37]. [score:5]
miR-143 directly targets TLR2. [score:4]
These results indicate that the expression of TLR2 may be regulated by miR-143. [score:4]
miR-143 directly targets TLR2 and reverses the invasive and migratory phenotype in CRC cells. [score:4]
Figure 4 miR-143 directly targets TLR2. [score:4]
Compared to the negative control group (miR-NC mimic), ectopic expression of miR-143 significantly decreased the expression of TLR2 protein levels (Figures  4A and Additional file 4: Figure S4A). [score:4]
These results collectively suggest a direct and specific inhibition of the 3′UTR of TLR2 by miR-143 in CRC cells. [score:4]
Click here for file miR-143 directly targets TLR2. [score:4]
To further confirm that TLR2 is a direct target of miR-143, a firefly luciferase reporter assay system was used. [score:3]
The expression of TLR3, TLR4, and TLR5 protein was not affected by miR-143 in SW620 and HCT116 cells (Figures  4A and Additional file 4: Figure S4A). [score:3]
In addition, restoring miR-143 in colon cancer cells could inhibit proliferation [40]. [score:3]
In contrast, transfection with the miR-143 inhibitor (Anti-miR-143) reduced mature miR-143 by almost 70% in SW620 and HCT116 cells (Additional file 3: Figure S3C). [score:3]
Additionally, lung bioluminescence was imaged 24 h post miR-143 over -expressing SW620 cells injection (Figure  5F). [score:3]
Mimics and inhibitors of miR-143 were purchased from Dharmacon (Lafayette, CO, US). [score:3]
These results may support the role of miR-143 in inhibiting the early colonisation of colorectal carcinoma cells at the lung. [score:3]
By comparing the results of the predictive algorithms, we identified miR-101, miR-143, miR-154, and miR-340 as the candidate TLR2 -targeting miRNAs. [score:3]
We identified TLR2 as a novel target of miR-143 in CRC cells. [score:3]
TLR2 expression correlates with miR-143 in CRC tissues and cells. [score:3]
As indicated, miR-143 over -expression in SW620 cells significantly decreased lung metastatic colonisation. [score:3]
The statistical method analysed the correlation between the expression of miR-143 and tumour pathological grade. [score:3]
Figure 3 Expression levels of TLR2 are inversely correlated with miR-143 in CRC tissues and cell lines. [score:3]
They also identified CD44, KLF5, and BRAF as proteins targeted by miR-143 and miR-145 [40]. [score:3]
Many studies have identified several miR-143 targets, including MDM2 [38], KRAS [39], and HK2 [40]. [score:3]
As with many other miRNAs, the biological information available for miR-143 is largely limited to expression analysis. [score:3]
Expression of miR-143 in normal colon epithelial cells and CRC cells. [score:3]
High levels of miR-143 can inhibit tumour invasion and migration in vitro and in vivo by reducing TLR2 activity. [score:3]
We detected the expression of TLR2 and mature miR-143 in the same clinical samples using real-time PCR (N = 79). [score:3]
Consistent with previous reports, our results reveal that miR-143 is under-expressed in most CRC samples. [score:3]
These results suggest that miR-143 targets TLR2 by playing a role in mRNA cleavage. [score:3]
This finding suggests that re -expression of miR-143 may lead to a reversal of the invasive and migratory phenotypes in CRC cells. [score:3]
The MiRcute miRNA qPCR detection kit (TIANGEN, Beijing, China) was used to quantify the expression levels of mature miR-143 according to the protocol provided, and GAPDH was used as an internal control. [score:3]
The miR-143 profile of human CRC tissues revealed that low levels of miR-143 are correlated with more advanced pathology grades (1, 2, 3) and lymph node metastasis (N0, N1, N2) (Figures  3C and 3D; *** p < 0.001; ** p < 0.01; * p < 0.05), suggesting an association between low miR-143 expression and tumour progression. [score:3]
These results imply that miR-143 might serve as a novel diagnostic and therapeutic target for CRC. [score:3]
S transfectants over -expressing miR-143 were generated by lentiviral transduction using a pMIRNA1 plasmid carrying miR-143 (System Biosciences, Mountain View, CA). [score:3]
This inhibition was abolished by treatment with Anti-miR-143, which is an antagonist for miR-143 (Figures  4B and Additional file 4: Figure S4B). [score:3]
The final concentration of miR-143 mimics/inhibitors in the transfection system was 100 nM. [score:3]
Click here for file Expression of miR-143 in normal colon epithelial cells and CRC cells. [score:3]
In animal experiments, miR-143 over -expression in SW620 cells significantly decreased lung metastatic colonisation. [score:3]
Transient transfections of miR-143 mimics/inhibitors in cancer cells were performed using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. [score:3]
In addition, we examined the endogenous miR-143 expression levels by northern blotting in 5 normal colon epithelial tissues and 4 CRC cells. [score:3]
The statistical method analysed the correlation between the expression of miR-143 and tumour lymph node metastasis. [score:3]
The ectopic expression of mature miR-143 was confirmed by real-time PCR assay. [score:2]
To determine whether TLR2 is the critical mediator of the role of miR-143 in cellular invasion and migration, we constructed a TLR2 transcript with a 3′UTR deletion mutation (TLR2). [score:2]
Interestingly, the UTR-WT luciferase activity in miR-143 co -transfected SW620 cells was significantly lower than in the cells that were co -transfected with the miR-NC, whereas mutation of the miR-143 recognition site rescued the luciferase activity (Figure  4D). [score:2]
In summary, our results show that miR-143 and TLR2 form a novel regulatory pathway that controls CRC cell invasion and migration. [score:2]
Inversely, miR-143 knockdown significantly increased the invasive and migratory activities of normal colon epithelial cells (Additional file 4: Figures S4D and S4E). [score:2]
Therefore, we examined whether TLR3, TLR4, and TLR5 are also regulated by miR-143 in human CRC. [score:2]
The mutant 3′UTR of TLR2 (UTR-MUT), which carried a mutation in the complementary site for the seed region of miR-143, was generated from the UTR-WT plasmid by overlap-extension PCR. [score:2]
Considering the function of TLR2 in a pro-invasive and pro-migratory phenotype, we hypothesised that miR-143 may have the opposite function. [score:1]
This knowledge may pave the way for new clinical applications utilising miR-143 mimics in the treatment of patients with CRC. [score:1]
To test our hypothesis, the effect of ectopic miR-143 expression on cell invasion and migration was investigated in SW620 and HCT116 cells. [score:1]
Briefly, after RNA electrophoresis, the transferred membrane was prehybridised with ULTRAhyb and detected with a miR-143-specific oligonucleotide probe (5′ GAGCT ACTGT GCTTC ATCTC A 3′) labelled with digoxigenin-ddUTP using a DIG Oligonucleotide 3′-End Labeling Kit (Roche Diagnostics, Indianapolis, IN). [score:1]
As expected, an approximately 10-fold increase in mature miR-143 was detected in the miR-143 mimic transfected cells (Additional file 3: Figure S3B). [score:1]
We detected lower photon flux intensity in SW620 cells treated with miR-143. [score:1]
As expected, miR-143 was able to reduce cancer cell invasion and migration. [score:1]
SW620 cells were seeded in 24-well plates and co -transfected with 100 nM of miR-143 mimics, 100 ng/ml UTR-WT or UTR-MUT luciferase reporter construct, and 10 ng/ml pRL-CMV Renilla luciferase reporter using lipofectamine 2000. [score:1]
The UTR-WT or UTR-MUT vector was co -transfected with miR-143 mimic (miR-143), miR-19a mimic (miR-19a) or miRNA mimic control (miR-NC) into SW620 cells. [score:1]
Figure 5 TLR2 modulation accounts for the antimetastatic effect of miR-143. [score:1]
The full length wild type 3′UTR (UTR-WT) of the TLR2 mRNA containing the putative miR-143 binding sites was amplified by PCR and cloned into the Xba1 site of the pGL3 control vector (Promega, Madison, WI, USA). [score:1]
miR-143 blocks the TLR2 signalling pathway in human CRC cells. [score:1]
Additionally, miR-143 levels above the median correlate with a higher overall survival of patients with CRC (p = 0.0018) (Figure  3E). [score:1]
Ricci-Vitiani et al. found that restoring miR-143 and miR-145 in colon cancer cells decreases proliferation, migration and chemoresistance. [score:1]
Repression of TLR2 by miR-143 can partially recapitulate the results of silencing TLR2 using RNA interference in SW620 and HCT116 cells (Figures  2C and 2D). [score:1]
TLR2 mediates the miR-143 -induced resistance to invasion and migration in vitro and in vivo. [score:1]
Transfection with miR-143 significantly decreased cell invasion and migration in SW620 cells and HCT116 cells (Figure  4E). [score:1]
[1 to 20 of 85 sentences]
11
[+] score: 264
Other miRNAs from this paper: hsa-mir-145
Although the inhibition of granzyme B abrogated the cytotoxicity of effector cells and cetuximab regardless of miRNA expression levels, the extent of caspase and nuclear fragmentation inhibition was higher in cells overexpressing miR-143 or miR-145, which also display reduced Bcl-2 protein steady-state levels. [score:9]
In addition, it was reported that decreased miR-143 expression might contribute to the pathogenesis of colon cancer by up -regulating KRAS expression [48], and miR-143 down-regulation correlates with poor prognosis in wild-type KRAS patients [29]. [score:9]
In addition, miR-143 is also chemosensitizer to docetaxel in prostate cancer by targeting KRAS and subsequently targeting EGFR/RAS/MAPK pathway [27], while miR-145 inhibits EGFR mutant lung cancer cell growth, sensitizing to gifitinib [25]. [score:7]
It was reported that EGFR signaling pathway suppressed miR-143/145 in colonic cells, while overexpression of these miRNAs suppressed EGFR -induced colon cancer cell growth [28]. [score:7]
Further, miR-143 down-regulation was correlated with poor prognosis in wild-type KRAS patients, but low levels of this miRNA did not display predictive value for response to EGFR -targeted agents [29]. [score:6]
In contrast, Bcl-2 steady-state expression levels in HCT116-miR-145 cells only slightly decreased following cetuximab treatment, which may be attributable to the fact that Bcl-2 is a miR-143 direct target [41]. [score:6]
miR-143 and miR-145 are tumor suppressor miRNAs reported downregulated in several cancer types, including in colon cancer adenomas and carcinomas [17– 19, 23]. [score:6]
HCT116, SW480 and SW48 cells with stable overexpression of miR-143 and miR-145, and empty control cells, were used as target cells (T), HCT116 and SW480 cells were plated onto a 96-well E-plate at 5,000 cells/well and SW48 cells were plated at 15,000 cells/well, and allowed to attach and grow for 24 h. Cells were then incubated in duplicate with cetuximab or effector cells at E:T of 6:1, 10:1 and 20:1 alone, and also with cetuximab or trastuzumab together with PBMCs, and vehicle control. [score:5]
Indeed, reduced levels of Bcl-2 in our HCT116-miR-143 and HCT116-miR-145 overexpressing cells following treatment with effector cells and cetuximab (Figure 5), could promote the release of proapoptotic proteins, such as Smac/DIABLO and Omi/HtrA2 [66], thus contributing to granzyme B -induced apoptotic pathway by relieving caspase inhibition. [score:5]
To generate miR-143 or miR-145 stable overexpression cells, HCT116, SW480 and SW48 cells were seeded in 6-well plates at 3 × 10 [5] cells/well, and 24 h later, transduced with retroviral particles carrying MSCV-Neo constructs overexpressing miR-143, miR-145 or empty vector. [score:5]
To gain insight into the biological effect of miR-143 or miR-145 in colon cancer cell response to cetuximab, HCT116 cells were transduced with retroviral particles containing MSCV-Neo constructs expressing miR-143 or miR-145, respectively, resulting in HCT116 overexpressing miR-143 (HCT116-miR-143) and miR-145 (HCT116-miR-145), and the respective Empty vector control cell line (HCT116-Empty). [score:5]
MSCV-Neo retroviral expression constructs expressing miR-143 or miR-145 were kindly provided by Dr. [score:5]
miR-143 or miR-145 overexpressing cells were produced by transducing HCT116 cell line with viral particles containing MSCV-Neo constructs expressing miR-143, miR-145 or empty vector, as control. [score:5]
Importantly, caspase inhibition abrogated cell killing induced by effector cells and cetuximab in HCT116 cells overexpressing miR-143 or miR-145 (Figure 4), confirming the involvement of caspases in cetuximab -mediated ADCC. [score:5]
This is in agreement with our previous results, which demonstrated that miR-143 overexpression reduces Bcl-2 expression in vitro [18], and reduces colon cancer tumor xenograft growth displaying higher levels of tumor cell apoptosis with decreased steady-state levels of Bcl-2 [19]. [score:5]
Figure 1miR-143 or miR-145 overexpressing cells were produced by transducing HCT116 cell line with viral particles containing MSCV-Neo constructs expressing miR-143, miR-145 or empty vector, as control. [score:5]
In this study, we demonstrated that miR-143 or miR-145 overexpression increased the growth inhibitory effect of cetuximab in cetuximab-resistant HCT116 colon cancer cells, upon exposure to high doses of cetuximab (Figure 2). [score:5]
Interestingly, we found that miR-143 overexpression significantly decreased Bcl-2 protein steady-state expression. [score:5]
For this purpose, SW480 cells were stably traduced with retroviruses overexpressing miR-143 or miR-145, and the control Empty vector, similarly to HCT116 and SW48 cell mo dels, in order to generate SW480 cells overexpressing miR-143 (SW480-miR-143), and miR-145 (SW480-miR-145), and the respective Empty-vector control (SW480-Empty). [score:5]
For this purpose, SW48 cells were stably transduced with the same retroviral particles used to generate HCT116 stable miRNAs overexpressing cells, resulting in cells overexpressing miR-143 (SW48-miR-143) and miR-145 (SW48-miR-145), and the respective Empty vector control cell line (SW48-Empty). [score:5]
Importantly, 100 μg/ml cetuximab concentration, which we previously found ineffective in reducing HCT116 cell viability (Figure 2), when combined with effector cells, significantly decreased cell index values, resulting in higher growth -inhibitory effects on miRNA overexpressing cell lines, HCT116-miR-143 and HCT116-miR-145, compared to HCT116-Empty vector cells (Figure 3C). [score:4]
In order to investigate the molecular mechanism of miR-143 or miR-145 activity in colon cancer and cetuximab sensitization, we examined the expression levels of Bcl-2, which was shown to be reduced following miR-143 overexpression [18, 19], and may be relevant in this cetuximab-sensitization context, due to role in apoptosis regulation. [score:4]
miR-143 overexpression significantly decreased cell viability for cetuximab concentrations higher than 1200 μg/ml (p < 0.01), while miR-145 overexpression had a similar sensitization effect for cetuximab concentrations higher than 600 μg/ml (p < 0.05), both compared to Empty control cells (Figure 2B). [score:4]
Cetuximab showed a higher growth -inhibitory effect on cells overexpressing miR-143 or miR-145, with IC [50] values of 832,22 and 668,42 μg/ml, respectively, compared to Empty control cells which displayed an IC [50] of 1719,66 μg/ml (Table 1). [score:4]
The results obtained suggest that miR-143 or miR-145 overexpression modulates cetuximab cell sensitivity independently of KRAS mutation status. [score:4]
Similarly, miR-145 is also implicated in Ras/MAPK signaling pathway by targeting RREB1 protein, which negatively regulates the miR-143/145 promoter and potentiates signaling through Ras effector pathway [49]. [score:4]
These data clearly show that miR-143 or miR-145 overexpression in HCT116 cells led to a reduction of the IC [50] value of cetuximab of nearly 40% (p < 0.01) (Figure 2A), indicating that these miRNAs may be involved in HCT116 cell response to cetuximab. [score:3]
miR-143 or miR-145 overexpressing cells are more sensitive to cetuximab -mediated ADCC -induced apoptosis. [score:3]
Briefly, 10 or 20 μg of total RNA isolated from HCT116, SW480 and SW48 cells with stable overexpression of miR-143 and miR-145 and empty control cells were loaded onto a 15% SequaGel (National Diagnostics, Atlanta, GA), electrophoresed, and transferred to nylon membranes at 15 V for 60 min using a Trans-Blot SD semidry transfer system (Bio-Rad Laboratories, Hercules, CA). [score:3]
HCT116 cells stably expressing miR-143 or miR-145, and empty control cells, were seeded on 12-well plates over 18 mm glass coverslips, at a density of 5 × 10 [4] cells/well. [score:3]
Further, combined overexpression of miR-143 and miR-145 decreases squamous carcinoma proliferation while sensitizing to cisplatin, and also sensitizes colon cancer cells to 5-FU, irinotecan and oxaliplatin treatment [23]. [score:3]
miR-143 and miR-145 are co-transcribed miRNAs that have been wi dely studied as potential tumor suppressors. [score:3]
miR-143 or miR-145 overexpression sensitizes colon cancer cells to cetuximab. [score:3]
miR-143 or miR-145 overexpression reduces HCT116 colon cancer cell doubling time and migration. [score:3]
In this context, miR-143 or miR-145 overexpression significantly increased cell death of SW480 cells exposed to cetuximab together with effector cells, and again, exposure to control antibody rituximab, and effector cells only increased cell cytotoxicity to a similar extent of that elicited by PBMCs (Figure S3F). [score:3]
We have shown that miR-143 overexpression induces tumor cell sensitization to 5-fluorouracil [18]. [score:3]
miR-143 or miR-145 overexpression sensitizes colon cancer cells to cetuximab by increasing antibody -dependent cellular cytotoxicity. [score:3]
Our results showed that miR-143 or miR-145 overexpression increased the sensitivity of colon cancer cells to cetuximab by enhancing cetuximab -mediated ADCC and apoptosis. [score:3]
Bcl-2 is involved in cetuximab sensitization induced by miR-143 or miR-145 overexpression, increasing cell susceptibility to cetuximab -mediated ADCC. [score:3]
Importantly, overexpression of miR-143 and miR-145 significantly reduced cell viability of cells exposed to cetuximab concentrations higher than 1 μg/ml (p < 0.01) (Figure S1B). [score:3]
In contrast, miR-143 overexpression did not alter cell doubling time. [score:3]
Importantly, inhibition of granzyme B in PBMCs almost completely abrogated miR-143 or miR-145 increase in cetuximab -mediated ADCC in HCT116 cells (p < 0.001) (Figure 6B). [score:3]
Therefore, miR-143 or miR-145 overexpression triggered cetuximab -mediated ADCC inducing caspase -dependent apoptosis. [score:3]
Apoptosis is increased in miR-143 or miR-145 overexpressing cells during cetuximab -mediated ADCC. [score:3]
On the other hand, the combination of cetuximab and effector cells resulted in a significant increase of cytotoxicity in cetuximab-resistant (HCT116 and SW480) and -sensitive (SW48) colon cancer cells overexpressing miR-143 or miR-145, at clinically achievable cetuximab doses (Figure 3, S2 and S3). [score:3]
In this study, we observed that miR-143 or miR-145 overexpression reduced cell proliferation and migration of mutant KRAS HCT116 colon cancer cells, and sensitized both mutant KRAS (HCT116 and SW480), as well as wild-type KRAS (SW48) cells to cetuximab. [score:3]
HCT116 cells with stable overexpression of miR-143 and miR-145 and empty control cells were seeded on 35 mm [3] dishes at 3 × 10 [6] cells/dish, and allowed to grow to confluence. [score:3]
miR-143 or miR-145 overexpression increases cetuximab -mediated ADCC in HCT116 cells. [score:3]
miR-143 or miR-145 overexpression sensitizes HCT116 mutant KRAS colon cancer cells to cetuximab. [score:3]
For this purpose, HCT116 cells stably expressing miR-143 or miR-145 were seeded on 96-well plates at 5,000 cells/well, and exposed to 100 μg/ml cetuximab or vehicle control, PBMCs (20:1), or cetuximab with PBMCs (20:1). [score:3]
Our results indicate that overexpression of miR-143 or miR-145 significantly sensitized HCT116 cells to cetuximab (Figure 2B). [score:3]
HCT116 cells with stable overexpression of miR-143 or miR-145, and empty control cells, were seeded on 6-well plates for 24 h, and next serum starved for 16 h by replacing the media with serum-free medium. [score:3]
This increased apoptosis could be explained in part by the reduced Bcl-2 levels in miR-143 and miR-145 overexpressing cells compared to empty control cells following cetuximab and PBMCs exposure, increasing the susceptibility of cells to effector cell -mediated apoptosis. [score:2]
Interestingly, this effect was abrogated in cells overexpressing miR-143 or miR-145, in which Bcl-2 levels were reduced in almost 50% compared to empty control cells (p < 0.01) (Figure 5A, lanes 11 and 12 versus 10). [score:2]
In addition, the cleavage of the endogenous substrate of active caspase-3, PARP, was substantially increased up to ~ 4- and 6-fold, respectively in HCT116-miR-143 and HCT116-miR-145, compared to HCT116-Empty control cells (p < 0.01) (Figure 4D), further confirming that miR-143 and miR-145 overexpression increased apoptosis induced by cetuximab -mediated ADCC in HCT116 cells. [score:2]
Bcl-2 knock-down is involved in miR-143 or miR-145-increased cetuximab -mediated ADCC. [score:2]
Importantly, caspase inhibition following exposure to cetuximab and effector cells, resulted in a significant cell kill reduction of 65 and 57%, respectively in HCT116-miR-143 and HCT116-miR-145, compared to the 17% reduction in HCT116-Empty cell line (p < 0.001) (Figure 4E, Upper Panel). [score:2]
Therefore, our data suggests that caspase activation in response to cetuximab and PBMCs proceeds through a granzyme B -dependent pathway, regulated by Bcl-2. Nevertheless, additional studies should be performed to deeply understand the involvement of these proteins in miR-143 or miR-145 -mediated cetuximab sensitivity. [score:2]
Importantly, higher growth -inhibitory effects were observed on SW48-miR-143 and SW48-miR-145, ~ 40% cell kill, compared to 29% cell kill in SW48-Empty cells (p < 0.01) (Figure S2D). [score:2]
Considering that the presence of mutations in KRAS gene renders tumor cells inherently resistant to anti-EGFR therapy, our results indicate that miR-143 or miR-145 may be key players in mitigating cetuximab resistance in mutant KRAS colon cancer cells. [score:2]
Corroborating these results, LDH release was significantly increased in cells overexpressing miR-143 or miR-145 treated with cetuximab combined with effector cells, compared to Empty-vector control (p < 0.05) (Figure S2E). [score:2]
Similarly to HCT116-derived cells, exposure of SW480-derived cells to PBMCs at a 20:1 E:T ratio did not induce high levels of cell killing (Figure S3C), while exposure to 100 μg/ml cetuximab and PBMCs, significantly decreased cell index values (Figure S3D), resulting in higher growth -inhibitory effects in SW480-miR-143 and SW480-miR-145 cells, ~ 50% cell kill, compared to 28% cell kill in SW480-Empty cells (p < 0.05). [score:2]
Importantly, exposure to 100 μg/ml cetuximab and effector cells at 20:1 E:T, resulted in higher growth -inhibitory effects in HCT116-miR-143 and HCT116-miR-145, ~ 65% cell kill, compared to 42% cell kill in HCT116-Empty cells (p < 0.01). [score:2]
However the addition of trastuzumab and effector cells significantly increased death of cells overexpressing miR-143 and miR-145, observed in both xCELLigence and LDH released assays (p < 0.01). [score:2]
The differential cetuximab sensitivity of colon cancer cells with stable overexpression of miR-143 or miR-145 and empty control cells, was evaluated through the assessment of cell death and cell viability. [score:1]
We next investigated whether miR-143 or miR-145 overexpression could alter the sensitivity of HCT116 cells to cetuximab therapy. [score:1]
We next ascertained if miR-143 or miR-145 increased cetuximab -mediated ADCC also occurred in other colon cancer cell lines, including cetuximab-sensitive cells. [score:1]
Collectively, our data indicates that restoration of miR-143 or miR-145 reduces the aggressiveness of mutant KRAS HCT116 cells. [score:1]
To evaluate the role of miR-143 or miR-145 in cetuximab -mediated ADCC, we used our cell mo del HCT116-miR-143, HCT116-miR-145 and HCT116-Empty cell lines (target cells) and peripheral blood mononuclear cells (PBMCs) isolated from human healthy donors (effector cells). [score:1]
Figure 3HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were plated on 96-well E-Plate and used on xCELLigence System, allowed to grow for 96 h. Cells were grown in medium alone or treated with increasing concentrations of cetuximab, and or PBMCs. [score:1]
Importantly, in experimental cancer mo dels, the delivery of anti-tumorigenic miRNAs, including miR-143 and miR-145, appears to be beneficial for cancer therapy [21, 22]. [score:1]
Therefore, miR-143 and miR-145 modulation may constitute relevant candidates for future therapeutic interventions in combination with cetuximab treatment, and possibly also with other therapeutic antibodies with ADCC-inducing capability. [score:1]
Similarly, no significant increase in PARP cleavage was observed in HCT116-miR-143 and HCT116-miR-145 cells treated control antibody rituximab together with PBMCs (Figure 4D). [score:1]
We further ascertained if the role of miR-143 or miR-145 on increasing cetuximab sensitivity also occurs in KRAS wild-type SW48 colon cancer cells, which are sensitive to cetuximab. [score:1]
HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab, 100 μg/ml rituximab or PBMCs (10:1 or 20:1) alone, or co-treatment of cetuximab or rituximab together with PBMCs (10:1 or 20:1), or vehicle (control). [score:1]
Sequences of the oligonucleotide probes were GAGCTACAGTGCTTCATCTCA (miR-143) and AGGGATTCCTGGGAAAACTGGAC (miR-145). [score:1]
Rituximab was used as a control antibody, and its addition alone or together with effector cells at 20:1 E:T, did not significantly increase cell kill, indicating that ADCC is a mechanism of cell death induction for cetuximab, and that miR-143 and miR-145 are modulators of this mechanism of antibody -mediated cell death (p < 0.01) (Figure 3D). [score:1]
Figure 4HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab, 100 μg/ml rituximab or PBMCs (10:1 or 20:1) alone, or co-treatment of cetuximab or rituximab together with PBMCs (10:1 or 20:1), or vehicle (control). [score:1]
Interestingly, we found that miR-143 or miR-145 are also able to increase trastuzumab -mediated ADCC (Figure S4), expanding the therapeutic relevance of these miRNAs and demonstrating that their effect is not restricted to cetuximab -mediated ADCC. [score:1]
Granzyme B activity is involved in miR-143 or miR-145-increased cetuximab -mediated ADCC. [score:1]
Therefore, taken together, these results unveil the importance of miR-143 and miR-145 in modulating ADCC as a mechanism of cell death induced by cetuximab in presence of PBMCs. [score:1]
HCT116-Empty, HCT116-miR-143 or HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab or PBMCs (20:1) alone, or co-treatment of cetuximab together with PBMCs, or vehicle (control). [score:1]
HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were plated on 96-well E-Plate and used on xCELLigence System, allowed to grow for 96 h. Cells were grown in medium alone or treated with increasing concentrations of cetuximab, and or PBMCs. [score:1]
HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 stably transduced cells were plated onto a 96-well E-Plate of xCELLigence System. [score:1]
Figure 6HCT116-Empty, HCT116-miR-143 or HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab or PBMCs (20:1) alone, or co-treatment of cetuximab together with PBMCs, or vehicle (control). [score:1]
Figure 5(A) HCT116-Empty, HCT116-miR-143 and HCT116-miR-145 cells were exposed to 100 μg/ml cetuximab or PBMCs (10:1) alone, or co-treatment of cetuximab together with PBMCs (10:1), or vehicle (control) for 48 h to evaluate Bcl-2 protein expression, by immunoblot. [score:1]
Next, we evaluated the effect of miR-143 or miR-145 overexpression in HCT116 cell proliferation in real-time, using the xCELLigence system. [score:1]
[1 to 20 of 87 sentences]
12
[+] score: 258
Strikingly, ERK5 expression was inversely correlated with miR-143 expression, as analyzed by in situ hybridization, suggesting that ERK5 could be a bona fide miR-143 target (Fig. 3C, compare upper to lower panels). [score:7]
Moreover, decreased ERK 5 expression in mir-143 treated cells also correlated with decreased expression of Jun, which is a known ERK5 target (Fig. 3E). [score:7]
These results suggested that downregulation of miR-143 expression could be a required event for cancer development or progression. [score:7]
Since miR-143 was found to be down-regulated in prostate cancer cells, we wanted to analyze its expression in human prostate cancer, and test the ability of miR-43 to arrest prostate cancer cell growth in vitro and in vivo. [score:6]
First, we show that miR-143 expression is clearly downregulated during prostate cancer progression. [score:6]
Finally, expression of ERK5 protein is inversely correlated to miR-143 expression in human prostate cancers. [score:5]
Interestingly, ERK5 expression was inversely correlated with miR-143 expression in these cell lines (Fig. 1A). [score:5]
It has been shown that ERK5 might be a direct or indirect target of miR-143 [32]. [score:5]
Decreased ERK5 expression correlated with decreased proliferation in these cell lines upon expression of miR-143 (Fig. 2). [score:5]
In summary we have shown that miR-143 is a tumor suppressor miRNA in prostate cancer, that controls cell proliferation and survival through modulation of, at least in part ERK5 expression. [score:5]
Furthermore, miR-143 inhibits expression of a reporter protein when this binding site replaces the 3′UTR of the luciferase mRNA. [score:5]
miR-143 expression could not be detected specifically in prostate cancer cells of high Gleason score, whereas miR-143 was expressed in normal prostate epithelium, and prostatic glands (Fig. 1C). [score:5]
Other studies have pointed to a tumor suppressor role of miR-143 in colon, and other cancer cells [26], particularly through inhibition of KRAS, and ERK5 proteins [26], [31]. [score:5]
Ectopic expression of miR-143 in LNCaP, and C4-2 prostate cancer cell lines resulted in a significant decrease in ERK5 protein expression, compared to cells transfected with non-relevant miRNA, or with the antisense miR-143. [score:4]
We show now and we provide enough evidence to demonstrate that ERK5 is a direct target of miR-143 in prostate cancer. [score:4]
We have analyzed the expression and the effects of miR-143 on prostate cancer development and progression. [score:4]
miR-143 was expressed 5- and 12-fold higher in transfected LNCaP, and C4-2 cells respectively, compared to control cells transfected with either non-relevant miRNA, or with anti-miR-143, which is a miR-143 inhibitor (Fig. 2A). [score:4]
Furthermore, we show that the effects of miR-143 are mediated, at least in part by the inhibition of extracellular signal-regulated kinase-5 (ERK5) activity. [score:4]
Consistent with our findings expression of miR-143 has been found to be decreased also in other cancers, such as colon cancer [25], B-cell malignancies [26], prostate cancer [27], pituitary tumors [28], or cervical cancer [29]. [score:3]
Luciferase activity of the 3′ UTR ERK-Luc construct was decreased in the presence of miR-143, whereas luciferase activity of mutated -Luc construct was not affected, suggesting that miR-143 modulate ERK5 expression through binding to ERK5-3′UTR (fig 3F). [score:3]
Rescue of miR-143 expression decreases tumor progression in mice. [score:3]
C, QPCR analysis of miR-143 expression in C4-2 (white bars) and LNCaP xenografts (black bars), normalized to RNU48. [score:3]
B, QPCR of miR-143, normalized to the amount of RNU48 target in prostate tissue samples. [score:3]
miR-143 is as a new target for prostate cancer treatment. [score:3]
Decreased proliferation and increased apoptosis in miR-143 -expressing prostate cancer cells. [score:3]
A, Schematic representation of the predicted target site of miR-143 in the 3′ UTR of ERK5 mRNA. [score:3]
A, Quantitative real-time PCR (QPCR) of miR-143, normalized to the amount of RNU48 target in prostate cancer cell lines. [score:3]
miR-143 overexpression in C4-2 cells and LNCaP cells. [score:3]
Global analysis of micro RNA expression in these treated cells correlated increased miR-143 with growth arrest. [score:3]
The anti-miR-143 is able to inhibit miR-143 present in cells by hybridization. [score:3]
Finally, analysis of ERK5 protein level by immunohistochemistry indicated that ERK5 expression was decreased in presence of miR-143 in LNCaP and C4-2 tumors (Fig. 4E). [score:3]
0007542.g003 Figure 3 A, Schematic representation of the predicted target site of miR-143 in the 3′ UTR of ERK5 mRNA. [score:3]
This down-regulation of miR-143 in prostate cancer samples has been suggested to reflect the lower differentiation stage of the tumor tissue compared the normal tissue [30]. [score:3]
We wanted to identify miR-143 targets that could be implicated in prostate cancer progression. [score:3]
In spite of the expected miR-143 rapid degradation in vivo, expression of miR-143 remained significantly increased in miR-143 electroporated tumors (Fig. 4C). [score:3]
To test this hypothesis miR-143 was ectopically expressed in C4-2 and LNCaP prostate cancer cell lines. [score:3]
Expression of miR-143 in prostate cancer. [score:3]
To more precisely analyze expression of miR-143, in situ hybridization was performed in high-density tissue arrays, containing 40 prostate cancer tissues vs. [score:3]
In the present study we investigated the expression of miR-143 in prostate cancer and found that the expression level of miR-143 was significantly decreased. [score:3]
miR-143 expression is decreased during prostate cancer progression. [score:3]
F, Western blot analysis of endogenous c-Jun expression in LNCaP cells 48 h after transient transfection of the indicated miR-143. [score:3]
Some studies have previously shown that miR-143 could play a role in tumorigenesis since its expression is decreased in several cancers [19]. [score:3]
We show here that ERK5 is a miR-143 target in prostate cancer. [score:3]
Furthermore, cell cycle analysis showed an increase in the G [0]-G [1] population, concomitant to a decrease in S-phase in miR-143 expressing cells (Fig. 2F). [score:3]
We proved, for the first time that miR-143 is a tumor suppressor in mice. [score:3]
Expression of miR-143 was analyzed in human prostate cancers by quantitative PCR, and by in situ hybridization. [score:3]
Identification of ERK5 as a miR-143 target. [score:3]
0007542.g001 Figure 1 A, Quantitative real-time PCR (QPCR) of miR-143, normalized to the amount of RNU48 target in prostate cancer cell lines. [score:3]
Further prospective studies to validate miR-143 as a predictive target of prostate cancer progression are warranted. [score:3]
ERK5 is a miR-143 target gene. [score:3]
Decreased expression in prostate cancer suggested that miR-143 could have anti-proliferative effects. [score:3]
Finally, bioinformatics analyses identified ERK5 as a potential target gene for mir-143. [score:3]
D, Western blot analysis of endogenous ERK5 expression in C4-2 and LNCaP cells 48 h after transient transfection of the indicated miR-143. [score:3]
In sharp contrast, cell number was inversely correlated to the expression levels of miR-143 in both LNCaP, and C4-2 cell lines (Fig. 2B–C). [score:3]
Rescue of miR-143 expression in cancer cells results in the arrest of cell proliferation and the abrogation of tumor growth in mice. [score:3]
Taken together these results proved that miR-143 functions as a tumor suppressor in prostate cancer cells. [score:3]
The second major finding of our study is the observation that rescue of miR-143 expression in prostate cancer cells results in the abrogation of cancer cell growth, both in vitro and in mice. [score:3]
Values are normalized to beta-galactosidase activity and expressed in fold versus absence of miR-143. [score:3]
Taken together these findings suggest that mir-143 could be a tumor suppressor and a potential novel diagnostic or prognostic marker in prostate cancer. [score:3]
Consistent with this observation, the expression of miR-143 was strongly decreased in human prostate cancer, compared to normal prostate tissues (fig. 1B). [score:2]
A first indication of the participation of miR-143 in prostate cancer was the observed decreased expression of this miRNA in LNCaP, and C4-2 prostate cancer, compared to normal epithelial cell lines, as analyzed by quantitative RT-PCR (Fig. 1A). [score:2]
Therefore, persistent decreased levels of mir-143 in cancer cells may be directly involved in carcinogenesis through activation of the mitogen-activated protein kinase (MAPK) cascade via ERK5. [score:2]
This suggested that miR-143 negatively regulates cell proliferation. [score:2]
Bioinformatics analysis and luciferase -based assays were used to determine miR-143 targets. [score:2]
Furthermore, levels of transcribed miR-143 were inversely correlated with histopathological grade in human prostate cancer, reaching the limit of detection in high-grade cancers (Gleason >7; Fig. 1B). [score:1]
D, Analysis of cell proliferation by PCNA staining on xenograft sections of athymic Nude mice injected subcutaneously with C4-2 (white bars) or LNCaP (black bars) cells after three electroporations with scrambled miR or miR-143 precursor. [score:1]
Effects of miR-143 rescue in mice mo del of prostate tumors. [score:1]
We show in this study that miR-143 levels are inversely correlated with advanced stages of prostate cancer. [score:1]
Cells were transfected with miR-143, negative control miR. [score:1]
E, Blue trypan incorporation in C4-2 (white bars) and LNCaP (black bars) cells 48 h after transfection in absence or presence of miR-143 or in presence of antimiR-143. [score:1]
H, Relative active Caspase 3 concentration in C4-2 (white bars) and LNCaP (black bars) cells 48 h after transfection in absence or presence of miR-143 or in presence of antimiR-143. [score:1]
0007542.g002 Figure 2 A, QPCR of miR-143 in C4-2 cells (white bars) and LNCaP cells (black bars), normalized to RNU48 48 h after transfection with scrambled miR (control), miR-143 precursor or antimiR-143. [score:1]
Bioinformatics analysis indicated that the 3′ UTR of the human ERK-5 gene harbors a putative consensus site for miR-143 binding (nucleotides 2917-2932) (fig 3A). [score:1]
Altogether, these data suggested that miR-143 negatively controls cell proliferation and positively controls cell death of prostate cancer cells. [score:1]
Two weeks after inoculation of the cells, when tumors reached a mean volume of 392 mm [3], miR-143 rescue experiments were performed. [score:1]
This is supported by the presence of miR-143 binding site in the 3′UTR of ERK5 mRNA. [score:1]
COS cells were co -transfected with 0.5 µg of pGL3 -based vectors and different concentrations of miR-143 precursor as indicated, using Lipofectamine 2000. [score:1]
No differences in cell numbers were observed when non-relevant miRNA or anti-miR-143 were used in these cells. [score:1]
