sort by

398 publications mentioning hsa-mir-30b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-30b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 353
Considering the downregulated expression of miR-30b in gastric cancer, we focused on the list of genes showing increased expressions and selected the top 30 increased genes in gastric cancer, then determined if those genes were potential targets of miR-30b by using the prediction algorithm, TargetScan. [score:12]
Moreover, PAI-1 was identified as the potential targets of miR-30b, and miR-30b may induce apoptosis and suppress tumor growth by repressing the expression of PAI-1. Our findings suggest that miR-30b may function as a novel tumor suppressor gene in gastric cancer and can be a potential therapy target for gastric cancer. [score:11]
Our study showed that miR-30b expression was inversely correlated with PAI-1 expression in gastric cancer cell lines and tumor tissues, PAI-1 overexpression could counteract the effect of promoting apoptosis by miR-30b, and ectopic expression of miR-30b had similar promoting-apoptosis effect compared with silencing PAI-1 expression. [score:10]
Above results suggest that miR-30b expression is inversely correlated with PAI-1 expression in gastric cancer, and enhanced PAI-1 expression in gastric cancer could be a result of reduced miR-30b expression. [score:9]
Taken together, above data suggest that PAI-1 is a potential target of miR-30b, and miR-30b might down-regulate the target protein. [score:8]
In addition, silencing of PAI-1 was able to phenocopy the effect of miR-30b overexpression on apoptosis regulation of cancer cells, and overexpression of PAI-1 could suppressed the effect of promoting cell apoptosis by miR-30b, indicating on cancer cells. [score:8]
Moreover, plasminogen activator inhibitor-1 (PAI-1) was identified as the potential target of miR-30b, and miR-30b level was inversely correlated with PAI-1 expression in gastric cancer. [score:7]
These results suggest that the miR-30b expression is frequently down-regulated in gastric cancer and maybe involved in the development of gastric cancer. [score:7]
In current report, we found ectopic expression of miR-30b could induce the apoptosis of gastric cancer cells in vitro, and overexpression of miR-30b could significantly inhibit tumor growth in nude mouse xenograft mo del by inducing the apoptosis of gastric cancer cells in vivo. [score:7]
Interestingly, we found that PAI-1 gene which was upregulated in microarray (3.83 fold, P = 0.04) might be a probable target gene of miR-30b (Figure 4A). [score:6]
Considering that miR-30b is down-regulated in gastric cancer, and it has been reported that PAI-1 protein in gastric cancer tissues is dramatically higher than in the non-tumor tissues [28], we performed the correlation analysis between miR-30b and PAI-1 expression in gastric cancer cell lines and gastric cancer tissues. [score:6]
Furthermore, overexpression of miR-30b in AGS and HGC-27 cells resulted in the down-regulation of the protein levels of PAI-1 (Figure 4E). [score:6]
miR-30b was reported to be down-regulated in prostate cancer [31], invasive bladder tumor [32], anaplastic thyroid cancer [33], esophageal cancer [34], and lung cancer [35], whereas enhanced expression of miR-30b was identified in medulloblastoma [36] and malignant mesothelioma [37]. [score:6]
miR-30b may function as a novel tumor suppressor gene in gastric cancer by targeting PAI-1 and regulating the apoptosis of cancer cells. [score:6]
Since miR-30b was either up-regulated or reduced in different cancers, we could draw a conclusion that miR-30b may play different roles as an oncogene or a tumor suppressor gene in various cancers. [score:6]
As shown in Figure 6E-G, the overexpressing of PAI-1 resulted in obvious suppression on the effect of miR-30b -induced apoptosis. [score:5]
As shown in Figure 1A, the expression of miR-30b was significantly down-regulated in four cell lines compared with a pool of five non-tumor gastric tissues (P<0.01). [score:5]
We further characterized PAI-1 as a potential target of miR-30b, and the expression of miR-30b was inversely correlated with PAI-1 expression in gastric cancer. [score:5]
Finally, we performed the correlation analysis between miR-30b and its target expression in gastric cancer. [score:5]
miR-30b may function as a potential tumor suppressor gene in gastric cancer, and have the potential application as a biomarker or therapeutic target in gastric cancer therapy. [score:5]
Ectopic expression of miR-30b could promote the apoptosis of gastric cancer cell in vitro, and miR-30b could significantly inhibit tumorigenicity of gastric cancers in nude mouse xenograft mo del. [score:5]
Enforced expression of miR-30b promoted the apoptosis of gastric cancer cells in vitro, and miR-30b could significantly inhibit tumorigenicity of gastric cancer by increasing the apoptosis proportion of cancer cells in vivo. [score:5]
Consistent with our finding, miR-30b was found to be down-expressed by microRNA array from 184 gastric cancers and 169 non-tumor mucosae [39], and Qiao et al found that miR-30b was down-expressed in gastric cancer tissue and gastric cancer cell lines, AGS and BGC-823 cells [40]. [score:5]
In contrast, miR-30b was commonly down-regulated in 18 of 21 tumors. [score:4]
Notably, PAI-1 siRNA was able to phenocopy the effect of miR-30b overexpression on apoptosis regulation of cancer cell (Figure 6B, 6C). [score:4]
To directly address whether miR-30b binds to the 3′-UTR of the target mRNAs, we constructed the luciferase report vectors that contain the putative miR-30b binding sites within 3′-UTR. [score:4]
Above findings suggest miR-30b may act as a novel tumor suppressor by regulating the apoptosis of cancer cell in gastric cancer. [score:4]
Here, we showed miR-30b was down-regulated in gastric cancer cells and tumor tissues. [score:4]
Our previous report found miR-30b was able to regulate the autophagy process by targeting ATG12 and BECN1 during H. pylori persist infection [19]. [score:4]
In current study, we found that miR-30b was significantly down-regulated in gastric cancer cells and tumor tissues. [score:4]
miR-30b was significantly down-regulated in gastric cancer cells and human gastric cancer tissues. [score:4]
Our previous studies have revealed that H. pylori infection was able to induce the altered expression of miRNAs in gastric epithelial cells including miR-155, miR-146a and miR-30b, miRNAs may function as novel negative regulators to fine-tune H. pylori -induced inflammation [16], [17]. [score:4]
Furthermore, the scatter diagram showed that miR-30b was significantly down-regulated in gastric cancer samples versus normal gastric mucosa, with an average 6.28-fold decrease (P = 0.002) (Figure 1C). [score:4]
Identification of PAI-1 as a potential target of miR-30b. [score:3]
Overexpression of miR-30b increases the apoptosis of gastric cancer cells. [score:3]
The expression of miR-30b was further examined in 21 paired GC and adjacent non-tumor gastric tissues through TaqMan quantitative real-time PCR (qRT-PCR). [score:3]
The controversial expression of miR-30b suggests the complexity of the function of miR-30b. [score:3]
Inverse correlation between mir-30b and PAI-1 expression in gastric cancer tissues and cancer cell lines. [score:3]
These results strongly suggested that introduction of miR-30b could inhibit gastric cancer growth by promoting apoptosis of cancer cells. [score:3]
We analyzed the expression of miR-30b in gastric cancer cell lines and human gastric cancer tissues. [score:3]
Decreased miR-30b expression in human gastric cancer cell lines and GC tissue samples. [score:3]
The construction of various luciferase report vectors for miR-30b target was performed as previously described [16], [26], and the construct containing mutant seed region was generated as a control. [score:3]
0106049.g001 Figure 1(A) Comparison of expression level of miR-30b between normal gastric mucosa tissue samples and gastric cancer cell lines HGC-27, SGC-7901, BGC-823 and AGS. [score:3]
To further investigate whether PAI-1 is involved in miR-30b-promoted apoptosis, we first tested if the silencing of PAI-1 expression may have the similar apoptosis-promoting effect as miR-30b overexpression. [score:3]
Therefore, the loss of miR-30b expression may be associated with the pathogenesis and progression of gastric cancer. [score:3]
Our previous studies have revealed that H. pylori infection was able to induce the altered expression of miR-30b in gastric epithelial cells. [score:3]
Above results reveal that overexpression of miR-30b can promote the apoptosis of gastric cancer in vitro. [score:3]
Our data also indicated that overxepression of miR-30b could improve the apoptosis of gastric cancer cells in vitro and in vivo, and miR-30b was able to suppress tumor growth of gastric cancer in vivo. [score:3]
On the contrary, it has been shown that miR-30 can inhibit the self-renewal and induce apoptosis of breast tumor-initiating cells (BT-ICs) by silencing Ubc9 and ITGB3 [42]. [score:3]
Recently, several novel targets of miR-30b have been confirmed including p53 [43], Delta-like 4 [44], and Snail1 [45]. [score:3]
Above evidences indicate that miR-30 is a multifunction gene which can inhibit or induce the apoptosis. [score:3]
To explore the molecular mechanism underlying miR-30b function, it is important to identify its target gene. [score:3]
Subsequently, we examined PAI-1 and miR-30b expression in 21 sets of gastric cancer and adjacent non-tumor tissues. [score:3]
SGC-7901 or HGC-27 cells were transfected with miR-30b mimics or scrambled miR-control, and the validity of miR-30b ectopic expression was confirmed by qRT-PCR (Figure 2A). [score:3]
Recently, Li et al [41] found that miR-30b was significantly reduced in response to the oxidative stress stimulation, and miR-30b could inhibit mitochondrial fission and consequent apoptosis. [score:3]
Decreased miR-30b expression in human gastric cancer cell lines and tumor tissues. [score:3]
miR-30b could serve as a potential biomarker and therapeutic target against gastric cancer. [score:3]
Regarding to miR-30b, it may have multi-function in H. pylori infection and H. pylori -associated diseases. [score:3]
0106049.g005 Figure 5(A) The expression of mir-30b and PAI-1 in gastric cancer cell lines MKN45, MGC-823, SGC-7901, AGS and HGC-27. [score:3]
SGC-7901 or HGC-27 cells were seeded in 12-well plate at a suitable density and grown to 30% confluency after 24 h. Then cells were transfected with miR-30b mimics or miR-control, and the medium was replaced with serum-free DMEM for 48 h. For co-transfection experiment with miR-30b and PAI-1 expressing vector, SGC-7901 cells were transfected with miR-control or miR-30b mimics, and then with PAI-1 Human cDNA ORF Clone vector (indicated as PAI-1) or empty vector 24 h later. [score:3]
To validate the expression data acquired from qRT-PCR, 3 of all 21 pairs samples were randomly chose to determine the level of miR-30b using Northern bolt. [score:3]
In summary, we report the down-regulation of miR-30b in gastric cancer, and investigate the potential role of miR-30b in tumorigenesis by regulating apoptosis. [score:3]
In our study, PAI-1was identified as a target gene of miR-30b in gastric cancer. [score:3]
miR-30b suppresses tumorigenicity and promotes cell apoptosis in vivo. [score:3]
Inverse correlation between miR-30b and PAI-1 expression in gastric cancer cell lines and human tumor tissues. [score:3]
0106049.g004 Figure 4(A) Sequence alignment of miR-30b and its target sites in 3′-UTRs of PAI-1. (B) HEK293 cells were transiently cotransfected with luciferase report vectors, and either miR-30b mimics or miR-control. [score:3]
PAI-1 is a candidate target gene of miR-30b. [score:3]
The relationship between the miR-30b level and PAI-1expression was analyzed using Pearson's correlation. [score:3]
0106049.g002 Figure 2. (A) Relative expression of miR-30b in AGS, HGC-27, and SGC-7901 cells transfected with miR-30b mimics or miR-control for 48 h. Data represent means±S. [score:3]
In the current study, we found that miR-30b expression was significantly decreased in gastric cancer tissues and cell lines compared with normal gastric tissues. [score:2]
miR-30b is one of the miR-30 family which is associated with the development of many types of cancers. [score:2]
Notably, we also found miR-30b could regulate the autophagy process during H. pylori persist infection, thereby contributing to the persistence of H. pylori infections [19]. [score:2]
It suggests that the miR-30b-PAI-1 axis may be involved in the development of gastric cancer. [score:2]
PAI-1 is involved in miR-30b-regulated apoptosis. [score:2]
We also found the consistent decreased expression of miR-30b in gastric cancer compared with non-tumor gastric tissues (Figure 1D). [score:2]
Above findings suggest that miR-30b may play the potential role in gastric cancer development by promoting apoptosis of cancer. [score:2]
To further assess the function of miR-30b, it is important to determine which host mRNAs are being regulated by miR-30b. [score:2]
The target of miR-30b was identified by bioinformatics analysis, luciferase assay and. [score:2]
One of the hallmark of cancer is its ability to evade apoptosis [27], so we examined the effect of miR-30b on gastric cancer cells apoptosis. [score:1]
The difference of tumor size between miR-control group and miR-30b group was statistically significant, **P<0.01. [score:1]
In addition, miR-30b was identified as one of independent predictors for recurrence-free survivals of hepatocellular carcinoma [38]. [score:1]
To determine the role of miR-30b in the pathogenesis of gastric cancer, we analyzed the miR-30b levels in various gastric cancer cells, including HGC-27, AGS, BGC-823 and SGC-7901. [score:1]
However, little is known about the potential role of miR-30b in gastric cancer. [score:1]
Top, western blot analysis of PAI-1 protein levels; bottom, qRT-PCR analysis of miR-30b levels. [score:1]
SGC-7901 or HGC-27 cells were transfected with miR-30b mimics or miR-control, and then the medium was replaced with serum-free DMEM for 48 h, cells were analyzed for apoptotic rate after staining with Annexin V-FITC and PI. [score:1]
As shown in Figure 4B, we observed a marked reduction in luciferase activity (P<0.01) after contransfection of luciferase report vectors and miR-30b mimics. [score:1]
To further determine whether miR-30b is involved in tumorigenesis of gastric cancer, nude mouse xenograft mo del was used. [score:1]
Now little is known about the effect of miR-30b on apoptosis in cancer. [score:1]
RNAs were hybridized sequentially with miR-30b and U6 probe, and U6 was used as a control for RNA loading. [score:1]
As shown in Figure 3D, tumor sections from miR-30b mimics treated xenografts exhibited significantly increase in TUNEL -positive cells. [score:1]
Nude mouse xenograft mo del was used to determine whether miR-30b is involved in tumorigenesis of gastric cancer. [score:1]
miR-30b mimics, scrambled miR-control, chemically modified miR-30b duplex (agomir), chemically modified scrambled miR-control, PAI-1 siRNA, or siRNA negative control were purchased from GenePharma (Shanghai GenePharma Co. [score:1]
Using Pearson's correlation analysis, we observed a significant inverse correlation between miR-30b and PAI-1 mRNA (Figure 5B, R = −0.6475, P = 0.0123). [score:1]
However the role of miR-30b in gastric cancer is still largely unknown. [score:1]
When tumors were harvested, the average volume of tumors derived from the miR-30b mimics group was only 27.87% of that in the miR-control group (Figure 3C, right panel, P<0.01). [score:1]
SGC-7901 cells were transfected with miR-control or miR-30b mimics for 24 h, and followed by transfection with PAI-1 Human cDNA ORF Clone vector (indicated as PAI-1) or empty vector. [score:1]
The cells were transfected with each firefly luciferase reporter vector, Renilla luciferase control vector, pRL-TK (Promega), and miR-30b mimics or miR-control (GenePharma). [score:1]
However, the role of miR-30b in tumorigenesis is controversial. [score:1]
U6 and β-actin served as internal normalized references for miR-30b and PAI-1 mRNA, respectively. [score:1]
miR-control- and miR-30b -transfected SGC-7901 (1×10 [6]) were suspended in 100 µl PBS and then injected subcutaneously into either side of the posterior flank of the same female BALB/c athymic nude mouse. [score:1]
miR-control- and miR-30b-tranfected SGC-7901 cells were injected subcutaneously into either posterior flank of the same nude mice. [score:1]
PAI-1 is potentially involved in miR-30b -induced apoptosis. [score:1]
This study provides new insights into the role of miR-30b in gastric cancers. [score:1]
Because we found that miR-30b played a more significant role in promoting SGC-7901 cells apoptosis than HGC-27 cells in vitro, we explore the role of miR-30b in tumorigenesis of gastric cancer using SGC-7901 cells. [score:1]
For GFP repression experiments, HEK-293 cells were seeded in 12-well plate at 1×10 [5] per well the day before transfection and then were cotransfected with the miR-30b mimics or miR-control with various GFP reporter vectors. [score:1]
The DNA oligonucleotide antisense probes used to detect miR-30b and U6 snRNA were as follows: miR-30b (5′- AGCTGAGTGTAGGATGTTTACA-3′) and U6 (5′-ATATGGAACGCTTCACGAATT-3′). [score:1]
Next, we also examined whether PAI-1 could abrogate the effect of promoting apoptosis by miR-30b. [score:1]
As shown in Figure 4C and 4D, GFP fluorescence was significantly reduced in cells transfected with GFP report vectors containing binding sites and miR-30b mimics, whereas there was no change of GFP fluorescence in cells transfected with mutant vector and miR-30b mimics. [score:1]
Viable miR-30b mimics- and miR-control -transfected SGC-7901 cells (1×10 [6]) were suspended in 100 µl PBS and then injected subcutaneously into either side of the posterior flank of the same female BALB/c athymic nude mouse at 4 to 6 weeks of age as described previously [25]. [score:1]
Taken together, our results suggest that PAI-1 is potentially involved in miR-30b-promoted apoptosis. [score:1]
[1 to 20 of 110 sentences]
2
[+] score: 267
Since overexpression of miR-30b/c suppressed the proliferation of NSCLC cells, and given that Rab18 is a direct target of miR-30b/c, we hypothesized that the inhibitory effect of miR-30b/c on NSCLC cell viability might be achieved via targeting Rab18. [score:12]
miR-30b/c directly targeted and down-regulated Rab18 expression and inhibited NSCLC cells proliferation. [score:11]
Recent studies showed that miR-30a regulated growth of breast cancer cells [26], down-regulation of miR-30 maintained self-renewal and inhibited apoptosis in breast tumor-initiating cells [27], miR-30 regulated B-Myb expression during cellular senescence [28]. [score:10]
As miRNAs are a group of post-transcriptional gene regulators which potentially play a critical role in tumorigenesis by regulating the expression of their target genes, the target genes of miR-30 that functioned in NSCLC pathogenesis was further analyzed. [score:9]
Overexpression of miR-30b/c directly down-regulates Rab18 and inhibits NSCLC cell proliferation. [score:9]
Our results demonstrated that down-regulation of Rab18 expression by miR-30b/c contributed, at least in part, to the suppression of the growth of NSCLC cells. [score:8]
Down-regulation of miR-30b/c and up-regulation of Rab18 protein levels were also found in NSCLC tissues compared to adjacent non-tumor tissues. [score:6]
Down-regulation of miR-30b/c and up-regulation of Rab18 protein levels were detected in NSCLC specimens compared with adjacent non-tumor tissues. [score:6]
Overexpression of miR-30b/c led to down-regulation of Rab18 in A549 and H23 cells at protein levels but not mRNA levels. [score:6]
In our study, we showed that Rab18 were identified as direct functional targets of miR-30b/c in NSCLC cells and miR-30b/c was down-regulated in NSCLC tissues compared to adjacent non-tumor tissues. [score:6]
Increasing evidences indicate that miR-30 expression is down-regulated in numerous human cancers including non-small cell lung cancer (NSCLC) which hypothesizes that miR-30 may play an important role in tumorigenesis. [score:6]
s using a reporter carrying a putative miR-30b/c target site in the coding DNA sequence (CDS) region of Rab18 revealed that miR-30b/c directly targeted Rab18. [score:6]
Our results showed that Rab18 mRNA expression was not affected by miR-30b and miR-30c (Figure  1C), while the level of Rab18 protein was consistently and substantially down-regulated by miR-30b and miR-30c (Figure  1D). [score:6]
The results suggested that the reduced miR-30b/c expression and increased Rab18 protein expression were frequent events in human NSCLCs tissues. [score:5]
Figure 3 Overexpression of miR-30b/c inhibits NSCLC cells growth in vitro. [score:5]
Overexpression of miR-30b/c suppressed NSCLC cells growth. [score:5]
These findings support the hypothesis that decreased expression of Rab18 by miR-30b/c accounts for the suppression of cellular proliferation in NSCLC. [score:5]
miR-30b/c are low-expressed and Rab18 is high-expressed in NSCLC tissue samples. [score:5]
As the down-regulation of miR-30 is related to a number of cancers, it has been hypothesized that miR-30 may play an important role in tumorigenesis and tumor development. [score:5]
miRNA -binding sites analysis revealed that Rab18 was one direct functional target of miR-30b/c in NSCLC cells. [score:4]
In this study, we confirmed that oncogene Rab18 was directly targeted by miR-30b/c in NSCLC cells. [score:4]
Our results showed that Rab18 was one direct functional targets of miR-30b/c in NSCLC cells. [score:4]
miR-30b/c inhibits the proliferation of NSCLC cells via regulation of Rab18. [score:4]
These data suggested that the reduced expression of miR-30b/c might facilitate the development of NSCLCs. [score:4]
Decreased miR-30b/c and increased Rab18 protein expression were also found in NSCLC tissues, which suggested that Rab18 was regulated by miR-30b/c in human NSCLC tissues. [score:4]
Taken together, our results demonstrated that Rab18 was a direct target of miR-30b/c in NSCLC cells. [score:4]
Compared with the negative control, treatment of cells with miR-30b or miR-30c led to a decrease in NSCLC cell growth at 72 h, and the inhibitory efficiencies in A549 cells were 25.1% (P < 0.05) and 35.7% (P < 0.05), respectively, and the inhibitory efficiencies in H23 cells were 37.2% (P < 0.05) and 43.6% (P < 0.01), respectively. [score:4]
miR-30 is significantly down-regulated in several cancers, including breast cancer [17], malignant peripheral nerve sheath tumors [18], glioma [19], and lung cancer [20]. [score:4]
Human miR-30 is down-regulated in several tumor types including NSCLC [20]. [score:4]
miR-30b/c directly targets Rab18 in human NSCLC cells. [score:4]
Taken together, we demonstrate that miR-30b/c is down-regulated in NSCLC tissues. [score:4]
s were conducted to explore the impact of miR-30 overexpression on the proliferation of human NSCLC cells. [score:3]
We demonstrated that miR-30b/c was down-regulated in NSCLC specimens compared with adjacent non-tumor tissues. [score:3]
These data indicated that miR-30b/c could serve as a tumor suppressor gene involved in NSCLC pathogenesis. [score:3]
Taken together, these results demonstrated that miR-30b/c could inhibite the proliferation of NSCLC cells in vitro. [score:3]
Figure 2 Expression analyses of miR-30b/c and Rab18 in NSCLC tissues. [score:3]
These data indicate that miR-30b/c could serve as a tumor suppressor gene involved in NSCLC pathogenesis. [score:3]
The effect of miR-30 on endogenous levels of this target were subsequently confirmed via (WB). [score:3]
The expressions of miR-30b/c were normalized to U6. [score:3]
Our results showed that the reporter plasmid with wild-type targeting sequence of Rab18 mRNA caused a significant decrease in luciferase activity in cells transfected with miR-30b and miR-30c, whereas reporter plasmid with mutant sequence of Rab18 produced no change in luciferase activity (Figure  1A,B). [score:3]
Figure 1 miR-30b/c targets Rab18. [score:3]
Furthermore, ectopic overexpression of miR-30b/c blocked tumor cell proliferation in vitro. [score:3]
Luciferase reporter assays were employed to validate regulation of a putative target of miR-30. [score:3]
Transfection of miR-30b/c mimics into NSCLC cells led to a significant Rab18 decrease at protein levels but not mRNA levels and inhibition of cellular proliferation. [score:3]
To confirm whether miR-30b/c regulated the expression of Rab18 gene, we first performed luciferase reporter assays in HEK293 cells. [score:3]
We found that miR-30b and miR-30c were down-regulated in these five pairs of clinical NSCLC tissues compared with their adjacent non-tomor tissues (Figure  2B). [score:3]
This suggests miR-30 is a potential tumor suppressor. [score:3]
qRT-PCR results determined that transfection of miR-30b or miR-30c increased their expressions in A549 (Figure  3A) and H23 (Figure  3B) cells. [score:3]
Furthermore, ectopic overexpression of miR-30b/c blocked NSCLC cells proliferation in vitro. [score:3]
The CLASH data showed that both miR-30b and miR-30c targeted in coding DNA sequence of Rab18 which was associated with proliferation in hepatocellular carcinoma [23]. [score:3]
Furthermore, we analyzed the expression of miR-30b/c in these five pairs of clinical NSCLC and adjacent non-tumor tissues by qRT-PCR and normalized to an endogenous control (U6 RNA). [score:3]
HEK293 cells were cotransfected with miR-30b or miR-30c mimics and negative control oligonucleotides, pRL-TK and firefly luciferase reporter plasmid containing putative miR-30b/c targeting sequences of Rab18. [score:3]
U6 small RNA was used as an internal control for normalization and quantification of miR-30b/c expression. [score:3]
Both miR-30b and miR-30c (miR-30b/c) were found having target site in same region of Rab18 mRNA. [score:3]
miR-30b/c inhibits NSCLC cell proliferation. [score:3]
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed to determine the expression level of miR-30 in NSCLC specimens and adjacent non-tumor tissues. [score:3]
Prompted by our results that Rab18 was a direct target of miR-30b/c in NSCLC cells, we sought to investigate the association of miR-30b/c and Rab18 in NSCLC tissues. [score:2]
Luciferase reporter construct was made by cloning human Rab18 sequence containing the potential miR-30b/c binding site into pMIR-Report construct (Ambion, Austin, USA). [score:1]
Sequence of human miR-30b mimics was 5′- UGU AAA CAUC CUA CAC UCA GCU -3′ and human miR-30c mimics was 5′- UGU AAA CAU CCU ACA CUC UCA GC -3′. [score:1]
Our results showed that cellular proliferation gradually declined following transfection with miR-30b or miR-30c in A549 (Figure  3C) and H23 (Figure  3D) cells. [score:1]
In this study, we focused on miR-30 which was decreased in several tumor types including NSCLC. [score:1]
A549 and H23 cells were cotransfected with miR-30b or miR-30c mimics and negative control oligonucleotides. [score:1]
Human miR-30 family including miR-30a, miR-30b, miR-30c, miR-30d and miR-30e have the samilar sequence. [score:1]
However, the function of miR-30 especially in NSCLC remains unclear. [score:1]
miR-30b miR-30c Proliferation Rab18 NSCLC Lung cancer is the most common cause of cancer -associated deaths worldwide, especially for male [1]. [score:1]
However, the role of miR-30 in cancers especially in NSCLC is not very much known. [score:1]
A549 and H23 cells were transfected with miR-30b or miR-30c, and Rab18 protein levels and mRNA levels were examined by WB and qRT-PCR, respectively. [score:1]
The aim of this study was to investigate the target gene of miR-30 and its roles in tumor growth of NSCLC. [score:1]
[1 to 20 of 68 sentences]
3
[+] score: 257
Here, we found that miR-30b negatively regulated catalase expression in ARPE-19 cells and a microRNA antisense approach increased catalase expression by suppressing the miR-30b -mediated inhibition of catalase expression under oxidative stress. [score:12]
Here, we demonstrated that a sublethal dose of H [2]O [2] (200 µM) up-regulated the expression of miR-30b, a member of the miR-30 family, which inhibited the expression of endogenous catalase both at the transcript and protein levels. [score:10]
miR-30b mimics not only significantly inhibited catalase expression (p<0.05) when compared with the NC, but also very significantly (p<0.001) suppressed the H [2]O [2]-stimulated expression of catalase. [score:8]
However, antisense (antagomirs) of miR-30b was not only found to suppress the miR-30b mimics -mediated inhibitions, but also to dramatically increase the expression of catalase even under an oxidant environment. [score:7]
However, what is interesting is that miR-30b antagomirs not only protected miR-30b mimics -mediated inhibition of catalase expression (p<0.001), but also significantly (p<0.001) enhanced its expression even when cells were stressed with H [2]O [2]. [score:7]
Therefore, we decided to examine if miR-30b could potentially target and regulate the expression of catalase, a major enzyme in the intracellular antioxidant defense mechanism and a key scavenger of H [2]O [2]. [score:6]
However, hypoxia was found to up-regulate the expression of miR-30b in many cell types [37]. [score:6]
Here, transfection with the mimics of miR-30b resulted in decrease of catalase protein expression (p<0.05) when compared with the control, whereas the antagomirs of miR-30b protected the miR-30b mimics -mediated inhibition of catalase expression (p<0.05) even in presence of miR-30b mimics (p<0.05) (Figure 6 ). [score:6]
