sort by

301 publications mentioning hsa-mir-27b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-27b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 497
Next, we analysed 721 substantially >1.33-fold up-regulated and 689 substantially <0.75 down-regulated genes (listed in table S1) after miR-27 over -expression with the online gene expression analysis tool “DAVID” in order to identify pathways regulated by miR-27. [score:12]
We also compared the number of genes down-regulated after miR-27 over -expression with miR-27 target genes predicted by Targetscan human V6.2 (Figure 5D). [score:9]
In the case of miR-27 over -expression, it is obvious that many pluripotency -associated genes were slightly or strongly down-regulated, whereas genes which promote differentiation were mainly up-regulated (Figure 5B). [score:9]
Our transcriptome analysis revealed that over -expression of miR-27 in human embryonal carcinoma cells leads to down-regulation of pluripotency -associated genes, such as GDF3, LIN28, TRIM71, DNMT3A, DNMT3B and USP46 and an activated expression of developmental genes such as SMAD6, BMP2, FST and HAND1 (Figure 5C). [score:9]
NANOG, a downstream target of activated SMAD2/3, has been predicted to be a miR-128 target, but not a miR-27 target gene, by TargetScan. [score:9]
In summary, we have demonstrated Over expression of miR-27 in hEC leads to a down-regulation of OCT4 and LIN28 on the transcriptional and translational level. [score:8]
Finally, we have shown that over -expression of miR-27 in hEC leads to a dramatic reduction in expression of OCT4 mRNA and protein (Figure 4C+D+E) but, as shown with the eGFP-sensor approach, OCT4 is not a direct target gene of miR-27 (Figure 2B). [score:8]
In summary, we have demonstrated Over expression of miR-27 in hEC leads to a down-regulation of OCT4 and LIN28 on the transcriptional and translational level. [score:8]
control mimic) or treated with the TGFßR2 inhibitor SB431542 (B) Heat map representing the expression of selected genes relative to the negative control transfection (Detection P-Value <0.01) (C) Venn diagrams representing the overlap of up- and down-regulated genes by let-7 and miR-27 (Detection P-Value <0.01) in comparison to the negative control transfection. [score:8]
The fact that loss of OCT4 induces activation of miR-27 expression in hES and that miR-27 over -expression results in reduced OCT4 expression in hEC, might imply that OCT4 and miR-27 form an indirect negative feedback loop but OCT4 rather than miR-27, is required for the maintenance of self-renewal in pluripotent stem cells [41] as depicted in Figure 6. 10.1371/journal. [score:8]
miR-27 expression has also been linked to cancer, it inhibits the tumor suppressor FOXO1 in endometrial cancer [36]. [score:7]
Remarkably, we show here that miR-27 directly regulates NANOG by binding to its 3′-UTR and inhibiting its expression (Figure 2B). [score:7]
Moreover, miR-27 over -expression activates expression of ZEB1 and ZEB2, (two antagonist of E-CADHERIN), which then leads to activated ß-CATENIN expression and decreased E-CADHERIN levels [37]. [score:7]
D) DiffQ0.05common: The table provides a detailed list of common and unique >1.3333 fold up-regulated and <0.75 fold down-regulated genes (Official gene Symbol) by let-7 and miR-27 (Detection P-Value <0.05) of Figure 5C. [score:7]
miR-27 over -expression in NCCIT cells repressed OCT4 and LIN28B expression levels to about 50% in comparison to the scrambled miRNA negative control but however no reduction of MYC expression. [score:7]
miR-27 inhibits OCT4 and LIN28 expression at the transcriptional and translational level in embryonal carcinoma (EC) cells. [score:7]
While over -expression of miR-27 results in a reduction of FOXO1 expression in hEC-1B cells, inhibition of miR-27 with antagomiRs leads to a de-repression of FOXO1 in Ishiwaka cells [36]. [score:7]
In order to search for miR-27 target genes, we used miRNA target gen prediction web tools such as TargetScan (http://www. [score:7]
More strikingly, we observed an up-regulation of genes that control developmental pathways such as p53-, WNT- and TGFß-signalling after miR-27 over -expression in NCCIT cells (Table 1). [score:7]
miR-27 inhibits OCT4 and LIN28 expression at both the transcriptional and translational level in embryonal carcinoma cells (NCCIT). [score:7]
regulated genes The Table represents all significantly up- and down-regulated genes after miR-27 or let-7 over -expression in comparison to the neg. [score:7]
Since miR-27 directly inhibits a number of pluripotency -associated genes that are involved in silencing the SMAD2/3 branch of the TGFß signalling pathway, we postulated that miR-27 expression would be activated at an early time point during directed differentiation of pluripotent cells. [score:7]
Other studies have shown that miR-27 is up-regulated during osteoblast differentiation and that miR-27 is highly expressed in endothelial cells [31], [32]. [score:6]
We have confirmed with our GFP-sensor approach that miR-27 directly inhibits the ACTIVIN/NODAL branch of TGFß-signalling by targeting ACVR2A, TGFßR1 and SMAD2 (Figure 1C). [score:6]
Therefore, we postulate that miR-27, a negatively regulated OCT4 target, is an inhibitor of self-renewal in hEC. [score:6]
miR-27 over -expression in hEC activates expression of developmental -associated genes and represses pluripotency -associated genes at the transcriptional level. [score:6]
miR-27 has been recently reported to be involved in metabolic processes such as fatty acid metabolism, where miR-27 inhibits adipogenesis through targeting two core regulators of adipogenesis, the peroxisome proliferator-activated receptor gamma (PPARγ) and C/EBPalpha [33]. [score:6]
This implies that OCT4 either directly or indirectly, negatively regulates miR-27 expression in hESC (Figure 3). [score:6]
Loss of OCT4 expression and function in hES results in the induction of miR-27 expression. [score:5]
Over -expression of miR-27 led to a ∼20% decrease in GFP expression of the GFP-ACVR2a sensor (p = 0.00096). [score:5]
Loss of self-renewal and therefore differentiation of hEC with SB431542 treatment resulted in ∼1.8-fold induced expression of miR-27a and an even lower level of miR-27b expression (Figure 4A). [score:5]
miR-27 targets the pluripotency -associated genes NR5A2, POLR3G, LIN28B and NANOG The fact that miR-27 regulates the SMAD2/3 branch prompted us to search for additional pluripotency -associated genes that might be regulated by miR-27. [score:5]
The observation that miR-27 over -expression leads to a reduction in OCT4 and LIN28B expression, led us to investigate whether miR-27 inhibits LIN28B or OCT4 at the protein level. [score:5]
The table reveals that miR-27 up-regulates a number of pathways associated with developmental processes, such as p53-, WNT- and TGFß-signalling (Table 1). [score:5]
Additionally, over -expression of mir-27 in hEC cells represses LIN28 at the transcriptional and translational level (Figure 4C+D+E). [score:5]
For miR-27 over -expression, the expression of OCT4 was highly reduced to levels similar to miR-125b and let-7a. [score:5]
Another potential miR-27 target gene, the RNA polymerase III (Pol III) subunit POLR3G, a downstream target of OCT4 and NANOG, has been reported to promote the undifferentiated state of embryonic stem cells. [score:5]
The lowest, just 1-fold up-regulation of both, miR-27a and miR-27b, was observed with the less efficient OCT4 knockdown sample- siOCT4#3. [score:5]
Employing an EGFP -based sensor approach, we show that miR-27 targets three genes of the ACTIVIN/TGFß branch of TGFß signalling pathway, namely: ACVR2, TGFßR1 and their downstream target SMAD2. [score:5]
RUNX1, an inhibitor of granulocyte differentiation, has been confirmed as a miR-27 target [35]. [score:5]
Screening with TargetScan we identified LIN28B as a putative miR-27 target gene (Figure 2A). [score:5]
In mesenchymal stem cells (MSCs), miR-27 expression is increased and promotes osteoblast differentiation by inhibition of the adenomatous polyposis coli gene (APC), a known activator of the WNT signalling pathway [32]. [score:5]
OCT4 knockdown in the hESC line H1 leads to activation of miR-27a and miR-27b expression. [score:4]
[16] The fact that SMAD2 has been predicted to contain two miR-27 binding sites located ∼5 kb apart to each other, we decided to clone two sub-fragments of the SMAD2-3-′UTR within the 3′-UTR of the GFP-sensor plasmid (SMAD2-1 and SMAD2-2) to assure that the GFP-SMAD sensor is not regulated by endogenously expressed miRNAs. [score:4]
With the GFP-sensor assay, we observed a significantly reduced (∼20%) level of GFP expression from the GFP-POLR3G reporter induced by miR-27 over -expression (Figure 2B). [score:4]
This observation is consistent with a recent report where the authors demonstrate that miR-27b is up-regulated in another hESC line (CHA-4) after endoderm priming [30]. [score:4]
We also screened for a number of pathways down-regulated by miR-27 in NCCIT cells. [score:4]
By using the above described GFP-sensor assay, we observed a significant (16%) reduction in GFP expression (p = 0.008) in the presence of exogenous miR-27 compared to the negative control, thus suggesting that LIN28B is a direct target of miR-27 (Figure 2B). [score:4]
The findings of our study reveal a novel role for miR-27 as a negative regulator of self-renewal by inhibiting core factors associated with pluripotency in hEC cells. [score:4]
miR-27 directly targets a number of pluripotency -associated genes such as TGFßR1, ACVR2, SMAD2, LIN28B, POLR3G, NR5A2 and NANOG. [score:4]
A previous study reported that miR-27 is up-regulated in the hESC line CHA-4, undergoing hepatocyte differentiation [30]. [score:4]
ACVR2A, TGFßR1 and SMAD2 are direct targets of miR-27. [score:4]
miR-27 directly inhibits a number of genes reported to sustain self-renewal in embryonic stem cells. [score:4]
miR-27 directly inhibits a number of genes of the TGFß signalling pathway that promote self-renewal in undifferentiated embryonic stem cells. [score:4]
Employing the GFP-sensor assay, we were able to confirm that miR-27 indeed directly regulates NR5A2 expression (Figure2B). [score:4]
List of pathways and associated genes significantly up-regulated 72 h after post-transfection of NCCIT with miR27. [score:4]
Surprisingly, miR-27 was able to repress GFP expression (approximately 29%) of the GFP-NANOG reporter compared with the negative control, thus indicating that NANOG is directly regulated by miR-27 (Figure 2B). [score:4]
These results reveal that miR-27 negatively regulates SMAD2/3 and therefore inhibits self-renewal in hESC. [score:4]
As shown in Figure 5C, the Venn diagrams represent a high overlap of substantially up- and down-regulated genes induced or repressed by let-7 and miR-27 in hEC cells. [score:4]
Another study demonstrated that miR-27 is strongly up-regulated in the heart of neonate mice and promotes myocardic maturation through modulating Mef2c [52]. [score:4]
miR-27 prevents adipogenic differentiation by targeting two main regulators of adipogenesis, the peroxisome proliferator-activated receptor gamma (PPARγ) and C/EBP alpha [33]. [score:4]
We observed for two samples with the most efficient OCT4 knockdown, a more than 16-fold increase in the levels of miR-27a and more than 6-fold increase in miR-27b expression (Figure 3D). [score:4]
To investigate miR-27 expression after RNAi -mediated knockdown of OCT4 inhESC, we isolated total RNA 72 h post transfection with siRNAs targeting either OCT4 (siOCT4) or EGFP (siEGFP) as a negative control [41]. [score:4]
Genes highlighted in bold, black letters are those validated experimentally to be direct targets of miR-27. [score:4]
Thereafter,s revealed that miR-27a expression was just slightly activated in definitive endoderm cells (DE) while miR-27b expression was activated more than ∼5-fold compared to undifferentiated hESC (Figure 2C histogram). [score:4]
0111637.g006 Figure 6 Genes highlighted in bold, black letters are those validated experimentally to be direct targets of miR-27. [score:4]
By using the Illumina Beadstudio microarray platform, we analysed the transcriptomes of NCCIT cells transfected with the following miRNA mimics (let-7, miR-125, miR-27, miR-200 and a scrambled negative control) and also treated with the TGFßR2 inhibitor SB431542 after 72 h. The dendrogram in Figure 5A presents the correlation of the transcriptomes to each other. [score:3]
These results show that miR-27 might act as a negative regulator of pluripotency because all three genes are known regulators of self-renewal in human ES/EC cells, as illustrated in Figure 1C. [score:3]
Transient over -expression of miR-27 in hEC, led to decreased levels of OCT4 mRNA and protein. [score:3]
However, in the case of TGFßR1, we observed a significant reduction of 24% (p = 0.0138) in GFP expression in the presence of miR-27. [score:3]
The fact that miR-27 regulates the SMAD2/3 branch prompted us to search for additional pluripotency -associated genes that might be regulated by miR-27. [score:3]
Furthermore, siRNA -mediated ablation of OCT4 function in the hESC line H1 led to the activation of miR-27 expression and loss of self-renewal and pluripotency. [score:3]
In order to validate these three genes as bona fide miR-27 targets, we generated GFP-sensor constructs bearing parts of the 3′-UTR with the putative miR-27 binding site as previously described. [score:3]
Additionally, we generated two GFP-sensor constructs bearing the whole 3′-UTRs of SOX2 and OCT4, two genes not predicted to be miR-27 targets. [score:3]
These results confirm that miR-27b expression is activated early during hepatic endoderm differentiation of embryonic stem cells. [score:3]
An interesting observation, when screening for miR-27 target sites, was that miR-27 sites are often predicted to be binding sites for miR-128 and vice versa. [score:3]
Our data has led us to hypothesise that miR-27 expression is activated upon the loss of self-renewal. [score:3]
For both constructs, we did not observe any significant changes in GFP -expression between miR-27 and the scrambled negative control (Figure 2B). [score:3]
Lower row: miR-27 expression was carried out for miR-27a and miR-27b using TaqMan -based PCR on total RNA samples from the above described stages, DE and HE and normalized to the untreated/undifferentiated H1 control. [score:3]
As miR-23 is transcribed together with miR-24 and miR-27 in a polycistronic cluster, these results support our observation that expression of miR-27a increases in the hEC line (NCCIT) 7 days post RA treatment (Figure 4A). [score:3]
Validation of miR-27 target genes. [score:3]
0111637.g004 Figure 4(A) Analysis of miR-27 expression was carried out for miR-27a and miR-27b using TaqMan -based PCR on total RNA samples isolated from NCCIT cells undergoing RA stimulated neuronal differentiation for seven days or by blocking TGFßR2 with SB431542 for seven days and normalized to the DMSO -treated control. [score:3]
Taken together, we have been able to confirm that miR-27 targets the 3′-UTRs of SMAD2 and their upstream activators, TGFßR1 and ACVR2A. [score:3]
Additional evidence in support of miR-27 acting as an “off-switch” for self-renewal are as follows; (i) miR-27 moderately inhibits LIN28B by using the eGFP-sensor approach (Figure 2B). [score:3]
Therefore, for miR-27 over -expression studies, we chose the human embryonal carcinoma cell line NCCIT. [score:3]
Another candidate, the orphan nuclear receptor NR5A2, has been predicted to be a target of miR-27. [score:3]
In order to detect and quantify miR-27 expression, we performed RT-PCR on total RNA samples using TaqMan probes detecting miR-27a and miR-27b. [score:3]
miR-27 targets the pluripotency -associated genes NR5A2, POLR3G, LIN28B and NANOG. [score:3]
Moreover, we demonstrate that LIN28 and NANOG as well as POLR3G and NR5A2 are target genes of miR-27. [score:3]
miR-27 expression in hESC line H1 during hepatocyte differentiation. [score:3]
miR-27 activates metastasis in human gastric cancer cells by activating the expression of ZEB1, ZEB2 and VIM thus leading to an induction of epithelial-to-mesenchymal transition [37]. [score:3]
miRNA profiling revealed that the expression level of miR-27 increases in hESC undergoing endoderm priming and hepatocyte differentiation [30]. [score:3]
In order to achieve a more global insight on the function of miR-27 during early development, we transfected hEC line NCCIT with miRNA mimics. [score:2]
In hepatic endoderm cells (HE), 14 days after the initial differentiation, we observed no changes in miR-27a expression compared to the undifferentiated stage but a ∼4-fold increase of mature miR-27b. [score:2]
To summarize, our results imply that (i) miR-27 indirectly promotes Let-7 maturation by modulating LIN28B. [score:2]
Furthermore, miR-27 seems to act as a cell cycle regulator and mediator of cell-cell junctions. [score:2]
Genes that were substantially (DetectionPvalue <0.05/DiffLimmaQvalue <0.01) more than 1.3333-fold increased or less than 0.75-fold decreased after miR-27 over -expression compared to the negative control transfection were further screened for pathway related genes using the DAVID Bioinformatic Tool V6.7 [63]. [score:2]
Schematic overview of our proposed regulatory network between miR-27 and pluripotency -associated genes. [score:2]
Finally, we compared miR-27 expression in hESC 72 h after siRNA mediated knockdown of OCT4 with a TAQman miRNA assay. [score:2]
Using the, we observed more than 2-fold increased expression of miR-27a and a moderate increase of miR-27b in the retinoic acid treatment compared to DMSO -treated NCCIT cells. [score:2]
miR-27 is involved in developmental processes. [score:2]
gr/tarbase/), we found that miR-27 is predicted to regulate two genes, ACVR2 and TGFßR1 which act upstream of the SMAD2/3 signalling cascade. [score:2]
It shows that blocking TGFßR2 with SB431542 or the over -expression of let-7 has the strongest effect at the transcriptome level, compared to the negative control transfection, followed by miR-27 (Figure 5A). [score:2]
The heat map illustrates transcriptional changes 72 h after over -expression of selected miRNAs (let-7, miR-125, miR-27, miR-200) compared to the scrambled negative control of a number of selected genes previously shown to promote either self-renewal (e. g. LIN28, TRIM71, DNMT3A, DNMT3B) or induction of differentiation (e. g. SMAD6, BMP2, FST). [score:2]