C, Representative immunohistochemical staining of ERK5, and in situ hybridization of miR-143 in consecutive sections of high-density tissue array. [score:1]
Transfection of LNCaP and C4-2 cells in vitro with precursor miR-143, or electroporation of miR-143 in prostate cancer xenografts in mice demonstrated that miR-143 negatively contributes to prostate cancer cell growth. [score:1]
500pmole of miR-143 precursor or scrambled miR were injected in 100 µL PBS into the xenograft. [score:1]
Consistent with the observed decrease in tumor growth, the proliferation ratio of LNCaP and C4-2 tumors was also decreased, as quantified by PCNA staining in tumors electroporated with miR-143 (Fig. 4D). [score:1]
miR-143 was introduced in cancer cells in vivo by electroporation. [score:1]
F, Percentage of cells in different phases of cell cycle in LNCaP and C4-2 cell lines 36 hours following transfection with control 5 (non relevant), miR-143 or antimiR-143. [score:1]
Nude mice injected subcutaneously with C4-2 (white bars) or LNCaP (black bars) cells after three electroporations with scrambled miR or miR-143 precursor. [score:1]
C, Representative in situ hybridization staining of miR-143 in human non-tumor and tumor prostate tissue. [score:1]
Intratumoral injection of miR-143, followed by electroporation as described in material and methods section resulted in the abrogation or decrease in tumor growth in mice grafted with LNCaP and C4-2 cells respectively (Fig. 4A and 4B), whereas electroporation of control non-relevant miR had no effect on tumor growth (Fig. 4A and 4B). [score:1]
B–C, Cell growth in LNCaP (B) or C4-2 (C) cells during 48 h after transfection with scrambled miR (black rhombus), miR-143 precursor (black cross) or antimiR-143 (white triangle). [score:1]
D, Quantification of BrdU incorporation 48 h after transfection in C4-2 and LNCaP cells in absence of miR-143 (top), in presence of miR-143 (middle) or antimiR-143 (bottom). [score:1]
A–B, Tumor growth of LNCaP (A) or C4-2 (B) cells injected subcutaneously and electroporated three times with non-relevant miR (control, white squared) or miR-143 precursor (black rhombus). [score:1]
A, QPCR of miR-143 in C4-2 cells (white bars) and LNCaP cells (black bars), normalized to RNU48 48 h after transfection with scrambled miR (control), miR-143 precursor or antimiR-143. [score:1]
G, FACS analysis of apoptosis in C4-2 (white bars) and LNCaP (black bars) cells 48 h after transfection in absence or presence of miR-143 or in presence of antimiR-143. [score:1]
Transfections with miR-143 precursor, anti-miR 143 (hsa-mir-143, Ambion) were performed at concentration of 50 nM with Dharmafect 2 (Dharmacon, Lafayette, CO). [score:1]
0007542.g004 Figure 4 Effects of miR-143 rescue in mice mo del of prostate tumors. [score:1]
Finally, to further prove that transient transfection experiments were performed using the 3′UTR region of ERK5 containing the putative miR-143 matching site, mutated or not, downstream of the luciferase open reading frame. [score:1]
Our finding that miR-143 is at the limit of detection in aggressive prostate cancer could help to identify such patients. [score:1]
[1 to 20 of 96 sentences]
13
[+] score: 227
Primary findings of interest include: (1) the placental amnion and the reflected amnion of TIL cases also have distinct miRNA expression patterns as is the case with transcriptome; (2) the miR-143/miR-145 cluster is among the down-regulated miRNAs in the reflected amnion with labor; (3) miR-143/miR-145 expression is significantly higher in AMCs than in AECs; (4) miR-143 targets PTGS2 3′ UTR in amnion cells; and (5) miR-143 regulation of PTGS2 occurs largely by translational repression. [score:13]
These results suggested that miR-143 regulation of PTGS2 expression occurs largely by translational inhibition than by PTGS2 mRNA degradation in the amnion, particularly in AMCs. [score:8]
To determine whether post-transcriptional regulation of PTGS2 by miR-143 occurs via translational repression or mRNA degradation mechanisms [18], [34], AECs and AMCs were transfected with either miR-143 mimic or hairpin inhibitor, and the changes in miR-143 and PTGS2 expression following transfection were determined by qRT-PCR and immunoblotting, respectively. [score:8]
Consequently, PTGS2 protein expression was decreased upon miR-143 mimic transfection, and inhibition of miR-143 increased PTGS2 expression (p = 0.014; Figure 4B). [score:7]
When we confirmed their expressions by qRT-PCR, the miR-143/miR-145 expression was significantly lower in the reflected amnion of both TNL and TIL cases (p<0.05 for each); and its expression in the reflected amnion also significantly decreased with labor (p<0.05). [score:7]
B, Immunoblot analysis of PTGS2 expression in AECs and AMCs transfected with mimic negative control (lane 1), mimic-miR-143 (lane 2), hairpin inhibitor negative control (lane 3), and inhibitor-miR-143 (lane 4). [score:7]
Furthermore, expression patterns of the miR-143/miR-145 cluster strongly suggest that miRNA -mediated regulation of gene expression in the amnion is a cell type-specific event. [score:6]
In AECs, miR-143 mimic transfection significantly increased (p = 0.014) miR-143 expression while decreasing PTGS2 expression. [score:5]
miR-143 expression is significantly higher in the PA than in the RA in both groups, and its expression in the RA is significantly higher in TIL cases than in TNL cases. [score:5]
miR-143 and miR-145 expression levels were normalized with 5S rRNA expression. [score:5]
In AMC, miR-143 mimic and hairpin inhibitor transfections 1.8-fold increased and 1.3-fold decreased the expression of PTGS2 protein (p = 0.014 for each), respectively. [score:5]
0024131.g004 Figure 4A, qRT-PCR analysis shows that 50 nM of miR-143 mimic transfection significantly increases miR-143 expression, while transfection with 200 nM of miR-143 inhibitor has no effect in AECs. [score:5]
AECs and AMCs were kept in DMEM, and all experiments were performed with the cells at passage 2 and passage 4. For the transfection with miR-143 mimic and inhibitor, 5×10 [5] of AMCs and 1×10 [6] of AECs were split in 6-well plates, kept overnight, and transfected with miRIDIAN miR-143 mimic (50 nM; Dharmacon, Lafayette, CO; C-301057-01-0005) or miR-143 hairpin inhibitor (200 nM; IH-301057-02-0005) using Lipofectamine 2000 (Invitrogen). [score:5]
In AECs, PTGS2 protein expression was 1.5-fold decreased in transfection with miR-143 mimic (p = 0.014), but no changes in transfection with miR-143 inhibitor. [score:5]
In AMCs, miR-143 mimic (50 nM) and hairpin inhibitor (200 nM) transfections significantly increased and decreased the expression of miR-143, respectively. [score:5]
B, qRT-PCR analysis of miR-143 expression which was normalized to 5S rRNA shows significantly higher expression in AMCs than AECs. [score:5]
A, qRT-PCR analysis shows that 50 nM of miR-143 mimic transfection significantly increases miR-143 expression, while transfection with 200 nM of miR-143 inhibitor has no effect in AECs. [score:5]
de/) to determine a functionally relevant target in the context of labor, PTGS2, a key enzyme of labor at term, was among the putative targets of miR-143. [score:5]
In AMCs, miR-143 mimic and hairpin inhibitor transfections significantly increased and decreased (p = 0.014 for both) the expression of miR-143, respectively (Figure 4A). [score:5]
However, effects of miR-143 inhibitor transfection were minimal on miR-143 and PTGS2 expressions, which were consistent with the luciferase reporter assay data (Figure 4A and 4B). [score:4]
miR-143 regulation of PTGS2 by translational repression. [score:4]
Thirty-one (97%) miRNAs, which included miR-143 and miR-145, a cardiovascular-specific miRNA cluster, were down-regulated in the reflected amnion. [score:4]
Among miRNAs down-regulated with labor in the reflected amnion, we found the presence of miR-143 and miR-145 as well as their relative abundance in AMCs intriguing and relevant. [score:4]
0024131.g001 Figure 1A, qRT-PCR analysis of miR-143 expression in PA and RA obtained from women at term not in labor (TNL; n = 10) and in labor (TIL; n = 10) to confirm microarray results. [score:3]
In AECs, there is a 58.5% of decrease in luciferase activity following transfection with miR-143 mimic but transfection of miR-143 hairpin inhibitor does not alter luciferase activity. [score:3]
miR-143/miR-145 cluster expression in PA and RA. [score:3]
Higher expression of miR-143/miR-145 in AMCs than in AECs, therefore, could be explained by intrinsic phenotype of the cells and is biologically quite relevant. [score:3]
Interestingly, expression of miR-143 and miR-145 was higher in AMCs than in AECs (p<0.05). [score:3]
The miR-143 and miR-145 expressions in the TNL reflected amnion were 3.2-fold and 2.4-fold higher than in the TIL reflected amnion, respectively (p<0.005 for each) (Figure 1A and 1B). [score:3]
The miR-143 expression in AMCs was 15-fold greater (p = 0.028) than that of AECs (Figure 2B). [score:3]
To assess miR-143 binding to PTGS2 mRNA 3′ UTR in AECs, 1×10 [6] cells were transfected with 200 ng of pMIR-REPORT plasmid or 200 ng of pMIR-REPORT-PTGS2 3′ UTR, 10 ng of Renilla luciferase reporter pSV40-RL (transfection control; Promega), and miRIDIAN miR-143 mimic (100 nM) or miR-143 hairpin inhibitor (50 nM) or equal amounts of negative controls using Lipofectamine 2000 (Invitrogen). [score:3]
A, qRT-PCR analysis of miR-143 expression in PA and RA obtained from women at term not in labor (TNL; n = 10) and in labor (TIL; n = 10) to confirm microarray results. [score:3]
B, The differential expression patterns of miR-145 are basically identical to those of miR-143. [score:3]
Interestingly, qRT-PCR analysis showed a marked difference in miR-143 expression between AECs and AMCs. [score:3]
PTGS2 mRNA expression levels, however, in both AECs and AMCs (Figure 4C) were not significantly changed by miR-143 transfection. [score:3]
The miR-143 and miR-145 expressions were 7.7-fold and 5.7-fold higher in the placental amnion than in the reflected amnion of TIL cases, respectively (p<0.005 for each). [score:3]
Findings were most likely related to the low basal endogenous level of miR-143 expression in AECs. [score:3]
In AECs, there was a decrease in luciferase activity by 58.5% (p = 0.008) following transfection with a miR-143 mimic (Figure 3B), but there were no significant changes in luciferase activity following transfection with a miR-143 hairpin inhibitor. [score:3]
Localization of miR-143 expression by in situ hybridization demonstrated readily detectable hybridization signals in both the amnion epithelial cells and the mesenchymal cells (Figure 1C). [score:3]
In this context, it is also possible that the difference in miR-143/miR-145 expression between placental amnion and reflected amnion can be related to a potential difference in the ratio of amnion epithelial and mesenchymal cells between placental amnion and reflected amnion. [score:3]
Analyses of miR-143 and miR-145 by qRT-PCR confirmed microarray results, and further demonstrated their decreased expression in the reflected amnion with labor. [score:3]
Effects of miR-143 on PTGS2 expression in AECs and AMCs. [score:3]
Prostaglandin-endoperoxidase synthase 2 as a putative target of miR-143. [score:3]
In AMCs, however, effects of both miR-143 mimic and hairpin inhibitor were readily detected (Figure 3B). [score:3]
For luciferase analysis of AMCs, 5×10 [5] cells were transfected with 500 ng of pMIR-REPORT plasmid or 500 ng of pMIR-REPORT-PTGS2 3′ UTR, 10 ng of Renilla luciferase reporter pSV40-RL, and miRIDIAN miR-143 mimic (100 nM) or miR-143 hairpin inhibitor (50 nM) or equal amounts of negative controls using Lipofectamine 2000 (Invitrogen). [score:3]
To estimate transfection efficiency prior to the transfections using miR-143 mimic and inhibitor, the cells were transfected with Cy3-labeled Pre-miR™ negative control #1 (Applied Biosystems) using Lipofectamine 2000, and visualized under an immunofluorescence microscope. [score:3]
The PTGS2 3′ UTR carrying a putative miR-143 binding site was PCR amplified, sequence confirmed, and cloned into a SpeI and HindIII site of the pMIR-REPORT™ miRNA Expression Reporter Vector (Ambion, Austin, TX). [score:3]
This miR-143 regulation is cell-type specific restricted to AMCs. [score:2]
We report region-specific amniotic microRNAome (placental amnion vs reflected amnion) and miR-143 regulation of PTGS2 in amnion mesenchymal cells for the first time. [score:2]
and transfection confirmed miR-143 binding to 3′ UTR of prostaglandin-endoperoxidase synthase 2 (PTGS2) mRNA and miR-143 regulation of PTGS2 in AMCs. [score:2]
In miR-143/miR-145 knockout mice, vascular neointima formation after injury is blocked due to perturbations in actin stress fiber formation [38]. [score:2]
For miRNA expression analysis, miR-143 (002146) and miR-145 (002149) TaqMan assays were used with 5S ribosomal RNA (4332078) as a normalizer. [score:2]
We report region-specific amniotic microRNAome and miR-143 regulation of PTGS2 in the context of human labor at term for the first time. [score:2]
Findings in the present study indicate that the changes in miR-143 regulation of PTGS2 plays a role in labor at term in addition to the increase in transcription of PTGS2 mRNA. [score:2]
The miR-143/miR-145 cluster has been wi dely studied in vascular smooth-muscle cells [36]. [score:1]
Cordes et al have demonstrated that the miR-143/miR-145 cluster is abundant in the developing heart and in their localization in smooth muscle cells and neural crest stem cell-derived vascular smooth muscle cells [37]. [score:1]
For in situ hybridization, a 5′-DIG labeled mercury miR-143 LNA probe (Exiqon, Cat. [score:1]
While miR-143 mimic transfection decreased luciferase activity by 25.9% compared to the control (p = 0.008), inhibition of miR-143 resulted in a 46.2% increase (p = 0.008) in luciferase activity compared to the vector control (Figure 3C). [score:1]
miR-143 binding to the 3′ UTR of PTGS2 mRNA. [score:1]
miR-143 binding to PTGS2 3′ UTR in amnion mesenchymal cells. [score:1]
C, In situ hybridization for miR-143 in the RA obtained from a TNL case. [score:1]
In AMCs, miR-143 mimic transfection decreased luciferase activity by 25.9% compared to the control, while inhibition of miR-143 increased luciferase activity by 46.2% compared to control. [score:1]
To confirm miR-143 binding to 3′ UTR of PTGS2 mRNA, a transient transfection experiment was carried out using a luciferase reporter plasmid with PTGS2 3′ UTR containing the putative miR-143 binding site (Figure 3A). [score:1]
[1 to 20 of 63 sentences]
14
[+] score: 212
Protein and mRNA expression of MAPK1 were observably suppressed by overexpression of miR-143To validate that MAPK1 was a direct target of miR-143, two types of MAPK1 vectors including wild type (WT) luc- MAPK1 and mutation type luc- MAPK1-mut were constructed (Figure 4A). [score:11]
For instance, Liu et al. found that miR-143 could mediate the apoptotic process in osteosarcoma cells by manipulating the expression of Bcl-2. Mao et al. revealed that miR-143, as a tumor suppressor, could inhibit the expression of family with sequence similarity 83 (FAM83F) in esophageal squamous cell carcinoma (ESCC). [score:9]
After HEC-1B cells were transfected with miR-143 mimics, miR-143 expressions were upregulated, and miR-143 expression in miR-143 mimics group was higher than that in blank control group and negative control (NC) group (P < 0.05, Figure 2A). [score:8]
The results of RT-PCR and western blot both revealed that protein and mRNA expressions of MAPK1 were suppressed by overexpression of miR-143 (Figure 4C and 4D). [score:7]
In conclusion, our study showed that overexpression of miR-143 could suppress proliferation, migration and invasion and cell cycle process of HEC-1B cells, and induce apoptosis by targeting MAPK1. [score:7]
All in all, we could conclude that miR-143 could suppress EC cell migration, invasion and proliferation by targeting down MAPK1, which therefore suppresses MAPK/ERK signaling. [score:7]
Protein and mRNA expression of MAPK1 were observably suppressed by overexpression of miR-143. [score:7]
The results indicated that miR-143 expression was significantly downregulated in the EC tissues in comparison with adjacent tissues (P < 0.05, Figure 1A and 1B). [score:6]
Overexpression of miR-143 or knockdown of MAPK1 in human EC cell line HEC-1B inhibited the EC cell proliferation, migration and invasion and induced apoptosis. [score:6]
MiR-143 overexpression could effectively inhibit mRNA and protein expression of MAPK1 in HEC-1B cells. [score:6]
Besides, Liu et al. found that miR-143 could inhibit cell invasion and proliferation through down -regulating TLR2 expression in hepatoma cells [36– 38]. [score:6]
This also indicated that miR-143 could directly target 3’UTR of MAPK1 and inhibited the transcriptional activity of MAPK1. [score:6]
In our study, the down-regulation of miR-143 in EC tissues and cells indicated that miR-143 could function as a tumor suppressor in EC. [score:6]
The expression levels of miR-143 were down-regulated in EC tissues and cell lines. [score:6]
We have confirmed that miR-143 could efficiently down-regulate MAPK1 expression in EC cells. [score:6]
MiR-143 was found to be capable of suppressing proliferation, migration and invasion and cell cycle process of HEC-1B cells, and inducing apoptosis via downregulation of MAPK1, which not only proved our previous conjuncture was right, but provided some valuable evidence for the intensive study on the subject. [score:5]
Overexpression of miR-143 inhibited cell proliferation and induced apoptosis of the cells. [score:5]
Figure 1 (A) The expression levels of miR-143 in tissue samples were down-regulated compared with normal tissues. [score:5]
These results revealed that miR-143 functions as a tumor suppressor and might play an important role in the inhibition of EC cell proliferation and metastasis. [score:5]
To validate that MAPK1 was a direct target of miR-143, two types of MAPK1 vectors including wild type (WT) luc- MAPK1 and mutation type luc- MAPK1-mut were constructed (Figure 4A). [score:5]
Overexpression of miR-143 reduced cell viability and cell cycle, inhibited migration and invasion ability of EC cells and promoted cell apoptosis. [score:5]
MiR-143 expression was downregulated in EC tissues and cells. [score:5]
Overexpression of miR-143 could inhibit the luciferase activity of luc- MAPK1, but had no effect on luc- MAPK1-mut (Figure 4B). [score:5]
Overexpression of miR-143 inhibited cell invasion and migration. [score:5]
MiR-143 directly targeted and regulated MAPK1 in EC cells. [score:4]
These studies indicate that miR-143 could possibly suppress EC progression or development by silencing some gene. [score:4]
In addition, Ning et al. showed that MAPK1 can be directly targeted by miR-143 during human keratinocyte differentiation [32]. [score:4]
Given that the expression of miR-143 in HEC-1B cells was relatively higher in comparison with the other four EC cell lines, we selected HEC-1B cell line for our further study. [score:3]
The expression of miR-143 was detected by RT-PCR. [score:3]
Thus, we speculate that miR-143 could probably hinder EC carcinogenesis by inhibiting MAPK1. [score:3]
Figure 4 (A) MiR-143 could directly target 3’UTR of MAPK1. [score:3]
In the current study, miR-143 was found under-expressed in EC tissues and cells. [score:3]
MAPK1 has also been reported to be a common target of miR-143 in renal cell carcinoma [33]. [score:3]
Besides, the miR-143 expression in EC cell lines (HEC-1B, AN3CA, KLE, ECC-1and Ishikawa) was significantly lower than normal cells (hESC, P < 0.05, Figure 1C). [score:3]
To study the expression of miR-143 in EC, we measured the expression of miR-143 in 35 EC tissues and the adjacent tissues using RT-PCR. [score:3]
Recent findings have found that miR-143 family members exerted influence on multiple features of tumor cells through different pathways and targets. [score:3]
Figure 2 (A) The expression of miR-143 in HEC-1B cells dramatically increased after transfection with miR-143 mimics. [score:3]
In the current study, we first demonstrated the molecular mechanism of miR-143 in influencing EC cells through targeting MAPK1. [score:3]
MAPK1 was verified to be a target gene of miR-143. [score:3]
In our study, we demonstrated that miR-143 could affect EC cells proliferation, migration and invasion through targeting MAPK1. [score:3]
T Luc- MAPK1-mut vector with MAPK1 3’UTR mutation without miR-143 binding site was constructed by XL Site-directed Mutagenesis Kit (Qiagen, Hilden, Germany). [score:3]
Compared with control group and NC group, cell viabilities in miR-143 group were significantly suppressed (P < 0.05, Figure 2B). [score:2]
The vectors containing negative control, miR-143 mimics and MAPK1 siRNA were bought from Dharmacon Corporation in USA. [score:1]
Cells were co -transfected with Luc- MAPK1-wt/Luc- MAPK1-mut and miR-143/negative. [score:1]
The results have shown that in miR-143 group, cell cycle arrested at G1 phase and a constant accumulation of apoptotic cell was detected (both P < 0.05, Figure 2C and 2D). [score:1]
As shown in the Figure 3, miR-143 mimics group displayed weaker migration and invasion abilities of EC cells in comparison with control group and NC group (both P<0.05). [score:1]
However, few researches were conducted to analyze the relationship between MAPK1 and miR-143 in EC. [score:1]
Figure 3 (A) The open wound area of EC cells in miR-143 group was much larger than that in control group and NC group. [score:1]
MAPK1 3’UTR with miR-143 binding site was amplified to psiCHECK-2 luciferase vector (Promega, Madison, WI, USA) as luc- MAPK1 vector. [score:1]
[1 to 20 of 49 sentences]
15
[+] score: 211
While miR-100 and miR-143 target NPR3 to downregulate its expression, both microRNAs were also observed to regulate MIR143HG promoter activity suggesting possible cross talk between the two NPR3 -targeting microRNAs. [score:11]
As shown in Fig.   5b, overexpression of miR-143 repressed NPPA, NPPC and NR3C2 expression in HCMa cells, while knockdown of miR-143 upregulated expression of CRHR2. [score:11]
To further examine the interaction of miR-100 and miR-143 with predicted target sites on the promoter region of MIR143HG, mutations were introduced into selected transcriptional response elements that contain over 90% complementary base pair matching with the mature seed region of micro-143 and miR-100, namely −1504 bp and −2171 bp (miR-143 target sites), as well as −44 bp, and −1439 bp (miR-100 target sites) with respect to the transcription start site on the MIR143HG promoter region. [score:8]
Second, the upregulated miR-100 levels observed in multiple cardiovascular cells after knock down of miR-143 expression under both normoxic and hypoxic conditions (Supplemental data 1). [score:7]
In this report, we explored a cluster of microRNAs predicted to target NPR3-3′UTR and discovered that miR-143, a microRNA previously demonstrated to play pivotal roles in cardiac development and smooth muscle cell differentiation [16], negatively regulates the expression of NPR3 in cardiac cells derived from human left ventricle. [score:7]
Our finding of the inhibitory effect of miR-143 on NPR3 expression in cardiac cells is particularly intriguing as knockdown of NPR3 in rats, using RNA interference, elevates circulating ANP levels and ameliorates isoproterenol -induced cardiac hypertrophy [24]. [score:6]
This finding was corroborated by the observed upregulation of miR-100 in multiple cardiovascular cell lineages after knock down of the endogenous miR-143 levels using antagomiR-143 (Supplemental data 1). [score:5]
Furthermore, we demonstrated that miR-143 upregulation resulted directly from hypoxia -induced transcriptional activation of its host gene, MIR143HG, as well as by a feed forward effect of miR-143 on its host gene promoter activity. [score:5]
Gain and loss of function assays were then performed in HCMa cells to examine the regulatory effects of miR-143 on the expression of these putative target genes. [score:5]
To examine the possible microRNA-directed transcriptional regulation of MIR143HG, miR-143 and miR-100 mimics were co -transfected with the pMIR143HG-containing vector and the relative strength of promoter activities in driving luciferase reporter expression in transfected cells was determined. [score:5]
Nevertheless, the changes in MIR143HG promoter activities after treatment with miR-100 and miR-143 mimics reflect the complexity of microRNA-directed regulatory mechanisms in gene expression. [score:5]
In experimental PAH mo dels, the authors further demonstrated that downregulation of miR-143 attenuates pulmonary vascular remo deling and the development of pulmonary arterial hypertension [17]. [score:5]
Figure 2Regulatory effects of miR-143 on the expression of NPR3. [score:4]
Figure 5Regulatory effects of miR-143 on the expression of NPPA, NPPC, NR3C2 and CRHR2. [score:4]
To confirm the involvement of hypoxia as a trigger for miR-143 upregulation in vitro, human left ventricle-derived HCMa cells were cultured in 0.2% oxygen for 48 hours and levels of miR-143 were examined. [score:4]
This finding indicates that complementary base pairing of miR-100 and miR-143 with predicted motifs in the promotor region might play role(s) in microRNA-directed transcriptional modulation of the expression of MIR143HG. [score:4]
Regulatory effect of miR-143 on NPR3 expression. [score:4]
The role of miR-143 in mouse vascular smooth muscle cells (VSMCs) differentiation was demonstrated by targeting Ets-like gene 1 (ELK1), a transcriptional coactivator that is crucial for regulation of the VSMC phenotype [16]. [score:4]
Consistent with our previous observations, miR-143 was upregulated in all three cardiac cell lines examined after hypoxic treatment (Fig.   1d and Supplemental data 1). [score:4]
This finding provides the molecular basis for the association of miR-143 with ischemic-related cardiovascular diseases and indicates that miR-143 functions as a modulator of the cardiac cellular response to oxygen deprivation. [score:3]
Western blotting analyses revealed distinct NPR3 expression patterns across three cardiac cell lines (derived from different donors) when subjected to normoxic or hypoxic conditions in the presence of exogenous miR-143 mimic or antagomir (Supplemental data 3). [score:3]
Importantly, results from our study demonstrate that miR-143 may modulate multiple molecules involved in cardiovascular neurohormonal signaling in cardiac lineages, suggesting miR-143 modulates expression of several genes relevant to cardiovascular biology and function. [score:3]
To further explore the possible pathological relevance of miR-143 after ischemic insults in vivo, a rat mo del of myocardial infarction (MI) induced by left anterior descending coronary artery ligation was developed to examine subsequent changes in miR-143 gene expression. [score:3]
These results indicate miR-143 may play multiple roles in circulatory homeostasis by modulating the expression of a range of relevant neurohormones and/or their associated receptors. [score:3]
Previous studies have shown that miR-143 is encoded by the microRNA-143/145 host non-coding RNA gene (MIR143HG, NR_027180; also known as NCR143/145) and the expression of miR-143 is modulated by transcriptional activation of the MIR143HG promoter [17]. [score:3]
In zebrafish heart, miR-143 has been shown to be essential for cardiac chamber morphogenesis by targeting adducin 3 [21]. [score:3]
Figure 1Expression of miR-143 in human HF plasma, animal mo del and in vitro experimental platforms. [score:3]
To further determine the regulatory effects of miR-143 on NPR3 gene expression, the binding of miR-143 to NPR3 3′UTR was examined using luminescence reporter -based interaction assay. [score:3]
Luciferase reporter -based assays together with gain- and loss- of function tests provided strong evidence for the regulatory effects of miR-143 on the expression of NPR3 in cardiac cells. [score:3]
As NPs, particularly ANP and BNP, are known to exert cardio-protective effects countering the deleterious pathological consequences arising from activation of the RAAS and sympathetic nervous systems in cardiovascular disease states, our results suggest that induction of miR-143 may potentially be exploited for therapeutic manipulation of the bioactivity of circulating and /or tissue based cardioprotective NPs. [score:3]
In silico microRNA target prediction (miRWalk 2.0) identified 5 putative miR-143 binding sites within the 3′UTR of NPR3 (Table  1). [score:3]
Recently, a link between miR-143 and cardiovascular disease was suggested by observations of elevated miR-143 levels in patients with pulmonary artery hypertension (PAH), as well as in animal mo dels of PAH [17]. [score:3]
Corroborating these findings, differential expression of these genes of interest were also observed in the other cardiac cell lines after manipulation of endogenous miR-143 levels using analogs or antagomirs (Supplemental data 2). [score:3]
Student’s t-test was used to compare the relative expression of NPR3, HIF-1A and miR-143 at different time points of hypoxia treatment, MI vs sham as well as between clinical groups of heart failure patients and controls. [score:3]
This hypothesis is supported by two lines of evidence, first, the observation of diminished regulatory effect of miR-100 and miR-143 on luciferase activity in cells that harbor mutations on the MIR143HG promoter. [score:3]
Hence, studies clarifying the mechanistic actions of miR-143 in modulating NPR3 gene expression may provide an alternative or supplementary approach in developing future HF therapeutics by prolong the half-life of NPs. [score:3]
A recent genetic study on ischemic stroke (IS) discovered the association of polymorphisms within the promoter region of the MIR143HG with the risk of IS and essential hypertension 22, 23, providing additional evidence for the functional relevance of miR-143 in cardiovascular diseases. [score:3]
Subsequently, HCMa cells were transfected with miR-143 mimics or antagonists and NPR3 transcriptional expression was examined using semi-quantitative PCR. [score:3]
In agreement with observations in HF patients, miR-143 was found to be significantly up-regulated in MI rat plasma compared with sham control (Fig.   1b). [score:3]
Hence targeting of NPR3 with miR-143 may increase ANP bioactivity to augment the cardioprotective effects of NP signaling. [score:3]
Using site-directed mutagenesis of MIR143HG promoter HREs, we have shown for the first time that miR-143 gene regulation may be controlled via a hypoxia -associated signaling cascade. [score:3]
MiR-143 targets other neurohormones and associated receptors. [score:2]
Relative expression levels of miR-143 in (b) rat plasma and (c) rat left ventricular tissue at 7 days post-surgery as compared to sham controls (n = 6). [score:2]
Feedforward regulation of miR-143 and miR-100 on the MIR143HG promoter activity. [score:2]
Hence, the regulatory effect of miR-143 on NPR3 transcript levels might be only one of varied post-transcriptional modification mechanisms present in cells. [score:2]
Figure 6 Schematic diagram of hypoxia -induced transcriptional activation of MIR143HG and the proposed microRNA directed transcriptional modification by miR-143 and miR100 in cardiac cells. [score:2]
Examination of the promoter region of MIR143HG revealed three hypoxia-inducible factor binding sites (consensus motif A/GCGTG), suggesting miR-143 gene regulation might be controlled via a hypoxia -associated signaling cascade. [score:2]
Intriguingly, the promoter activity of MIR143HG was enhanced in the presence of exogenous miR-143, but was suppressed by the exogenous miR100 compared to scrambled controls (Fig.   4a). [score:2]
The negative modulation of the transcriptional activity of miR-100 host gene, MIR100HG, was also observed when treated with exogenous miR-143 (Fig.   4b). [score:1]
Elevations of miR-143 in HF and experimental platforms. [score:1]
Location Sequence alignment Transcriptional factors −1038pMIR143HGmiR-1435′- GAGCTAGCCA GCAAGAAACT A-3′3′- CUCGAUGUCA CGAAGUAGAG U-5′ ENKTF-1 −1504pMIR143HGmiR-1435′-C AGGG ACAGTGTC TG ATTCAG-3′3′-C UCGA UGUCACGA AG UAGAGU-5′ TFII-I, AR −1891pMIR143HGmiR-1435′-AG GAG ACAGTGA TCTTCACAG-3′3′-CU CGA UGUCACG AAGUAGAGU-5′ — −1900pMIR143HGmiR-1435′- GT GCTACAGA GGAGACAG TG A-3′3′- CU CGAUGUCA CGAAGUAG AG U-5′ GR-α −2064pMIR143HGmiR-1435′ -ACATGAAC GGAA TTCATCTTC-3′3′-CUCGAUGU CACG AAGUAGAGU-5′ XBP-1, NFI/CTF −2106pMIR143HGmiR-1435′-CTT CCCT AACC CAC CATCTCT-3′3′-CUC GAUG UCAC GAA GUAGAGU-5′ YY1, coup-TF1 −2171pMIR143HGmiR-1435′-TGT CAGTG GTGCTTTGGAGT A- 3′3′-CUC GAUGU CACGAAGUAGAG U-5′ NFI/CTF, SRY, GR, TCF and LEF-1 The promoter position of the nucleotide with respect to the transcription start site (defined as position 0) that is aligned to the 3′ end of each putative miR-143 binding site in MIR143HG promoter region is indicated under the “Location” column. [score:1]
The NPR3 and MIR143 promoter fragments were inserted upstream of the luciferase reporter coding sequence which is flanked downstream by the NPR 3′ UTR. [score:1]
In that study, miR-143 was found to be highly enriched in pulmonary artery smooth muscle cell (PASMC)-derived exosomes suggesting a role as a biological messenger mediating crosstalk between PASMCs and endothelial cells. [score:1]
Collectively, results from multiple platforms support the postulation that circulating miR-143 could in part originate from hypoxic tissues. [score:1]
To elucidate the involvement of hypoxia in the induction of miR-143 in HCMa, promoter activity of the alpha subunit of hypoxia-inducible factor-1 (HIF-1α) was first examined. [score:1]
Hypoxia induces transcriptional activity of miR-143 host gene in HCMa cells. [score:1]
In the current study, the effects of miR-143 and miR-100 on MIR143HG and MIR100HG promoter activities suggest possible cross talk between the two microRNAs. [score:1]
Sequence analysis of the promoter region of MIR143HG revealed the presence of several specific sequence motifs (~6–7 nucleotides) that are complementary to mature miR-143 and miR-100. [score:1]
Moreover, the elevation of miR-143 was particularly prominent in the peri-infarct zone of the left ventricle (Fig.   1c), suggesting a cardiac contribution to the increase in circulating miR-143. [score:1]
Although two HREs were previous identified in the promoter region of MIR143HG, the functional consequence of induction of miR-143 in hypoxic insults is unknown. [score:1]
Intriguingly, only HCMa and PromoCell cardiac cells responded to miR-143 antagomir treatment with increased NPR3 protein levels under normoxic condition. [score:1]
Luciferase reporter analyses showed that miR-100 and miR-143 fail to modulate the luciferase activities in cardiac cells that harbor the corresponding mutated MIR143HG promoter constructs (Fig.   4a). [score:1]
Findings from previous studies using various experimental platforms have suggested important roles for miR-143 in the cardiovascular system. [score:1]
One hundred and fifty ng psiCHECK-2-NPR3-3′UTR plasmid and 10 pmol mature microRNA-143 mimic (Ambion™) were co -transfected into HeLa cells with Lipofectamine 2000 (Life Technologies) in a 24-well plate. [score:1]
Collectively, our findings support a role for miR-143 in fine tuning NPR3 transcript levels in cardiac cells under both normoxic and hypoxic conditions. [score:1]
Figure 4Differential promoter activities of MIR143HG and MIR100HG in the presence of exogenous miR-100 or miR-143 in HCMa cells. [score:1]
Intriguingly, in addition to NPR3, four additional neurohormonal-related genes were found to interact with miR-143, including natriuretic peptide A (NPPA), natriuretic peptide C (NPPC), and nuclear receptor subfamily 3, group C, member 2 (NR3C2), and corticotropin releasing hormone receptor 2 (CRHR2) (Fig.   5a). [score:1]
In the 2-Kb MIR143HG promoter region, 7 and 4 putative binding sites were identified for miR-143 and miR-100, respectively (Tables  2 and 3). [score:1]
As shown in Fig.   2a, relative luciferase activity in cells co -transfected with psiCHECK2-NPR3 3′UTR and miR-143 mimics was significantly repressed, indicating that the seed region of miR-143 can indeed interact with the NPR3 3′UTR as predicted. [score:1]
The increase in miR-143 in HF was more pronounced in 44 reduced ejection fraction (HFREF) patients (p = 0.0017) than in 12 patients with preserved ejection fraction (HFPEF). [score:1]
None of the tested cardiac cells responded to miR-143 mimic treatments as judged from the Western blotting analyses. [score:1]
[1 to 20 of 71 sentences]
16
[+] score: 193
Other miRNAs from this paper: hsa-mir-31, hsa-mir-148a, hsa-mir-205
IGF-I treatment upregulated IGF-IR and IRS1 expression in PC-3 cells, whereas overexpression of miR-143 inhibited IGF-I -induced IGF-IR and IRS1 expression (Figure 3B and 3C). [score:12]
In agree with the results from in vitro experiments above, the expression levels of IGF-IR, IRS1 and VEGF from the tumor tissues of miR-143 expressing group were lower than those from miR-NC group (Figure 5D–5E), demonstrating that miR-143 acts as a tumor suppressor to inhibit tumor growth in PC cells, and IGF-IR and IRS1 are targets of miR-143 in vivo. [score:11]
Moreover, we demonstrated that miR-143 suppressed IGF-I -induced IGF-IR, IRS1, and VEGF expression and enhanced sensitivity to docetaxel treatment in the presence of IGF-I. Forced expression of IGF-IR and IRS1 restored miR-143 -inhibited VEGF transcriptional activation. [score:9]
We also demonstrated that IGF-I downregulated miR-143 and upregulated IGF-IR and IRSI, the well-known oncogenes in carcinogenesis. [score:7]
The results showed that miR-143 overexpression decreased VEGF transcriptional activation to 45%, whereas forced expression of IGF-IR or IRS1 alone was sufficient to rescue miR-143-inhibiting VEGF transcriptional activity. [score:7]
Consistent with the downregulation of miR-143, IGF-I treatment markedly induced expression of IGF-IR and IRS1 at both protein (Figure 2B) and mRNA levels in PC-3 and DU145 cells (Figure 2C and 2D). [score:6]
The results showed that miR-143 overexpression further increased docetaxel effect for inhibiting tumor volume and weight in vivo (Figure 6A–6C). [score:5]
To test miR-143 expression, expression of U6 was used as an endogenous control. [score:5]
Our previous studies have demonstrated that miR-143 acts as a tumor suppressor to inhibit tumor growth, angiogenesis and increases the anti-cancer effects of oxaliplatin and temozolomide [14, 15, 26]. [score:5]
IGF-IR and IRS1 were two key downstream targets of miR-143 to inhibit VEGF transcriptional activation. [score:5]
IGF-I decreased miR-143 and increased its targets IGF-IR and IRS1 expression levels. [score:5]
Moreover, miR-143 inhibited VEGF transcriptional activation through IGF-IR and IRS1, and suppressed IGF-I -induced chemoresistance to docetaxel treatment. [score:5]
Similar results were obtained using DU145 cells, showing that IGF-I increased IGF-IR, IRS1 and VEGF expression, and miR-143 attenuated protein levels of IGF-IR and IRS1 and mRNA levels of VEGF with or without IGF-I treatment (Figure 3E–3G), confirming the inhibitory effect of miR-143 on these signaling molecules. [score:5]
As expected, expression levels of VEGF in tumor tissues from miR-143 expressing group were significantly lower than those from miR-NC group (Figure 6D). [score:5]