Our in silico analysis also found that the miR-30b could potentially target genes such as integrin beta 3 (ITGB3), C-reactive protein (CRP), paraoxonase 2 (PON2), retinoblastoma 1(RB1), retinitis pigmenstosa (RP) GTPase regulator (RPGR), and endothelin receptors (EDNR) that are likely candidates of oxidative stress -mediated ocular diseases such as AMD, diabetic retinopathy (DR), glaucoma, RP, and retinoblastoma. [score:6]
By employing luciferase vector with the cloned target 3′-UTR region of catalase mRNA, we also demonstrated that the negative effect of miR-30b on catalase levels in the ARPE-19 cell was the result of direct targeting of catalase mRNA by miR-30b. [score:6]
Also, the transfection of miR-30b antagomirs into ARPE-19 cells not only protected the cells from the miR-30b mimics -mediated suppression of catalase both at mRNA and protein levels, but also significantly enhanced its expression even under oxidative environment. [score:5]
In silico analysis of the putative miR-30b that target human catalase were performed using TargetScan (http://www. [score:5]
However, it is not known whether miR-30b could regulate human catalase expression through miRNA -mediated trans-regulatory mechanisms. [score:5]
The antisense of miR-30b (miR-30b antagomirs) protected the RPE cells from the miR-30b mimics -mediated suppression of catalase expression under H [2]O [2]-mediateed oxidative stress. [score:5]
The mimics of miR-30b significantly reduced intracellular expression of catalase while an inhibitor of miR-30b (miR-30b antagomir) protected ARPE-19 cells from oxidative damage by increasing the levels of catalase (Figure 7 ). [score:5]
Our in vitro experiments showed that miR-30b binding to the 3′-UTR inhibits the expression of catalase both at mRNA and protein levels. [score:5]
Antagomirs of miR-30b protect ARPE-19 cells from miR-30b mimics -mediated inhibition of catalase expression under oxidative condition. [score:5]
Antagomirs of miR-30b protects miR-30b -mediated suppression of catalase expression under oxidative environment. [score:5]
In our investigation, it was observed that ARPE-19 cells exposed to H [2]O [2] increased the expression of miR-30b, which in turn inhibited the expression of cellular catalase. [score:5]
Using TargetScan and miRanda algorithms, the human catalase was predicted to be the putative target of miR-30. [score:5]
Our in silico analyses demonstrated that miR-30c and miR-30e are localized in the intron of nuclear transcription factor Y, gamma (NF-YC) on chromosome 1. miR-30a derived from the intronic sequence of ‘chromosome 6 ORF155’, a putative transcription factor, is located on chromosome 6. miR-30b and miR-30d are possibly clustered and expressed under the control of the promoter of ZFAT (zinc finger and AT hook domain containing) gene located on the chromosome 8. The sensitivity of miR-30b/miR-30d to H [2]O [2], as demonstrated in our experiment, is possibly mediated through the transcriptional regulation of the promoter of ZFAT gene. [score:4]
To determine the potential role of miR-30 in H [2]O [2] -mediated cellular effects on antioxidative defense system in ARPE-19 cells, we selected a H [2]O [2] -upregulated miRNA, miR-30b. [score:4]
Sequences of wild-type or mutant (3 bp mutation within the seed region) target site for miR-30b in catalase 3′-UTR are shown above the figure. [score:4]
In our experiments using ARPE-19 as a human RPE mo del, we are for the first time demonstrating that miR-30b is able to bind to the human catalase gene and regulate its expression. [score:4]
The bioinformatic analysis for the target site of miR-30 in catalase 3′-UTR is shown in Figure 1. [score:3]
However, the turnover of catalase protein by miR-30b if mediated separately at the translational level needs to be studied. [score:3]
The 8 bp seed sequences of miR-30 and the putative target site in catalase 3′-UTR in both the panels are highlighted in bold. [score:3]
In summary, all five members of the miR-30 family are expressed in human RPE cells of which miR-30b and miR-30d are found to be sensitive to H [2]O [2]. [score:3]
The effects of mimics or antagomirs of miR30b on mRNA expression were also assessed in cells against H [2]O [2] (200 µM) exposure. [score:3]
Validation of in silico target analysis of miR-30b. [score:3]
The transcriptional regulation of the members of miR-30 family seems to be different from each other, since they are regulated by different promoters of their respective genes. [score:3]
This cis-regulation occurs by direct interaction of miR-30b through the perfect match of its seed sequence to the binding site in the catalase 3′-UTR and that interaction in our experiment was destroyed when the miR-30b binding site was mutated by three nucleotides. [score:3]
In our experiment, functional analysis of miR-30b using specific mimics validated its role in targeting the catalase mRNA. [score:3]
Furthermore, mir-30b antagomirs -mediated increase of catalase expression was significantly higher than the cells treated with H [2]O [2] (p = 0.009). [score:3]
A significant decrease (p = 0.004) in relative luciferase activity was observed when pmir-GLO-catalase-3′-UTR was co -transfected with miR-30b mimics as compared with the scrambled miRNAs (NC, Figure 5A ), and the miR-30b mimics -mediated suppression was abolished by the mutation of the 3′-UTR miR-30b binding site, which disrupts the interaction between miR-30b and the catalase-3′-UTR (Figure 5B ). [score:3]
It is possible that the mechanisms involving the epigenetic regulation at the DNA level [13] and transcription factor at the transcriptional level [17] regulate the genes that mediate the transcription of miR-30b and miR-30d. [score:3]
0042542.g001 Figure 1Panel A: Complimentarity between the members of miR-30 family and the putative human catalase 3′-UTR site targeted (318–324 bp downstream from the human catalase stop codon). [score:3]
The H [2]O [2] treatment in our experiment did not influence the expression of the other three members (miR-30a, miR-30c, and miR-30e) of miR-30 family. [score:3]
Our study suggests that miR-30b antagomirs could be a useful therapeutic tool to treat the oxidative stress -mediated ocular diseases in vivo. [score:3]
In order to get unidirectional ligation into the vector, we cloned 466 bp of human catalase 3′-UTR containing the one 8 bp target site (5′-ATGTTTAC-3′) for miR-30b into the XhoI-SalI sites downstream of the luc2 gene in pmirGLO Vector (Promega, Madison, WI) using the following primers: sense 5′-AA TGAG CTCGAGCGAAGCTTAGCGTTCATCCGTGT-3′; antisense 5′-AA CATC GTCGACTTAAGCCATGACGGTGCTCAAG-3′. [score:3]
As shown in Figure 1, all five members of the miR-30 family (miR-30a through miR-30e) have one 8 bp conserved target site in catalase 3′-UTR. [score:3]
The computational analysis predicted a number of miRNAs including miR-30b that could putatively target catalase mRNA. [score:3]
miR-30 targeting human catalase is sensitive to H [2]O [2]. [score:3]
The expression levels of miR-30 family members were determined by qRT-PCR using snRNA U5 as an internal control. [score:3]
For this study we have focused on miR-30b that may target the human catalase 3′-UTR since this site is conserved across species. [score:3]
The reduction of catalase expression in ARPE-19 cells transfected with miR-30b mimics would suggest that the action of miR-30b is mediated through degradation of catalase mRNA, which in turn reduced the abundance of catalase protein (Figure 6 ). [score:3]
This finding is not consistent with the work done in rat cardiac cells, where miR-30b and miR-30d expression was reported to be reduced by H [2]O [2] mediated-oxidative stress [36]. [score:3]
In silico analysis demonstrates that miR-30b can target a number of genes, including the human catalase. [score:3]
Effects of miR-30b mimics and antagomirs on catalase protein expression in ARPE-19 cells. [score:3]
Panel A: Complimentarity between the members of miR-30 family and the putative human catalase 3′-UTR site targeted (318–324 bp downstream from the human catalase stop codon). [score:3]
Moreover, absence of G∶U wobble pairing in the seed sequence and the substantial 3′ pairing of miR-30 with the catalase 3′-UTR strongly led us to believe that the catalase 3′-UTR could be a target of miR-30. [score:3]
However, co-transfection of miR-30b antagomirs together with the mimics of miR-30b in presence or absence of H [2]O [2] resulted in significant increase of catalase expression as compared with the NC (p<0.05) or with the groups mimics/mimics+H [2]O [2] (p<0.001). [score:2]
To eliminate the possibility that the inhibitory action of miRNA mimics on catalase expression in presence of H [2]O [2] was due to the toxic effect of H [2]O [2], we measured the cellular viability at 24 h and found no significant changes in the cells transfected with either mimics (20 nM) or antagomirs (50 nM) of miR-30b, when compared to negative control (NC). [score:2]
Response of miR-30b to H [2]O [2] In order to investigate whether the expression of miR-30 family members was influenced by H [2]O [2], ARPE-19 cells were treated with vehicle or 200 µM H [2]O [2] for 18 h. The expression level of miR-30b as determined by qRT-PCR was found to be sensitive to H [2]O [2] (p = 0.004) when compared with the control. [score:2]
In the future, the promoter analysis of the gene of miR-30b/miR-30d is expected to reveal the mechanism of the ROS -mediated gene regulation of miR-30b/miR-30d. [score:2]
The expression of other members of miR-30 family (miR-30a, miR-30c, and miR-30e) was not observed to be altered by H [2]O [2] treatment, as compared to the control (Figure 4 ). [score:2]
The plasmid containing mutant catalase 3′-UTR (pmirGLO-Cat-3′-UTR-mut) was generated using QuikChange Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, CA) by changing the core of the three miR-30 binding sites from 5′-TGTTTAC-3′ to 5′-T CT AT GC-3′. [score:2]
In order to investigate whether the expression of miR-30 family members was influenced by H [2]O [2], ARPE-19 cells were treated with vehicle or 200 µM H [2]O [2] for 18 h. The expression level of miR-30b as determined by qRT-PCR was found to be sensitive to H [2]O [2] (p = 0.004) when compared with the control. [score:2]
The molecular mechanism of ROS -mediated gene regulation of the miR-30 family members has not been demonstrated yet. [score:2]
H [2]O [2] increased the expression levels of miR-30b (p = 0.004) and miR-30d (p = 0.049) miRNAs as compared to the control. [score:2]
miR-30b mimics. [score:1]
Synthesized RNA duplexes of miR-30b mimics and miR-30b antagomirs were purchased from Qiagen (Valencia, CA). [score:1]
Cells transfected for 24 h with NC, miR-30b mimics, or miR-30b antagomirs, were lysed and subjected to western blotting following the protocol mentioned in ‘’. [score:1]
In our experiments, we found that the transfection of miR-30b mimics or antagomirs did not have negative effects on ARPE-19 cell viability. [score:1]
0042542.g006 Figure 6Cells transfected for 24 h with NC, miR-30b mimics, or miR-30b antagomirs, were lysed and subjected to western blotting following the protocol mentioned in ‘’. [score:1]
Response of miR-30b to H [2]O [2]. [score:1]
The fold change for catalase or miR-30b expression level was calculated using 2 [−ΔΔCt] [60]. [score:1]
In this group, ARPE-19 cells were treated with mimics or antagomirs of miR-30b for 6 h prior to H [2]O [2] insult for 18 h and then harvested for total RNA extraction. [score:1]
The miR-30 family is comprised of five distinct mature miRNA sequences, which are organized into three clusters: miR-30a/miR-30c-2, miR-30d/miR-30b, and miR-30e/miR-30c-1 [39]. [score:1]
In our investigation, we found that the expression of miR-30b and miR-30d was sensitive to H [2]O [2] stimulation. [score:1]
Effect of miR-30b mimics and antagomirs on cell viability. [score:1]
The human catalase 3′-UTR contains one putative miRNA binding site for the members of miR-30 family. [score:1]
Although the mature miRNA sequences of all the members of miR-30 family share a common 8-mer conserved seed sequence, the flanking sequences between the members are substantially different from each other (Figure 1A ). [score:1]
Panel B: The potential binding sequences for miR-30b within the catalase 3′-UTR of human (H. sapiens), chimpanzee (P. troglodytes), rhesus monkey (M. mulatta), gibbon (N. leucogenys), cow (B. taurus), and giant panda (A. melanoleuca). [score:1]
miR-30b interacts with the human catalase 3′UTR. [score:1]
ARPE-19 cells were seeded in 12-well plates at 1.5×10 [5] cells/well and cultured for 48 h and then transfected with scrambled miRNA (NC, 20 nM), miR-30b mimics (20 nM), miR-30b antagomirs (50 nM), or mimics and antagomirs together using Lipofectamine 2000 reagent and OPTI-MEM I reduced serum medium (Invitrogen Life, Technologies, Carlsbad, CA), according to the manufacturer's protocol, and further incubated for 24 h before harvesting for RNA and protein analyses. [score:1]
Rather, mir-30b antagomirs significantly protected the cells from H [2]O [2] -mediated cell death. [score:1]
In silico analysis of these databases demonstrated that the human catalase 3′-UTR harbors a single binding site for the members of miR-30 family. [score:1]
[1 to 20 of 78 sentences]
4
[+] score: 212
Radiation downregulated Mcl-1 and enhanced Bax expression in non- or CT-miR transfected samples, whereas transfection of miR30 -inhibitor maintained Mcl-1 protein levels and suppressed Bax expression in CD34+ cells 24 and 48 h after irradiation. [score:12]
The effect of miR-30 occurred only when both miR-30 and its target sequence were present; suggesting that miR-30 directly inhibits the expression of Mcl-1 through binding to its target sequence in Mcl-1gene. [score:10]
shown in Fig.   6a demonstrate that transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitor suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
We previously reported that radiation upregulated miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30 played a key role in radiation -induced human hematopoietic and their niche osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) and inducing apoptosis in these cells. [score:9]
Forty-eight h after pre-miR-30 transfection, the level of Mcl-1 expression in CD34+ cells was inhibited significantly, whereas no Mcl-1 downregulation was shown in control- or miR-30 -inhibitor transfected samples compared with non-transfection control (Fig.   6c). [score:9]
a Transfection of pre-miR-30 enhanced both miR-30b and miR-30c expression more than 100-fold and transfection of inhibitors suppressed miR-30b and miR-30c expression by >50-fold in CD34+ cells. [score:9]
Furthermore, we found putative miR-30 binding sites in the 3′UTR of Mcl-1 mRNA (Fig.   5b) and demonstrated for the first time that miR-30 directly inhibits the expression of Mcl-1 by binding to its target sequences (Fig.   7c, d). [score:8]
Levels of Mcl-1 expression in CD34+ cells were significantly inhibited 48 h after pre-miR-30 transfection, whereas Bcl-2 was not impacted by miR-30 overexpression in these cells. [score:7]
Transfection of miR-30 inhibitor significantly protected Mcl-1 from radiation -mediated downregulation and maintained the Mcl-1 levels as in sham-irradiated CD34+ cells. [score:6]
To answer this question, we analyzed potential targets of miR-30 family members using the miRNA target prediction database RNAhybrid 2.2 (http://bibiserv. [score:5]
The cells were exposed to different doses of γ-radiation at 24 h after non-transfection, miR-control, or miR-30 inhibitor transfection, and Mcl-1 and Bcl-2 protein expressions were tested by western blot in samples collected at 24 h (48 h post-transfection) and 48 h (72 h post- transfection) after irradiation. [score:5]
As expected, Bcl-2 expression was not changed by radiation nor miR-30 inhibition in CD34+ cells. [score:5]
Thus, our data from the current study suggest an important downstream target of miR-30 in irradiated hematopoietic cells is Mcl-1, and miR-30 is responsible for radiation -induced apoptosis in mouse and human hematopoietic cells through targeting the antiapoptotic factor Mcl-1. The authors declare no conflict of interest. [score:5]
However, when the mir-30 target site from the Mcl-1 3′UTR is inserted into the luciferase construct (pMIR-hMcl-1), expression of luciferase is strongly decreased when cotransfected with pre-miR-30. [score:5]
In this study, expression of miR-30b and miR-30c was determined in mouse serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation, since miR-30 levels in serum were parallel to expression in BM after radiation [15]. [score:5]
Radioprotector delta-tocotrienol suppressed miR-30 expression in mouse serum and cells and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [14, 15]. [score:5]
Radiation -induced Mcl-1 downregulation was miRNA-30 dependent. [score:4]
Western blot assays were used to test Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells as shown in Fig.   6b. [score:4]
In addition, radiation -induced Bax expression was completely blocked by knockdown of miR-30 in CD34+ cells. [score:4]
Antiapoptosis factor Bcl-2 was not impacted by miR-30 overexpression in these cells (Fig.   6b, c). [score:3]
The putative miR-30 binding sites were predicted using target prediction programs RNAhybrid 2.2 [21]. [score:3]
b Mcl-1 and Bcl-2 expression in non -transfected, miR-control, inhibitor and pre-miR-30 transfected CD34+ cells were evaluated by immunoblotting 24 and 48 h after transfection. [score:3]
Delta-tocotrienol (DT3), a radioprotector, suppressed miR-30 and protected mice and human CD34+ cells from radiation exposure [15]. [score:3]
Levels of miR-30b and miR-30c expression were determined by Quantitative Real Time-RT PCR in mouse (a) Serum at 4 h, and 1, 3 and 4 days after 5, 8 or 9 Gy irradiation. [score:3]
miR-30b and miR-30c expression were examined 24 h post-transfection by quantitative RT-PCR. [score:3]
de/rnahybrid/) [21], and found that members of the miR-30 family were predicted to target the antiapoptosis factor Mcl-1. Figure  5b shows putative binding sites for miR-30b and miR-30c in the 3′UTR of the Mcl- 1 gene. [score:3]
Recently, we further reported that miR-30 expression in mouse BM, liver, jejunum and serum was initiated by radiation -induced proinflammatory factor IL-1β and NFkB activation. [score:3]
irradiated We previously reported that miR-30 played a key role in radiation -induced human CD34+ and osteoblast cell damage through an apoptotic pathway [14], and a radiation countermeasure candidate, delta-tocotrienol (DT3), suppressed radiation -induced miR-30 expression in mouse BM, liver, jejunum and serum, and in human CD34+ cells, and protected mouse and human CD34+ cells from radiation exposure [15]. [score:3]
However the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cell damage are not well understood. [score:3]
; miR-30b and miR-30c expression were examined by quantitative RT-PCR 24 h post-transfection and U6 was used as a control. [score:3]
Pre-miR30, miR30 inhibitor (si-miR30), or control miR (CT-miR) molecules were transfected into CD34+ cells. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
Pre-miR30 (PM11060), miR30 -inhibitor (AM11060) or control-miRNA were purchased from Thermo Fisher Scientific (Grand Island, NY) and transfected into CD34+ cells using the Lipofectamine RNAiMAX (Cat# 13778-075, Invitrogen) according to the manufacturer’s protocol discussed in our previous report [14]. [score:3]
d The firefly luciferase p-MIR-report vector (pMIR) as a control, p-MIR-report vector with Mcl-1 3′UTR (pMIR-hMcl-1), and p-MIR-report vector with mutant 3′UTR (pMIR-MUT) were transiently transfected or cotransfected with an expression plasmid for pre-mir-30 into human CD34+ cells. [score:3]
As shown in Fig.   7d, cotransfection of CD34+ cells with the parental firefly luciferase reporter construct (pMIR-vector control) plus the pre-mir-30 does not significantly change the expression of the reporter. [score:3]
CD34+ cells were transfected with miR-30 inhibitor, precursors (pre-miR30) or control-miR from Life Technologies Co. [score:3]
However, the specific role of miR-30 in radiation -induced apoptotic cell death and its downstream target factors which caused mouse and human hematopoietic cells damage are not well understood. [score:3]
Hence we explored interactions between the miR-30 family and Mcl-1. The effects of miR-30 on Mcl-1 expression in CD34+ cells were evaluated using gain and loss of miR-30 expression. [score:3]
In contrast, Bcl-2 expression was not affected by miR-30 in these cells. [score:3]
Knockdown of miR-30 blocked radiation -induced Mcl-1 reduction in CD34+ cells. [score:2]
In the current study as shown in Fig.   7a and b, we further demonstrated that knockdown of miR-30 before irradiation in human CD34+ cells blocked radiation -induced reduction of Mcl-1, and the proapoptotic factor Bax was no longer increased by radiation. [score:2]
In this study, we extend our findings using human hematopoietic stem and progenitor CD34+ cells and an in vivo mouse mo del, to explore the effects and mechanisms of miR-30 on regulation of apoptotic cell death signaling in hematopoietic cells after γ-radiation. [score:2]
Reverse transcription (RT) was performed using TaqMan [®] MicroRNA Reverse Transcription Kits (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions, and the resulting cDNAs were quantitatively amplified in triplicate for miR-30b and -30c expression using TaqMan [®] MicroRNA specific primers for miR30b (ID#000602), miR30c (ID#000419) and U6 (ID#001973) on an IQ5 Real-Time PCR System (Bio-Rad, Hercules, CA). [score:2]
A mutation was generated on the Mcl-1 3′-UTR sequence in the complementary site and the 5′end seed region of miR-30, as indicated. [score:2]
Previously we reported that knockdown of miR-30 before irradiation significantly increased clonogenicity in irradiated human CD34+ cells [14]. [score:2]
Luciferase activity in CD34+ cells transfected with pMIR alone, or pre-miRNA-30 precursor cotransfected with pMIR-control, pMIR-hMcl-13′UTR, or pMIR-MUT 3′UTR is shown. [score:1]
β-actin were measured in different treatment groups We next examined the effects of miR-30 on Mcl-1 expression in CD34+ cells after radiation. [score:1]
c Two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329–1351 and 1584–1602 nt) and the alignment of miR-30 with the 3′UTR insert are illustrated. [score:1]
NM_021960) containing two putative miR-30 binding sites (1329–1351 and 1584–1602 nt) or a corresponding multi-base mutant sequence was cloned into the SacI and HindIII sites downstream of the firefly luciferase reporter gene in pMIR-REPORT Luciferase (Ambion, Austin, TX, USA) by BioInnovatise, Inc. [score:1]
There are two putative miR-30 binding sites in the 3′UTR of Mcl-1 (1329-1351 and 1584–1602 nt, with the 5′ end of the miR-30 seed sequence in the latter) and the alignment of miR-30 with the 3′UTR insert is illustrated in Fig.   7c. [score:1]
The Pre-miRNA-30 Precursor was co -transfected where indicated in Fig.   7d. [score:1]
The firefly luciferase -report vector plasmid (p-MIR, Ambion, Austin, TX, USA) was modified by insertion of the Mcl-1-derived mir-30 binding sites or a multi-base mutant into the 3′UTR. [score:1]
We found that both miR-30b and miR-30c were highly induced by 5–9 Gy within 4 h in serum, in a radiation dose -dependent manner (Fig.   5a). [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shownWe further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
The Ambion pre-miR-30 precursors were co -transfected with pMIR-report, pMIR-hMcl-1-WT, or pMIR-hMcl-1-MUT plasmid. [score:1]
In the current study, we demonstrated increased levels of miR-30b and miR-30c in mouse serum after 5–9 Gy WBI, and this increase was radiation dose -dependent. [score:1]
b MiR-30b and miR-30c binding sites in Mcl-1 3′UTR are shown We further asked whether increases of miR-30 are responsible for radiation -induced Mcl-1 repression in hematopoietic cells. [score:1]
Our previous studies suggested miR-30 is an apoptosis inducer in mouse and human hematopoietic cells. [score:1]
Our results from both in vitro and in vivo studies suggested miR-30 is an apoptosis inducer after radiation exposure. [score:1]
[1 to 20 of 59 sentences]
5
[+] score: 198
The horizontal dashed line shows p = 0.05, and vertical dashed lines indicate FC = −1.5 and 1.5. e, results of miRhub analysis to test for enrichment of predicted miR-30 target sites in significantly up-regulated (purple) and down-regulated (green) genes at each time point. [score:9]
We found that both highly conserved and species-specific predicted miR-30 targets sites were significantly enriched (p < 0.05) in genes up-regulated at both 48 and 72 h post-transfection, but as expected not in down-regulated genes (Fig. 4 e). [score:9]
To identify genes that might act as post-translational regulators of SOX9 protein in response to LNA30bcd treatment, we performed Gene Ontology Molecular Function enrichment analysis (40, 41) using Enrichr (42) on genes with predicted miR-30 target sites that were significantly up-regulated (FC > 1.5 and FDR < 0.05) relative to mock treated cells at each time point (see supplemental Table S2 for gene lists). [score:9]
Moreover, UBE3A does have a predicted miR-30 target site and is up-regulated in LNA30bcd -treated HIECS. [score:6]
Knockdown of miR-30 in Vitro in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 ProteinTo evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:6]
We performed next generation high throughput RNA sequencing and found that up-regulated genes with predicted miR-30 target sites were most significantly enriched for ubiquitin ligases. [score:6]
We hypothesized that the opposite effect of miR-30 inhibition on SOX9 mRNA and protein levels could be due to miR-30 -mediated regulation of factors that modify SOX9 protein stability without affecting SOX9 RNA levels, such as post-translational modifiers (Fig. 2 e). [score:6]
” Ubiquitin ligase -mediated regulation of SOX9 has been shown previously in chondrocytes (43) and therefore is consistent with our hypothesis that miR-30 may regulate SOX9 protein levels indirectly through control of post-translational modifiers of SOX9. [score:6]
We focused on miR-30 because it has a SOX9 target site that is broadly conserved across vertebrates, including human and rodent, and it is robustly and variably expressed among stem, progenitor, and differentiated cell types of the intestinal epithelium. [score:5]
Agrawal R., Tran U., and Wessely O. (2009) The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. [score:5]
miR-30 Is Predicted to Target SOX9 and Is Robustly Expressed in the Intestinal Epithelium. [score:5]
Below, we show the conservation of the predicted miR-30 target site (red text) across various species (TargetScan6.2). [score:5]
FIGURE 1. miR-30 is predicted to target the 3′-UTR of SOX9 and is differentially expressed across functionally distinct cell types of the intestinal epithelium. [score:5]
This suggests that miR-30 is able to regulate SOX9 protein expression through post-transcriptional regulation of ubiquitin ligases (Fig. 5 d). [score:5]
To evaluate this hypothesis, we next sought to define the regulatory program that miR-30 directs in HIECs and to identify potential miR-30 targets that may be regulating SOX9 protein levels. [score:4]
Knockdown of miR-30 in Vitro Results in Increased SOX9 mRNA Expression, but Decreased Levels of SOX9 Protein. [score:4]
Up-regulation of miR-30 family members in myoblasts promotes differentiation (53). [score:4]
Taken together, our data suggest that miR-30 normally acts to promote proliferation and inhibit enterocyte differentiation in the intestinal epithelium through a broad regulatory program that includes the proteasome pathway. [score:4]
Through time course mRNA profiling following knockdown of a single miRNA family, we found that the effect of treatment with LNA30bcd on miR-30 target genes was only beginning to emerge at 24 h, evident at 48 h, and very robust at 72 h post-transfection. [score:4]
d, cartoon showing mo del of miR-30 regulation of SOX9 mRNA and protein expression levels. [score:4]
FIGURE 2. Knockdown of miR-30 increases SOX9 mRNA and decreases SOX9 protein expression. [score:4]
We observed increased relative luciferase activity in cells transfected with 100 n m LNA30bcd (Fig. 2 d), consistent with direct targeting of SOX9 by miR-30 that has been previously shown in cartilage (35). [score:4]
In Caco-2 cells we observed significant knockdown of miR-30 even 21 days following a single transfection with LNA30bcd; therefore, it would of interest to evaluate gene expression at this time point to determine whether the effects on miR-30 target genes are still robust. [score:4]
Upon knockdown of miR-30 in two intestinal-relevant cell lines, we unexpectedly found inverse effects on SOX9 mRNA and protein expression. [score:4]
Further analyses in vivo (mouse) or through ex vivo culture systems (mouse or human) are warranted to extend the definition of the function of miR-30 across distinct cell types of the intestinal epithelium in health and disease. [score:3]
However, the predicted miR-30 target site in UBE3A is human-specific. [score:3]
miR-30 Promotes IEC Proliferation and Inhibits IEC Differentiation. [score:3]
Moreover, the miR-30 target site and flanking ∼15 bases are highly conserved among most mammals including human, rodent, dog, opossum, and horse, as well as distant vertebrates such as lizard. [score:3]
Upon knockdown of these miR-30 family members, we observed a significant increase in SOX9 mRNA at 48 and 72 h post-transfection (Fig. 2 a), which is consistent with alleviation of negative post-transcriptional regulation of SOX9 by miR-30. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
miR-30b and miR-30e targeting are shown in detail with predicted base paring colored in red. [score:3]