As a confirmatory experiment, we transfected HEK293 cells with the GFP-sensor and pdsRED as a control to monitor transfection efficiency, together with miR-27 mimics (Ambion) or a scrambled negative control miRNA mimic. [score:1]
To exclude that miR-27 does not influence the GFP-sensor per se, we performed a co-transfection of the GFP-sensor with miR-27 or the scrambled negative control. [score:1]
miR-27 promotes myogenic differentiation by silencing PAX3 in muscle progenitor cells [34]. [score:1]
In this study, we focus on the somatic-enriched microRNA, miR-27. [score:1]
Our results (Figure 2C and 4A) also demonstrate that miR-27b is activated during endoderm differentiation. [score:1]
Duplicate samples were hybridized for miR-27 and the neg. [score:1]
Next, we examined the influence of miR-27 in hEC. [score:1]
However, both OCT4 and miR-27, operate in a larger differentiation mechanism that involves a negative feedback loop. [score:1]
PCR fragments flanking the predicted miR-27 binding sites were cloned into the 3′-UTR of the modified EGFP-C1 vector. [score:1]
The highest GFP repression was observed for both SMAD2 constructs in the presence of miR-27. [score:1]
In a next step, we wanted to investigate whether miR-27 over -expression promotes differentiation in hESC. [score:1]
This observation inspired us to investigate if NANOG is indeed a target of miR-27. [score:1]
0111637.g005 Figure 5 (A) Hierarchical clustering of NCCIT cells transfected either with miRNAs (miR-27, let-7, miR-125, miR-200 or neg. [score:1]
However, the seed sequence of miR-128 (CACAGUG, nucleotides 2–7) can also be found within the miR-27 sequence (U CACAGUG, nucleotides 3–8). [score:1]
To date, an increasing number of functions of miR-27 have been reported. [score:1]
In vertebrates two paralogs of miR-27, i. e. miR-27a and miR-27b, which only differ by one nucleotide, have been described. [score:1]
Transcriptome analysis of human embryonal carcinoma cells (NCCIT) post transfection with miR-27, let-7, miR-125 or miR-200. [score:1]
To confirm this, we generated a GFP-sensor construct bearing the 3′-UTR of NANOG and performed a co-transfection in HEK293 cells with either a scrambled negative control or miR-27. [score:1]
Here, we report a novel role of miR-27 as a negative modulator of self-renewal and pluripotency. [score:1]
To achieve this, we transfected NCCIT cells with miR-27 and isolated total RNA and protein 48 h post transfection. [score:1]
Interestingly, the seed sequences of miR-128 (CACAGUG) and miR-27 (UCACAGU) overlap but are not identical. [score:1]
[1 to 20 of 125 sentences]
2
[+] score: 307
Furthermore, we confirmed that miR-27b-3p was significantly downregulated in GC and GC cell lines (Fig.   3d and f), notably, by analyzing of their expression levels in GC tissues, the expression level of miR-27b-3p was found to be negatively associated with ROR1 mRNA expression (Fig.   3e). [score:10]
e Western blotting analysis of c-Src/STAT3 signaling pathway related proteins showed upregulation of p-c-Src, p-STAT3, c-Myc and cyclin D1 in miR-27b-3p inhibitor of AGS cell and downregulation of p-c-Src, p-STAT3, c-Myc and cyclin D1 in miR-27b-3p mimics of BGC823 cell, total c-Src and total STAT3 protein level was unchanged To further study the mechanism by which miR-27b-3p mediated ROR1 enhances the growth of GC, the c-Src, p-c-Src, STAT3, p-STAT3, c-Myc and cyclin D1 protein levels were detected by western blotting. [score:9]
Thus, miR-27b-3p additionally suppresses cell proliferation via interactions with other target genes, although miR-27b-3p suppresses cell proliferation and induces G0/G1 cell cycle arrest by mainly targeting ROR1. [score:9]
Cell proliferation, colony formation assay in soft agar in vitro and tumorigenicity in vivo were performed to observe the effects of downregulation and upregulation miR-27b-3p expression on GC cell phenotypes. [score:8]
miR-27b-3p inhibitor was further used in AGS cell, the results showed that miR-27b-3p is downregulated by specific inhibitors, along with cell cycle progression (Fig.   4d). [score:8]
Overexpression of miR-27b-3p significantly reduced the ROR1 level in GC cells, and the inhibitory effects of miR-27b-3p on GC cell proliferation and colony formation were reversed by overexpression of ROR1. [score:7]
These data collectively indicated that miR-27b-3p inhibits cell proliferation and induces cell cycle arrest mainly by targeting ROR1, and that miR-27b-3p may act as a “tumor suppressor” in GC. [score:7]
The data clearly confirmed that ectopic expression of ROR1 partly reversed the suppression of cell proliferation and cell cycle arrest caused by miR-27b-3p overexpression (Fig.   5a, b and c). [score:7]
These results show that miR-27b-3p suppresses ROR1 expression through the binding site in the 3’UTR inhibiting the cell proliferation. [score:7]
These findings indicate that miR-27b-3p exerts tumor-suppressive effects in GC through the suppression of oncogene ROR1 expression and suggest a therapeutic application of miR-27b-3p in GC. [score:7]
Given that miR-27b has been reported to be downregulated and implicated in suppressing invasion, metastasis in gastric cancer [36]. [score:6]
a Western blotting assay was used to analyze the expression levels of ROR1 and miR-27b-3p in AGS and BGC823 cells transfected with miR-NC, miR-27b-3p inhibitor or miR-27b-3p mimics; b Representative profiles of CCK-8 cell growth in AGS cells after transfection with miR-27b-3p inhibitor compared to the miR-NC, transfection with miR-27b-3p mimics inhibited cell proliferation compared with miR-NC used as control. [score:6]
In this study, our data indicate that ROR1 is the main downstream target gene of miR-27b-3p, and that miR-27b-3p can bind to its 3’UTR and subsequently regulate its expression post-transcriptionally. [score:6]
miR-27b-3p mimics and miR-27b-3p inhibitor were packaged in lentiviral vector (Genepharma) to overexpress or knockdown miR-27b-3p in GC cells. [score:6]
d The effects of miR-27b-3p on cell cycle Fig. 5miR-27b-3p inhibits GC progression by mainly downregulating ROR1 in vitro. [score:6]
In conclusion, the present study provides evidence that the dysregulation of ROR1 results from miR-27b-3p downregulation in GC and may promote cancer progression, and the c-Src/STAT3 signaling pathway was involved in miR-27b-3p-ROR1 -mediated cell proliferation regulation (Fig.   7). [score:6]
In contrast, the miR-27b-3p inhibitor upregulated ROR1 protein levels in AGS cell line. [score:6]
miR-27b-3p suppressed cell proliferation and induce cell cycle arrest mainly by targeting ROR1 in vitro. [score:5]
The vector ROR1, which contains only the ROR1 coding sequence, was constructed for ROR1 expression without miR-27b-3p targeting. [score:5]
Taken together, these results indicated that miR-27b-3p might suppress cell proliferation through targeting ROR1. [score:5]
miR-27b-3p suppressed ROR1 expression by binding to the 3’UTR of ROR1 mRNA in GC cells. [score:5]
In the current work, we validated that the 3’UTR of ROR1 contains a highly conserved miR-27b-3p binding motif and its direct interaction with miR-27b-3p downregulated endogenous ROR1 protein level. [score:5]
Re -expression ROR1 upon miR-27b-3p overexpression could partly reverse but not completely prevent the effect of miR-27b-3p. [score:5]
Fig. 7 Schematic miR-27b-3p inhibits GC cell proliferation through ROR1 suppression. [score:5]
The data showed that miR-27b-3p suppresses cell proliferation by inducing G0/G1 phase arrest mainly through targeting ROR1. [score:5]
The levels of p-c-Src, p-STAT3, c-Myc and cyclin D1 were shown to be significantly upregulated in AGS cell line transfected with miR-27b-3p -inhibitor compared with the same cells transfected with the miR-NC, however, no difference in the total c-Src and STAT3 protein levels were observed between the two cell groups. [score:5]
Ectopic miR-27b-3p expression suppressed cell proliferation, colony formation in soft agar, xenograft tumors of GC cells. [score:5]
Our study is the first report showing the role of miRNA-27b-3p in the regulation of ROR1 expression in GC cells. [score:4]
Fig. 3ROR1 is a direct downstream target gene of miR-27b-3p. [score:4]
Therefore, this study demonstrates a novel regulator of ROR1 and enriches our knowledge on the interactions between miR-27b-3p and its targets in GC. [score:4]
Herein, we demonstrated that miR-27b-3p could regulate cell proliferation, colony formation and tumorigenicity by targeting oncogene ROR1 in GC. [score:4]
miR-27b-3p was significantly downregulated and reversely correlated with ROR1 protein levels in clinical samples. [score:4]
f The expression of miR-27b-3p in a panel of tumorigenic GC cell lines To determine the role of the direct interaction between miR-27b-3p and ROR1, western blotting was used. [score:4]
To further illustrate miR-27b-3p that affects cell proliferation by regulating ROR1, we investigated whether ROR1 counteracted the suppression of cell phenotypes caused by miR-27b-3p overexpression in GC cells. [score:4]
The results identifying a new tumor-suppressive miR-27b-3p -mediated pathway in GC and provide new insights into the pathogenesis of gastric oncogenesis and will aid the development of novel therapeutic strategies. [score:4]
ROR1 is a direct downstream target of miR-27b-3p. [score:4]
Furthermore, compelling evidences proved that miR-27b-3p was significantly downregulated and reversely correlated with ROR1 protein levels in clinical samples. [score:4]
Wild-type and mutant ROR1 3’UTR containing putative target sites of miR-27b-3p were cloned into reporter plasmids respectively. [score:3]
As shown in Fig.   4a, miR-27b-3p could inhibit the protein levels of ROR1 in BGC823 cell line. [score:3]
Furthermore, the correlation between ROR1 or miR-27b-3p expression levels and clinicopathological features were assessed. [score:3]
These data indicate that miR-27b-3p mediated differential expression of ROR1consequently resulted in activation of c-Src/STAT3 signaling pathway. [score:3]
When AGS and BGC823 cells grew to 50 % confluence, cells were infected with lentiviral vectors miR-NC, miR-27b-3p mimics or miR-27b-3p inhibitor, respectively, at an appropriate multiplicity of infection. [score:3]
Western blotting showed that ROR1 protein levels were inhibited in miR-27b-3p mimics -transfected cells (Fig.   3b). [score:3]
In addition, flow cytometry indicated similar cell cycle distribution in cells with overexpression of miR-27b-3p through induction of G0/G1 phase arrest. [score:3]
e The scatter plots show the expression levels of miR-27b-3p and ROR1 in GC samples. [score:3]
Herein, our findings conclude that ROR1 could be a new target gene of miR-27b-3p in GC. [score:3]
Although many studies have reported the role of miR-27b in cancer progression, much remains to be illuminated to supplement the network of its interactions, a series of comprehensive research data have identified miR-27b as a tumor suppressor in a series of malignant tumor [36, 39, 40]. [score:3]
The above four groups of cells AGS-NC, AGS-miR-27b-3p inhibitor, BGC823-NC and BGC823-miR-27b-3p mimics were selected with 3.5 lg/ml puromycin (Sigma) for 6 days to build stable cell lines. [score:3]
In addition, the expression level of miR-27b-3p was lower in samples with tumor size larger than 3 cm and stages III/IV. [score:3]
In this study, our data also demonstrated that miR-27b-3p could repress ROR1 protein expression in GC cells. [score:3]
In this study, ROR1 was identified as an important downstream target of miR-27b-3p. [score:3]
miR-27b-3p mediated differential expression of ROR1 affects the c-Src/STAT3 signaling pathway related proteins. [score:3]
d RT- PCR was used to detect the expression levels of miR-27b-3p in GC and non-GC specimens. [score:3]
b Western blotting was used to analyze the expression levels of ROR1 after transfecting with miR-NC or miR-27b-3p mimics. [score:3]
Thereafter, the cells were analyzed using Hairpinit TM miRNAs qRT-PCR Quantitation Kit for miR-27b-3p expression. [score:3]
To determine the effect of overexpression of miR-27b-3p on tumorigenicity in vivo, miR-27b-3p mimics was used to transfect BGC823 cells, then these cells were harvested and injected into the flank of male nude mice. [score:3]
We demonstrated the expression of ROR1 and miR-27b-3p in GC cells, validated the relationship between ROR1 and miR-27b-3p, and explored the role of the miR-27b-3p-ROR1 axis in GC cancers. [score:3]
Furthermore, ROR1 was increased in GC tissues and negatively correlated with the expression of miR-27b-3p. [score:3]
The expression patterns of miR-27b-3p and ROR1 in human gastric cancer (GC) specimens and cell lines were determined by microRNA RT-PCR and western blotting. [score:3]
As expected, miR-27b-3p mimics was able to significantly suppress tumorigenicity, resulting in obvious reductions in tumor weight and volume compared to miR-NC (Fig.   6b, c and d). [score:2]
By contrast, miR-27b-3p knockdown enhanced these malignant behaviors. [score:2]
Furthermore, cell proliferation was measured by the CCK-8 and colony formation in soft agar assay, and miR-27b-3p significantly suppressed cell proliferation in BGC823 cell line, whereas miR-27b-3p inhibitor enhanced cell viability and colony formation (Fig.   4b and c). [score:2]
Our studies further revealed that the c-Src/STAT3 signaling pathway was involved in miR-27b-3p-ROR1 -mediated cell proliferation regulation. [score:2]
Luciferase responsiveness to miR-27b-3p was abrogated because of the mutation of the putative miR-27b-3p binding sites in the 3’UTR of ROR1 (Fig.   3c). [score:2]
Compared with AGS cells transfected with miR-NC, injection of the same cells transfected with miR-27b-3p -inhibitor resulted in larger tumors sizes in male nude mice about 4 weeks after injection (Fig.   6a, c and d). [score:2]
As expected, a reduction in the level of p-c-Src, p-STAT3, c-Myc and cyclin D1 protein in BGC823 was caused by the miR-27b-3p mimics compared with the negative control, likewise, the level of total c-Src and total STAT3 expression were found to be almost unchanged (Fig.   6e). [score:2]
However, limited information is obtainable concerning the clinical potentials and underlying mechanisms of miR-27b-3p in GC thus far. [score:1]
Bioinformatic prediction, luciferase reporter assay, quantitative real-time PCR (qRT-PCR) and western blotting were used to reveal the regulatory relationship between miR-27b-3p and ROR1. [score:1]
miR-27b-3p ROR1 Gastric cancer Cell proliferation c-Src/STAT3 Gastric cancer (GC) is one of the most common solid malignancies and a leading cause of cancer-related death worldwide [1– 6]. [score:1]
The 3’UTR of ROR1 containing the wild or mutated miR-27b-3p binding sequences were synthesized by Genescript (Nanjing, China). [score:1]
Thus, our findings provide new prospects for miR-27b-3p and ROR1 as promising molecular therapies in GC treatment. [score:1]
As shown in Fig.   3a, we found that miR-27b-3p can bind the 3’UTR of ROR1. [score:1]
The snRNA U6 was selected as an endogenous reference to calculate the relative expression levels of miR-27b-3p in every sample using the 2 [-ΔΔCt] method. [score:1]
To the best of our knowledge, limited information is obtainable concerning the clinical potentials and underlying mechanisms of miR-27b-3p in GC thus far. [score:1]
BGC823 cells were cotransfected with miR-27b-3p mimics and either ROR1 or pcDNA3.1B empty vector. [score:1]
All these data indicate that miR-27b-3p mediated ROR1 plays a key role in GC tumorigenesis. [score:1]
The results revealed that the activity of the luciferase reporter gene fused to the ROR1 3’UTR was significantly declined by miR-27b-3p. [score:1]
c Effects of miR-27b-3p on the colony formation of GC cells. [score:1]
Bioinformatic prediction, luciferase reporter assay, qRT-PCR and western blotting were used to reveal the regulatory relationship between miR-27b-3p and ROR1. [score:1]
miR-27b-3p influences tumorigenesis and tumor burden. [score:1]
c Relative ROR1 luciferase activity was analyzed after the wild-type or mutant 3’UTR reporter plasmids co -transfected with miR-NC or miR-27b-3p. [score:1]
a The ROR1 3’UTR regions containing the wild-type or mutant binding site for miR-27b-3p are shown. [score:1]
[1 to 20 of 82 sentences]
3
[+] score: 233
miR-27b targets the 3’-untranslated region (3’-UTR) of PPARγ and inhibits its mRNA and protein expression in neuroblastoma cells [13]. [score:9]
In the current study, we found that ectopic overexpression of miR-27b suppressed TGFβ -induced fibroblast activation, as evidenced by the decreased collagen synthesis, inhibition of α-SMA mRNA and protein expression, and enhanced contractile ability. [score:9]
The overexpression of miR-27b with a lentiviral vector inhibited TGFβ1-stimulated mRNA expression of collagens (COL1A1, COL3A1, and COL4A1) and alpha-smooth muscle actin, and protein expression of Col3A1 and alpha-smooth muscle actin in LL29 human pulmonary fibroblasts. [score:9]
Moreover, the TGFβ1 -induced protein expression of Col3A1 and α-SMA was also inhibited by miR-27b overexpression (Fig.   2c, d). [score:7]
In liver cells, miR-27b regulates PPARα indirectly since overexpression of miR-27 reduced the PPARα protein level, but 3’-UTR luciferase reporter assay did not confirm PPARα as a direct target protein level [12]. [score:7]
The endogenous protein expressions of these targets were reduced in LL29 fibroblasts by miR-27b, which further confirmed that TGFBR1 and SMAD2 are the targets of miR-27b. [score:7]
The mRNA expression of COL1A1, COL3A1, COL4A1 and α-SMA was increased by TGFβ1 treatment, and this increase was suppressed by miR-27b overexpression (Fig.   2b). [score:7]
Additionally, TGFβ inhibited miR-27b expression in lung epithelial A549 cells [14], but increased miR-27a expression in MRC-5 fibroblasts [15]. [score:7]
We found that miR-27b inhibited fibroblast activation, and TGFβ receptor 1 (TGFBR1) and SMAD2 are direct targets of miR-27b. [score:6]
Recently, miR-27b was identified as a major miRNA in modulating TGFβ -induced collagen I expression using a miRNA inhibitor library [14]. [score:5]
It appears that miR-27a-3p and miR-27b have multiple targets and which genes are the main targets may depend on cell types. [score:5]