IGF-IR and IRS1 were downstream targets of miR-143 to inhibit VEGF transcriptional activation. [score:5]
[**] P<0.01 when compared to IGF-I treatment without miR-143 overexpression; [#] P<0.05 when compared to miR-143 overexpression without IGF-I Treatment; [∆∆] P<0.01 when compared to miR-143 overexpression upon IGF-I treatment. [score:4]
IGF-IR and IRS1 have been reported as direct targets of miR-143. [score:4]
IGF-IR and IRS1 have been reported as direct targets of miR-143 [14, 15]. [score:4]
MiR-143 suppressed IGF-I -induced chemoresistance to docetaxel treatment, and decreased expression of IGF-IR and IRS1, and VEGF transcriptional activation in PC cells. [score:4]
To date, some genes including K-RAS, ELK1, IGF-IR, IRS1, Bcl-2 and ERK5 have been identified as direct targets of miR-143 [11– 17]. [score:4]
To further study the effect of miR-143 in regulating signal molecules, we found that miR-143 overexpression increased sensitivity to docetaxel treatment in PC cells in the presence of IGF-I (Figure 3A). [score:4]
Figure 6MiR-143 sensitized the PC cells to docetaxel treatment in vivo (A) PC-3 cells stably expressing miR-143 or miR-NC at 5x10 [6] cells were subcutaneously injected into both flanks of male BALB/cA nude mice. [score:3]
Finally, miR-143 inhibited tumor growth and increased sensitivity of PC to docetaxel and IGF-I treatment in vivo. [score:3]
MiR-143 sensitized PC cells to docetaxel treatment in vivoFinally, in order to study whether miR-143 sensitize PC cells to docetaxel and IGF-I treatment, PC-3 cells stably expressing miR-143 or miR-NC were subcutaneously injected into both flanks of male BALB/cA nude mice. [score:3]
The results showed that IGF-I treatment decreased miR-143 expression in PC-3 and DU145 cells. [score:3]
For plasmid transient transfection, PC-3 cells stably expressing miR-143 or negative control were co -transfected with VEGF reporter [40], pRL-TK vector plasmid without (pCMV6 vector alone) or with pCMV6-IGF-IR or pCMV6-IRS1 plasmid (OriGene Technologies, Rockville, USA) at 50 ng (1/4 dose) or 200 ng (1 dose) using Lipofectamine 2000 (Invitrogen, Carlsbad, USA). [score:3]
Finally, miR-143 inhibited tumor growth and increased sensitivity of PC to docetaxel and IGF-1 treatment in vivo. [score:3]
PC-3 cells stably expressing miR-NC or miR-143 were subcutaneously injected into male BALB/cA nude mice to study tumor growth. [score:3]
Finally, in order to study whether miR-143 sensitize PC cells to docetaxel and IGF-I treatment, PC-3 cells stably expressing miR-143 or miR-NC were subcutaneously injected into both flanks of male BALB/cA nude mice. [score:3]
Given the important role of IGF-IR and IRS1 in drug resistance [24, 25], these results suggest that miR-143 and its targets IGF-IR and IRS may be involved in IGF-I -induced docetaxel resistance in PC cells. [score:3]
Next, we found that IGF-I significantly decreased the expression levels of miR-143 in PC-3 and DU145 cells by 50% (Figure 2A). [score:3]
Figure 3 (A) PC-3 and DU145 cells stably expressed with miR-143 or miR-NC were treated with IGF-I and docetaxel as above. [score:3]
Cells stably expressing miR-143 or miR-NC at 5x10 [6] were subcutaneously injected into both flanks of male BALB/cA nude mice. [score:3]
Figure 2 (A) PC-3 cells were treated with IGF-I, then the expression of miR-143 was analyzed by RT-qPCR. [score:3]
PC-3 cells stably expressing miR-143 or negative control were co -transfected with VEGF promoter reporter, pRL-TK vector plasmid without or with IGFIR or IRS1 cDNA plasmid at 50 ng (1/4 dose) or 200 ng (1 dose). [score:3]
Among the identified tumor-suppressing miRNAs, miR-143 has been well studied in human PC [10, 32, 33]. [score:3]
Figure 5MiR-143 inhibited tumor growth in vivo (A) PC-3 cells were transduced with lentivirus carrying miR-143 or miR-NC and selected using puromycin. [score:3]
Forced expression of miR-143 also decreased IGF-I-enhancing VEGF mRNA levels in PC-3 cells (Figure 3D). [score:3]
In summary, we report here that IGF-I induces chemoresistence to docetaxel treatment in PC, and miR-143 and its targets IGF-IR and IRS1 are involved in this process. [score:3]
It has been demonstrated that miR-143 is a tumor suppressor in several types of cancer including prostate, breast and colorectal cancer [8– 10]. [score:3]
MiR-143 inhibited tumor growth in vivo. [score:2]
MiR-143 abolished IGF-I -induced IGF-IR, IRS1 expression, VEGF transcriptional activation and chemoresistance in PC cells. [score:2]
Lentivirus carrying miR-143 and miR-NC (negative control) were packaged in HEK-293T cells using lentiviral packaging kit following the manufacturer’s instructions (Open Biosystems, AL, USA). [score:1]
MiR-143 inhibited tumor growth in vivoWe next investigated the effect of miR-143 on tumor growth of PC-3 cells using nude mice. [score:1]
The results suggest that miR-143 enhances response to docetaxel treatment and reversed IGF-I -induced chemoresistance in PC cells. [score:1]
For chemoresistant effects of miR-143 in vivo, 14 days after implantation, IGF-I (200 ng/ml) and docetaxel (10 nM) were intraperitoneal injected into mice for docetaxel and IGF-I-treatment. [score:1]
To determine expression of miR-143 forward primer: GCTCGTCGAGATAAGCTGTGTG; reverse primer: GTTCGCTGAGATGAAGCACTG. [score:1]
The results demonstrate that IGF-IR and IRS1 are two key downstream mediators of miR-143 to attenuate VEGF transcriptional activation. [score:1]
Our results reveal a novel mechanism of miR-143 in docetaxel resistance in PC, which is useful for developing new mechanism -based treatment option for PC in the future. [score:1]
The results showed that miR-143 significantly attenuated tumor growth with decreased tumor size and weight (Figure 5A–5C). [score:1]
However, the role and underlying mechanism of miR-143 in mediating docetaxel resistance in PC remain elusive. [score:1]
Stable cell lines PC-3/miR-143 and PC-3/miR-NC were established by lentiviral transduction in the presence of polybrene and screened by puromycin (Sigma, MI, USA). [score:1]
Thus, these results indicate that miR-143 renders PC cells more sensitive to docetaxel treatment in vivo. [score:1]
[1 to 20 of 53 sentences]
17
[+] score: 192
It was found that knockdown EZH2 by siRNA in T24 and 5637 cells induced miR-143 expression greatly (Figure 4A and 4B); whereas ectopic expression of EZH2 in T24 cells significantly reduced miR-143 expression (Figure 4C and 4D). [score:8]
Altogether, honokiol down-regulates EZH2 expression, gets rid of the repressive H3K27me3 mark and induces miR-143 expression in human UBC cells. [score:8]
In addition, the inhibition of miR-143 could re-induce the CD44 expression, which was suppressed by EZH2 knockdown in T24 and 5637 cells (Figure 5D). [score:8]
Honokiol -induced upregulation of miR-143 was also observed (Figure 6F), consistent with the downregulation of EZH2 gene (Figure 6G and 6H). [score:7]
D., Overexpression of EZH2 suppressed miR-143 expression by qRT-PCR. [score:7]
The inhibitory effect of honokiol on UBC cells may function through suppression of EZH2 function and induction of its target, miR-143. [score:7]
UBC cells were plated in 6 cm dish overnight, transfected with 20 μM of EZH2 siRNA (5′-GUGUAUGAGUUUAGAGUCAtt-3′) or scramble control siRNA (5′-UUCUCCGAACGUGUCACGUtt-3′), miR-143 mimic and miR-143 inhibitor (RIBOBIO, Guangzhou, China) by Lipofectamine 2000 (Life Technologies) for 48 h. For forced expression of EZH2, pcDNA3-EZH2 and empty vector (pcDNA3) were transfected into UBC cells by Lipofectamine 2000, respectively. [score:5]
In T24 and 5637 cells, miR-143 inhibitor increased the cell proliferation in MTT assay (Figure 5B) and elevated colony forming numbers (Figure 5C), respectively, comparing to the anti-miR negative control (CTRL inhibitor) under the same condition of EZH2 knockdown. [score:5]
In this study, we are the first to report that honokiol suppresses EZH2/miR-143 axis to inhibit UBC cell proliferation, invasion, and stemness. [score:5]
D., The expression levels of EZH2 and CD44 proteins in T24 and 5637 bladder cancer cells with EZH2 knockdown alone or combination with miR-143 inhibitor by Western blotting assay. [score:5]
Pagliuca A et al, has confirmed that miR-143 can reduced the expression level of CD44 (one stemness marker) through targeting CD44 3′UTR [35]. [score:5]
EZH2 directly regulated miR-143 expression in UBC cells. [score:5]
E., The expression levels of CD44, Sox2, and Cyclin D1 proteins in T24 and 5637 bladder cancer cells with miR-143 overexpression. [score:5]
Hence, these data reveal that miR-143 overexpression, induced by honokiol treatment, could suppress cell proliferation and stemness maintenance. [score:5]
Whether miR-143 is required for honokiol -induced anti-cancer effects was studied using the miRNA inhibitor for miR-143 (miR-143 inhibitor. [score:5]
B., Expression levels of miR-143 by EZH2 knockdown (siEZH2) in T24 and 5637 cells, detected by qRT-PCR. [score:4]
Previous reports showed that DNA methyltransferase 3B may account for epigenetic regulation on the expression of miR-143 in endometrioid carcinomas [45]. [score:4]
Our data, for the first time, demonstrate that miR-143 is one of the direct targets of EZH2 in UBC cells. [score:4]
Several genes, such as CD44, KLF5, K-Ras and hexokinase 2, have been confirmed as the direct targets of miR-143 in cancer cells [35, 40, 41]. [score:4]
To further test whether miR-143 depletion can rescue cell growth arrest induced by EZH2 knockdown, we exploited miR-143 inhibitor to block miR-143 activity. [score:4]
EZH2 directly binds to miR-143 promoter to repress its expression. [score:4]
The upregulation of miR-143 upon honokiol treatment was further verified in 5637 and J82 cells (Figure 3B and Supplementary Figure 1D). [score:4]
We then examined if honokiol regulates miR-143 expression through EZH2. [score:4]
Downregulation of miR-143 was detected in many cancer types, including UBC [30- 33]. [score:4]
Moreover, miR-143 has been reported to inhibit cancer cells stemness in glioblastoma stem-like cells and prostate cancer cells [38, 39]. [score:3]
F. & G., The expression levels of miR-143 by qRT-PCR F., and EZH2, CD44, Sox2, and MMP9 proteins by Western blot analysis G. in T24 tumor xenografts with vehicle or honokiol (80 mg/kg) treatment. [score:3]
In this study, we have determined the effects of honokiol through the repression of oncoprotein EZH2 and induction of tumor suppressor miR-143, on the UBC cell proliferation, survival, cancer stemness maintenance and cell migration in vitro and in vivo. [score:3]
Under 9.6 μg/ml honokiol treatment, miR-143 inhibitor could partially restore the honokiol -induced cell growth arrest (Figure 3F) and reduction of colony number (Figure 3G) in T24 cells. [score:3]
Honokiol induced the expression of miR-143. [score:3]
As shown in Figure 5A, ectopically expression of EZH2 into T24 cells significantly reversed the induction of miR-143 by honokiol. [score:3]
B. - C. T24 and 5637 cells were treated with siRNA against EZH2 (siEZH2) alone or combined with miR-143 inhibitor. [score:3]
Besides, the decrease of miR-143 expression in cancer cells induces cancer cell proliferation, migration, and chemoresistance [35- 37]. [score:3]
Based on our findings, re-introduction of EZH2 or miR-143 inhibitor did not fully rescue honokiol -induced cell viability and colony formation capacities. [score:3]
Furthermore, the novel mechanism how EZH2 directly regulates miR-143 in UBC cells has also been uncovered. [score:3]
qRT-PCR was performed to examine the expression level of miR-143. [score:3]
B., Relative expression levels of miR-143 in T24 and 5637 cells treated with honokiol (9.6 μg/ml) by qRT-PCR. [score:3]
Mimic miR-143 significantly inhibited UBC cell proliferation (Figure 3C) and clonogenicity (Figure 3D). [score:3]
D., Colony formation capacity of T24 and 5637 cells with miR-143 overexpression. [score:3]
Furthermore, EZH2 overexpression represses the promoter activity of miR-143 by luciferase assay (Figure 4E). [score:2]
EZH2 gene regulated cell proliferation and clonogenicity through miR-143 in UBC cells. [score:2]
C., Cell proliferation of T24 and 5637 cells with ectopic expression of mimic miR-143 for 3 days by MTT assay. [score:2]
Transcriptional regulation mechanism of miR-143 has not been well-defined. [score:2]
F. & G., miR-143 inhibitor reversed the honokiol -induced cytotoxicity by MTT assay F. and clonogenicity G. in T24 cells. [score:2]
In chronic ulcerative colitis, with high risk for neoplastic transformation, miR-143 was significantly increased, suggesting that loss of miR-143 might be an early event during colon cancer development [34]. [score:2]
In this study, we proved that EZH2 directly bound to the miR-143 promoter, modified the trimethylation status of histone H3K27 and repress the miR-143 transcription. [score:2]
In order to test whether miR-143 is essential for bladder cancer cell proliferation and stemness, miRNA mimic for miR-143 (mimic miR-143) was transiently transfected into T24 and 5637 cells. [score:1]
Briefly, in 24-well plates T24 cells were transfected with pGL3-miR143-promoter plasmid with p3XFlag-CMV10 control vector (control group) and p3XFlag-CMV10-EZH2 (experiment group), respectively. [score:1]
F., A schematic representation of miR-143 genomic structure. [score:1]
In addition, the protein levels of CSC markers, such as CD44 and Sox2, were also decreased with the miR-143 mimic transfection (Figure 3E). [score:1]
The anticancer effect of honokiol is through induction of miR-143. [score:1]
Among them, miR-143 is the one with the highest change. [score:1]
E., showed repression of transcriptional activity of the miR-143 promoter. [score:1]
Whether miR-143 is the downstream target of EZH2 gene was investigated. [score:1]
Altogether, it suggests that ectopic restoration of miR-143 mimic might be a promising approach for cancer treatment. [score:1]
Further functional analysis indicated that EZH2/miR-143 axis could confer accelerated cell proliferation and increased cell stemness in UBC cells both in vitro and in vivo. [score:1]
[1 to 20 of 55 sentences]
18
[+] score: 174
Given our observation of significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in cells treated with 3.5 mM Pi, we used RT-qPCR to determine the expression levels of representative VSMC phenotypic marker genes - most of which are targeted by these miRNAs [8], [10]. [score:11]
These changes were evidenced by significant downregulation of miRNA-143 (miR-143) and miR-145 and concomitant upregulation of their targets and key markers in synthetic VSMCs, such as Krüppel-like factors−4 and −5 and versican. [score:9]
Elevated Pi significantly downregulates expression of miR-143 and miR-145 and upregulates miR-223. [score:9]
Furthermore, downregulation of miR-143 and miR-145 in the presence of high Pi implies the upregulation of their targets (such as KLF4, KLF5, PDGFRα and VSCN). [score:9]
In contrast, some of the synthetic phenotypic markers (such as Krüppel-like factor 4 [KLF4], KLF5, platelet derived growth factor receptor-α [PDGFR α] and versican [VSCN]) which are all targeted by miR-143 and/or miR-145 [7] were significantly upregulated; this was expected, given the observed downregulation of the corresponding miRNAs (Figure 2A). [score:9]
To complement these in vitro findings, we also observed significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in aorta samples collected from ApoE knock-out mice, which display vascular calcification. [score:8]
Evidence from our studies suggests that Pi alters cell proliferation and migration, reduces the amount of the actin cytoskeleton, downregulates miR-143 and miR-145 and upregulates miR-223. [score:7]
miR-143 and miR-145 are downregulated and miR-223 is upregulated in ApoE- KO mice. [score:7]
There was significant downregulation of miR-143 and miR-145 and concomitant upregulation of miR-223 in 20-week-old ApoE- KO mice. [score:7]
Here, we showed that high Pi treatment results into downregulation of SMαA and MYO, with a concomitant downregulation of miR-143 and miR-145. [score:7]
Our in vivo results in a well-established murine mo del thus reflected our in vitro findings, i. e. downregulation of miR-143 and miR-145 and upregulation of miR-223 in the presence of calcium-Pi deposits. [score:7]
The expression of miR-143 and miR-145 was also downregulated in Pi -treated cells. [score:6]
These events affected downstream processes by reducing the size of the actin cytoskeleton, disturbing cell morphology, upregulating miR-143 and miR-145 targets and, ultimately, leading to increased calcification and a greater VSMC migration rate. [score:6]
Additionally, we normalized the expression of miR-223 to the expression of the VSMC-specific miR-143 (Figure S3). [score:5]
The latter authors also determined that expression levels of miR-143 and miR-145 are low in the aortas of apolipoprotein E gene knockout (ApoE- KO) mouse. [score:4]
MiR-143 and miR-145 (the most extensively studied species) have been correlated with human cardiovascular diseases, since VSMC maintenance and vascular homeostasis are altered in mir-143 and mir-145 knock-out (KO) mice [8]. [score:4]
We found significant downregulation of the vascular miRNAs miR-143 and miR-145 and a number of contractile phenotypic marker genes, such as MYO and SMαA [7]– [10]. [score:4]
Similarly, PDGFRα is a direct target of miR-143 and is one of the factors required for VSMC migration [32]. [score:4]
Here, we expanded on Elia et al. results by finding that downregulation of miR-143 and miR-145 in mouse aortas was not detected in younger mice but became significant in 20-week-old mice (which also display vascular calcification [23]). [score:4]
Interestingly, we also found that miR-143 and miR-145 are downregulated in vivo in the aortas of ApoE- KO mice. [score:4]
MiR-143 and miR-145 negatively regulate the expression of many genes that are specific for the VSMC synthetic phenotype [7], [10]. [score:4]
Figure S7 Effect of pre-miR-223 and anti-miR-223 on expression of miR-143 and miR-223 in VSMCs. [score:3]
Vascular smooth muscle cells transfected with pre-miR (over -expression) and anti-miR (knock-down) specific for miR-143 and miR-223 were compared with a scrambled RNA control (Figure 3A). [score:3]
Accordingly, the expression of miR-143 was unaffected in either of the conditions. [score:3]
RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
There was a significant downregulation (20–25%) of both miR-143 and miR-145 in 3.5 mM Pi treated cells, when compared with control cells (Figure 1E). [score:3]
Expression of miR-143, miR-145 and miR-223 in wild-type and ApoE- KO mice. [score:3]
0047807.g006 Figure 6 RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
Figure S3 Expression of miR-223 relative to miR-143 in control or Pi treated VSMCs. [score:3]
Recently, the chondroitin sulfate proteoglycan VSCN was identified as a new target for miR-143 [31]. [score:3]
As observed with VSMCs in culture, the expression levels of both miR-143 and miR-145 were significantly lower in ApoE- KO mice than in WT mice. [score:3]
The relative expression of miR-223 compared to miR-143 at basal level, i. e. in control cells is approximately 1000 times lower than the VSMC specific miR-143. [score:2]
We thus investigated the expression of miRNAs miR-143 and miR-145 in the presence of high Pi. [score:1]
Anti-miR-143 treatment did not affect motility, whereas pre-miR-143 treatment was associated with moderately (20%) but significantly greater migration than in control experiments. [score:1]
Boettger and colleagues also demonstrated that the mouse mir-143/145 cluster is necessary for acquisition of the contractile VSMC phenotype [9]. [score:1]
In our in vitro and in vivo mo dels, we confirmed the previously described impacts of miR-143 and miR-145 on normal and pathological cardiovascular events. [score:1]
Transfection of pre-miR-143/223 or anti-miR-143/223. [score:1]
Lastly, we sought to study the fate of miR-143, miR-145 and miR-223 under in vivo vascular calcification conditions. [score:1]
Our results suggest that miR-143, miR-145 and miR-223 are potential biomarkers of vascular calcification. [score:1]
[1 to 20 of 39 sentences]
19
[+] score: 172
Other miRNAs from this paper: hsa-mir-18a
In addition to being passed from smooth muscle cells to endothelial cells, miR-143 was also shuttled in extracellular vesicles derived from endothelial cells, and miR-143 regulated the expression of differentiation-related target genes in the smooth muscle cells 34. [score:6]
For further confirmation of whether miR-143 regulates the permeability of endothelial cells by targeting PUMA, HBMECs were transduced with PUMA siRNA or PUMA OE lentivirus and assessed for the expression of TJPs. [score:6]
Our study provides new insight into the role of miR-143 in the regulation of BBB integrity by demonstrating its targeting of PUMA and the subsequent distinct downstream activation of the p53 and NF-κB pathways and the altered expression of TJPs in HBMECs. [score:6]
Mechanistically, our study provides new insight into the role of miR-143 in the regulation of BBB integrity by demonstrating its targeting of PUMA and the subsequent distinct downstream activation of the p53 and NF-κB pathways and the altered expression of TJPs in endothelial cells (Fig. 8k). [score:6]
To our knowledge, this is the first study to provide direct evidence of the regulatory role of STAT3 in the expression of miR-143. [score:5]
Treating HBMECs with methamphetamine decreased the expression of PUMA (Fig. 4c), which was inversely correlated with the expression of miR-143. [score:5]
The regulation of miR-143/PUMA expression may be a therapeutic intervention to help regulate BBB integrity in the context of drug abuse. [score:5]
Another novel finding of this study was that PUMA, a newly identified target of miR-143, mediated the expression of TJPs in endothelial cells. [score:5]
Therefore, the PUMA expressed from the construct was not targeted by miR-143. [score:5]
A previous study also demonstrated that miR-143 and STAT3 regulated the expression of hexokinase 2 in breast cancer cells 50. [score:4]
miR-143 regulated the permeability of endothelial cells by targeting PUMA. [score:4]
The extent of miR-143 overexpression and knockdown was assessed by real time-PCR (Supplementary Fig. S3). [score:4]
Specific regulation of miR-143/PUMA could be a potential therapeutic target for the treatment of BBB damage. [score:4]
Methamphetamine administration caused BBB damage (Fig. 1a) and concomitant up-regulation of mature miR-143 in isolated microvessels (Fig. 1c) and in tissue from various brain regions, such as the hippocampus, cortex, striatum and midbrain (Fig. 1b). [score:4]
Mechanistically, methamphetamine mediated the up-regulation of miR-143 via the sigma-1 receptor with sequential activation of mitogen-activated protein kinases (MAPKs) and the phosphatidylinositol-3′ kinase (PI3K)/Akt and STAT3 pathways. [score:4]
miR-143 induced the activation of the NF-κB and p53 transcription factors by targeting PUMA. [score:3]
Our study indicated that methamphetamine administration significantly decreased the expression of tight junction proteins (TJPs) in the cortex and hippocampus in the anti-miR-control group, and this effect was significantly ameliorated in the anti-miR-143-microinjected mice (Fig. 2d,e) Silencing miR-143 ameliorated the increased permeability of the BBB and endothelial cells in vitroWe next sought to explore the role of miR-143 in methamphetamine -mediated endothelial permeability in vitro. [score:3]
The transduction of HBMECs with miR-143 decreased the expression of TJPs (Fig. 3c), an effect that was accompanied by a concomitant increase in endothelial permeability (Fig. 3d). [score:3]
In this study, we demonstrate that methamphetamine treatment increased the expression of miR-143 both in vitro and in vivo, providing a biological basis for the interaction between methamphetamine and miR-143. [score:3]
Methamphetamine treatment increased the expression of miR-143-3p (Fig. 4a) but not miR-143-5p (Supplementary Fig. S4a); this result was further confirmed by FISH (Fig. 4b) in HBMECs. [score:3]
Our study indicated that methamphetamine administration significantly decreased the expression of tight junction proteins (TJPs) in the cortex and hippocampus in the anti-miR-control group, and this effect was significantly ameliorated in the anti-miR-143-microinjected mice (Fig. 2d,e) We next sought to explore the role of miR-143 in methamphetamine -mediated endothelial permeability in vitro. [score:3]
In these HBMECs, miR-143 failed to decrease the expression of TJPs (Fig. 5e). [score:3]
To determine whether the miR-143 -mediated functional effects specifically depended on PUMA suppression, HBMECs were transduced with a PUMA OE construct that lacked the UTR (PUMA-Δ3′ UTR). [score:3]
The sigma-1 receptor/MAPK/STAT3 pathway was involved in the methamphetamine -induced expression of miR-143. [score:3]
Consistent with this finding, transducing the HBMECs with anti-miR-143 enhanced the expression of TJPs (Fig. 5f); this effect was ameliorated in cells that were co-transduced with PUMA siRNA. [score:3]
PUMA was predicted to have a conserved miR-143 binding site within its 3′-untranslated region (UTR) in most species. [score:3]
Consistently, in HBMECs, miR-143 decreased PUMA expression, whereas anti-miR-143 increased it, at both the mRNA (Fig. 4d) and protein (Fig. 4e) levels. [score:3]
Methamphetamine treatment increased the binding of STAT3 to the miR-143 promoter in HBMECs (Fig. 8h), and the methamphetamine -mediated induction of miR-143 was significantly attenuated by pretreating the cells with the known STAT3 inhibitor Stattic (Fig. 8i); this result was further confirmed using STAT3 siRNA (Fig. 8j). [score:3]
In addition to STAT3, Kruppel-like factor 2 is involved in the expression of miR-143 in endothelial cells 34. [score:3]
The role of PUMA, which is the target of miR-143, in BBB integrity has remained elusive; therefore, we examined the role of PUMA in BBB integrity. [score:3]
The σ-1R/MAPK/STAT3 pathway was involved in the methamphetamine -induced expression of miR-143. [score:3]
p53) in the miR-143 -mediated expression of TJPs. [score:3]
Moreover, Climent et al. demonstrated that miR-143 provides a means of communication between smooth muscle cells and endothelial cells to regulate the vessel stabilization properties of endothelial cells 33. [score:2]
Methamphetamine regulates miR-143 in the brain and in HBMECs. [score:2]
miR-143 is regulated by methamphetamine in the brain and in HBMECs. [score:2]
The methamphetamine treatment increased the BBB permeability in WT mice but not in miR-143 [+/−] mice, demonstrating the role of miR-143 in regulating methamphetamine -mediated BBB damage in vivo. [score:2]
The transcription factor STAT3 has emerged as a major regulatory transcription factor for miR-143, as predicted. [score:2]
Moreover, fluorescence in situ hybridization (FISH) revealed that methamphetamine treatment increased the miR-143 expression in the isolated microvessels compared with that in the control group (Fig. 1d). [score:2]
Taken together, these results indicate that miR-143/PUMA mediates a regulatory pathway that is critical for the maintenance of BBB integrity. [score:2]
The miR-143 lentivirus, anti-miR-143 lentivirus and PUMA siRNA lentivirus were purchased from HANBIO (Shanghai, China). [score:1]
Methamphetamine treatment increased the BBB permeability in the anti-miR-control -injected group (Fig. 2b), but this effect was significantly ameliorated in the anti-miR-143 -injected group. [score:1]
To validate the role of miR-143 in vivo, an anti-miR-143-RFP lentivirus was microinjected into the left lateral ventricle of mice, as illustrated in Fig. 2a. [score:1]
To further confirm the role of PUMA in the amelioration of BBB damage by anti-miR-143, PUMA KO mice were microinjected with anti-miR-143. [score:1]
We next examined the role of miR-143 in the methamphetamine -induced increase in endothelial cell permeability. [score:1]
For microinjection, 24 eight-week-old C57BL/6N mice were divided into the following four groups (n = 6 in each group; male): (1) saline+anti-miR-control; (2) methamphetamine+anti-miR-control; (3) saline+anti-miR-143; and (4) methamphetamine+anti-miR-143. [score:1]
Next, we sought to identify the intracellular signaling pathways involved in the processes mediated by miR-143/PUMA. [score:1]
Under natural chromatin conditions, STAT3 binds to the miR-143 promoter (Fig. 8g). [score:1]
Methamphetamine significantly increased the number of monocytes in WT mice but not in miR-143 [+/−] mice (Fig. 1e,f). [score:1]
The use of pharmacological and genetic approaches to further dissect the signaling pathways involved in the methamphetamine -mediated induction of miR-143 revealed the activation of σ-1R and the downstream STAT3 pathway. [score:1]
The in vivo importance of these findings was further corroborated in mice: we demonstrated that methamphetamine increased the permeability of the BBB in WT mice but not miR-143 [+/−] mice. [score:1]
Silencing miR-143 ameliorated the increased permeability of the BBB and endothelial cells in vivoTo validate the role of miR-143 in vivo, an anti-miR-143-RFP lentivirus was microinjected into the left lateral ventricle of mice, as illustrated in Fig. 2a. [score:1]
To further confirm the role of miR-143 in methamphetamine -induced increase in BBB permeability, we examined monocyte migration from the blood in miR-143 [+/−] mice using in vivo two-photon laser scanning microscopy (TPLSM). [score:1]
Putative STAT3 binding sites are predicted upstream of the miR-143 promoter sequence, and methamphetamine treatment increased the nuclear translocation of STAT3 (Fig. 8e). [score:1]
The methamphetamine -mediated induction of miR-143 was significantly attenuated in cells that were pretreated with the known σ -1R antagonist BD1047 (Fig. 8a) and those that were transfected with σ -1R siRNA (Fig. 8b). [score:1]
As shown in Fig. 4i, microinjection of anti-miR-143 significantly decreased the BBB permeability in WT mice; however, anti-miR-143 failed to affect the BBB permeability in PUMA KO mice, suggesting a role of PUMA in the anti-miR-143 -mediated protection of BBB integrity in vivo. [score:1]
Consistent with previous findings regarding the role of miR-143 in endothelial cells 32, miR-143 was involved in the response of endothelial cells to shear stress. [score:1]
Transducing cells with miR-143 decreased the translocation of NF-κB and p53 into the nucleus, whereas transducing cells with anti-miR-143 increased the translocation of NF-κB and p53 into the nucleus (Fig. 6a). [score:1]
Effect of miR-143 on the permeability of endothelial cells in vitro. [score:1]
the miR-143/Vector group or the anti-miR-143/siRNA-Con group using one-way ANOVA followed by the Holm-Sidak test. [score:1]
The transduction of cells with the anti-miR-143 lentivirus reduced the methamphetamine -mediated increase in endothelial permeability (Fig. 3g). [score:1]
Representative images following microinjection of anti-miR-143 into the lateral ventricle. [score:1]
Reciprocally, the transduction of cells with the miR-143 precursor had the opposite effects; the transduction of cells with the miR-143 lentivirus decreased the translocation of NF-κB and p53 into the nucleus, and this effect was ameliorated in HBMECs that were co-transduced with the PUMA OE lentivirus (Fig. 6d). [score:1]
the anti-miR-143/siRNA-Con group or the miR-143/Vector group using one-way ANOVA followed by the Holm-Sidak test. [score:1]
The transduction of cells with the anti-miR-143 lentivirus increased the translocation of NF-κB and p53 into the nucleus, and this effect was ameliorated in cells that were co-transduced with the PUMA siRNA lentivirus (Fig. 6c). [score:1]
Silencing miR-143 ameliorated the increased permeability of the BBB and endothelial cells in vivo. [score:1]
Silencing miR-143 ameliorated the increased permeability of the BBB and endothelial cells in vitro. [score:1]
Silencing miR-143 in a genetic animal mo del or via an anti-miR-143 lentivirus ameliorated the BBB damage induced by methamphetamine. [score:1]
Red, miR-143; blue, DAPI. [score:1]
Two weeks after the lentivirus injection, the animals in the anti-control and anti-miR-143 lentivirus groups were intraperitoneally injected with either saline or methamphetamine (1.5 mg/kg, 4.5 mg/kg, 7.5 mg/kg, and 10 mg/kg) every day for a total of eight days according to the previously described dosing schedule. [score:1]
How to cite this article: Bai, Y. et al. Silencing microRNA-143 protects the integrity of the blood-brain barrier: implications for methamphetamine abuse. [score:1]
We constructed an miR-143-GFP lentivirus and an anti-miR-143-RFP lentivirus (Supplementary Fig. S4b). [score:1]
We next wanted to investigate the mechanism(s) underlying the expression of miR-143. [score:1]
Reciprocally, transducing HBMECs with anti-miRNA-143 had the opposite effect (Fig. 3e,f). [score:1]
[1 to 20 of 73 sentences]
20
[+] score: 167
Other miRNAs from this paper: hsa-mir-145, hsa-mir-664a
Further, high HER3 expression could rescue the cells from the inhibitory effects of miR-143 and miR-145, underlining the importance of the cellular context and active signaling pathways on the net effect of miRNA up- or downregulation. [score:8]
Further, the stimulation of proliferation and, at the same time, inhibition of invasion, argue for several regulated target genes which could have opposing effects in tumorigenesis, as indeed demonstrated by the target genes for miR-143 listed in S1 Table. [score:8]
Downregulation of miR-143 appears to contribute to the estradiol -mediated upregulation of bcl-2 and survivin. [score:7]
Relative to MCF-10A, endogenous expression levels of miR-143 and miR-145 were downregulated in all BC cell lines. [score:6]
Estradiol has been published to downregulate expression of miR-143 in an ER -dependent manner in the ER+ cell line MCF7, whilst having no effect on miRNA levels in the TN cell line MDA-MB-231 [43]. [score:6]
In our study, the expression of both miR-143 and miR-145 was elevated in the least aggressive tumor types, which is in line with the tumor suppressor functions described for these miRNAs in previous publications [15– 19, 43]. [score:5]
In this study, we used 5 nM miR-145-5p target probe, 10 nM miR-143-3p target probe, 10 nM scramble miR negative control probe and 0.5 nM U6 positive control probe. [score:5]
Noteworthy, the coexpression of miR-143 and miR-145 led to inhibition of proliferation and invasion, which is also described in previous publications [52– 55]. [score:5]
Endogenous levels of miR-143 and miR-145 in the selected cell lines were quantified relative to the stably expressed reference snRNA RNU6 using real-time PCR and the miScript SYBR® Green PCR Kit (cat. [score:3]
Using microarray and PCR, we found a significant downregulation of miR-143 and miR-145 in malignant tumors compared to normal tissue, which is in line with previously published studies in breast cancer [29– 31] and other tissues, especially colorectal carcinomas [32]. [score:3]
ISH expression of miR-143 and miR-145 in benign and malignant breast tissue. [score:3]
Stromal ISH expression of miR-143 and miR-145 was also correlated (p = 0.049) (Table 6). [score:3]
Means plot for the expression of miR-143 (panel A) and miR-145 (panel B) according to molecular subgroup, using PCR. [score:3]
MiR-143 and miR-145 constitute a miRNA cluster and appear to have tumor suppressor functions in a variety of organ systems, both as individual miRNAs and as a cluster [15– 24]. [score:3]
Cotransfection of miR-143 and miR-145 results in a tumor suppressor phenotype. [score:3]
Scatterplot of miR-143 and miR-145 expression in breast tumor tissue. [score:3]
Of note, microarray- and PCR -based expression levels were significantly correlated for both miR-143 (r = 0.60, p<0.001) and miR-145 (r = 0.72, p<0.001). [score:3]
miR-143 and miR-145 inhibits invasion in vitro. [score:3]
Cotransfection of miR-143 and miR-145 had an inhibitory effect on invasion, in line with the observations made for each individual miRNA (Fig 2D). [score:3]
Relative expression of miR-143 and miR-145 in breast cancer. [score:3]
Expression of miR-143 and miR-145 in benign and malignant breast tissue and according to histopathological parameters: microarray and PCR-results. [score:3]
There were no significant differences in miR-143 and miR-145 expression between tumor groups stratified according to tumor size or lymph node metastases. [score:3]
The means plot for miR-143 and miR-145 in Fig 6A and 6B, respectively, illustrates the distribution of expression across molecular subtypes. [score:3]
As in benign tissue, miR-143 was expressed in the cytoplasm of tumor cells and stromal fibroblasts. [score:3]
Additionally, the expression levels of miR-143 and miR-145 were highly correlated (R = 0.88, p<0.001, Fig 3). [score:3]
S1 and S2 Tables present the validated mRNA targets for miR-143 and miR-145, based on searches using the online database miRTarBase [58]. [score:3]
The endogenous expression of miR-143 and miR-145 in the studied BC cell lines was quantified relative to the non-cancerous cell line MCF-10A (Fig 1). [score:3]
Interestingly, we found that miR-143 had a significant inhibitory effect on cell invasion in all cell lines. [score:3]
However, Dimitrova et al. describe stromal expression of the miR-143/145 cluster as a stimulator of neoangiogenesis, and a supporter of tumor expansion in lung [56]. [score:3]
0186658.g006 Fig 6 Means plot for the expression of miR-143 (panel A) and miR-145 (panel B) according to molecular subgroup, using PCR. [score:3]
In contrast to the cytoplasmatic staining pattern for miR-143, miR-145 was expressed in the nuclei and with the strongest staining intensity in the myoepithelial cells in benign breast tissue (Fig 7). [score:3]
miR-143 and miR-145 inhibits invasion in vitroThe cells’ invasive abilities were studied using a Boyden chamber assay. [score:2]
The results in this study, including the differential effects in vitro of miR-143 in BC cell lines, the effects of cotransfecting miR-143 and miR-145, and the nuclear enrichment of miR-145 in breast tissue, underline the complexity of miRNA regulation and function. [score:2]
List of miR-143 target genes verified by reporter assay and western blot. [score:2]
All cell lines were transiently transfected with 100 nM hsa-miR-143-3p Pre-miR™ miRNA Precursor (cat. [score:1]
Proliferation and invasion were assessed after transfecting BC cell lines with either miR-143, miR-145, or miR-143 and miR-145 in combination. [score:1]
Synergistic effects of miR-143 and miR-145 on BC cell proliferation have been demonstrated in MCF7 and MBA-MD-231 cells and in a mouse mo del using MCF7 xenografts [53]. [score:1]
Both miR-143 and miR-145 had a profound effect on cell invasion (Fig 2D). [score:1]
The BC cell lines were simultaneously transfected with 50 nM of both miR-143 and miR-145. [score:1]
Endogenous expression of miR-143 and miR-145 in breast cancer cell lines compared to the non-cancerous breast cell line MCF-10A and in breast cancer tumors compared to benign breast tissue, analyzed using PCR or microarray technology. [score:1]