To evaluate miR-30 regulation of SOX9 in IECs, we knocked down miR-30 expression using locked nucleic acids complementary to miR-30b, miR-30c, and miR-30d (LNA30bcd), in human intestinal epithelial cells (HIECs). [score:3]
In contrast, members of the miR-30 family and miR-320a showed robust expression in IECs (Fig. 1 b). [score:3]
At 24 h post-transfection, predicted miR-30 target sites were not enriched. [score:3]
FIGURE 6. miR-30 promotes proliferation and inhibits enterocyte differentiation. [score:3]
FIGURE 5. miR-30 target genes in intestinal epithelial cells are over-represented in the ubiquitin ligase pathway. [score:3]
Moreover, only miR-30 family members exhibited differential expression across functionally distinct IECs, leading us to select this miRNA family for follow-up analyses. [score:3]
This finding is consistent with the relatively higher expression levels of miR-30 in proliferating subpopulations, such as the progenitors, compared with non-proliferating enterocytes (Fig. 1 b). [score:2]
Therefore, given the strong regulatory effect of miR-30 on SOX9 protein, we hypothesized that treatment of HIECs with LNA30bcd would affect this balance as well. [score:2]
Guess M. G., Barthel K. K., Harrison B. C., and Leinwand L. A. (2015) miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. [score:2]
f, mo del of miR-30 regulation of SOX9 in the intestinal epithelium. [score:2]
Alternatively, knockdown of miR-30 in an osteoblast precursor cell line promotes differentiation (54). [score:2]
To test whether miR-30 regulates enterocyte differentiation of IECs, we transfected Caco-2 cells with 100 n m LNA30bcd and allowed the cells to differentiate on Transwell membranes (see “Experimental Procedures”). [score:2]
Together, these data suggest that our knockdown of miR-30 using LNA30bcd was specific and highly effective in HIECs, particularly in the later time points of our study. [score:2]
Next Generation High Throughput Reveals That miR-30 Regulates Genes Enriched in the Ubiquitin Ligase Pathway. [score:2]
In terms of differentiation, the miR-30 family has been shown to regulate myogenic and osteoblastic differentiation. [score:2]
Although increased proliferation has been seen in many cancer cells in response to reduced miR-30 levels, a number of studies have found knockdown of miR-30 to result in decreased proliferation (52). [score:2]
Knockdown of the miR-30 family in HIECs and Caco-2 cells resulted in reduced proliferation and enhanced enterocyte differentiation. [score:2]
Our analyses provide new evidence that miR-30 plays a significant role in regulating proliferation and differentiation in the intestinal epithelium. [score:2]
More research will be needed to identify the specific miR-30-directed ubiquitin ligase protein that acts on SOX9 protein in intestinal epithelial cells. [score:2]
Wu T., Zhou H., Hong Y., Li J., Jiang X., and Huang H. (2012) miR-30 family members negatively regulate osteoblast differentiation. [score:2]
To test for a direct relationship between miR-30 and the SOX9 3′-UTR, we performed a luciferase reporter assay in Caco-2 cells. [score:1]
To evaluate whether miR-30 influences ubiquitin ligase -mediated degradation of SOX9 protein, we subjected Caco-2 cells to either mock or LNA30bcd transfection and then treated them with vehicle or MG132, a potent proteasome inhibitor. [score:1]
Of these, miR-30 has the strongest predicted base pairing with SOX9, consisting of an 8-mer seed as well as supplementary 3′-end pairing for two of the family members. [score:1]
LNAs against mouse miR-30 family members are cross-reactive with the human miR-30 family. [score:1]
[1 to 20 of 55 sentences]
6
[+] score: 196
Our results have indicated that reduced miR-30* is required for XBP1 activation in the early stages of hypertrophic hearts in vivo and the upregulation of miR-30* and miR-214 inhibit the expression of XBP1 by targeting XBP1 3′ UTR, resulting in VEGF suppression in the maladaptive heart phage. [score:12]
These results suggest that ectopic expression of miR-214 and miR-30* led to a decrease in XBP1 expression, sequentially inhibited the expression of its targets. [score:11]
Together, these results of upregulated miR-214 and reduced miR-30* expression in several forms of heart failure raise the intriguing possibility that disbalance between miR-214 and miR-30* actually cause accumulation of XBP-1 protein in the early phase of cardiac hypertrophy and thereby contribute to impairment of cardiac XBP1 expression in the maladaptive diseased heart. [score:10]
However, along with increasing expression of miR-214 in late stage of hypertrophy, the inhibitory effects of miR-214 become dominant which results in the suppression of XBP-1. In another hand, we also found that XBP1 is a potential target of the miR-30* family. [score:9]
Moreover, the time-course change in the ratio of miR-30a*/miR-214 during cardiac hypertrophy and heart failure (Additional file 1: Fig. S1) show that down-regulation of miR-30a* may minimize the role of increased miR-214 in regulation of XBP-1 in the early phase of cardiac hypertrophy, while increased expression of both miR-214 and miR-30* synergistically lead to suppression of XBP1 in the maladaptive heart. [score:9]
These results provide the first clear link between miRNAs and direct regulation of XBP1 in heart failure and reveal that miR-214 and miR-30* synergistically regulates cardiac VEGF expression and angiogenesis by targeting XBP1 in the progression from adaptive hypertrophy to heart failure. [score:8]
These data suggest that miR-30* can inhibit the expression of XBP1 by directly targeting the 3′-UTR of XBP1 mRNA. [score:8]
XBP1 was declined in response to miR-30* upregulation in maladaptive hypertrophy, further suggesting that miR-30* is able to directly target the XBP1 pathway, either during the period of compensated hypertrophy or during the transition to heart failure. [score:7]
Along with increasing expression of miR-30* in the late stage of hypertrophy, the inhibitory effects of miR-30* on XBP1 become dominant, and results in the suppression of XBP1 and impairment of cardiac angiogenesis. [score:7]
Previous studies shows that expression of miR-30* and miR-30 were significantly down-regulated in mouse heart hypertrophy mo dels and failing human hearts [22, 40]. [score:6]
To further establish the relevance of the above observations of miR-30* with ISO infused hypertrophic mo del, we then analyze the changes in myocardial expression of the miR-30* family and found that the expression trend of miR-30a* in ISO mo del heart was similar with AAC mo del (Fig.   4b). [score:5]
Moreover, we found that miR-30* was significantly reduced in the early phase of cardiac hypertrophic animal mo del and in human failing hearts, while both miR-214 and miR-30* were increased in the maladaptive diseased heart, thereby contribute to impairment of cardiac XBP1 and VEGF expression. [score:5]
Fig.  5miR-214 and miR-30* reduce the target of XBP1 expression in cardiomyocytes. [score:5]
Hence, we therefore examined the expression of VEGF, the downstream target of miR-30*/XBP1, in AAC heart. [score:5]
These data show that dynamic expression of miR-30* and miR-214 caused opposite expression of XBP1 and VEGF in hypertrophic and failing heart. [score:5]
We first analyzed the effect of the miR-30* family on XBP1 expression and found that among these candidates, overexpression of miR-30a* caused a significant decrease in the protein levels of XBP1 s in H9c2 cells, with greater effect than the others (Fig.   3c). [score:5]
miR-214 and miR-30* reduce the expression of XBP1’s targets in cardiomyocyte. [score:5]
In this study, we have established the essential roles of miR-30* in the transition of the hypertrophic heart to the failing heart by down-regulation of XBP1. [score:4]
miR-30* are downregulated in the early phase of cardiac hypertrophy, but restored in maladaptive hypertrophy. [score:4]
Reduced miR-30* caused cardiac XBP1 and VEGF upregulation in hypertrophic and failing heart. [score:4]
Fig.  6Reduced miR-30* caused cardiac XBP1 and VEGF upregulation in hypertrophic and failing human heart. [score:4]
Our study has for the first time established that XBP1 is an important angiogenic factor to maintain normal cardiac function in the early stage of hypertrophy and deregulation of of mir-214 and miR-30* in the hypertrophic and failing hearts inhibits XBP1 and XBP1 -induced angiogenesis results in the transition of hypertrophic hearts into heart failure. [score:4]
The VEGF-A suppressing effect of miR-214 and miR-30* over expression was similar to what was measured after down regulation of XBP1 in H9c2 (2-1) cells (Additional file 1: Fig. S2). [score:4]
Fig.  4Dynamic expression of miR-30* contributed to XBP1 dysregulation in hypertrophic and failing heart. [score:4]
Interestingly, we further found that XBP1 and its downstream target VEGF were attenuated by miR-30* and miR-214 in cardiomyocyte. [score:3]
Potential miRNA binding sites in the XBP1 3′UTR were predicted using these tools, and analysis indicated that XBP1 is an evolutionarily conserved target of miR-30*. [score:3]
miR-30* targets XBP1 in cardiomyocytes. [score:3]
As cardiac expression of XBP-1 was induced in the early adaptive phase, but decreased in the maladaptive phase in hypertrophic and failing heart, it was interesting to monitor the levels of miR-30* in the different phases of AAC -induced cardiac hypertrophy. [score:3]
Real-time PCR analysis confirmed that miR-30* and miR-30 showed a striking decrease in expression in a murine mo del of right ventricular hypertrophy (RVH) and failure (RVF) pulmonary artery constriction (PAC) [41]. [score:3]
d The expression of miR-30* in human failing heart. [score:3]
In particular, we found that restored expression of miR-30* decreased the protein levels of XBP1 s and the mRNA levels of VEGF in H9c2 cells and the luciferase activity of the pMIR-reporter-XBP1-3′UTR (XBP1-3′UTR) vector in 293T cells. [score:3]
a Expression of the miR-214 and miR-30* family in normal mice heart tissue. [score:3]
Next we performed real time PCR to analyze the changes in myocardial miR-30* expression in human failing heart tissue. [score:3]
As with the miR-30 family, miR-30* family members all have the similar ‘‘seed sequence’’ in their 5′ termini, and are abundantly expressed in the heart under physiological conditions [22]. [score:3]
These findings suggest a direct interaction between miR-30* and XBP1 3′ UTR. [score:2]
These reports indicate that distinct miR-30* were regulated during heart failure, suggesting the possibility that this might function as modulators of this process. [score:2]
We extend the previously reported loss of mature miR-30* family in hypertrophic hearts [22, 41, 42], to two rodent mo dels of cardiac hypertrophy and heart failure. [score:1]
Recent study found that miR-30* family was involved with TGF-beta induced-impaired endothelial cells function [42]. [score:1]
XBP1-3′ UTR vector -transfected 293T cells showed a distinct decrease in luciferase activity when co -transfected with miR-30*, while no significant change in luciferase activity was observed following the co-transfection of mut 3′ UTR vector with miR-30* mimics or miR-NC (Fig.   3d). [score:1]
Non-specific negative control oligonucleotides, antimiRNA, mimics, for miR-214 and miR-30* (miR-30a*, miR-30b*, miR-30c-2*, miR-30d*, miR-30e*) and specific siRNA against rat XBP-1 were obtained from RiboBio (Guangzhou, China). [score:1]
n = 6, *P < 0.05 compared with normal controlFinally, we measured the expression of miR-30* and XBP-1s in two normal hearts and six patients with heart failure and the results showed that both XBP-1 and its downstream target VEGF were significantly increased in all failing human hearts, with the mean signal intensity increased compared to normal hearts (Fig.   6c). [score:1]
c Western blot of XBP1 in H9C2 (2-1) cells 48 h after transfection of miR-30* mimics or miRNA negative control (miR-NC) oligonucleotides. [score:1]
We predicted six miRNAs for miR-30* (recently designated miR-30-3p) family, including miR-30a*, miR-30b*, miR-30c-1*, miR-30c-2*, miR-30d*, miR-30e* (Fig.   3a), with potential base pair complementarities to conserved sequences in the XBP1 mRNA 3′UTR (Fig.   3b). [score:1]
As we known, the miR-30* family members include miR-30a*, miR-30b*, miR-30c*, miR-30d* and miR-30e* [39]. [score:1]
a, b Dynamic levels of miR-30* in AAC -treated heart, ISO -induced heart mo del, respectively. [score:1]
n = 6, *P < 0.05 compared with normal control Finally, we measured the expression of miR-30* and XBP-1s in two normal hearts and six patients with heart failure and the results showed that both XBP-1 and its downstream target VEGF were significantly increased in all failing human hearts, with the mean signal intensity increased compared to normal hearts (Fig.   6c). [score:1]
n = 6. b a schematic diagram of the reporter constructs showing the entire XBP1 3′ UTR sequence and the sequence of the miR-30* binding sites within the human XBP1 3′ UTR and MUT 3′ UTR. [score:1]
To measure a direct interaction between miR-30* and its potential binding site within XBP1 mRNA, the pMIR-reporter-XBP1-3′UTR (XBP1-3′UTR) vector or pMIR-reporter -XBP1-3′UTR mut (mut 3′UTR) vector was co -transfected into 293T cells along with miR-30a* mimics or miRNA negative controls (miR-NC) and assayed for expression of a luciferase reporter. [score:1]
[1 to 20 of 48 sentences]
7
[+] score: 185
We recently reported that radiation upregulates miR-30b and miR-30c in human hematopoietic CD34+ cells, and miR-30c plays a key role in radiation -induced human hematopoietic and osteoblast cell damage through negatively regulating expression of survival factor REDD1 (regulated in development and DNA damage responses 1) in these cells after γ-irradiation [19]. [score:9]
To determine whether the radiation -induced IL-1β increase contributed to miR-30 expression and whether DT3 could inhibit the miR-30 expression induced by IL-1β, we used assays to validate the effects of IL-1β on miR-30 expression in CD34+ cells (Fig 5B). [score:8]
DT3 protected mouse BM hematopoietic progenitor cells and human hematopoietic stem and progenitor CD34+ cells from radiation damage, repressed the expression of radiation -induced proinflammatory factors IL-1β and IL-6 in mouse spleen, and we report for the first time that DT3 downregulated radiation -induced miR-30b and miR-30c expression in mouse tissues and serum and in human CD34+ cells. [score:8]
We reported recently that radiation upregulates miR-30b and miR-30c in human hematopoietic CD34+ cells, and miRNA-30c plays a key role in radiation -induced human hematopoietic and osteoblast cell damage by negatively regulating survival factor REDD1 expression in these cells after γ-irradiation[19]. [score:7]
DT3 downregulated radiation -induced miR-30 expression and secretion in mouse tissues and serum. [score:6]
Finally, neutralization of IL-1β activation or knockdown of NFκBp65 gene expression in CD34+ cells resulted in complete abrogation of the radiation -induced miR-30 expression in these cells. [score:6]
DT3 downregulated the expression and secretion of radiation -induced miR-30 in mouse tissues and serum. [score:6]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in CD34+ cells. [score:5]
These data suggest that radiation -induced IL-1β may be responsible for miR-30 expression and the radioprotective effects of DT3 may result from inhibition of a storm of radiation -induced inflammatory cytokines. [score:5]
DT3 or anti-IL-1β antibody suppressed radiation -induced miR-30 expression in human CD34+ cells. [score:5]
In the current study, we confirmed expression of radiation -induced miR-30b and miR-30c in mouse tissues and serum, and miR-30 expression in mouse BM, jejunum, and liver within 1 h, that returned to baseline 4 or 8 h after irradiation (data not shown). [score:5]
In this study, we further demonstrated the effects of DT3 and the anti-IL-1β antibody on suppression of radiation or IL-1β -induced miR-30 expression in CD34+ cells. [score:5]
We previously demonstrated radiation -induced miR-30b and miR-30c expression in human hematopoietic CD34+ cells [19], and here we further examined the effects of gamma-radiation on miR-30b and miR-30c expression in mouse tissues. [score:5]
In this study, we confirmed our previous in vitro results and extend our findings using an in vivo mouse mo del, to explore our hypothesis that the radioprotective effects of DT3 are mediated through regulation of miR-30 expression in irradiated cells. [score:4]
To further understand the interaction between miR-30 and IL-1β in response to radiation and DT3, and the mechanisms of DT3 on radiation protection, we explored the role of radiation and DT3 on regulation of miR-30 and IL-1β expression. [score:4]
We further compared the effects of anti-IL-1β antibody and DT3 on miR-30 expression and survival of CD34+ cells after radiation and found that treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in these cells. [score:4]
Due to the ability of miRNA to target multiple transcripts [29], miR-30 has been found in multiple cellular processes to regulate cell death through different genes such as cyclin D1 and D2 [30], integrin b3 (ITGB3) [31], B-Myb [32], and caspase-3 [33]. [score:4]
IL-1β (10 ng/mL) was added to CD34+ culture with the anti-IL-1β antibody (0.2 μg/mL) or the same amount of a nonspecific IgG, and miR-30 expression was tested at 15 min, 30 min, and 1 h after addition of IL-1β. [score:3]
NFκB activation was responsible to radiation (and IL-1β) -induced miR-30 expression in CD34+ cells. [score:3]
DT3 protected against radiation -induced apoptosis in mouse and human CD34+ cells through suppressing of IL-1β -induced NFκB/miR-30 signaling, and significantly enhanced survival after lethal doses of total-body γ-irradiation in mice. [score:3]
IL-1β significantly induced both miR-30b and miR-30c expression in CD34+ cells at all-time points. [score:3]
Interestingly, IL-1β -induced miR-30 expression was completely blocked by DT3 treatment (Fig 5C). [score:3]
Next, miR-30b and miR-30c expression were validated in sham- or 2 Gy radiation with or without anti-IL-1β antibody -treated and siNFκB or control-siRNA transfected cells by quantitative real-time RT-PCR. [score:3]
Interestingly, radiation induced miR-30 expression in serum was observed at 4 h and remained elevated up to 24 h post-irradiation. [score:3]
Treatment with DT3 (2 μM, 24 h before irradiation) or an anti-IL-1β antibody (0.2 μg/mL, 1 h before irradiation) equally repressed expression of radiation -induced miR-30 in CD34+ cells. [score:3]
DT3 treatment suppressed miR-30b and miR-30c in irradiated mouse serum at all time points in comparison with vehicle -treated samples. [score:3]
Addition of the anti-IL-1β antibody for 30 min completely neutralized the expression of IL-1β -induced miR-30 in these cells. [score:3]
Cells were used for quantitative real-time PCR to determine the effects of IL-1β neutralization on miR30 expression. [score:3]
DT3 significantly suppressed miR-30 and protected animals from the acute radiation syndrome and increased survival from lethal doses of total-body irradiation. [score:3]
We next evaluated the effects of DT3 on radiation and/or IL-1β -induced miR-30 expression in human hematopoietic CD34+ cells because DT3 had suppressed the radiation -induced IL-1β and its downstream cytokine IL-6 production in mouse spleen (Fig 3) and jejunum [4]. [score:3]
Vehicle, DT3, or a neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy irradiation, and miR-30 expression was examined 1 h after irradiation. [score:3]
DT3 or anti-IL-1β antibody inhibited radiation -induced IL-1β production and reversed IL-1β -induced NFκB/miR-30 stress signaling. [score:3]
Fig 7C shows that in the control-siRNA transfected samples, γ-radiation enhanced miR-30b and miR-30c expressions by 3- and 2.2-fold, respectively, in comparison with sham-irradiated cells. [score:3]
We next sought to determine which a stress-response signal-transduction pathway may be involved in this IL-1β -induced miR-30 expression. [score:3]
NFκB activation was responsible for radiation -induced miR-30 expression in CD34+ cells. [score:3]
shown in Fig 5C confirmed that DT3 administration abolished expression of IL-1β -induced miR-30 in CD34+ cells. [score:3]
Modulation of miR-30 expression with IL-1β neutralizing antibody. [score:3]
Finally, vehicle or DT3 was added to CD34+ culture 22 h before IL-1β treatment, and miR-30 expression was examined at 24 h post-DT3 addition and 1 h after IL-1β treatment. [score:3]
0122258.g005 Fig 5 (A) Vehicle, DT3, or neutralizing antibody for IL-1β activation were added into CD34+ cell culture before 2 Gy radiation, and miR-30b and miR-30c expression were examined 1 h after irradiation. [score:3]
As expected, both miR-30b and miR-30c were expressed significantly in CD34+ cells 15 min after IL-1β addition and continually increased to 3-fold at 1 h after IL-1β-treatment as shown in Fig 5B (IL-1β + IgG). [score:3]
It was also observed that anti-IL-1β antibody-treatment blocked the radiation -induced miR-30 expression in control-siRNA transfected cells. [score:3]
DT3 administration abolished IL-1β -induced miR-30 expression in CD34+ cells. [score:3]
DT3-treatment completely blocked the radiation -induced expression of miR-30b and miR-30c in mouse BM, jejunum and liver cells compared with vehicle -treated mice (Fig 4B and 4C, N = 6/ group). [score:2]
DT3-treatment completely blocked the radiation -induced miR-30b and miR-30c expressions in mouse (B) BM cells after 7 Gy irradiation and in (C) jejunum and liver cells after 10 Gy irradiation, compared with vehicle -treated mice. [score:2]
Radiation induced both miR-30 subunits between 4–24 h after 7 and 10 Gy TBI. [score:1]
In conclusion, results from our current study demonstrated that an increase of miR-30 in irradiated cells results from a cascade of IL-1β -induced NFκB -dependent stress signals that are responsible for radiation damage in mouse and human cells. [score:1]
in Fig 4D demonstrated the levels of miR-30b and miR-30c in serum changed in a radiation dose -dependent manner. [score:1]
This circulating miR-30 increase is specific, reproducible, and radiation dose -dependent in irradiated mouse serum. [score:1]
In contrast, no miR-30 increase was observed after 2 Gy irradiation to siNFκB transfected cells. [score:1]
We found that miR-30 was highly induced by radiation within 1 h in BM (Fig 4B), jejunum, and liver (Fig 4C), but not in kidney cells (data not shown). [score:1]
We believe that the acute secretion of extracellular miR-30 in mouse serum after radiation is likely to derive from a variety of cell types. [score:1]
These results further support our hypothesis that levels of miR-30 in irradiated mouse tissues and serum reflect the severity of radiation damage in these animals. [score:1]
Fig 5A shows that 2 Gy radiation increased miR-30b and miR-30c by 3- and 2.5-fold in vehicle -treated CD34+ cell samples, respectively. [score:1]
We added IL-1β into CD34+ cell culture and observed a significant miR-30b and -30c increase in these cells (Fig 5B). [score:1]
[1 to 20 of 54 sentences]
8
[+] score: 182
The concentration of Hcy was 1 mmol/L, both the time of transfection and treatment of Hcy were 24 h. (A) shows the transfection of miR-30b mimic significantly up-regulated the expression of miR-30b which Hcy reduced; and (B) shows the overexpression of miR-30b down-regulated the expression of caspase-3 mRNA which Hcy induced. [score:13]
Overexpression of miR-30b can inhibit the Hcy -induced apoptosis by downregulating the expression of caspase-3. Our study indicated that miR-30b was involved in the Hcy -induced apoptosis in HCAECs by regulating the expression of caspase-3. Interestingly, previous study has reported that Hcy-thiolactone which is a metabolite of Hcy, but not Hcy, induces apoptotic death in HUVECs in a caspase-3 independent way [36]. [score:13]
Previous studies have shown that miR-30b is involved in cell apoptosis by regulating the expression of caspase-3. Li constructed the ischemia-reperfusion (I/R) injury mo del in H2C9 rat myocardial cells and found the overexpression of miR-30b down-regulated the expression of caspase-3 and improve I/R injury in H2C9 cells [29]. [score:11]
In addition, overexpression of miR-30b inhibited apoptosis Hcy -induced in HCAECs by downregulating the caspase-3 expression. [score:10]
Figure 7 The expression of procaspase-3 and cleaved caspase-3 protein after overexpression of miR-30b in Hcy -induced HCAECs, the concentration of Hcy was 1 mmol/L, both the time of transfection and treatment of Hcy were 24 h. The HCAECs were treated with the Hcy of 0.1, 0.3, 0.6, 1.0, 1.3, 1.6 and 2.0 mmol/L concentration for 24 h. To observe the influence of Hcy on the HCAECs, the expression of caspase-3 mRNA was detected by real-time qPCR (Figure 1A), the expression of caspase-3 protein was detected by Western Blot (Figure 1B), the apoptosis rate was detected by flow cytometry with AnnexinV/PI staining (Figure 2 and Table 1). [score:9]
In this process, the expression of caspase-3 was upregulated and miR-30b was downregulated. [score:9]
Furthermore, overexpression of miR-30b inhibited myocardial cells apoptosis and exhibited a dramatic reduction of caspase-3 expression [30]. [score:7]
Liao found the expression level of miR-30b is low in colon cancer tissues, and the lower the level of miR-30b, the worse the differentiation and prognosis of colon cancer; overexpression of miR-30b can inhibit the proliferation and promote apoptosis of cancer cells apoptosis [32]. [score:7]
It was shown that the upregulation of caspase-3 by Hcy was significantly suppressed by miR-30b mimics both in mRNA level (Figure 6) and protein level (Figure 7). [score:6]
Figure 4The expression of miR-30b upregulated after transfection of miR-30b mimic in HCAECs. [score:6]
Overexpression of miR-30b Inhibits the Apoptosis Induced by Hcy in HCAECs. [score:5]
In addition to miR-30b, miR-18a was also significantly downregulated by 1 mmol/L Hcy in our study, and several researches had reported the important role of miR-18a in regulating cell apoptosis [33, 34, 35]. [score:5]
Compared with the control group, the expression of miR-30b which was detected by real-time qPCR was significantly upregulated. [score:5]
It was shown in Figure 5 and Table 2 that overexpression of miR-30b in HCAECs significantly improved the Hcy -induced apoptosis (10.59% ± 0.6% for Hcy miR-30b overexpressed group, 15.83% ± 0.51% for Hcy negative group, 4.77% ± 1.23% for control group, p < 0.05). [score:5]
Figure 7 The expression of procaspase-3 and cleaved caspase-3 protein after overexpression of miR-30b in Hcy -induced HCAECs, the concentration of Hcy was 1 mmol/L, both the time of transfection and treatment of Hcy were 24 h. Since McCully found a close relationship between the levels of serum Hcy and atherosclerosis by autopsy in 1969 [27], the vascular complications by Hcy-induction raises concern. [score:5]
Figure 6The expression of miR-30b and caspase-3 mRNA after overexpression of miR-30b in Hcy -induced HCAECs. [score:5]
Zhu reported that miR-30b was significantly downregulated in human gastric cancer tissues, and overexpression of miR-30b in SGC-7901 or HGC-27 tumor cells can significantly promote cell apoptosis compared with the control group [31]. [score:5]
The miR-30b was significantly downregulated by 1 mmol/L Hcy. [score:4]
To investigate the role of miR-30b in Hcy-induces apoptosis in the HCAECs, we upregulated the expression of miR-30b by transfecting with miR-30b mimics in HCAECs. [score:4]
These studies indicate that miR-30b has an important role in regulating cell apoptosis and links with the caspase-3 expression. [score:4]
Similarly, Song et al., demonstrated that miR-30b levels were down-regulated by I/R injury in rat myocardial cells. [score:4]
Liao W. T. Ye Y. P. Zhang N. J. Li T. T. Wang S. Y. Cui Y. M. Qi L. Wu P. Jiao H. L. Xie Y. J. MicroRNA-30b functions as a tumour suppressor in human colorectal cancer by targeting KRAS, PIK3CD and BCL2 J. Pathol. [score:4]
To further understand the molecular mechanism of Hcy -induced apoptosis in HCAECs, providing new drug targets and therapeutic orientation of intervention Hcy -induced endothelial dysfunction, the present study determined the role of miR-30b in Hcy induced apoptosis in the vascular endothelial cells. [score:3]
MiR-30b Is Downregulated during Hcy-Induced Apoptosis in HCAECs. [score:3]
Overexpression of miR-30b. [score:3]
MiR-30b microRNA mimics (GenePharma, Shanghai, China) were utilized to overexpress the miR-30b. [score:3]
In order to analysis of miR-30b suppressing apoptosis, 100 ng miR-30b mimics or miR-30b negative control was transfected into HCAECs with FuGENE HD transfection reagent (Roche, Basel, Switzerland) for 24 h. The success and efficiency of transfection was confirmed by real-time qPCR. [score:3]
Figure 5AnnexinV/PI flow cytometry apoptosis chart, on behalf of the control group (A); Hcy negative control group (B); and Hcy miR-30b overexpressed group (C). [score:3]
The increased expression of the cleaved caspase-3 induced by Hcy, which represented the activity of the caspase-3, was also significantly reduced by miR-30b mimics (Figure 7). [score:3]
Data were expressed as mean ± standard deviation, t-test was used to compare the experimental group and the control group, one-way ANOVA was used to compare the control group, miR-30b negative group/Hcy + miR-30b negative group, miR-30b mimic group/Hcy + miR-30b mimic group. [score:3]
The influence of miR-30b overexpression on caspase-3 was also detected by real-time qPCR and Western blot. [score:3]
These data suggest that miR-30b plays an important role in the regulation of endothelial cell apoptosis induced by Hcy in vitro. [score:2]