Our results suggest that miR-27b is an anti-fibrotic microRNA that inhibits fibroblast activation by targeting TGFβ receptor 1 and SMAD2. [score:5]
A recent report shows that miR-27b inhibitor increased TGFβ -induced COL1A1 expression in lung epithelial A549 cells [14]. [score:5]
Indeed, TGFBR1 and SMAD2 were identified as potential targets of miR-27b by TargetScan. [score:5]
The inhibition of miR-27b increased COL1A1 expression. [score:5]
Student t-test To study whether miR-27b affects fibroblasts’ function, we overexpressed miR-27b in LL29 human pulmonary fibroblasts using a lentiviral vector and determined the effect of miR-27b on TGFβ1 -mediated collagen and α-SMA expression by real-time PCR and western blotting. [score:5]
The overexpression or inhibition of miR-27b in HuH7 cells significantly decreased or increased the peroxisome proliferator-activated receptor (PPAR) alpha protein level [12]. [score:5]
Using TargetScan, TGFBR1 and SMAD2 were identified as the potential targets of miR-27b (Fig.   4a). [score:5]
ANOVA, followed by Turkey’s test Because miR-27b inhibits TGFβ1 -induced fibroblast activation, it likely targets the components in the TGFβ signaling pathway. [score:5]
Furthermore, TGFBR1 and SMAD2 protein expression was inhibited by miR-27b in LL29 fibroblasts (Fig.   4c, d). [score:5]
LL29 fibroblasts were infected with a miR-27b lentivirus or virus control (VC) at a MOI of 50. a miR-27b expression and b mRNA expression of COL1A1, COL3A1, COL4A1, and α-SMA were determined by real-time PCR. [score:5]
We found that miR-27b was down-regulated in fibrotic lungs and fibroblasts from an experimental mouse mo del of pulmonary fibrosis. [score:4]
miR-27b is down-regulated in the lungs and fibroblasts from bleomycin -treated mice. [score:4]
miR-27b directly targets TGFBR1 and SMAD2. [score:4]
In the present study, we demonstrated that miR-27b was down-regulated in fibrotic lungs and fibroblasts from bleomycin -induced mouse pulmonary fibrosis mo del. [score:4]
TGFβ receptor 1 and SMAD2 were identified as the targets of miR-27b by 3’-untranslated region luciferase reporter and western blotting assays. [score:4]
To produce lentivirus overexpressing miR-27b, lenti-miR-27b or its control plasmid was transfected to HEK 293 T cells along with Lenti-X HTX Packaging mix (Clontech) by using Lipofectamine 2000. [score:3]
Fig. 4TGFBR1 and SMAD2 are the targets of miR-27b. [score:3]
Bleomycin treatment reduced miR-27b expression in the fibroblasts (Fig.   1), suggesting that fibroblasts are the cells responsible for the reduction of miR-27b in the fibrotic lungs. [score:3]
The expression level of miR-27b in fibroblasts was much higher than alveolar epithelial type I and type II cells (AEC I and AEC II). [score:3]
In lung epithelial A549 cells, miR-27b targets gremlin 1 [14]. [score:3]
Next we constructed 3’-UTR luciferase reporter vectors and performed the dual luciferase assay to validate whether TGFBR1 and SMAD2 are the direct targets of miR-27b. [score:3]
We determined miR-27b expression levels in the fibrotic lungs induced by bleomycin in mice by real-time PCR. [score:3]
HEK 293 T cells were transfected with TGFBR1-UTR or SMAD2-UTR luciferase vector together with the miR-27b expression plasmid or vector control (CON). [score:3]
miR-27b inhibits pulmonary fibroblast activation. [score:3]
miR-27b Fibroblast activation TGFβ Idiopathic pulmonary fibrosis Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and usually fatal disease. [score:3]
For example, antagomir of miR-27b suppressed cell invasion in human breast cancer cell line, MDA-MB-231, whereas pre-miR-27b stimulated invasion in ZR75 breast cancer cells [10]. [score:3]
As shown in Fig.   3, miR-27b inhibited the TGFβ1 -induced contractility of LL29 fibroblasts. [score:3]
ANOVA, followed by Turkey’s test We determined miR-27b expression levels in the fibrotic lungs induced by bleomycin in mice by real-time PCR. [score:3]
The expression levels of miR-27b and mRNA were normalized to U6 and GAPDH, respectively. [score:3]
The expression of miR-27b was determined by real-time PCR and normalized to RNU6 (U6). [score:3]
a The binding sites of miR-27b on the 3’-UTRs of TGFBR1 and SMAD2 as predicted by TargetScan. [score:3]
Data shown are means ± S. E * P < 0.05, ** P < 0.01 n = 4. c, d TGFBR1 and SMAD2 protein levels in miR-27b overexpressing fibroblasts. [score:3]
The overexpression of miR-27b in LL29 fibroblasts were confirmed (Fig.   2a). [score:3]
However, a miR-27b-3p mimic was used for these studies, which may result in overwhelmed expression of miR-27a. [score:3]
As shown in Fig.   4b, miR-27b significantly inhibited the luciferase activities of TGFBR1-UTR and SAMD2-UTR reporters. [score:3]
To sum up, our present studies show that miR-27b plays an important role in the pulmonary fibroblast activation by regulating TGFBR1 and SMAD2. [score:2]
The expression of miR-27b in the lung tissue of bleomycin -treated mice was decreased significantly compared to that of the control mice (Fig.   1). [score:2]
In neuroblastoma cells, PPARγ is a target of miR-27b as determined by 3’-UTR luciferase reporter and endogenous protein assays [13]. [score:2]
The reasons for these differences remain to be determined, but could be due to the differences in transcription because miR-27a-3p and miR-27b are located in different chromosomes, chromosome19 and chromosome 9, respectively. [score:1]
Our results suggest that miR-27b is an anti-fibrotic miRNA in pulmonary fibroblasts. [score:1]
miR-27b has been reported to play a role in breast, liver, kidney or other organs. [score:1]
LL29 fibroblasts were infected with a miR-27b lentivirus or virus control (VC) at a MOI of 50. [score:1]
Fig. 2Effect of miR-27b on fibroblast activation. [score:1]
We suspected that miR-27b may act in a similar mechanism in pulmonary fibrosis. [score:1]
miR-27b or its control plasmid (150 ng) were co -transfected into HEK 293 T cells using Lipofectamine 2000 with TGFBR1-UTR or SMAD2-UTR plasmid (5 ng), which contains a Renilla luciferase gene for normalization. [score:1]
Infection of fibroblasts with a lentiviral miR-27b. [score:1]
These results indicate that miR-27b represses fibroblast activation. [score:1]
LL29 fibroblasts were seeded in 6-well plates at a density of 1–2 × 10 [5] cells per well overnight and infected with miR-27b or its control lentivirus at a MOI of 50 for 48 h. The cells were treated with TGFβ1 (5 ng/ml) for another 48 h. The cells were trypsinized and mixed with rat tail collagen I (BD Bioscience, Cat# 354236) to a final concentration of 1 × 10 [5]cells/ml and 1 mg/ml of collagen 1, followed by the addition of 15 μl 0.5 M NaOH to 1 ml of the cells. [score:1]
miR-27b attenuates the contractile activity in pulmonary fibroblasts. [score:1]
After 24 h, cells were infected with a lentiviral miR-27b or its control at a multiplicity of infection (MOI) of 50. [score:1]
miR-27b also reduced contractile activity of LL29. [score:1]
In this study, we investigated a role of miR-27b in fibroblast activation using a human lung fibroblasts and a lentiviral vector expressing a primary miR-27b, which is converted into a mature miRNA via the endogenous processing system after entering cells. [score:1]
However, there is only one base difference between miR-27a-3p and miR-27b. [score:1]
The dual-luciferase reporter assay confirmed that miR-27b functioned through a direct binding to its 3-’UTR of TGFBR1 and SMAD2. [score:1]
LL29 lung fibroblasts were infected with miR-27b lentivirus or virus control (VC), and then treated with TGFβ1. [score:1]
Fig. 3Effects of miR-27b on contractile activity of lung fibroblasts. [score:1]
miR-27b synergized with anticancer drugs in a defined subgroup of liver and kidney cancer patients [11]. [score:1]
[1 to 20 of 68 sentences]
4
[+] score: 210
Furthermore, inhibition of miR-27b and upregulation of Spry2 could suppress glioma cell invasion, while downregulation of Spry2 reversed the suppressive effect of miR-27b inhibition on glioma cell invasion. [score:15]
In conclusion, the present study suggests that upregulation of miR-27b in glioma may promote glioma cell invasion by inhibiting the expression of its target, Spry2. [score:10]
Additionally, inhibition of Spry2 reversed the suppressive effect of miR-27b downregulation on glioma U251 cell invasion. [score:8]
As shown in Fig. 3B, upregulation of miR-27b significantly inhibited the protein expression of Spry2 in U251 cells. [score:8]
However, the inhibitory effect of miR-27b inhibition on U251 cell invasion was attenuated by siRNA -induced Spry2 downregulation (Fig. 4). [score:8]
It was then demonstrated that the inhibition of miR-27b activation and overexpression of Spry2 significantly suppressed U251 cell invasion (Fig. 4). [score:7]
In addition, miR-27b was shown to regulate the protein expression of Spry2 by directly targeting the 3′UTR of Spry2 mRNA in glioma U251 cells. [score:7]
Wan et al revealed that miR-27b was notably decreased in non-small cell lung cancer (NSCLC) tissues and cell lines, and that overexpression of miR-27b significantly suppressed NSCLC cell proliferation and invasion (15), indicating that miR-27b acts as a tumor suppressor in NSCLC. [score:7]
In addition, the present study identified Spry2 as a direct target of miR-27b, and demonstrated that the protein expression of Spry2 was negatively regulated by miR-27b in glioma U251 cells. [score:7]
Based on these data, it can be suggested that miR-27b may promote glioma cell invasion through direct inhibition of Spry2 expression. [score:6]
Furthermore, by the gain of function assay, it was found that miR-27b inhibition led to a significant inhibition of U251 cell invasion, similar to the effect of Spry2 overexpression. [score:6]
As shown in Fig. 3A, the miR-27b level was significantly upregulated following transfection with miR-27b mimics, while notably reduced subsequent to transfection with the miR-27b inhibitor. [score:6]
Jin et al revealed that miR-27b was highly upregulated in human breast cancer, and that knockdown of miR-27b substantially repressed breast cancer growth (19). [score:5]
The present data suggested that miR-27b may promote the regulation of U251 cell invasion via direct targeting of Spry2. [score:5]
By contrast, inhibition of miR-27b resulted in an increased protein expression of Spry2 in U251 cells. [score:5]
These findings further confirmed that miR-27b plays a role in the regulation of glioma cell invasion through direct targeting of Spry2. [score:5]
To verify this speculation, U251 cells were transfected with the miR-27b inhibitor or Spry2 plasmid, or the cells were co -transfected with the miR-27b inhibitor and Spry2 siRNA. [score:5]
As Spry2 has previously been suggested to be associated with invasive glioma (9) and miR-251 negatively regulated the Spry2 expression in U251 cells, it was speculated that miR-27b may also participate in the regulation of glioma U251 cell invasion. [score:5]
miR-27b has previously been reported to directly target Spry2 in zebrafish (22). [score:4]
The majority of studies have demonstrated that miR-27b plays an inhibitory role in the development and progression of human malignancies, including colon and prostate cancer and neuroblastoma (16– 18). [score:4]
This study found that miR-27b was upregulated in glioma tissues and cells (9), which is consistent with the present findings. [score:4]
Based on these data, it was suggested that miR-27b negatively regulated Spry2 expression at a post-transcriptional level in glioma U251 cells. [score:4]
To explore the regulatory association between miR-27b and Spry2, the protein level of Spry2 was determined in U251 cells transfected with the miR-27b mimics or inhibitor. [score:4]
Spry2 was identified as a direct target of miR-27b in U251 cells. [score:4]
MiR-27b negatively regulated Spry2 expression at a post-transcriptional level in U251 cells. [score:3]
It was found that miR-27b was significantly upregulated in glioma tissues, when compared with normal adjacent tissues (Fig. 1A). [score:3]
The diluted Lipofectamine 2000 was added to the diluted miR-27b inhibitor, Spry2 plasmid or Spry2 siRNA, incubated for 20 min at room temperature and then added to the cell suspension. [score:3]
Therefore, miR-27b may serve as a promising target for the prevention and treatment of glioma invasion. [score:3]
However, the existence of this targeting association between miR-27b and Spry2 has never been reported in humans. [score:3]
Compared with normal human HA astrocytes, the glioma cells demonstrated notable upregulation of miR-27b, particularly in U251 cells (Fig. 1B). [score:3]
The expression level of miR-27b was also determined in three common glioma cell lines, U87, U251 and SHG44, and in the normal human astrocyte HA cell line. [score:3]
U251 cells were transfected with scramble miRNA control (NC), miR-27b mimics or the miR-27b inhibitor. [score:3]
Bioinformatic analysis was performed to predicate the target association between miR-27b and Spry2. [score:3]
Subsequently, the expression level of miR-27b in each group was examined. [score:3]
In the present study, it was found that miR-27b played a promoting role in the regulation of glioma U251 cell invasion, and further molecular mechanism investigation suggested that the promotion of U251 cell invasion by miR-27b occurred partially by direct inhibition of Spry2. [score:3]
MiR-27b was upregulated in glioma tissues and cell lines. [score:3]
Briefly, miR-27b inhibitor, Spry2 plasmid or Spry2 siRNA (all from Niunbio Company, Changsha, China) were diluted (1:50) with serum-free medium. [score:3]
The expression level of miR-27b was determined using RT-qPCR in glioma tissues and their matched normal adjacent tissues. [score:3]
The present data revealed that the luciferase activity was notably reduced only in U251 cells co -transfected with the wild type 3′-UTR of Spry2 and miR-27b mimics, suggesting that miR-27b could directly bind to the 3′UTR of Spry2 mRNA in U251 cells (Fig. 2B). [score:2]
Dysfunction of miR-27b and Spry2 has been found to be involved in the development and progression of glioma (9, 13). [score:2]
The present study aimed to explore the roles of miR-27b and Spry2 in the regulation of glioma cell invasion. [score:2]
In the present study, it was revealed that the expression level of miR-27b was markedly increased in glioma tissues and the U87, U251 and SHG44 glioma cell lines compared with normal brain tissue and astrocytes. [score:2]
MiR-27b promoted U251 cell invasion by targeting Spry2. [score:2]
However, the detailed role of miR-27b in the regulation of invasive glioma remains largely unknown. [score:2]
However, the effect of miR-27b on glioma cell invasion and the involved mechanism remains largely unknown. [score:1]
Chen et al previously suggested that miR-27b acts as an oncogene in glioma. [score:1]
The putative seed sequences for miR-27b in the 3′UTR of Spry2 were evolutionarily conserved. [score:1]
Subsequently, U251 cells were transfected with psiCHECK2-Spry2-3′-UTR or psiCHECK2-mutant Spry2 -3′-UTR vector, with or without miR-27b mimics. [score:1]
However, a few studies have also suggested that miR-27b may act as a tumor promoter. [score:1]
However, to the best of our knowledge, the roles of and association between miR-27b and Spry2 have never been studied in glioma. [score:1]
The U251 cells were transfected with the psiCHECK2-Spry2-3′-UTR or psiCHECK2-mutant Spry2 -3′-UTR vector, with or without 100 nM miR-27b mimics. [score:1]
[1 to 20 of 51 sentences]
5
[+] score: 188
As is shown in Fig.   6D, the mutation of binding sites in 3′UTRs of NR2F2 reversed the downregulation on luciferase activity induced by miR-27b, and abrogated the suppressing effect of miR-27b overexpression. [score:9]
We found NR2F2 with greater than 30% decreased expression upon ectopic miR-27b overexpression in MGC-803 cells and miR-27b inhibitor increased the level of NR2F2 expression (Fig.   6A). [score:9]
Moreover, the miR-27b level was inversely associated with the expression of NR2F2 in gastric cancer tissues, indicating that miR-27b can inhibit gastric cancerous proliferation and metastasis, at least in part, by downregulating the levels of NR2F2. [score:8]
Meanwhile, the miR-27b overexpression inhibited the proliferation and invasion of gastric cancer cells in vitro and suppresses tumor growth and liver metastasis of gastric cancer cells in vivo. [score:7]
Consistent with these phenotypes, then we detected that mRNA levels of MMP2, MMP9, Cyclin D1, c-Myc and the protein levels of c-Myc and Cyclin D1 were downregulated with overexpressed miR-27b (Fig.   3D and 3E). [score:6]
Q-RT detected that the level of miR-27b was significantly down-regulated by about 70% after the transfection with miR-27b inhibitor (Supplementary Figure 2B). [score:6]
These results suggest that miR-27b can suppress the proliferation, migration and invasion of gastric cancer cells and inhibit the growth and metastasis of gastric cancer. [score:5]
The ectopic overexpression of miR-27b in MGC-803 cells dramatically inhibited cell migration (Fig.   3C). [score:5]
NR2F2 directly targeted by miR-27b. [score:4]
In our study, miR-27b was downregulated in gastric cancer tissues, with an inverse correlation with lymph node metastasis. [score:4]
Figure 6 NR2F2 are direct targets of miR-27b. [score:4]
These results prove that the miR-27b level is down-regulated in gastric cancer tissues and gastric cancer cell lines, and is negatively correlated with the metastasis of gastric cancer. [score:4]
MTT assays showed that the ectopic overexpression of miR-27b suppressed the proliferation of MGC-803 cells (Fig.   3A). [score:4]
Moreover, soft agar formation assays revealed that overexpression miR-27b could inhibit the expanding of MGC-803 cellular colonies (Fig.   3B). [score:4]
MiR-27b can inhibit the proliferation and metastasis of gastric cancer cells by suppressing NR2F2. [score:4]
MiR-27b inhibited proliferation, migration, and invasion of gastric cancer cells in vitro and suppressed tumor growth and its metastasis to the liver in vivo. [score:4]
First, we used miR-27b inhibitor to knock down endogenous miR-27b in GES-1 cells. [score:4]
These results indicate that NR2F2 is the direct target of miR-27b in gastric cancer cells. [score:4]
Figure 2 miR-27b is downregulated in human gastric cancer tissues and metastatic gastric cancer cell lines. [score:4]
Cell proliferation, migration and invasion suppressed by miR-27b in gastric cancer. [score:3]