0186658.g003 Fig 3 Scatterplot of miR-143 and miR-145 expression in tumor tissue, measured by PCR. [score:1]
The HER2+ cell line, however, did not demonstrate any significant change in proliferation when transfected with miR-143 (Fig 2B). [score:1]
0186658.g002 Fig 2 on BC cell lines after transfection with miR-143 and/or miR-145. [score:1]
0186658.g001 Fig 1 Endogenous expression of miR-143 and miR-145 in breast cancer cell lines compared to the non-cancerous breast cell line MCF-10A and in breast cancer tumors compared to benign breast tissue, analyzed using PCR or microarray technology. [score:1]
This finding is in contrast to the majority of studies regarding the effect of miR-143 on proliferation [15– 19]. [score:1]
In situ hybridizationIn order to study the cellular and subcellular location of miR-143 and miR-145 in benign and malignant breast tissue, we analyzed the miRNA in situ hybridization (ISH) staining in full histological slides of 16 tumors with adjacent normal tissue. [score:1]
ER+ MCF7 cells (panel A), HER2+ SK-BR-3 cells (panel B) and triple negative MDA-MB-231 cells (panel C) were transfected with miR-143 mimic, miR-145 mimic, either alone or in combination, or with control mimic, and cell proliferation monitored in real time using xCelligence. [score:1]
*** signifies P<0.001 using one-way ANOVA and the Benjamini & Hochberg correction comparing miR-143 and/or miR-145 transfected cells to controls. [score:1]
Correlations of miR-143 and miR-145 in situ hybridization staining intensities in tumor and stromal cells. [score:1]
This study characterizes the functional properties and expression pattern of the miRNA cluster miR-143 and miR-145 in BC. [score:1]
In our in vitro experiments, miR-143 was revealed to increase the proliferative capacity of the ER+ cell line MCF7 and the TN cell line MDA-MB-231, whilst having no significant effect on proliferation in the HER2+ cell line SK-BR-3. The effect was pronounced (Fig 2A and 2C), and reproduced in three biological replicates. [score:1]
At present, we do not have enough information to offer any explanatory mo del for the effects demonstrated by miR-143 in our proliferation studies. [score:1]
The mean staining intensity for miR-143 in tumor cells was 2.17 and in stromal fibroblasts 2.06 whereas mean miR-145 staining intensity was 2.10 in tumor cells and 1.69 in stromal fibroblasts. [score:1]
The proliferation promoting effects observed for miR-143 in the ER+ cell line and the TN cell line were cancelled by the simultaneous transfection of miR-145 (Fig 2A and 2C). [score:1]
Means plot of miR-143 and miR-145 in breast tumors according to molecular subtype. [score:1]
The cellular and subcellular expression of miR-143 and miR-145 in benign and malignant breast tissue was evaluated in full histological slides of 16 tumors with adjacent benign breast tissue. [score:1]
This study evaluates the miR-143 and miR-145 expression profile in an unselected cohort of BC within the Norwegian Women and Cancer Study (NOWAC) postgenome cohort [25]. [score:1]
MiR-143 and miR-145 in situ hybridization staining intensities in tumor and stromal cells. [score:1]
MiR-143 and miR-145 in situ hybridization staining pattern in breast tissue. [score:1]
miR-143 promotes proliferation in vitroThe proliferation rate of the BC cell lines was assessed using the real-time monitoring system xCelligence, fitted with a proliferation plate. [score:1]
In order to study the cellular and subcellular location of miR-143 and miR-145 in benign and malignant breast tissue, we analyzed the miRNA in situ hybridization (ISH) staining in full histological slides of 16 tumors with adjacent normal tissue. [score:1]
The experiments were performed by introducing miR-143 mimic or miR-145 mimic, alone or in combination, alongside a miRNA negative control into various BC cell lines. [score:1]
Using Spearman’s rho, the staining intensity in tumor cells and stromal fibroblasts was found to be positively correlated for both miR-143 (p = 0.006) and miR-145 (p = 0.006). [score:1]
Functional studies on miR-143 and miR-145 in vitro. [score:1]
Interestingly, transfection of miR-143 led to increased proliferation in the ER+ cell line MCF7 and the TN cell line MDA-MB-231 (Fig 2A and 2C). [score:1]
Functional studies on BC cell lines after transfection with miR-143 and/or miR-145. [score:1]
miR-143 promotes proliferation in vitro. [score:1]
Illustrative examples of miR-143 and miR-145 in situ hybridization staining pattern in benign breast tissue (x400 magnification) and adjacent benign and malignant breast tissue (x200 magnification). [score:1]
Recently, Donnarumma et al. reported that the levels of miR-143 are increased in exosomes from cancer associated fibroblasts, and could promote breast cancer progression through exosome -mediated delivery of miRNA to breast cancer cells [57]. [score:1]
There was higher expression of both miR-143 and miR-145 in low and intermediate grade tumors compared to the high grade tumors, as shown in Tables 2 and 3 and Fig 4, and in ER -positive compared to ER -negative tumors (Table 4). [score:1]
In situ hybridization staining of miR-143 and miR-145 in tumor cells (panel A-C and panel D-F, respectively) and stromal fibroblasts (panel G-I and panel J-L, respectively) with examples of staining intensities corresponding to score weak, moderate and strong. [score:1]
All slides were denaturated for 8 min at 90°C, hybridization with probes took place for 60 min at 50°C for miR-145, 55°C for miR-143, 57°C for scramble miR and 55°C for U6. [score:1]
Tumor cells and stromal fibroblasts were scored for staining intensity as illustrated in Fig 8. Noteworthy, all 16 tumors had positive staining for both miR-143 and miR-145 in both tumor cells and fibroblasts. [score:1]
The potential functional role of miR-143 and miR-145 in breast cancer tumorigenesis was explored by a series of in vitro experiments. [score:1]
on miR-143 and miR-145 in vitroThe potential functional role of miR-143 and miR-145 in breast cancer tumorigenesis was explored by a series of in vitro experiments. [score:1]
The proliferation of cells cotransfected with miR-143 and miR-145 was dramatically reduced in all three cell lines and was similar to the proliferation pattern of cells transfected with miR-145 alone (Fig 2A–2C). [score:1]
[1 to 20 of 76 sentences]
21
[+] score: 160
In this study, the overexpression of miR-143 can suppress the expression of IL-13Rα1 in mast cells, which may be stimulated by combined IL-13/IL-4. This ultimately translates into minimizing the allergic response. [score:9]
This indicates that IL-13Rα1 is a target gene of miR-143 in HMC-1 cells, and that miR-143 can significantly inhibit the target gene IL-13Rα1 expression in HMC-1 cells. [score:9]
The results indicated there was significantly reduced expression of IL-13Rα1 when miR-143 is overexpressed in HMC-1 cells, with an inhibition efficiency of 71%. [score:7]
In this study, we also identified IL-13Rα1 as a target gene of miR-143, and that it was inhibited by overexpression of miR-143 in mast cells. [score:7]
The cumulative data for mRNA expression of IL-13Rα1 are presented in Figure 4. Compared with the control, IL-13Rα1 mRNA expression was significantly downregulated in miR-143 transfected cells (p > 0.05). [score:7]
Pleiotropic cytokines, IFN-beta and IFN-gamma, could stimulate miR-143 expression of smooth muscle cell in airways, contributing to airway allergic diseases such as asthma [13]. [score:5]
RNA Isolation and Reverse Transcription and Polymerase Chain Reaction (RT-PCR) for miR-143-Target Gene Expression. [score:5]
Moreover, the sustained expression of RFP in HMC-1 also showed that there was long-term overexpression of miR-143 in cells. [score:5]
The results indicate that the miR-143 lentiviral vector was successfully transfected into HMC-1 cells, and that it expressed the relevant target genes in a stable manner. [score:5]
2.3. miR-143 Suppresses IL-13Rα1 Expression in HMC-1 Cells. [score:5]
As shown in Figure 5, the over -expression of miR-143 caused reduction in IL-13Rα1 protein expression in HMC-1 cells. [score:5]
de/) to predict miR-143 target genes, and found that the IL-13Rα1 gene 3′ UTR had 15 sequential pairing bases with miR-143 (Table 1), which indicates that IL-13Rα1, known to play an important role in allergy, may be a potential target of miR-143. [score:5]
To determine the expression of the target gene of miR-143, IL-13Rα1, we performed fluorescent quantitative real time RT-PCR assay. [score:4]
To study the mechanism of miR-143 regulation in allergic inflammation, we investigated the target genes of miR-143 through the TargetScan procedure (http://genes. [score:4]
In this study, the overexpression of miR-143 was chosen for exploring the regulation of miR-143 on genes of inflammatory cytokines in allergic inflammation. [score:4]
Western Blotting Results of IL-13Rα1 Downregulation in miR-143 Transfected HMC-1 Cells. [score:4]
When compared with normal tissue, microRNA-143 (miR-143) was the most significantly downregulated miRNA in nasal mucosa of tissues exhibiting AR. [score:3]
As shown in Figure 4, the expression of IL-13Rα1 in the miR-143 transfected HMC-1 cells group was reported to be 3.41; this value is relative to the internal reference 18sRNA. [score:3]
To investigate this, we used mast cells, which are an important AR target cell and built the miR-143 overexpression system. [score:3]
It was found that miR-143 may target multiple genes, including NOVA1, ZIC3 and MARCKS etc. [score:3]
With the help of Lectivirus vector, we could determine the gene expression plasmid, the (pLenO-RIP + miR-143), which also containing the red fluorescent protein (RFP). [score:3]
The results indicated that the miR-143 lentiviral expression vector was successfully built which could be perfomed for the next step. [score:3]
This is the first study to illustrate that the allergic reaction in mast cells was attributable to inhibition of IL-13Rα1 by miR-143. [score:3]
miR-143 caused allergic inflammation, which might be associated with the target gene IL-13α1. [score:3]
Using the miR-143 target sequence obtained from Ensembl, we designed its pre-miRNA sequence (GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAG UCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC). [score:3]
Thomas Boettger’s study revealed that the expression of miR-143, which formed a small cluster on mouse chromosome 18, strongly correlated with the number of SMCs. [score:3]
It was found that expression of miR-143 in smooth muscle cells of airways triggers allergic conditions such as asthma [4]. [score:3]
Construction of miR-143 Target Sequence-Luciferase Reporter Plasmid. [score:3]
The target genes of miR-143 were screened using miRanda (http://www. [score:3]
Vascular smooth muscle cells (VSMCs) from miR-143 -deficient mice were locked in the synthetic state, which incapacitated their contractile abilities and favored neo-intimal lesion development, thereby revealing an unanticipated role of miR-143 in the regulation of VSMC phenotype [12]. [score:3]
Western blot analysis showed that the expression of IL-13Rα1 protein in the miR-143 group was much lower than in the negative and blank control groups (p < 0.05 for each). [score:3]
We successfully constructed the lentiviral miR-143 overexpression vector and transfected it into human mast cell. [score:3]
The high expression of RFP indicates the high efficiency of miR-143 transfection. [score:3]
Thus, the role of miR-143 in allergic response may be associated with regulation of IL-13 pathway. [score:2]
However, we have not yet been able to understand how miR-143 regulates allergic inflammation in upper airways such as AR. [score:2]
Furthermore, some authors showed that miR-143 is a critical regulator of cell cycle activity in stem cells [15]. [score:2]
It has been reported that miR-143 plays an important role in regulating smooth muscle cell (SMC) fate and plasticity. [score:2]
Construction and Identification of miR-143 pLenO-RIP Plasmid. [score:1]
The production of lentiviral vector pLenO-RIP + miR-143 was performed by simultaneously delivering lentiviral transfer vectors and packaging plasmids (pRsv-REV, pMDlg-pRRE and pMD2. [score:1]
All these findings indicate that miR-143 may play important roles in triggering allergic inflammation. [score:1]
Among them, miR-143 was found to be associated with allergic rhinitis in our research [6], but the mechanism of its action was unclear. [score:1]
Recently it was discovered that miR-143 has tumor suppressor activity [16], but the role of miR-143 in allergic inflammation, especially in functional cells, such as mast cell, EOS, and T cell has been little investigated. [score:1]
In order to study this mechanism, we determined the target genes of miR-143 and investigated related mechanisms. [score:1]
The aim of this study was thus to identify the effects of miR-143 on IL-13Rα1 in mast cells to further an understanding of the molecular mechanisms of allergic inflammation. [score:1]
Some studies also demonstrated that miR-143 deficiency is associated not only with altered vasocontraction but also with impaired vasodilation [14]. [score:1]
Forty-eight hours after developing HMC-1 cell culture, the lentiviral vector of miR-143 was transfected into cell culture, and RFP blank lentivirus was used as the control. [score:1]
To eliminate the interference of transfection reagent, cell lines were seeded into 24-well plates and set up as follows: (a) miR-143 mimics group, in which the cells were transfected with lentivirus at a multiplicity of infection (MOI) of 10 for 48 h; (b) negative control group, in which the cells were subjected to transfection with lentiviral without miR-143; and (c) blank control group, in which the HMC-1 cells were cultured routinely without any treatment. [score:1]
The precursor sequence of miR-143 was synthesized directly, and then this sequence amplified genes using the primer extension method. [score:1]
[1 to 20 of 48 sentences]
22
[+] score: 151
The level of UCC was upregulated in CRC tissues based on qRT-PCR, whereas miR-143 expression was downregulated in the same tumor specimens (Figure 4b). [score:9]
Overexpressing miR-143 significantly inhibited UCC expression, whereas silencing UCC did not affect miR-143 expression (Figure 6c). [score:9]
23, 24, 25, 26, 27 Western blot assays revealed that the expression levels of these genes were dysregulated in CCD841 cells compared to SW620 cells (Supplementary Figure S6) and that forced expression of miR-143 triggered a significant silencing effect on the expression of these genes in SW620 cells, confirming that they are targets of miR-143 (Figure 6f). [score:8]
13, 14, 15, 16, 35, 36, 37, 38, 39 As a putative tumor suppressor, miR-143 participates in CRC development and progression by targeting KRAS, IGF1R, Bcl-2, and HK2. [score:6]
UCC functions as an oncogene in CRC, mechanistically acting by upregulating KRAS and other target genes in part through sponging miR-143. [score:6]
Inversely correlated expression of UCC and miR-143 in CRCAccumulating evidence has shown that miRNAs are able to interact with lincRNAs and regulate their expression levels. [score:6]
miR-143 has been reported to target and repress KRAS, IGF1R, Bcl-2, and HK2 expression in CRC. [score:5]
miR-143 suppresses UCC functionWe transfected SW620 and SW480 cells with the miR-143 inhibitor or with si- UCC#2 to study the UCC -mediated effects of miR-143 on cell proliferation and invasion. [score:5]
Inversely, suppressing miR-143 enhanced UCC expression. [score:5]
The miR-143 target site-mutation UCC 3′-UTR luciferase reporter (UCC-MUT) construct was generated by employing direct-site mutagenesis using mutation primers that mutate the miR-143 -binding site. [score:5]
Although miR-143 has been experimentally shown to target many protein-coding genes, our data show that miR-143 also targets UCC. [score:5]
Overexpressing miR-143 reduced UCC expression in CRC cells. [score:5]
Besides, co-transfection of si- UCC#2 with the miR-143 inhibitor abolished the repressive effect of si- UCC#2 on CRC cell invasion (Figure 5d), indicating that miR-143 suppresses UCC function. [score:5]
For transient transfection assays, miR-143 mimics, a miR-143 inhibitor, small interfering RNA (siRNA) duplexes (si- UCC#1, si- UCC#2 and si- UCC#3), and negative control (NC) RNA duplexes for miRNA mimics, the miR-143 inhibitor or the siRNAs were synthesized (Ribobio, Guangzhou, China). [score:4]
Interestingly, attenuation of UCC expression was observed after co-transfection miR-143 inhibitor and si- UCC#2 when compared to the NC control group (Figure 6d). [score:4]
Collectively, these results suggest that UCC regulates the target genes of miR-143 by sequestering endogenous miR-143. [score:4]
Generally, miR-143 is downregulated in a variety of tumors, including lung cancer, pancreatic cancer, and melanoma. [score:4]
UCC acts as a competing endogenous RNA by directly binding to miR-143To examine the potential lincRNA–miRNA interaction, we subcloned full-length UCC or UCC harboring a site-directed mutation in the miR-143 -binding site into the psiCHECK dual luciferase reporter vector (referred to as UCC-WT or UCC-MUT, respectively) (Figure 6a). [score:4]
Transwell invasion assays showed that the miR-143 inhibitor enhanced CRC cell invasion but that si- UCC#2 inhibited CRC cell invasion. [score:4]
In addition, we provide evidence that miR-143 targets UCC by directly binding to miRNA -binding sites in the UCC sequence. [score:4]
We provide evidence that UCC may act as an endogenous sponge by binding to miR-143, thus abolishing the miRNA -induced repression of its target genes. [score:3]
These results suggest that UCC is targeted by miR-143. [score:3]
These results indicate that there might be an inverse correlation between the expression levels of UCC and miR-143. [score:3]
First, we found a negative correlation between UCC and miR-143 expression in clinical CRC specimens. [score:3]
Inversely correlated expression of UCC and miR-143 in CRC. [score:3]
Furthermore, these effects were maintained by co-transfection with si- UCC and the miR-143 inhibitor (Figure 6h). [score:3]
Using online software, we identified UCC as a possible target of miR-143. [score:3]
miR-143 suppresses UCC function. [score:3]
Spearman correlation analysis suggested a negative relationship between UCC and miR-143 expression (r=−0.27, P=0.018; Figure 4c). [score:3]
To examine the potential lincRNA–miRNA interaction, we subcloned full-length UCC or UCC harboring a site-directed mutation in the miR-143 -binding site into the psiCHECK dual luciferase reporter vector (referred to as UCC-WT or UCC-MUT, respectively) (Figure 6a). [score:3]
We transfected SW620 and SW480 cells with the miR-143 inhibitor or with si- UCC#2 to study the UCC -mediated effects of miR-143 on cell proliferation and invasion. [score:3]
Dual-luciferase assays showed a significant decrease in luciferase activities after co-transfecting cells with miR-143 mimics and the UCC-WT expression vector (P<0.05, Figure 6b) but not the UCC-MUT vector (P>0.05, Figure 6b). [score:2]
UCC acts as a competing endogenous RNA by directly binding to miR-143. [score:2]
We further clarified the regulatory relationship between UCC and miR-143. [score:2]
MTS proliferation assays revealed that the miR-143 inhibitor abrogated the effect of si- UCC#2 in reducing cell viability (Figure 5a). [score:2]
Next day, cells were co -transfected with wild-type or mutant reporter plasmids and miR-143 mimics. [score:1]
19, 20 The predicted sites of miR-143 binding to the UCC sequence are illustrated in Figure 4a. [score:1]
23, 24, 25, 26, 27 In addition, miR-143 is a plasma miRNA that provides high diagnostic accuracy for early-stage HCC [39] and is a predictive factor for the response to fluoropyrimidine -based chemotherapy in patients with metastatic CRC, [40] indicating the clinical relevance of miR-143. [score:1]
[1 to 20 of 38 sentences]
23
[+] score: 131
Other miRNAs from this paper: hsa-mir-21, hsa-mir-1-2, hsa-mir-141, hsa-mir-1-1
The miR-143/145 cluster, wi dely recognized as a tumor suppressor, was recently found to be expressed and active in the stromal, rather than epithelial, compartment of the colon and lung 2, 3. These new discoveries strongly suggest that the observed loss of miR-143/145 expression in colon and lung carcinomas has been due to differential stromal sampling between benign and malignant tissues, rather than from the loss of miRNA expression within cancer cells. [score:9]
Thus, miR-143 expression may be specifically suppressed in the tumor microenvironment, or different cell types with altered miR-143 expression may be recruited to the tumor. [score:7]
In summary, we have demonstrated for the first time predominant stromal expression of miR-1 and miR-143 in prostate tissue, predominant epithelial expression of miR-141, and both stromal and epithelial expression of miR-21. [score:7]
Analyses of the TCGA dataset further support a direct correlation between miR-143 expression and the expression of stromal markers MYH11 and ACTA2. [score:6]
The levels of miR-1 and miR-143 are commonly diminished in PCa, and ectopic expression of either miR-1 or miR-143 inhibits the growth and survival of PCa cells 9– 13. [score:5]
These data indicate a predominantly stromal expression pattern for miR-1 and miR-143, and a predominantly epithelial expression pattern for miR-141. [score:5]
These results show a generally tissue-restricted expression pattern for miR-1 and miR-141, and a broader and higher level expression pattern for miR-143 and miR-21, across multiple tissue types. [score:5]
These results challenge the role of miR-143/145 as a cell-autonomous tumor suppressor, and instead, raise new questions regarding the expression and function of miR-143/145 within the tumor microenvironment [4]. [score:5]
In situ hybridization and microdissection analyses further demonstrated near-exclusive miR-143/145 expression in murine and human intestinal mesenchyme, with undetectable expression in colon tumor epithelium [2]. [score:5]
Compartmentalized expression of miR-1, miR-141, and miR-143 in normal human prostate. [score:3]
Figure 2Compartmentalized expression of miR-1, miR-141, and miR-143 in normal human prostate tissue. [score:3]
Strikingly, the expression of miR-1 and miR-143 were found to be almost exclusively stromal, with very few copies detected in the epithelium. [score:3]
In contrast to miR-1 and miR-143, miR-141 expression was predominantly epithelial in human tissues and cell cultures. [score:3]
In a separate study of murine lung tumorigenesis, Dimitrova and colleagues found no significant changes in disease phenotype when miR-143/145 was deleted from lung epithelium [3]. [score:3]
Four miRNAs have been frequently reported to have aberrant expression in PCa: miR-1, miR-21, miR-141, and miR-143. [score:3]
The expression of miR-21 (hsa-miR-21-5p) and miR-141 (hsa-miR-141-3p) are frequently reported to be elevated in human PCa, while the levels of miR-1 (hsa-miR-1-p3) and miR-143 (hsa-miR-143-3p) are frequently found to be decreased [8]. [score:3]
Expression of miR-1, miR-21, miR-141, and miR-143 in normal human cells and tissues. [score:3]
Through two independent sources of microdissected tissue, we found that miR-143 is predominantly expressed within the prostatic stroma. [score:3]
Figure 3Cell and tissue type specific expression of miR-1, miR-143, miR-141, and miR-21. [score:3]
miR-143 was more highly expressed in stromal cells, with an average of 526 copies, while only 10 copies were detected in the epithelium. [score:3]
Our data also indicate that miR-143 expression may not be exclusively stromal in these tissues. [score:3]
Collectively, these studies implicate a stromal, rather than epithelial, role for miR-143/145 in human disease. [score:3]
Like miR-143, miR-21 expression was also high in most tissues (10 [4]–10 [6] RPM). [score:3]
Our current study of human prostate tissues substantiates a predominantly stromal gene expression pattern for miR-143. [score:3]
Thus, miR-1 and miR-143 have been considered cell-autonomous tumor suppressors of PCa. [score:2]
This indicates that miR-143 expression is likely very low in epithelial cells, and near the limit of detection for some assays. [score:2]
mir-143 was verified to be predominantly stromal in these tissues, with 222 fold (p = 0.004) greater expression in the stroma when compared to the epithelium. [score:2]
MYH11 also strongly and directly correlated with miR-143, with a Pearson’s r value of 0.49 (p < 2.2 × 10 [−16]) (Fig.   6D). [score:2]
Our direct comparisons between normal and cancer stroma provide new data that miR-143 can also be specifically diminished in tumor -associated stroma. [score:2]
The potential for sampling artifact in adenocarcinomas may be best exemplified by the miR-143/145 gene family [4]. [score:1]
Very low levels of miR-143 could be detected in epithelium, and from pure populations of epithelial and cancer cell lines. [score:1]
Extremely low copy numbers of miR-143 were also detected in these LNCaP cell extracts (3.9 copies). [score:1]
Levels of miR-1 and miR-143 are significantly reduced in tumor -associated stroma. [score:1]
miR-143 was only detected at appreciable levels in fibroblasts, with extremely low levels detected in PrEC (average of 0.03 copies) and BPH1 cells (average of 0.005 copies). [score:1]
On the other hand, depletion of miR-143/145 from the tumor stromal microenvironment resulted in reduced tumorigenesis and diminished neoangiogenesis. [score:1]
Like miR-143, the levels of miR-1 were selectively decreased in the tumor -associated stroma of microdissected tissues. [score:1]
miR-21 and miR-141 levels are elevated in human PCa, and miR-1 and miR-143 levels are reduced. [score:1]
For example, in some LNCaP cell extracts 3.9 copies of miR-143 could be detected, while in others, miR-143 was undetectable. [score:1]
miR-143 was detected at high levels (10 [4]–10 [6] RPM) in most tissues (Fig.   3C). [score:1]
Figure 4Reduced miR-1 and miR-143 levels in PCa -associated tumor stroma. [score:1]
Significant differences could only be found for miR-1 and miR-143 in tumor -associated stroma in this small sample set. [score:1]
The specific and significant loss of miR-1 and miR-143 in tumor -associated stroma indicates a potential role for these miRNAs in the tumor microenvironment. [score:1]
From these data, we conclude that miR-143 is predominantly, but not exclusively, stromal. [score:1]
A recent study of miR-143/145 in murine intestinal regeneration found that tissue repair was only compromised when miR-143/145 was specifically deleted from the mesenchyme, but not the epithelium. [score:1]
Consistent with our analyses in human tissue, we found increased levels of miR-21 (1.1 fold, p < 0.001) and miR-141 (1.3 fold, p < 0.001) in PCa cases, and decreased levels of miR-143 (2.6 fold, p < 0.001) (Fig.   6A). [score:1]
miR-143 was detected at high levels (905–2,930 copies) in all stromal cultures, as well as HFF cells (99 copies). [score:1]
This is consistent with the detection of miR-143 in multiple tissue and cell types in the SRA database. [score:1]
More specifically, an average of 2,067 copies of miR-143 were detected in the stroma, while only 9 copies were detected in the epithelium. [score:1]
The RT-ddPCR results show that these JHU samples have similar trends of elevated miR-21 and miR-141 in PCa, and reduced miR-1 and miR-143 (Fig.   1B). [score:1]
TaqMan MicroRNA RT (Applied Biosystems, Life Technologies) was used to generate cDNA for hsa-miR-21-5p, hsa-miR-143-3p, hsa-miR-141-5p, hsa-miR-1-5p, cel-miR-39, and RNU6B from 10 ng of RNA. [score:1]
This new data, and those observed in colon and lung cancer, indicate that the loss of miR-143 in macrodissected tumors may due to differential stromal sampling between benign and malignant tissues. [score:1]
[1 to 20 of 51 sentences]
24
[+] score: 128
In most studies, miR-143 was found to be highly expressed in normal tissues and downregulated in many cancers, indicating that miR-143 might function as a potential tumor suppressor 48 49. [score:8]
p38 mediates NO toxicity through upregulating pro-apoptotic miR-143, revealing that miR-143 might be considered as a potential target in improving neurodegenerative diseases caused by NO toxicity. [score:7]
As expected, miR-143 was strongly induced in response to SNP stimulation (Fig. 6A), whereas RBM3 overexpression significantly attenuated its induction, indicating that RBM3 downregulates NO -induced miR-143. [score:6]
Growing SH-SY5Y cells were transfected with 20 nM miR-143 mimics (5′-UGA GAU GAA GCA CUG UAG CUC-3′) or the negative control (NC) mimics (5′-UUC UCC GAA CGU GUC ACG UTT-3′), antisense miRNA inhibitor (5′-GAG CUA CAG UGC UUC AUC UCA-3′) or the NC inhibitor (5′-CAG UAC UUU UGU GUA GUA CAA-3′) using Lipofectamine 2000, following the manufacturer’s instruction. [score:5]
In conclusion, these data suggested that RBM3 prevents cells from NO -induced apoptosis by inhibiting the expression of pro-apoptotic miR-143. [score:5]
In a more recent study, Wong et al. demonstrated that a reduced expression of RBM3 by fever results in an increased expression of temperature-sensitive miRNAs (thermomiRs), including miR-143 39. [score:5]
In a recent report, the researchers demonstrated that miR-143 could inhibit the expression of Bcl-2 and cause caspase-3 activation, thus inducing apoptosis in osteosarcoma cells 38. [score:5]
The qPCR results showed that upon p38 signaling inhibition, miR-143 induction by NO was markedly inhibited (Fig. 6D). [score:5]
In combination, these data suggest that RBM3 might not affect the biogenesis of miR-143 directly, but it may inhibit the induction of miR-143 indirectly, namely by interfering with p38 signaling. [score:5]
Lastly, it was determined whether the downregulation of miR-143 by RBM3 confers a protective effect on NO -induced apoptosis. [score:4]
SH-SY5Y cells were transfected with miR-143 inhibitor (143i) or negative control (NC) inhibitor for 2 d, and treated with SNP (1 mM) for 16 h. (A) Cell viability was assessed by MTT assay, (D) cleaved PARP was detected with Western blotting, and (E) FACS analysis was conducted to evaluate the effect of miR-143 inhibitor on NO -induced apoptosis. [score:4]
Most recently, miR-143 was also identified as a downstream target of p38 in muscle cells 40, but whether it is regulated by p38 in the present scenario is unknown. [score:4]
RBM3 downregulates NO -induced miR-143 in p38 -dependent way. [score:4]
Taken together, these data indicate that RBM3 downregulates NO -induced miR-143 by interfering with p38 signaling. [score:4]
Compared to negative control (NC) inhibitor, miR-143 inhibitor (143i) significantly reduced NO -induced apoptosis (Fig. 7E). [score:4]
RBM3 downregulates NO -induced miR-143 in a p38 -dependent manner. [score:4]
Interestingly, one recent report also demonstrated that miR-143 is an RBM3-regulated miRNA, and that it plays a crucial role in modulating the expression of immune-related genes during fever 39. [score:4]
Second, miR-143 inhibitor attenuated NO -induced apoptosis. [score:3]
qPCR was performed to detect miR-143 expression for all the following samples. [score:3]
Using co-immunoprecipitation (co-IP) and anti-myc tag beads, myc-tagged RBM3 was isolated from RBM3 -overexpressing cells and PCR for pre-miR-143 was performed. [score:3]
For these reasons, we determined whether RBM3 is involved in the regulation of miR-143 in a direct -binding way. [score:3]
Instead, transfection of miR-143 mimics oligonucleotide (143 m) into RBM3 -overexpressing cells markedly attenuated RBM3-conferred cell protection against NO (Fig. 7B). [score:3]
First, miR-143 was strongly induced on NO stimuli, whereas p38 inhibitor diminished the induction. [score:3]
As shown in Fig. 7A, transfection of miR-143 inhibitor oligonucleotide (143i) into the cells significantly reduced the cytotoxicity of NO. [score:3]
In line with this evidence, when the activity of endogenous miR-143 was blocked by miR-143 inhibitor (143i), NO -induced PARP cleavage was markedly reduced (Fig. 7D). [score:3]
To further confirm the inhibitory effects of RBM3/hypothermia on NO -induced miR-143, RBM3 was silenced using siRNA under mildly hypothermic conditions. [score:3]
Unexpectedly, no pre-miR-143 product could be detected from IP products of myc-tagged RBM3 (data not shown), thus ruling out the possibility that RBM3 regulates miR-143 in a direct way. [score:3]
The siRNAs specific to human Rbm3, human miR-143 mimics and antisense inhibitor, and their negative control oligonucleotides were purchased from GenePharma (Shanghai, China). [score:3]
In this way, it was highly worthwhile to determine whether RBM3 confers protection against NO via regulation on miR-143 in this scenario. [score:2]
However, the addition of miR-143 mimics (143 m) substantially reversed it (Fig. 7C). [score:1]
miR-143 mediates NO -induced apoptosis. [score:1]
Third, miR-143 mimics abolished RBM3-conferred protective effect. [score:1]
To further confirm the role of miR-143 in NO -induced apoptosis, annexin V-FITC/PI staining, followed by FACS analysis was performed. [score:1]
As expected, mild hypothermia pretreatment blocked much of the induction of miR-143 attributable to NO (Fig. 6B). [score:1]
How to cite this article: Yang, H. -J. et al. RNA -binding protein RBM3 prevents NO -induced apoptosis in human neuroblastoma cells by modulating p38 signaling and miR-143. [score:1]
The second important finding of this study is that miR-143 acts downstream of p38 signaling and mediates NO -induced apoptosis. [score:1]
For this reason, more mechanisms regarding to pro-apoptotic effect of miR-143, should be explored in the future. [score:1]
Furthermore, a thermomiR, miR-143, was identified as a new pro-apoptotic effector of NO cytotoxicity. [score:1]
In summary, the present study indicates that the cold-inducible protein RBM3 prevents NO -induced apoptosis in human neuroblastoma cells by modulating p38 signaling and miR-143. [score:1]
[1 to 20 of 39 sentences]
25
[+] score: 127
Other miRNAs from this paper: hsa-mir-145
And up-regulation of miR-143 expression transcribed by nuclear factor kappa B (NF-кB) promotes cancer cell invasion and metastasis by repression of FNDC3B expression. [score:8]
The results showed that the miR-143 was up-regulated in EC compared to EU (p=0.016), and also the miR-145 was up-regulated (p=0.008). [score:6]
And the expression of miR-143 in EC was up-regulated (p=0.000). [score:6]
For example, miR-143, which is down-regulated in colon cancer, suppresses ERK5 (5). [score:6]
Referring to the studies which had been reported, we found that fibronectin type III domain containing 3B (FNDC3B), which regulates cell motility, was identified as the direct and functional target of miR-143 (11). [score:5]
Compared to EU, the expression of miR-143 in EC was up-regulated (p=0.005). [score:5]
Moreover, they found that local liver metastasis and distant lung metastasis are significantly inhibited by blocking miR-143 in p21-HBx transgenic mice, showing that overexpression of this miRNA favors liver tumor cell invasive and metastatic behavior. [score:5]
Comparison among EN, EU and EC group (Using Wilcoxon rank sum test) Compared to EN, the expression level of miR-143 in EU was up-regulated, but the difference did not reach statistically significance (p=0.053). [score:5]
After comparison, in EN group, the expression levels of miR-143 and/or miR-145 in proliferative endometrium were up-regulated compared to secretory endometrium, but the difference did not reach statistically significance (p=0.085, 0.173, respectively Table II). [score:5]
The results showed the miR-143 and/or miR-145 in proliferative endometrium was up-regulated compared to secretory endometrium in EN group, but proliferative endometrium was down-regulated compared to secretory endometrium in EC group. [score:5]
We suspected FNDC3B may also be the direct and functional target of miR-143 in endometriosis which had the similar clinicopathological features to malignant tumors, such as local invasion and distant metastasis. [score:4]
Recently, Akao et al found that miR-143 and -145 were down-regulated in colon cancer (5, 6). [score:4]
In addition, Bloomston et al and Szafranska et al both found that miR-143 and -145 are up-regulated in pancreatic ductal adenocarcinoma (12, 13). [score:4]
Then they used the miR-143 or -145 precursor miRNAs for transfection of the human colon cancer DLD-1 and SW480 cells, the cell growth of both cell lines was significantly inhibited in a dose -dependent manner at 48 h. Also, both MiR-143 and miR-145 are frequently down regulated in tumors deriving from breast, lung, colon, the gastrointestinal system, ovary, cervix, bladder tissue and in human cancer cell lines, suggesting anti-oncogenic nature of miR-143 and -145 (7, 8). [score:4]
The value of R [2] >1.0 was considered to represent increased expression of miR-143 and/or miR-145 in EC tissues to the paired EU tissues, and R [2] <1.0 represent decreased expression. [score:4]
According to the published on EMs, we find that miR-143 expression in different types of cancer spectrum is inconsistent. [score:3]
In our study, we analyzed three types of samples, even paired EU and EC samples to identify the differential expression of miR-143 and miR-145. [score:3]
In previous studies, miR-143 and miR-145 were also found differentially expressed in endometriosis, although some with a bit difference from our results (9, 10, 16- 18). [score:3]
The body of expression data for miR-143 and miR-145 in endometriosis suggests that they may have a diagnostic and therapeutic potential. [score:3]
The results had not yet found that the expression of miR-143 and/or miR-145 in EN or EC changed with menstrual cycle. [score:3]
However, Ohlsson et al and Filigheddu et al both found that miR-143 and -145 are up-regulated in ectopic endometrium compared with paired eutopic endometrium in women with endometriosis (9, 10). [score:3]
Moreover, miR-143 was up-regulated in EC compared to EU. [score:3]
So the lack of knowledge about the targets for miR-143 and miR-145 hampered a full understanding on the biological functions and clinicopathological features. [score:3]
However, in the future, more and more studies should be performed to discover the relationship between miR-143/miR-145 and clinicopathological features of endometriosis, such as disease stages or clinical parameters, especially CA125 in endometriosis. [score:3]
To further compare the overall level of miR-143 and/or miR-145 expression in EC tissues to the paired EU tissues, we got a second analysis using R [2]. [score:3]
In this study, we employed stem-loop RT-PCR to quantify the miR-143 and miR-145 expression in endometrium of women with endometriosis, along with the endometrium of women without endometriosis. [score:3]
Obviously, the expression of miR-143 in EN, EU and EC took on an uptrend. [score:3]
Using equation, we got the expression of miR-143 and/or miR-145 in all the samples (1). [score:3]
MiR-143 was up-regulated both in EU and EC samples compared to EN, although in EU the difference did not reach statistically significance. [score:2]
Taken together, the results imply that the miR-143 and/or miR-145 may play a certain role in the development and progression of endometriosis. [score:2]