MiR-30b is downregulated 0.49-fold during Hcy -induced apoptosis in HCAECs, compared with control group (p < 0.05). [score:2]
Group (n = 4) Apoptosis Rate % (LR + UR) Control group 4.77 ± 1.23 Hcy negative control group 15.83 ± 0.51 * Hcy miR-30b overexpressed group10.59 ± 0.6 * [,#]Compared with the control group, * p < 0.05; Compared with the negative control group, [#], p < 0.05 (n = 4 in each group); Abbreviations of the samples means: LR, Low right quadrants in the apoptosis figure of the flow cytometry; UR, Up right quadrants in the apoptosis figure of the flow cytometry. [score:1]
Therefore, miR-30b may play an important role in apoptosis induced by Hcy in endothelial cells. [score:1]
The HCAECs were treated with 1 mmol/L Hcy for 24 h after confirming the success and efficiency of the miR-30b transfection. [score:1]
Unfortunately, in this study, we only discussed the function and mechanism of miR-30b. [score:1]
Because caspase-3 was the main indicator of apoptosis detected in this study, we chose miR-30b for further research. [score:1]
[1 to 20 of 38 sentences]
9
[+] score: 159
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Searching 3′-UTR of putative target mRNA, targeting sequences which can make base pairing with 5′ seed sequences of miR-30 were found in the 3′-UTR of lifr, eed, pcgf5 and sirt1 utilizing TargetScan (Fig 7B). [score:7]
miR-30 targets were predicted using TargetScan. [score:5]
These data suggest that miR-30 members could be repressing targets at the MSC and osteocytic stages, while repression on target mRNA may be relieved during the intermediate osteoblastic stage. [score:5]
0058796.g009 Figure 9(A) Relative expression levels of miR-30 target mRNA in proliferating/sparse KUSA cells. [score:5]
In fact, runx2 as well as sox9 a master transcription factor for chondrogenesis was upregulated in mRNA level by miR-30d, indicating miR-30 could direct differentiation of MSC. [score:5]
Our data also indicate that miR-30b/c represses runx2 mRNA; however, overexpression of miR-30d increased runx2 expression, through unknown mechanisms. [score:5]
mRNA expression patterns of miR-30 targets in mMSC line. [score:5]
Together with the data of expression patterns in Fig 9 and Fig 2, miR-30 targets were classified into several groups; immediate induction followed by rapid attenuation group (ccn1/2/3, hnrnpa3 vC, eed, hspa5/grp78), immediate reduction and rapid recovery group (runx2 and lifr), the constant induction group (lin28a and opn/spp1) and the constant reduction group (pcgf5 and hnrnpa3 vB). [score:5]
As observed in Fig 11C, suppression of lifr expression by miR-30 may control osteoblast and osteocyte differentiation leading to attenuation of Lif/LifR/Jak-Stat signal. [score:5]
Expression pattern of miR-30 targets. [score:5]
For a better understanding of miR-30 targeting, basal mRNA expression levels of 18 gene products were quantified and compared in proliferating/sparse KUSA-A1 cells (vector transfected control cells). [score:4]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
EED, named after embryonic ectoderm development, is another novel target of miR-30. [score:4]
miR-30 controls expression of LifR and Runx2, the known regulators for osteoblasts. [score:4]
These predictions appear to be specific to each of the miR-30 members; however, 11 nt of the 5′ seed sequence in miR-30 family members are common and the mature miR-30s sequences are quite homologous among miR-30a/d/e or between miR-30b/c (Fig 7A), indicating shared and distinctive targets among miR-30 members. [score:3]
One miR-30 targeting sequence in the 3′-UTR of ctgf/ccn2 has been reported. [score:3]
List of predicted miR-30 targets. [score:3]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
Analysis of miR-30 targeting. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
In addition, two putative miR-30 targeting sites on spp1/osteopontin were found. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesis. [score:3]
Stem, Dev, signals M miR-30b LRP6 −0.5 Frizzled co-receptor for Wnt signaling Dev, signal M miR-30b LIN28A −0.46 Inhibit pri-let-7 maturation in cytoplasm. [score:3]
miR-30 targeting prediction. [score:3]
These in silico analyses suggested putative shared and distinctive target mRNA recognition by miR-30 family, the groups of miR-30a/d/e and miR-30b/c. [score:3]
As targets of miR-30, we found novel key factors in osteogenesis including Lin28, hnRNPA3, Eed, Pcgf5 and HspA5/Grp78. [score:3]
0058796.g006 Figure 6(A) miR-30 family expression pattern in KUSA-A1 mMSC line with (red bars, Os+) or without (blue bars, Os−) osteoinduction. [score:3]
Known target of miR-30. [score:3]
miR-30 targeting in mMSC line. [score:3]
Matching around the 3′ part and intermediate part of miR-30 were tested to those targets. [score:3]
miR-30 controls CCN family gene expression during MSC osteogenesisPhysiological production of CCN2/CTGF is more abundant from chondrocytes in cartilage than those in other tissues, while CCN1/2/3, the prototype members of CCN family, control both chondrocytic and osteoblastic differentiation [57, 58). [score:3]
miR-30 expression pattern during KUSA-A1 MSC osteocytogenesis. [score:3]
Prediction of miR-30 targeting. [score:3]
Since miR-30 family members are homologous (Fig 6A) and possibly share targets, we further investigated the miR-30 family expression patterns at four time points with or without osteo-induction. [score:3]
Dev, Txn N miR-30b hnRNPA3 −0.96 hnRNPA family directly bind to mRNA for nuclear export. [score:2]
RNA N/C miR-30b EED −0.9 Embryonic ectoderm development. [score:2]
Hspa5/grp78, lifr, eed, opn/spp1 and pcgf5 mRNA levels in miR-30 transfected cells were 20–30% lower than those in control cells in both proliferating and confluent cells (Fig 8AB), indicating direct repression of mRNA stability. [score:2]
As a result, miR-30a, miR-30c and miR-30d were highly expressed compared with miR-30b or miR-30e (Fig. 6B). [score:2]
miR-30b/c repress hspa5, eed, ccn1/2/3, hnrnpa3 vC (A), lin28a, opn/spp1 (B), lifr and runx2 (C) in MSC stage. [score:1]
Moreover, the miR-30 family was predicted to recognize sox9, lrp6, smad2, smad1, notch1, bdnf and a number of epigenetic factors (Table 2). [score:1]
0058796.g007 Figure 7(A) List of mature miR-30 family members. [score:1]
This repression is released during osteogenesis due to reduction of miR-30b/c, especially significantly in increase in opn/spp1, lin28a (B), lifr and runx2 (C). [score:1]
In this mo del, miR-30b/c represses hspa5, eed, ccn1/2/3, hnrnpa3 vC (Fig 11A), opn/spp1, lin28a (Fig 11B), lifr and runx2 (Fig 11C) at the MSC stage. [score:1]
Dev, Epige, Stem N, Chro miR-30b CCNE2 −0.84 G1/S transition Cell cycle N miR-30b YOD1 −0.7 DeUbiquitination enzyme Protein Modi miR-30b WDR82 −0.61 WD repeat domain protein. [score:1]
These immediate early induction followed by quick attenuation patterns were shared with those of CCN gene family shown in Fig 2A, indicating these 6 kinds of transcripts are under the control of same factors and the miR-30 family. [score:1]
Osteo-induction transiently induces hspa5, eed, ccn1/2/3 and hnrnpa3 vC, thereafter those transcripts are attenuated by miR-30b/c in early stage and by miR-30a/d/e in osteocytic stage (A). [score:1]
Txn N miR-30b Sox9 −0.6 Master transcription factor for chondrogenesis Dev, Txn N miR-30b LIFR −0.6 Key factor for ES cell self-renewal. [score:1]
This repression is released during osteogenesis upon reduction of miR-30b/c, a change especially significantly in increase in opn/spp1, lin28a (Fig 11B), lifr and runx2 (Fig 11C). [score:1]
Mature miR-30 quantification during osteocytogenesis. [score:1]
Homologous nucleotides among miR-30a/d/e or between miR-30b/c were shown in bold. [score:1]
In addition, miR-30d was induced by osteo-induction (Fig. 5J), and miR-30 family recognition sites were found in the 3′-UTR regions of the runx2 and nov/ ccn3 mRNAs (Fig. S2, S3). [score:1]
Osteo-inductive stimulation transiently induces hspa5, eed, ccn1/2/3 and hnrnpa3 vC, but thereafter those transcripts are attenuated by miR-30b/c at the early stage and by miR-30a/d/e during the osteocytic stage (Fig 11A). [score:1]
These findings suggest that members of the miR-30 family could play an essential role in osteocytic differentiation. [score:1]
Therefore, immediate induction and subsequent rapid repression of ctgf/ccn2 could be controlled by fluctuations in these miRNAs including the miR-30 family. [score:1]
Tuning mo del of canonical and novel osteogenic factors by miRNA-30 family and miR-541 during MSC osteogenesis. [score:1]
WD protein associated, miR-30-specificity. [score:1]
Phos Sig C miR-30b Runx2 −1 Master transcription factor for osteoblast differentiation. [score:1]
All the miR-30 members once reduced during osteoblastic differentiation stage on day 2 and day 7. Among those members, miR-30a/d/e were increased on day 14 around a late osteocytic stage (Fig 6A). [score:1]
On the other hands, miR-30b/c 5′ seed as well as 3′ part was matched with 3′-UTR sequences of spp1/opn, pcgf5, hspa5/grp78 and ctgf/ccn2. [score:1]
We focused on the miR-30 family and miR-541 in this study, while still further analyzing roles of OstemiR in MSC differentiation. [score:1]
Together with these results and data interpretations, we propose the tuning mo del of canonical and novel osteogenic factors by the OstemiRs including miR-30 family and miR-541. [score:1]
[1 to 20 of 61 sentences]
10
[+] score: 152
The level of expression of each gene in control cells (anti-miR-neg or pre-miR-neg) was taken as 1. To identify molecular mechanisms that would regulate the effects of miR-30 miRNAs on adipogenesis, bioinformatics prediction of their targets was performed with TargetScan. [score:8]
Inhibition of the miR-30 family was achieved with the transfection of a combination of three oligonucleotides that can target and inhibit activity of the whole miR-30 family. [score:7]
The expression profile of the miRNAs that were strongly up-regulated during adipogenesis (miR-642a-3p, miR-378, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, and miR-193b) was validated by quantitative PCR (qPCR; Additional file 4). [score:6]
The up-regulation of miR-30 expression is triggered at early stages of adipocyte differentiation (day 3) and increases until terminal differentiation. [score:6]
Although expressed at lower levels than the highly abundant miR-30 family, two members of the miR-642 family were the most highly up-regulated miRNA in our adipogenesis mo del. [score:6]
Moreover, as adipose tissue-derived stem cells can differentiate into either adipocytes or osteoblasts, the down-regulation of the osteogenesis regulator RUNX2 represents a plausible mechanism by which miR-30 miRNAs may contribute to adipogenic differentiation of adipose tissue-derived stem cells. [score:5]
In order to test whether RUNX2 is targeted by the miR-30 family, we cloned two regions of its 3' UTR that contain the predicted miR-30 binding sites into the pSi-CHECK™-2 vector, downstream of the Renilla translational stop codon (Figure 5a,b). [score:5]
Finally, we checked for the expression of the adipogenic -induced transcripts C/EBPβ, PPARγ and fatty acid binding protein (FABP) 4. These genes showed consistent profiles after inactivation of the miR-30 family and over -expression of miR-30a (Figure 4c). [score:5]
Inhibition of the miR-30 family blocked adipogenesis, whilst over -expression of miR-30a and miR-30d stimulated this process. [score:5]
Quantitative RT-PCR confirmation of inhibition or over -expression of the miR-30 family. [score:5]
Given their up-regulation after induction of adipogenesis and their high abundance in adipocytes, we focused on the role of miR-30 family members in adipogenesis. [score:4]
In addition to miR-30 miRNAs, we identified potent up-regulation of other miRNA families, such as miR-378 (35.7-fold), during adipogenic differentiation. [score:4]
Altogether, these data strongly support a direct and functional link between RUNX2 and miR-30, but does not exclude the contribution of additional miR-30 targets. [score:4]
We then focused our study on the miR-30 family, which was also up-regulated during adipogenic differentiation and for which the role in adipogenesis had not yet been elucidated. [score:4]
Finally, we sought to establish a direct link between miR-30 effects on adipogenesis and RUNX2 targeting. [score:4]
In addition to miR-378, our data confirmed that the miR-30 family was up-regulated in adipogenesis (Table 1). [score:4]
Up-regulation of miR-642a-3p, miR-378/378* and miR-30 miRNAs suggests their contribution to adipogenesis. [score:4]
In conclusion, RUNX2 targeting is, at least in part, responsible for miR-30 positive effects on adipocyte differentiation. [score:3]
Screen shot from TargetScan (release 5.1) showing conserved and poorly conserved miR-30 family putative binding sites located in the 3' UTR of human RUNX2. [score:3]
For the target protection experiment, sub-confluent hMADS cells were transfected with TSBs, which are custom designed LNA oligonucleotides with a phosphorothioate backbone (Exiqon); the sequences were 5'-ACATGAAGTAAACACACA-3' for miR-30-TSB and 5'-CAGTCGAAGCTGTTTAC-3' for TSB-neg (mismatch control). [score:3]
In the list of predicted miR-30 targets, we noticed the presence of CBFB (core binding factor beta), a co-transcription factor that forms a heterodimer with RUNX proteins [28]. [score:3]
We used the target site blocker (TSB) strategy to mask miR-30 binding sites 2 and 3 in the RUNX2 3' UTR. [score:3]
Morphological observation and coloration of lipid droplets showed that inactivation of the miR-30 family impaired adipogenesis and that over -expression of miR-30a and miR-30d improved adipogenesis (Figure 4a). [score:3]
We altered their expression by transfecting synthetic miR-30 miRNAs or the corresponding antagomirs. [score:3]
Importantly, we also showed that miR-30 stimulation of adipogenesis was impaired by masking miR-30 binding sites in the 3' UTR of RUNX2, and preliminary data suggest that miR-30 inhibition might stimulate osteogenesis. [score:3]
The simultaneous use of these three oligonucleotides successfully inhibited all miRNAs from the miR-30 family (Exiqon, personal communication; Additional file 6). [score:3]
We show here for the first time that miR-30 miRNAs target RUNX2. [score:3]
miR-30 miRNAs stimulate adipogenesis via inhibition of the osteogenesis transcription factor RUNX2. [score:3]
However, we found that miR-204 and miR-211 were expressed at extremely low levels - for example, below our 0.03% threshold - while miR-30 represented 4.9% of the miRNA reads in adipocytes. [score:3]
Using miRonTop [27], we verified that predicted miR-30 targets were correctly enriched in these experiments. [score:3]
Thus, it is tempting to speculate that RUNX2 inhibition is required for adipocyte differentiation and that miR-30 miRNAs play a critical role in this process. [score:3]
In order to dissect the molecular mechanisms involved in the effects of miR-30 on adipogenesis, we searched for predicted target genes. [score:3]
Overall, our data suggest that the miR-30 family plays a central role in adipocyte development. [score:2]
Figure 4 The miR-30 family positively regulates hMADS cell adipocyte differentiation. [score:2]
In particular, we show that the miR-30 family is a positive, key regulator of adipocyte differentiation in a human adipose tissue-derived stem cell mo del. [score:2]
Thus, in our system, this very low abundance of miR-204 and miR-211 suggests that their impact on RUNX2 and differentiation is minor when compared with the highly expressed miR-30 family. [score:2]
Statistical scores were highest for the miR-30 family (P-value = 5.32.10 [-10]), showing its strong overall impact in these cells. [score:1]
The first region covers positions 32 to 332 of the RUNX2 3' UTR and contains a poorly vertebrate-conserved putative miR-30 binding site (positions 229 to 235 of the RUNX2 3' UTR). [score:1]
Gain and loss of function studies reveal that the miR-30 family favors adipogenesis. [score:1]
Inactivation of the miR-30 family drastically reduced GPDH activity at day 10 (fold reduction of 23.9). [score:1]
The day after this first transfection, hMADS cells were co -transfected with miR-30 Pre-miR™ miRNA precursor molecules (Ambion) at a final concentration of 40 nM, together with the miR-30-TSB again, or the mismatch control TSB. [score:1]
This is probably not due to a deep sequencing cloning bias, as miR-204 detection was above average and better than that of miR-30 in a synthetic equimolar miRNA panel that we sequenced in similar conditions (data not shown). [score:1]
Since CBFB was shown to be essential for functions of RUNX1 and RUNX2 [28], these additional data may explain the drastic effect of miR-30 on adipogenesis. [score:1]
Transfection with RUNX2 miR-30-specific TSB, but not a control TSB, significantly decreased miR-30a stimulation of adipogenesis (Figure 5E). [score:1]
Even though none of the miR-30 family members are encoded within introns of pro-adipogenic sites, their increased abundance is likely to reflect a major role in differentiation. [score:1]
Interestingly, the relative abundance of the miR-30 family varies from 1.1% in undifferentiated cells to 4.9% in adipocyte-differentiated cells (Figure 2b). [score:1]
Of note, all miR-30 miRNAs do not belong to the same genomic cluster (Additional file 8). [score:1]
Table S2: miR-30 family identifiers, genomic coordinates and mature sequences. [score:1]
Amongst the adipogenesis -induced miRNAs, miR-30 reached the highest levels during differentiation. [score:1]
[1 to 20 of 49 sentences]
11
[+] score: 107
Interestingly, miR-30 family members respond to radiation differently in CD34+ and hFOB cells and radiation oppositely regulated miR-30 expression in these cells: miR-30b, miR-30c and miR-30d were upregulated in CD34+ cells whereas miR-30c was downregulated in hFOB cells (Figure 1). [score:10]
Furthermore, our data show that radiation regulates miR-30 expression in the opposite manner in CD34+ and hFOB cells, with enhanced miR-30b, miR-30c and miR-30d expression in CD34+ cells (which are sensitive to radiation damage), and decreased miR-30c expression in the relatively radio-resistant hFOB cells. [score:8]
miR-30b, miR-30c and miR-30d were upregulated in CD34+ cells whereas miR-30c was downregulated in hFOB cells. [score:7]
Next, we analyzed potential targets of miR-30 family members using the miRNA target prediction database TargetScan 5.1 (http://www. [score:7]
miR-30 family members are involved in regulation of p53 -induced mitochondrial fission and cell apoptosis [11], regulation of B-Myb expression during cellular senescence [12], and play important roles in epithelial, mesenchymal, osteoblast cell growth and differentiation [13]- [15]. [score:5]
Our data suggest that CD34+ and hFOB cells have different miRNA expression patterns after irradiation and that radiation -induced miR-30 expression in CD34+ cells may aggravate cell death. [score:5]
Radiation -induced REDD1 expression was inhibited by pre-miR30 transfection. [score:5]
Fresh thawed human hematopoietic progenitor CD34+ cells were transfected with miR-30c inhibitor or control miRNA and were exposed to 2 Gy radiation at 24 h post-transfection of miR-30 inhibitor or control molecule. [score:5]
Since multiple potential targets of miRNAs have been suggested (5), validating miR-30 targets in irradiated CD34+ cells will be important to understand the roles of miR-30 in these cells after radiation injury. [score:5]
Interestingly, miR-30 has potential target sites located in the 3′UTR of REDD1 gene, and we show here that REDD1 is a target of miR30c in response to γ-radiation in primary human hematopoietic CD34+ and hFOB cells. [score:5]
The profiles of miRNA expression in human CD34+ cells and osteoblast cells in response to γ-radiation were completely different, and only Let-7 and miR-30 miRNA families were regulated by radiation in both types of cells (Table 1) with increased Let-7f in CD34+ cells and increased let-7g in hFOB cells. [score:4]
Interestingly, miR-30 family member expression in irradiated CD34+ and hFOB cells were changed in opposite directions. [score:4]
org), and found that members of the miR-30 family were predicted to target the stress-response gene REDD1. [score:3]
miRNA Real-Time RT-PCR validation of miR-30 family member expressions in CD34+ and hFOB cells. [score:3]
Recent studies suggested that miR-30 is one of the most common known tumor suppressor miRNAs [10]. [score:3]
from two experiments showed that transfection of miR30 inhibitor resulted in significant colony number increases in irradiated cells. [score:3]
hsa-miR-30 expression after γ-irradiation (Quantitative Real Time-PCR). [score:3]
To confirm the miRNA microarray findings, the changes in miRNA expression for miR-30 family were validated by RT-PCR. [score:3]
Consistent with miRNA microarray data, RT-PCR results demonstrated that 2 Gy γ-radiation significantly induced miR-30b and miR-30c expression in CD34+ cells. [score:3]
There is abundant evidence of miR-30 in regulation of cell growth, differentiation, apoptosis and senescence in hematopoietic [25], osteoblast [15], adipocyte [26], epithelial and pancreatic cells [27] through different signal transduction pathways. [score:2]
Levels of OD were dramatically lower in pre-miR30 -transfected hFOB cells in both irradiated and non-irradiated samples, compared with controls and miR30 inhibitor -transfected samples (p<0.01). [score:2]
Nevertheless, Let-7 and miR-30 families were regulated by radiation in both CD34+ and hFOB cells. [score:2]
miR-30b and miR-30c levels were increased at 0.5 or 1 h after γ-irradiation in (A) CD34+ cells, whereas they were decreased or not altered in (B) hFOB cells in response to radiation. [score:1]
Figure 2C shows the miR-30b and miR-30c binding site in the 3′UTR of the REDD1 gene. [score:1]
Using bioinformatics analysis we found a potential binding site of miR-30 in the 3′ UTR of REDD1 gene. [score:1]
miR-30 family members, miR -30a,-30b, -30c, 30d and 30e, were examined in both irradiated and non-irradiated CD34+ and hFOB cells using quantitative real-time RT-PCR. [score:1]
Hence manipulation of miR-30 may be a useful approach to explore the mechanisms of radiation -induced apoptosis and/or premature senescence in mammalian hematopoietic tissues. [score:1]
At 2 h after irradiation, levels of miR-30b and miR-30c returned to baseline as shown in non-irradiated cells and did not change thereafter. [score:1]
In contrast with CD34+ cells, levels of miR-30b did not change and miR-30c was reduced 0.4 fold in hFOB cells by 8 Gy γ-irradiation (Figure 2B). [score:1]
Hence we explored interactions between the miR-30 family and REDD1. [score:1]
However, effects of miR-30 on ionizing radiation -induced cell damage have not been reported. [score:1]
miR-30b and miR30c expression were evaluated by RT-PCR. [score:1]
[1 to 20 of 32 sentences]
12
[+] score: 96
Upregulation of Smad1 and Osx Expression Is Restored by Mg [2+] In a recently published study [28], a link was established between miR-30b regulation and mRNA expression of Smad1, Runx2, and caspase-3 in human primary aortic valve interstitial cells. [score:9]
Indeed, its levels were decreased during calcification, whereas its modulation altered Runx2, Smad1, phosphorylated Smad1/5/8, and caspase-3 protein levels; that is, target levels were increased by miR-30b inhibition and decreased by overexpression strategies. [score:7]
The past and present findings are summarized in Figure 6, where the multiple modes of action of Mg [2+] in Pi -induced VC are depicted: from its entry into the cell through TRPM7, its modulation of Ca/P crystal composition and structure, its modifications of calcification inhibitors, enhancement of cell viability, suppression of osteogenic differentiation, inhibition of Wnt/ β-catenin pathway, and finally its active influence on osteogenesis (Runx2, Osx, and Smad1) through specific miR modulation (miR-30b, miR-133a, and miR-143). [score:7]
Mg [2+] Is Able to Reverse a Pi-Induced Decrease in miR-30b ExpressionData on miR-30b regulation show a significant, progressive decrease in its expression in the calcifying condition from day 3 onwards. [score:6]
It reveals three main findings: (i) our screening showed a downregulation of key miRs such as miR-30b, miR-133a, and miR-143 during Pi -induced calcification of HAVSMC; (ii) osteogenesis and VC markers related to these miRs, such as Smad1 and Osterix, were found to be modulated accordingly; and (iii) Mg [2+] had a protective effect by interfering with the Pi -induced VC process as the modulations of the affected miRs and their related targets were partially abrogated or even improved. [score:6]
We are now able to assert that Mg [2+] is effective relatively early during Pi -induced VC by cancelling osteogenic gene expression through miR-30b/miR-133a/miR-143 expression reinforcement, resulting in a retention of the SMC phenotype. [score:5]
Adding Mg [2+] to the calcifying condition resulted in an initial decrease of miR-30b expression that quickly rose and then returned to the basal expression level from day 7 onwards, being nonsignificantly different from the control condition set to 1 (Figure 3(a)). [score:5]
In our experimental setup, miR-30b was found to be downregulated during Pi -induced VC, confirming previous findings. [score:4]
The expression of Runx2 mRNA is regulated by several miRs: miR-30b, miR-133a, and miR-204 (Table 1). [score:4]
The Pi -induced downregulation of miR-30b and -133a is at its maximum at day 10. [score:4]
In a recently published study [28], a link was established between miR-30b regulation and mRNA expression of Smad1, Runx2, and caspase-3 in human primary aortic valve interstitial cells. [score:4]
Knockdown of miR-30b/c established Runx2 as their preferential target during VC. [score:4]
In the meantime, miR-30b was found to be a multifunctional regulator of aortic valve interstitial cells in calcified aortic valve disease [28]. [score:4]
Data on miR-30b regulation show a significant, progressive decrease in its expression in the calcifying condition from day 3 onwards. [score:4]
Mg [2+] Is Able to Reverse a Pi-Induced Decrease in miR-30b Expression. [score:3]
We mentioned that miR-30b and -133a were found to be differentially expressed (Figures 3(a) and 3(b)). [score:3]
Considering the previous studies, we decided to assess Runx2 and Smad1 mRNA expression to see the potential consequences of a miR-30b and miR-133a Pi -induced decrease. [score:3]
In summary, we found that Pi, the most prominent natural inducer of VC, was able to decrease the expression of miR-30b/miR-133a/miR-143. [score:3]
These three mRNA were identified and confirmed as potential target genes of miR-30b (Table 1). [score:3]
This correlates with the observed miR-30b regulation. [score:2]
To date, the whole miR-30 family has been implicated in the osteogenesis process [30]. [score:1]
The results are in line with previous publications suggesting that the miR-30b decrease was a procalcifying event [18] in human smooth muscle cells. [score:1]
Before the initiation of our study, Balderman et al. reported a decrease of miR-30b/c during BMP-2 (Bone Morphogenetic Protein-2) induced VC of human artery smooth muscle cells [18]. [score:1]
Our results confirmed the implication of miR-30b in calcification and brought miR-133a as well as miR-143 from phenotypic switch and vascular remo deling into the field of VC. [score:1]
Our data suggest that Mg [2+] is able to antagonize the Pi -induced decrease of 3 miRs (miR-30b, miR-133a, and miR-143) involved in mineralization processes or SMC phenotypic switch. [score:1]
Moreover, a siRNA strategy to decrease Smad1 mRNA and consequently Smad1 protein levels prevented the decrease of miR-30b/c. [score:1]
[1 to 20 of 26 sentences]
13
[+] score: 88
We have selected to study two representative miRNAs from each family: miR-29b (a potent inhibitor of breast tumor metastasis [34]) and miR-29c (associated with a significantly reduced risk of dying from breast cancer [41]), miR-30b and miR-30d (both significantly down-regulated in ER -negative and progesterone receptor (PR) -negative breast tumors [42]), and miR-200b and miR-200c (both representing key negative regulators of EMT and anoikis resistance [30- 32]). [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
To determine whether miR-29b/c, miR-30b/d, or miR-200b/c might regulate ADAM12-L expression in breast cancer patients in vivo, we examined the relationship between these miRNAs and ADAM12-L mRNA in a cohort of 100 breast cancer patients for which mRNA/miRNA expression data were publicly available (GEO: GSE19536) [44]. [score:6]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
To test whether miR-30b or miR-30d directly targets the ADAM12-L 3′UTR, we used the luciferase reporter in SUM159PT cells. [score:4]
We conclude that the miR-30 family does not contribute significantly to the regulation of ADAM12-L expression in the two cell lines examined here. [score:4]
Similarly, we assessed whether miR-30b/d potentially target ADAM12-L. We transfected miR-30b/d or control mimic into SUM159PT and SUM1315MO2 cells, two claudin-low cell lines with low to moderate endogenous miR-30b/d expression (Figure  1D), and measured the level of ADAM12-L and ADAM12-S mRNA by qRT-PCR. [score:3]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
The 3′UTR of human ADAM12-L contains well conserved potential target sites for miR-29b/c, miR-30b/d, and two poorly conserved potential sites for miR-200b/c (Figure  1C). [score:3]
Down-regulation of miR-30 family members was observed in non-adherent mammospheres compared to breast cancer cells under adherent conditions [37]. [score:3]