In conclusion, miR-27b is a tumor-suppressing gene in gastric cancer metastasis. [score:3]
To knock down miR-27b in GES-1 cells, miR-27b inhibitor was used GenePharma Colone Primer sequences were as follows: miR-27b Fw-GC TCTAGA TTGCCAGGGATTACCACGCAA; Rv-CG GGATCC CTAGCATTCCCAGCAGGAGACAG NR2F2; 3′UTR Fw-CG ACGCGT AAGAAGGGGGAGTGAAACAGAG; Rv-CCC AAGCTT AGCAAGTTGTTCTGACCGACA. [score:3]
We also observed that miR-27b expression was lower in gastric cancer cell lines MGC-803 than in GES-1 cells (human immortalized gastric epithelial cell line) (Fig.   2D). [score:3]
The miR-27b increased the migration and invasion of GES-1 cells (Fig.   4C) and the mRNA expression of MMP2, MMP9 and CyclinD1, c-Myc. [score:3]
With Targetscan, miRanda, mirwalk, and Pictar databases, we found highly conserved miR-27b binding sites in the 3′UTRs of NR2F2. [score:3]
Suppressive role of miR-27b in gastric cancer. [score:3]
Figure 3 miR-27b inhibits gastric cancer cell growth, migration, and invasion in vitro. [score:3]
Figure 5 miR-27b suppresses tumor growth and liver metastasis of gastric cancer cells in vivo. [score:3]
Figure 4 miR-27b inhibitor promotes gastric cancer cell growth, migration, and invasion in vitro. [score:3]
To determine its exact function, Q-RT was performed to detect the expression level of miR-27b in gastric cancer tissues and cell lines. [score:3]
Luciferase activity assays revealed that miR-27b suppressed the expression of luciferase containing 3′UTRs of NR2F2, compared with controls on 293T cells and MGC-803 cells (Fig.   6C). [score:3]
We further tested the correlation between the level of miR-27b expression and the metastasis of gastric cancer, finding that both were negatively associated (Fig.   2C). [score:3]
In all, this experiment provides evidence that miR-27b is a suppressor gene in gastric cancer proliferation and metastasis. [score:3]
To generate a miR-27b -expressing stable cell line, a lentivirus -mediated packaging system containing four plasmids, pCDH-miR-27b or control plasmid, pMDL, REV, and VSVG, was used. [score:3]
Overexpression of miR-27b reduced the invasiveness of gastric cancer cells. [score:3]
Our study concludes that miR-27b plays a suppressive role in gastric cancer metastasis. [score:3]
Moreover, in patients with gastric cancer, a correlation was clarified between lowered miR-27b expression and increased lymphatic metastasis. [score:3]
Conversely, miR-27b inhibitors significantly enhanced the proliferation and invasion of gastric cancer cell in vitro. [score:3]
The mRNA levels of NR2F2 in GES-1/miR-27b inhibitor and GES-1/ctrl cells were further analyzed by real-time PCR. [score:3]
Gastric tumor growth and metastasis inhibited by miR-27b in vivo. [score:3]
Interestingly, a recent report demonstrates that the lower level of miR-27b expression correlates with gastric cancer proliferation (Tao et al., 2015). [score:3]
Moreover, bioluminescence imaging of mice with a 4-week injection of MGC-803/miR-27b or MGC-803/ctrl cells showed that the metastasis of MGC-803 liver cells was significantly impaired by the ectopic overexpression of miR-27b (Fig.   5B). [score:3]
Of all the patients, 89.47% (17/19) had a lower expression of miR-27b in tumor tissues than that in the adjacent mucosa (Fig.   2B). [score:3]
Next, we explored whether miR-27b inhibitor could augment the proliferation of GES-1 cells. [score:3]
MiR-27b is a strain of intronic miRNA that regulates chondrosarcoma (Huang et al., 2016), cervical carcinogenesis (Yao et al., 2016) and neuroblastom (Lee et al., 2012). [score:2]
As is shown in Fig.   2A, miR-27b expression was significantly decreased in gastric cancer samples compared to matched normal tissues. [score:2]
MiR-27b exhibited a decreased expression level in gastric cancer tissues. [score:2]
We found possible binding sites of miR-27b in 3′UTRs of NR2F2, and obliterated these sites by QuickChange PCR (Zheng et al., 2004). [score:1]
An hsa-miR-27b-containing flank region was amplified from human genomic DNA and inserted into pCDH-CMV-EF1-GFP+puro (System Biosciences). [score:1]
The mechanism that miR-27b participates in gastric cancer proliferation is clear (Tao et al., 2015), but the mechanism in metastasis remains elusive. [score:1]
In this report, we demonstrated that miR-27b took part in the proliferation and metastasis of gastric cancer. [score:1]
Currently, the function of miR-27b in gastric cancer metastasis remains unclear. [score:1]
However, little is known about the function of miR-27b in gastric cancer metastasis. [score:1]
miR-27b NR2F2 gastric cancer tumor metastasis Gastric cancer (GC), the second leading cause of cancer -induced death, has a high incidence in countries like China or Japan (Kang et al., 2014; Yan et al., 2015). [score:1]
Notably, the miR-27b inhibitor dramatically increased the ability of GES-1 cells in colony formation in a serial passage MTT assay and a soft agar assay (Fig.   4A and 4B). [score:1]
[1 to 20 of 55 sentences]
6
[+] score: 165
Importantly, cell lines with higher miR-27b, miR-101, or miR-128 expression tended to have lower VEGF-C expression, while cell lines with lower expression of miR-27b, miR-101 or miR-128 had higher VEGF-C expression. [score:9]
Collectively, these results suggest ectopic expression of miR-27b, miR-101 or miR-128 significantly inhibits migration and invasion activity of gastric cancer cells in vitro, and provide further evidence that metastasis due to VEGF-C is likely due to downregulation of key miRNAs. [score:8]
Collectively, these findings highlight the role of miRNAs in suppressing carcinogenesis, tumor development, and progression and suggest that aberrant overexpression of VEGF-C may be due to the decreased miR-27b, miR-101, or miR-128 expression in gastric cancers. [score:8]
Additionally, miR-27b and miR-128 expression inversely correlated to VEGF-C expression in gastric cancers (Figure 3G2 and 3G4 p = 0.0492, r = −0.2414 or p = 0.0031, r = −0.3900), although there was no statistically significant inverse correlation between miR-101 level and VEGF-C expression (Figure 3G P = 0.3224, r = −0.068). [score:7]
MiR-27b, miR-101, or miR-128 directly down-regulates VEGF-C expression through posttranscriptional repression in gastric cancer cells. [score:7]
As the results showed, miR-101 merely restrained its expression by about 30% via a fine-tuning manner; however, miR-27b or miR-128 has inhibited VEGF-C expression by ∼45% or more respectively. [score:7]
MiR-27b, miR-101, or miR-128 directly down-regulates VEGF-C expression. [score:7]
The luciferase assays showed that miR-27b, miR-101, or miR-128 rather than miR-144 or miR-186 (Figure 3A and 3B) displayed more effectively inhibited luciferase activity with an inhibitory rate of more than 30% in pmiR-VEGF-C and miRNAs co -transfected cells, indicating that miR-27b, miR-101, and miR-128 were candidate miRNAs for VEGF-C. Specifically, miR-27b, miR-101, or miR-128 transfection decreased luciferase expression by 41.65 ± 4.60%, 30.36 ± 15.99%, and 51.20 ± 7.3%, respectively in MKN-45 cells (Figure 3C, p = 0.0020, p = 0.0179, or p = 0.0037). [score:6]
Importantly, we found that miR-27b and miR-128 are significantly down-regulated and inversely correlated with VEGF-C expression in gastric cancer cell lines and tissues. [score:6]
Spearman's correlation was applied for analyzing the association between miR-27b, miR-101, or miR-128 and VEGF-C expression, MVD or LVD, as well as the association between VEGF-C expression and MVD or LVD. [score:5]
Our data showed that miR-27b and miR-101, miR-27b and miR-128, or miR-101 and miR-128 co-transfection led to significant decreases in luciferase activity (miR-27b and miR-101: 42.58% ± 4.83%, p = 0.002; miR27b and miR-128: 45.59% ± 5.99%, p = 0.0027; miR101 and miR-128: 53.39% ± 2.27%, p = 0.0003), decreases of VEGF-C mRNA expression by 70% ± 4.50%, 66.55% ± 5.67%, or 47.18% ± 5.4% (p = 0.0012, p = 0.0017, or p = 0.0058, respectively) and decreases of VEGF-C protein expression by 52.92% ± 33.83%, 34.04% ± 7.59%, or 31.94% ± 6.99% (p = 0.0205, p < 0.0001, or p < 0.0001, respectively) in MKN-45 cells (Figure 3C- 3E). [score:5]
We identified three miRNAs that target and suppress VEGF-C: miR-27b, miR-101, or miR-128. [score:5]
A. and B. However, there was no significant difference in the overall survival and disease-free survival between the miR-27b C. and D., miR-101 E. and F. or miR-128 G. and H. lower and higher expression groups. [score:5]
Collectively, our data suggest VEGF-C is down-regulated by miR-27b, miR-101, or miR-128. [score:4]
Collectively, these data suggest miR-27, miR-101, and miR-128 suppress the migration and proliferation of HUVECs at least in part by down -regulating VEGF-C secretion. [score:4]
Dual-luciferase reporter gene assay showed that miR-27b, miR-101, or miR-128(decreased 38.68% ± 10.86%, 30.36% ± 10.29%, 47.76% ± 13.61%, p = 0.0115, p = 0.0156, or p = 0.0111) respectively, but not miR-144 or miR-186 displayed strong inhibitory effect on the luciferases expression in MKN-45 cells. [score:4]
In addition to reduced VEGF-C expression in gastric cells transfected with miR-27b, miR-101, or miR-128, migration and invasion abilities were also attenuated, indicating that autocrine regulation of gastric cancer cells is critical for tumorigenesis [8]. [score:4]
Compared to human non-tumorous gastric mucosa (n = 5), higher expression of VEGF-C mRNA and protein and decreased expression of miR-27b, miR-101 or miR-128 were detected in 3 gastric cancer cell lines by and RT-qPCR, respectively F.. [score:4]
Ye et al. demonstrated that miR-27b suppressed tumor growth and angiogenesis in colorectal cancer [21]. [score:3]
Inhibition of miR-27b, miR-101, or miR-128 affected VEGF-C secretion was confirmed by ELISA. [score:3]
MiR-27b, miR-101, miR-128 or miR-27b/miR-101, miR-27b/miR-128, miR-101/miR-128 co-transfection could significantly decrease the VEGF-C protein expression in MKN-45 cells E.. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the tube formation of HUVECs. [score:3]
Here we demonstrated that miR-27b, miR-101, and miR-128 inhibited HUVEC migration, proliferation and tube formation by reducing secretion of VEGF-C by gastric cancer cells. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration and proliferation activity in HUVECs. [score:3]
MiR-27b, miR-101, miR-128 or miR-27b/miR-101, miR-27b/miR-128, miR-101/miR-128 co-transfection could significantly reduce the VEGF-C mRNA expression in MKN-45 cells D.. [score:3]
Overexpression of miR-27b, miR-101, or miR-128 abolished the migration, invasion activity of gastric cancer cells and the migration activity of HUVECs in vitro. [score:3]
An inverse correlation was found between miR-27b (G2) and miR-128 (G4) expression and VEGF-C levels in human gastric cancers samples. [score:3]
Expression of VEGF-C and miR-27b, miR-101 or miR-128 and their correlation with patients’ survival in gastric cancers. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration or invasion activity of gastric cancer cells in vitroPrevious studies suggest the VEGF-C/VEGFR-3 axis is critical in enhancing cancer cell migration and invasion and promotes metastasis [13]. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration or invasion activity of gastric cancer cells in vitro. [score:3]
MiR-27b, miR-101, miR-128, miR-27b/miR-101, miR-27b/miR-128 or miR-101/miR-128 co-transfection could significantly suppress the luciferase activity in pmiR-VEGF-C transfected MKN-45 cells C.. [score:3]
Overexpression of miR-27b, miR-101, or miR-128 attenuated proliferation and tube formation of HUVECs. [score:3]
Importantly, VEGF-C expression positively correlated with MVD and LVD (Figure 5A3 and A4 p = 0.0003 or p = 0.0027), and miRNA-27b, miR-101, or miR-128 levels inversely correlated with MVD (Supplementary Figure S7A-C p = 0.0471, p = 0.0442, or p = 0.0018); no correlation between the level of the three miRNAs and LVD was found (Supplementary Figure S7D-F p > 0.05). [score:3]
To determine whether miR-27b, miR-101, or miR-128 inhibits VEGF-C -induced endothelial cell migration, transwell monolayer permeability assays were used to detect the changes in migration activity of HUVECs, which were treated with the culture supernatants of gastric cancer cells transiently transfected with the three miRNAs or a negative control. [score:2]
The efficacy of miR-27b, miR-101, and miR-128 was significant as indicated by reduced VEGF-C protein levels (36.38 ± 27.62%, 40.56 ± 20.50%, or 43.22 ± 22.27% reduction) (Figure 3E, p = 0.0108, p = 0.0026, or p = 0.0036, respectively). [score:1]
Figure 3 through posttranscriptional repression in gastric cancer cellsScheme representation of the potential binding site of miR-27b, miR-101, or miR-128 in the VEGF-C 3′UTR A.. [score:1]
Five tumor-suppressing miRNAs including miR-27b, miR-101, miR-128, miR-144, and miR-186, which have potential binding sites in the 3′-UTR of VEGF-C (Figure 3A and Supplementary Figure S1A), were selected for further investigation. [score:1]
Gastric cancer cells were co -transfected with miR-27b and miR-101, miR-27b and miR-128, or miR-101 and miR-128. [score:1]
Scheme representation of the potential binding site of miR-27b, miR-101, or miR-128 in the VEGF-C 3′UTR A.. [score:1]
VEGF-C levels were significantly reduced by 82.23% ± 2.07%, 81.54% ± 1.76%, or 52.33% ± 1.94% respectively in MKN-45 cells transfected with miR-27b, miR-101, or miR-128 (Figure 5A1 and Supplementary Figure S4B) (all p < 0.05). [score:1]
Other mechanisms underlying the synergistic effect of miR-27b, miR-101 and miR-128 on VEGF-C expression need further investigation in the future. [score:1]
These results suggest that miR-27b, miR-101, or miR-128 attenuates tube formation of HUVECs induced by secreted VEGF-C from gastric cancer cells in vitro. [score:1]
Figure 4Overexpression of miR-27b, miR-101, or miR-128 abolished the migration, invasion activity of gastric cancer cells and the migration activity of HUVECs in vitroIn migration assay, the migration activity of the miRNAs -transfected MKN-45 cells was significantly decreased when compared to the negative control A.. [score:1]
Based on these studies, we investigated whether miR-27b, miR-101, and miR-128 could inhibit migration and invasion. [score:1]
HUVECs cultured with the media supernatant from cancer cells transfected with miR-27b, miR-101, miR-128 mimics, or negative control, were incubated with 50 μM EdU for 4 h. Samples were fixed, permeabilized, and stained for EdU. [score:1]
We evaluated 48 samples of gastric cancer tumors for expression of miR-27b, miR-101, and miR-128. [score:1]
As shown in Figure 4A, miR-27b, miR-101, or miR-128 -transfected cells showed a considerable decrease in migration activity by 64.9% ± 4.27%, 45.16% ± 3.71%, or 46.38% ± 0.56% (p = 0.0001, p < 0.0001, or p = 0.0003, respectively) and a decrease in invasion capacity by 45.83% ± 4.83%, 39.13% ± 9.46% or 63.64% ± 3.49% (Figure 4B p = 0.0004, p = 0.0133, or p = 0.0002, respectively) than that of the negative control group in MKN-45 cells. [score:1]
[1 to 20 of 47 sentences]
7
[+] score: 128
After, 20 miRNAs were significantly upregulated more than two-fold and six miRNAs were significantly downregulated more than two-fold; miR-27b-3p was one of the most downregulated miRNAs after in HESCs from patients with endometriosis. [score:10]
Overexpression of miR-27b promotes hypertrophic cardiomyocyte growth, while its suppression leads to inhibition of hypertrophic cell growth [39]. [score:7]
In addition, Rg3 downregulated miR-27b-3p expression in HESCs. [score:6]
Transfection of the miR-27b-3p inhibitor downregulated markers of fibrosis in HESCs (Fig.   5). [score:6]
The miR-27b-3p expression was significantly downregulated in endometriosis patient’s HESCs after. [score:6]
In this study, we show that miR-27b-3p expression is elevated in the eutopic endometrium of patients with endometriosis, and Rg3E effectively reduces expression of this miRNA in HESCs from patients with endometriosis. [score:5]
Expression of miR-27b-3p was 100- to 200-fold lower after treatment with the hsa-miR-27b-3p inhibitor than that observed after treatment with the hsa-miR -negative control (Supplementary data). [score:5]
Cells were cultured to 70–80% confluence after being seeded onto 6-well plates and were transfected with hsa-mir-27b-3p inhibitor, a chemically synthesized double-stranded RNA that inhibits mature endogenous miRNA, or hsa-mir -negative as a control (Ambion by Life Technologies) with the use of Lipofectamine 2000 (Invitrogen) per the manufacturer’s instructions, at a final concentration of 50 nmol/L. [score:5]
In pulmonary fibrosis, overexpression of miR-27b increased the expression of alpha smooth muscle actin (α-SMA) [41]. [score:5]
Figure 5mRNA concentrations and protein expressions of Col-1, CTGF, Fibronectin, TGF- β1, MMP2 and MMP9 in HESCs from the patients with endometriosis after mir-27b-3p inhibitor transfection. [score:5]
Cells were transfected with miR-27b-3p inhibitor for 48 h, and then subjected to qRT-PCR and western blot analysis to determine the mRNA concentrations and protein expression levels of Col-1, CTGF, Fibronectin, TGF- β1, MMP2 and MMP9. [score:5]
Col-1 mRNA concentration and protein expression significantly decreased after treatment with the miR-27b-3p inhibitor (0.40 fold decrease, P = 0.035), whereas that of CTGF (1.02 fold increase, P = 0.979), fibronectin (0.45 fold decrease, P = 0.063), and TGF- β1 (0.45 fold decrease, P = 0.057) did not significantly change. [score:5]
In the eutopic endometrium of patients with endometriosis, miR-27b-3p expression was approximately two-fold higher than that observed in patients without the disease (fold change 0.28 vs. [score:5]
The transfection experiment was specifically proceeded with miR-27b-3p inhibitor that other fibrosis markers which were not significantly changed may be regulated mainly by other types of miRNAs. [score:4]
Among the endometriosis-affected miRNAs, miR-27b-3p was especially related to the development of fibrosis and inhibition of miR-27b significantly reduced fibrosis. [score:4]
To validate the miRNA microarray results, expression levels of miR-27b-3p were compared between eutopic endometria from patients with endometriosis and those without the disease. [score:4]
More importantly, decreased miR-27b by demonstrates that Rg3 may be effective for reducing the fibrotic nature of the disease. [score:3]