Real-time PCR analysis for miRNAs expression The miR-143 and miR-145 and endogenous control U6 primers (Table I) were purchased from the Invitrogen. [score:2]
To generate cDNA of miR-143, miR-145 and U6, 1μg of RNA and 10 μl DEPC H [2]O were first denatured at 70 [o]C for 10 min before quenching on ice, and then 50nM stem-loop RT primer with 1mM final of each of the four deoxynucleotide triphosphates, 2 U/ μl ribonuclease inhibitor, 5 U/ μl M-MLV reverse transcriptase and 1 ×M-MLV RT buffer (Toyobo Co. [score:2]
Our aim was to investigate the miR-143 and miR-145 expression in endometriosis and their relationships to clinicopathological variables in the patients. [score:1]
Zhang et al demonstrated that the level of miR-143 is dramatically increased in metastatic HBV-HCC of both p21-HBx transgenic mice and HCC patients (11). [score:1]
MiR-143 and miRNA-145 are located within approximately 1.8 kb of each other in the chromosome 5q32 region, which led us to speculate that both precursors originate from the same primary miRNA (6). [score:1]
And we have selected miR-143 and miR-145 here for further analyses (data not shown). [score:1]
[1 to 20 of 36 sentences]
26
[+] score: 111
Elevated miR-143 expression correlated with BMP-4 and CK8 expression, and elevated miR-205 expression correlated negatively with CK14 expression. [score:9]
In support of the proposal that alterations in miR-143 and miR-145 expression occur at an early stage in the development of Barrett’s oesophagus, we also observed positive correlations in expression between miR-143 and CK8, and miR-143 and BMP-4, in the oesophageal mucosa from individuals with ulcerative oesophagitis. [score:6]
This extends our previous observation of elevated miR-143 and miR-145 expression in Barrett’s oesophagus epithelium [15], and suggests that increased expression of these miRNAs occurs prior to the development of Barrett’s oesophagus. [score:6]
Although we observed upregulation of miR-143 and miR-145 in squamous mucosa from individuals with ulcerative oesophagitis, we did not observe altered expression of other miRNAs, miR-21, miR-194 and miR-215, which have previously been shown to be increased in Barrett’s oesophagus mucosa. [score:6]
miR-203 and miR-205 are expressed at higher levels in squamous mucosa, and miR-143, miR-145, miR-194 and miR-215 are expressed at higher levels in Barrett’s oesophagus. [score:5]
Taken together, these correlations with BMP-4 and CK8 support an association between elevated miR-143 expression and elevated expression of columnar cell markers in reflux-exposed squamous mucosa. [score:5]
It is possible that up-regulation of miR-143, miR-145 or miR-205, and the associated anti-proliferative effect, might counterbalance hyperplasia in the basal layer of the oesophageal epithelium. [score:4]
Previous work from our laboratory which compared normal squamous oesophageal mucosa with Barrett’s oesophagus showed increased expression of miR-21, miR-143, miR-145, miR-194 and miR-215, and decreased expression of miR-203 and miR-205 in Barrett’s oesophagus. [score:4]
However, support for the argument that miR-143 and miR-145 might have a role in promoting the development of Barrett’s oesophagus does not actually require the expression of other columnar miRNAs to be altered in our current study. [score:4]
Therefore miR-143, miR-145 and miR-205 may regulate gene expression in the nucleus of oesophageal epithelial cells to exert the effects observed in our study. [score:4]
Whether or not miR-143 has a role in modulating gene expression programs to promote metaplastic conversion of a squamous to a columnar mucosa remains undetermined. [score:3]
Taken together, these results suggest that miR-143, miR-145 and miR-205 might suppress proliferation or promote apoptosis in the basal layer of the oesophageal epithelium. [score:3]
These changes in miR-143, miR-145 and miR-205 expression appear to be most pronounced in the basal layer of the oesophageal epithelium. [score:3]
To assess the impact of selected miRNAs on proliferation and apoptosis in oesophageal epithelial cells miR-143, miR-145 or miR-205 were overexpressed in Het-1A cells, a non-neoplastic oesophageal keratinocyte derived cell line [1, 17]. [score:3]
Staining for miR-143 (Figure 1B), miR-145 (Figure 1C) and miR-205 probes (Figure 1D) revealed similar expression patterns, with the most intense staining seen in the basal layer of the epithelium. [score:3]
We sought to identify the spatial expression of miR-143, miR-145 and miR-205. [score:3]
In oesophageal mucosal biopsies from individuals with ulcerative oesophagitis, the expression of miR-143, miR-145 and miR-205 was predominantly most intense in the basal layer of the epithelium (Figure 1). [score:3]
Spatial expression of miR-143, miR-145 and miR-205 in oesophageal biopsies. [score:3]
Endogenous miR-143, miR-145 and miR-205 expression was localised to the basal layer of the oesophageal epithelium. [score:3]
In oesophageal squamous mucosa biopsies from individuals with ulcerative oesophagitis, there were significant positive correlations between the expression of miR-143 and CK8 (Rho = 0.802, p = 0.004), miR-143 and BMP-4 (Rho = 0.591, p = 0.032), and a significant negative correlation between miR-205 and CK14 (Rho = −0.587, p = 0.034). [score:3]
Elevated miR-143, miR-145 and miR-205 expression was observed in oesophageal squamous mucosa of individuals with ulcerative oesophagitis. [score:3]
Restoring miR-143, miR-145 or miR-205 expression in other cell mo dels has also been shown to reduce cell proliferation and increase apoptosis [20- 24]. [score:3]
Our study demonstrated elevated miR-143 and miR-145 levels in the oesophageal squamous mucosa from subjects with ulcerative oesophagitis (and without Barrett’s oesophagus) compared to subjects without gastro-oesophageal reflux disease. [score:2]
In ulcerative oesophagitis miR-143, miR-145 and miR-205 staining intensity was greatest in the basal layer of the oesophageal epithelium, and it is possible that these miRNAs might direct anti-proliferative and pro-apoptotic effects within this layer. [score:2]
The expression of miR-143, miR-145, and miR-205 were significantly higher in oesophageal squamous mucosa from subjects with ulcerative oesophagitis compared to squamous mucosa from subjects without pathological reflux. [score:2]
Cells were transfected using miRNA mimic or negative control duplexes at 33 nM concentration (miR-143 #2988, miR-145 #8480, miR-205 #3391, negative control duplex #1733 all from GenePharma, Shanghai, China). [score:1]
We observed reduced proliferation and increased apoptosis in the cells following transfection with miR-143, miR-145 and miR-205 mimics. [score:1]
Transfection of miR-143, 145 and 205 mimics into Het-1A cells resulted in increased apoptosis and decreased proliferation. [score:1]
In-situ hybridisation staining for miR-143, miR-145 and miR-205 appeared to be both nuclear and cytoplasmic. [score:1]
B, C, D and E: Hybridisation with LNA-probes for miRNAs miR-143 (B), miR-145 (C) and miR-205 (D), and LNA -negative control (E). [score:1]
The pro-apoptotic effects of transfection with miR-143, miR-145 or miR-205 mimics may reflect the physiological apoptotic response observed in the oesophagus following reflux exposure. [score:1]
miRNA levels were increased by transfecting cells with miR-143, miR-145 or miR-205 mimics using the Lipofectamine™ 2000 system (Invitrogen, Mulgrave, Victoria) as per the manufacturer’s protocol. [score:1]
Cell numbers at each time point were assessed to compare cell groups transfected with either miR-143, miR-145 or miR-205 with cells transfected with the negative control duplex. [score:1]
Nuclear staining has been reported for miR-145 [26] in breast myoepithelium, but our study is the first to show nuclear staining for miR-143, miR-145 and miR-205 in the oesophagus. [score:1]
The LNA-probes used include miR-143 (#38515-15), miR-145 (#38517-15), miR-205 (#18099-15) and miR-SCR (#99004-15). [score:1]
The median fold increase in miR-143, miR-145 and miR-205 levels, 24 hours after transfection, is presented in Figure 2. Figure 3 summarises the effect of elevating miR-143, miR-145 or miR-205 activity in the Het-1A cell line. [score:1]
Increasing miR-143, miR-145 and miR-205 activity in Het-1A cells. [score:1]
Cells were transfected with either miR-143, miR-145 or miR-205 mimics or a negative control duplex. [score:1]
Figure 2 Normalised median fold increase in miR-143, miR-145 and miR-205 levels at 24 hours after transfection with respective mimics. [score:1]
Figure 3 Cell proliferation (A) and apoptosis (B) levels in Het-1A cells 48 h after transfection with miR-143, miR-145 or miR-205. [score:1]
In addition RNA was extracted from the transfected cells using TRIzol®, and miR-143, miR-145 and miR-205 levels were assessed in transfected cell lines using the methods described above. [score:1]
[1 to 20 of 41 sentences]
27
[+] score: 103
Bioinformatic analysis provided insight into the biological pathways controlled by miR-143 and miR-145 and comparison of gene expression profiles has indicated that miR-145 targets are differentially expressed between metastatic and non-metastatic isogenic cell line mo dels. [score:7]
When this analysis was performed specifically for miR-145 and miR-143 targets, no significant overlap of pathways was found indicating that the two co-expressed miRNAs target different biological pathways, possibly explaining the opposing phenotypes observed. [score:7]
The first study showing de-regulation of miRNAs reported the down-regulation of miR-143 and miR-145 as early as the pre-adenomatous polyp stage, suggesting a possible role for these miRNAs in early stages of CRC [24]. [score:5]
Over -expression of miR-143 and miR-145 has previously been shown to result in a tumor suppressor effect in non-metastatic CRC cell lines [21, 27, 32]. [score:5]
Through functional studies, we also show that re -expression of miR-143 or miR-145 leads to tumor suppressor and oncogenic phenotypes in a metastatic CRC mo del, respectively. [score:5]
Seven stable clones expressing miR-143 were isolated and each displayed a cell clumping phenotype, which was associated with increased E-cadherin protein expression (Fig. 5A-C). [score:5]
We found that miR-143 re -expression in SW620 cells converted the round, independent cells into aggregated cell masses, increased E-cadherin expression and decreased cell proliferation/metabolism, all consistent with a transition to a more epithelial-like cell phenotype. [score:5]
There was no correlation between the level of miR-143 expression, E-cadherin, or the degree of growth inhibition. [score:5]
Our observation that miR-143 and miR-145 were down-regulated in CRC confirmed earlier reports [21- 25]. [score:4]
MiR-143 and miR-145 consistently displayed reduced expression levels in CRC clinical samples and were undetectable in CRC cell line mo dels. [score:3]
The above data indicated that over -expression of miR-145 leads to an oncogenic phenotype in metastatic CRC cells, the opposite effect of miR-143. [score:3]
The pathways targeted by miR-143 and miR-145 showed no significant overlap. [score:3]
Importantly, our results highlight that delivery of miR-143, in isolation, may be a potential therapeutic modality for CRC, and that a strategy involving over -expression of miR-145 alone should be approached with caution. [score:3]
miRNA fold change location CRC Fragile site* hsa-miR-20a up 13q31.3 gain hsa-miR-19a up 13q31.3 gain hsa-miR-17-5p up 13q31.3 gain hsa-miR-93 up 7q22.1 gain hsa-miR-25 up 7q22.1 gain hsa-miR-31 up 9p21.3 hsa-miR-106a up Xq26.2 hsa-miR-143 down 5q32 loss hsa-miR-145 down 5q32 loss hsa-miR-125a down 19q13.41 gain hsa-miR-1 down 18q12.3 or 20q13.33 loss (18q) or gain (20q)* Summarized from [41- 43] Figure 4 Expression of 14 miRNAs in 8 CRC cell lines and normal colon total RNA. [score:3]
These conflicting data may be due to the different cell lines mo dels used and/or the methods used for expressing miR-143. [score:3]
miRNA fold change location CRC Fragile site* hsa-miR-20a up 13q31.3 gain hsa-miR-19a up 13q31.3 gain hsa-miR-17-5p up 13q31.3 gain hsa-miR-93 up 7q22.1 gain hsa-miR-25 up 7q22.1 gain hsa-miR-31 up 9p21.3 hsa-miR-106a up Xq26.2 hsa-miR-143 down 5q32 loss hsa-miR-145 down 5q32 loss hsa-miR-125a down 19q13.41 gain hsa-miR-1 down 18q12.3 or 20q13.33 loss (18q) or gain (20q)* Summarized from [41- 43] Figure 4 Expression of 14 miRNAs in 8 CRC cell lines and normal colon total RNA. [score:3]
In contrast to the miR-143 tumor suppressor effects, replacing miR-145 activity in the same cells led to an elongated cell phenotype, increased E-cadherin, and increased cell proliferation/metabolism (all consistent with a mesenchymal-like phenotype). [score:3]
Seven stable SW620 clones were identified that expressed miR-143 (A4, B3, B5, B6, C1, C5, and D2). [score:3]
Genetic network analysis of miR-143 and miR-145 targets. [score:3]
SW620 CRC cells were stably transduced with miR-143 or miR-145 expression vectors and analyzed in vitro for cell proliferation, cell differentiation and anchorage-independent growth. [score:3]
Figure 5 Over -expression of miR-143 in the SW620 cell line affects cell morphology and proliferation. [score:3]
miR-143 has a tumor suppressor effect in metastatic CRC cells. [score:3]
However, in contrast to our findings, the previous reports demonstrated dose -dependent tumor-suppressor effects of miR-143. [score:3]
In vitro functional studies indicated that miR-143 and miR-145 appear to function in opposing manners to either inhibit or augment cell proliferation in a metastatic CRC mo del. [score:3]
The DNA encoding pre-miR-143 was PCR-amplified from human genomic DNA using primers 143F (5'CGGGATCCCGGAGAGGTGGAGCCCAGGTC) and 143R (5'GCTCTAGACAGCATCACAAGTGGCTGA), digested with BamHI and XbaI and ligated to pSilencer 2.1Term to produce the miR-143 expression plasmid. [score:2]
However, the commonly deregulated miRNAs included miR-31, members of the miR-17-92 cluster, miR-1, miR-143 and miR145, thereby validating the findings of previous studies. [score:2]
Therefore miR-145 may be an activator of the transition to a more mesenchymal-like phenotype thus advancing tumor evolution, whereas miR-143 may contribute as a guardian of the epithelial-like state (both consistent with their opposing impacts on the metastatic cell mo del SW620). [score:1]
Akao and colleagues have also demonstrated a reduction in cell viability upon delivery of pre-miR-143 into the non-metastatic DLD1 or SW480 CRC cell lines, which is consistent with our observations [21]. [score:1]
To generate stable clones using pSilencer 2.1 (miR-143) and pSilencer 4.1 (miR-145) plasmids, 1-5 × 10 [6 ]SW620 cells were seeded in a single well of a 6-well plate. [score:1]
We elucidated the opposing phenotypic effects of miR-143 and miR-145 in metastatic CRC cells. [score:1]
We therefore performed bioinformatic analyses to help elucidate the difference between miR-143 and miR-145 biology. [score:1]
For instance, we generated stable clones while previous studies performed transient transfections with synthetic pre-miR-143. [score:1]
[1 to 20 of 32 sentences]
28
[+] score: 103
At the same time, both preneoplastic and cancerous phenotypes exhibited weak/diffuse miR-143 ISH signals but moderate/strong cytoplasmic HK2 expression (Figure 3C and 3D), indicating down-regulation of the tumor suppressor, miR-143, leads to overexpression of HK2 and enhanced cell proliferation/ESCC development. [score:11]
Thus, integration of metabolomics with transcriptomics [16] & microRNA profiling data [28] in the hyperplastic ZD esophagus revealed that deregulated glucose uptake is accompanied by miR-143 down-regulation and up-regulation of the hexokinase gene Hk2. [score:8]
Based on this observation, we went on to perform Taqman miRNA assays using and showed that the tumor suppressor miR-143 was down-regulated 2.5-fold in hyperplastic ZD vs ZS esophagus from rats after a brief 6-week dietary regimen (P < 0.05, n = 8 rats/group ), and down-regulated 10-fold (P < 0.001, n = 8 rats/group) in archived samples of ESCC-bearing ZD esophagus vs non-ESCC-bearing ZS counterpart from an esophageal tumor study in Zn-modulated rats [28]. [score:8]
Divergent inverse correlation of miR-143 & HK2 expression in nonproliferative esophagus vs proliferative ZD esophageal neoplasia and human ESCCTo understand the distribution and localization of miR-143 in esophageal neoplasia in relation to localization of its target HK2 protein and the level of cell proliferation, we performed in situ hybridization (ISH) and immunohistochemical staining (IHC) on near serial sections of rat esophageal tissues (n = 10 rats/group), as well as in the archived human ESCC tissues for which we previously reported overexpression of miR-31, -21, -223 [27, 28]. [score:7]
Significantly, miR-143, a tumor suppressor in human cancers, including ESCC [55, 56], and a known negative regulator of HK2 [36], was down-regulated 1.8-fold (P = 0.0136) in the highly proliferative ZD esophagus as compared to its non-proliferative counterpart vs ZS [28]. [score:6]
For example, miR-122 and its host gene regulate cholesterol and lipid metabolism in liver [35]; miR-143 and its target gene, HK2, regulates aerobic glycolysis in tumor cells [36- 39]. [score:5]
To understand the distribution and localization of miR-143 in esophageal neoplasia in relation to localization of its target HK2 protein and the level of cell proliferation, we performed in situ hybridization (ISH) and immunohistochemical staining (IHC) on near serial sections of rat esophageal tissues (n = 10 rats/group), as well as in the archived human ESCC tissues for which we previously reported overexpression of miR-31, -21, -223 [27, 28]. [score:5]
The finding shows that to support cell proliferation, ZD reprograms glucose metabolism by modulating the expression of miR-143, which targets HK2. [score:5]
Moreover, we showed that miR-143 regulates cancer glycolysis in ZD -induced esophageal neoplasia by targeting HK2 (Figure 3), a result consistent with reports for lung cancer, renal cell carcinoma, head and neck squamous cell carcinoma, breast cancer, and prostate cancer [36- 38, 62, 63]. [score:4]
In addition, future studies are needed to unravel the mechanism(s) whereby dietary ZD regulates the expression of miR-143. [score:4]
This result is consistent with reports that miR-143 is an essential regulator of cancer glycolysis by targeting HK2 in cancer cells, including lung cancer, head and neck squamous cell carcinoma, renal cell carcinoma, and colon cancer cells [36- 39]. [score:4]
Concurrently, these ZS tissues showed abundant and intense miR-143 ISH signal in basal and suprabasal cell layers along with weak HK2 protein expression. [score:3]
While miR-143 ISH signals were absent in human ESCC tissues, strong cytoplasmic HK2 protein expression was present (Figure 4). [score:3]
In this study, integrated analysis of -omics datasets with miRNA expression profiling revealed a miR-143-HK2-glucose link in hyperplastic ZD esophagus. [score:3]
Figure 4Analysis of cell proliferation, miR-143 and HK2 expression in human esophageal squamous cell carcinoma (ESCC) tissue by in situ hybridization and immunohistochemistryRepresentative hematoxylin and eosin [H&E]-stained and PCNA-stained ESCC tissues (2 cases are shown). [score:3]
Analysis of miR-143 and HK2 expression by in situ hybridization (ISH) and immunohistochemistry (IHC) in formalin fixed paraffin embedded esophageal samples in - C. ZD versus ZS esophagus after a 6-week dietary regimen (n = 8 rats/group) D. Archived samples of ESCC-bearing ZD esophagus versus tumor-free control ZS esophagus [28] (n = 10 rats/group). [score:3]
Analysis of cell proliferation, miR-143 and HK2 expression in Zn -deficient preneoplastic and neoplastic rat esophageal tissues. [score:3]
Divergent inverse correlation of miR-143 & HK2 expression in nonproliferative esophagus vs proliferative ZD esophageal neoplasia and human ESCC. [score:3]
Analysis of cell proliferation, miR-143 and HK2 expression in human esophageal squamous cell carcinoma (ESCC) tissue by in situ hybridization and immunohistochemistry. [score:3]
Together, these data revealed for the first time the opposing inverse-correlation between miR-143 & HK2 expression in normal esophagus with limited cell growth (ZS esophagus) and precancerous/cancerous ZD esophageal cells with unbridled cell proliferation. [score:3]
Following deparaffinization, rehydration in graded alcohol and proteinase K treatment, tissue sections were hybridized with miR-143 probe (20 nM), in hybridization buffer (Exiqon) at 57°C for 14 h in a hybridizer (Dako, Glostrup, Denmark). [score:1]
miR-143 ISH signal (blue, 4-nitro-blue tetrazolium and 5-brom-4-chloro-3′-indolylphosphate; counterstain, nuclear fast red). [score:1]
Figure 3 A. analysis of miR-143 (U87 as normalizer, n = 8 rats/group; results are shown as means, error bars represent standard deviation). [score:1]
Integration of metabolomics with our published transcriptomics and microRNA profiling data revealed a miR-143-HK2-glucose pathway that underlies esophageal neoplasia by ZD. [score:1]
Cellular origin of miR-143 was defined by ISH using high affinity double Dig-labeled LNA probes (Exiqon, Vedbaek, Denmark). [score:1]
In situ hybridizationmiRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, hsa-miR-143, rno-miR-31, and negative controls were purchased from Exiqon (Vedbaek, Denmark). [score:1]
miR-143 ISH signal (blue, 4-nitro-blue tetrazolium and 5-brom-4-chloro-3′-indolylphosphate; counterstain, nuclear fast red) was absent in ESCC tumor area. [score:1]
A. analysis of miR-143 (U87 as normalizer, n = 8 rats/group; results are shown as means, error bars represent standard deviation). [score:1]
miRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, hsa-miR-143, rno-miR-31, and negative controls were purchased from Exiqon (Vedbaek, Denmark). [score:1]
[1 to 20 of 29 sentences]
29
[+] score: 103
We then armed RNA molecules with a target sequence for hsa-miR-143 to regulate their expression by microRNA (miRNA) mimics. [score:6]
Although a very recent finding by Chivukula et al. [32] have raised controversy around the cell-autonomous tumor suppressor role of miR-143, this miRNA has been repeatedly reported and commonly accepted as a tumor suppressor in colorectal malignancies. [score:5]
When the target sequence of hsa-miR-143 was omitted from the mRNA construct in B2Δ AgeI mRNA, results from the flow cytometry analysis showed a non-significant difference (P > 0.05) in the transgene expressing cells and the mean fluorescence intensity levels in the presence of hsa-miR-143 (Fig. 4B and 4C). [score:5]
Fig. 4 Effect of transient expression of hsa-miR-143 duplex on EGFP expression from B2 and B2ΔAgeI mRNA. [score:5]
Similarly, EGFP expression level in the presence of miR-143 mimic was significantly restored when hsa-miR-143 target sequence was omitted from the construct (Fig. 4). [score:5]
In normal cells, high levels of miR-143 prevent the expression of the suicide gene construct, while in transformed cells the absence of miRNA-143 can result in efficient expression of the suicide construct. [score:5]
The data also showed that the restoration of hsa-miR-143 expression in SW480 leads to a significant translation repression of the introduced reporter and suicide genes. [score:5]
EGFP expression was down regulated by hsa-miR-143. [score:4]
As shown in Figure 4A, flow cytometry data showed that when hsa-miR-143 level was restored, EGFP expression was dropped by 88%. [score:3]
This construct was used to evaluate the effect of three tandem repeats of a complete complementary miRNA-143 target sequence on the expression of HSV1-TK and enhanced green fluorescent protein (EGFP) construct in SW480 cell line. [score:3]
On the other hand, by omitting the target sequence for hsa-miR-143 in B1Δ AgeI mRNA, the level of this mRNA was dropped only 28% when hsa-miR-143 was used to treat cells instead of scrambled miR (Fig. 5). [score:3]
B2Δ AgeI plasmid was prepared by omitting the target sequence of hsa-miR-143 from B2 plasmid by AgeI enzyme digestion procedure (Fig. 1). [score:3]
Such decrease in the cellular levels of miRNA-143 provides a good chance for cell-specific expression of a suicide gene. [score:3]
Twenty four hours after transfection with EGFP expressing mRNA (or 48 hours after transfection with hsa-miR-143 duplexes), cells were collected by trypsinization. [score:3]
It has been previously shown that the expression of miRNA-143 in transformed cells is severely decreased [21]. [score:3]
Thymidine kinase Polio 3’NCR miR-143 Despite the significant progress in cancer therapy, the burden of the disease remains high, requiring new strategies for treatment [1]. [score:3]
EGFP expression in cells transfected with B2 mRNA, and hsa-miR-143 was reduced 88% and 80% in cells transfected with no microRNA and scrambled miR, respectively (A). [score:3]
The expression of hsa-miR-143 is demolished in SW480 cell line [19]. [score:3]
This result indicated that omitting the target sequence for hsa-miR-143 increases the sensitivity of cells to GCV significantly. [score:3]
To decrease the chance of unspecific expression of HSV1-TK in normal cells, we used a tandem of three repeats with absolute complementarity to hsa-miR-143 as an arming strategy. [score:3]
The suppressive role of miRNA-143 in colorectal cancer, which is the third most frequently occurring tumor worldwide, is well established [19, 20]. [score:3]
Effect of mimic miR-143 and scrambled miR on inhibition of ganciclovir (GCV) cytotoxicity. [score:3]
When the abundance of hsa-miR-143 was restored in SW480, cytotoxicity of GCV was more strongly inhibited at low dose (20 µ/ml) by miR mimic. [score:3]
Down regulation of thymidine kinase mRNA in the presence of hsa-miR-143 in SW480. [score:2]
Flow cytometry (Fig. 4A) and cytotoxicity assay (Fig. 6A) results showed that when hsa-miR-143 was restored in SW480, the transgene expression by B1 and B2 mRNA was successfully deteriorated. [score:2]
According to the results from transfection of SW480 with Mimic House Keeping Positive Control 2 (GAPDH), cells were transfected with 100 nM hsa- miR-143 duplex. [score:1]
B1 plasmid was used as the basis for the construction of plasmid B1Δ AgeI in which the tandem repeat of hsa-miR-143 was omitted by AgeI enzyme digestion. [score:1]
Fig. 5Relative abundance of B1 and B1Δ AgeI mRNA in SW480 supplemented with hsa-miR-143 mimic. [score:1]
The sequence of hsa-miR-143-3p (MI0000459) was extracted from miRBase database (http://www. [score:1]
To prove that the resistance to GCV in the presence of hsa-miR-143 was due to sequence-specific interaction of miR-target sequence on B1 mRNA and hsa-miR-143, we evaluated the cytotoxicity of B1Δ AgeI mRNA in the presence of hsa-miR-143 and different concentrations of GCV. [score:1]
Finally, tandem repeat of hsa-miR-143 was removed by AgeI enzyme, and B2ΔAgeI was produced. [score:1]
When 100 nM hsa-miR-143 was applied to a similar set of GCV concentrations followed by transfection with B1 mRNA, analysis of variance showed that difference in absorbance between wells treated with 0 and 20 µg/ml GCV was not statistically significant (P = 0.75). [score:1]
Mature sequence of hsa-miR-143 was chemically modified by addition of a 5'-2'-O-Methyl (5'-2'Ome-UGAGAUGAAGCAC UGUAGCUC). [score:1]
Flow cytometry analysis of SW480 transfected with B2ΔAgeI mRNA showed that neither percentage of transfected cells (depicted as fold changes [B]) nor mean fluorescence intensity (C) changed in the presence of mimic miR and miR-143. [score:1]
Sense and antisense strands were diluted to a final concentration of 50 μM in RNase free water in order to generate mature duplexes of hsa-miR-143. [score:1]
SW480 cells were transiently transfected with hsa-miR-143 duplexes 24 hours before transfecting cells with each mRNA when the confluency of cells was 80% [25]. [score:1]
Tandem repeat of hsa-miR-143 was removed by AgeI restriction enzyme to have B1ΔAgeI plasmid. [score:1]
In this plasmid, the sequences of internal ribosomal entry site from encephalo-myocarditis virus (GenBank: X74312.1, nucleotides 285-868), HSV1-TK (KOS strain, GenBank: JQ673480.1, nucleotides 46613- 47743), three tandem repeats of complementary sequence for hsa-miR-143 (MI0000459) and 3′UTR from Poliovirus (Sabin 1 strain, GenBank: AY184219, nucleotides 7376–7441) were designed in tandem and subcloned into pcDNA [TM]3.1 (-). [score:1]
It can be concluded that hsa-miR-143 has increased SW480 resistance to GCV. [score:1]
[1 to 20 of 39 sentences]
30
[+] score: 99
Other miRNAs from this paper: mmu-mir-143, mmu-mir-130b, hsa-mir-130b
These data suggest that the downregulation of PNPO expression by TGF-β1 is at least in part via the upregulation of miR-143-3p. [score:9]
MiR-143-3p is upregulated upon TGF-β1 stimulation and interacts with the 3′-UTR of PNPO mRNA, leading to a downregulation of PNPO expression. [score:8]
We speculate that the loss of TGF-β responsiveness or a defect in TGF-β signalling may lead to the downregulation of miR-143-3p and, in turn, the upregulation of PNPO. [score:7]
PNPO is downregulated by the TGF-β signalling pathway through the upregulation of miR-143-3p. [score:7]
Treating SK-OV-3 cells with miR-143 mimics resulted in decreased PNPO protein expression (P < 0.05; Fig.   7 i and j), whereas treating cells with miR-143 inhibitor (anti-miR-143) resulted in increased PNPO protein expression (Fig.   7k). [score:7]
These data suggest that TGF-β -mediated PNPO expression is at least in part controlled through the upregulation of miR-143-3p. [score:6]
We found that TGF-β1 upregulated miR-143-3p and that PNPO was a target gene of miR-143-3p. [score:6]
k Effect of miR-143 inhibitor (anti-miR-143) (150 n m for 72 h) on PNPO protein expression detected by western blot in OVCAR-3 cells. [score:5]
To determine the correlation between PNPO mRNA expression and miR-143 expression in patients with ovarian tumours, we performed a qRT-PCR in ovarian tissues of 14 patients (4 benign, 3 borderline, 7 malignant tumours) and 5 normal controls. [score:5]
PNPO expression is regulated by the TGF-β signalling pathway via miR-143-3p. [score:4]
Furthermore, PNPO is mediated by the TGF-β signalling pathway through the upregulation of miR-143-3p. [score:4]
l Effect of TGF-β1 (0, 1 and 10 ng/ml for 3 h) on primary miR-143 (Pri-miR-143) expression detected by qRT-PCR in OVCAR-3 cells. [score:3]
Using miRWalk 2.0 database [33], we found that PNPO is a potential target of miR-143-3p. [score:3]
After seeding at a density of 2×10 [5] cells/well into a six-well plate and incubation for 16 h, OVCAR-3 cells were transfected with 50 n m miR-143-3p mimics, 50 n m miR -negative control (miR-Ctrl), 150 n m miR-143-3p inhibitors (anti-miR-143) or 150 n m anti-miR -negative control (anti-miR-Ctrl) (Supplementary Table  S2) (RiboBio Co. [score:3]
It has been shown that a chemically modified miR-143 significantly suppresses the tumour formation in a colorectal cancer mo del [41]. [score:3]
m Effect of TGF-β1 (0, 1 and 10 ng/ml for 3 h) on mature miR-143 expression detected by qRT-PCR in OVCAR-3 cells. [score:3]
Kitade Y Akao Y MicroRNAs and their therapeutic potential for human diseases: microRNAs, miR-143 and -145, function as anti-oncomirs and the application of chemically modified miR-143 as an anti-cancer drugJ. [score:3]
Notably, TGF-β1 enhanced primary and mature miR-143-3p expression (P < 0.05; Fig.   7 l and m). [score:3]
i Effect of miR-143 mimics (50 n m for 72 h) on PNPO protein expression detected by western blot in OVCAR-3 cells. [score:3]
The 3′-UTR mutant pEZX-PNPOmut was generated in the consensus miR-143-3p binding site by using a QuikChange II site-directed mutagenesis kit (Stratagene). [score:2]
The current study utilized clinical samples that showed a slight negative-correlation between PNPO and its regulator miR-143. [score:2]
The interaction of miR-143-3p with the PNPO mRNA at 3′-UTR in HEK293T cells was confirmed (n = 3). [score:1]
g A schematic diagram illustrated the sequences of the putative miR-143-3p binding site in the PNPO 3′-UTR and its mutant. [score:1]
In order to confirm the interaction of miR-143-3p with PNPO mRNA, we constructed two plasmids: a wild-type PNPO 3′-UTR containing a miR-143-3p binding site (position at 1260−1266 of 3′-UTR) and a mutated PNPO 3′-UTR in which the binding site was changed (Fig.   7g). [score:1]
[1 to 20 of 24 sentences]
31
[+] score: 98
Other miRNAs from this paper: hsa-mir-221, hsa-mir-222, hsa-mir-145
This has revealed that both EBNA3A and EBNA3C –but not EBNA3B –are required for the transactivation of the oncomiRs miR-221 and miR-222, while concurrently silencing the expression of the tumour suppressor miR-143/miR-145 cluster. [score:5]
Although various target mRNAs have been proposed, there appears to be a lot of cell-type specificity and a general lack of consensus on precisely how miR-143/miR-145 act as tumour suppressors. [score:5]
Analysis of the same lines for expression of miR-143 and miR-145 confirmed the TLDA result showing that in the absence of EBNA3A or functional EBNA3C (by washing out 4HT) there was an increase in the expression of miR-143 and miR-145 (Fig 1B). [score:5]
Since no EBNA3 binding sites were detected within more than a million DNA base pairs either side of the pri-miR-143/145 TSS (S9 Fig), it is likely that this repression of transcription is a secondary, downstream event triggered by altered expression of another EBNA3A/EBNA3C-target gene. [score:5]
The details of how the tumour suppressors miR-143 and miR-145 might inhibit cell proliferation are poorly understood. [score:5]
In contrast to miR-221/miR-222, miR-143 and miR-145 are tumour suppressor miRs that have been reported to inhibit the proliferation of many cancer-and non-cancer-derived cell lines. [score:5]
In contrast to miR-143/miR-145, functions of the miR-221/miR-222 cluster is relatively well characterised, with wide agreement that two of the major targets are mRNAs for CIP/KIP CDKIs p57 [KIP2] and p27 [KIP1], the translation of which are robustly inhibited by these miRs in various types of cell (see ). [score:5]
There are very few data available on the activities of miR-143/miR-145 in B cells, although there has been one report of their down-regulation in EBV-transformed, but not in mitogen-stimulated B cells [84]. [score:4]
Our interpretation of these data is that transcriptional regulation of pri-miR-143/145 (and hence mature miR-143/miR-145) is unlikely to be due to EBNA3A/EBNA3C binding to cis-regulatory elements and is therefore probably a secondary, trans-acting effect of the regulation of an unknown gene(s). [score:4]
Here—following a relatively unbiased array screen for miRs regulated by EBNA3A and/or EBNA3C in the context of latent infection with EBV—we identified the oncogenic miR-221/miR-222 cluster as being activated and the tumor suppressor miR-143/miR-145 cluster as being repressed by EBNA3A together with EBNA3C. [score:4]
S7 FigThe expression level of the non-coding RNA precursor of miR-143/miR-145 was determined (A) in EBNA3A- KO and-REV LCLs; (B) in EBNA3A-ERT2 LCLs cultured with (+HT) or without 4HT (Washed); (C) in p16 -null LCLs 3CHT with (+HT) or without 4HT (Washed); (D) in LCL EBNA3A-ERT2 (never HT) cultured for 28 days with (+HT) or without 4HT; (E) and p16 -null LCL 3CHT (never HT) and cultured for 30 days with (+HT) or without 4HT. [score:3]
Activation of EBNA3C represses miR-143/miR-145 expression. [score:3]
The same two EBV proteins silence a tumour-suppressor miR cluster miR-143/miR-145. [score:3]
Consistently on removal of 4HT (washed), miR-221 and miR-222 were expressed at a lower level (Fig 4B), whereas miR-143 and miR-145 were modestly induced (Fig 4C). [score:3]
1005031.g002 Fig 2(A) MiR-143, miR-145 and RNU48 expression were analysed by qPCR from p16 -null LCL 3CHT established without the presence of 4HT (never HT) or 30 days after 4HT was added to culture medium (+HT). [score:3]
Therefore, in order to determine whether the regulation of miR-221/miR-222 and/or miR-143/miR-145 might result from direct binding of either EBNA3A or EBNA3C –or both—to chromatin at the genomic locus of each miR cluster, genome-wide chromatin immunoprecipitation (ChIP) data sets were interrogated. [score:3]
Expression of miR-143/miR-145, miR-221/miR-222 and control RNA RNU48 are not affected by the treatment of LCL WT by 4HT. [score:3]
When EBNA3A was deleted there was particularly robust expression of both miR-143 and miR-145. [score:3]
Activation of EBNA3A represses miR-143/miR-145 expression. [score:3]
1005031.g005 Fig 5(A) MiR-143/miR-145 and RNU48 expression were determined by qPCR in EBNA3A-ERT2 LCL established without the presence of 4HT (never HT) and 28 days after addition of 4HT to culture medium (+HT). [score:3]
Positive leads that were of particular interest—because they have been reported in the literature to have either oncogenic activity (the miR-221/miR-222 cluster) or tumour suppressor activity (the miR-143/miR-145 cluster)–were chosen for more detailed analysis. [score:3]
Expression of miR-221, miR-222, miR-143, miR-145 and two snRNAs, RNU6B and RNU48 were quantified by qPCR using the TaqMan MicroRNA Assay listed in S2 Table (Applied Biosystem). [score:2]
Regulation of miR-221/miR-222 and miR-143/miR-145 in EBNA3A-ERT2 conditional LCLs. [score:2]
EBNA3A and EBNA3C do not bind within at least 1Mbp either side of the putative TSS of the pri-miR-143/145. [score:1]
Silencing of the miR-143/miR-145 locus by the combined action of EBNA3A and EBNA3C remains poorly understood. [score:1]
ChIP-seq and ChIP-qPCR analysis of the miR-221/miR-222 and miR-143/miR-145 loci. [score:1]
32)–over a region of more than 1Mb either side of the putative TSS of the pri-miR-143/145 –failed to reveal any EBNA3A- or EBNA3C -binding sites (compare S9 Fig with Fig 7A). [score:1]
As with the experiments using conditional EBNA3C, when EBNA3A-conditional cells that had been grown into LCLs in the absence of 4HT (never HT), there was a substantial repression of miR-143 and miR-145 when 4HT was added to the culture medium (Fig 5A and S1 Fig). [score:1]
The non-coding pri-miR-143/145 (called MIR143-HG in the genome browser) as well as miR-143/miR-145 are highlighted by inclusion in a red box. [score:1]
EBNA3A and EBNA3C both repress the pri-miR transcript for miR-143/miR-145. [score:1]
MiR-143/miR-145 coding sequences are located in a cluster on chromosome 5 and are co-transcribed as a single pri-miR transcript [61, 63]. [score:1]
PloS one 5. 63 Iio A, Nakagawa Y, Hirata I, Naoe T, Akao Y (2010) Identification of non-coding RNAs embracing microRNA-143/145 cluster. [score:1]
10 ng of cDNA product was then used per qPCR reaction (except for the detection of pri-miR-143/145 where 100ng were used) using Platinum Sybr Green qPCR SuperMix UDG kit (Invitrogen). [score:1]
Consistent with this, when 4HT was added to a p16 -null EBNA3C-conditional LCL that had been established in its absence (never HT), there was a substantial repression of the miR-143/miR-145 cluster (Fig 2A and S1 Fig). [score:1]
It may be significant that miR-143 and miR-145 are also repressed by the E7 oncoprotein in epithelial cells infected with human papillomavirus (HPV)-31 [83]. [score:1]
In contrast, interrogation of ChIP-seq data corresponding to the miR-143/miR-145 locus (chromosome 5q. [score:1]