Figure 3 ADAM12-L is a poor target for miR-30b/d. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
Destruction of the potential miR-30 target site by mutagenesis eliminated the effect of miR-30b mimic. [score:3]
In contrast, miR-30b/d did not elicit consistent and significant effects on ADAM12-L expression. [score:3]
Expression data for miR-30b were not available. [score:3]
Reduction of miR-30 levels was reported to promote self-renewal and to inhibit apoptosis in breast tumor-initiating cells [36]. [score:3]
miR-30b did not diminish ADAM12-L levels in either cell line and neither miRNA mimic affected ADAM12-S expression (Figure  3A). [score:3]
The miR-30 family appears to modulate the stem-like properties of breast cancer cells as well. [score:1]
Both miR-30b and miR-30d had only minor effects on ADAM12-L protein levels in SUM159PT and SUM1315MO2 cells. [score:1]
miR-30b/d had a modest effect on ADAM12-L protein in both cell lines (Figure  3B). [score:1]
Among the three miRNA families tested, miR-30 elicited the least consistent effects. [score:1]
miR-29b/c, miR-30b/d, miR-200b/c, or control miRNA mimics were transfected into SUM159PT, BT549, SUM1315MO2, or Hs578T breast cancer cells. [score:1]
Transfection of miR-30b mimic elicited a significant decrease in luciferase activity but miR-30d mimic did not (Figure  3C). [score:1]
While miR-30b diminished the ADAM12-L 3′UTR reporter activity, the level of ADAM12-L mRNA in SUM159PT and SUM1315MO2 cells was not affected upon transfection of miR-30b. [score:1]
We established that transfection of miR-29b/c and miR-200b/c mimics strongly decreased the level of ADAM12-L protein in claudin-low SUM159PT, BT549, SUM1315MO2, and Hs578T cells, while miR-30b/d mimics had a more modest effect. [score:1]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
[1 to 20 of 29 sentences]
14
[+] score: 81
To do this, we injected the neurone -targeted gene knock-down system (LV-mCMV/SYN-tTA + LV-Tretight-GFP-miR30-shRNA/Luc) with LVV to express Luc in astrocytes (LV-GfaABC [1]D-Luc) and, conversely, the astrocyte -targeted knock-down system (LV-mCMV/GfaABC [1]D-tTA+ LV-Tretight-GFP-miR30-shRNA/Luc) together with LVV for neuronal Luc expression (LV-SYN-Luc). [score:11]
LTR, lentiviral long terminal repeats; Tretight, a modified tetracycline and Dox-responsive promoter derived from pTRE-tight (Clontech); GFP, green fluorescence protein; miR30-shRNA/Luc, miR30 -based shRNA targeting firefly Luc gene; miR30-shRNA/nNOS, miR30 -based shRNA targeting rat neuronal nitric oxide synthase gene; Luc, firefly Luc gene; GfaABC [1]D, a compact glial fibrillary acidic protein promoter (690 bp); SYN, human synapsin 1 promoter (470 bp); mCMV, minimal CMV core promoter (65 bp); GAL4BDp65, a chimeric transactivator consisting of a part of the transactivation domain of the murine NF-κBp65 protein fused to the DNA binding domain of GAL4 protein from yeast; WPRE, woodchuck hepatitis post-transcriptional regulatory element. [score:6]
To this end, we constructed a binary Dox-controllable and cell-specific miR30 -based RNAi system to express shRNAs targeting a reporter gene for Luc and an endogenous gene for nNOS. [score:5]
a: LV-mCMV/GfaABC [1]D-tTA controlled miR30-shRNA/Luc didn't knockdown Luc expression in neurones. [score:4]
b: LV-mCMV/SYN-tTA controlled miR30-shRNA/Luc didn't knockdown Luc expression in glia. [score:4]
These results demonstrate that bidirectional transcriptionally amplified SYN and GfaABC [1]D promoters provide a sufficient level of tTA to activate the Tretight promoter which then drives the synthesis of GFP-miR30-shRNA/Luc transcript to induce substantial Luc knock-down. [score:3]
tTA binds to Tretight promoter in LV-Tretight-GFP-miR30-shRNA/Luc and activates the expression of shRNA/Luc. [score:3]
In these constructs gene targeting sequences were embedded in the precursor miRNA context derived from miR30, one of the most well-studied miRNA in mammals. [score:3]
For example, miR-195, miR-497, and miR-30b were found to be enriched in the cerebellum whereas miR-218, miR-221, miR-222, miR-26a, miR-128a/b, miR-138 and let-7c were highly expressed in the HIP. [score:3]
Abbreviation Vector combination Function LVVs-miRLuc-neuroneLV-SYN-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/SYN-tTA Neurone-specific Luc knock-down system. [score:2]
LVVs-miRnNOS-neuroneLV-Tretight-GFP-miR30-shRNA/nNOS+ LV-mCMV/SYN-tTA Neurone-specific nNOS knock-down system. [score:2]
LVVs-miRLuc-control2LV-GfaABC [1]D-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc + LV-GfaABC1D-WPRE Control combination used in Luc knock-down experiments for the astrocyte-specific system. [score:2]
LVVs-miRnNOS -negative control1LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/SYN-tTA Negative control combination used in nNOS knock-down experiments for the neurone-specific system. [score:2]
Again, the anti-Luc construct LV-Tretight-GFP-miR30-shRNA/Luc (treatments 4 in Figure 4c and Figure 4d) did not trigger nNOS knock-down. [score:2]
LVVs-miRnNOS-control2LV-Tretight-GFP-miR30-shRNA/nNOS + LV-GfaABC [1]D-WPRE Control combination used in nNOS knockdown experiments for the astrocyte-specific system. [score:2]
LVVs-miRLuc-gliaLV-GfaABC [1]D-Luc+LV-Tretight-GFP-miR30-shRNA/Luc+LV-mCMV/GfaABC1D-tTA Astrocyte-specific Luc knock-down system. [score:2]
LVVs-miRnNOS-control1 LV-Tretight-GFP-miR30-shRNA/nNOS + LV-SYN-WPRE Control combination used in nNOS knockdown experiments for the neurone-specific system. [score:2]
LVVs-miRnNOS-glia LV-Tretight-GFP-miR30-shRNA/nNOS + LV-mCMV/GfaABC1D-tTA Astrocyte-specific Luc knock-down system. [score:2]
Lentiviral systems developed in the course of this study enable tight Dox-controllable and cell-specific miR30 -based RNAi gene knock-down. [score:2]
LVVs-miRLuc-control1LV-SYN-Luc+ LV-Tretight-GFP-miR30-shRNA/Luc+ LV-SYN-WPRE Control combination used in Luc knock-down experiments for the neurone-specific system. [score:2]
LVVs-miRnNOS -negative control2LV-Tretight-GFP-miR30-shRNA/Luc+ LV-mCMV/GfaABC1D-tTA Negative control combination used in nNOS knock-down experiments for the astrocyte-specific system. [score:2]
It is important to note that anti-Luc construct, LV-Tretight-GFP-miR30-shRNA/Luc (treatment 4 in Figure 4a and Figure 4b), was without effect in either cell line, indicating that the nNOS knock-down was sequence-specific. [score:2]
Figure 3Analyses of the efficacy of miR30-shRNA/Luc in vivo in adult rat brain. [score:1]
First, the effect of miR30-shRNA/Luc was assessed in cell lines. [score:1]
To examine whether the different RNAi efficiency in DVC and HIP is caused by different processing of RNAi, we performed northern blotting analysis to assess the ratio between mature -RNAi and precursor-miR30 -RNAi in these two regions. [score:1]
Analysis of the effects of miR30-shRNA/Luc in vivo. [score:1]
We first confirmed the efficacy of the anti-nNOS construct, LV-Tretight-GFP-miR30-shRNA/nNOS in PC12 and 1321N1 cells. [score:1]
Figure 4Western-blot analyses of the functions of miR30-shRNA/nNOS both in vitro (a, b) and in vivo (c, d). [score:1]
A: LVVs-miRLuc-control1; B: LV-SYN-Luc + LV-Tretight-GFP-miR30-shRNA/Luc + LV-mCMV/GfaABC [1]D-tTA. [score:1]
To construct the LV-Tretight-GFP-miR30-shRNA/nNOS shuttle vector, we replaced the Luc shRNA sequence in the LV-Tretight-GFP-miR30-shRNA/Luc shuttle vector with the nNOS shRNA. [score:1]
Figure 2Analyses of the functions of miR30-shRNA/Luc in vitro. [score:1]
A': LVVs-miRLuc-control2; B': LV-GfaABC [1]D-Luc + LV-Tretight-GFP-miR30-shRNA/Luc + LV-mCMV/SYN-tTA. [score:1]
To generate the LV-Tretight-GFP-miR30-shRNA/Luc shuttle vector, we excised the Tretight fragment containing the modified Tet-responsive promoter from pTRE-Tight-DsRed2 (Clontech) and inserted it into the pTYF-SW Linker and cloned, into the obtained vector, PCR product of GFP-miR30-shRNA/Luc cassette from pPRIME-CMV-GFP-FF3 (kindly provided by F. Stegmeier, Harvard Medical School) downstream of Tretight promoter. [score:1]
Our constructs, following the design of Stegmeir et al. used flanking and loop sequences from an endogenous miR30 [37]. [score:1]
Analyses of the functions of miR30-shRNA/Luc in vitro. [score:1]
[1 to 20 of 35 sentences]
15
[+] score: 81
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30c-1, hsa-mir-30e
In the process of generating stable EGFP knockdown cell lines in human Jurkat T cells by using an anti-EGFP shRNA expressed from CMV -driven miR30-backbone expression vectors (shRNA-miRs, see Figure 1A for design of the constructs), we noted a much reduced target knockdown (52.7%) as compared to identical shRNAs expressed from the mouse polymerase III U6 promoter (90.2%, see Figure 1B, top panels). [score:10]
Since this processing could be impacted by the number of mRNA copies present in the cell, we thus chose to correlate the relative mCherry expression with viruses not expressing the miR-30 cassette to the percentage of target knockdown in cells expressing the shRNAs. [score:10]
B) EGFP -expressing Jurkat T cells (top panels) or 293T cells (lower panels) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a mouse U6 promoter (U6 anti-EGFP shRNA) or from a miR-30 backbone expressed from a CMV promoter (miR-context anti-EGFP shRNA) or the relevant control viruses that lack shRNA inserts. [score:7]
EGFP -expressing human immune cell types (Raji B cells, Jurkat T cells, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoter. [score:5]
EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoters. [score:5]
2±2.4 72.2±2.4 60.2±0.4 56.7±4.9 76.7±0.7EGFP -expressing human cell lines (see top row) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoters (left column). [score:5]
0026213.g003 Figure 3 EGFP -expressing human immune cell types (Raji B cells, Jurkat T cells, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs expressed from a miR-30 backbone driven by various indicated polymerase-II promoter. [score:5]
0026213.g006 Figure 6EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoters. [score:5]
EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoter. [score:5]
0026213.g005 Figure 5EGFP -expressing human immune cell types (Raji B, Jurkat T, and THP-1 monocytic cells) and adherent cell lines (293T, HeLa, and HT29 cells) were infected at an MOI of <0.2 with anti-EGFP shRNAs (left panels) expressed from a miR-30 backbone driven by various polymerase-II promoter. [score:5]
We set out to explore the nature of this discrepancy, and assessed whether the potency of the polymerase II promoter used to express the miR30-backbone anti-EGFP shRNAs could impact the shRNA-directed silencing in Jurkat T cells. [score:4]
Monitoring EGFP knockdown by shRNAs expressed from miR-30 backbone vectors. [score:4]
For all lines, there was a clear correlation between promoter strength (as determined by mCherry expression) and EGFP-knockdown by the miR30-backbone anti-EGFP shRNA, suggesting that the strength of the promoter is a major determinant for shRNA-miR potency. [score:4]
B) mCherry expression is reduced upon cloning of an shRNA-containing miR-30 cassette in the 3′UTR of the fluorescent protein. [score:3]
As additional controls, cells were infected with the same viruses lacking a miR-30-anti-EGFP unit. [score:1]
Various mammalian and viral polymerase II promoters (CMV, PGK, UbiC, CAGGS, EF1A) were cloned upstream of mCherry in the miR30-anti-EGFP vectors and control (mCherry alone) vectors. [score:1]
To this end, we cloned five different polymerase II promoters upstream the miR-30 anti-EGFP shRNA cassette that is located in the 3′UTR of the fluorescent protein mCherry to mark cells that have been infected with the lentiviral construct. [score:1]
A similar anti-EGFP shRNA sequence with the miR30 loop (bold) was cloned between miR30 pricursor arms (underlined and italic) downstream of mCherry in the same vector (AAGAAGGTATATTGCTGTTGACAGTGAGCG TCAAGCTGACCCTGAAGTTCAT TAGTGAAGCCACAGATGTAATGAACTTCAGGGTCAGCTTGC TGCCTACTGCCTCGGACTTCAAGGGG ), the U6 promoter unit was removed. [score:1]
[1 to 20 of 18 sentences]
16
[+] score: 73
It might occur at the stage of disease initiation: compared with normal Wistar rat, varied copy number of mir-30b and mir-30d in GK might result in altered expression level at some specific developmental stages and at some specific tissues, and the altered expression of mir-30b and mir-30d might then lead to dysfunction of some specific targets, contributing to the development of T2D. [score:10]
We then mapped these microRNA targets to KEGG pathways, and found that 5(2), 12(6), 10(4), 14(12), 4(5) and 1(3) targets of mir-30b(mir-30d) belonged to the pathways of “type II diabetes (04930)”, “Type I diabetes (04940)”, “pancreatic cancer (05212)”, “insulin signaling (04910)”, “PPAR signaling (03320)” and “maturity onset diabetes of the young (04950)”, respectively (Table 4). [score:5]
Since rno-mir-30b was processed to two mature forms, rno-miR-30b-3p and rno-miR-30b-5p, their targets were combined for further analysis; and it was the same with rno-mir-30d, where the targets of rno-miR-30d and rno-miR-30d* were merged. [score:5]
In addition to the aforementioned study of the expression of mir-30d, there were several other expression profiling reports suggesting the involvement of mir-30 family in diabetes or adipogenesis [47]– [49]. [score:5]
It turned out that 39 and 35 targets of mir-30b and mir-30d occurred in this T2D gene list respectively, and were both significantly overrepresented (p = 0.000273 and 0.00152, detailed targets listed in Table 3), supporting the hypothesis of mir-30b and mir-30d's involvement in T2D. [score:5]
Among them, Pparg and Akt2 (targets of mir-30b), Hnf1b, Hnf4a, and Lmna (targets of mir-30d), are well-known genes implicated in T2D or insulin resistance. [score:5]
We re-analyzed a public microRNA expression dataset GSE13920, currently the only one microRNA profiling in GK and Wistar rats [43], and found that the expression levels of mir-30b/30d in muscle cells were strikingly different between normal rat and T2D rat (Figure S2). [score:5]
To further elucidate the putative roles of mir-30b/30d, we looked at their predicted targets using MicroCosm [39]. [score:3]
microRNA Predicted targets rno-mir-30b Aire, Akt2 *, Bud13, Cblb, Cdc123, Eif4e, Elf1, Fgb, Gcg, Hdac3, Irf4, Kcnj5, Klrg1, Mapk8, Med14, Mgea5, Mttp, Neurod1, Nfkb1, Nmu, Parl, Pbx1, Pfkl, Pik3r2, Pparg *, Ppargc1b, Prkce, Prmt2, Rapgef4, Rpa2, Rrad, Serpine1, Slc2a10, Socs1, Srebf1, Tlr4, Ubl5, Ucp2, Wdr42a rno-mir-30d Ace, Cblb, Cdh15, Cp, Cyb5r4, Egfr, Foxo1, Hdac3, Hnf1b *, Hnf4a *, Inpp5k, Irf4, Lgr5, Lmna *, Neurod1, Nfkb2, Nfkbia, Nr1i3, Nr4a1, Parl, Pbx1, Pik3r2, Ppargc1b, Ppp1r3d, Prkar2b, Ptf1a, Rbp4, Rrad, Sell, Sirt1, Slc2a10, Socs1, Sorcs1, Srebf1, Tlr4 *Well-known genes implicated in T2D or insulin resistance. [score:3]
Figure S2 Expression levels of mir-30b/30d in the muscle of GK and Wistar Rat. [score:3]
Targets of rno-mir-30b and rno-mir-30d in T2D-related genes. [score:3]
As for the microRNA expression dataset GSE13920, we simply looked at the mean signal intensities after removing mean background noise for each probe of mir-30b and mir-30d. [score:3]
Table S10 Pathway mapping and enrichment of the targets of rno-mir-30b. [score:3]
The targets of rno-mir-30b and rno-mir-30d involved in diabetes-related pathways. [score:3]
Taken together, there were 1868 and 1776 targets for rno-mir-30b and rno-mir-30d, respectively. [score:3]
The down-regulation of Zfat in muscles is consistent with that of mir-30b and mir-30d, that is, all of them are inconsistent with the CNV gain, suggesting further investigations are still needed to confirm these results and to unveil detailed mechanisms. [score:2]
0014077.g002 Figure 2The microRNA rno-mir-30b and rno-mir-30d located in T2D QTLs. [score:1]
These results provided extra evidence of a role for mir-30b/30d in diabetes pathogenesis. [score:1]
We proposed that the altered copy number of mir-30b and mir-30d in GK rats could contribute to the pathogenesis of T2D. [score:1]
We noticed that there was a protein-coding gene named Zfat which is located at the same gain CNVR as mir-30b and mir-30d are positioned in. [score:1]
The microRNA rno-mir-30b and rno-mir-30d located in T2D QTLs. [score:1]
By comparing the genomic positions of known rat microRNA genes with those of GK/Wistar CNVRs, we found that rno-mir-30b and rno-mir-30d were simultaneously covered by a “gain” region on chromosome 7 in all three samples (Table S9) within a region of only 3.8 Kb. [score:1]
A non-redundant set of CNV regions with the total length of about 36 Mb was identified, including several novel T2D susceptibility loci involving 16 protein-coding genes (Il18r1, Cyp4a3, Sult2a1, Sult2a2, Sult2al1, Nos2, Pstpip1, Ugt2b, Uxs1, RT1-A1, RT1-A3, RT1-Db1, RT1-N1, RT1-N3, RT1-O, and RT1-S2) and two microRNA genes (rno-mir-30b and rno-mir-30d). [score:1]
[1 to 20 of 23 sentences]
17
[+] score: 67
Expression analysis using the Real-time PCR method revealed that two out of nine miRNAs were significantly downregulated: the expression of miR-30b differed between ACVIM stage B and stage A (control) dogs; the expression of mi-133b differed ACVIM stage C and stage A dogs. [score:10]
miR-30b could be a potential biomarker of ACVIM stage B heart failure in Dachshunds and miR-133b could be a potential biomarker of ACVIM stage C. The lack of expression of miR-208a and 208b in healthy dogs and dogs with heart disease and lack of significant changes in expression in the remaining 5 miRNAs which are potential biomarkers of heart diseases in humans proves that the findings in human medicine are not always directly reflected in veterinary medicine. [score:10]
miR-30b was downregulated in ACVIM stage B dogs when compared to ACVIM stage A dogs (this miRNA also showed a downregulatory trend in ACVIM stage C dogs) and miR-133b was downregulated in ACVIM stage C dogs. [score:9]
miR-30b could be a potential biomarker of ACVIM stage B heart failure in Dachshunds with endocardiosis and miR-133b could be a potential biomarker of ACVIM stage C. The lack of expression or lack of significant changes in expression in 7 miRNAs which are potential biomarkers of heart diseases in humans proves that findings from human medicine are not always directly reflected in veterinary medicine. [score:8]
The results revealed that miR-30b was significantly downregulated in ACVIM stage B–its expression was -2.63 times lower than in unaffected dogs. [score:6]
miR-30 and miR-133 are cardiomyocyte-enriched miRNAs which regulate connective tissue growth factor (CTGF)–a key molecule in the process of fibrosis and therefore an attractive therapeutic target of heart diseases. [score:6]
Thus we concluded that the cause of the changed expression of miR-30b and miR-133b in our study was the stage of the disease, not the age of the animals. [score:5]
Downregulation of miR-30 is related to endoplasmic reticulum stress in cardiac muscle and vascular smooth muscle cells [34]. [score:4]
5 miRNAs (miR-125, miR-126, miR-21, miR-29b and miR-30b) showed a trend of downregulation in the ACVIM C group. [score:4]
1: The expression of miR-21, miR-29, miR-30b, miR-133b, miR-126, miR-423 and miR-125 in dogs with heart failure divided into groups based on age (fold changes relative to youngest group; mean ± SEM). [score:3]
The mean fold change for each of them was as follows: -1.84 for miR-30b, -1.55 for miR-126, -1.82 for miR-125. [score:1]
On the other hand the results of the study conducted by Goren et al. revealed elevated levels of miR-30 in the serum of stable chronic systolic heart failure patients [21]. [score:1]
[1 to 20 of 12 sentences]
18
[+] score: 65
Mutation of the ARE-motif further downregulated reporter expression, whereas the double mutation of miR-30 binding sites abolished the downregulatory effect of the calretinin 3′UTR. [score:11]
Utilizing several prediction algorithms, miR-30 family members were identified as potential candidates targeting calretinin mRNA; overexpression or inhibition experiments revealed that only miR-30e-5p is able to modulate calretinin protein levels through the calretinin 3′UTR. [score:7]
FIGURE 4Members of miR-30 family are abundantly expressed in mesothelioma cell lines and miR-30e-5p regulates calretinin expression. [score:6]
Quantitative expression analysis showed that miR-30b/c/d/e (5p-arm) are abundantly expressed in ZL55, ONE58, ACC-MESO-4 cells (Figure 4A). [score:5]
The observation that the double miR-30 mutant construct (pmiRGLO-CALB2-3′UTR-mir30-dmt) abolished the downregulatory effect mediated by CALB2-3′UTR, led us to identify the critical miR-30 member conveying this effect. [score:4]
In contrast, mutation of both miR-30 binding sites restored the expression of the luciferase reporter to the level of the empty vector. [score:4]
This downregulatory effect is possibly conveyed through the second miR-30 binding site alone. [score:4]
We then generated an additional four constructs harboring mutations of the consensus sequence for the predicted ARE motif and miR-30 binding sites and transiently transfected all variants into ONE58 cells to test for their effects on luciferase expression (Figures 2C,D). [score:4]
ONE58 cells stably expressing Firefly luciferase-CALB2-3′UTR, were transiently transfected with 1 and 5 nM of miR-30b/c/e-5p mimetic treatment (Supplementary Figure 4). [score:3]
Based on the analysis of 1319 differentially expressed genes, Cheng et al. (2016) identified the miR-30 family amongst the top 20 enriched miRNA families in mesothelioma. [score:3]
The AREsite2 software (Fallmann et al., 2016) revealed a putative ARE motif (AUUUA) within the first stretch, and TargetScan7.1 software predicted two binding sites for the miR-30 family and one for miR-9, within the second conserved stretch (Figures 2A,B). [score:3]
Interestingly, unlike the other miR-30 members where the 3p arm was almost absent, both the miR-30e-5p and-3p arms were expressed in ZL55, ONE58, ACC-MESO-4 cells. [score:3]
Four additional luciferase reporter constructs carrying mutations in either ARE and/or miR-30 binding sites were generated and their activity was tested in ONE58 cells. [score:2]
The miR-30 family includes five members, miR-30a through miR-30e and is evolutionary well conserved. [score:1]
Calretinin 3′UTR Harbors a Functional ARE Motif and miR-30 Sites. [score:1]
So far there was no study on the biological function of the miR-30 family or AUBP in mesothelioma. [score:1]
Upon miR-30-5p mimetic treatment (red) no change is observed on calretinin protein levels due to exogenous CALB2-3′UTR that sponges miR-30e-5p. [score:1]
The QuickChange Site-Directed mutagenesis kit (200518, Agilent technologies) was employed to introduce mutations in the ARE or miR-30 sites with the following primers: pmiRGLO-CALB2-3′UTRmtARE (74425 Addgene), 5′-ctctgttggacatagaagcccagaccatacagcgagggagctcat-3′, 5′-atgagctccctcgctgtatggtctgggcttctatgtccaacagag-3′; pmiRGLO-CALB2-3′UTRmir30mt (74428 Addgene), 5′-cgtgctccttttctctttgggtttcttttatcccaaagaagagtttacagacaat-3′, 5′-attgtctgtaaactcttctttgggataaaagaaacccaaagagaaaaggagcacg-3′; pmiRGLO-CALB2-3′UTRmir30dmt (74429 Addgene), 5′-ttgggtttcttttatcccaaagaagattatccagacaataaaatggaaaggtcctgc-3′, 5′-gcaggacctttccattttattgtctggataatcttctttgggataaaagaaacccaa-3′ and, a combination of primers above to construct pmiRGLO-CALB2-3′UTR-mir30dmt-mtARE (74430 Addgene). [score:1]
For mimics and anti-miR treatment, following mimics were used: 1 or 5 nM of has-miR-30b-5p (MSY0000420, Qiagen), has-miR-30c-5p (MSY0000244, Qiagen), hsa-miR-9-5p (MSY0000441, Qiagen), hsa-miR-30e-5p (Shanghai GenePharma Co. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 61
Overexpression of miR-24, miR-30b, and miR-142-3p suppress type I cytokines by DCs. [score:5]
Enforced expression of miR-24, miR-30b, and miR-142-3p in untreated MΦ significantly induced (~1.5–2 fold) CD86 expression (Fig. 5a,b). [score:5]
Marked induction (~2–4.5 fold) in PD-L1 expression was observed in miR-24, miR-30b, and miR-142-3p overexpressing cells compared to control mimic (Fig. 5a). [score:4]
PD-L1 surface expression is induced in miR-24, miR-30b, and miR-142-3p transfected MΦ and DC. [score:3]
MΦ and DCs overexpressing miR-24, miR-30b, and miR-142-3p are defective in antigen processing. [score:3]
Time kinetics of antigen uptake and processing in MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p. [score:3]
miR-24, miR-30b, and miR-142-3p induce PD-L1 expression in APCs. [score:3]
MiR-24, miR-30b, and miR-142-3p mimics or inhibitors were purchased from Qiagen (Gaithersburg, MD, USA). [score:3]
Time kinetics of antigen uptake and processing in miR-24, miR-30b, and miR-142-3p overexpressing APCs. [score:3]
MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p exhibit impaired antigen processing. [score:3]
However, CD86 expression was significantly elevated only in miR-142-3p transfected MΦ treated with Ova while Ova treated or untreated DC transfected with miR-30b showed significant changes (Fig. 5a,b). [score:3]
Impaired T-cell proliferation by MΦ and DC overexpressing miR-24, miR-30b and miR-142-3p. [score:3]
Flow cytometric analysis showed antigen processing was reduced to approximately 22%, 38% and 40% in DC overexpressing miR-24, miR-30b and miR-142-3p, respectively (Fig. 1g–j). [score:3]
In this study we demonstrate an inhibitory effect of miR-24, miR-30b, and miR-142-3p on the uptake as well as processing of Ova by APCs. [score:3]
Taken together, these results show that Th1 activation -associated cytokine profiles are suppressed in DC transfected with miR-24, miR-30b, and miR-142-3p. [score:3]
MΦ transfected with miR-24, miR-30b and miR-142-3p mimics show reduced green signal compared to control mimics (Fig. 1a) suggesting impaired antigen processing upon enforced expression of the miRNA mimics. [score:2]
Compared to control mimic, no significant differences were noted in the presence of miR-24, miR-30b or miR-142-3p inhibitor (Fig. 1e). [score:2]
Overall, our results highlight novel mechanistic insights through which miR-24, miR-30b and miR-142-3p can regulate activation of adaptive immune responses guided by APCs. [score:2]
miR-24, miR-30b, and miR-142-3p impair Ova specific T-cell proliferation. [score:1]
We therefore examined the impact of miR-24, miR-30b and miR-142-3p on antigen processing by MΦ and DC. [score:1]
How to cite this article: Naqvi, A. R. et al. miR-24, miR-30b and miR-142-3p interfere with antigen processing and presentation by primary macrophages and dendritic cells. [score:1]
We next examined the impact of PD-L1 blocking on T cell proliferation by miR-24, miR-30b, and miR-142-3p. [score:1]
Impaired T-cell activation and proliferation by miR-24, miR-30b, and miR-142-3p transfected APCs. [score:1]
[1 to 20 of 23 sentences]
20
[+] score: 59
To calculate the expression of the target gene miR-30* relative to each of the EC candidates, the ΔΔCt method was used, with ΔΔCt = (Ct target gene, test sample-Ct endogenous control gene, test sample)-(Ct target gene, calibrator sample-Ct endogenous control gene, calibrator sample). [score:7]
For example, in the BEN and BM breast tissues, the expression of miR-30* could be made to appear up- or down-regulated relative to normal breast tissue depending on the EC gene used (Fig. 2A). [score:6]
Downregulation of miR-30* has previously been shown to increase transcription of mRNAs involved in processes such as angiogenesis (thrombospondin I, cysteine-rich, angiogenic inducer) and cell cycle transition (cyclin -dependent kinase 6) [38]. [score:4]
MiR-30* expression was significantly different between the tissue subgroups (P < 0.05) except when using miR-26b as a single EC. [score:3]
Significant differences in miR-30* expression were detected between tissue groups using either the one EC (P = 0.007) or the two EC (P = 0.01) approach, however the BM and MF tissue groups were found to be significantly different using the EC pair, let-7a and miR-16 but this was not detected when let-7a was used as the sole EC gene. [score:3]
Effect of EC on Relative Quantity of miR-30*To assess the effect of EC on relative quantitation of the target gene, miR-30*, this miRNA was normalised using each of the candidate EC genes in turn. [score:3]
miR-30* was differentially expressed between groups using either the top 2 or the top 5 most stable ECs (p < 0.05). [score:3]
To assess the effect of EC on relative quantitation of the target gene, miR-30*, this miRNA was normalised using each of the candidate EC genes in turn. [score:3]
Conversely, the 5 gene approach identified a significant difference in miR-30* expression between the MF and VBM tissues, not detected when using the most stable pair. [score:3]
Significant differences in miR-30* expression were detected between the tissue groups using either the top two ECs (P = 0.01) or the top five ECs (P = 0.002, Fig. 2B). [score:3]
The differences in miR-30* expression detected between the tissue groups varied greatly depending on which single EC was used for normalisation. [score:3]
MiR-30*, previously referred to as miR-30a-3p, targets RNA involved in several cancer-related biological processes [38] and was chosen as a target gene to investigate the effect of EC gene selection on relative quantitation. [score:3]
Significant differences in miR-30* expression were detected between the tissue groups using either the top two ECs (P = 0.01) or the top five ECs (P = 0.002, Fig. 2B), however the post-hoc analyses varied slightly in that the two gene normalisation detected a difference between the BEN and MF tissue groups not detected by the five EC gene approach. [score:3]
Thus the effect of using either let-7a as a single gene or using the recommended EC pair, let-7a and miR-16, on miR-30* expression was assessed. [score:3]
Only normalisation with RNU48 detected a significant difference in miR-30* expression between the MF and VBM tissue groups. [score:3]