All these studies have shown that miR-27b expression is induced by TGF- β1, which is also related to fibrosis. [score:3]
After, miR-27b-3p expression significantly decreased in HESCs (0.51 fold decrease, P = 0.029) (Fig.   4(b), Table  2); however, similar changes were not observed in Ishikawa cells. [score:3]
miR-27b-3p Inhibitor Transfection and Western Blot. [score:3]
miR-27b expression significantly increased in both the sclerotic intima and serum samples of arteriosclerosis obliterans patients [40]. [score:3]
Figure 3Expressions of miR-27b-3p in eutopic endometrium of the patients with and without endometriosis. [score:3]
MiR-27b-3p is known for its correlation with fibrosis and its downregulation by Rg3E demonstrates the possibility of Rg3E decreasing fibrotic nature of endometriosis. [score:3]
MMP2 and MMP9, markers of invasion, were also affected by transfection of the miR-27b-3p inhibitor. [score:3]
Among the miRNAs examined in this study, miR-27b was particularly highly expressed in the endometrium of patients with endometriosis. [score:3]
Figure 4Expressions of miR-27b-3p in (a) Ishikawa cell lines and (b) HESCs from the patients with endometriosis after. [score:3]
Several previous studies suggest that miR-27b is involved in fibrosis development. [score:2]
The basal miR-27b-3p expression was significantly increased in endometriosis patients compared to control. [score:2]
We showed that Rg3E and miR-27b-3p inhibition effectively reduce endometriosis fibrotic potential using a contraction gel assay and an in vivo mouse mo del. [score:2]
The treatment mechanism involved changes in several miRNAs, including miR-27b-3p. [score:1]
Quantitative real-time PCR for miRNAs was performed using a Taqman [®] Universal Master Mix II, no UNG (Applied Biosystems, Foster City, CA, USA) with sets for miR-27b-3p and U6 snRNA (Applied Biosystems, Foster City, CA, USA). [score:1]
miRNA Profiling after Rg3E Treatment and Validation of miR-27b-3p in Endometriosis. [score:1]
Therefore, increased expression of miR-27b in endometriosis may be related to its fibrotic characteristics. [score:1]
To evaluate transfection efficacy, miR-27b-3p expression was measured 48 h after transfection with an hsa-miR -negative control and hsa-miR-27b-3p inhibitor in HESCs from the endometrium of the patients with endometriosis. [score:1]
[1 to 20 of 34 sentences]
8
[+] score: 118
This suggested to us that aberrant overexpression of CREB1 in gastric cancer may be partially due to the downregulation of miR-27b/miR-200b in gastric cancer, and miR-27b/miR-200b could be potential CREB1 inhibitors to suppress carcinogenesis and tumor progression. [score:10]
We suspect that this may be due to the fact that miR-27b has already strongly inhibited the expression of CREB1 by ~50% or more in gastric cancer cells; therefore, it's hard to see evidently stronger inhibitory effect of miR-27b/miR-200b co-transfection on CREB1 expression. [score:9]
These data suggest that CREB1 is a direct target of miR-27b/miR-200b, and is downregulated by miR-27b/miR-200b. [score:7]
In addition, we identified a regulatory mechanism of CREB1 expression that was inhibited by miR-27b and miR-200b. [score:6]
Furthermore, our data suggest that CREB1 is directly targeted and inhibited by miR-27b and miR-200b. [score:6]
Inhibition of miR-27b and miR-200b on CREB1 expression was also seen in MKN45 cells (Supplementary Figure S3). [score:5]
However, in the present study, we did not observe synergistic action of miR-27b and miR-200b in inhibiting CREB1 expression in gastric cancer. [score:5]
Furthermore, Western blot analysis validated that miR-27b and miR-200b could significantly inhibit the expression of CREB1 protein in SGC7901 cells, with the decrease of 59.20 ± 2.46% and 34.77 ± 8.94% respectively (Figure 4D, 4E, P = 0.0003 and 0.0165). [score:5]
Although miR-27b/miR-200b co-transfection seemed to show more power than miR-200b in suppressing the expression of CREB1, it displayed less activity than miR-27b. [score:5]
CREB1 expression was inhibited by miR-27b and miR-200b. [score:5]
In this study we found that miR-27b and miR-200b inhibited CREB1 expression in gastric cancer. [score:5]
In these previous studies, decreased expression of miR-27b/miR-200b was identified as an unfavorable prognostic factor and miR-27b/miR-200b reduced cellular proliferation, migration and invasion, suggesting potentially tumor-suppressing roles of miR-27b/miR-200b in human cancers. [score:5]
In this study we showed that CREB1 was a target of miR-27b and miR-200b, and inhibited by miR-27b/miR-200b in both mRNA and protein levels. [score:5]
Subsequently, we tested whether miR-27b and miR-200b could synergistically inhibit CREB1 expression in gastric cancer. [score:5]
To test whether miR-27b and miR-200b decreased CREB1 expression at mRNA level, we detected the CREB1 mRNA expression in gastric cancer cells transfected with miR-27b/miR-200b. [score:5]
Therefore we could not conclude that miR-27b and miR-200b have synergistic roles in inhibiting CREB1 expression in gastric cancer. [score:5]
We found that miR-27b and miR-200b could dramatically reduce the CREB1 mRNA expression by 57.81 ± 5.74% and 49.98 ± 9.29% respectively in SGC7901 cells (Figure 4C, P = 0.0025 and 0.0011). [score:3]
D, E. miR-27b, miR-200b, and miR-27b/miR-200b co-transfection led to dramatic reduction of CREB1 protein expression in SGC7901 cells with the decrease of 59.20 ± 2.46%, 34.77 ± 8.94% and 48.76 ± 4.49% respectively (* P < 0.05, ** P < 0.01, *** P < 0.001, N. S. = nonsignificant). [score:3]
B. miR-27b, miR-200b, and miR-27b/miR-200b co-transfection could suppress the luciferase activity in pmirGLO-CREB1 transfected SGC7901 cells by 46.29 ± 8.20% 36.06 ± 3.07%, and 41.14 ± 7.80% respectively (* P < 0.05, ** P < 0.01, *** P < 0.001, N. S. = nonsignificant). [score:3]
We found that miR-27b and miR-200b co-transfection led to significant decrease of luciferase activity (41.14 ± 7.80%), CREB1 mRNA expression (53.92 ± 11.2%) and CREB1 protein level (48.76 ± 4.49%) in SGC7901 cells (Figure 4, P < 0.05). [score:3]
The luciferase assays revealed that miR-27b and miR-200b (Figure 4, Supplementary Figure S3), rather than miR-214, miR-32, and miR-429 (Supplementary Figure S2, P > 0.05) could significantly suppress the luciferase activity in pmirGLO-CREB1 (3′-UTR) and miRNAs co -transfected cells. [score:2]
The gastric cancer cells were co -transfected with miR-27b (15 nM) and miR-200b (15 nM), and subjected to luciferase assay and CREB1 expression detection. [score:2]
C. Compared with negative control, miR-27b, miR-200b, and miR-27b/miR-200b co-transfection could significantly reduced the CREB1 mRNA expression in SGC7901 cells by 57.81 ± 5.74%, 49.98 ± 9.29% and 53.92 ± 11.2% respectively (* P < 0.05, ** P < 0.01, *** P < 0.001, N. S. = nonsignificant). [score:2]
Figure 4 A. Sequence alignment of miR-27b and miR-200b with the 3′-UTR of CREB1. [score:1]
Specifically, miR-27b and miR-200b transfection led to 46.29 ± 8.20% and 36.06 ± 3.07% decrease of luciferase activity in SGC7901 cells respectively (Figure 4A, 4B, P = 0.0016 and 0.0054). [score:1]
A. Sequence alignment of miR-27b and miR-200b with the 3′-UTR of CREB1. [score:1]
Our findings suggest that CREB1, as a valuable biomarker of gastric cancer prognosis, may be a promising approach to gastric cancer treatment through the miR-27b/miR-200b-CREB1 pathway. [score:1]
Based on these data and the previous reports about the candidate miRNAs' function, we chose 5 cancer-related or tumor-suppressing miRNAs, including miR-214, miR-200b, miR-27b, miR-32, and miR-429, for further investigation. [score:1]
MiR-27b and miR-200b have been reported to be downregualted in numerous human tumors, including gastric cancer [30– 33]. [score:1]
However, miR-27b/miR-200b co-transfection did not show stronger ability than miR-27b or miR-200b alone (Figure 4, P > 0.05). [score:1]
[1 to 20 of 30 sentences]
9
[+] score: 116
In contrast, Jin et al showed that the expression of miR-23b and miR-27b was highly upregulated in human breast cancer, and knockdown of these miRNAs substantially repressed breast cancer growth (22). [score:7]
The strategy for selecting miR-23b/27b cluster-regulated pathways is shown in Fig. 3. The TargetScan program showed that 4206 and 4075 genes had putative target sites for miR-23b and miR-27b-, respectively, in their 3′-UTR regions. [score:6]
These results suggested that miR-23b and miR-27b were significantly downregulated in BC and could represent putative tumor suppressors in BC. [score:6]
In the present study, our data demonstrated that miR-23b and miR-27b expression was significantly downregulated in BC clinical specimens. [score:6]
The strategy for selecting miR-23b/27b cluster-regulated pathways is shown in Fig. 3. The TargetScan program showed that 4206 and 4075 genes had putative target sites for miR-23b and miR-27b-, respectively, in their 3′-UTR regions. [score:6]
Our results showed that EGFR was directly regulated by miR-27b and that c-Met was directly regulated by both miR-23b and miR-27b. [score:5]
Moreover, tumor-suppressive miR-23b and miR-27b directly regulated tyrosine kinase receptor genes EGFR and c-Met. [score:5]
miRNA target sequences targeted by miR-23b and miR-27b are summarized in Table II. [score:5]
Putative miR-23b and miR-27b target gene pathway analysis and expression. [score:5]
The data showed that 1827 and 1733 genes were 2.0-fold or more upregulated in BC tissues compared to normal tissues for miR-23b and miR-27b target genes, respectively. [score:5]
EGFR and c-Met were directly targeted by miR-23b and miR-27b. [score:4]
We performed western blot analysis of BOY and T24 cells to investigate whether EGFR, RET and c-Met expression were downregulated by restoration of miR-23b and miR-27b. [score:4]
To obtain putative miR-23b- and miR-27b-regulated genes, we used the TargetScan database (Release 6.2, http://www. [score:4]
Effects of restoring miR-23b and miR-27b expression on cell proliferation, migration and invasion activities in cancer cell lines. [score:3]
RET protein expression was not repressed in either miR-23b or miR-27b transfectants (Fig. 4). [score:3]
We found that restoration of miR-23b or miR-27b mature miRNAs significantly inhibited cancer cell migration and invasion. [score:3]
We used wild-type and mutant vectors encoding either the partial sequence of the 3′-UTRs of EGFR and c-Met, including the predicted miR-23b and miR-27b target sites. [score:3]
Functional analysis demonstrated that restoration of miR-23b and miR-27b in BC cells inhibited cancer cell proliferation, migration and invasion. [score:3]
The expression levels of miR-23b and miR-27b were significantly lower in tumor tissues than in corresponding non-cancerous tissues (both P<0.0001; Fig. 1A). [score:3]
The protein expression level of c-Met was significantly repressed in miR-23b and miR-27b transfectants (Fig. 4). [score:3]
Spearman’s rank test showed a positive correlation between the expression of miR-23b and that of miR-27b (r=0.966 and P<0.0001; Fig. 1B). [score:3]
Expression of EGFR protein was significantly repressed in miR-27b transfectants in comparison with mock or miR-control transfectants (Fig. 4). [score:3]
The TargetScan database predicted that two putative miR-27b binding sites existed in the 3′-UTR of EGFR (positions 200–207 and 430–436; Fig. 5A). [score:3]
EGFR and c-Met were regulated by miR-23b and miR-27b. [score:2]
We performed a luciferase reporter assay in T24 to determine whether EGFR and c-Met had target sites for miR-23b and miR-27b. [score:2]
Moreover, wound healing assays demonstrated significant inhibition of cell migration was observed in BOY and T24 cells transfected with miR-23b and miR-27b (BOY: P<0.0001 and P=0.0001, respectively; T24: both P<0.0001) (Fig. 2B). [score:2]
XTT assays revealed significant inhibition of cell proliferation in BOY and T24 cells transfected with miR-23b and miR-27b in comparison with mock -transfected cells and control transfectants (BOY: P=0.0011 and P<0.0001, respectively; T24: P=0.0035 and P<0.0001, respectively) (Fig. 2A). [score:2]
Therefore, we performed a luciferase reporter assay to determine whether EGFR had target sites for miR-27b. [score:2]
Indeed, the number of invading cells was significantly decreased in BOY and T24 cells transfected with miR-23b and miR-27b (BOY: P<0.0024 and P<0.0001, respectively; T24: P<0.0075 and P<0.0001, respectively) (Fig. 2C). [score:1]
Spearman’s rank test was used to evaluate the correlation between the expressions of miR-23b and miR-27b. [score:1]
With regards to c-Met, the luminescence intensity was significantly reduced by transfection of miR-23b with vectors carrying a portion of the 3′-UTR of c-Met (position 1019–1026: P<0.0001; position 2065–2072: P<0.0001; Fig. 5B) and the luminescence intensity was also reduced by transfection of miR-27b with the vector carrying the 3′-UTR of c-Met (position 1564–1571: P<0.0001; Fig. 5B), whereas transfection with a mutant vector failed to decrease luminescence. [score:1]
Stem-loop RT-PCR for miR-23b (P/N 000400; Applied Biosystems, Foster City, CA, USA) and miR-27b (P/N 000409; Applied Biosystems) were used to quantitate miRNAs according to previously published conditions (11). [score:1]
To examine the functional roles of miR-23b and miR-27b, we performed gain-of-function studies using miRNA transfection into BOY and T24 cells. [score:1]
The database also predicted that two putative miR-23b binding sites and one putative miR-27b binding site existed in the c-Met 3′-UTR (positions 1019–1026, 2065–2072 and 1564–1571, respectively; Fig. 5B). [score:1]
We found that the luminescence intensity was significantly reduced by transfection of miR-27b with the wild-type vector carrying the 3′-UTR of EGFR (position 200–207: P<0.0001; position 430–436: P<0.0001; Fig. 5B), whereas transfection with a mutant vector showed no decrease in luminescence. [score:1]
We evaluated the expression levels of miR-23b and miR-27b in BC tissues (n=58) and normal bladder specimens (n=25). [score:1]
[1 to 20 of 36 sentences]
10
[+] score: 99
Furthermore, FAK inhibitor, LY294002, wortmannin and Akt inhibitor reversed leptin -inhibited miR-27b expression (Fig. 4F), indicating that leptin increases VEGF-C production and lymphangiogenesis by suppressing miR-27b expression via the FAK, PI3K and Akt pathways. [score:13]
In addition, treatment with FAK inhibitor, LY294002, wortmannin and Akt inhibitor diminished leptin-promoted wt-VEGFC-3′UTR luciferase activity (Fig. 4I), suggesting that miR-27b inhibites the protein expression of VEGF-C via integrating to the 3′UTR region of the human VEGF-C gene through FAK, PI3K and Akt pathways. [score:9]
Strikingly, we revealed that miR-27b directly inhibited protein production of VEGF-C through binding to the 3′UTR of the human VEGF-C gene, thereby negatively regulating VEGF-C -upregulated lymphangiogenesis. [score:8]
In summary, we show that leptin increases the expression and secretion of lymphangiogenic factor VEGF-C by down -regulating miR-27b via FAK, PI3K, and Akt pathways in human chondrosarcoma cells (Fig. 6), and thereby promotes lymphangiogenesis in human LECs, indicating that leptin and miR-27b may be the novel molecular targets to restrict VEGF-C -mediated lymphangiogenesis in chondrosarcoma microenvironment. [score:6]
In this study, leptin knockdown significantly reduced the expression of VEGF-C (Fig. 5A,B) and increased miR-27b expression (Fig. 5C). [score:6]
In addition, transfection with miR-27b inhibitor rescued leptin shRNA -inhibited LEC cell migration and tube formation (Fig. 5D,E). [score:5]
JJ012 cells pretreated with indicated pharmacological inhibitors then incubated with leptin were applied to qPCR for miR-27b expression (F). [score:5]
The qPCR analysis of miR-27b expression was performed on StepOnePlus sequence detection system by using the TaqMan MicroRNA Reverse Transcription Kit and was normalized to U6 expression. [score:5]
Leptin promotes VEGF-C production by inhibiting miR-27b expression via the OBRl, FAK, PI3K and Akt pathways. [score:5]
Leptin promotes VEGF-C via downregulation of miR-27b. [score:4]
Current study showed that leptin markedly repressed miR-27b expression in human chondrosarcoma cells in vitro and in vivo. [score:3]
The Trizol, Lipofectamine 2000, MMLV RT kit, miR-27b mimic, miR-27b inhibitor and control miRNA were obtained from Invitrogen (Carlsbad, CA, USA). [score:3]
On the other hand, transfection with miR-27b mimic enhanced miR-27b expression (Supplementary Fig. S2). [score:3]
Exogenous leptin reduced the expression of miR-27b concentration -dependently (Fig. 4A). [score:3]
The expression of VEGF-C and miR-27b in indicated cells were analyzed by qPCR (A, C), western blotting (A) and ELISA (B). [score:3]
How to cite this article: Yang, W. -H. et al. Leptin promotes VEGF-C production and induces lymphangiogenesis by suppressing miR-27b in human chondrosarcoma cells. [score:3]
To explore miR-27b involvement in leptin -induced VEGF-C and lymphangiogenesis, miR-27b mimic was used; transfection with miR-27b mimic diminished leptin -induced VEGF-C expression (Fig. 4B,C). [score:3]
Schematic the target site of miR-27b on VEGF-C 3′UTR (G). [score:3]
JJ0112 cells were stimulated with leptin or pretreated with pharmacological inhibitors for 30 min or pretransfected with siRNA or miR-27b mimic for 24 h. Cells were then incubated with serum-free medium for 2 days. [score:3]
Leptin enhances VEGF-C production and lymphangiogenesis by down -regulating miR-27b. [score:2]
Transfection with miR-27b mimic antagonized leptin -induced VEGF-C production and LECs tube formation. [score:1]
org) revealed that the 3′UTR region of VEGF-C mRNA harbors potential binding sites for miR-27b. [score:1]
Next we study whether miR-27b manages the 3′UTR region of VEGF-C, the wild-type and mutant binding site of VEGFC-3′UTR luciferase plasmids were used (Fig. 4G). [score:1]
Conversely, miR-27b mimic also diminished leptin-promoted LECs migration and tube formation (Fig. 4D,E). [score:1]
[1 to 20 of 24 sentences]
11
[+] score: 93
MiR-27b mimic, miR-142 mimic, miR-206 mimic, miR-21 mimic, miR-130a mimic, mimic negative control, miR-27b inhibitor, miR-142 inhibitor, miR-206 inhibitor, miR-21 inhibitor, miR-130a inhibitor, and inhibitor negative control were obtained from RiboBio (Guangzhou, China). [score:13]