S9 Fig ChIP-seq data at the miR-143/miR-145 cluster genomic locus generated from LCL 3A-TAP and LCL 3C-TAP (Paschos et al., manuscript in preparation) were displayed using UCSC Genome Browser. [score:1]
[1 to 20 of 37 sentences]
32
[+] score: 90
Of the miRNAs we identified as being differentially regulated during senescence and validated with RT-PCR, 6 were confirmed to be either up-regulated in senescence whereas they remained unchanged or down-regulated, in the case of miR-143, in quiescent cells (Table 1). [score:8]
Perhaps expression of TERT results in up-regulation of one or more miR-143 targets, altering the concentration of miR-143 required to induce growth arrest. [score:8]
MiR-143 and miR-145, which are processed from the same primary transcript, are up-regulated approximately 3.5-fold during senescence in WT BJ cells and either show no change or are down-regulated in the quiescent BJ cells. [score:7]
Finally, whereas miR-143 and miR-145 were significantly up-regulated in senescent BJ cells, these miRNAs were down-regulated approximately 2 and 3-fold respectively in late-passage BJ-hTERT cells. [score:7]
Based on the previous observation that miR-34a is more frequently down-regulated in colorectal cancer cells compared to adenomas, in contrast to the frequent down-regulation of miR-143 and miR-145 in both cancer cells and adenomas, it has been implied that miR-143 and miR-145 regulate processes implicated in earlier phases of tumorigenesis [26]. [score:7]
MiR-10b (a miRNA tied to invasion and metastasis in several cancer types) [15], [16], and miR-143 and miR-145 (polycistronic miRNAs that are down-regulated in tumors) [17] were also among the most significantly up-regulated (approximately 7-fold, 3.5-fold, and 3.5-fold, respectively) miRNAs during senescence. [score:7]
The expression of its polycistronic counterpart, miR-143, is unchanged during quiescence relative to expression in early passage cells. [score:5]
The relationship between telomerase expression and inhibition of miR-143 induced growth arrest in fibroblasts is still being determined. [score:5]
At a concentration of 60 nM, miR-143 inhibited proliferation to an extent that was statistically indistinguishable from growth inhibition caused by serum starvation (Figure 3). [score:5]
Together with the reported down regulation of miR-143 and miR-145 in several cancer cells, this suggest that miR-143 and miR-145 have a general role in regulating cellular proliferation and may function as tumor suppressor miRNAs. [score:5]
Remarkably, identical experiments in BJ-hTERT cells indicate that hTERT expression renders BJ cells resistant to miR-143 induced cell-cycle arrest (Figure 3). [score:3]
Transient transfection of miR-143 mimic in WT BJ fibroblasts inhibits cell proliferation relative to untransfected cells at a level comparable to serum starved cells. [score:3]
0012519.g003 Figure 3 Transient transfection of miR-143 mimic in WT BJ fibroblasts inhibits cell proliferation relative to untransfected cells at a level comparable to serum starved cells. [score:3]
We confirmed the ability of miR-143 to induce growth arrest in normal cells by transient over -expression of a miR-143 mimic in early passage BJ cells (Figure 3). [score:3]
Thus we postulate that miR-143 and miR-145 are critically involved in regulating the G1/S transition, whereas miR-34a may have broader roles in regulating stress response, including the stress of long-term cell culture conditions. [score:3]
The MiR-143 mimic inhibited the proliferation of young BJ cells in a dose -dependent manner. [score:2]
MiR-143 does not inhibit proliferation of BJ-hTERT cells. [score:2]
Effect of miR-143 on BJ fibroblast growth. [score:1]
Preliminary evidence suggests this result is not cell-type specific, since another foreskin fibroblast cell line, NHF1, transfected with hTERT are also resistant to miR-143 (Bonifacio and Jarstfer, unpublished data). [score:1]
To determine whether miR-143 can affect the proliferation of BJ fibroblasts we transfected young BJ cells with a synthetic miR-143 mimic. [score:1]
Remarkably, miR-143 failed to arrest BJ-hTERT cells (Figure 3) and NHF1-hTERT cells (Bonifacio and Jarstfer, unpublished data). [score:1]
Analysis by one-way ANOVA comparing growth of miR-143 transfected cells to control and untransfected cells suggests that transfection with a miR-143 mimic results in a significantly smaller cell population 3 days after transfection. [score:1]
BJ WT cells at population doubling number 5 were transfected with 60 nM miR-143 mimic or negative control miRNA mimic (Dharmacon) for 6 hours in Opti-MEMI in the presence of 3 µg/ml Lipofectamine 2000. [score:1]
The influence of TERT in pro-proliferative pathways may obscure the anti-proliferative phenotype normally conferred by miR-143. [score:1]
[1 to 20 of 24 sentences]
33
[+] score: 89
Re -expression of miR-143 in SW620 cells of colorectal cancer also increased E-cadherin expression and the cells were in consistent with a transition to a more epithelial-like cell phenotype [60]. [score:5]
The invasive property of PC-3 cells was significantly inhibited by miR-143 and -145, even more obviously inhibited by miR-145. [score:5]
Moreover, fibronectin, which is a sort of mesenchymal markers and should be up-regulated during EMT, was repressed in stably expressing miR-143 or miR-145 transfected PC-3 cells, compared to PC-3 cells transfected with vector. [score:5]
Upregulation of miRs-143 and -145 reduced the skeletal aggressiveness of PC-3 cells in vitro and in vivo To investigate the role of miRs-143 and -145 in the development and progression of PCa metastasis, miRs-143 and -145 over -expressing cell lines (PC-3/miR-143, PC-3/miR-145, LNCaP/miR-143 and LNCaP/miR-145) were established by retrovirus transfection. [score:5]
The expression of three miRNAs (miRs-145, -143, -612) was obviously decreased in bone metastasis, especially the expression of miR-145 and miR-143 with the reduction of 5.4-fold and 2.7-fold, respectively. [score:5]
Figure 4, B and E ), and a significant inverse correlation between the expression of miR-145 and total PSA level (Spearman correlation = −0.456, p = 0.033, Figure 4 F ); whereas no correlation between the expression of miR-143 and total PSA level (Spearman correlation = −0.403, p = 0.063). [score:5]
Plenty of studies identified several miR-143 targets including DNMT3A and KRAS [65], [66], as well as miR-145 targets including BNIP3, IRS, C-MYC, YES and STAT1 [10], [67], [68], [69]. [score:5]
In the present study, the expression levels of miR-143, -145 and -125b were first identified to be down-regulated in bone metastatic tumors compared to primary PCa tumors. [score:5]
The result illustrated that E-cadherin, which is one of epithelial markers and supposed to be down-regulated during EMT, was increased in PC-3 cells transfected with miR-143 or miR-145. [score:4]
However, Vimentin, another mesenchymal marker, was just down-regulated in PC-3 cells when transfected with miR-143 (Figure 8 A ). [score:4]
These findings suggest that miR-143 or -145 may have a cell type–specific function and only inhibit bone metastasis instead of lymph node metastasis, or loss of miRs-143 and -145 could promote the bone metastasis other than lymph node metastasis, which might be regulated by other miRNAs such as miR-221 [76]. [score:4]
Downregulations of miR-143 or -145 were found in different tumor types including breast, gastric, liver, lung, bladder, pituitary, ovary and colon [53], [54], [55], [56], [57], [58], [59], [60]. [score:4]
Our study demonstrated that upregulation of miR-143 in PC-3 cells repressed mesenchymal markers of fibronectin and vimentin, and increased E-cadherin, one of epithelial markers. [score:4]
Moreover, we want to figure out whether one controls the expression of the other one, but there's no study about the interaction between miR-143 and miR-145. [score:3]
To further investigate whether the expression tendency of miR-145 and miR-143 was identical in the same sample, the relative expression of miR-145 and miR-143 in the same sample was plotted from the real-time PCR in all 22 samples of primary PCa (including 6 microarray samples) (Figure 3 A ) and 20 samples of bone metastases (including 7 microarray samples) (Figure 3 B ), respectively. [score:3]
A, The migration actions of over -expressing miR-143 were analyzed by wound healing assay. [score:2]
Briefly, miRNA was reverse transcribed using sequence specific stem-loop primers (invitrogen) to the following miRNAs: hsa-miR-125b, hsa-miR-145, hsa-miR-153, hsa-miR-210, hsa-miR-143, hsa-miR-100, hsa-miR-363, hsa-miR-451, hsa-miR-572 and hsa-miR-508-5p, based on microarray analysis and their predicted target genes. [score:2]
0020341.g006 Figure 6 A, The migration actions of over -expressing miR-143 were analyzed by wound healing assay. [score:2]
In our study, the results in vitro and in vivo both supported that the deregulations of miR-143 and -145 might promote bone metastasis of PCa. [score:2]
To investigate the role of miRs-143 and -145 in the development and progression of PCa metastasis, miRs-143 and -145 over -expressing cell lines (PC-3/miR-143, PC-3/miR-145, LNCaP/miR-143 and LNCaP/miR-145) were established by retrovirus transfection. [score:2]
All the stable cell lines, including PC-3/vector, PC-3/miR-143, PC-3/miR-145, LNCaP/vector, LNCaP/miR-143 and LNCaP/miR-145, were seeded in 100 mm tissue culture dishes. [score:1]
Moreover, these results of cell migration, invasion and adhesion indicated that the ability of ectopic miR-145 repressing aggressiveness was more significant than that of miR-143. [score:1]
The miR-143 was also demonstrated to abrogate PCa progression in mice by interfering with ERK5 signaling, which is involved in EMT pathway [62], [73]. [score:1]
PC-3 cells transfected with miR-143 also presented a higher adhesive ability, but it is not statistically significant. [score:1]
However, LNCaP/miR-143 and LNCaP/miR-145 cells and LNCaP/vector cells did not show significant difference in cell migration, invasion and adhesion (data not shown). [score:1]
Nevertheless, all these proteins did not exhibit significant difference in LNCaP cells whatever the cells transfected with miR-143 or -145 (Figure 8 B ). [score:1]
After washed by 0.2% glycine/PBS for 1 min and fixed with 4% paraformaldehyde, the sections were incubated in hybridization buffer (50% formamide, 5×SSC, 0.1% Tween, 9.2 mM citric acid for adjustment to pH 6.0, 50 µg/mL heparin, 500 µg/mL yeast RNA) at 37°C for 2 h. Digoxigenin-labeled, LNA -modified probes of miR-143 (20 nmol/L; 5′-GAGCTACAGTGCTTCATCTCA-3′, Exiqon) and miR-145 (20 nmol/L; 5′-AGGGATTCCTGGGAAAACTGGAC-3′, Exiqon) were added respectively and incubated at 55°C for 18 h. Sections were washed with 2×SSC twice, then with 2×SSC and 50% formamide at 50°C thrice (30 min each). [score:1]
In PCa, miR-143 deregulated in primary cancer compared with normal prostate tissue [61], [62]. [score:1]
The sequence of pri-miR-143 and pri-miR-145 were cloned into pMSCV-puromycin plasmid with restriction enzyme Bgl II and EcoR I (New England Biolabs). [score:1]
Sections at lower panel showed the location of miR-143 (left) and miR-145 (right) in PCa cells by LNA-ISH. [score:1]
Animals were randomized into two groups equally, where each 5 animals were treated with PC-3/miR-143 or PC-3/miR-145 on right tibias respectively. [score:1]
The significant correlations of miR-145 and miR-143 were found in primary PCa (kendall correlation = 0.850, p<0.001) and bone metastases (kendall correlation = 0.765, p<0.001). [score:1]
A recent study showed that chemically modified miR-143 can be a candidate for an RNA medicine for the treatment of colorectal tumors [82], which could function as anti-cancer drugs in the future. [score:1]
[1 to 20 of 33 sentences]
34
[+] score: 86
We showed that MAPK1 (ERK2, a potential target of miR-143), MAPK8 (JNK1, a demonstrated target of miR-455-3p), MAPK9 (JNK2, a demonstrated target of miR-17, miR-20b, and miR-106a), and p21 and RB (potential targets of miR-17 and miR-106a) were strongly upregulated at protein level upon inhibition of the miRNAs. [score:14]
Because the expression of the miR-17 family is directly controlled by the proto-oncogene MYC [32]– [34] and because we have recently demonstrated (7) that in human keratinocytes lacking p63, MYC expression is down regulated, the down-regulation of miR-17, miR-20, miR-106a, miR-143 and miR-455-3p genes we observed in keratinocytes lacking p63 could be due to MYC down-regulation. [score:13]
Mir-143 is under control of p63 and could act on keratinocyte differentiation through inhibition of MAPK1 (ERK2), but we did not demonstrate that MAPK1 was a direct target of miR-143, so the inhibitory arrow is presented as a dot line. [score:8]
0045761.g005 Figure 5(A, B) Quantification of the expression of early differentiation markers K1 and K10 in double knockdowns of miR-143 and of its targets (A) and of miR-455-3p and its targets (B). [score:8]
As demonstrated in figure 5A, we observed a significant up-regulation of K1 and K10 upon the double knockdown of both miR-143 and MAPK1, but not upon the double knockdown of miR-143 and either MAPK7 or LIMK1. [score:6]
These results suggested that MAPK1 could be a direct target of miR-143, while MAPK7 and LIMK1 were probably not. [score:4]
We observed on western blots that MAPK1 was significantly upregulated (2.63-fold) at protein level, upon miR-143 silencing, whereas MAPK7 and LIMK1 were not (Figure 3B). [score:4]
We performed a double knockdown of miR-143 with LNA and of its predicted target with a specific siRNA in HaCaT cells. [score:4]
Based on their level of expression in human primary keratinocytes in culture (data not shown) and their biological relevance, we chose several potential candidates from our list: miR-17, miR-18a, miR-20b, miR-30a, miR-106a, miR-143 and miR-455-3p. [score:3]
miR-143 and miR-455-3p target several MAPKs. [score:3]
Because of the demonstrated role of MAPK signaling in keratinocyte differentiation, we have selected among the putative in silico targets of miR-143 several kinases belonging to the MAPK signaling cascade, such as MAPK1 (ERK2), MAPK7 (ERK5), as well as another kinase, LIMK1, not belonging to that pathway. [score:3]
0045761.g003 Figure 3(A) The effectiveness of miR-143 inhibition mediated by LNA was quantified by RT-qPCR. [score:3]
RT-qPCR were done on the same RNA extracts as in figure 3A, which also serve as a control for miR-143 inhibition. [score:3]
Using luciferase::3′UTR reporter constructs, we demonstrated that MAPK7 and LIMK1 were not a target of miR-143 (Figure 3C & 3D). [score:3]
The following miRNA inhibitors (LNA) were obtained from Exiqon: hsa-miR-143 (138515-00), hsa-miR-455-3p (138667-00), hsa-miR-30a (138468-00), hsa-miR-17 (138461-00), hsa-miR-20b (138221-00), hsa-miR-106a (138477-00), and hsa-miR-18 (138462-00), and scramble miR (199002-04) was used as a negative control. [score:3]
In this study, we have characterized multiple miRNAs, including the mir-17 family (miR-17, miR-20b, miR-106a) and miR-30a, miR-143 and miR-455-3p, which are downregulated in p63-silenced keratinocytes, suggesting that they act downstream of p63. [score:2]
The efficiency of miR-143 silencing was systematically verified with RT-qPCR (Figure 3A). [score:1]
MiR-143 regulates smooth muscle cell plasticity [38] and prostate cell growth arrest. [score:1]
[1 to 20 of 18 sentences]
35
[+] score: 84
c qPCR determination of the relative expression of miRNA target genes in hMSCs treated with miRNA inhibitors for miR-100-5p and d miR-143-3p. [score:7]
Statistically different samples are denoted by (*) A closer analysis of the predicted targets of miR-100-5p and miR-143-3p, both of which showed the most significant impact upon the differentiation of hMSCs, revealed a potential convergence upon mTOR signalling, with miR-100-5p targeting mTOR itself, while RICTOR and LARP, both key components of the mTOR network, were predicted targets of miR-143-3p. [score:7]
showed upregulation of mTOR and Rictor with C3T treatment and on 0.6 kPa substrates- the conditions in which we observed decreased expression of miR-100-5p and miR-143-3p (Fig.   4a, Supplementary Fig.   5A). [score:6]
We next treated hMSCs with rapamycin, an inhibitor of mTOR, to determine whether this would have similar effects to downregulation of mTOR components mediated by miR-100-5p and miR-143-3p. [score:6]
Both miR-100-5p and miR-143-3p showed a significant decrease in response to C3T-treatment and soft substrates, suggesting that downregulation of their expression is related to low RhoA activity and substrate stiffness. [score:6]
Conversely, mTOR and Rictor expression was elevated in MSCs treated with inhibitors of miR-100-5p, miR-143-3p or both and Larp1 levels were increased in the presence of miR-143-3p mimic (Fig.   4b; Supplementary Fig.   6A). [score:5]
miR-100 has been consistently linked to mTOR in the literature, where it has been shown to regulate proliferation and migration via its effects on mTOR, particularly in cancer cells 42, 43. miR-143 has also been linked to regulation of mTOR, through inhibition of mTOR and Akt phosphorylation [44]. [score:5]
Mu S Kang B Zeng W Sun Y Yang F MicroRNA-143-3p inhibits hyperplastic scar formation by targeting connective tissue growth factor CTGF/CCN2 via the Akt/mTOR pathwayMol. [score:4]
Notably, our analysis of putative targets of the miRNAs showed that both miR-100-5p and miR-143-3p converge upon components of the mTOR signalling network (mTOR, RICTOR, LARP), which is known for its critical role in regulating cell fate. [score:4]
Likewise, treatment with miR-143-3p inhibitor increased RICTOR and Larp1 transcript levels (Fig.   4c, d). [score:3]
However, levels have been shown to increase in differentiating adipocytes and miR-143 inhibition retards this differentiation [38]. [score:3]
Inhibition of these miRNAs had the opposite effect on hMSC differentiation bias to the mimics, with miR-100-5p, miR-143-3p and both miR-100-5p, and miR-143-3p together causing a significant decrease in the proportion of osteoblasts in the culture (Fig.   3b, d). [score:3]
Consistent with our previous results, inhibition of both miR-100-5p and miR-143-3p enhanced the bias towards adipogenesis resulting in a decrease in the proportion of osteoblasts in the culture (Fig.   5; Supplementary Fig.   7). [score:3]
To further confirm that mTOR signalling is modulated by miR-100-5p and miR-143-3p, MSCs were transfected with inhibitors of miR-100-5p and miR-143-3p and treated with rapamycin. [score:3]
The ability of rapamycin to over-ride the effects of miR-100-5p and miR-143-3p inhibitors provided a clear demonstration that the effects of these factors upon MSC fate is mediated by mTOR signalling. [score:3]
We further showed that miR-100-5p targets mTOR itself and so would affect signalling via mTORC1 and mTORC2, while miR-143-3p could exert differentiation effects on both mTORC1 and mTORC2 via Larp1 and Rictor, respectively. [score:3]
Statistically different samples are denoted by * p < 0.05, ** p < 0.01 and *** p < 0.001Confirming the regulation of these mTOR components within our system, transfection of hMSCs with a mimic of miR-100-5p decreased mTOR levels, while co-transfection of miR-100-5p and miR-143-3p mimics reduced Rictor and Larp1 protein levels. [score:2]
Statistically different samples are denoted by * p < 0.05, ** p < 0.01 and *** p < 0.001 Confirming the regulation of these mTOR components within our system, transfection of hMSCs with a mimic of miR-100-5p decreased mTOR levels, while co-transfection of miR-100-5p and miR-143-3p mimics reduced Rictor and Larp1 protein levels. [score:2]
However, mimics of miR-100-5p and miR-143-3p, both of which were expressed at greater levels in stiff substrates, caused a significant increase in the proportion of osteoblasts when compared to cells treated with a control oligonucleotide (Fig.   3a, c; Supplementary Fig.   4). [score:2]
Fig. 4 miR-100-5p and miR-143-3p converge on mTOR signalling. [score:1]
Esau C MicroRNA-143 regulates adipocyte differentiationJ. [score:1]
miR-143 has no known link to MSC differentiation. [score:1]
Our findings indicate that both miR-100-5p and miR-143-3p enhance osteogenesis. [score:1]
This supports our premise that miR-100-5p and miR-143-3p exert their effects upon MSC fate via mTOR signalling. [score:1]
On the 70kPa substrate, combining mimics of both miR-100-5p and miR-143-3p had a larger effect than modulating either miRNA individually. [score:1]
We provide an insight into the mechanism of action by showing that miR-100-5p and miR-143-3p converge on mTOR signalling. [score:1]
[1 to 20 of 26 sentences]
36
[+] score: 83
Mechanistically, this is mediated, at least in part, by the downregulation of HK2-stimulatory MYC expression and by the upregulation of the HK2 -inhibitory micro(mi)RNA miR-143-3p, following E6/E7 repression. [score:11]
Collectively, these data show that HK2 repression upon E6/E7 silencing is linked to the induction of the HK2 -targeting miR-143-3p, indicating that the downregulation of this miRNA species by E6/E7 contributes to the elevation of HK2 expression in HeLa cells. [score:8]
Both processes seem to contribute to the stimulation of HK2 expression by E6/E7 in HeLa cells, since HK2 repression upon E6/E7 silencing could be counteracted by the ectopic expression of MYC as well as by miR-143-3p inhibition. [score:7]
Thus, the ability of HeLa cells to repress HK2 expression upon E6/E7 silencing correlates with the induction of miR-143-3p, raising the possibility that this miRNA directly contributes to the regulation of HK2 expression by E6/E7. [score:7]
Next, we addressed the question whether the miR-143-3p induction upon E6/E7 silencing (Figure 3A) is involved in the concomitant downregulation of HK2 expression in HeLa cells. [score:6]
Second, E6/E7 repression results in a significant induction of miR-143-3p [14], indicating that E6/E7 downregulates the levels of this abundant HK2 inhibitory miRNA. [score:6]
miR-143-3p Inhibitor (Qiagen) and the miScript Inhibitor Negative Control (Qiagen) were transfected with DharmaFECT I (Thermo Fisher Scientific) to reach a final concentration of 100 nM. [score:5]
In a deep sequencing analysis of E6/E7-regulated miRNAs, it was found that–among the most abundant intracellular miRNA species (>1000 reads per million)–miR-143-3p shows the highest upregulation following endogenous E6/E7 repression in HeLa cells [14]. [score:5]
Notably, and in contrast to the situation in HeLa cells, miR-143-3p was not upregulated upon E6/E7 repression in CaSki or in SiHa cells (Figure 3A). [score:4]
The E6/E7 -mediated regulation of HK2 expression in HeLa cells is linked to miR-143-3p. [score:4]
Introduction of a miR-143-3p mimic did not affect HPV E7 protein levels but resulted in a reduction of HK2 protein amounts (Figure 3B), indicating that miR-143-3p is able to repress HK2 expression in HeLa cells. [score:3]
control’) or a specific miR-143-3p inhibitor. [score:3]
We found that the miR-143-3p inhibitor counteracted HK2 repression in response to E6/E7 silencing (Figure 3C). [score:3]
Figure 3(A) Analyses of miR-143-3p levels in HeLa, SiHa and CaSki cells upon silencing of viral E6/E7 expression by RNAi. [score:3]
In this case, the inhibition of miR-143-3p function should counteract the HK2 repression that is observed upon E6/E7 silencing. [score:3]
HK2 levels in HeLa cells depend on E6/E7-linked repression of miR-143-3p expression. [score:3]
To investigate this question, we treated HeLa cells with chemically synthesized miR-143-3p mimics and inhibitors. [score:1]
Synthetic siRNAs (Ambion, Life Technologies) and miR-143-3p mimic (Qiagen, Hilden, Germany) were transfected with DharmaFECT I (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, to reach a final concentration of 10 nM. [score:1]
[1 to 20 of 18 sentences]
37
[+] score: 83
In this study, the molecular experiments showed that AZD8055 downregulated the activity of mTOR, upregulated the expression of miR-143 and inhibited the expression of HK2 in HeLa cells. [score:13]
Our study suggested that AZD8055 -mediated cervical cancer cell proliferation inhibition may occur through deregulating mTOR activity and upregulating the expression of miR-143, whose targets include HK2, a key time-limiting enzyme in the process of glucose activation. [score:11]
Based on these data, we suggested that AZD8055 inhibited the proliferation and glycolysis of HeLa cells partially through upregulating the expression of miR-143, which further deregulated the expression of HK2. [score:11]
The downregulation or loss of miR-143 may contribute to tumorigenesis, while forced expression of miR-143 may effectively inhibit the proliferation of cancer cells. [score:8]
Recently, Fang et al found that mTOR was able to inhibit the expression of miR-143, which further regulates cancer glycolysis via targeting HK2 in lung adenocarcinoma cell lines (12). [score:8]
AZD8055 upregulates the expression of miR-143. [score:6]
In fact, HK2 has recently been demonstrated to be a direct target of miR-143 (27, 28). [score:4]
As shown in Fig. 5, the upregulation of miR-143 by AZD8055 is time -dependent with the maximal increase (3.5-fold) achieved at 24 h of treatment. [score:4]
mTOR was recently demonstrated to regulate the expression of miR-143 in lung adenocarcinoma cell lines (13). [score:4]
Based on these findings, we further determined the expression of miR-143 in HeLa cells treated with AZD8055 for 24-72 h by qRT-PCR. [score:3]
Our findings suggest that miR-143 may be an important potential target for cervical cancer treatment and AZD8055 may be a useful therapeutic agent for the treatment of human cervical cancer. [score:3]
We also explored the effect of AZD8055 on the expression of miR-143 as well as several important enzymes involved in growth control and energy metabolism. [score:3]
Accumulating evidence has shown that the expression of miR-143 is decreased in multiple types of cancer, and has been shown to be associated with lower survival rates and poor prognostic features (5, 9). [score:3]
miR-143 has been reported to play a crucial role in cancer development (23– 26). [score:2]
[1 to 20 of 14 sentences]
38
[+] score: 82
As circUBAP2 was found to bind miR-143, we next examined that whether circUBAP2 could function as the sponge of miR-143 and inhibit miR-143 expression, thus upregulating Bcl-2 expression in osteosarcoma. [score:10]
In MG63 and U2OS cells, overexpression of circUBAP2 inhibited the expression of miR-143, while knockdown of circUBAP2 enhanced miR-143 expression (Figure 6A and 6B). [score:10]
In osteosarcoma, we previously reported that anti-apoptotic Bcl-2 was directly targeted by miR-143, and miR-143 is downregulated in osteosarcoma and causes the upregulation of anti-apoptotic Bcl-2 [33]. [score:10]
Here, we present that increased circUBAP2 expression is responsible for the decreased miR-143 expression in osteosarcoma, and circUBAP2 expression is reverse-correlated with miR-143 expression in human osteosarcoma tissues. [score:9]
Furthermore, in human osteosarcoma tissues, circUBAP2 expression was found to be reverse-correlated with miR-143 expression, confirming its sponge function to inhibit miR-143 expression (Figure 6C). [score:9]
Thus, we conclude that circUBAP2 is the sponge of miR-143 and then upregulates anti-apoptotic Bcl-2 expression in osteosarcoma. [score:6]
Figure 6 (A, B) MG63 and U2OS cells were transfected with circUBAP2 expressing plasmids (A) or siRNA (B) as indicated, miR-143 expression was examined using. [score:5]
Previously, we reported that miR-143 expression was decreased in osteosarcoma tissues, and miR-143 decrease was responsible for the increased anti-apoptotic Bcl-2 expression in osteosarcoma [33]. [score:5]
Pearson’s correlation coefficient assay in SPSS 17.0 was used to analyze the correlation between circUBAP2 expression and miR-143 expression in osteosarcoma tissues. [score:4]
Thus, the mechanism for miR-143 decrease in osteosarcoma may be dependent on the increased circUBAP2 expression. [score:3]
Figure 5In circUBAP2 stably overexpressed MG63 cells, circUBAP2 was precipitated using circUBAP2 specific probe or control probe, circUBAP2 (A) and miR-143 (B) were detected in the precipitates using. [score:3]
In circUBAP2 stably overexpressed MG63 cells, circUBAP2 was precipitated using circUBAP2 specific probe or control probe, circUBAP2 (A) and miR-143 (B) were detected in the precipitates using. [score:3]
org/), a set of miRNAs were predicted to have potential interaction with circUBAP2, including miR-150, miR-135, miR-101, miR-181, miR-23, miR-149, miR-139, miR-491, miR-124, miR-301m miR-328, miR-122, miR-186, let-7, miR-132, miR-191, miR-425, miR-125, miR-149, miR-143, and miR-146a. [score:1]
CircUBAP2 functions as the sponge of miR-143. [score:1]
However, the underlying mechanism for miR-143 decrease in osteosarcoma was not known at that time. [score:1]
Among them, we found a specific enrichment of miR-143 in the precipitates of circUBAP2 (Figure 5A and 5B), suggesting that miR-143 is the circUBAP2 -associated miRNA in osteosarcoma cells. [score:1]
CircUBAP2 binds miR-143 in osteosarcoma cells. [score:1]
[1 to 20 of 17 sentences]
39
[+] score: 81
Target mRNAs (TargetScan, negatively correlated) Cell Type specificity HSA-MIR-223 82 Monocytes; Eosinophils; Neutrophils HSA-MIR-143 60 Neutrophils HSA-MIR-150 27 B cells; T cells; NK cells HSA-MIR-500 25 Monocytes; pDCs HSA-MIR-652 11 Monocytes; Eosinophils; Neutrophils HSA-MIR-125A 9 T cells; Neutrophils To further support our observations, we searched for studies in which cell-type specific miRNA expression levels were altered by either over -expression or knock-out, and asked if the genes we had identified as miRNA targets were correspondingly up- or down-regulated in response. [score:15]
Target mRNAs (TargetScan, negatively correlated) Cell Type specificity HSA-MIR-223 82 Monocytes; Eosinophils; Neutrophils HSA-MIR-143 60 Neutrophils HSA-MIR-150 27 B cells; T cells; NK cells HSA-MIR-500 25 Monocytes; pDCs HSA-MIR-652 11 Monocytes; Eosinophils; Neutrophils HSA-MIR-125A 9 T cells; Neutrophils 696 genes were specifically up or down-regulated in one, two or three different cell-types, with the majority of genes (542) uniquely up or down-regulated in a single cell-type. [score:11]
Since we observed that several miRNAs were expressed in the same cell type, e. g. miR-143, miR-145 and miR-223 are specifically expressed in neutrophils, we asked if miRNAs specific to the same cell type would target an overlapping set of genes. [score:7]
Finally, we observed that miR-143 was uniquely expressed in neutrophils, the only cell type where the log2 RMA expression value was greater than 7. miR-143 was also 9.2 fold more expressed in neutrophils than in eosinophils; p* = 0.0007. [score:7]
Of interest, miR-223, miR-143, miR-150 and miR-652 replicated as significant in both Roche and HUG datasets, strengthening the case that these miRNAs may indeed regulate expression of their respective predicted target mRNAs. [score:6]
Ranking genes in the myeloid cluster by their connectivity, we found ABL2, a gene which regulates cytoskeleton remo deling during cell differentiation, cell division and cell adhesion was found to be targeted by the largest number of miRNAs (N = 5: miR-223, miR-143, miR-25, miR-27, miR-17), followed by EIF4A2, EPC1 and INO80D, which were targeted by four miRNAs each. [score:6]
Several previous reports have shown that miR-143 is indeed expressed in neutrophils, and patients with polycythemia vera have elevated miR-143 expression in their neutrophils [28]. [score:5]
The organization of myeloid miRNAs in the regulatory network placed miR-223, miR-143 and miR-145 in a central position, since they targeted several genes in common with other miRNAs. [score:4]
miR-31 and miR-143 were verified to be specifically expressed in T cells and neutrophils in the single donor data (Figure S2). [score:3]
Four small -RNA transcripts were each found to be expressed specifically in one cell type: miR-378 in monocytes, miR-31 in T cells, miR-935 in eosinophils and miR-143 in neutrophils (Figure 1). [score:3]
Indeed, miR-223, miR-143 and miR-145 have been shown to be overexpressed in myeloid cells from polycythemia vera patients in which enhanced erythropoiesis is observed [28], suggesting that these 3 miRNAs are usually decreased during erythropoiesis. [score:3]
Expression levels for miR-31, miR-143, miR-223 and miR-150 (Log2, mean ± SEM) are plotted across a panel of immune cell subsets, for samples obtained from single donors (dark shaded bars) and pooled donors (light shaded bars). [score:3]
The final network consisted of two clusters, a large cluster consisting of 9 miRNAs specific to neutrophils, monocytes and myeloid lineage cells (miR-223, miR-143, miR-145, miR-25, miR-27, miR-425, miR-17, miR-652 and miR-191) and a much smaller cluster specific to lymphoid lineage cells (B, T and NK cells), consisting of miR-150 and miR-29 co -regulating TET3, ERP44 and VEGFA. [score:2]
Six of these miRNAs (miR-223, miR-143, miR-150, miR-500, miR-652 and miR-125) were cell-type specific based on our previous analysis. [score:1]
We identified miR-143 as neutrophil specific, miR-31 as T-cell specific, miR-378 as monocyte specific and miR-935 as eosinophil specific. [score:1]
miR-143 and miR-145 are located in close proximity at chromosome 5q32 and while the pre-miRNA structure has not been identified, it is suggested that they are co-transcribed [29]. [score:1]
A) miR-143 and miR-31 were specific to neutrophils and T cells respectively, while B) miR-362 and miR-125 were specific to monocytes, pDCs and T cells, neutrophils. [score:1]
Figure S2 miR-31, miR-143, miR-223 and miR-150 are confirmed to be cell type specific, using data from single donor samples. [score:1]
All miRNAs reported as specific to single cell types in the Roche dataset (miR-143, miR-31, miR-935 and miR-378) remained significant in the HUG dataset, while additional miRNAs were found to be cell-type specific, most notably miR-145 in neutrophils, miR-181 in NK cells and miR-146 in T cells and NK cells. [score:1]
[1 to 20 of 19 sentences]
40
[+] score: 79
Other miRNAs from this paper: hsa-mir-21, hsa-mir-218-1, hsa-mir-218-2
MiR-21 is reported to be overexpressed in a number of cancers [29], [44] and targets transcripts of the PTEN [24], TPM1 [26] and PDCD4 [14], [31], [32] genes, whilst miR-143 is underexpressed in many cancers and targets ERK5 transcripts [17], [29], [30]. [score:9]
Expression of mir-143 was not correlated with histological diagnosis of clinical samples, however it was significantly down-regulated in cervical cancer cell lines. [score:6]
Both mir-21 overexpression and mir-143 underexpression have been observed in cervical cancer cell lines and clinical specimens [12], [17]. [score:5]
We found that mir-21 expression was significantly increased only in ICC with respect to other clinical samples and that mir-143 expression did not correlate with histology at all. [score:5]
These observations were in stark contrast to previous reports involving cervical cancer cell lines in which mir-143 was consistently down-regulated but mir-21 largely unaffected. [score:4]
However, Wang et al 2008 [12] suggested that reduction of mir-143 was required for tumor development whilst Lui et al 2007 [17] showed mixed results for mir-143, mainly due to the low level of expression detected in either normal or cancerous samples. [score:4]
Mir-143 was significantly down-regulated in all three cervical cancer cell lines, in agreement with previous studies. [score:3]
0028423.g001 Figure 1 Mir-143 was significantly down-regulated in all three cervical cancer cell lines, in agreement with previous studies. [score:3]
Expression profiling for (a) mir-21 and (b) mir-143 in 133 clinical samples stratified by histological diagnosis. [score:3]
Expression profiling data for mir-21 and mir-143 in cervical cancer cell lines and normal specimens. [score:3]
In contrast to cell line data, we observed a significant association between mir-21 expression and histologic type in clinical samples, but no association for mir-143 (Figure 2 and Table 1). [score:3]
We found that mir-21 expression increased with worsening clinical diagnosis but that mir-143 was not correlated with histology. [score:3]
Inconsistencies may be due to the relatively low level mir-143 expression in cervical tissues, which may require a more precise extraction method (e. g. laser microdissection) for tumor extraction – none of the studies listed here used such methods. [score:3]
A number of studies have identified mir-143 as significantly underexpressed in cancer, including breast and cervical cancers [12], [17], [30]. [score:3]
In this study we investigated the expression profiles of two microRNAs (mir-21 and mir-143) and their previously validated target proteins in clinical samples from women with HPV infection without lesions, with histologically diagnosed pre-cancerous lesions, or with invasive cancer (ICC), as well as normal controls without HPV infection. [score:3]
We identified a significant association between mir-21 expression and histological diagnosis, but no association with mir-143. [score:3]
However, mir-143 expression of all three cancer cell lines was substantially decreased with respect to clinical samples However, we have not attached statistical analysis to these comparisons because of the different error distributions between clinical samples and cell lines, and because we would only have n = 3 in the case of the cell lines for comparison. [score:3]
In contrast to the cell-line data presented in Figure 1, we observed a significant association between increased mir-21 expression an worsening histological diagnosis, however no significant associations for mir-143. [score:3]
0028423.g002 Figure 2In contrast to the cell-line data presented in Figure 1, we observed a significant association between increased mir-21 expression an worsening histological diagnosis, however no significant associations for mir-143. [score:3]
MicroRNA-21 (mir-21) and microRNA-143 (mir-143) have previously been identified as significantly deregulated in a range of cancers including cervical cancer. [score:2]
Lee et al 2008 [11] did not include either mir-21 or mir-143 in their initial screening experiments and as such did not identify these species as being involved in cancer development; this highlights a clear challenge in identifying potential biomarkers, in cases where leading candidates are ignored. [score:2]
We measured the expression of mir-21 and mir-143 in 142 formalin-fixed, paraffin embedded (FFPE) cervical biopsy tissue blocks, collected from Dantec Oncology Clinic, Dakar, Senegal. [score:1]
RT and qPCR for the RNU6B control shRNA analysis was performed side-by-side with the mir-21 and mir-143 reactions for each sample. [score:1]
We investigated the expression of mir-21 and mir-143 in cervical cancer cell lines with respect to (Normal (HRHPV-) in order to confirm previous observations. [score:1]
[1 to 20 of 24 sentences]
41
[+] score: 77
Other miRNAs from this paper: hsa-mir-21, hsa-mir-125b-1, hsa-mir-125b-2, hsa-mir-155
To explore the mechanisms underlying miR-155 -induced activity of miR-143, C/EBPβ (a miR-155 target) was knocked down, which strongly reduced miR-143 expression in ZR-75-30 cells, while the overexpression of C/EBPβ led to an increase in the miR-143 level. [score:8]