Depending on the normaliser, miR-30* expression was either significantly different between tissue groups (P < 0.05) or no differences were detected. [score:3]
Figure 3Boxplot of miR-30* relative quantities in benign (BEN, clear), bone metastases (BM, dark), metastases free (MF, dashed) and visceral and bone metastases (VBM, shaded) tissues using different normalisation strategies. [score:1]
MiR-30* was normalised using the top two EC genes and using the top five EC genes to assess what effect this would have on miR-30* relative quantification. [score:1]
Effect of EC on Relative Quantity of miR-30*. [score:1]
[1 to 20 of 19 sentences]
21
[+] score: 56
The antagomirs designed to inhibit the expression of endogenous miR-30 members and Antagomir Negative Control were obtained from Ribobio. [score:5]
HWJMSC-EVs Deliver and Restore the Expression of miR-30 in Injured Rat Kidney. [score:3]
In rat kidneys, enforced DRP1 expression and activation were seen in antagomir -treated EVs group, especially in miR-30b/c/d cotreated EVs group (Figure 3(a)). [score:3]
Mitochondrial Apoptotic Pathways Are Inhibited by EVs-Derived miR-30. [score:3]
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) showed that IRI caused lower expression of miR-30b, miR-30c, and miR-30d (miR-30a and miR-30e did not exist in rat kidney) and EVs treatment entirely reversed the reduction (Figure 2(a)). [score:3]
Our data demonstrate that miR-30b/c/d reduced in renal tubular cells during IRI and hWJMSCs-EVs could increase the expression of miR-30b/c/d in injured tubular cells both in vitro and in vivo. [score:3]
EVs treatment abrogated the injury and miRNA antagomir did not block this effect in miR-30b/c/d single inhibited group. [score:3]
Meanwhile, antagomir -treated EVs group revealed lower miR-30 expression as well as the vehicle group (Figure 2(c)). [score:3]
We demonstrated that hWJMSC-EVs may ameliorate acute renal IRI by inhibition of mitochondrial fission via miR-30. [score:3]
We next explored the miR-30 expression of rat kidney during IRI in vivo. [score:3]
Given that miR-30 has been reported to regulate mitochondrial fission through the DRP1 pathway on cardiomyocytes [20], we hypothesized that human Wharton Jelly MSCs (hWJMSCs) derived EVs may be involved in the modulation of mitochondrial fission via miR-30, thereby protecting kidney from IRI. [score:2]
To understand how hWJMSC-EVs exert effects on mitochondrial fission, we test whether EVs-derived miR-30 family plays a crucial role in regulating mitochondrial fission through DRP1. [score:2]
EVs-Derived miR-30 Members Regulate Mitochondrial Fission through DRP1. [score:2]
To further explore the mechanism of miR-30 reversion, we used specific miR-30 antagomir to treat MSCs. [score:1]
As we expected, miR-30 antagomir mitigated this effect, especially in miR-30b/c/d antagomir cotreated group. [score:1]
In addition, the mature sequence of human miR-30b/c/d was the same as the rats'. [score:1]
The miR-30 family is involved in several cellular processes, including cardiomyocytes exposed to oxidative stress or ischemia injury and apoptosis of type II alveolar epithelial cells [20, 32, 33]. [score:1]
Here we have identified a miR-30-related antiapoptotic pathway involving DRP1 and mitochondria, which may be one of the mechanisms by which hWJMSC-EVs alleviate renal ischemia reperfusion injury. [score:1]
These data suggested a role of miR-30b/c/d in EVs treatment of IRI. [score:1]
The absence of miR-30 in EVs canceled the miR-30 restoration effects in normal EVs treatment group in vitro. [score:1]
Then, we treated hWJMSCs with miR-30 antagomir. [score:1]
Data showed that miR-30b/c/d were, respectively, absent in EVs derived from MSCs (Figure 2(b)). [score:1]
The sequence of miR-30b antagomir is 5′-AGCUGAGUGUAGGAUGUUUACA-3′; miR-30c antagomir is 5′-GCUGAGAGUGUAGGAUGUUUACA-3′; miR-30d antagomir is 5′-CUUCCAGUCGGGGAUGUUUAGA-3′. [score:1]
The levels of miR-30 family members analyzed by qRT-PCR were normalized to that of U6. [score:1]
S1 MiR-30b/c/d levels in renal tubular epithelial cells in different experimental conditions, including normal, vehicle, EVs and miR-30b/c/d antagomir treated EVs group. [score:1]
We used at least six rats for each group: (1) sham (n = 6); (2) vehicle (n = 6); (3) EVs (n = 6); (4) EVs + antagomir control (n = 6); (5) EVs + antagomir miR-30b (n = 6); (6) EVs + antagomir miR-30c (n = 6); (7) EVs + antagomir miR-30d (n = 6); (8) EVs + antagomir miR-30b/c/d (n = 6). [score:1]
Taken together, it appears that EVs-derived miR-30 can block the mitochondrial apoptotic pathways. [score:1]
Our research reveals links among EVs, miR-30, and DRP1 in the apoptotic program of the kidney. [score:1]
Our results suggest that modulation of miR-30 from EVs may represent a therapeutic approach to treat apoptosis-related renal ischemia reperfusion injury. [score:1]
Our data showed that hWJMSC-EVs could enhance miR-30b/c/d of renal tubular cells and mitigate the activation of DRP1 and mitochondrial fragmentation which leads to antiapoptotic effects. [score:1]
The absence of miR-30 in EVs canceled the miR-30 restoration effects in normal EVs treatment group. [score:1]
[1 to 20 of 31 sentences]
22
[+] score: 56
Another approach to multiple siRNA expression was stimulated by report that a mouse miR30 -based shRNA expression cassette can be driven by Pol II promoters and provide higher knockdown efficiency than those driven by the Pol III U6 promoter [10]. [score:6]
These results suggest that although NP miRNA can be expressed from the mouse miR30 -based cassette in DF-1 cells, the level of target gene knockdown is modest following stable integration of the lentiviral vector. [score:6]
Subsequently, Sun et al showed that a single Pol II promoter can drive three artificial miR30 cassettes to express siRNAs all targeting GFP, resulting in further knockdown of the GFP intensity in the cells [17]. [score:6]
The mouse miR30 -based miRNA expression cassette has been wi dely used to express artificial miRNA in lentiviral vectors [21]. [score:5]
As shown in Figure 1c, transient expression of miR30-NP inhibited Renilla luciferase activity by ∼85%. [score:5]
Inhibition of luciferase activity by NP miRNA expressed from a mouse miR30 -based lentiviral vector. [score:5]
To express anti-influenza artificial miRNA, we replaced the mature miR30 sequences in pLB2 with sequences that target nucleoprotein (NP) of influenza virus (Figure 1b). [score:5]
As a control, Vero cells were transduced with a CPGM lentivirus that expressed miR30 -based miRNA specific for the firefly luciferase transcript. [score:3]
Expression of NP miRNA from the mouse miR30 -based lentiviral vector. [score:3]
Zhou et al reported that two tandem copies of the miR30 -based cassette can be expressed in a single transcript driven by a Pol II promoter [15], [16]. [score:3]
In addition to miR30 -based designs, mouse miR155 -based design has also been used to knockdown multiple genes [19]. [score:2]
In the transient transfection assay, the miR30-NP lentiviral vector and psicheck-2 dual luciferase reporter plasmid, in which the NP target sequence was cloned into the 3′ UTR of the synthetic Renilla luciferase gene, were co -transfected into DF-1 cells. [score:2]
A similar miR30 -based approach was utilized by Zhu et al to knockdown multiple genes [18]. [score:2]
Flanking and hairpin sequences are miR30. [score:1]
0022437.g001 Figure 1(a) Schematic diagram of the miR30-NP lentiviral vector. [score:1]
Psicheck-2 dual luciferase reporter plasmid (50 ng) and miR30-NP lentiviral vector (450 ng) were co -transfected in DF-1 cells. [score:1]
[1 to 20 of 16 sentences]
23
[+] score: 52
Interestingly, 7 of the 12 miRNAs that were up-regulated in the presence of IFN-α (miR-30b,miR-30c, miR-130a, miR-192, miR-301, miR-324-5p and miR-565) were also down-regulated in HCV -infected Huh7.5 cells. [score:7]
Seven miRNAs (miR-30b, miR-30c, miR-130a, miR-192, miR-301, miR-324-5p, and miR-565) were down-regulated in HCV-infected Huh7.5 cells (p<0.05) and subsequently up-regulated following interferon-α treatment (p<0.01). [score:7]
Our data suggest that the miR-30(a–d) cluster and miR130a/301are significantly associated with gene targets found in pathways that involve HCV entry and replication, and thus, may play a role in the pathogenesis of chronic liver disease. [score:5]
Several miR-30 targets including the Suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) genes contained conserved 8 mer sites that matched the seed region of miR-30c (Table 2). [score:5]
The GOMir tool JTarget, using five major miRNA-mRNA prediction databases, identified a list of mRNA targets for miR-30, miR-130a, miR-192, miR-301 and miR-324-5p [21]. [score:5]
We hypothesize that the down regulation of miR-30 in HCV-infected Huh7.5 cells may alter the expression of genes involved in the ubiquitin and actin cytoskeleton pathways that create a permissive environment for viral replication and this “proviral effect” is diminished with the addition of IFN-α. [score:4]
Bioinformatic analysis predicted that mRNAs of gene targets associated with the miR-30 cluster were concentrated in 2 major pathways – ubiquitin mediated proteolysis and regulation of actin cytoskeleton (Fig. S2, Fig. S3). [score:4]
Figure S3 MiR-30(a–d) -associated gene targets in the Regulation of Actin Cytoskeleton pathway. [score:3]
The miR-30(a-d) cluster and miR-130a/301 and their putative mRNA targets were predicted to be associated with cellular pathways that involve Hepatitis C virus entry, propagation and host response to viral infection. [score:3]
The DAVID Pathway analysis tool applied to the same data sets revealed targeted bio-pathways for the miR-30 cluster (miR-30a, miR-30b, miR-30c and miR-30d) and miR-130a/301 cluster (Table 1). [score:3]
Figure S2 MiR-30(a–d) -associated gene targets in the Ubiquitin-Mediated Proteolysis pathway. [score:2]
Anti-miRs specific for 5 miRNAs down regulated upon HCV infection (miR-30b, miR-30c, miR-130a, miR-192, and miR-324-5p) were tested against a mock -transfected HCV [+] Huh7.5 cell control (Fig. 2). [score:2]
Two pathways, ubiquitin -mediated proteolysis and regulation of actin cytoskeleton, were predicted for MiR-30 at a p-value of 3.2×10 [−3] and 6.33×10 [−3] respectively. [score:1]
No effect on HCV replication was observed with miR-30b, miR-192 and miR-324-5p in vitro. [score:1]
[1 to 20 of 14 sentences]
24
[+] score: 44
0036157.g003 Figure 3 Activities of two miRNAs, including miR30 (A), miR-N367 (B), were imaged in live HeLa cell cultures that were transfected with the indicator vectors pmiR30:4tar(30), pmiR-N367:4tar(n) and their control vectors with miRNAs or target sequences only, respectively. [score:3]
Activities of two miRNAs, including miR30 (A), miR-N367 (B), were imaged in live HeLa cell cultures that were transfected with the indicator vectors pmiR30:4tar(30), pmiR-N367:4tar(n) and their control vectors with miRNAs or target sequences only, respectively. [score:3]
uk/) as byproducts, miR30 -based precursor stem-loops were used to exclusively express miR423-5p and miR-S1-5p [9] (see Figure S2A, B). [score:3]
The miRNA expression vector pmiR423-5p was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR423-5p sequences into the EcoR V and Not I sites of. [score:3]
0036157.g002 Figure 2. (A) Sequences of miR30, hiv1-miR-N367 and their non-fully complementary targets. [score:3]
The miRNA expression vector pmiR-S1-5p was constructed by inserting the artificial pre-miR-S1-5p sequences that are based on the miR30 precursor stem-loops into the EcoR V and Not I sites of. [score:3]
The construction of is outlined in Figure 1. The miR30 expression vector pmiR30 was constructed by inserting the miR30 precursor (pre-miR30) sequences into the EcoR V and Not I sites of vector. [score:3]
Figure S4 Relative expression level determination of miR30, miR423-5p and miR192 using real-time quantitative PCR method. [score:3]
The construction of is outlined in Figure 1. The miR30 expression vector pmiR30 was constructed by inserting the miR30 precursor (pre-miR30) sequences into the EcoR V and Not I sites of vector. [score:3]
uk/) as a byproduct, the miR30 -based precursor stem-loops were used to exclusively express miR192 [9] (see Figure S2C). [score:3]
The miRNA expression vector pmiR192 was constructed by inserting the miR30 precursor stem-loops based artificial pre-miR192 sequences into the EcoR V and Not I sites of. [score:3]
For the fluorescence reporter assays, the indicator vector pmiR30:4tar(30) was constructed by the stepwise insertion of four tandem copies of miR30 non-fully complementary target sequence (tar(30)) into the 3′-UTR of the mCherry gene in pmiR30 using the Bgl II/Hind III and Hind III/EcoR I restriction sites. [score:2]
The expression of miR30, miR423-5p and miR192 was compared to mock transfected sample using 2 [–ΔΔCT] method. [score:2]
Figure S2 Secondary structure mo dels for artificial pre-miRNA based on stem-loops of miR-30 precursor. [score:1]
The vectors pmiR30 and pmiR-N367 were constructed to produce high levels of the human-encoded miR30 [12] and the HIV-1-encoded miR-N367, respectively. [score:1]
A. Secondary structure mo del for artificial pre-miR-S1-5p based on stem-loops of miR-30 precursor; B. Secondary structure mo del for artificial pre-miR423-5p based on stem-loops of miR-30 precursor; C. Secondary structure mo del for artificial pre-miR192 based on stem-loops of miR-30 precursor. [score:1]
* Artificial pre-miRNAs which were designed being based on stem-loops of miR-30 precursor (ref 9). [score:1]
The pre-miR30 sequences were generated by overlap extension PCR with the following two partially complementary oligonucleotides: 5′-CTCGTGATCTGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGT-3′ and 5′-ATGTTATCCGCGGCCGCAAAAACTCGTGGATCCGCAGCTGCAAACATCCGACTGAAAGCCCATC-3′. [score:1]
As shown in Figure 2B, Northern blot analysis readily revealed detectable levels of the specific miRNAs in all of the HeLa cultures transfected with constructs producing the pre-miRNA sequences of miR30 and miR-N367. [score:1]
HeLa cells were mock -transfected (mock) or transfected with plasmids pmiR30, pmiR-N367 individually, and the location of the mature miR30 and miR-N367 is indicated. [score:1]
[1 to 20 of 20 sentences]
25
[+] score: 44
These tumor suppressors were targeted by multiple upregulated miRNAs (miR-19b-3p, miR-26a-5p, miR-30b-5p, miR-92a-5p and miR-27b-3p) which could account for their aberrant expression in eBL. [score:10]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Upregulation of miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) in eBL targeting ATM suggests abnormal miRNA mediate regulation of this gene which would lead to ATM loss. [score:7]
Genomic aberrations such as abnormal upregulation of host miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) targeting ATM would favor proliferation, tumor cell survival and occurrences of mutations that would favor oncogenesis. [score:7]
It is possible that during tumorigenesis a number of GC B cells have low ATM levels due to small interfering RNA -mediated regulation, as a result of irregular expression of miR-27b-3p, miR-26a-5p, miR-30b-5p and myc -dependent activation of miR-17~92 cluster miRNAs. [score:4]
[1 to 20 of 6 sentences]
26
[+] score: 42
The miRWalk database also contains experimentally validated target genes for the additional three miRNAs (miR-1224-3p, miR-197 and miR-532-3p) that were differentially overexpressed in response to both proanthocyanidin extracts (Table 5), although the number of target genes for these miRNAs was much lower than for miR-30b*. [score:7]
miR-1224-3p, miR-197 and miR-532-3p were differentially expressed after treatment with the two procyanidin extracts; however, only miR-30b* was differentially expressed in response to all the three treatments. [score:5]
Interestingly, miR-30b*, the sole miRNA affected by the two proanthocyanidin extracts and EGCG, is the miRNA among those differentially expressed in response to proanthocyanidins that has the greatest number of validated target genes. [score:5]
Selection of validated target genes for miR-30b* grouped by pathway. [score:3]
The target genes of has-miR-30b* are included in pathways involved in these processes. [score:3]
Therefore, we focused our attention on miR-30b* target genes related to these pathways using the miRWalk, BioCarta and KEGG databases (Table 4). [score:3]
Four hundred and eighty gene targets for miR-30b* have been validated, some of which are central to lipid and glucose metabolism, insulin signaling, oxidative stress and inflammation. [score:3]
On the other hand, 480 target genes of miR-30b* have been experimentally verified. [score:3]
de/apps/zmf/mirwalk/) contained 480 genes that have been experimentally verified as target genes of miR-30b*. [score:3]
The targeted miRNA assay sequences were 5′-CCCCACCUCCUCUCUCCUCAG-3′ for miR-1224-3p and 5′-CUGGGAGGUGGAUGUUUACUUC-3′ for miR-30b*. [score:2]
We focused our attention on miR-30b* because it was the only miRNA affected by the three treatments. [score:1]
Thus, miR-30b* likely mediates part of the beneficial health effects of proanthocyanidins. [score:1]
To validate the microarray results, two miRNAs (miR-1224-3p and miR-30b*) were selected for QRT-PCR quantification. [score:1]
Interestingly, miR-30b* was repressed by all three treatments. [score:1]
To our knowledge, no paper has been published regarding the specific role of has-miR-30b* in intracellular processes. [score:1]
[1 to 20 of 15 sentences]
27
[+] score: 42
miR30 is significantly down-regulated in several cancers, including breast cancer [30] and lung cancer [31] and it has been hypothesized that miR30 may play an important role in tumorigenesis and tumor development. [score:5]
The results showed that CLCNs were able to transfect the cells with miR30b as well as DharmaFect did and the miR30-b expression in vitro was increased by using CLCNs or DharmaFect. [score:3]
All of these results suggested that CLCNs are able to efficiently transfect the cells in vitro and increase the miR30b expression similar to that seen with DharmaFect. [score:3]
In vitro gene expression experiments were performed transfecting lung cancer cells, H1299, with CLCNs-miR30b complexes and the relative gene expression of miR30b was evaluated after 24 hour of transfection. [score:3]
in vitroGene-silencing and gene expression evaluation experiments were performed to determine whether CLCNs are able to deliver siRNA to cells to induce silencing of a reporter gene (Green fluorescent protein, GFP) or enhancing the expression of an endogenous microRNA (miR-30b) (Figure 5). [score:3]
Gene-silencing and gene expression evaluation experiments were performed to determine whether CLCNs are able to deliver siRNA to cells to induce silencing of a reporter gene (Green fluorescent protein, GFP) or enhancing the expression of an endogenous microRNA (miR-30b) (Figure 5). [score:3]
The expression of miR30b increased in the spleen, lung, liver, and in the tumor. [score:3]
The 4- to 6-week-old nu/nu female mice bearing H1299 subcutaneous tumors were treated with CLCNs-miR30b and CLCNs -negative siRNA control at 1.5 mg/kg via tail vein injection. [score:1]
Untreated control group and non-specific CLCN-siRNA were used as negative control to validate the gene silencing efficiency of CLCNs/miR30b complexes and Dhermafect-miR30b. [score:1]
Various concentrations of miR30b (25, 50, and 100 nM) were used and the same concentration were used for the NSC-siRNA (negative control) conjugated to CLCNs or to DharmaFect. [score:1]
Significantly different p-values were found at 25 nM concentration were the DharmaFect worked better than CLCNs above all the formulation CLCN1-miR30b vs DharmaFect-miR30b = 0.0003 (***) showed a lower transfection efficiency results. [score:1]
However, the function of miR30 especially in NSCLC remains unclear [32]. [score:1]
In vivo CLCNs-miR30b biodistribution. [score:1]
In vivo CLCNs-miR30b biodistribution The 4- to 6-week-old nu/nu female mice bearing H1299 subcutaneous tumors were treated with CLCNs-miR30b and CLCNs -negative siRNA control at 1.5 mg/kg via tail vein injection. [score:1]
CLCNs showed equivalent transfection efficiency to DharmaFect at the concentration of miR30b of 50 and 100 nM. [score:1]
was performed to compare the transfection efficiency of CLCNs-miR30b vs DharmaFect-miR30b. [score:1]
The tissues sections were collected 24 hours after treatment with CLCN D275/miR30 b complexes (1.5 mg/kg). [score:1]
Basically, H1299 were treated for 24 hours with various concentrations of miR30b, 25, 50 and 100 nM, conjugated with CLCNs or DharmaFect. [score:1]
CLCNs-miR30b complexes and CLCNs/negative siRNA control complexes were injected at a dose of 1.5 mg/kg via tail vein. [score:1]
Biodistribution studies were performed to track fluorescent CLCNs (CLCNs D275) and to evaluate the expression of miR30b delivered by CLCNs, in the major organs and tissues after 24 hours of intravenous administration by tail vein. [score:1]
After 24 hours, the cells were treated with CLCNs conjugated with miR30b (Ambion) or DharmaFECT transfection reagents (Dharmacon) mixed with miR30b as well. [score:1]
In the microRNA biodistribution experiment no fluorescent CLCNs were conjugated with miR30b and the concentration of miR30b was quantified using RT-qPCR. [score:1]
25 nM, CLCN1-miR30b vs DharmaFect-miR30b p value 0.0003 (***) and CLCN2miR30b vs DharmaFect-miR30b p value 0.0053 (**). [score:1]
The fold expression of miR30b was evaluated by RT-qPCR after 24 hours of treatment with CLCNs-miR30b complexes at various concentrations (25, 50 and 100 nM). [score:1]
50 nM, CLCN1miR30b vs DharmaFect-miR30b p value 0.0004 (***) and CLCN2miR30b vs DharmaFect miR30b p value 0.0225 (*). [score:1]
The Quantitative real-time PCR showed a high concentration of miR30b in spleen and lung, liver and tumor (Figure 6E). [score:1]
[1 to 20 of 26 sentences]
28
[+] score: 42
To illustrate the impact of miRNA overexpression on the expression of their target genes, we have selected two microRNAs, miR-30 and -128, that were previously shown to be upregulated during myogenic differentiation [26, 27], but their function in myogenesis is not well-established. [score:10]
Similarly, overexpressing miR-30 led to the downregulation of three of its five randomly selected transcriptome-supported targets. [score:8]
Transcriptome-supported target genes of miR-128 and miR-30 were downregulated when human rhabdomyosarcoma cells were transfected with lentiviral constructs overexpressing miR-128 (E) and miR-30 (F). [score:8]
Two remaining miR-30 target genes, PPIA and CASD1 could not be validated via qRT-PCR, as we did not observed significant changes in its expression level following miRNA precursor transfection (data not shown). [score:5]
Instead, our predictions suggest that miR-30 might target genes involved in the regulation of protein phosphorylation and kinase activity, cell cycle control, intracellular transport, cytoskeleton organization, protein ubiquitination, DNA damage response and nucleotide biosynthesis (Figure  5, Additional file 9). [score:4]
These qRT-PCR validated miR-30 targets include PLXNB (plexin B2), C11orf45 (chromosome 11 open reading frame 45) and ATP2B1 (ATPase, Ca++ transporting, plasma membrane 1) (Figures  4D). [score:3]
miR-30 was shown to induce apoptosis [71] and regulate cell motility by influencing extracellular the matrix remo delling process [72- 74]. [score:2]
Human rhabdomyosarcoma cells (RD) were transfected with plasmids coding for miR-128 and miR-30 precursors or scrambled sequence (scr) (B). [score:1]
phrGFP-1 vector was from Stratagen, pcDNA3.2/V5 hsa-mir-128 (#26308) [115] and pCMV-miR30 (#20875) [116] vectors were provided by Addgene. [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 41
Modulation of pulmonary miRNAs targeting p53 (miR-138 and miR-376c) and apoptosis (miR-98 and miR-350) is consistent with the notion that AMPK is involved in the p53 -mediated cell cycle arrest and apoptosis 2. Several miRNAs upregulated in the lung of metformin -treated mice, including miR-30b, miR-138, miR-239a, miR-342, and miR-574, are involved in stress response and inflammation and target NF κB or Tlr9 (Toll-like receptor). [score:8]
Accordingly, qPCR analysis demonstrated that metformin upregulated 3.0-fold let-7f, which is in line with microarray results indicating a 3.8-fold miR-30b upregulation in the same experimental groups (Table 2). [score:7]
In line with the known role of this drug to activate AMPK 4, considered an ideal drug target for cancer treatment 38, metformin upregulated both miR-148b, which targets this kinase, and miR-30b, belonging to a family of miRNAs that are known to modulate AMPK 39. [score:7]
In addition, metformin modulated the expression of a number of miRNAs (let-7f, miR-30b, miR-362, miR-376c, miR-466h, miR-490, and miR-574) involved in the regulation of the cell cycle, which is a crucial mechanism in the AMPK -mediated activity of this drug 42. [score:4]
Because of the biological relevance of two metformin-modulated miRNAs, let-7f and miR-30b, their expression was validated by qPCR analysis. [score:3]
Furthermore, this drug modulated miRNAs that target angiogenesis (let-7f and miR-98), stem cell recruitment, and multidrug resistance (miR-30b). [score:3]
In addition, the expression of two miRNAs (let-7f and miR-30b) was validated by real-time quantitative polymerase chain reaction (qPCR), as previously described 26. [score:3]
Validation of let-7f and miR-30b microarray results by real-time qPCRBecause of the biological relevance of two metformin-modulated miRNAs, let-7f and miR-30b, their expression was validated by qPCR analysis. [score:3]
Validation of let-7f and miR-30b microarray results by real-time qPCR. [score:1]
For miR-30b, the normalized fluorescent intensity was 20.5 FU in the lung of sham-exposed mice, in the absence of metformin, and 61.3 FU in the lung of mice treated with metformin. [score:1]
The specificity of the qPCR amplified products was confirmed by analyzing melting temperature peaks, which were 70.5°C for let-7f and 72.0°C for miR-30b. [score:1]
[1 to 20 of 11 sentences]
30
[+] score: 40
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
This network (Figure 2B) indicated that two mRNAs (V KORC1 and CSTB; in red) were predicted to be targets of five miR-30 miRNAs, six mRNAs (ANXA2, GPATCH3, OAZ1, PSMB4, SLC7A11, ZNF37A; in turquoise) were targeted by four of the miRNAs, and ten mRNAs (CAPG, C7orf28A, DAP, GPX1, ITPA, MMP11, NEBL, POLR2H, S100A11 and GTF2IRD1; 3 in green and 7 in blue) were targeted by three of the miRNAs (Figure 2B). [score:7]
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
We developed a network to demonstrate the overlapping miRNA targets for miRNAs in the miR-30 family (a-e) (Figure 2B) since these miRNAs have a large number of mRNA targets. [score:5]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
The number of predicted targets for each member of the miR-30 family (a-e) was 22, 20, 15, 25 and 17, respectively. [score:3]
The number of targets for miR-30 a-e was 22, 20, 15, 25 and 17, respectively (Table 3). [score:3]
B. A sub-network depicting miRNA-mRNA interactions predicted from the miR-30 family. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 37
Other miRNAs from this paper: hsa-mir-320a, hsa-mir-155, hsa-mir-196b, hsa-mir-1246
From the ceRNA networks, we identified miR-30b-3p as an important potential target for many genes that were significantly up- or down-regulated post virus infection. [score:6]
We constructed the miR-Report luciferase reporter to determine whether miR-30b-3p directly targets the 3′-UTR of CLDN18. [score:4]
In the validation of the ceRNA interactions, we identified miR-30b-3p as a potential target of CLDN18 that might also be regulated by ceRNA-chr19. [score:4]
As shown in (Figure 6), miR-30b-3p is a potential target for CLDN18 and may also be regulated by ceRNA-chr19. [score:4]
In addition, CLDN18 repression caused by circRNA-chr19 knockdown (using si-1) was reversed by the miR-30b-3p inhibitor (Figure 8B). [score:4]
The luciferase activity of the reporter containing the wild-type 3′-UTR of CLDN18 was suppressed by miR-30b-3p, whereas the luciferase activity of the reporter containing the mutant 3′-UTR was not affected (Figure 7D). [score:3]
The vector expressing miR-30b-3p was co -transfected with the vector containing the wild-type or mutant 3′-UTR. [score:3]
The miR-Report luciferase reporter was co -transfected with miR-30b-3p expression plasmid. [score:3]
CLDN18 Forward: ACATGCTGGTGACTAACTTCTG CLDN18 Reverse: AAATGTGTACCTGGTCTGAACAG The CLDN18 3′-UTR containing the miR-30b-3p binding site and a mutation of this site were inserted into pmiR-RB-ReportTM. [score:2]
Thus, we selected miR-30b-3p to validate its interaction details. [score:1]
We chose miR-30b-3p and verified its interactions with related circRNAs and mRNAs. [score:1]
Genes related to miR-30b-3p had the highest k-core values. [score:1]
Informatics analysis revealed that miR-30b-3p matches the 3′-UTR of CLDN18 and that there are also miR-30b-3p binding sites in the sequence of ceRNA-chr19 (Figure 7C). [score:1]
[1 to 20 of 13 sentences]
32
[+] score: 35
Of the miRNAs expressed, miR-23b, miR-30b, miR-30c, and miR-125b expression were significantly increased in H69 cells after exposure to live C. parvum infection for 12 h (p< = 0.05; Figure 1A and Table S1). [score:5]
Increased expression of miR-125b, miR-16, miR-23b, miR-21 and miR-30b, as well as decreased expression of miR-98, was further confirmed in cells following C. parvum infection for 12 h by (Figure 2B). [score:5]
Our analysis of miRNAs upregulated by C. parvum in H69 cells revealed that mir-125b-1, mir-23b-27b-24-1, mir-21, and mir-30b genes are transactivated via potential promoter binding of the NF-κB p65 subunit. [score:4]