These results suggest that miR-142 could independently inhibit CYP3A4 and CYP3A5 expression and that miR-27b could inhibit CYP3A4 expression (Fig. 5a,b). [score:9]
To validate whether miR-27b, miR-206, miR-21, and miR-130a regulate CYP3A4 and miR-27b and miR-142 regulate CYP3A5 by directly targeting binding sites, wild-type and mutant versions of CYP3A4 3′-UTR and CYP3A5 3′-UTR were constructed and cloned downstream of a luciferase reporter gene. [score:6]
Our results indicated that CYP3A activity could be repressed by miR-27b and miR-206 via translational regulation and by miR-142 through transcriptional inhibition of CYP3A4 and CYP3A5. [score:6]
PPARα was reported to regulate the expression of CYP3A4 36 and was found to be regulated by miR-21, miR-27 and miR-130a 37 38. [score:5]
The expression levels of four related miRNAs, namely, miR-27b, miR-21, miR-130a, and miR-142, were significantly negatively associated with CYP3A4 mRNA expression level. [score:5]
MiR-27b was reported to regulate the transcription of VDR, which regulates CYP3A4 gene expression 20. [score:4]
indicated that miR-27b could repress CYP3A4 gene expression and CYP3A activity through direct binding to the CYP3A4 3′-UTR. [score:4]
These results show that miR-27b and miR-142 do not target the predicted CYP3A5 MRE. [score:3]
The CYP3A5 mRNA level was significantly decreased by mimics of miR-27b, miR-142, miR-206 and miR-21, but increased by inhibitor of miR-142. [score:3]
Interindividual differences in CYP3A activity were affected not only by CYP3A4 gene expression but also by miR-27b and miR-206. [score:3]
These results indicate that miR-27b functionally recognizes CYP3A4 MRE27b to decrease CYP3A4 expression. [score:3]
Specifically, miR-27b, miR103, miR107 were previously reported to play key roles in regulating CYP3A and CYP2C 20 33, while miR-142 and miR-491 were reported to play key roles in regulating phase II enzymes, namely UGT1A1 and UGT1A3 34 35. [score:3]
PXR is a well-known nuclear receptor regulating CYP3A4 and was reported to be regulated by miR-27a, miR-27b and miR-371b 39 40. [score:3]
Our study demonstrated that 35.5% of the interindividual variation in CYP3A activity maybe predicted by CYP3A4 mRNA levels, which are regulated by miR-27b, and miR-206. [score:2]
was significantly decreased by transfection of mimics of miR-27b, miR-206, miR-21, and miR-142 into the human primary hepatocytes, while was significantly increased by inhibitors of miR-27b and miR-206, compared to the control (Fig. 5c). [score:2]
To investigate the effects of miR-27b, miR-206, miR-21, miR-130a and miR-142 on regulation of CYP3A activity, 75 nM mimic or 100 nM inhibitor of miRNA or control was transfected into human primary hepatocytes using Lipofectamine 3000 (Invitrogen Life Technologies, USA). [score:2]
Repressive regulation of CYP3A4 by miR-27b and miR-206. [score:2]
The relative level of CYP3A4 mRNA was significantly decreased by mimics of miR-27b, miR-142, miR-206 and miR-130a, compared with negative controls, while the level of CYP3A4 mRNA was increased by inhibitors of miR-27b and miR-142. [score:2]
showed that luciferase activity of the pRB/CYP3A4 wild-type plasmid was significantly decreased by co-transfection with mimic of miR-27b (54%, p < 0.01), whereas that of the pRB/CYP3A4 MRE-27b-Mut plasmid, which conained a mutant recognition site, was not affected (Fig. 6). [score:1]
MiR-27b, miR-206, and miR-130a were significantly negatively correlated with the formation rates of OAT (r = −0.43, P = 0.001, FDR = 0.013; r = −0.36, P = 0.007, FDR= 0.030; r = −0.36, P = 0.007, FDR = 0.030, respectively). [score:1]
Among the 13 miRNAs studied, miR-27b, miR-206, and miR-21 were significantly negatively correlated with reductions in AT (r = −0.38, P = 0.004, FDR = 0.022; r = −0.42, P = 0.001, FDR = 0.013; r = −0.37, P = 0.005, FDR = 0.022, respectively). [score:1]
Therefore, a total of 13miRNAs, namely miR-21-5p, miR-27a-3p, miR-27b-3p, miR-103a-3p, miR-106a-5p, miR-107, miR-126-5p, miR-130a-3p, miR-142-5p, miR-206, miR-371b-5p, miR-491-3p, and miR-1260b, were selected. [score:1]
Among the 13 miRNAs tested, miR-27b, miR-130a, miR-21, and miR-142 were significantly negatively associated with CYP3A4 mRNA in the human liver. [score:1]
MiR-27b, miR-130a, and miR-27a were also negatively correlated with CYP3A activity in human liver tissues. [score:1]
CYP3A4 mRNA, miR-27b, and miR-206 were independent predictors of CYP3A activity, explaining 35.3% of the variance observed. [score:1]
MiR-27b and miR-206 were also identified to be independent contributors to variability of CYP3A activity in liver tissues. [score:1]
Similarly, the luciferase activities of both the pRB/CYP3A5 wild-type and mutant plasmids were unaffected by miR-27b and miR-142 (Supplementary Fig. S2c,d). [score:1]
MiR-27b represses CYP3A activity by directly binding with CYP3A4 3′-UTR. [score:1]
Human CYP3A4 3′-UTR fragments, the sequence from 1620 to 2792 (~1173 bp) in the human CYP3A4 mRNA (NM_017460.5), containing a putative miR-27b/miR-206/miR-21/miR-130a binding sites or mutated binding sites (reverse binding sites), and human CYP3A5 3′-UTR fragments, the sequence from 552 to 1105(~554 bp) in the human CYP3A5 mRNA (NM_001190484.2), containing a putative miR-27b/miR-142binding sites or mutated binding sites (reverse binding sites), were cloned into the pmiR-RB-REPORT [TM] Vector (Ribobio Co. [score:1]
MiR-27b, miR-206, miR-21, miR-27a, and miR-130a were significantly negatively correlated with the formation rates of PAT (r = −0.46, P = 0.001; FDR= 0.013; r =−0.39, P = 0.003, FDR = 0.013; r = −0.35, P = 0.010, FDR= 0.033; r = −0.33, P = 0.014, FDR = 0.036; r = −0.39, P = 0.003, FDR = 0.013, respectively, Supplementary Table S2). [score:1]
The values of activity and mRNA level were measured 48 h after transfection with mimic or inhibitor for miR-27b. [score:1]
[1 to 20 of 32 sentences]
12
[+] score: 88
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograftTo validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograft To validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
To define the effect of characterized metastamiRs on the putative target proteins, we adopted two approaches: (i) inhibited hsa-miR-1224-3p or hsa-miR-1260 (both significantly upregulated) and (ii) functionally mimicked hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (all significantly downregulated) and examined for the miRNA -dependent modulations in protein targets. [score:11]
In order to validate the miRNA expression obtained from whole genome profiling, expression of selected metastamiRs, including hsa-miR-1224-3p, hsa-miR-1260 (both significantly upregulated), hsa-miR-125b, hsa-miR-27b, hsa-miR-93,and hsa-miR-20a (all significantly downregulated) were confirmed using QPCR. [score:11]
First, MSDACs transiently transfected with mimics for hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (those exhibited complete suppression in aggressive disease) and examined for the regulation of their corresponding target proteins (Fig.   6a). [score:8]
Thus, we validated our microarray results with RT-qPCR for upregulation (Hsa-miR-1260; Hsa-miR-1224-3p) and downregulation (Hsa-miR-20a, Hsa-miR-27b, Hsa-miR-125b, Hsa-miR-93) profiles (see Fig.   3b). [score:7]
miRNA mimic (hsa-miR-125b, hsa-miR-27b, hsa-miR-93, hsa-miR-20a) and inhibitor (hsa-miR-1224-3p, hsa-miR-1260) approach for select miRNAs revealed the direct influence of the altered metastamiRs in the regulation of identified protein targets. [score:7]
Transient transfection of MSDACs with hsa-miR-125b-, hsa-miR-27b-, hsa-miR-93- or hsa-miR-20a- mimics (MISSION® microRNA Mimics, Sigma-Aldrich) as well as hsa-miR-1224-3p- and hsa-miR-1260 -inhibitors (MISSION® Synthetic miRNA Inhibitors, Sigma-Aldrich) were carried out by using either TurboFectin 8.0 reagent (Origene) or Neon electroporation transfection system (Life Technologies). [score:5]
Interestingly, mimicking hsa-miR-27b did not inhibit the expression of EGFR and VEGF in MSDACs. [score:5]
b Histograms of mean cell–Alexa Fluor intensity obtained from Columbus automated batch analysis showing alterations in the expression (i) GRB10, MMP2, p38, STAT3, TNFα and VEGF in cells with hsa-miR-125b mimic, (ii) EGFR FOSB, kRAS, p38, PTPN3 and VEGF in hsa-miR-27b mimic transfected cells, (iii) ASK1, CREB, MMP2, MMP3/10, PTPN3, STAT3and VEGF in MSDACs with hsa-miR-20a mimic and, (iv) MMP2, MMP3/10, PTPN3 and STAT3 with hsa-miR-93 mimic in MSDACs. [score:3]
Similarly, functionally mimicking hsa-miR-27b resulted in the profound (P < 0.001) inhibition of FOSB, kRAS, p38 and PTPN3 (Fig.  6b i i). [score:3]
Compared to the non-metastatic xenograft, we observed a complete (P < 0.001) decrease in the expression of hsa-miR-93, hsa-miR-20a, hsa-miR-125b, and hsa-miR-27b (Fig.   3b). [score:2]
[1 to 20 of 12 sentences]
13
[+] score: 69
Interestingly, Wnt5a can up-regulate miR-27b which miRNA has been reported to bind to the highly conserved binding site in the 3′UTR of PPARgamma [48] and suppress its expression [49]. [score:8]
Binding of miR-27b to its target sequence can suppress PPARgamma expression [49] and augment VEGF-A induced angiogenesis [50]. [score:7]
While canonical Wnts down-regulate PPARgamma directly, non-canonical Wnt5a increases miR27b that is known regulator of PPARgamma. [score:6]
Additionally, miR-27b can also block the Wnt5a target NF-kappaB [64] and the TGF-beta target, Gremlin-1 [65]. [score:5]
Wnt5a induces miR-27b a regulator of both PPARgamma expression and blood vessel branching. [score:4]
In the literature PPARgamma has been described to have a highly conserved binding site in its 3′UTR that is a direct target of miR-27b [48]. [score:4]
Remarkably, rhWnt5a could not up-regulate miR-27b in the presence of a PPARgamma agonist, only if the antagonist was present (Fig.   3e). [score:4]
d, miR-27b is up-regulated by rhWnt5a in 3D lung aggregate cultures, while neither miR-27b nor miR-200b was affected by rhWnt11. [score:4]
Importantly, both miR-27b as well as another miRNA, miR-200b can inhibit blood vessel branching during angiogenesis [51, 52]. [score:3]
One-way ANOVA, post hoc Bonferroni, n = 6. e, VEGF-A and miR-27b expression levels after 10 μM RSG (PPARgamma agonist) and 10 μM GW9662 (PPARgamma antagonist) and combination treatment with rhWnt5a. [score:3]
Karbiener M Fischer C Nowitsch S Opriessnig P Papak C Ailhaud G microRNA miR-27b impairs human adipocyte differentiation and targets PPARgammaBiochem. [score:3]
Interestingly, while rhWnt11 had no effect on either miRNAs (Fig.   3d), miR-27b expression was significantly increased by rhWnt5a treatment (Fig.   3d), while miR-200b levels were unaffected. [score:3]
Inhibitors of branching and tube formation like miR-200b [63] and miR-27b [51] are both increased in SCC compared to AC potentiating differences in the actual blood vessel formation and pattern in tumors of squamous histology. [score:2]
Macrophage pro-angiogenic miRNA, miR-27b, is under NF-kB transcription regulation. [score:2]
As only miR-27b is regulated by Wnt5a, further studies are needed to find the molecules that control miR-200b. [score:2]
As alternative signaling pathways, such as basic fibroblast growth factor (bFGF), platelet derived growth factor (PDGF) as well as miRNAs, especially the pro-angiogenic miR-27b and the miR-200 family [17, 18] also play a significant role in the regulation of angiogenesis; solely blocking VEGF-A simply cannot provide a therapeutic solution in NSCLCs [19]. [score:2]
c, miR-27b and miR-200b expression levels are significantly lower in AC compared to SCC. [score:2]
Graham JR Williams CMM Yang Z MicroRNA-27b targets gremlin 1 to modulate fibrotic responses in pulmonary cellsJ. [score:2]
Thulasingam S Massilamany C Gangaplara A Dai H Yarbaeva S Subramaniam S miR-27b*, an oxidative stress-responsive microRNA modulates nuclear factor-kB pathway in RAW 264.7 cellsMol. [score:1]
PPARgamma, VEGF-A, Wnt5a, miR-27b and miR-200b levels were determined in resected adenocarcinoma and squamous cell carcinoma samples by qRT-PCR and. [score:1]
Finally, it may be possible in the future to use serum levels of Wnt5a, miR-27b, PPARgamma levels and/or activity of the tumor tissue as prognostic markers to identify groups of patients that are at higher risk of developing hemorrhage if treated with anti-angiogenic therapies. [score:1]
[1 to 20 of 21 sentences]
14
[+] score: 57
The heat map diagram (Figure 2(b), Supplementary Table S4) showed hsa-miR-27b-3p, hsv1-miR-H6-5p, and hsa-miR-1265 genes in Cd -induced 35th cells were higher (deeper) than in untreated 16HBE cells, suggesting that these differentially expressed genes in Cd -induced 35th cells were upregulated and this was consistent with the fact that 3 genes out of 8 differentially expressed genes were upregulated by differentially expressed genes analysis (y-axis and x-axis). [score:13]
A significant upregulated expression of has-miR-27b-3p and CCM2 in malignant 16HBE cells (16HBE cells, 35th Cd -induced 16HBE cells, and tumorigenic cells) was found, while has-miR-944 was downregulated in malignant 16HBE cells. [score:9]
133 genes were found as the target genes of hsa-miR-27b-3p and 11 genes were found as the target genes of hsa-miR-877-5p; however 70 genes were found as the target genes of hsa-miR-944. [score:7]
However the target genes of two miRNAs in TargetScan are CCM2, while more than two miRNAs' target genes are CCM2 in the nother two databases, both of them including hsa-miR-27b-3p, hsa-miR-877-5p, and hsa-miR-944 (Supplementary Table S5). [score:7]
hsa-miR-27b-3p, hsv1-miR-H6-5p, and hsa-miR-1265 were upregulated under Cd stress, whereas the other miRNAs were all downregulated. [score:7]
Expression Analysis of has-miR-27b-3p, has-miR-944, and Their Common Target Gene in Cd-Induced 16HBE Cells. [score:5]
CCM2 was the same target gene of hsa-miR-27b-3p and hsa-miR-944. [score:3]
CCM2 is the common target between hsa-miR-27b-3p and hsa-miR-944. [score:3]
Only the two former miRNAs could regulate same genes in mRNA microarray, especially has-miR-27b-3p. [score:2]
According to the combination analysis, three miRNAs were found in the intersection, including hsa-miR-27b-3p, hsa-miR-944, and has-miR-877-5p. [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 57
It is a direct target of miR-10b [63] and miR-128 [49], and is indirectly suppressed by miR-27 [46] and miR-378 [64]. [score:7]
Indeed, in vitro treatment with miR-27 suppressed LPL mRNA and protein expression while inhibition of miR-27 yielded the opposite effect. [score:7]
MiR-27 also suppressed CD36 expression, though interestingly, CD36 does not contain an miR-27 binding site [46] suggesting that this specific regulation might be indirect. [score:7]
Recently, miR-27b and miR-185 were also shown to regulate expression of HMGCoA-R [28, 35], although suppression of HMGCoA-R by miR-27b in vitro did not reach statistical significance (p = 0.06) [28]. [score:6]
In addition to its numerous other target genes, miR-27 also decreased ACAT1 mRNA and protein expression in vitro [46]. [score:5]
Because EL reduces plasma HDL cholesterol, the hypothesis is that miR-27b overexpression should suppress ANGPTL3 and, therefore, EL. [score:5]
In a study published by Vickers et al. [28], miR-27b suppressed miRNA and protein expression of Angiopoietin-like 3 (ANGPTL3) in vitro. [score:5]
However, miR-27 also regulates cholesterol homeostasis by suppressing macrophage cholesterol uptake [46]. [score:4]
Perhaps physiological levels of miR-27b are not high enough to facilitate significant suppression or perhaps there are other components of this pathway that have not yet been identified. [score:3]
Regardless, miR-27 -mediated suppression of LPL and CD36 may reduce macrophage cholesterol uptake and attenuate lesion formation. [score:3]
Conversely, miR-27b may regulate plasma HDL cholesterol. [score:2]
However, in a mo del of elevated miR-27b, ANGPTL was only slightly reduced [28]. [score:1]
MiR-27 was discussed above with regard to its potential ability to regulate HDL catabolism and cholesterol synthesis. [score:1]
Clearly, more research is needed to determine if and how miR-27b impacts plasma HDL. [score:1]
[1 to 20 of 14 sentences]
16
[+] score: 53
The introduction of pre-miR-27b stimulates invasion in breast cancer cells by targeting the ST14 tumor suppressor [27], and is upregulated in glioma cells and tumor tissues [28]. [score:8]
Consistent with the results of the ovarian cell lines, ALDH1 mRNA expression in the chemoresistant group was significantly higher (2.5-fold) than that in the chemosensitive group, and the expression of miR-23b, miR-27b, and miR-424 was significantly upregulated in the chemoresistant group. [score:8]
In the present study, miR-23b, miR-27b, and miR-424 were significantly upregulated in the chemoresistant human cancer group among six miRNAs differentially overexpressed in ALDH1(+) cells. [score:6]
A recent study for miRNAs expression signatures in tumorigenesis [30] indicated that miR-424 was associated with angiogenesis, and that miR-23b and miR-27b were upregulated in metastatic stage. [score:6]
We identified six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, overexpressed in ALDH1 (+) cells, and they were significantly upregulated in chemoresistant ovarian cancer cells (1.4 ~ 3.5-fold) and tumor samples (2.8 ~ 5.5-fold) compared with chemosensitive group. [score:5]
As a result, miR-424 (1.62-fold), miR-346 (3.25-fold), miR-503 (1.66-fold), miR-27a (2.08-fold), miR-23b (1.98-fold), and miR-27b (3.09-fold) were upregulated in ALDH1 (+) cells relative to ALDH1 (−) cells (Figure  4B). [score:4]
Our findings indicate that ALDH1 is a useful marker for enriching ovarian CSCs, and high expression of ALDH1 and its related miRNAs, particularly miR-23b, miR-27b, miR-424, and miR-503, are significantly implicated in chemoresistance and tumor progression in ovarian cancer. [score:3]
We found that six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, were significantly overexpressed in CSC-enriched ALDH1(+) cells using and qRT-PCR. [score:3]
Six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503 were overexpressed in ALDH1(+) cells, and significantly implicated in chemoresistance in ovarian cancers. [score:3]