In fact, p53 loss enhances HK-II mRNA stability through the inhibition of miR143 biogenesis [102], which, as discussed above, inhibits HK-II expression in various cancer cells [98]. [score:7]
Furthermore, miR-143 was shown to inhibit HK-II expression via a conserved miR-143 recognition motif located in the 3′-untranslated region of HK-II mRNA [100]. [score:7]
miR-155/(C/EBPβ)/miR-143 signaling pathwaymiR-143 directly suppresses HK-II expression in various cancer cells [77, 98, 100, 101]. [score:6]
According to another study by Jiang et al., miR-155, which is thought to be a pro-inflammatory cytokine, upregulates HK-II through the miR-155/suppressor of cytokine signaling 1 (SOCS1)/STAT3 and miR-155/CCAAT enhancer binding protein β (C/EBPβ)/miR-143 signaling pathways [123]. [score:6]
miR-155/(C/EBPβ)/miR-143 signaling pathway miR-143 directly suppresses HK-II expression in various cancer cells [77, 98, 100, 101]. [score:6]
This miR-143 inhibition was rescued upon co -expression of a miR-155-resistant form of C/EBPβ [123]. [score:5]
mTOR is also a suppressor of some miRNAs, such as miR-143 and miR-125b, which are upstream suppressors of HK-II in the Warburg effect [98, 99]. [score:5]
In addition to miR-143, miR-125b targeted inhibits HK-II to sensitize human HCC cells to chemotherapy [99]. [score:5]
According to a study by Jiang et al., mir-143 expression was inversely correlated with mir-155 expression in breast cancer cell lines. [score:5]
p53/miR-143 pathwaySimilarly to PTEN, another tumor suppressor gene, p53, was also found to be involved in the HK-II -mediated Warburg effect [90]. [score:3]
In addition, the transfection of miR-155 into ZR-75-30 cells significantly decreased miR-143 expression and C/EBPβ protein levels. [score:3]
The HIF-1α/INPP4B/Akt/mTOR/S6K, PTEN/Akt/mTOR/4E-BP1, miR-155/SOCS1/STAT3, miR-155/(C/EBPβ)/miR-143, and p53/miR-143 signaling pathways, as well as c-Myc and CA-IX, may be involved in the mechanisms elevating HK-II expression in laryngeal carcinoma. [score:3]
p53/miR-143 pathway Similarly to PTEN, another tumor suppressor gene, p53, was also found to be involved in the HK-II -mediated Warburg effect [90]. [score:3]
In HNSCC-derived cell lines, miR-143 expression was inversely correlated with HK-II level. [score:3]
The HIF-1α/INPP4B/Akt/mTOR/S6K, PTEN/PI3K/Akt/mTOR/4E-BP1, miR-155/SOCS1/STAT3, miR-155/(C/EBPβ)/miR-143, p53/miR-143 and c-MYC signaling pathways are showed here. [score:1]
All of these results indicate that the miR-155/(C/EBPβ)/miR-143 signaling pathway is involved in the Warburg effect. [score:1]
[1 to 20 of 17 sentences]
42
[+] score: 73
With the data from the current and other studies, we have demonstrated that, besides the inhibition of cell proliferation and the induction of cell apoptosis by downregulating the mTOR signaling, everolimus also inhibits glycolysis in Panc-1 cells, partly by the upregulation of miR-143 and the deregulation of HK2. [score:12]
miR-143 has been shown to be downregulated in various types of human cancers (21– 33) and forced expression of miR-143 effectively inhibits the growth, invasion and migration of cancers (34, 35). [score:8]
Moreover, everolimus inhibited cellular glycolysis in Panc-1 cells in a time -dependent manner, which may partly be explained by the upregulation of miR-143 and the deregulation of HK2, the latter of which plays an essential role in glycolysis in cancer cells. [score:7]
As shown in Fig. 5, during the treatment of Panc-1 cells with everolimus, the upregulation of miR-143 was time -dependently accompanied by the downregulation of HK2. [score:7]
Everolimus upregulated miR-143 and downregulated HK2 in Panc-1 cells. [score:7]
Collectively, for the first time we have demonstrated that everolimus inhibits glycolysis, partly by repressing mTOR signaling which then upregulates miR-143, an important cancer-related microRNA involved in the deregulation of HK2. [score:7]
A previous study reported that HK2 is a direct target of miR-143 and may be downregulated by it (20). [score:7]
Therefore, we further analyzed the expression of miR-143 and verified that with the prolonged treatment with everolimus, the miR-143 level was gradually upregulated. [score:6]
It has been reported that miR-143 is regulated by mTOR and that HK2, a key enzyme involved in glycolysis, is a direct target of miR-143. [score:5]
Additionally, in lung adenocarcinoma cell lines, the expression of miR-143 was found to be repressed by mTOR (20) and the mTOR signaling was inhibited by everolimus in our study. [score:5]
Futhermore, the miR-143 -mediated HK2 regulation may also exist in breast and colon cancer (36, 37), suggesting a common mechanism of miR-143 repressing HK2. [score:2]
[1 to 20 of 11 sentences]
43
[+] score: 71
Other miRNAs from this paper: hsa-mir-145
In our study, the activity and expression of Dicer and RISC proteins seemed to be intact in colorectal cancer cells, because the expression levels of miR-143 and - 145 were up-regulated by stimulation with a growth inhibitor [7]. [score:10]
The introduction of the mature type of either miR-143 or - 145 into colon cancer cells [6, 7, 20], B cell lymphoma [9], and gastric cancer cells [8, 21] results in a significant growth inhibition that occurs in a dose -dependent manner; and the target genes, ERK5 [22] and KRAS [20] for miR-143 and IRS-1 [23] and c-myc [21] for miR-145, were posttranscriptionally down-regulated. [score:8]
Therefore, further detailed cytogenetic study will be needed to understand the mechanism of miR-143 and - 145 down-regulation in many cancer cell lines. [score:4]
We previously found that microRNA-143 (miR-143) and - 145 (miR-145) were down-regulated in colon cancers [6, 7], gastric cancers [8], chronic lymphocytic leukemias, and B cell lymphomas [9], and in several human cancer cell lines [7]. [score:4]
In order to investigate the coordinated expression of the host gene identified in this study with mature miR-143 and - 145, we performed real-time RT-PCR analysis by using the host gene-specific primer set shown in Fig. 2. In human normal tissues, the host gene was highly expressed, as were both miRNAs; but in the corresponding cancer cell lines, the signal was hardly detected (Fig. 4A), though the host gene and both miRNAs were highly expressed in normal human cell lines (Additional files 1 - Figure S1 & S2). [score:4]
Thus, the aberrant transcription of NCR143/145 could contribute to the low expression of miR-143 and - 145. [score:3]
Taken together, these findings suggest that miR-143 and - 145 act as tumor suppressors and provide an important clue in the study of the mechanism of tumor initiation and progression involving miRNAs. [score:3]
Therefore, we propose that the inadequate expression of miR-143 and - 145 was due to the perturbation of transcription and/or that of the another processing enzyme, Drosha, which causes the transit from primary miRNAs to precursor ones. [score:3]
Relative miR-143 (A) and - 145 (B) expression levels are indicated on the left axis by using the comparative ΔCt method (value of 2 [-ΔCt(miR-RNU6B)]). [score:3]
Figure S1: Real-time RT-PCR analysis of mature miR-143 and - 145 expression in human cell lines. [score:3]
Figure 1Real-time RT-PCR analysis of mature miR-143 and - 145 expression in human normal tissues. [score:3]
Expression of miR-143 and -145. [score:3]
Relative miR-143 (A) and - 145 (B) expression levels (value of 2 [-ΔCt(miR-RNU6B)]) are indicated on the left axis, with error bars indicating the standard deviation for these analyses. [score:3]
In human normal tissues, miR-143 and - 145 showed good expression in stomach, intestine, cervix, uterus, colon, and prostate (Fig. 1A, B). [score:3]
Also, in human normal tissues, miR-145 was consistently expressed at higher levels than miR-143 (Fig. 1A, B). [score:3]
We examined the expression levels of mature miR-143 and - 145 in human normal tissues by performing TaqMan microRNA assays (Fig. 1). [score:2]
This indicates that the predicted transcriptional start site near the sequence of clone 4-35 is a putative promoter region of the miR-143 and - 145-encoding gene. [score:1]
Identification of non-coding RNA carrying the miR-143/145 cluster. [score:1]
Next, we performed Northern blot analysis to look for the transcripts that originated from the host gene encoding miR-143 and - 145. [score:1]
Michael et al. [13] reported that in colorectal cancers the decreased levels of mature miR-143 and - 145 were due to reduced Dicer-processing activities. [score:1]
Figure 3Northern blot analysis of the host gene encoding miR-143 and - 145. [score:1]
Figure 4Real-time RT-PCR analysis of the host gene encoding miR-143 and - 145. [score:1]
Figure S4: Confirmation of the presence of genomic loci of miR-143 and - 145 at chromosome 5q33 by genomic PCR. [score:1]
These results indicate that the host gene was firstly transcribed into the 11-kb transcript and then processed to the mature miR-143 and - 145 via 7.5 and 5.5 kb processed variant transcripts. [score:1]
In the present study, we identified non-coding RNAs carrying an miR-143 and - 145 cluster (NCR143/145: Non- coding RNA encoding miR- 143/145) and investigated the expression of NCR143/145 in all cancer cell lines tested. [score:1]
[1 to 20 of 25 sentences]
44
[+] score: 68
Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Several miR-143 targets, including DNMT3A and KRAS [32], [33], and miR-145 targets including BNIP3, IRS, C-MYC, YES and STAT1 [34]– [36], have been identified, indicating that miR-143 and 145 act as tumor suppressors to repress tumor proliferation or promote apoptosis. [score:7]
0033762.g004 Figure 4 Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Kaplan–Meier survival analyses revealed that the SCCC patients with low expression of has-miR-100 (P = 0.019) and has-miR-125b (P = 0.020) had a poorer prognosis compared to patients with high expression of these miRNAs, while has-let-7c (P = 0.071), has-miR-143 (P = 0.064), has-miR-145 (P = 0.072) and has-miR-199a-5p (P = 0.056) down-regulation tended to adversely affect survival. [score:7]
In this study, we observed that downregulation of six miRNAs (has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p) is associated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC patients (Table 1 ), suggesting that clustering analysis based on miRNA expression may facilitate a detailed individual diagnosis of SCCC patients. [score:6]
Recently, altered processing of miR-143 and 145 had been linked to metastasis [37]– [39], and our study suggests that down-regulation of miR-143 and 145 may also promote lymph node metastasis in SCCC. [score:4]
Interestingly, of the nine miRNAs associated with metastasis, downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were also significantly correlated with advanced tumor stage as described above. [score:4]
Downregulation of miR-143 and 145 are also observed in other tumor types including breast, gastric, liver, lung, bladder, pituitary, ovary and colon cancer [24]– [31]. [score:4]
In conclusion, this study has revealed that downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p are significantly correlated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC. [score:4]
Among, downregulation of six miRNAs, has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly associated with lymph node metastasis and reduced survival in SCCC. [score:4]
Seven miRNAs, has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down-regulated in advanced stage SCCCpatients (FIGO IB2-IV) compared to early stage SCCC patients (FIGOIB1). [score:3]
Kaplan-Meier estimates of overall survival in 44 patients with stage small cell carcinoma of the cervix according to has-let-7c (A), has-miR-100 (B), has-miR-125b (C), has-miR-143 (D), has-miR-145 (E) andas-miR-199a-5p expression (F). [score:3]
0033762.g006 Figure 6The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
Has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down- regulated in advanced stage SCCC, compared to early stage SCCC. [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
We also identified nine miRNAs (has-let-7c, has-miR-31, has-miR-100, has-miR-125b, has-miR-143, has-miR-145, has-miR-199a-5p, has-miR-203 and has-miR-218) which could significantly discriminate between tumor tissues from patients with metastasis (M, n = 13) and without metastasis (NM, n = 31, P<0.05). [score:1]
0033762.g005 Figure 5The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
Similarly, the sensitivity and specificity of discriminate presence or absence of lymph node metastasis for each miRNA were: has-let-7c (P = 0.030, has-miR-100 (P = 0.025), has-miR-125b (P = 0.007), has-miR-143 (P = 0.016), has-miR-145 (P = 0.009), has-miR-199a-5p (P = 0.008). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
The sensitivity and specificity of discriminate early from advanced tumour stages for each miRNA were plotted: has-let-7c (P = 0.009), has-miR-100 (P = 0.002), has-miR-125b (P = 0.003), has-miR-143 (P = 0.006), has-miR-145 (P = 0.004), has-miR-199a-5p (P = 0.015). [score:1]
[1 to 20 of 20 sentences]
45
[+] score: 65
We also found that treating Huh7.5 human hepatoma cell-derived tumor xenografts with DCLK1-specific siRNA resulted in tumor growth arrest, downregulation of DCLK1, and increased expression of tumor suppressor miRNAs let-7a, miR-200, and miR-143/145. [score:8]
Treatment of Huh7.5 human hepatoma cell-derived tumor xenografts with DCLK1-specific siRNA produced tumor growth arrest, DCLK1 downregulation, and increased expression of tumor suppressor miRNAs let-7a, miR-200, and miR-143/145. [score:8]
Figure 6DCLK1 regulates pluripotency via post-transcriptional regulation of miR-143/145 A. Following the knockdown of DCLK1 in Huh7.5 tumor xenografts, RT-PCR revealed a significant upregulation of miR-143 and miR-145 miRNA. [score:7]
These results show that DCLK1 negatively regulates miR-143/145, and DCLK1 knockdown may downregulate miR-143/154 downstream pluripotency transcription factors. [score:6]
We observed a significant (p < 0.01) upregulation (>2-fold) in miR-143 and miR-145 expression in tumors treated with NP-siDCLK1 compared with control and NP-siSCR -treated tumors (Figure 6A). [score:5]
DCLK1 controls pluripotency factors expression via post-transcriptional regulation of miR-143/145 in liver cancerWe previously demonstrated that DCLK1 post-transcriptionally regulates pluripotency factors via miR-143/145 in pancreatic cancer. [score:5]
A. Following the knockdown of DCLK1 in Huh7.5 tumor xenografts, RT-PCR revealed a significant upregulation of miR-143 and miR-145 miRNA. [score:5]
DCLK1 controls pluripotency factors expression via post-transcriptional regulation of miR-143/145 in liver cancer. [score:4]
DCLK1 regulates pluripotency via post-transcriptional regulation of miR-143/145. [score:3]
A significant (p < 0.01) downregulation (~50%) of miR-143/45 -dependent luciferase activity was observed in NP-siDCLK -treated cells compared with control and NP-siSCR -treated cells (Figure 6B). [score:3]
B. A decrease in luciferase activity (luciferase units) following transfection with plasmid-encoding luciferase containing the miR-143/145 binding site was observed following the knockdown of DCLK1 in Huh7.5 human liver cancer cells. [score:2]
We previously demonstrated that DCLK1 post-transcriptionally regulates pluripotency factors via miR-143/145 in pancreatic cancer. [score:2]
These findings revealed that DCLK1 regulates pluripotency factors via an miR-143/145 -dependent mechanism in liver cancer. [score:2]
mRNA isolated from siRNA -treated tumors were analyzed for miR-143 and miR-145. [score:1]
Huh7.5 cells were transfected with a vector containing firefly luciferase gene with complimentary miR-143/145 binding sites at the 3′UTR. [score:1]
pri-miR-143: forward: 5′-AGGGCCAGCAGCAGGC-3′, reverse: 5′-TCAGGAAATGTCTCTGGCTGTG-3′. [score:1]
The crossing threshold value was noted for pri-let-7a, pri-miR-144, pri-miR-143, pri-miR-145, and pri-miR-200a miRNAs, and normalized with U6 pri-miRNA. [score:1]
Huh7.5 cells were transfected with a plasmid containing the firefly luciferase (Photinus pyralis) gene with a complementary miR-143/145 and let-7a (separate plasmids) binding site at its 3′ UTR (Signosis, Inc. [score:1]
[1 to 20 of 18 sentences]
46
[+] score: 65
In this section, we will discuss the roles of certain miRNAs in prostate cancer as summarized in Table 2. Table 2 miRNAs that influence PCa progression miRNA Role in PCa Function Study miR-15a and miR-16 Tumor suppressors Inhibit cell proliferation, invasion and angiogenesis through regulation of multiple targetsAqeilan 2010 [25], Musumeci 2011[72] miR-21 Onco-miRNA Increases tumor growth, invasion and metastasisSi 2007 [79], Selciklu 2009 [80], Li 2009 [81], Ribas 2009 [82] miR-125b Onco-miRNA Increases cell proliferation and inhibits apoptosisLee 2005 [84], Shi 2007 [26], Vere White 2009 [85] miR-143 Tumor suppressor Inhibits cell proliferation and migration by regulating KRAS, MAPK pathways and cell cycle. [score:15]
In this section, we will discuss the roles of certain miRNAs in prostate cancer as summarized in Table 2. Table 2 miRNAs that influence PCa progression miRNA Role in PCa Function Study miR-15a and miR-16 Tumor suppressors Inhibit cell proliferation, invasion and angiogenesis through regulation of multiple targetsAqeilan 2010 [25], Musumeci 2011[72] miR-21 Onco-miRNA Increases tumor growth, invasion and metastasisSi 2007 [79], Selciklu 2009 [80], Li 2009 [81], Ribas 2009 [82] miR-125b Onco-miRNA Increases cell proliferation and inhibits apoptosisLee 2005 [84], Shi 2007 [26], Vere White 2009 [85] miR-143 Tumor suppressor Inhibits cell proliferation and migration by regulating KRAS, MAPK pathways and cell cycle. [score:15]
This information suggests that miR-143 and -145 may have a cell type-specific activity and could suppress only bone metastasis without inhibiting lymph node metastasis, and that the loss of these miRNAs could selectively promote metastasis, which could be due to deregulated expression of other miRNAs such as miR-221 [73]. [score:8]
The up-regulation of miR-143 in prostate cancer cells represses mesenchymal markers (vimentin and fibronectin) and increases the epithelial marker E-cadherin [1], while the up-regulation of miR-145 leads to the same effects except for vimentin [1]. [score:7]
K-RAS is a potential target of miR-143 [73], thereby lower levels of miR-143 in prostate cancer cells may be incriminated in carcinogenesis due to the lack of its inhibitory effect on K-RAS and MAPK pathway. [score:5]
Over -expression of miR-143 and -145 by retrovirus transfection decreased the ability of migration and invasion in vitro, and tumor development and bone invasion in vivo of PC-3 cells (a human PCa cell line originated from a bone metastatic PCa specimen) [73]. [score:4]
They also showed that miR-143 over -expression in prostate cancer cells represses proliferation and migration, thereby augmenting sensitivity to docetaxel by affecting EGFR/RAS/MAPK pathway. [score:3]
Studies have shown that miR-143 is considerably decreased in PCa, and its expression is further decreased during cancer progression [67]. [score:3]
Xu et al. [4] showed that miR-143 regulates K-RAS, p-ERK1/2, and cyclin D1 and plays a role in cell proliferation, migration, and chemosensitivity in prostate cancer. [score:2]
In PCa, miR-143 and miR-145 are deregulated in primary cancer compared with normal prostate tissue [64- 67]. [score:1]
The role of miR-143 and miR-145. [score:1]
We have discussed above the role of miR-143 in EMT. [score:1]
[1 to 20 of 12 sentences]
47
[+] score: 64
The past and present findings are summarized in Figure 6, where the multiple modes of action of Mg [2+] in Pi -induced VC are depicted: from its entry into the cell through TRPM7, its modulation of Ca/P crystal composition and structure, its modifications of calcification inhibitors, enhancement of cell viability, suppression of osteogenic differentiation, inhibition of Wnt/ β-catenin pathway, and finally its active influence on osteogenesis (Runx2, Osx, and Smad1) through specific miR modulation (miR-30b, miR-133a, and miR-143). [score:7]
It reveals three main findings: (i) our screening showed a downregulation of key miRs such as miR-30b, miR-133a, and miR-143 during Pi -induced calcification of HAVSMC; (ii) osteogenesis and VC markers related to these miRs, such as Smad1 and Osterix, were found to be modulated accordingly; and (iii) Mg [2+] had a protective effect by interfering with the Pi -induced VC process as the modulations of the affected miRs and their related targets were partially abrogated or even improved. [score:6]
We are now able to assert that Mg [2+] is effective relatively early during Pi -induced VC by cancelling osteogenic gene expression through miR-30b/miR-133a/miR-143 expression reinforcement, resulting in a retention of the SMC phenotype. [score:5]
During osteogenic differentiation of MC3T3-E1 cells, miR-143 had decreased levels of expression and had a role in osteogenesis inhibition. [score:5]
Downregulation of miR-143/145 was previously studied during HAVSMC Pi -induced calcification by our team [27], thus supporting the present results. [score:4]
Moreover, Osx was identified to be a direct target of miR-143 [29]. [score:4]
Mg [2+] Prevents miR-143 Pi-Induced Decrease Expression Figure 3(c) shows the time course of miR-143 regulation for the various conditions. [score:4]
As suggested in [29], these results are correlated and could be mirrored to miR-143 expression. [score:3]
Conversely, Mg [2+] constantly increased miR-143 levels from the early time points until day 10 over the time course, resulting in a significant difference between the Pi 3 mM and Pi 3 mM + Mg [2+] 2 mM conditions on day 7. A decrease of miR-143/145 is correlated with several important cardiovascular diseases; for review see [9]. [score:3]
Here, regarding miR-143 modulation, Osx was tested as its most important putative target in the field of VC. [score:3]
Indeed, vascular smooth muscle-specific miR-143 expression was decreased in aortas of ApoE [−/−] mice in states of atherosclerosis and/or CKD during VC progression. [score:3]
Mg [2+] Prevents miR-143 Pi-Induced Decrease Expression. [score:3]
A recent report established Osx as a target of miR-143 in in vitro osteogenesis [29]. [score:3]
At day 3, Pi 3 mM significantly lowered miR-143 expression, and this decrease remained stable until day 10, although not reaching statistical significance on days 7 and 10. [score:3]
In summary, we found that Pi, the most prominent natural inducer of VC, was able to decrease the expression of miR-30b/miR-133a/miR-143. [score:3]
Figure 3(c) shows the time course of miR-143 regulation for the various conditions. [score:2]
Our data suggest that Mg [2+] is able to antagonize the Pi -induced decrease of 3 miRs (miR-30b, miR-133a, and miR-143) involved in mineralization processes or SMC phenotypic switch. [score:1]
First described to contribute to the VSMC phenotypic switch [18, 27], miR-143 was recently involved in VC of uremic mice [34]. [score:1]
Our results confirmed the implication of miR-30b in calcification and brought miR-133a as well as miR-143 from phenotypic switch and vascular remo deling into the field of VC. [score:1]
[1 to 20 of 19 sentences]
48
[+] score: 62
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Several miRNAs are upregulated in adipose tissue in animal mo dels of metabolic disease and/or obesity, e. g. mir-125a [31], mir29 [32], and mir-143 [33], while adipose tissue miR-519d expression is associated with human obesity [15]. [score:8]
Both miR-21 and miR-143 show an altered expression level in cancer: miR-21 is upregulated 5-fold in colorectal cancer, when compared with adjacent non-tumour tissue, while miR-143 is downregulated 3-fold [54]. [score:8]
Mir-21 showed higher expression in persons with a BMI >30, while mir-143 showed lower expression in persons with a BMI >30 (p < 0.05), see Figure 4. There was a strong positive correlation of mir-21 expression in human adipose tissue with BMI (p < 0.001, see Figure 5). [score:7]
Of these 10 miRNAs, only mir-21, mir34c and mir-143 were differentially expressed between mature adipocytes and preadipocytes (p < 0.05), see Table 1 and Figure 2. Mir-34c upregulation during brown adipocyte maturation was in contrast to our microarray data and this result must be treated with caution. [score:6]
Nevertheless, the miRNAs mir-34c, mir-143, mir-24, mir-720 and mir-21 showed robust expression in the adipocyte cultures, and these 5 miRNAs were thus profiled in subcutaneous adipose tissue from healthy humans with different BMIs to examine their regulation in adipose tissue expansion. [score:4]
We also decided to follow up on miR-143, which we found upregulated in both white and brown adipocytes, as mir-143 is induced upon differentiation of human preadipocytes and 3T3-L1 fibroblasts [25- 27]. [score:4]
miR-143 and also miR-103 can induce adipogenesis in 3T3-L1 adipocytes and augment or accelerate expression of several key adipogenesis-regulated genes, such as FABP4 and adiponectin [27]. [score:4]
MiR-143 and miR-181a were expressed in both white and brown adipocytes during both developmental stages and showed a trend for a 2-fold enrichment in white adipocytes, similarly to what was found by Walden et al. [16]. [score:4]
Xie et al. [27] identified miR-143, miR-148a, miR-30c, miR146b as being upregulated during in vitro differentiation of 3T3-L1 cells, which is identical to our findings. [score:4]
The miRNAs targeting Sirt1 include miR-143, miR-23b miR-34c as well as mir-34a [51, 52]. [score:3]
Figure 2 Expression levels of mir-21, mir-34c and mir-143 in primary murine brown and white preadipocytes and mature adipocytes (n = 3+3 for each tissue). [score:3]
Of the miRNAs we described in the murine primary cell cultures, miR-21 and miR-143 were differentially expressed in healthy non-obese persons (BMI <30) versus obese persons (BMI >30). [score:3]
Five miRNAs (mir-21, mir-143, mir-34c, mir-24 and mir-720) were profiled in subcutaneous adipose tissue from healthy humans with varying degrees of obesity. [score:1]
The first miRNA found to play a role in maturation of human adipocytes was miR-143 [25, 26]. [score:1]
Of the 10 miRNAs that showed expression in the adipocyte cultures, we chose a subset of 5 miRNAs (mir-34c, mir-143, mir-24, mir-720 and mir-21) to measure in human adipose tissue RNA samples from obese persons (BMI >30, n = 10) and non-obese persons (BMI <30, n = 10). [score:1]
Figure 4 Expression levels of mir-21, mir-24, mir-34c, mir-143 and mir-720 were measured in subcutaneous adipose tissue of obese (BMI >30, n = 10) and non-obese (BMI <30, n = 10) healthy persons. [score:1]
[1 to 20 of 16 sentences]
49
[+] score: 52
In a high-fat diet mo del of obesity miR-143 was found to be upregulated in mesenteric adipose tissue of mice, yet only a modest downregulation of miR-143 target protein ERK5 was observed in-vivo [62]. [score:9]
The findings of these studies are summarized in Table 1. In adipose tissue of obese mice increased miR-143 expression is associated with parallel alterations in PPARγ and aP24 which are markers of adipocyte differentiation [62], although an earlier study reported downregulation of miR-143 in obese mice [55]. [score:6]
TNF-α treatment of differentiated adipocytes downregulated miR-103 and miR-143 expression, although the mechanism responsible remains unknown [55]. [score:6]
A screening study of adipogenic using ASO (anti-sense oligonucleotides) directed at a large panel of in human primary sub-cutaneous pre-adipocytes revealed inhibition of miR-9* and miR-143 suppressed the adipogenic markers GLUT4, HSL, FABPaP2, PPAR-γ2 and triglyceride accumulation [60]. [score:6]
The upregulation of miR-143 in mesenteric fat was associated with body weight, plasma leptin concentration, PPARγ mRNA and aP2 mRNA levels [62]. [score:4]
One study demonstrated ERK5 (Extracellular-signal-regulated kinase 5) is targeted by miR-143 in human pre-adipocytes [60]. [score:4]
For example, miR-143 was reported to be upregulated in mesenteric fat of mice fed a high-fat diet for 8 weeks [62]. [score:4]
Ideally studies are needed to determine whether triglyceride accumulation can be altered by miR-143 inhibition in mature adipocytes. [score:3]
There have been few reports of experimental validation of miR-143 targets in adipocytes. [score:3]
Ectopic miR-143 expression during differentiation of 3T3-L1 pre-adipocytes resulted in twice the level of triglyceride accumulation early during differentiation [55]. [score:3]
If miR-143 is pro-adipogenic then developing miR-143 inhibitors may be a useful approach to slow down adipocyte differentiation and lipid droplet formation. [score:3]
miR-143 is also reported to be strongly induced during pre-adipocyte 3T3-L1 differentiation [55, 61, 58] and human pre-adipocyte differentiation [60]. [score:1]
[1 to 20 of 12 sentences]
50
[+] score: 52
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-21, hsa-mir-25, hsa-mir-16-2
Data show that the expression of miR-H25 (10 nM) suppresses miR-143 expression in both cell lines. [score:7]
The effect of miR-H25 on miR-143 seems unrelated to nonspecific down-regulation of miRNA processing, as no significant difference between miR-H25 negative and positive patients in the overall expression of non-coding RNA was observed (Fig. 9D). [score:6]
Only miR-H25 produced a significant down-regulation of miR-143 expression (Fig. 10). [score:6]
0114750.g009 Figure 9Box-whisker plot chart showing the expression of miR-143 (TPM) according to expression of miR-H25 (A) and miR-BART7 (B). [score:5]
The influence of miR-H25 on miR-143 expression may, in fact, be specific and direct; we were able to reproduce the same phenomenon in vitro utilizing two SEOC cell lines (A2780 and S KOV-3) transfected with a synthetic miR-H25. [score:4]
The chart shows a significant downregulation of miR-143 in women positive for miR-H25 (p<0.001, t-test) but not in patients positive for miR-BART7. [score:4]
Patients with high expression of miR-143 exhibit a significantly worse outcome compared to patients with low miR-143 expression (P<0.001, Wilcoxon test). [score:4]
In A–C and B–D the expression of miR-H25 and miR-143, respectively. [score:3]
0114750.g010 Figure 10 In A–C and B–D the expression of miR-H25 and miR-143, respectively. [score:3]
For example, women with high levels of miR-H25 (Fig. 9A) but not miR-BART7 (Fig. 9B) showed a significant reduction in the expression of miR-143. [score:3]
Kaplan-Meier analysis of patients according to the expression of miR-143 (C). [score:3]
MiR-H25 may exert its effects by hijacking host RNA processing and down -regulating human miR-143, a potent miRNA in human cellular function [28]. [score:2]
In the case of miR-143 and ADH1B, a cutoff value has been optimized after setting a ROC curve as previously described [34]. [score:1]
MiR-143 is a potent miRNA, which, in the TCGA study, was related to poor outcome in the multivariate Cox mo del (HR 14.8, CI 5.9–37.9, p<0.001) and Kaplan-Maier analysis (Fig. 9C). [score:1]
[1 to 20 of 14 sentences]
51
[+] score: 50
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-128-2
The 2′ O-methyl -modified mRNA oligonucleotides miR-128-CYP2C9-target, miR-128-PAIP2-target1, miR-128-PAIP2-target2, miR-128-PFKFB4-target, and miR-143-CYP2C9-target were labeled with IRDye®800 (LI-COR Biosciences, Lincoln, NE) dye on their 5′ ends. [score:11]
We first transfected the hsa-miR-128-3p or hsa-miR-143-3p mimics into liver HepG2 and kidney 293T cells, together with a reporter gene (luciferase) plasmid containing the core region of CYP2C9 3′-UTR, and found that hsa-miR-128-3p suppressed luciferase activity in both liver cells and kidney cells, while hsa-miR-143-3p exhibited a relatively smaller suppression effect only in kidney cells. [score:5]
The hsa-miR-128-3p and hsa-miR-143-3p suppressed reporter gene expression. [score:5]
The miRNA hsa-miR-143 was reported as a tumor suppressor in cervical cancer 40 and prostate cancer 41, by suppressing KRAS, ERK5, and other genes. [score:5]
To test the potential effects of hsa-miR-128-3p and hsa-miR-143-3p on CYP2C9 expression, a reporter construct retaining the core region of the CYP2C9 3′-UTR that harbors the putative binding sites for hsa-miR-128-3p and hsa-miR-143-3p was constructed and then co -transfected into HepG2 and 293T cells together with the hsa-miR-128-3p mimic, hsa-miR-143-3p mimic, or miRNA negative control. [score:3]
The solid vertical line indicates base pairing and the numbering used for the hsa-miR-128-3p and hsa-miR-143-3p target sequences (88–108 or 161–181, respectively) is consistent with that given for the CYP2C9 3′-UTR in NM_000771. [score:3]
hsa-miR-128-3p and hsa-miR-143-3p suppress CYP2C9 3′-UTR luciferase reporter. [score:3]
In contrast, hsa-miR-143-3p exhibited a similar significant suppression effect in 293T cells only (31%, P < 0.001), while the effect in HepG2 cells was marginally significant (14%, P = 0.062). [score:3]
Compared to the related hsa-miR-143-3p complex, the enhanced thermodynamic stability predicted for the hsa-miR-128-3p complex with its CYP2C9 3′-UTR target sequence correlated with results from RNA EMSA experiments, confirming the in vitro stability of the latter complex only. [score:2]
There was no evidence of an interaction between CYP2C9 3′-UTR and hsa-miR-143-3p (Fig. 2a). [score:1]
Arrow indicates an oligonucleotide complex (yellow) in Lane 3. * or † indicates the CYP2C9 mRNA oligonucleotides retaining the hsa-miR-128-3p or hsa-miR-143-3p recognition sites, repectively. [score:1]
In silico analysis predicted that hsa-miR128-3p and hsa-miR143-3p might form complexes with target sequences present in the 3′-UTR of CYP2C9 to yield unique structures with different calculated free energies of binding: −23.9 kcal/mol for hsa-miR128-3p (Supplementary Fig. S2a) and −16.1 kcal/mol for hsa-143-3p (Supplementary Fig. S2b). [score:1]
Interaction between CYP2C9 3′-UTR and hsa-miR-128-3p or hsa-miR-143-3p. [score:1]
293T and HepG2 cells were transiently transfected with the CYP2C9- CU, CYP2C9-MUT1-CU (containing a mutated sequence in the 3′UTR of CYP2C9), or CYP2C9-MUT2-CU (containing another mutated sequence in the 3′-UTR of CYP2C9) plasmid, together with 50 nmol/L hsa-miR-128-3p mimic, hsa-miR-143-3p mimic, or miRNA negative control, respectively, and harvested 48 hours after transfection. [score:1]
The miRNA oligonucleotides hsa-miR-128-3p and hsa-miR-143-3p were labeled with cy5.5™ dye on their 5′ ends. [score:1]
To determine whether or not hsa-miR-128-3p or hsa-miR-143-3p is able to bind its cognate CYP2C9 3′-UTR mRNA sequence in vitro, RNA EMSA was performed. [score:1]
When the cells reached 70%–80% confluence, they were transfected with the CYP2C9-CU plasmid (100 ng/well) that contains the 3′-UTR of CYP2C9 together with 50 nmol/L (final concentration) hsa-miR-128-3p mimic, hsa-miR-143-3p mimic, or miRNA negative control (Thermo Scientific, Tewksbury, MA) using the Lipofectamine reagent 2000 (Life Technologies, Carlsbad, CA). [score:1]
Several miRNAs, including hsa-miR-128-3p and hsa-miR-143-3p, were identified in all three databases. [score:1]
When hsa-miR-143-3p was examined, no statistically significant results were obtained (Data not shown). [score:1]
[1 to 20 of 19 sentences]
52
[+] score: 49
We found that suppression of miR-143 led to a strong increase in the hepatic expression of PPARγ and blocked the ability of leucine to induce both MSTN and FOXA2 expression. [score:7]
Moreover, leucine supplementation alters the expression of several small RNA species including miR-143, miR-335 and miR-92b*, which target main gene regulators of these effects. [score:6]
As expected, the expression of miRNA-143 was reduced 1.5-fold (P ≤0.05), while that of miRNA-92b* and miR-335 was upregulated 1.8- and 1.5-fold (P ≤0.05) at 2.5 mM of leucine, respectively (Figure  5B). [score:6]
Following miR-143 suppression, leucine supplementation induced a significant increase in PPARγ expression by 6- and 8.6-fold at 0.1 mM and 2.5 mM leucine, respectively, compared to cells without miR-143 suppression (Figure  5C). [score:6]
On the contrary, miRNA-143 suppression led to a reduced MSTN expression by 50% (P ≤0.01) in the presence of leucine, suggesting that MSTN is also regulated in a miR-143 dependent manner. [score:6]
This is in contrast to our earlier observation that leucine induced a modest 1.6-fold increase in HepG2 cells (without miR-143 suppression; Figure  2A), suggesting an inhibitory effect of miR-143 on PPARγ via leucine. [score:5]
Finally, differential expression of specific target genes measured after inhibition of miR-143 (C), miR-92b* (D) and miR-335 (E) using selective siRNAs. [score:5]
In particular, expression of miR-143, miR-17-92b and miR-335 are significantly altered in diet -induced obese mice [46], during 3 T3-L1 adipocyte differentiation [47], and in human adipose tissues inflammation [48]. [score:3]
We validated the expression of leucine -dependent microRNAs in HepG2 cells, including miR-143, miR-92b*, miR-335, miR-181d, miR-3185 and miR-4763 by real-time PCR (qPCR) (Table  1). [score:3]
The cDNA synthesis was carried out with 2 μg total RNA using a miScript II RT Kit (Qiagen, Hilden, Germany), and expression of the miR-143, miR-92b*, miR-335, miR-181d, miR-3185 and miR-4763 was assayed with a a miScript SYBR Green PCR kit (Qiagen, Hilden, Germany). [score:2]
[1 to 20 of 10 sentences]
53
[+] score: 47
0021249.g002 Figure 2By qPCR analysis, (A) miR-143 and (B) miR-145 was up-regulated (compared to U6 expression) in LPC epithelia, when compared to CC (P<0.001, Mann Whitney U-test). [score:4]
By qPCR analysis, (A) miR-143 and (B) miR-145 was up-regulated (compared to U6 expression) in LPC epithelia, when compared to CC (P<0.001, Mann Whitney U-test). [score:4]
Among them, miR-143 and miR-145 were expressed predominantly in the limbal epithelium but at very low levels in the central corneal epithelium. [score:3]
We found expression of miR-143/145 cluster in human corneal epithelium. [score:3]
Over -expressions of miR-143 and miR-145 were shown by GFP live imaging (Figs. 3A–B, miR-143; 3C–D, miR-145) and qPCR (Fig. 3E). [score:3]
In this study, miR-143/145 were expressed in the limbal epithelium, in particular the parabasal wing cell layers, but not in the central corneal and basal limbal epithelia. [score:3]
On the other hand, miR-145 -transfected cells showed relatively stronger Cnx-43 expression (Fig. 3K), which was mild in cells transfected with scrambled sequences (Fig. 3I) or miR-143 (Fig. 3J). [score:3]
Validation of miR-143 and miR-145 expression in limbal epithelium. [score:3]
With about 88% efficiency in our PCR amplification system, LPC had miR-143 and miR-145 expressions 26.6-fold and 36.5-fold higher than CC epithelia respectively. [score:3]
Cluster miR-143/145 was expressed strongly in LPC but weakly in CC epithelia (P = 0.0004, Mann-Whitney U-test). [score:3]
By immunofluorescence, both miR-143 and 145 -transfected cells had increased CK3/12 expression (Figs. 3G and H), when compared to cells transfected with scrambled sequences (Fig. 3F). [score:2]
Transfection analysis of miR-143 and miR-145. [score:1]