Expression of pri-miR-125b-1, pri-miR-21, pri-miR-23b-27b-24-1, pri-miR-30b, pri-miR-30c-1, pri-miR-15a-16-1, and pri-miR-15b-16-2 showed a time -dependent increase in cells following C. parvum infection, with a peak at 8 h or 12 h after exposure to the parasite (Figure 3). [score:3]
Increased expression of miR-125b, miR-21, miR-23b, miR-30b and miR-16 was detected in H69 cells following C. parvum infection for 12 h to 24 h, but not in the early time points (2 h to 8 h) (Figure 2A). [score:3]
Treatment of cells with SC-514 blocked C. parvum -induced increase of pri-miR-30b, suggesting p65 -dependent miR-30b expression. [score:3]
Figure S6Promoter binding of p65 transactivates the mir-30b gene to increase miR-30b expression in biliary epithelial cells following C. parvum infection. [score:3]
Transfection of cells with anti-miRs to miR-125b, miR-23b or miR-30b, but not anti-miRs to miR-16 or miR-21, significantly increased parasite burden in cholangiocytes. [score:1]
Nevertheless, database analysis revealed one potential binding site for NF-κB in the upstream sequence of miR-30b precursor. [score:1]
In this study, we demonstrated that promoter binding of the NF-κB p65 subunit is required for transactivation of the mir-125b-1, mir-23b-27b-24-1, mir-21 and mir-30b genes in cells following C. parvum infection. [score:1]
Cells were transfected with specific anti-miRs (30 nM, Ambion) or a mixture of anti-miRs to miR-125b, miR-23b and miR-30b (a total of 30 nM with 10 nM for each), and then exposed to C. parvum. [score:1]
was utilized to identify 5′ end of miRNA primary transcripts to localize the start sites of mir-125b-1, mir-30b and mir-30d. [score:1]
These results support that pri-miR-30b and pri-miR-30d are not transcribed from the same gene in human cholangiocytes, inconsistent with previous results suggesting that pri-miR-30b and pri-miR-30d may be transcribed from the same gene on chr8 [31], [40]. [score:1]
Using the same approaches, we analyzed p65 promoter element binding in C. parvum -induced transcription of pri-miR-21, pri-miR-23b-27b-24-1, pri-miR-30b, pri-miR-30c-1, pri-miR-30c-2, pri-miR-15a-16-1, and pri-miR-15b-16-2. Our data are summarized in Table 2 and presented in detail in Figures S4, S5, S6 and S7. [score:1]
5′-RACE PCR was utilized to identify 5′ end of miRNA primary transcripts to localize the start sites of mir-125b-1, mir-30b and mir-30d. [score:1]
Increased transcription of pri-miR-30b induced by C. parvum is p65 -dependent (Figure S6). [score:1]
[1 to 20 of 16 sentences]
33
[+] score: 34
Two members of the miR-30 family (miR-30b and miR-30d), putative regulators of the genes implicated in oxidative stress -mediated ocular diseases, were significantly (miR-30b: p=0.001, FC 3.52; miR-30d: p=0.001, FC 2.14) upregulated under the oxidative environment, and curcumin alone significantly (p<0.05) reduced the expression of all five members of the miR-30 family, compared to the controls, and significantly reduced induction by H [2]O [2] (Figure 5). [score:8]
All five members of the miR-30 family (miR-30a-e) were upregulated and downregulated by H [2]O [2] and curcumin, respectively. [score:7]
H [2]O [2] treatment significantly upregulated miR-30b and miR-30d, two members of the miR-30 family, which is consistent with our previous results [17], and all five members of the family were downregulated by the curcumin treatments. [score:7]
In silico analysis suggests that the expression of miR-30b and miR-30d, but not the other three members of the family, is regulated by the promoter of the zinc finger and AT hook domain–containing (ZFAT) gene. [score:4]
However, only miR-30b and miR-30d were differentially expressed more than twofold after H [2]O [2] treatment. [score:3]
Based on statistical significance (p<0.05) and 2 -FC, curcumin pretreatment attenuated the H [2]O [2] -induced expression of 17 miRNAs (miR-15b, miR-17, miR-21, miR-26b, miR-27b, miR-28–3p, miR-30b, miR-30d, miR-92a, miR-125a-5p, miR-141, miR-196b,, miR-195, miR-302a, miR-302c, miR-320a, and miR-9), which were also significantly reduced by the curcumin treatment alone (Figure 4, Table 2). [score:3]
The mechanism of ROS -mediated gene regulation of miR-30b and miR-30d seems to be different from that of the other three members of the family. [score:2]
[1 to 20 of 7 sentences]
34
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Within 6 hrs of the presence of E. coli, the expression of 6 miRNAs in MAC-T cells was significantly altered (P < 0.05), three were down regulated (bta-miR-193a-3p, miR-30c and miR-30b-5p) while three were up-regulated (bta-miR-365-3p, miR-184 and miR-24-3p) (Table  3). [score:7]
The three miRNAs (bta-miR-193a-3p, miR-30c and miR-30b-5p) that were significantly down regulated or one miRNA (bta-miR-365-3p) that was significantly up regulated within 6 hrs of E. coli presence only showed a retarded significant down regulation by 24 or 48 hrs (bta-miR-193a-3p, 30c and 30b-5p) or up regulation (bta-miR-365-3p) by 48 hrs in the presence of S. aureus. [score:5]
The up-regulation of miR-193a-3p and miR-30b-5p may play regulatory roles in cell death which need to be further confirmed in the context of mastitis. [score:5]
For example, gene targets of five differentially expressed miRNAs (miR-365-3p, miR-30b-5p, miR-30c, let-7a-5p and miR-23a) were enriched for pathways in immune system (B-cell receptor signaling pathway, chemokine signaling, T-cell receptor signaling and Fc gamma R -mediated phagocytosis). [score:5]
It is not surprising owing to their involvement in almost all biological processes as demonstrated by GO functional annotation of the target genes of three (bta-miR-193a-3p, miR-423-5p and miR-30b-5p) of these miRNAs. [score:3]
GO functional annotation of target genes of bta-miR-193a-3p and miR-30b-5p showed enriched genes related to cell growth and death, e. g. growth arrest specific gene 1 (GAS1), myeloid cell factor 1 (MCL1, also BCL2 related), BCL2-like 11 (apoptosis facilitator) and programmed cell death 10 (PDCD10). [score:3]
In addition, our study revealed a temporal differential regulation of five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p, miR-29c and miR-un116) in unchallenged cells. [score:2]
We observed that five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p, miR-29c and miR-un116) were differentially expressed (P < 0.05) in at least two time points in control cells as compared to 0 hr (Figure  2). [score:2]
The expression of bta-miR-30b-5p and bta-miR-29c also increased over time but to a lesser magnitude as compared to bta-miR193a-3p. [score:2]
[1 to 20 of 9 sentences]
35
[+] score: 33
MiR-29a and miR-30b expression were down-regulated by almost all the tested polyphenols; miR-222 was down-regulated by caffeic acid (300 mg/d for 2 weeks) and hesperidin (30 mg/d for 2 weeks); miR-181a was down-regulated by curcumin (30 mg/d for 2 weeks) and hesperidin and up-regulated by naringin (30 mg/d for 2 weeks), quercetin (30 mg/d for 2 weeks) and proanthocyanidin (300 mg/d for 2 weeks); miR-132 was up-regulated by naringin [(] [88] [)]. [score:18]
In particular, EGCG (50 mg/l for 5 h), grape seed (100 mg/l for 5 h) and cocoa proanthocyanidin extracts (100 mg/l for 5 h) down-regulated miR-30b expression in human hepatocellular carcinoma HepG2 cells [(] [78] [)]. [score:6]
Bridge G, Monteiro R, Henderson S, et al (2012) The microRNA-30 family targets DLL4 to modulate endothelial cell behavior during angiogenesis. [score:3]
Furthermore, miR-30 family members increase in abundance during the differentiation of pancreatic islet-derived mesenchymal cells into hormone-producing islet-like cell aggregates, thus indicating their participation in the regulatory signalling of the embryonic development of human pancreatic islets [(] [81] [)]. [score:3]
Joglekar MV, Patil D, Joglekar VM, et al (2009) The miR-30 family microRNAs confer epithelial phenotype to human pancreatic cells. [score:1]
On the other hand, miR-30 belonging to the miR-30 family that has a key role in angiogenesis [(] [78] [)] might be involved in the hyper capillarisation of the placenta in women with mild hyperglycaemia [(] [79] [,] [80] [)]. [score:1]
Furthermore, miRNA profiles of peripheral blood mononuclear cells isolated from Brazilian GDM women, obtained by using microarray platforms, have identified ten miRNA that seemed to be specific for GDM, namely, miR-101, miR-1180, miR-1268, miR-181a, miR-181d, miR-26a, miR-29a, miR-29c, miR-30b and miR-595 [(] [67] [)]. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 32
In contrast, neither knockdown nor overexpression of miR-30 substantially altered the expression of p66Shc, p52Shc, and p46Shc. [score:6]
As shown in Fig. 1(D), nascent Shc protein synthesis in AS-let-7a -expressing cells was ~3.2- to 4.1-fold higher than what was observed in control cells, while Shc translation in AS-miR-30 -expressing cells was comparable with that measured in control cells. [score:5]
The levels of p66Shc mRNA, which could potentially be used for synthesis of all Shc proteins, were not substantially altered by modulating let-7a or miR-30 abundance (Fig. 1C), suggesting that let-7a does not affect Shc expression at the level of mRNA turnover and instead may affect Shc translation. [score:5]
The effect of let-7a was specific, as inhibition of let7c, let-7d, miR-9, miR-22, and miR-30 did not affect the levels of Shc proteins, while inhibition of let-7b moderately increased the levels of Shc proteins (Fig. S2). [score:5]
To test this hypothesis, IDH4 cells transiently expressing antisense let-7a or antisense miR-30 were incubated in medium containing L-[[35]S] methionine and L-[[35]S] cysteine for 20 min, cell lysates were then prepared and subjected to immunoprecipitation to analyze the level of nascent Shc proteins. [score:3]
In addition, transfection of cells with inhibitor of let-7c, let7d, miR-9, miR-22, or miR-30 did not alter the levels of Shc proteins (Fig. S2B,C). [score:3]
In control reactions, knockdown of let-7a or miR-30 did not influence the levels of nascent GAPDH. [score:2]
Using the cells described in Fig. 3(A,B), the levels of let-7a, miR-30, U6, as well as p66Shc mRNA levels in 2BS and IDH4 cells progressing toward senescence were determined by Northern blot analysis (Fig. 3D) and by conventional RT-PCR analysis (Fig. 3E) respectively. [score:1]
In contrast, the levels of miR-30, U6, and p66Shc mRNA remained unchanged during senescence of 2BS (Fig. 3D) and IDH4 cells (Fig. 3E). [score:1]
As shown in the Fig. S2(A), transfection of IDH4 cells with let-7a siRNA, but not miR-30 siRNA, elevated the levels of Shc proteins. [score:1]
[1 to 20 of 10 sentences]
37
[+] score: 31
In our own study of three miRNAs (miR-24, miR-30b, and miR-142-3p) whose expression were downregulated during MΦ differentiation and in response to LPS, and whose inhibitory potential are comparable, we have not observed synergy in their action (14). [score:8]
While the effect of miR-142-3p appears to be mediated, at least in part, through its direct targeting of PKCα, neither miR-24 nor miR-30b directly targets PKCα. [score:7]
We have previously reported that enforced expression of miR-24, miR-30b, or miR-142-3p in activated MΦs inhibits their production of(p40) (11, 13). [score:5]
For example, we have extensively characterized the inhibitory effects of miR-24, miR-30b, and miR-142-3p expression on myeloid inflammatory cell viz. [score:3]
This convergence/divergence is mirrored by our studies on miR-24, miR-30b and miR-142-3p mediated cytokine regulation. [score:2]
This is also an area where convergent miRNA regulation appears to exist, as these same studies identified a very similar phenotype for miR-24 and miR-30b to that of miR-142-3p. [score:2]
We have previously described miR-24, miR-30b, and miR-142-3p -mediated regulation of MΦ phagocytosis (13, 71). [score:2]
Human and murine miR-24 and miR-142-3p possess 100% sequence homology, while miR-30b differs in 2 of its nucleotides. [score:1]
Taken together, our studies on miR-24, miR-30b, and miR-142-3p may provide a route toward novel therapies aimed at treating chronic inflammatory disorders. [score:1]
[1 to 20 of 9 sentences]
38
[+] score: 31
Liu et al. [29] found that expression of 4 miRNAs was significantly upregulated (miR-136, miR-703, miR-30b, and miR-107), while miR-653 and miR-598 were significantly downregulated. [score:9]
Total PDE-derived cells from 110 PD patients (82 new, 28 prevalent) showed significant miRNA upregulation of miR-15a, miR-21, and miR-192 when comparing new, prevalent and UF groups, while miR-17, miR-30, and miR-377 expression was similar between groups [36]. [score:6]
Finally, this group demonstrated that miR-30b directly targets BMP-7 in PMs of rats, which could antagonize the effects of TGF- β1 [29]. [score:4]
BMP-7 was significantly downregulated after 4 weeks of MGO injection and this effect was reversed by intraperitoneal miR-30b ASO injection [29]. [score:4]
miR-30 significantly correlated with GFR and no detectable expression of miR-216a and miR-217 was found in patient samples [36]. [score:3]
Chen et al. [36] selected the following candidate miRNAs based on a report on EMT and kidney disease [46]: miR-15a, miR-17-92, miR-21, miR-30, miR-192, miR-216a, miR-217, and miR-377 [36]. [score:3]
Intraperitoneal injection of miR-30b chemically modified antisense RNA oligonucleotide (ASO) in week 2 counteracted MGO -induced EMT of PMCs in rats [29]. [score:1]
All array data were confirmed by RT-qPCR analysis, with miR-30b showing the greatest increase in the PMs of rats injected with MGO [29]. [score:1]
[1 to 20 of 8 sentences]
39
[+] score: 31
Expression profiling of the 6 shortlisted miRNAs revealed that most of the miRNAs were downregulated in oral tumors and miR-22-3p and miR-30b-5p were significantly downregulated in undifferentiated tumors. [score:9]
We further analyzed the expression of miRNAs with reference to cellular differentiation status and observed low-level expression of miRNAs in undifferentiated tumors, and only miR-22-5p and miR-30b-5p expression were statistically significant (P = 0.0485 and 0.0440, respectively). [score:7]
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
Except for miR-22-3p and miR-30b-5p, other miRNAs are significantly downregulated in oral tumors. [score:4]
Further, in undifferentiated tumors, OIP5-AS1 alone or together with other lncRNAs might sponge miR-22-3p and miR-30b-5p to a greater extent resulting in the derepression of the downstream target genes. [score:3]
miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p shared maximum common downstream targets. [score:3]
[1 to 20 of 6 sentences]
40
[+] score: 26
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30c-1, hsa-mir-30e
MicroRNA30 -based shRNA (miRshRNA) encoded in expression plasmid DNA was shown to have higher gene downregulation activity than conventional shRNA. [score:6]
MicroRNA30-Based shRNA Expressed by RRV Has Higher Potent Gene Downregulation Activity than Conventional shRNA. [score:5]
We generated human U6 promoter driven-MLV -based RRV expressing conventional shRNA (RRV-shGFP) or microRNA30 -based shRNA (RRV-miRGFP) targeted to GFP (Figure 1). [score:5]
Although construction of multiple shRNA or miRshRNA cassettes have been reported in various expression vectors, 17, 22, 39, 40 incorporating such a design in an RRV genome could be technically challenging due to the repeated sequence in miRNA30-derived backbone in the same vector that may lead to early emergence of deletion mutants. [score:3]
RRVs derived from pAC3-yCD2 [41] containing human H1, U6 Pol III, or RSV Pol II promoter were generated to express conventional 21-nucleotide stem shRNA (shGFP and shPDL1) or microRNA30-derived shRNA with a 21-nucleotide stem as described [37] against GFP (miRGFP), human PDL1 (miRPDL1), human IDO-1 (miRIDO1), or human TGF-β2 (miRTGFb2) (Table S4 for sequences tested). [score:3]
For example, processing and stability of miRNA30 could be affected by such changes. [score:1]
Our short-term vector stability data indicate that miRNA30-derived miRshRNA in general is stable in the RRV genome in various cell lines tested. [score:1]
3, 9, 10 With increasing understanding of miRNA processing, Zeng et al. first demonstrated that artificially designed miRNA derived from miRNA-30 (miRshRNA) can function as siRNA. [score:1]
10, 25 One of the advantages of generating siRNA from the miR30-derived shRNA backbone is potential further minimization of type I IFN response. [score:1]
[1 to 20 of 9 sentences]
41
[+] score: 26
Recent studies have also revealed that the miR-30 family is downregulated in tumors, where it is involved in EMT and participates in the mechanisms of tumor development and progression in several types of cancer. [score:5]
The miR-30 family has been reported to suppress EMT by targeting Snail in human hepatocytes and pancreatic epithelial cells [28, 29]. [score:5]
Although these reports suggest that the miR-30 family works as a tumor suppressor via regulating EMT, their roles in CCA have not been fully elucidated. [score:4]
These results suggested that miR-30e was the most important candidate miRNA among the miR-30 family for suppressing EMT in CCA. [score:3]
This indicated that miR-30e has the potential to be an onco-suppressor gene, similar to the other miR-30 family members. [score:3]
Thus, we assessed miR-30 family expression in HuCCT1 cells after incubation with TGF-β. [score:3]
The newly-identified miR-30 family is composed of miR-30a, miR-30b, miR-30c, miR-30d and miR-30e, and there have been inconsistent results regarding their function in cancer [26]. [score:1]
RNA was extracted and qRT-PCR for the miR-30 family was performed. [score:1]
Figure 3RNA was extracted and qRT-PCR for the miR-30 family was performed. [score:1]
[1 to 20 of 9 sentences]
42
[+] score: 25
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
We used a pair of reporters, one of which had an inserted single miR-30 perfect binding site (1xP miR-30) while the other did not have the insertion (Figure 6B). [score:1]
Furthermore, the dose-response trends were highly similar for the majority of the compounds; the pattern was the most striking for the miR-30 experiment in HeLa cells (Figure 6A). [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Except for the control and 1xP miR-30 reporters, which utilized the SV40 promoter and 3′ UTR, all other reporters were driven by the PGK promoter and had BGH 3′ UTR. [score:1]
Remarkably, the majority of compounds yielded a comparable impact on luciferase activity regardless of the presence of the miR-30 perfect binding site. [score:1]
The pGL4_SV40_1xmiR-30P plasmid was generated by inserting the fragment with the miR-30 1xP binding site from phRL_SV40_1xmiR-30P (Ma et al., 2010) into pGL4_SV40 using XbaI and ApoI restriction sites. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
[1 to 20 of 17 sentences]
43
[+] score: 25
Among these candidates, miR-30a-3p was selected for further analysis because its expression was down regulated in Poly (I:C)- and IFN-γ-activated RAFLS and SScHDF; such inverse correlation with the expression of BAFF transcripts in the same cells and the same conditions indicated that miR-30-3p family members might have a role in the regulation of BAFF expression. [score:9]
The prediction provided by bioinformatic tools and this inverse correlation between miR-30 family members and BAFF expression prompted us to analyze their likely direct interaction. [score:4]
Importantly, additional results (data not shown) indicate that additional members (and closely related) of the miR-30a-3p family (miR30-d-3p and -e-3p) also regulate BAFF expression in RAFLS and SScHDF stimulated with Poly (I:C) or IFN-γ. [score:4]
uk/enright-srv/microcosm/htdocs/targets/v5) identified several miRNAs candidates: miR-144*, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p, miR-302c* and miR-30 family members (miR-30a, d and e which share the same seed sequence). [score:3]
A. Luciferase reporter constructs with wild-type or mutated (for miR-30-3p binding sites) BAFF 3′UTR were generated. [score:1]
D. NHDF (n = 3) transfected with miR-30-3p antisense, were stimulated with poly (I:C). [score:1]
C. NFLS (n = 3) and NHDF (n = 3) were transfected with miR-30-3p antisense oligonucleotides (20 pM/sample) or with an AllStars negative control (CT). [score:1]
For this, we added anti-BAFF antibodies to poly (I:C)-stimulated NHDF treated with miR-30-3p antagomiRs. [score:1]
0111266.g003 Figure 3 A. Luciferase reporter constructs with wild-type or mutated (for miR-30-3p binding sites) BAFF 3′UTR were generated. [score:1]
[1 to 20 of 9 sentences]
44
[+] score: 25
A. Expression of miR-21 and miR-23a, B. Expression of miR-30b and miR-130a, C. Expression of miR-133b and miR-191, D. Expression of miR-204 and miR-208b. [score:9]
Likewise, among upregulated miRNAs, miR-23b and miR-30b showed more incremental expression in the male subjects, compared to the female subjects. [score:5]
These miRNAs are miR-30b which has target for Notch1 and Bcl [2] and, miR-130a has target for BMPR1b and SMAD2. [score:5]
The expression of miR-30b was 1.54±0.22-fold (p<0.05) and 3.58±0.63-fold -folds (p<0.01) in moderate and severe PH, respectively (Fig. 4 B). [score:3]
It is of note that the expression of miR-23b and miR-30b but, not the miR-21, were significant in severe PH subjects; compared to their moderate counterparts. [score:2]
MiR-21, miR-23b and miR-30b are moderately elevated in PH subjects. [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 22
Since previous microarray -based analysis had indicated that members of the miR-30 family were downregulated in latency III cells compared to latency I cells or EBV -negative cells, we examined the role of these miRs in RGC-32 translation control. [score:5]
Although we found that miR-30c and miR-30d could direct translational repression via the RGC-32 3′UTR in reporter assays, mutation of the miR-30 binding site in the RGC-32 3′UTR did not relieve repression mediated by the RGC-32 3′UTR. [score:4]
We therefore conclude that the miR-30 family have the potential to repress RGC-32 expression, but are not the main mediators of RGC-32 3′UTR directed repression in the B cells used in our assays. [score:3]
In contrast, miR-30 with a mutated seed sequence did not repress reporter gene expression. [score:3]
We found that the miR-30 family of miRNAs were predicted to target the 3′UTR of RGC-32. [score:3]
However, when we mutated the miR-30 target sequence in the RGC-32 3′UTR reporter construct, we did not observe any loss of 3′UTR mediated repression in our transient transfection assays (Figure S7C). [score:2]
The miR-30 family (miR-30a, b, c, d, e) were the only miRNAs identified by most programmes used (Supplementary Figure S7A). [score:1]
We therefore investigated whether miR30-c and miR30-d were able to repress reporter gene expression via the RGC-32 3′UTR when they were transfected into cells. [score:1]
[1 to 20 of 8 sentences]
46
[+] score: 22
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
Shuffling analysis of miR-30 family members revealed similar specificity, although certain preferences were more significant than others (Fig. 7d). [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
Specifically, miR-30b and miR-30c showed more significant differences from miR-30a, miR-30d and miR-30e than from each other and vice versa. [score:1]
An exception was G–U wobble interactions, which showed strong preferences such as miR-30 position 3 (Supplementary Fig. 3d). [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
[1 to 20 of 10 sentences]
47
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-30c was upregulated by HDI in all the three experiments, miR-30d was upregulated in two of the three experiments, while miR-30b and miR-30e were upregulated in one of the three experiments but were downregulated in the other two experiments. [score:13]
All the five miR-30 miRNAs were expressed in B cells stimulated by LPS plus IL-4. The abundance of miR-30b, miR-30c, miR-30d, and miR-30e were greater than that of miR-30a (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
The miR-30 family consists of five miRNAs (miR-30a, miR-30b, miR-30c, miR-30d, and miR-30e) encoded by different host genes. [score:1]
The miR-30 family members are similar to each other and have identical seed sequences. [score:1]
Like human PRDM1 (48), the 3′ UTR of mouse Prdm1 mRNA contains three highly conserved bindings sites complementary to the seed sequence of miR-30a and other miR-30 family members (Figure 8). [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 20
Furthermore, it has been recently demonstrated that increased levels of miRNA-30b inhibit phagocytosis in myeloid inflammatory cells [18]. [score:3]
Thus, transgenic miRNA-30b overexpressing mice with lactation defects and disturbances of mammary epithelial cell differentiation are not suitable for studying milk exosome traffic under physiological conditions. [score:3]
The defect in mammary epithelial cell biology caused by overexpression of miRNA-30b may impair cellular traffic and correct assembly of milk exosomes. [score:3]
Transgenic mice overexpressing miRNA-30b. [score:3]
An aberrant composition of miRNA-30b-containing milk exosomes may explain the observed failure of miRNA-30b intestinal uptake [13]. [score:1]
Laubier et al [13] used this mo del to examine milk exosomal miRNA traffic in the offspring and found no effect of the elevated miRNA-30b level in the mouse milk on its level in pup tissues. [score:1]
miRNA-30b is a critical miRNA involved in the control of lactation [12]. [score:1]
MC: Milk cell; MEC: mammary epithelial cell; MFG: Milk fat globule miRNA-30b is a critical miRNA involved in the control of lactation [12]. [score:1]
The authors reported that the concentration of miRNA-30b in the milk of transgenic mice was 134 times the concentration in the wild-type control. [score:1]
However, they did not assess whether the extra miRNA-30b in the milk of this mo del was encapsulated in extracellular vesicles such as exosomes. [score:1]
The fact that miRNA-30b concentration in the stomach of transgenic pups was only 31 times the concentration in the wild-type pups, i. e. substantially lower than the ratio in milk, is consistent with an extravesicular localization resulting in impaired stability and bioavailability of miRNA-30b from these transgenic mice. [score:1]
The nutritional hypothesis is based on three problematic mouse mo dels: 1) miRNA-375 KO mice, 2) miRNA-200c/141 KO mice, and 3) transgenic mice presenting high levels of miRNA-30b in milk. [score:1]
[1 to 20 of 12 sentences]
49
[+] score: 20
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
[1 to 20 of 2 sentences]
50
[+] score: 19
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Interestingly, dihydropyrimidinase-related protein 2, DPYSL2, a highly abundant protein in brain, is targeted by miR-30, 20 and 181 and has been shown to be up-regulated in proteomic studies on APP23 mice already at a very early age [63]. [score:6]
In addition, specific members of the miR-30 family (30c and 30b) were also significantly down-regulated in response to Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
[1 to 20 of 4 sentences]
51
[+] score: 19
In addition to these factors, KSHV can also downregulate miR-30b and miR-30c, whereas increasing the expression of their direct target, Delta-like 4 (DLL4), a functional protein in vascular development and angiogenesis [24], can induce KSHV -mediated LECs angiogenesis [25]. [score:10]
Interestingly, these miRNAs (miR-21, miR-31, miR-221/222, miR-30) can act as either “oncogenes” or “tumor-suppressor genes” in a variety of cancers in which they can regulate tumor cell proliferation, apoptosis, invasion, angiogenesis, metastasis and other important cellular functions [26, 27, 28, 29, 30], indicating functional relevance of these regulatory miRNAs in virus-related malignancies. [score:5]
Human miRNAs Validated Targets Regulated by Viral Proteins Functions References miR-21 - K15M Cell mobility[22] miR-31 FAT4 K15M Cell mobility[22, 23] miR-221/222 ETS2/ETS1 LANA and Kaposin B Cell migration[23] miR-30b/c DLL4 - Angiogenesis[25] miR-557/766/1227/1258/1301 RTA - Viral replication[39] miR-146a CXCR4 vFLIP Immune response[41] miR-1293 vIL-6 ORF57 Immune response[46, 47] miR-608 hIL-6 ORF57 Immune response[46, 47] miR-132 p300 - Immune escape[48] This work was supported by grants from a Center for Biomedical Research Excellence P20-GM103501 subaward (RR021970), the Ladies Leukemia League Grant (2014-2015), and the National Natural Science Foundation (NNSF) of China (81101791, 81272191, 81472547 and 81400164). [score:4]
[1 to 20 of 3 sentences]
52
[+] score: 19
In our study, CASP3 was significantly upregulated by qRT-PCR analysis (Figure 6) and targeted by the downregulated miRNAs: miR-342-3p, miR-29b, miR-29c, miR-29a, let-7g and miR-30b, which can be expected to develop miRNA -based therapeutics for influenza disease. [score:11]
P38 MAPKs (MAPK11, MAPK13, and MAPK14) were found to be regulated by miR-769-5p, miR-146b-5p, let-7g, miR-30b, miR-31, miR-361-3p, and miR-362-3p (Figure 7), which were all down expressed in H1N1 critically ill patients. [score:4]
We found that EGFR was regulated by miR-342, miR-155, miR-30b, miR-210, miR-192, let-7g, and miR-146b-5p, which were all down expressed in H1N1 critically ill patients. [score:4]
[1 to 20 of 3 sentences]
53
[+] score: 18
The upregulated miRNAs included miR-132-3p, miR-604, miR-186-5p, miR-29b-3p, miR-125b-5p, miR-376c-3p, and miR-30b-5p, where the only downregulated miRNA was miR-423-3p (Table 1). [score:7]