Among the miRNAs examined, the expression levels of miR-23b (2.8-fold, p = 0.039), miR-27b (3.5-fold, p = 0.007), miR-346 (2.7-fold, p = 0.02), and miR-503 (2.2-fold, p = 0.049) were significantly higher than those in S KOV3 cells (Figure  5A). [score:3]
As a result, six miRNAs were differentially overexpressed more than 1.5-fold in ALDH1 (+) cells compared with that in ALDH1 (−) cells (Table  4, Figure  4A) (miR-424 [1.98-fold], miR-346 [1.95-fold], miR-503 [1.86-fold], miR-27a [1.66-fold], miR-23b [1.53-fold], and miR-27b [1.50-fold]). [score:2]
0.6-fold p = 0.037), miR-27b (5.5-fold vs. [score:1]
Taken together, the oncogenic function of miR-23b, miR-27b, and miR-424 seems to be cell type- and context-specific. [score:1]
[1 to 20 of 13 sentences]
17
[+] score: 53
These tumor suppressors were targeted by multiple upregulated miRNAs (miR-19b-3p, miR-26a-5p, miR-30b-5p, miR-92a-5p and miR-27b-3p) which could account for their aberrant expression in eBL. [score:10]
Based on our results, we hypothesize that low NLK levels in eBL tumors, probably due to miRNA (upregulated miR-92a-3p and miR-27b-3p expression) mediated regulation, would reduce the stability and activation of P53 in suppressing eBL lymphomagenesis. [score:9]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Upregulation of miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) in eBL targeting ATM suggests abnormal miRNA mediate regulation of this gene which would lead to ATM loss. [score:7]
Genomic aberrations such as abnormal upregulation of host miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) targeting ATM would favor proliferation, tumor cell survival and occurrences of mutations that would favor oncogenesis. [score:7]
It is possible that during tumorigenesis a number of GC B cells have low ATM levels due to small interfering RNA -mediated regulation, as a result of irregular expression of miR-27b-3p, miR-26a-5p, miR-30b-5p and myc -dependent activation of miR-17~92 cluster miRNAs. [score:4]
[1 to 20 of 7 sentences]
18
[+] score: 33
Other miRNAs from this paper: hsa-mir-27a
Collectively, these data indicated that two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, were both frequently overexpressed in gastric cancer, while the expression level of miR-27-3p in GC was significantly higher than that of miR-27a-5p. [score:5]
Previous studies have also described aberrant expression of mature miR-27a in gastric cancer [15– 17], however, very little was known about the expression profiles of its two mature isoforms, miR-27a-5p and miR-27-3p, in gastric cancer and the biological effects of these two isoforms on gastric carcinogenesis and cancer progression. [score:5]
The results showed that the expression of miR-27-3p, the major isoform of mature miR-27a, was increased obviously in pEGFP-C1-miR-27a(+) transfection cells while decreased obviously in pEGFP-C1-miR-27a(−) transfection cells (Figure 2A). [score:3]
Herein, the expression level of miR-27-3p in GC was significantly higher than that of miR-27a-5p. [score:3]
In conclusion, we found that two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, were both frequently overexpressed in gastric cancer. [score:3]
In the present study, we found that two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, were both frequently overexpressed in 20 paired clinical GC samples and GC cell lines. [score:3]
In addition, consistent with the results from clinical GC samples, the levels of miR-27a-3p and miR-27a-5p were also found to be markedly up-regulated in GC cell lines (AGS, NCI-N87, BGC-823, HGC-27, SGC-7901 and MGC-803) compared with those of the normal gastric epithelial cells, GES-1, and the levels of miR-27-3p in GC cell lines were significantly higher than those of miR-27a-5p (Figure 1E and 1F). [score:3]
We found both miR-27-3p and miR-27a-5p had significantly increased expression in GC tissues as compared to the corresponding non-tumor samples, and the average fold-changes were greater than 2.0 (Figure 1A–1D). [score:2]
Similarly, we found that the mimic of miR-27-3p, but not miR-27a-5p, markedly increased the proliferation rate of BGC-823, MGC-803 and GES-1 cells (Figure 2H). [score:1]
The miRbase database shows that miR-27a precursor could generate two mature miRNAs, miR-27a-5p and miR-27-3p, and miR-27-3p is the major isoform. [score:1]
However, the expression profiles of two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, in gastric cancer and the biological effects of these two isoforms on gastric carcinogenesis has previously not been investigated. [score:1]
A. Schematic representation of the binding between miR-27-3p and BTG2 with mutated sites labeled with gray shading. [score:1]
In the present study, we examined the expression patterns of two isoforms of mature miR-27a, miR-27a-5p and miR-27-3p, in gastric cancer tissues and cell lines and investigated the biological effects of the major isoform of mature miR-27a, miR-27a-3p, on gastric cancer cell proliferation in vitro and tumor growth in vivo. [score:1]
Figure 3 A. Schematic representation of the binding between miR-27-3p and BTG2 with mutated sites labeled with gray shading. [score:1]
[1 to 20 of 14 sentences]
19
[+] score: 31
Moreover, we tested the target specificity of the 6C-miR-18–11bp probe against a non-specific miRNA background, by incubating the 6C-miR-18–11bp probe with several non-target miRNAs, miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-21 (Figure 6C). [score:5]
This result confirms that the expression level of miR-27b is higher in PANC-1 than in the other two controls. [score:3]
Moreover, all three tested probes are highly competent to detect several target miRNAs such as miR-18a, miR-21 and miR-27b in total RNA samples extracted from human cancer cell lines. [score:3]
A recent study (35, 42) reported that HEK-293T cell lines maintain a substantial expression level of miR-18a whereas miR-21 and miR-27b are almost untraceable, hence we used total RNA from HEK-293T to validate the 6C-miR-18–11bp probe. [score:3]
The 6C-miR-21–10bp probe was incubated with several non-target miRNAs such as miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-18a (Figure 5B). [score:3]
MiR-18a has important roles in controlling gastric cancer growth and angiogenesis (35) and miR-27b is known to regulate numerous types of cancers such as breast and ovarian (36). [score:2]
Interestingly, the spectral parameters for 6C-miR-27b-4bp are close to those found for the first reported DNA/AgNCs probe, DNA-12nt-RED-160, although the sequence and secondary structure are different (see Supplementary Figure S10) (22). [score:1]
1.5 μM of 6C-miR-18a-11bp probe was mixed with 1.5 μM of miR-18a (black bar), miR-21 (red bar), miR-200c (green bar), miR-125c (blue bar), miR-221 (sky blue bar), miR-451 (pink bar) and miR-27b (yellow bar). [score:1]
For similar testing of the 6C-miR-27b-4bp probe, the emission was monitored under the presence of total RNA from PANC-1 cell lines. [score:1]
As shown in Figure 7D-3, miR-27b is detected only in PANC-1 cell lines, validating the functionality of when 6C-miR-27b-4bp probe. [score:1]
These miRNAs can thus be useful biomarkers for cancer diagnosis and therefore, functional DNA/AgNCs probes for miR-18a and miR-27b are attractive objectives. [score:1]
In the case of 6C-miR-27–4bp, we examined the functionality of the probe with the PANC-1 cell line, which originates from non-endocrine pancreatic cancer cells (43). [score:1]
In a similar manner a probe for miR-27b was designed and named 6C-miR-27b-4bp (Supplementary Figures S8, S9 and corresponding description). [score:1]
Based on the coincident patterns between 540 and 560 nm, we carefully speculated that 6C-miR-27b-4bp may embed at a species of AgNCs that is highly similar to one of AgNCs in DNA-12nt-RED-160. [score:1]
1.5 μM 6C-miR-21–10bp probe was mixed with 1.5 μM of miR-21 (black bar), miR-200c (red bar), miR-125c (green bar), miR-221 (blue bar), miR-27b (sky blue bar), miR-451 (pink bar) and miR-18a (yellow bar). [score:1]
Based on the results presented for the fold-back anchored DNA/AgNCs probe for miR-21, we further designed analogous probes for miR-18a and miR-27b. [score:1]
Similarly, we tested 6C-miR-18–11bp and 6C-miR-27b-4bp probes with total RNAs from specific cell lines. [score:1]
The red fluorescence of 6C-miR-27b-4bp probe was diminished 2-fold by adding 5 μg of total RNA from PANC-1, and the fluorescence was maintained or increased when 6C-miR-27b-4bp was mixed with total RNA from two control cell lines, HepG2 and HEK-293T, respectively (Figure 7C). [score:1]
[1 to 20 of 18 sentences]
20
[+] score: 31
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
While let-7i directly regulates the expression of toll-like receptor 4 (TLR4) [16], miR-27b targets KH-type splicing regulatory protein (KSRP) to coordinate TLR4 -mediated epithelial immune responses to pathogens [17], indicating that miRNA may act as a critical regulator in epithelial immune responses. [score:9]
Up-regulation of miR-27b by LPS was found to destabilize proliferator-activated receptor γ1 (PPARγ1) mRNA which is often associated with chronic inflammatory diseases [41]. [score:6]
Recent studies on human epithelial cells infected by a protozoan parasite (Cryptosporidium parvum) revealed the up-regulation of let-7i or miR-27b. [score:4]
The top five highly expressed miRNAs were bta-miR-21-5p, miR-27b, miR-22-3p, miR-184 and let-7f, accounting for 16.02%, 15.18%, 8.37%, 5.45% and 5.01% of total known miRNA reads, respectively. [score:3]
In addition, miR-27b was reported to target KSRP and increase iNOS mRNA stability for host’s defense against cryptosporidial infection [17], further supporting a role for this miRNA in immunity. [score:3]
Therefore, the highly expressed miR-21-5p and miR-27b in mammary epithelial cells in this study might be associated with a function in immunity. [score:3]
It has been recently shown that the level of immune and development related miRNAs, including miR-27b, were significantly higher in colostrum than in mature milk [40]. [score:2]
A total of 231 known bovine miRNAs were identified with more than 10 counts per million in at least one of 13 libraries and 5 miRNAs including bta-miR-21-5p, miR-27b, miR-22-3p, miR-184 and let-7f represented more than 50% of the abundance. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 30
The miRNAs with the most significant differences in expression levels mirrored those observed in the primary group: miR-24, miR-223, miR-27b and miR-199a (Fig.   2). [score:3]
Significant differences in covariate-adjusted expression levels were noted for miR-24 (p = 0.0072), miR-223 (p = 0.0184), miR-27b (p = 0.0107) and miR-199a (p = 0.0435; ESM Fig.   1). [score:3]
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
In conclusion, we have shown that expression of the circulating miRNAs miR-24, miR-223, miR-27b and miR-199a depends on HNF1β function, making them potentially applicable in the diagnosis of HNF1B-MODY. [score:3]
The most striking differences were found between the HNF1B-MODY and HNF1A-MODY groups, evidenced by lower expression levels of miR-223, miR-24, miR-27b and miR-199a in the former. [score:3]
Five of them differed between HNF1A-MODY and HNF1B-MODY, and, amongst those, four (miR-24, miR-27b, miR-223 and miR-199a) showed HNF1B-MODY-specific expression levels in the replication group. [score:3]
Brackets are used to connect the groups with significant (p < 0.05) pairwise differences; [†] p = 0.07; exact p values are shown in ESM Table  4 Afterwards, we measured the impact of siRNA -induced knockdowns of HNF1α and HNF1β on the expression levels of miR-24, miR-223, miR-27b and miR-199a in human hepatocytes (HepG2). [score:2]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
For miR-27b and miR-24, a ChIP signal peak was also located upstream of the miRNA cluster. [score:1]
Silencing of HNF1B in human hepatocytes significantly decreased intracellular levels of miR-24, miR-27b, miR-199a and miR-223. [score:1]
AU, arbitrary units These data suggest that serum levels of miR-24, miR-223, miR-27b and miR-199a associated with HNF1B dysfunction might reflect changes in intracellular miRNA profile in the liver. [score:1]
Fig. 2Comparisons of serum miRNA levels in the UK group: (a) miR-24; (b) miR-223; (c) miR-27b; (d) miR-199a. [score:1]
The silencing of HNF1A significantly decreased levels of miR-24, miR-27b and miR-199a, and had no effect on the miR-223 content in HepG2 cells (Fig.   3d). [score:1]
miR-27b and miR-24 are clustered together. [score:1]
[1 to 20 of 15 sentences]
22
[+] score: 30
Other miRNAs from this paper: mmu-mir-27b
These results are in accordance with a recent report that describes that mir-27b can suppress the directional migration of MSC by downregulating SDF1α expression by binding indirectly to the SDF1α 3′UTR [44]. [score:10]
A recent report describes that mir-27b can suppress the directional migration of MSCs by downregulating SDF1 α expression by binding directly to the SDF1 α 3′UTR [44]. [score:10]
In our conditions, hMSCs might have acquired in vivo a high level CXCR4 expression and migrated in irradiated liver expressing high levels of SDF1 α. A high level of SDF1 α might be related to a low level of mir-27b. [score:5]
We conclude that hMSC engraftment is related to a low level of mir-27b. [score:1]
A high level of SDF1 α might be related to a low level of mir-27b. [score:1]
The level of mir-27b was more elevated in the liver of ungrafted mice in comparison to that of the liver containing hMSCs (P < 0.05). [score:1]
We conclude that hMSCs engraftment is related to a low level of mir-27b. [score:1]
Furthermore, the level of mir-27b is more elevated in the liver of ungrafted mice in comparison with the liver containing hMSCs. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 30
The miRNA target prediction software, TargetScan does predict common targets of and miR-23b and and miR-27b, and there are also reports where both the isoforms (27a & 27b or 23a & 23b) are simultaneously up regulated and down regulated (Table 1). [score:9]
There was no detectable expression of miR-23b, miR-27b and in all 6 cell lines (3D5, Jurkat, K562, CMK, HL-60, U937) but and was detected with similar expression levels in 4 cell lines (3D5, K562, HL-60, U937). [score:5]
regulates fat metabolism and cell proliferationJi et al in 2009 observed that along with miR-27b were up-regulated in activated Hepatic stellate cells (HSCs). [score:5]
Ji et al in 2009 observed that along with miR-27b were up-regulated in activated Hepatic stellate cells (HSCs). [score:4]
They also observed that the fatty acid metabolism and cell proliferation regulating properties of and miR-27b maybe, at least partly mediated by affecting RXRα expression [73]. [score:4]
miR-27a is the microRNA sandwiched between the and-2. Its paralogue, miR-27b originates from miR-23b~27b~24-1 cluster. [score:1]
Mature sequence of and differ by just one nucleotide in comparison to their paralogs miR-23b and miR-27b while the mature sequence of-1 and-2 is same. [score:1]
is the microRNA sandwiched between the and-2. Its paralogue, miR-27b originates from miR-23b~27b~24-1 cluster. [score:1]
[1 to 20 of 8 sentences]
24
[+] score: 29
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
One of the interesting aspects our data analysis (Figure 1) is that Mir27b expression is also present in the developing midface, with its expression mirroring that of Mir23b. [score:5]
mir23b and mir27b are separated by less than 200 bp, though it is not clear that their expression is co-regulated. [score:4]
Cardiomyocyte overexpression of miR-27b induces cardiac hypertrophy and dysfunction in mice. [score:3]
MicroRNA profiling during mouse ventricular maturation: a role for miR-27 modulating Mef2c expression. [score:3]
This is especially true for Mir23b and Mir27b, as while both work concurrently to drive cardiomyocyte development from ES cells in vitro, Mir23b subsequently controls the later beating phenotype of differentiated cells while Mir27b functions to inhibit this event (Chinchilla et al., 2011; Wang et al., 2012). [score:3]
In mouse, Mir23b is part of a miRNA cluster that includes Mir23b, Mir27b, Mir3074.1, and Mir24.1. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 27
MicroRNA miR-27 inhibits adenovirus infection by suppressing the expression of SNAP25 and TXN2. [score:7]
Additionally, host cell miRNAs were described targeting HDFs important for HIV-1 Tat -mediated LTR activation: PCAF (P300/CBP -associated factor), a histone acetylase is target by hsa-miR-20a and hsa-miR-17-5p (Triboulet et al., 2007); purine-rich element binding protein alpha (PUR-α), is targeted by hsa-miR-15a, hsa-miR-15b, hsa-miR-16, hsa-miR-20a, hsa-miR-93, and hsa-miR-106b (Shen et al., 2012); and cyclin T1 is repressed by hsa- miR-198 and hsa-miR-27b (Sung and Rice, 2009; Chiang et al., 2011). [score:7]
The post-transcriptional silencing of both genes by hsa-miR-27, lead to efficient suppression of adenovirus replication by two distinct mechanisms: silencing of SNAP25 interferes with adenovirus entry into target cells, while TXN2 suppression hampers adenovirus replication through a G1 arrest of cell cycle (Machitani et al., 2017). [score:7]
Two cell-encoded miRNAs, hsa-miR-27a and hsa-miR-125b (as well as hsa-miR-27b and hsa-miR-125a, although in less extent), are particularly important to refer in this context given their role as oncogenic or tumor suppressive miRNAs, depending on the tissue type, and their interference with viral replication during infection by other viruses such as HCV, HCMV, and HPV. [score:3]
Not surprisingly, hsa-miR-27 was recently described as a potent adenovirus inhibitor (Machitani et al., 2017). [score:3]
[1 to 20 of 5 sentences]
26
[+] score: 27
Indeed, the Herpesvirus saimiri (HSV)-derived non-coding transcripts called H. saimiri U-rich RNAs (HSURs) were reported to interact with and downregulate the cellular miR-27, thereby altering the expression of its target genes [287]. [score:8]
Interestingly, this upregulation of cyclin T1 was accompanied by a significant downregulation of a group of miRNAs that included miR-27b, miR-29b, miR-150, and miR-223 in activated CD4 [+] T-cells. [score:7]
However, only the miR-27b was shown to directly regulate the cyclin T1 expression, whereas miR-29b, miR-150, and miR-223 were all proposed to indirectly affect the cyclin T1 levels. [score:6]