We hybridized the corneal rim cryosections with denatured DIG-labeled LNA-miRCURY oligo probes for miR-143 (Fig. 2C), miR-145 (Fig. 2E), scrambled sequences (Fig. 2G) and U6 (Fig. 2H). [score:1]
0021249.g003 Figure 3 (A–D) Human P2 CEPCs transfected with (A and B) Lenti-miR-143 and (C and D) Lenti-miR-145. [score:1]
Localization of miR-143 and miR-145 in human corneal rim specimens was shown by LNA -based in situ hybridization. [score:1]
Human P2 CEPCs transfected with miR-143, miR-145 or scrambled sequences were expanded to monolayer cell sheet on denuded AM in submerged culture, followed by air-lifting to induce cell stratification. [score:1]
Immunofluorescence of (F–H) cytokeratin-3/12 and (I–K) connexin-43 in CEPCs transfected with (F, I) scrambled sequence, (G, J) Lenti-miR-143 and (H, K). [score:1]
At higher magnification, (D) miR-143 and (F) miR-145 were present in parabasal layers. [score:1]
After normalization with the respective U6, ΔCT of miR-143 was 5.9±0.8 in LPC and 11.1±0.9 in CC epithelia (P = 0.0006, Mann Whitney U-test) (Fig. 2A). [score:1]
Locked nucleic acid -based in situ hybridization on corneal rim cryosections showed miR-143/145 presence localized to the parabasal cells of limbal epithelium but negligible in basal and superficial epithelia. [score:1]
Located in human chromosome 5 and rodent chromosome 18, miR-143/145 are co-transcribed as one microRNA cluster from the same microRNA precursor. [score:1]
In contrast to U6 as the positive control and scrambled sequence as the negative control, miR-143 and miR-145 were more intensively detected in the limbal epithelium, but low to negligible in the corneal epithelium. [score:1]
As shown in Figures 2D and F under higher magnification, miR-143 and miR-145 were present predominantly in the parabasal layers, with the intensity reducing towards the superficial layers. [score:1]
The epithelium generated from miR-143 -transfected CEPCs had morphology and compactness intermediate between control and miR-145 epithelia (8.3±1.6 layers) (Fig. 4C). [score:1]
[1 to 20 of 24 sentences]
54
[+] score: 45
In oral cancer, the expression of OIP5 may not be regulated at the post-transcription level as the miR-143/145, miR-200 and let-7 family microRNAs were reported to be downregulated in oral cancer 9, 11, 14. [score:7]
However, OIP5 was targeted by stemness regulatory miR-143/145, EMT associated miR-200 family and oral cancer-specific tumor suppressor let-7 family. [score:6]
Moreover, systematic epigenomic analysis of OIP5-AS1 suggested that the positive transcriptional regulation of OIP5-AS1 by co-expressed NEAT1, TUG1 and HOTAIR by recurring miR-143/145 targeting the stemness associated transcription factors might account for the maintenance of stemness and dedifferentiation in tumors and accounts for poor prognosis. [score:6]
Further, all 3 lncRNAs harbored interaction sites for miRNAs targeting Yamanaka factors, especially for miR-143/145 suggesting that overexpressed NEAT1, HOTAIR and TUG1 could modulate the post-transcriptional control of the stemness factors by sponging miR-143/145. [score:5]
Therefore, the co -expression of lncRNA NEAT1, HOTAIR and TUG1 has pivotal role not only in sponging stemness TFs targeting miR-143/145 but also interacts with active euchromatins to maintain stemness properties. [score:5]
Interestingly, we also found many MREs for stemness regulatory miRNAs miR-143/145 family, EMT regulatory miRNA miR-200a/miR-200b/miR-141, TP53 induced miR-34a, let-7, and several other oral cancer specific tumor suppressive miRNAs in OIP5 mRNA 3′-UTR (Supplementary Table  S7). [score:5]
OIP5-AS1 in addition activates co -expression of NEAT1, TUG1 and HOTAIR which sponges stemness regulatory miR-143/145 and maintains the steady state level of stemness TFs. [score:4]
The sponging of miR-143/145 also facilitates the overexpression of OIP5 mRNA. [score:3]
However, all the lncRNAs harbor binding sites for miR-143/145 which regulates the Yamanaka factors suggesting that these lncRNAs can collectively maintain stemness in tumors by modulating the Yamanaka factors (Supplementary Table  S7). [score:2]
One such important function of miR-200 family is regulation of epithelial to mesenchymal transition and miR-143/145 is to maintain the stemness 9, 14. [score:2]
[1 to 20 of 10 sentences]
55
[+] score: 43
In human cancer cells, miR-143 is one of the most notable tumor suppressor miR -RNAs, which can directly inhibit oncogene KRAS translation and block the downstream signal pathways [29]. [score:8]
Restoring miR-143 expression inhibited proliferation and induced apoptosis by targeting BCL2 [30, 31]. [score:7]
Expression of miR-143, -34a, or -29a led to the increased expression of some of the senescence markers. [score:5]
While expression of miR-34a increased p16 [INK4a], p15 [INK4b], DcR2, and Dec1 transcripts, expression of miR-143, or 29a increased the p15 [INK4b] and DcR2 transcripts (Figures 3(c)– 3(e)). [score:5]
Among the microRNAs that are induced by the BRaf gain-of-function mutation, only miR-143 or -34a is sufficient to induce growth arrest and senescence when ectopically expressed in primary melanocytes. [score:4]
Expression of miR-143 or -34a but not -29a or -100 led to a decrease in melanocyte proliferation as measured by the expression of proliferation marker protein ki-67. [score:3]
Among them, miR-143 or -34a alone can induce growth arrest and senescence when expressed in primary melanocytes. [score:3]
Unlike miR-34a, miR-143 only increased expression of p15 [INK4b] and DcR2. [score:3]
In addition, we showed that oncogenic BRaf also significantly increased the expression of miR-143, miR-34a, let-7c, miR-15a, miR-29a, miR-100, miR-181a, and miR-181d. [score:3]
To investigate directly their role in cellular senescence, we measured cell proliferation by quantifying the number of melanocytes expressing the proliferation marker protein ki-67 due to the expression of miR-143, 34a, or 29a. [score:2]
[1 to 20 of 10 sentences]
56
[+] score: 41
Prior to validating whether miR-583 and miR-143 contributed to targeted suppression of IL2Rγ expression, we analyzed the expression kinetics of miR-583 and miR-143, as well as the well-known miRNAs miR-223 and miR-150, during NK cell differentiation using real-time qPCR (Fig. 3b). [score:9]
Based on the data presented in Fig. 2, we chose the 4 miRNAs (miR-583, miR-143, miR-200b and miR-1181) that were significantly downregulated in mNK cell, which suggested an inhibition of target genes by the predicted miRNAs. [score:8]
To determine whether IL2Rγ expression is regulated by the miR-583 and miR-143 miRNAs as predicted, we examined the mRNA and protein expression of IL2Rγ during NK cell differentiation. [score:6]
Our results were consistent with the microarray data presented in Fig. 2 showing that the expression of miR-583, miR-143 and miR-223 were decreased; however, the expression of miR-150 was increased during NK cell differentiation. [score:5]
Given these collective data, we hypothesized that miR-583 or miR-143 may play a role in NK cell differentiation through the regulation of IL2Rγ expression. [score:4]
To investigate the biological effects of miRNAs on NK cell development, miR-583 and miR-143 were validated as regulators of NK cell differentiation by targeting IL2Rγ. [score:3]
The expression of miR-143, miR-223, miR-150 and miR-583 was analyzed by real-time qPCR. [score:3]
Importantly, both miR-583 and miR-143 were highly correlated with subunit IL2Rγ of the IL2 receptor, related to the IL-15 signaling pathway. [score:1]
0108913.g005 Figure 5(a) Differentiating cells were transfected with miR-143, a miR-583 mimic or negative control miRNA. [score:1]
In contrast, the introduction of a miR-143 mimic resulted in similar percentages of mature CD56 [+]CD3 [−] NK cells and mimic controls (Fig. 5a). [score:1]
[1 to 20 of 10 sentences]
57
[+] score: 41
CleavageHorseeca-miR-143AKT1 (Predicted)479 aa98Glucose homeostasis, positive regulation of glucose import, positive regulation of glycogen biosynthetic process, response to food, glucose transportCleavage Dog cfa-miR-143 AKT1 (Predicted) 479 aa 97 Glucose homeostasis, positive regulation of glucose import, positive regulation of glycogen biosynthetic process, response to food, glucose transport CleavageOver -expression of hsa- miR-143 inhibits insulin-stimulated AKT activation and impairs glucose metabolism [83]. [score:9]
Example of conserved disease miRNA targets linked to type 2 diabetes is included in this article (Figure  7, Table  2) and more targets are shown as Additional file 3. Figure 7 Comparative structural analysis of human hsa-miR-143 and its animal orthologs. [score:7]
Example of conserved disease miRNA targets linked to type 2 diabetes is included in this article (Figure  7, Table  2) and more targets are shown as Additional file 3. Figure 7 Comparative structural analysis of human hsa-miR-143 and its animal orthologs. [score:7]
As demonstrated using hsa-miR-143-3p which has been associated with diabetes type 2 [84] (Figure  7 and Table  2) it is logical that similar miRNAs perform comparable functions across related species, and therefore diseases correlated with miRNAs in one species may be correlated with homologous miRNA expression and disease in related species. [score:7]
CleavagePigssc-miR-143-3pAKT1 (Predicted)480 aa100Glucose homeostasis, positive regulation of glucose import, positive regulation of glycogen biosynthetic process, response to food, glucose transport. [score:3]
The hsa-miR-143-3p target gene is AKT1 [84] which has 97- 100% sequence identity with AKT1 found in pig, horse and dog. [score:3]
As an example we demonstrated conservation of human hsa-miR-143-3p which is associated with type 2 diabetes and targets AKT1 gene which is highly conserved in pig, horse and dog. [score:3]
We found that the hsa-miR-143 which is located on the right arm (3′) of its pre-miRNA is highly conserved in pig, horse and dog. [score:1]
The example of diabetes type 2 -associated miRNA hsa-miR-143-3p gave a highlight on how to link disease -associated elements across species and develop hypothesis -driven investigation in animals. [score:1]
[1 to 20 of 9 sentences]
58
[+] score: 40
We prepared D-probe-143-(7) with seven nucleotides complementary to the 3′ end of the target miR-143 and C-probe-143-(14) with 14 nucleotides complementary to the 5′ end of the target. [score:5]
Because the normal HEK293 cell line expresses a small amount of miR-143 which is hardly detected, we prepared a HEK293 cell line engineered to over-express miR-143 in order to examine accurately whether qRT-PCR and LASH show the same result or not. [score:5]
Mature miR-143, 21 nucleotides in length, is down-regulated in prostate cancer and is, therefore, a potential biomarker of prostate cancer [31]. [score:4]
HEK293 cells, a human embryonic kidney cell line (CRL-1573) and HEK293 cells over -expressing miR-143 [28] were a kind gift from Dr. [score:3]
MiR-141, 5′-(UAA CAC UGU CUG GUA AAG AUG G)-3′, miR-143, 5′-(UGA GAU GAA GCA CUG UAG CUC)-3′, miR-21, 5′-(UAG CUU AUC AGA CUG AUG UUG A)-3′, miR-16, 5′-(UAG CAG CAC GUA AAU AUU GGC G)-3′, miR-92a, 5′-(UAU UGC ACU UGU CCC GGC CUG U)-3′ and cel-miR-39, 5′-(UCA CCG GGU GUA AAU CAG CUU G)-3′ were used as the target sequences. [score:3]
In addition, a passenger strand of miR-143, which is produced with mature miR-143 from the miR-143 precursor, was used as a negative control. [score:1]
This is thought to be due to miR-143 contamination or/and cross-hybridization between spiked-in miR-141 and the TaqMan probes for miR-143. [score:1]
Among the four probe sets, the D8 probe set showed the highest signal intensity of D-probe bound to miR-143 (Figure 2B). [score:1]
We cultured normal HEK293 cells as well as HEK293 cells transfected with a vector containing pri-miR-143 (termed miR-143-HEK cells). [score:1]
Surprisingly, PBS buffer with miR-141 showed a very small miR-143 signal of ∼0.0015 pM. [score:1]
The upper axis indicates the final concentration of input miR-143 in the hybridization chamber while the lower axis indicates the total amount of input miR-143. [score:1]
D-probe-143-(7), p-5′-(CTC AAC TGG TGT CGT GGA(-Alexa647) GTC GGC AAT TCA GTT GAG GAG CTA C ) -3′ was used as a detection probe (termed D-probe) to detect miR-143. [score:1]
0090920.g002 Figure 2 (A) Complementary sequences of four probe sets for miR-143. [score:1]
Figure S3 Standard curves of synthetic cel-miR-39, miR-143, miR-21, miR-16 and miR-92a generated by qRT-PCR. [score:1]
Therefore, we subtracted its value from raw miR-143 concentration data and we show the corrected concentrations in Figure 4. (TIF) Click here for additional data file. [score:1]
This improves the hybridization yield ∼50,000 times, and we could quantify miR-143 at concentrations ranging from 30 fM –30 pM (10 amol –10 fmol in 0.3 ml of sample solution). [score:1]
Quantification of Extracellular miR-143 Exported from HEK293 Cells. [score:1]
The concentration of synthetic miR-141, which was spiked in all media before purification, was used to correct for any variability of miR-143 detection. [score:1]
For miR-143, four probe sets were prepared as follows. [score:1]
As expected, the signal of D-probe-143-(8) with the passenger strand was lower than the detection limit even in the presence of 10,000 fmol of the passenger strand, which indicated that the sensitivity for miR-143 is at least 10 [6] times greater than the sensitivity for the passenger strand. [score:1]
Total miRNAs were purified from culture media collected from HEK293 cells, HEK293 cells transfected with primary miR-143 vector (HEK293*) or from PBS buffer only. [score:1]
A passenger strand of miR-143, 5′-(GGU GCA GUG CUG CAU CUC UGG U)-3′ was used in negative control experiments. [score:1]
Designs of C-probes were 5′-(GTGCTTCATCTC-(ACA) [15]-AC)-3′ for miR-143, 5′-(AGTCTGATAAGCTA-(ACA) [15]-A)-3′ for miR-21, 5′-(TTTACGTGCTGCTA-(ACA) [15]-A)-3′ for miR-16, 5′-(GGACAAGTGCAATA-(ACA) [15]-A)-3′ for miR-92a and 5′-(TTTACACCCGGTGA-(ACA) [15]-A)-3′ for cel-miR-39. [score:1]
Normal HEK293 cells released very low levels of miR-143 as described previously [28]. [score:1]
qRT-PCR was also unable to quantify miR-143 from normal HEK293 cells because the estimated miR-143 concentration was similar to background levels (0.0015 pM) (Figure S2B). [score:1]
[1 to 20 of 25 sentences]
59
[+] score: 39
Among D3 UM with liver metastasis (n = 6), higher expressions of miR-149* (83.3%), miR-1238 (83.3%), miR-199a (100%); moderate expressions in miR-134 (50%), miR-214 (50.0%), while lower expressions of miR-146b (33.33%) and let-7b (25%) and negative expression in miR-143 (100%) were observed. [score:9]
Among M3 UM with liver metastasis (n = 11), higher expressions of miR-149* (72.72%), miR-1238 (100%), miR-134 (100%), miR-214 (54.54%), miR-146b (54.54%), miR-199a (100%) while moderate expression of miR-143 (45.45%) and negative expression of let-7b (100%) was observed. [score:7]
Among M3 UM with no history of liver metastasis (n = 40), higher expressions of miR-149* (90.0%), miR-1238 (97.5%) and miR-134 (57.5%), miR-214 (62.5%), miR-146b (67.5%), miR-143 (65.0%), miR-199a (90.0%) and lower expression of let-7b (30.0%) were observed. [score:5]
Among D3 UM with no liver metastasis (n = 29), higher expressions of miR-149* (72.41%), miR-1238 (86.2%), miR-199a (82.75%), miR-134 (41.37%), miR-214 (41.37%) and miR-146b (58.62%), while lower expression of miR-143 (37.93%), let-7b (13.79%) were observed (S6 Table and Fig 3). [score:5]
Among the five miRNAs previously shown as class 2 tumor discriminators [13], four up-regulated miRNAs (miR-214, miR-143, miR-146b and miR-199a) showed a significant association with M3 tumors while the other miRNA, let-7b did not show any significant association with M3 UM (Fig 3). [score:4]
Five miRNAs (miR-214, miR146b, miR-143, miR-199a and miR-134) were found to be differentially expressed in M3/ D3 UM tumors. [score:3]
Differential expression of 8 miRNAs: miR-214, miR-149*, miR-143, miR-146b, miR-199a, let7b, miR-1238 and miR-134 were studied. [score:3]
miR-143 is known for its oncogenic activity together with KRAS (Kirsten rat sarcoma viral oncogene homolog), NF-kB (Nuclear factor kappa B) genes in cancers [31, 32]. [score:1]
In the second study, 6 miRNAs (let-7b, miR-199a, miR-199a*, miR-143, miR-193b, and miR-652) were identified to differentiate class 1 and class 2 UM tumors [13]. [score:1]
Three miRNAs: miR-149*, miR-1238 and miR-134 (which were in common with supervised and unsupervised data analysis; Fig 1C) and 5 miRNAs: miR-214, miR-143, miR146b, miR-199a and let7b (earlier shown as class 1/ class 2 discriminators) [13] were selected for validation. [score:1]
[1 to 20 of 10 sentences]
60
[+] score: 38
Out of the eight miRNAs, miR-648 was up-regulated and the seven remaining miRNAs were down regulated (miR-744-5p, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-423-3p and miR-766-3p). [score:5]
The cardiomyogenesis regulator miR-143 is highly expressed during vascular smooth muscle cell differentiation and is involved in normal function and formation of the cardiac chamber via regulation of myocardial cell morphology [39]. [score:5]
We used miScript Primer Assays for 9 miRNAs (miR-744-5p, miR-648, miR-193b-3p, miR-212-3p, miR-143-3p, miR-93-5p, miR-222-3p, miR-423-3p and miR-766-3p) and QuantiTect Primer assays for 9 target genes (CDKN1A, MYC, PTEN, ESR1, ETS1, SOD2, MGMT, KRAS and HNF4A) (Qiagen, Hilden, Germany) to validate the different expression levels of the miRNA and their target genes, which are determined by miRTargetLink prediction software. [score:5]
Deregulation of a number of miRNAs in our study have been previously reported in right and left atrial appendages of patients with rheumatic mitral valve disease (RMVD), including miR-222-3p, miR-4484 and miR-940 in left atrial appendage [41], miR-5190 and miR-23c in right atrial appendages [42] and miR-143-3p in both, in the LAA and RAA of patients with RMVD [43]. [score:4]
The down-regulation of miR-143 causes ventricular collapse by affecting cell morphology and contractility [39]. [score:4]
The blue and orange lines indicate the two main clusters of samples To validate the data obtained from the miRNA microarray, RT-qPCR was performed to re-examine the expression level of nine miRNAs, namely miR-328-5p, miR-4750-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p. [score:3]
As for atrial myocardial samples from infants with CHDs, we found significantly different expression of six miRNAs (miR-210-5p with a P-value of 0.014, miR-423-3p with a P-value of 0.034, miR-143-3p with a P-value of 0.018, miR-564 with a P-value of 0.024, miR-770-5p with a P-value of 0.025, and miR-874-5p with a P-value of 0.040) between prior and after CPB (Fig.   4). [score:3]
Furthermore, miR-143 targets ETS Transcription Factor (Elk1), an activator of vascular smooth muscle cells proliferation [40]. [score:3]
In addition, we selected six miRNAs (miR-328-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-874-5p and miR-93-5p) with low or moderate expression levels based on the array analysis and with known association with cardiac pathologies and its related process [26– 33]. [score:3]
The significance of the differences in the expression was confirmed for seven miRNAs namely miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p) (P < 0.05) in the atrial myocardial samples from patients with CHDs after CPB compared to before CPB by RT-qPCR (Fig.   3). [score:2]
By including two out of the seven validated miRNAs namely miR-143-3p and miR-93-5p, a clear distinction between the groups based on the clustering dendrogram was, however, not possible (Additional file 2: Figure S1). [score:1]
[1 to 20 of 11 sentences]
61
[+] score: 37
hsa-miR-182, hsa-miR-183 and hsa-miR-224 are upregulated and hsa-miR-1, hsa-miR-101, hsa-miR-143, hsa-miR-145, hsa-miR-127 and hsa-miR-29c are downregulated in bladder urothelial carcinoma compared to matched histologically normal urothelium [27]. [score:6]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium (p<0.001 for each miRNA) (Table S3). [score:4]
The hsa-miR-143∼145 cluster is located on chromosome 5 and downregulated in many cancers, including bladder cancers and their cell lines [13], [26]. [score:4]
The hsa-miR-143∼145 cluster was significantly downregulated. [score:4]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium. [score:4]
The upregulation of hsa-miR-182 and hsa-miR-183 and the downregulation of hsa-miR-143 were found in bladder urothelial carcinoma compared to matched histologically normal urothelium in our Real-Time qPCR evaluation. [score:4]
Three overexpressed (hsa-miR-182, hsa-miR-183 and hsa-miR-200a) and two underexpressed miRNAs (hsa-miR-143 and hsa-miR-195) were evaluated in all of the patients included in this study. [score:3]
Our findings provided more evidence to support that the hsa-miR-143∼145 cluster is tumor-suppressive in bladder cancer. [score:3]
For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
0018286.g001 Figure 1For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
In this study, Real-Time qPCR was performed to evaluate the expression patterns of hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 in a total of fifty-one bladder urothelial carcinoma patients. [score:1]
[1 to 20 of 11 sentences]
62
[+] score: 36
Finally, linking differentially expressed miRNAs to their potential differentially expressed target using the algorithm published by Kertesz et al [25] identified a total of 11 potential miRNA-mRNA pairs: COL21A1 (collagen, type XXI, alpha 1; targeted by hsa-miR-155), CYP46A1 (cytochrome P450, family 46, subfamily A, polypeptide 1; targeted by hsa-miR-342-3p), KCNJ1 (potassium inwardly-rectifying channel, subfamily J, member 1; targeted by hsa-miR-155), MADCAM1 (mucosal vascular addressin cell adhesion molecule 1; targeted by hsa-let-7i), MRPS26 (mitochondrial ribosomal protein S26; targeted by hsa-miR-15a), OR2T29 (olfactory receptor, family 2, subfamily T, member 29; targeted by hsa-miR-143), RPS9 (ribosomal protein S9; targeted by hsa-miR-132), SLC10A1 (solute carrier family 10 (sodium/bile acid cotransporter family), member 1; targeted by hsa-miR-31), SLC16A8 (solute carrier family 16, member 8 (monocarboxylic acid transporter 3); targeted by hsa-miR-31), SNTG1 (syntrophin, gamma 1; targeted by hsa-miR-21) and TRPC5 (transient receptor potential cation channel, subfamily C, member 5; targeted by hsa-miR-335). [score:29]
In contrast, in an experimental study of oral squamous cell carcinoma in Syrian hamsters, miR-155 and miR-143 were down-regulated, whereby miR-21 was up-regulated [46], yet it is unclear how to compare this mo del system to the human ex-vivo data presented here. [score:7]
[1 to 20 of 2 sentences]
63
[+] score: 36
Jordan et al. demonstrated that increased expression of miR-143 in the liver could induce insulin resistance through down-regulation of ORP8, subsequently preventing AKT activation by insulin [6]. [score:6]
2008.09.050 18809385 6. Jordan S. D. Kruger M. Willmes D. M. Redemann N. Wunderlich F. T. Bronneke H. S. Merkwirth C. Kashkar H. Olkkonen V. M. Bottger T. Obesity -induced overexpression of miRNA-143 inhibits insulin-stimulated AKT activation and impairs glucose metabolism Nat. [score:5]
However, the importance of miR-103, miR-143 and miR-483-3p in human glucose and lipid metabolism, and the relative impact of genetic and environmental factors in the regulation of their expression, are undisclosed. [score:4]
Using murine mo dels of T2D, Trajkovski et al. demonstrated that miR-103 silencing improved glucose homeostasis, insulin sensitivity and decreased the amount of adipose tissue [4], while Takanabe et al. have found miR-143 levels associated with markers of adipocyte differentiation, and up-regulated in adipose tissue of high-fat diet -induced obese mice [5]. [score:4]
Figure 1Multivariate analyses were performed to study the association between (A) age, birth weight, BMI and sex and miR-103, miR-143 and miR-483-3p expression in adipose tissue from elderly twins and the association between (B) miR-103, miR-143 and miR-483-3p and 2 h glucose values after an oral glucose tolerance test, hemoglobin A1c (HbA1c), homeostatic mo del assessment of insulin resistance (HOMA-IR) and triglycerides shown for all subjects (black), dizygotic (DZ) twins (blue) and monozygotic (MZ) twins (orange). [score:3]
Using SAT biopsies from a unique cohort of 244 elderly MZ and DZ twins, we estimated the genetic influence on the expression of miR-483-3p, miR-103 and miR-143, and found low heritability estimates. [score:3]
In conclusion, we have demonstrated that the expression levels of miR-483-3p, miR-103 and miR-143 in SAT are mainly influenced by age, obesity and birth weight in a non-genetic manner. [score:3]
In the DZ twins we found a statistically significant positive association between the levels of miR-143 and Hba1c levels. [score:1]
However, our study revealed no associations between miR-143 and HOMA-IR. [score:1]
The interclass correlations for MZ and DZ twins were not significantly different for any of the miRNAs and all heritability estimates were low (0.21, 0.12 and ~0 for miR-483-3p, miR-143 and miR-103 respectively). [score:1]
Importantly, using twins gives us a unique opportunity to explore the relative influence of genetic versus environmental factors on the levels of miR-483-3p, miR-103 and miR-143 in human SAT. [score:1]
We evaluated the associations between glucose metabolism (2-hour (2 h) glucose from an OGTT and hemoglobin A1c (HbA1c)), insulin resistance (HOMA-IR) and lipid metabolism (triglyceride levels); and miR-483-3p, miR-103 and miR-143 expression levels (Figure 1B). [score:1]
Age: We found that a ~5 year increase in age was associated with a ~33% decrease in miR-483-3p levels (p = 0.05) and with a 77% increase in miR-143 levels (p = 0.02). [score:1]
There were no differences or associations between zygosity and miR-143 or mir-483-3p levels. [score:1]
We evaluated the associations between age, sex, birth weight and BMI; and the expression levels of miR-483-3p, miR-103 and miR-143 (Figure 1A). [score:1]
[1 to 20 of 15 sentences]
64
[+] score: 36
The authors showed that miR-126, miR-143 and miR-145 were down-regulated and miR-15b, miR-16, mi-146 and miR-155 were up-regulated. [score:7]
Their data also indicated that decreased miR-143 and miR-145 expression and increased miR-146a expression are relevant for cervical carcinogenesis. [score:5]
They found reduced expression of miR-143 and increased expression of miR-21 in 29 matched pairs of human cervical cancer and normal cervical specimens [15]. [score:5]
Similarly, expression of miR-143 and miR-145 was reduced in different tumour types, e. g., colorectal tumours [23], breast, prostate and B cell lymphoma [24], [25], suggesting that those miRNAs may have a suppressor role in a wide range of tumours. [score:5]
Previous studies also showed that miR-143 and miR-145, which are expressed from the same precursor [26], showed reduced expression in HPV -induced pre-neoplasic lesions suggesting that they might be involved in cervical carcinogenesis. [score:5]
At least eight miRNAs showed significant down-regulation between normal cervical samples and the pre-neoplasic and neoplasic samples, namely miR-143, miR-145, miR-99a, miR-26a, miR-203, miR-513, miR-29a and miR-199a. [score:4]
Eight miRNAs exhibited relative decreased expression with transition from normal cervix to atypical dysplasia to cancer (miR-26a, miR-143, miR-145, miR-99a, miR-203, miR-513, miR-29a, miR-199a) (Figure 4A). [score:3]
MicroRNA-143 and miR-145 are located in a region, which is deleted in prostate cancer, whereas miR-205 is located in the 12q14.1 region, which is amplified in lung cancer. [score:1]
The abundance of miR-143 and miR-145 was sharply reduced between the normal cervical samples and cervical pre-neoplasic and cancer tissues, which is in agreement with previous cervical cancer studies [15], [20]. [score:1]
[1 to 20 of 9 sentences]
65
[+] score: 34
In human clinical specimens, miR-143 was down-regulated while NRAS was up-regulated. [score:7]
MiR-143 expression was found to target KRAS mRNA and to be down-regulated in colorectal cancer [67, 68]. [score:7]
Overexpression of miR-143 decreased glioma cell migration, invasion, tube formation and slowed tumor growth and angiogenesis in a manner associated with NRAS down-regulation in vitro and in vivo. [score:6]
MiR-143 was also demonstrated to directly target NRAS and may function as a tumor-suppressor in glioma [90]. [score:5]
In addition, RAS activation led to down-regulation of the miR-143/145 cluster through RREB1 (RAS-responsive element -binding protein) activation that represses the miR-143/145 cluster promoter [70]. [score:4]
Interestingly, miR-143 and miR-145 clustered on chromosome 5q33.1 and both displayed decreased expression profiles in many cancer types. [score:3]
These results suggested a complex oncogenic network involving various partners such as p53 oncogene, miR-143/145 cluster, and the RAS-MAPK pathway. [score:1]
TP53 loss-of-function led to a decreased level of both miR-143 and miR-145 through attenuating the maturation processing [69]. [score:1]
[1 to 20 of 8 sentences]
66
[+] score: 34
A significant downregulation was observed for miR-132-5p, -132-3p and −143-3p while miR-143-5p and −574-5p were significantly upregulated. [score:7]
While dysregulation of miR-143-5p/3p seems to be a common feature of ALS pathology, downregulation of miR-132-5p/3p and miR-574-5p/3p was evident in sporadic, TARDBP, FUS and C9ORF72, but not SOD1 mutant patients. [score:5]
Most interestingly, during this study FUS has been implicated in the biogenesis of several miRNAs that overlap with the TDP-43 binding miRNAs found to be downregulated in our study including FUS mutant LCLs, e. g. miR-132 and miR-143. [score:4]
We found both strands of miR-143 downregulated in all ALS-derived LCLs. [score:4]
However, validated targets of miR-143 comprise proteins involved in cell proliferation and apoptosis [38] as well as multiple proteins participating in actin cytoskeleton remo deling [39]. [score:3]
Moreover, with the exception of miR-143-3p whose relative abundance showed a clear correlation between the two body fluids both in patients and in controls, the amount of most miRNAs was independently regulated between the two compartments at an individual-to-individual basis. [score:2]
The most robustly regulated miRNAs in our study were miR-132-5p, miR-132-3p and miR-143-3p which were reduced to ~70% relative to healthy controls in both CSF and serum samples. [score:2]
Another miRNA found to be dysregulated in all types of samples studied here were both strands of miR-143. [score:2]
Figure 2 Correlation of CSF and serum levels of miR-143-3p. [score:1]
The lack of statistical significance of the decrease of miR-143-3p in SOD1 and TARDBP mutant LCLs is rather due to the small sample number available than to indistinct results. [score:1]
Hence, while a decrease of both strands of miR-143 seems to be a common feature of ALS patient derived LCLs, reduced levels of both strands of miR-132 and miR-574 accompany ALS cases with TDP-43 and/or FUS pathology. [score:1]
Further miRNAs found to be decreased in the serum were miR-143-5p and let7b. [score:1]
Relative concentrations of miR-143-3p in CSF and serum standardized to the means of the respective compartment are plotted. [score:1]
[1 to 20 of 13 sentences]
67
[+] score: 30
Therefore, some common deregulated miRNA loci were selected to perform isomiR expression analysis based on gender-specific diseases and the common diseases, including down-regulated miR-143 and up-regulated miR-182 (S2 Table). [score:14]
As expected, isomiR expression may show a significant difference between tumor and control samples, particularly for miR-143 in male-specific PRAD disease and miR-182 in LUSC disease (S3 Table). [score:7]
IsomiR expressions in selected common deregulated miRNA loci, including miR-143 and miR-182, differ across the four groups with different diseases (P < 0.01, Fig 3). [score:6]
Based on all the normal and tumor groups across different tissues, the rates of dominant isomiRs showed diverse expression except for miR-143 in normal groups. [score:3]
[1 to 20 of 4 sentences]
68
[+] score: 30
Conversely, treating cells with a miR-143 mimic or overexpressing miR-143 in colorectal cancer cells, knocked down expression of KRAS, decreased activation of ERK1/2, and blocked cell proliferation [69, 77]. [score:6]
The role of miR-143 as a tumor suppressor was demonstrated through the ability of miR-143 inhibition to increase KRAS protein levels and cell proliferation in vitro [77]. [score:5]
4.6. miR-143 and KRASmiR-143 is one of the most downregulated miRNAs in colorectal cancer samples compared to normal adjacent tissue specimens [69, 77]. [score:3]
miR-143 is one of the most downregulated miRNAs in colorectal cancer samples compared to normal adjacent tissue specimens [69, 77]. [score:3]
Colorectal cancer patients with low levels of miR-143 expression had a significantly higher risk of having shorter cancer-specific survival and progression-free survival [78]. [score:3]
miR-143 expression has been identified as an independent predictor of patient survival. [score:3]
Taken together, the literature on let-7 and miR-143 miRNAs in colon cancer highlights the potential that miRNA -based therapies may have in targeting KRAS -driven colorectal cancers. [score:3]
Like let-7 miRNA, miR-143 has been implicated in colorectal cancer as a link to KRAS -driven carcinogenesis [64, 68, 69, 77, 78] and is shown to bind to the 3′-UTR of the KRAS gene [77]. [score:1]
In addition to antagonizing cell survival, miR-143 has also been shown to increase chemosensitivity to 5-FU in vitro [79]. [score:1]
4.6. miR-143 and KRAS. [score:1]
Some of the better understood miRNAs that play a role in cell proliferation in colorectal cancer are lethal-7 (let-7) and miR-143 [64, 66, 68, 69]. [score:1]
[1 to 20 of 11 sentences]
69
[+] score: 30
Both PRC1 and PLK1 are involved in cytokinesis [37], explaining the inhibitory effect of miR-143 expression on cellular proliferation. [score:5]
SSX1 is a potential target for miR-143, as predicted by miRBase and Target Scan 3.1. [score:5]
As with well- and dedifferentiated liposarcomas, miR-143 is significantly downregulated in synovial sarcoma [58]. [score:4]
Moreover, the miR-143/miR-145 cluster (gene region 5q32) is downregulated along with the miR-144/451 (gene region 17q11.2) cluster in liposarcoma, in contrast to benign adipocytic tumours [38]. [score:4]
In well-differentiated and dedifferentiated liposarcomas, miR-143 is significantly downregulated, in comparison to normal adipose tissue [36]. [score:4]
Apoptosis is induced, and cellular proliferation diminished, upon experimental overexpression of miR-143 in dedifferentiated liposarcoma. [score:3]
As the expression levels of miR-143 decrease, from well- to dedifferentiated liposarcomas, this miRNA seems to be already involved in the early processes of tumourigenesis [36]. [score:3]
As the fusion protein SYT-SSX1 is characteristic of synovial sarcoma, miR-143 downregulation may contribute to formation of this oncoprotein [58]. [score:2]
[1 to 20 of 8 sentences]
70
[+] score: 28
Besides, by targeting a transcriptional activator (C/EBPβ) of miR-143, miR-155 could inhibit the expression of miR-143, which is a negative regulator of HK2, therefore leading to the up-regulation of HK2 expression at the post-transcriptional level [81]. [score:13]
By targeting HK2, miR-143 reduces glucose metabolism and inhibits cancer cell proliferation. [score:5]
It has been reported that miR-143 could regulate glycolysis in cancer cells by targeting the first rate-limiting enzyme hexokinase 2 (HK2). [score:4]
MiR-143 expression level inversely correlates with HK2 protein levels. [score:2]
As a crucial regulator of cancer glycolysis, miR-143 offers potential clinical therapeutic prospects [79]. [score:2]
These findings indicate that by modulating the miR-143/HK2 axis, miR-155 not only controls the aerobic glycolysis (or Warburg effect) in cancer cells, but also provides a possible mechanism to explain the link between inflammation and the altered glucose metabolism in cancer. [score:1]
Meanwhile, miR-143 and miR-155 form a negative feedback loop to control glycolysis process. [score:1]
[1 to 20 of 7 sentences]
71
[+] score: 27
In particular, isomiRs from the miR-1304-3p precursor arm, a locus previously associated with regulating enamel formation in Neanderthals [18], were significantly up-regulated in the YRI population (in both males and females) whereas isomiRs from the miR-143-3p precursor arm were significantly up-regulated in the CEU population (but only in females). [score:8]
There are 2,355 predicted targets for miR-1304-3p isomiRs and 2,358 predicted targets for miR-143-3p isomiRs. [score:5]
Summarily, among the predicted targets for miR-143-3p we find a strong enrichment for genes that participate in ribonucleoprotein complex biogenesis and mRNA splicing. [score:3]
However, and somewhat surprisingly, no isomiRs from the miR-143-3p arm show differential expression in any males-vs. [score:3]
Lastly, we stress that miR-143-3p is differentially expressed only in the females-vs. [score:3]
GO term analysis for miR-1304-3p and miR-143-3p. [score:1]
each of the other four groups) and miR-143-3p (CEU vs. [score:1]
-others) and miR-143-3p (CEU-vs. [score:1]
Indeed, the isomiRs from the miR-143-3p (CEU) and miR-1304-3p (YRI) arms are the only miRNAs distinguishing the older CEU and YRI samples from the remaining three younger FIN, GBR and TSI samples. [score:1]
Several isomiRs stand out in these comparisons with the ones from the right arm of miR-1304 and the right arm of miR-143 being the most notable. [score:1]
[1 to 20 of 10 sentences]
72
[+] score: 27
Wang et al. showed that these miRNAs suppress cervical (HeLa) cancer cell growth [11], suggesting that downregulation of miR-143 and miR-145 might lead to cell proliferation in CC (Figure 1). [score:6]
Thus, miR-182 and miR-183 are overexpressed and miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in both cell lines containing integrated HPV16 or HPV18 DNA [30]. [score:5]
miRNAs expression profiles by microarray analysis have shown that the miRNAs most highly expressed in normal cervix were miR-145, miR-26a, miR-99a, let-7a, miR-143, let-7b, let-7c, miR-125b, miR-126, and miR-195, in that order [11, 18, 30, 31]. [score:5]
HPV18 positive HeLa cell line has overexpression of miR-182 and miR-183, while miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in this cell line as compared with normal cervical tissue. [score:4]
It is important to note that the only experimentally verified target for miR-143, ERK5 (also known as MAPK7), is known to promote cell growth and proliferation in response to tyrosine kinase signaling [33]. [score:3]
Several studies have demonstrated that the expression levels of miR-143 and miR-145 are significantly lower in CC as compared with their normal counterparts (Table 1) [11, 18, 30]. [score:2]
In contrast, miR-1, miR-126, miR-133b, miR-143, miR-145, miR-195, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in these cell lines as compared with normal cervical tissue. [score:2]
[1 to 20 of 7 sentences]
73
[+] score: 26