Turini Gonzales Marioto et al. (97) evaluated the miRNA profiles in mice intravenously administered P. brasiliensis and showed that the most upregulated miRNAs at 28 days included miR-126a-5p, miR-340-5p, miR-30b-5p, miR-19b-3p, miR-221-3p, miR-20a-5p, miR-130a-3p, and miR-301a-3p, whereas after 56 days, miRNAs from the let-7 family, as well as miR-26b-5p, and miR-369-3p were the greatest upregulated miRNAs (97). [score:5]
Interestingly, both studies reported an upregulation in miR-30b-5p, suggesting a possible biomarker for P. brasiliensis infection. [score:4]
Along with an increase in miR-30-5p and miR-210-3p in THP-1 cells treated with β-glucan isolated from C. albicans, Du et al. found that miR-146a was increased upon Dectin-1 stimulation and negatively regulated the resultant inflammatory response (94). [score:2]
[1 to 20 of 4 sentences]
54
[+] score: 18
The backbone of miR-30 is one of the most frequently used microRNA sequence to direct the processing and maturation of shRNA, because its stem sequence could be substituted with exogenous sequences that match different target genes and to produce 12 times more mature shRNAs than simple hairpin designs [12], [14], and its ability to prevent interferon-stimulated gene expression and associated off-target effects and toxicity in cultured cells and mouse brain [17], [28]. [score:8]
Efficient Knockdown of Reporter Gene In Vivo by Mir-shRNAIt has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:4]
It has been previously shown that the 5′ and 3′ flanking sequences of miRNA precursor are crucial for miRNA processing and maturation [16], and the hairpin shRNA can be expressed from a synthetic stem-loop precursor flanked by the 5′ and 3′ flanking sequences of either human miR-30 [14] or mouse miR-155 gene [13]. [score:3]
In combination with a natural backbone of the primary miR-30 microRNA (miRNA), higher amounts of synthetic shRNAs can be produced from the pol III promoter than from the simple hairpin design [12]. [score:1]
We first identified zebrafish homologues of mammalian miR-30 and miR-155 genes based on their sequence identity (data not shown), and cloned both zebrafish pri-miR-30e (409 bp) and pri-miR-155 (447 bp) genomic precursor sequences into the pCS2 [+] vector (Figure 1A. [score:1]
The resultant construct mir-shRNA [EGFP-ORF] contained the same sequence (including a di-nucleotide bugle [17]) as the native miR-30e precursor, except that the strand of the mir-30 hairpin stem has been replaced with the 22 nt-long sequences complementary to EGFP open reading frame (ORF) at the position of 121–142 (Figure 1A and Figure 2A). [score:1]
[1 to 20 of 6 sentences]
55
[+] score: 18
Because miR-30a shares the same “seed sequence” with other miR-30 family miRNAs for targeting mRNA (Figure  5A), we hypothesized that EZH2 may also regulate miR-30a and that miR-30a may inhibit KPNB1 in MPNST cells. [score:6]
We also found that EZH2 inhibited expression of another miR-30 family member, miR-30a, in MPNST cells. [score:5]
These microarray studies revealed that, in addition to miR-30d, another miR-30 family member, miR-30a, was also upregulated in EZH2-knockdown cells compared with negative controls in MPNST724, S462, and STS26T cells [5]. [score:4]
Together with our findings, these data suggest that EZH2-regulated miR-200 and miR-30 family members may modulate cell survival and EMT in numerous different cancers. [score:2]
The miR-200 and miR-30 families have been shown to induce mesenchymal-epithelial transition [25]. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 17
The miR-30 family has been shown to be down-regulated in mdx4cv mice (mo dels for Duchenne muscular dystrophy), with in vitro analysis indicating that miR-30 miRNAs are decreased following injury and are increased during myoblast differentiation [45]. [score:4]
Two members of the miR-30 family, miR-30b-5p and miR-30e-5p, had decreased expression post-exercise. [score:3]
The largest number of gene targets were identified for the miR-30 family members. [score:3]
In skeletal muscle samples, 97/179 miRNAs were detected with 5 miRNAs (miR-21-5p, let-7d-3p, let-7d-5p, miR-30b-5p, miR-30e-5p) differentially expressed (DE, P < 0.05) between time-points. [score:3]
The expression of the miR-30b-5p and miR-30e-5p family members increased 0.52 ± 0.1 and 0.64 ± 0.2 fold, respectively. [score:3]
Accession numbers for the miRNA data generated in this study are: MIMAT0004484 (hsa-let-7d-3p), MIMAT0000076 (hsa-miR-21-5p), MIMAT0000065 (hsa-let-7d-5p), MIMAT0000420 (hsa-miR-30b-5p) and MIMAT0000692 (hsa-miR-30e-5p). [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 17
The expression levels of selected group of miRNAs identified in the microarray experiment, miR−374−5p, −30b, −222, −320c, −186, −320a,−320e and −29c, were validated using quantitative real-time reverse transcription PCR (qRT-PCR) that confirmed the microarray results and showed upregulation of miR-30b, miR-320 family (320a/320c/ 320e) on day 7 post-AD differentiation induction and further increase in expression levels of the same miRNAs in addition to miR-186 on day 13 (Figure 1e). [score:8]
Interestingly, several of the identified differentially regulated miRNAs during AD differentiation of hMSC have previously been reported to regulate hMSC differentiation (e. g., miR-222, miR-138 and miR-30 family 23, 27, 29, 30), indicating the importance of the regulatory network controlled by miRNAs as they are preserved across different cellular mo dels of MSC. [score:4]
Overexpression of miR-320c and miR-30b promote adipocytic differentiation of hMSCs. [score:3]
To examine for the potential role of selected miRNAs, miR-320c and -30b in regulating the adipocytic differentiation of hMSC, cells were transfected with pre-miR-320c, pre-miR-30b or pre-miR -negative control and subsequently were exposed to AIM. [score:2]
[1 to 20 of 4 sentences]
58
[+] score: 17
In another study, it has been found that Hcy can induce apoptosis in HCAECs in a dose -dependent manner which caused the up-regulation in the expression level of caspase-3 while down-regulation of miR-30b. [score:9]
In addition, enforced expression of miR-30b inhibited apoptosis Hcy -induced in HCAECs by down -regulating the caspase-3 expression level [13]. [score:8]
[1 to 20 of 2 sentences]
59
[+] score: 17
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
In contrast, only 5 miRNAs (miR-21, miR-26a, miR-24, miR-30b and miR-29a) were found to be downregulated both in vitro and in vivo by EF24 treatment. [score:4]
miR-30b appears to play an important oncogenic role in the development of medulloblastoma [36]. [score:2]
[1 to 20 of 3 sentences]
60
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 16
More recently, it is demonstrated that up-regulated expression of miR-30 in breast cancer-initiating cells inhibits their self-renewal capacity by reducing the ubiquitin-conjugating enzyme 9 (Ubc9). [score:8]
Integrin β3 (ITGB3) is another direct target of miR-30, which contributes to apoptosis (22). [score:4]
These miRNAs include miR-200c, Let-7, miR-30, but presently, little is known about the mechanism by which it functions to regulate BT-IC self-renewal. [score:2]
A previous report has shown that unligated ITGB3 recruits caspase-8 to the cell membrane and activated caspase-8-mediates apoptosis in a death receptor-independent manner (25), while miR-30 induces apoptosis not in the death receptor-independent manner but through an unclear pathway. [score:1]
Other miRNAs, such as miR-30, miR-17-5p, miR-9, are phase-specific. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 16
The four genes were not identified as targets of miR-30 due to the inability to link them to the “four genes” mention, and subsequently to the “15 upregulated target genes” mention. [score:8]
An example is the following sentence: “Among 15 upregulated target genes of the miR-30 miRNA, four genes known to be expressed and/or functional in podocytes were identified, including receptor for advanced glycation end product, vimentin, heat-shock protein 20, and immediate early response 3” (PMID 18776119). [score:8]
[1 to 20 of 2 sentences]
64
[+] score: 15
Therefore, the different trend they observed in miR-30b, miR-15a and let-7i expression comparing to our results could be conferred to the fact that the expression of those miRNA in centenarians is very similar to young people. [score:5]
Moreover, we have confirmed the decreasing expression of miR-15a, miR-30b, let-7i and let-7g with age in and independent cohort by RT-qPCR. [score:3]
miR-15a and miR-30b also had a slightly lower expression in this group, but the difference was not statistically significant (RQ=0.632; p-value=0.121 and RQ=0.777; p-value=0.0591, respectively) (Table 5). [score:3]
Serna et al, had also related those miRNA to human aging but, they found and overexpression of miR-30b, miR-15a and let-7i in centenarians compared to octogenarians[17]. [score:2]
Even if miR-15a and miR-30b did not show a statistically significant change, we decided to include them in further validation experiments. [score:1]
This selection resulted in a list of 5 candidate miRNA: miR-15a, miR-30b, let-7i, let-7g and miR-1281 (Table 5). [score:1]
[1 to 20 of 6 sentences]
65
[+] score: 14
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein. [score:4]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 3 sentences]
66
[+] score: 14
And a larger flanking region may be necessary for optimal target knockdown by a mir-30 -based cassette [117]. [score:4]
However, it is noteworthy that a contradicting study shows shRNA with 19-nt stem and 9-nt loop may outperform the miR-30 based scaffold for target knockdown in some experimental setting [133]. [score:4]
To date, the well-defined endogenous miR-26a [123] and miR-30 [113, 116] have been used as typical scaffolds for the expression of RNAi triggers. [score:3]
Recently, second-generation shRNA libraries covering mouse and human genomes have been designed in the backbone or pri-miR30, showing improvement over the conventional shRNAs [132]. [score:1]
Successes of employing this pri-miR-Pol II system have been reported for miR-30 [118] and miR-155 [114]. [score:1]
Zeng et al. [116] have demonstrated that miR-30 miRNA backbone including siRNA sequences effectively degrades mRNAs of endogenous human genes such as the polypyrimidine tract binding protein. [score:1]
[1 to 20 of 6 sentences]
67
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
68
[+] score: 14
For lentiviral -mediated knockdown of Trp53, we generated a vector (pLenti X1 Puro DEST, Addgene 17297) containing the U6 promoter (derived from pENTR/pSM2 (U6), Addgene 17387) driving expression of a previously described (Dickins et al, 2005) miR30 format shRNA against Trp53 (1224) or expressing an empty (ns) miR30 backbone. [score:6]
Cells were infected with adenoviruses expressing GFP (Vector Biolabs, 1060) or Cre-GFP (Vector Biolabs, 1700), retroviruses (LMP) expressing non-silencing hairpin or miR30-shRNA against Trp53 (Dickins et al, 2005), lentiviruses (L KO. [score:5]
I. Proliferation assays of Vhl [fl/fl] MEFs infected with GFP or Cre and lentiviruses expressing an empty miR30 shRNA (shRNA-ns) or miR30-format shRNA directed against Trp53 (shRNA-Trp53). [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 14
For example, the down-regulation of miR-30 family and miR-107 can up-regulated p53 expression in human cell lines (Li et al., 2010), and overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells (Le et al., 2009). [score:13]
Thus, reduced levels of both the miR-30 family and miR-107 in old adults seem to protect these individuals from malignant mesothelioma and neuroblastoma, whereas reduced levels of the let-7 family in old adults seem to promote tumor progression. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 13
Fc -induced CD8 [+] Ts with CD8 [+]CD28 [−] Ts induced in MLC by chronic allogenic stimulation demonstrated that the characteristic signatures of CD8 [+] T suppressor cells generated by either of these methods are the same, consisting of upregulation of the BCL6 transcriptional repressor and downregulation of inflammatory microRNAs, miR-21, miR-30b, miR-146a, and miR-155. [score:7]
Fc inhibited the expression of miR-21, miR-30b, and miR-155. [score:5]
Studies of exosomes from MLC supernatants revealed the presence of inflammatory microRNA, including miR-146a, miR-155, miR-21, miR-30b, miR-365, and Let-7a. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 13
In addition, in agreement with previous studies showing that the miR-30 family members inhibit the EMT process and confer epithelial phenotype to cancer cells including pancreatic and hepatocellular carcinomas [34], [35], our data demonstrated that FHIT-activated miR-30c inhibits TGF-β -induced EMT in NSCLC A549 cells through direct targeting of mesenchymal markers, VIM and FN1, and activation of epithelial marker and metastasis suppressor, E-cadherin (Figure 6I). [score:10]
In fact, this miRNA may function as an anti-metastatic miRNA in several types of human cancer; it has been shown that miR-30 inhibits metastasis in vivo and in vitro in a metastatic breast cancer mo del [31], [32]. [score:3]
[1 to 20 of 2 sentences]
72
[+] score: 12
For example, the median log2 expression level change of the top 150 TargetScan conserved targets was 0.096 (6.9%) for mir-29 knockdown in fetal lung fibroblasts [89], 0.131 (9.5%) for mir-145 transfection of MB-231 breast cancer cells [90], 0.173 (12.7%) for mir-30 overexpression in melanoma cell lines [91], and 0.465 (38.0%) for mir-7 overexpression in A549 cancer cells [92]. [score:12]
[1 to 20 of 1 sentences]
73
[+] score: 12
Meanwhile, overexpressing miR-30 could inhibit apoptosis through repression of p53 expression in cardiomyocytes [48], but upregulation of miR-30 in breast cancer cells induced apoptosis by targeting Ubc9 [49]. [score:12]
[1 to 20 of 1 sentences]
74
[+] score: 12
Briefly, the ‘Flp-In' targeting vector, called pCol-TGM, was configured with a GFP ‘spacer' between a tetracycline-regulated element and the miR30 -based expression cassette. [score:6]
Nine shRNA guide sequences predicted to target Rtn1 for knockdown were embedded into a miR30 -based expression cassette of a retroviral DOX-inducible shRNA vector. [score:6]
[1 to 20 of 2 sentences]
75
[+] score: 12
Meanwhile, the HNF1A-AS1-miR-30b axis could significantly up-regulate cell autophagy during starvation by enhancing the expression of ATG5, the target of miR-30b (Liu Z. et al., 2016). [score:8]
The oncogene lncRNA HNF1A-AS1 could promote tumor growth by sponging tumor-suppressive hsa-miR-30b-5p in hepatocellular carcinoma. [score:3]
Long non-coding RNA HNF1A-AS1 functioned as an oncogene and autophagy promoter in hepatocellular carcinoma through sponging hsa-miR-30b-5p. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 11
The expression profile of infected and uninfected cells was evaluated using a miRNA microarray, and 16 miRNAs were reported to be up-regulated (miR-4290, miR-4279, miR-625*, miR-let-7e, miR-1290, miR-33a, miR-3686, miR-378, miR-1246, miR-767-5p, miR-320c, miR-720, miR-491-3p, miR-3647, miR-451 and miR-4286) and 4 down-regulated (miR-106b, miR-20a, miR-30b and miR-3653) during dengue infection. [score:7]
The authors also identified epigenetic regulators as the potential targets of miR-let-7e (EZH2) and miR-30b (methyltransferase 3A). [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 11
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30c-1, hsa-mir-30e
Expression of miR30b (Figure 2B) and miR30c (Figure 2C) was dowregulated significantly by BMP‐2 after 2 hours, before the observed upregulation of Runx2 mRNA, indicating that these miRs are plausible candidates to regulate Runx2 expression. [score:10]
Human CASMCs were treated with BMP‐2 (100 ng/mL) for 4 hours and (A) expression of miR30 family members (miR‐30a, miR‐30b, miR‐30c, miR‐30d, and miR‐30e) was evaluated by quantitative real‐time–polymerase chain reaction (PCR). [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 11
Correspondingly, the potential target genes of these miRNAs, i. e., ADAM22, MYO5A, LOX and GM2A for miR-145; ADAM22 for miR-30b, were upregulated in IR subjects [62]. [score:6]
IS group, including 16 miRNAs downregulated in IR individuals, such as miR-30b, and miR-145. [score:4]
Zheng Y. Wang Z. Tu Y. Shen H. Dai Z. Lin J. Zhou Z. miR-101a and miR-30b contribute to inflammatory cytokine -mediated β-cell dysfunction Lab. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 11
This observation suggests a possible unidentified interaction between miR-30 and BDNF promoter as well as multiple layers of regulation of BDNF level by targeting both 3′-UTR and promoter regions. [score:4]
Members of the miR-30 family were previously reported to target both human and mouse BDNF at the 3′-UTR (55, 56). [score:3]
For example, members of the miR-30 family were good candidates given that they are predominantly nuclear-localized and were predicted to commonly target human and mouse BDNF sense promoter with strong favorable thermodynamic interaction. [score:3]
Experimental evidence for the existence of nuclear miRNAs was also present for the three miRNA families, namely miR-188, miR-671 and miR-30. [score:1]
[1 to 20 of 4 sentences]
80
[+] score: 11
For example, these studies reported up to seven fold differences in miRNA expression levels between receptive (LH day 7) and non-receptive (cycle day 12 or LH day 2) endometrium, where miR-30d, miR-30b, miR-31, miR-193a-5p, miR-203 showed up-regulation and miR-503 down-regulation in receptive endometrium [17, 18, 20]. [score:9]
17 Altmäe S, Martinez-Conejero JA, Esteban FJ, Ruiz-Alonso M, Stavreus-Evers A et al. (2013) MicroRNAs miR-30b, miR-30d, and miR-494 regulate human endometrial receptivity. [score:2]
[1 to 20 of 2 sentences]
81
[+] score: 11
Similar results were observed in p53 [+/+] and p53 [−/−] cells (Figure 2c): the expression levels of miR-3151 and miR-663b were upregulated in p53 [−/−] cells, while the expression levels of miR-140, miR-30b, miR-506, miR-124 and miR-30c were downregulated in p53 [−/−] cells compared with that in p53 [+/+] cells. [score:10]
Several miRNAs were proposed, among which seven of them were reported to be related to p53: miR-140, miR-30b, miR-3151, miR-506, miR-124, miR-30c, and miR-663b 19, 20, 21, 22, 23, 24 (Figure 2a). [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 11
pAPM is a lentiviral vector expressing puromycin-resistance and a miR30 -based knockdown cassette from the spleen focus forming virus LTR [48, 63, 64]. [score:4]
Jurkat T cells (A) or primary human CD4 [+] T cells (B) were transduced with lentiviral vectors bearing a puromycin resistance cassette and miR30 -based knockdown cassettes targeting either luciferase (black squares), CypA (gray diamonds), or TRIM5 (white triangles). [score:4]
As a control for miR30 lentiviral vector transduction and puromycin selection, Jurkat T cells were transduced with an otherwise isogenic lentiviral vector targeting luciferase (Luc), a gene that is not present in these cells. [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 11
[95] In addition, Beclin 1 and ATG12 have also been defined as targets of miR-30b in a previous study, indicating that, aside from ATG5, HNF1A-AS1 might also upregulate Beclin 1 and ATG12 expression to promote vesicle nucleation and autophagosome elongation/closure. [score:8]
The lncRNA HNF1A-AS1 can sequester miR-30b from binding to its target ATG5 and thereby provoke autophagy in HCC. [score:3]
[1 to 20 of 2 sentences]
84
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
The miR-30(b/c/d/e) family regulates kidney development by targeting the transcription factor Xlim1/Lhx1 in Xenopus[66]. [score:5]
In addition, ssc-moRNA-3, belonging to new type of miRNA termed moRNA, was found at the 5’ end of pre-miR-30. [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
#: due to miRNAs classification by seed sequence, 3p and 5p of miR-30 represent different miRNAs families. [score:1]
Similarly, miR-30a was the most abundant in the miR-30 family. [score:1]
At the 5’ end of pre-miR-30, a 18 nt RNA sequence was found to be generated from the loop, downstream of ssc-miR-30a-5p (Figure 10C). [score:1]
[1 to 20 of 7 sentences]
85
[+] score: 11
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-30c-1, hsa-mir-30e
The structural difference between the microRNA and the shRNA is that the microRNA contains flanking miR30 sequences while in the shRNA these sequences were removed, but the GRB2 targeting sequence is identical in both these suppressive RNAs. [score:5]
We cloned potential microRNA targeting sequences for GRB2 into a modified form of the human miR30 microRNA in viral packaging vectors that have a gene for YFP to identify transduced cells. [score:3]
However, there was no large difference in the effectiveness of each type of targeting sequence, since our studies in HuT78 T cell line performed utilizing both miR30 and shRNA constructs had identical results (data not shown). [score:3]
[1 to 20 of 3 sentences]
86
[+] score: 11
Interestingly, another recent study by Haque et al. [43] showed that in ARPE-19 cells, a sublethal dose of H [2]O [2] upregulated miR-30b, which inhibited catalase, another anti-oxidant enzyme. [score:6]
MicroRNA-30b has previously been shown to impair oxidative stress mechanisms in ARPE-19 [43], whereas miR-9 has been shown to be upregulated by a retinoic acid analogue in the same cells [44]. [score:4]
Furthermore, a miR-30b antagonist protected RPE cells from oxidative stress, concurring with our findings after using miR-17-3p. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 11
Downregulated miRNAs in CD5 [+] cells included members of both the mir-29 and mir-30 families as well as the mir-17-92 cluster. [score:4]
Conversely, 15 miRNAs resulted downregulated in activated B cells: mir-483, mir-95, mir-326, mir-135a, mir-184, mir-185, mir-516-3p, mir-30b, mir-203, mir-216, mir-150, mir-182*, mir-141 and mir-211 (Table 3). [score:4]
Other miRNAs such as mir-155, mir-181b, mir-15a, mir-16, mir-15b, mir-34a, mir-9, mir-30, let-7a, mir-125b, mir-217 and mir-185 modulate the expression of pivotal genes and functions which contribute to the final B-cell maturation [6]. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 10
The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
The two shRNA sequences were placed into miR30 context downstream eGFP CDS and thereby lentiviral vectors expressing the miR-shRNAs, named as FUW-eGFP-miR-shRNA in this article, were constructed (Fig. 1). [score:3]
0030560.g001 Figure 1 The designed shRNA sequences targeting mouse CYP3A mRNAs were placed into human miR30 context downstream eGFP coding sequence (CDS). [score:3]
To place the shRNA sequences into miR30 context, a 97-mer sequence containing the designed shRNA was retrieved through the RNAi design algorithm, which was then subcloned into the site of pri-miRNA area downstream the eGFP coding sequence (CDS) in pRIME vector as previously described [10]. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 10
The results are shown in Figure 4A, bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-193a-5p, bta-miR-339b, bta-miR-375, bta-miR-487b, and bta-miR-100 were differentially expressed in peak and late lactation, and the expression levels of bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-339b, bta-miR-375, and bta-miR-487b in late lactation tissue were higher than the expression levels in peak lactation, bta-miR-100 was down regulated in late lactation compared with peak lactation, the expression pattern was consistent with the Solexa sequencing results (Table S1), only bta-miR-107 was not consist with Solexa sequencing results, this may be caused by deviation of qRT-PCR. [score:9]
However, in late lactation, miR-143, let-7, miR-21, miR-148, miR-30, miR-146, miR-107 and miR-103 were the most abundant, each with more than 100,000 reads. [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 10
data are expressed as relative quantification using miR-30b as normalizer, normalized on average of control expression Fig. 3miR-31, miR-708, and miR-34c targeted 3′UTR sequences of NOS1 gene. [score:7]
was normalized on miR-30b-5p expression (204765) using 2 [−dCT] method. [score:3]
[1 to 20 of 2 sentences]
91
[+] score: 10
Among the target genes of miR-30b/30d, the authors found a significant down-regulation of SEMA3A. [score:6]
In a more recent study on miRNA, Gaziel-Sovran A (27) have observed that miR-30b/30d upregulation correlates with higher metastatic potential, shorter time to recurrence, and reduced overall survival. [score:4]
[1 to 20 of 2 sentences]
92
[+] score: 10
A direct target gene of miR-30 is integrin β3 [18]. [score:4]
Of note, the expression of most members of the miR-30 family including miR-30b, -30c, and -30d, were also reduced in CK2β -depleted cells. [score:3]
It has been reported that a miR-30 reduction maintains self-renewal and inhibits apoptosis in breast tumour-initiating cells [18]. [score:3]
[1 to 20 of 3 sentences]
93
[+] score: 10
Therefore one could speculate that miR-30 family members play a role in the complex network of podocytopathia -associated up-regulation of TGF-ß 53. [score:4]
TGF-ß treatment of podocytes in vitro resulted in a diminished expression of all miR-30 family members 52. [score:3]
In particular miR-132-3p, miR-30b-5p and miR-30c-5p were strongly expressed compared to reference miRNAs. [score:2]
crescentic IgA-GN as well as miR-30c-5p, miR-30b-5p, hsa-miR-505-5p in controls vs. [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 10
On the other side, miR-378 (6.6-fold), miR-30c (5.1-fold), miR-30a (4.0-fold), miR-30b (3.1-fold), miR-30e (3.1-fold), miR-30a* (2.8-fold) and miR-34a (2.5-fold), were up-regulated in mature adipocytes (Figure 2). [score:4]
Also related to pancreas development and regulation, the cluster of miRNAs related to miR-30 (miR-30a, b, c, d and e) increased during adipocyte maturation as well as during differentiation of pancreatic islet-derived mesenchymal cells into hormone-producing cells [32] –[34]. [score:3]
Our findings are also in agreement with those of Esau et al. [27], that identified a similar expression pattern regarding miR-30c, miR-30a*, miR-30d, miR-196, miR-107, miR-30b and miR-100 during differentiation of human adipocytes. [score:3]
[1 to 20 of 3 sentences]
95
[+] score: 10
Some miRNAs had only two viral targets, such as gga-mir-32 (targeting HA and NS genes) and gga-miR-30b (targeting M and NA genes). [score:7]
: AY278204), has predicted binding sites for seven differentially expressed miRNAs: gga-miR-30b, 34a, 142-5p, 202, 460b-5p, 449b, and 460a. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 10
In lung cancer, down-regulation of both miR-30b and miR-30c was demonstrated to inhibit cell proliferation 55. [score:6]
Pivot miRNA miR-30 family significantly regulated most modules in the subnetwork. [score:2]
TF BRG1, TF CEBPA, miRNA miR-27b and miRNA miR-30 family members recurred with relatively high degrees. [score:1]
Among these pivots, we showed that TF BRG1 and CEBPA and miRNA miR-27b and miR-30 family members recurred with relatively high degrees between the two different patterns, which thus turned out to be promising candidates for further confirmation. [score:1]
[1 to 20 of 4 sentences]
97
[+] score: 10
For example, MMP16, predicted target of miRs miR-27, miR-30 and miR-140, is an important protein regulating bone homeostasis through regulating osteocyte differentiation [58]. [score:5]
Among the miR expression of which was differentially expressed in the osteogenic tissues from adult and old donors, miRs with known function in bone biology were validated: let-7 [52], miR-21 [53], miR-30 [54], miR-96 [55], miR-27 [56], and miR-140 [57]. [score:5]
[1 to 20 of 2 sentences]
98
[+] score: 10
For bladder cancer, Takahiro et al. demonstrated that KRT7 mRNA was significantly down-regulated by transfection of miR-30-3p, miR-133a and miR-199a in the bladder cancer cell line (KK47), suggesting that these three miRNAs may have a tumor suppressive role via the mechanism underlying transcriptional repression of KRT7 [9]. [score:6]
Figure  1 shows that target genes of four miRNAs such as hsa-miR-221, hsa-miR-30-3p, hsa-miR-133a and hsa-miR-21 were enriched in three pathways. [score:3]
Of note, nine miRNAs such as hsa-miR-199a*, hsa-miR-143, hsa-miR-127, hsa-miR-30-3p, hsa-miR-221, hsa-miR-21, hsa-miR-101, hsa-miR-129 and hsa-miR-133a were listed (Table  2). [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 10
Differential expression analysis between the validation group and RRMS samples identified eight out of nine significantly dysregulated miRNAs as identified previously (miR-15b-5p, miR-23a-3p, miR-223-3p, miR-374a-5p, miR-30b-5p, miR-433-3p, miR-485-3p, miR-342-3p, miR-432-5p) (Table  3). [score:4]
A combination of just three miRNAs (miR-223-3p, miR-485-3p, miR-30b-5p) had a 95% accuracy rate of predicting disease progressive forms of MS from RRMS as identified by Random Forest analyses, suggesting that they may be useful clinical biomarkers. [score:3]
Both miR-342-3p and mir-30b-5p have been proposed as free circulating miRNA biomarkers in Alzheimer’s and Parkinson’s diseases 27, 28, and their association with MS in this study suggests that they may be more general markers of neuro-axonal injury. [score:3]
[1 to 20 of 3 sentences]
100
[+] score: 10
Recently, miR-30b has been reported to act as a hypertrophic suppressor by inhibition of Ca/calmodulin -dependent protein kinase II expression (CaMKII), a hypertrophic signaling marker [44]. [score:7]
Our results also suggest the involvement of miR-127, miR-27b, miR-30b, miR-655, miR-95 and miR-495 in skeletal muscle development (S1B Fig. ). [score:2]
However, our data demonstrated that miR-30b might be important to volumetric muscle growth and muscle maturation. [score:1]
[1 to 20 of 3 sentences]