Libri V. Helwak A. Miesen P. Santhakumar D. Borger J. G. Kudla G. Grey F. Tollervey D. Buck A. H. Murine cytomegalovirus encodes a miR-27 inhibitor disguised as a targetProc. [score:5]
Marcinowski L. Tanguy M. Krmpotic A. Radle B. Lisnic V. J. Tuddenham L. Chane-Woon-Ming B. Ruzsics Z. Erhard F. Benkartek C. Degradation of cellular mir-27 by a novel, highly abundant viral transcript is important for efficient virus replication in vivoPLoS Pathog. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas, these miRNAs were also reported to be downregulated in vitreous [68] and plasma of AMD patients [69]. [score:7]
A recent study also demonstrated that knockdown of miR-27, which downregulates the antiangiogenic factors Sprouty2 and semaphorin 6A (Sema6A), is protective against laser -induced choroidal neovascularization [70]. [score:5]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas. [score:4]
Consistently with the microarray results, miR-205 (p value = 0.001), miR-206 (p value = 0.01) and miR-27 (p value = 0.04) were significantly downregulated in cbs [+/–] compared to control cbs [+/+] (p value < 0.05). [score:3]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
miR-205, miR-27, miR-29 and miR-31 were significantly changed in our cbs [+/–] retina microarray and were also reported to be involved in AMD. [score:1]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
[1 to 20 of 7 sentences]
28
[+] score: 22
Of these differentially expressed miRNAs, miR-27b (downregulated in OA) directly targets MMP-13 expression (Stone et al., 2011); miR-22 (upregulated in OA) directly regulates PPARA and BMP-7 expression in cartilage; miR-9 inhibits MMP13 secretion in isolated human chondrocytes; and miR-146a is highly expressed in early OA cartilage and has been shown to control knee joint homeostasis and OA -associated algesia by balancing inflammatory responses in the cartilage and synovium. [score:22]
[1 to 20 of 1 sentences]
29
[+] score: 21
In fact, miR-101, miR-210, miR-21a, miR-27b, miR-331, miR-339, miR-484 and miR-8106 were downregulated by Sp110, while miR-142, miR-181a, miR-200c, miR-3473b and miR-451a were upregulated by Sp110 (Fig. 5c,). [score:7]
The results confirmed that expression of miR-27b and miR-29a in the RAW-Control induced by H37Ra was downregulated significantly in the H37Ra-infected RAW-Sp110 cells (Fig. 5d). [score:6]
The presence of Sp110 inhibited the induction effects of H37Ra on miR-27b and miR-29a, while enhanced H37Ra induced miR-146a and miR-155 expression. [score:5]
Moreover, Sp110 significantly inhibited the miR-99b-let-7e-125a cluster, miR-152, miR-21a, miR-23a and miR-27b (Fig. 5b,). [score:3]
[1 to 20 of 4 sentences]
30
[+] score: 21
88 genes were identified to be down regulated after pre-miR-1 treatment, 83 were downregulated after pre-miR-206 treatment, and 51 were down regulated after pre-miR-27b treatment. [score:6]
For example, in [26] LNCaP cell lines were treated with pre-miRNA (pre-miR-1, pre-miR206, and pre-miR27b) and downregulated genes were identified using differential gene expression analysis. [score:6]
To demonstrate the applicability and effectiveness of using Lasso regression mo deling to identify miRNAs whose targets are enriched in gene lists, we used affymetrix gene expression data from LNCaP cell lines treated with pre-miR-1, pre-miR-27b and pre-miR-206 that was retrieved from [26] under the access number GSE31620. [score:5]
In the downregulated genes after miR-27b treatment, the mo del showed that miRNA-9 has the highest coefficient and miRNA-27b ranked second. [score:4]
[1 to 20 of 4 sentences]
31
[+] score: 21
Thus while miRNA tailing required only early viral gene expression, a full replication cycle was necessary for efficient reduction of unmodified and modified forms of miR-27b-3p. [score:3]
The rapid VACV -induced reduction of modified and unmodified forms of miR-27b-3p is inhibited by arrest of viral replication. [score:3]
VACV infection caused a striking reduction in the amount of unmodified (22 nt) mature miR-27b-3p at 6 hpi, with barely detectable levels at 24 hpi. [score:1]
The middle row shows northern blot analyses of RNA extracted from HeLa cells under the same conditions as in a, d, g, using probes complementary to (b) miR-16-5p, (e) miR-29a-3p, and (h) miR-27b-3p. [score:1]
The probe was a DNA oligonucleotide perfectly complementary to miR-27b-3p. [score:1]
The bottom row compares the modifications to the miRNA read for (c) miR-16-5p, (f) miR-29a-3p and (i) miR-27b-3p in uninfected and infected cells at 6 and 24 hpi, with and without AraC treatment. [score:1]
The top row shows the relative abundance of unmodified or templated (blue) and modified (red) (a) miR-16-5p, (b) miR-29a-3p, and (c) and miR-27b-3p in uninfected and infected cells at 6 and 24 hpi, with and without AraC treatment. [score:1]
Sequence analysis (Fig 5i) detected the majority of miR-27b-3p modifications as 2–9 nt in length, most likely reflecting the difficulty of long homopolymeric sequencing. [score:1]
To examine further the requirement of a full replication cycle on miR-27b-3p reduction, we examined the levels of this miRNA in HeLa cells infected with Modified Vaccinia virus Ankara (MVA), a replication deficient VACV strain lacking 15% of the parental genome. [score:1]
Polyadenylated miR-27b-3p in virus-infected cells was visible as a dark “smear” on the northern blot with a band at approximately 40 nt (Fig 5h), which would indicate tail lengths of ~ 18 nt. [score:1]
An increase in abundance of a band consistent with pre-miR-27b-3p was identified in response to VACV infection (arrow), similar to miR-29a-3p. [score:1]
Although it is likely that the probe used did not distinguish between miR-27a and miR-27b (which differ by only 1 nt) we refer here to miR-27b as this is 16 fold more abundant in Hela cells according to our sequencing analysis (S6 Table) and both family members showed the same pattern of modification and reduction upon infection (S5 Table). [score:1]
Most strikingly, treatment of VACV-infected cells with AraC had a dramatic effect on both unmodified and modified miR-27b-3p at 6 and 24 hpi, rescuing both forms in infected cells. [score:1]
0131787.g005 Fig 5 The top row shows the relative abundance of unmodified or templated (blue) and modified (red) (a) miR-16-5p, (b) miR-29a-3p, and (c) and miR-27b-3p in uninfected and infected cells at 6 and 24 hpi, with and without AraC treatment. [score:1]
Specifically, AraC treatment partially rescued the levels of modified and unmodified forms of miR-27b-3p (Fig 5). [score:1]
To visualize the polyadenylation of miRNAs we used northern blotting to examine three highly abundant miRNAs (miR-16-5p, miR-29a-3p and miR-27b-3p) that displayed varying responses to VACV infection. [score:1]
Interruption of VACV replication after early viral transcription does not impact tailing but arrests the reduction of modified and unmodified miR-27b-3p. [score:1]
[1 to 20 of 17 sentences]
32
[+] score: 19
For example using a steatotic L02 cell mo del, Zheng et al. [24] demonstrated that mir-10b was up-regulated, and mir-27b was down-regulated in non-alcoholic fatty liver disease (NAFLD). [score:9]
Additionally, up regulation of miR-10b and down-regulation of miR-27b has been observed in oesophageal cancer [26]. [score:5]
Normalizing the data to a combination of mir-152 and mir-23b however, identified only mir-10a as being highly associated with mir-10b while mir-27b was additionally identified as being negatively correlated to mir-10b. [score:1]
At the same time, normalizing to a combination of mir-152 and mir-23b also allowed us to identify a negative relationship between mir-10b and mir-27b. [score:1]
An analysis of the best ranking candidates (RNU6B, mir-10a, mir-23b, mir-27b, mir-128a, and mir-152) using GeNormplus identified mir-23b as the most stable gene, followed by mir-152, mir-27b and mir-10a respectively (Figure  3A). [score:1]
Although we do not know the biological relevance of this association, especially in context to hepatic compartment, inverse relationships of mir-10b and mir-27b have been previously observed in other studies too [24, 25]. [score:1]
This resulted in inclusion of mir-10a, mir-23b, mir-27b, and exclusion of mir-10b, mir-148a, mir-23a and mir-27a from further analysis. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 18
The expression of miR-27 is upregulated by VEGF in breast CSCs and promotes angiogenesis and metastasis [43]. [score:6]
Furthermore, miR-27 targets ectonucleotide pyrophosphatase/phosphodiesterase family member 1 (ENPP1) and regulates the tumorigenicity and drug resistance of breast cancer cells [42]. [score:4]
For example, miRNAs, such as miR-135, miR-27, mir-155, miR-129, miR-106b, let-7, miR-125, miR-663, and miR-142, target APC and activate canonical Wnt signaling [100, 138, 139, 140, 141, 142, 143, 144, 145, 146]. [score:3]
In addition, other miRNAs, including let-7, miR-1 and miR-27, are among the miRNAs that are differentially expressed between breast CSCs and non-tumorigenic cancer cells ([24, 40, 41, 42, 43], for review [8, 44, 45]). [score:3]
Takahashi R. U. Miyazaki H. Takeshita F. Yamamoto Y. Minoura K. Ono M. Kodaira M. Tamura K. Mori M. Ochiya T. Loss of microRNA-27b contributes to breast cancer stem cell generation by activating ENPP1 Nat. [score:1]
Wang T. Xu Z. miR-27 promotes osteoblast differentiation by modulating Wnt signaling Biochem. [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 17
Kida et al. [45] found that the PPARα protein level in the human hepatocellular carcinoma cell line HuH7 significantly decreases when the levels of miR-21 or miR-27b are over-expressed and inhibited, respectively. [score:5]
Has-miR-26a and has-miR-27b were both found in ovarian tumor cells and their corresponding exosomes; however, their expression levels significantly differ between the two samples [34]. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Kida K. Nakajjima M. Mohri T. Oda Y. Takagi S. Fukam T. Yokoi T. PPARα is regulated by miR-21 and miR-27b in human liver Pharm. [score:2]
In the present study, has-miR-21, has-let-7 family, miR-26a and miR-27b were abundant in EC9706 cells and their corresponding exosomes. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 17
Subsequent analysis demonstrates FZD7 to be negatively regulated by miRNA-27b, which when overexpressed is sufficient to inhibit the expression of FZD7 and reduce gastric cancer cell proliferation. [score:8]
Likewise, targeted knockdown (siRNA) of FZD7 in H. pylori -induced gastric cancer cells effectively phenocopies the effect of miRNA-27b overexpression [187]. [score:6]
Geng Y. Lu X. Wu X. Xue L. Wang X. Xu J. MicroRNA-27b suppresses Helicobacter pylori -induced gastric tumorigenesis through negatively regulating Frizzled7 Oncol Rep. [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 17
miR-27a and miR-27b seem to be among the main studied miRNAs involved in OA; recent evidence has been reported that their lower expression in OA cartilage in comparison to normal cartilage was accompanied bydysregulation of both MMP-13 and insulin-like growth factor binding protein (IGFBP)-5 expression levels [17, 18]. [score:6]
In addition, Akhtar et al. demonstrated an inverse correlation between expression levels of miR-27b and its target gene MMP-13 in an in vitro study of human OA chondrocytes [18]. [score:5]
Akhtar N. Rasheed Z. Ramamurthy S. Anbazhagan A. N. Voss F. R. Haqqi T. M. MicroRNA-27b regulates the expression of matrix metalloproteinase 13 in human osteoarthritis chondrocytes Arthritis Rheum. [score:3]
Concerning miR-27b and miR-146b, no significant differences between OA and normal cells were detected (Figure 1A). [score:1]
There is no evidence about the possible effects of mechanical loading on modification of miR-27 a/b. [score:1]
The same results were obtained analyzing miR-27b levels, except for T48. [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
These indicated that miR-21, miR-30, and miR-27 and their target lncRNAs may play an important role in the androgen deficiency-related fat deposition, as it is wi dely known that miR-30a targets the androgen receptor (AR) gene [22]. [score:5]
Five depressing-adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326) target 217 lncRNAs. [score:3]
Our results were consisted with these reports, it was predicted that there were lncRNAs were the target genes for miR-21, miR-30, and miR-27. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 16
miR-24 remained significantly downregulated at three time points (days 7, 14 and 28; Fig. 1d), while miR-23b and miR-27b were downregulated only at day 7, supporting independent release of individual miRNAs from the cluster-transcript. [score:7]
miR-27b was also downregulated in AAA (Fig. 6c). [score:4]
It also causes a transient minor increase in miR-27b expression (Supplementary Fig. 7B). [score:3]
Pri-miR-23b, -27b and -24-1 may be transcribed independently from the cluster gene in mice, although pre-miR-23b may be co-transcribed with pre-miR-27b and pre-miR-24-1 (ref. [score:1]
One is intronic (mouse-chr13; human-chr9: miR-23b, miR-27b and miR-24-1) and the second is intergenic (mouse-chr8; human-chr19: miR-23a, miR-27a and miR-24-2) 12. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 15
Statistical significance of the qRT-PCR data was obtained for ten of these 17 miRNAs: downregulation of miR-17–5p, miR-186–5p, miR-378a-3p, miR-378f, miR-629–5p and miR-7–5p and upregulation of miR-143–3p, miR-23a-3p, miR-23b-3p and miR-27b-3p, upon E6/E7 silencing (Fig. 2E and indicated in bold in S2 Table). [score:7]
Moreover, two seed families, the miR-23 family (miR-23a-3p, miR-23b-3p) and miR-27 family (miR-27a-3p, miR-27b-3p), were upregulated. [score:4]
On the other hand, continuous E6/E7 expression is linked to a decrease of the intracellular concentrations of miR-23a-3p, miR-23b-3p, miR-27b-3p, and miR-143–3p. [score:3]
miR-23b and miR-27b belong to the miR-23b-27b-24–1 cluster and both exhibit anti-tumorigenic activities [95, 96]. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 15
They have postulated that rs10719T to C transition leads to weaker at the miR-27b target site and consequently to increased Drosha expression. [score:5]
yes Han Chinese[57] bladder cancer miR-27b DROSHA rs10719 T>C (C impairs binding site) in vitro: reporter gene assay in T24 and J82 cells (with miR mimic, stable negative control, miR inhibitor or inhibitor negative control), In vivo: analysis of total RNA in 61 bladder tumour tissues with different genotypes (32 for TT, 24 for TC, and 5 for CC). [score:4]
Yuan et al. [58] reported that DROSHA's 3′-UTR contains a target site for miR-27b, while rs10719 (T>C) is located in close proximity to this site (46 bp downstream of the miR-27b binding site). [score:3]
7263) 58 Yuan L et al. 2013 Genetic variation in DROSHA 3'UTR regulated by hsa-miR-27b is associated with bladder cancer risk. [score:2]
DROSHA | miR-27b. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 15
Moreover, miR-27a/b, a potential regulator of myogenesis, could induce skeletal muscle hypertrophy by down -regulating myostatin, an inhibitor of myogenesis (Huang et al., 2012; Sharma et al., 2014) and miR-27b inhibition leads to more proliferation and delays the onset of differentiation (Crist et al., 2009). [score:7]
miR-27b showed increasing expression levels during development, and miR-1 showed the opposite trend. [score:4]
Therefore, miR-27b promotes myogenesis and proliferation, whereas miR-1 inhibits these processes and induces apoptosis. [score:3]
Of these miRNAs, six (miR-133a-1/-2-3p, let-7a-1/-2-5p, miR-27b-3p, miR-26a-5p, miR-1-3p, and let-7f-1/-2-5p) were shared by all five stages and were closely related to myogenesis, cell growth, myocyte proliferation, and cell apoptosis. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 15
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
[1 to 20 of 2 sentences]
43
[+] score: 15
In general, this approach of direct delivery should be implemented for those miRNAs that are downregulated during TB infection, including miR-155, miR-146a, miR-145, miR-222 [∗], miR-27a, or miR-27b (Spizzo et al., 2010; Belver et al., 2011; McGregor and Choi, 2011; Graff et al., 2012). [score:5]
Furci et al. (2013) studied Mtb -induced miRNA expression profile in primary human macrophages infected with virulent Mtb H37Rv and avirulent M. bovis BCG and showed that macrophages differentially expressed miRNAs, including miR-155, miR-146a, miR-145, miR-222 [∗], miR-27a, and miR-27b. [score:5]
In this study, miR-222 [∗], miR-27a, and miR-27b, which have been reported to control inflammatory response and lipid metabolism (McGregor and Choi, 2011; Graff et al., 2012) were significantly downregulated. [score:4]
Among the candidates for this approach we can cite miR-155, miR-146a, miR-145, miR-99b, miR-19b-2 [∗], miR-27a, or miR-27b. [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 14
The miR expression profile of E. granulosus was studied for its different developmental stages and the protoscolex and cyst wall both showed the expression of miR-2, miR-9, miR-10, miR-27, let-7, and miR-71 except for miR-125 which was present only on protoscolex (Cucher et al., 2011). [score:6]
Apart from this, they also found striking similarities between fhe-mir-2b-A and fhe-mir-2a-B and the two mir-27 orthologs, bta-mir-27a and bta-mir-27b, these two are known to target the 3′ un-translated region (UTR) of myostatin and insulin growth factor (IGF) in cattle and human (Miretti et al., 2013). [score:5]
Functional effect of mir-27b on myostatin expression: a relationship in piedmontese cattle with double-muscled phenotype. [score:3]
[1 to 20 of 3 sentences]
45
[+] score: 14
Interestingly, according to the miRNA target finding algorithm TargetScan the 3’UTR of leptin harbors putative miRNA binding sites for miR-9, miR-490, miR-29 family, miR-27 family and miR-128 [44]. [score:5]
Another family member, miR-27b is also downregulated during adipocyte differentiation. [score:4]
These studies suggest the miR-27 family could be a useful anti-adipogenic target. [score:3]
Adipocytes adipogenesis biomarkers microRNAs miR-27 miR-519d obesity. [score:1]
However, transfection of miR-27b two days after adipogenic stimulation was not sufficient to repress PPARγ protein in 3T3-L1 adipocytes [68]. [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 14
In summary, the cell-cycle-regulatory genes CDK2, CDK4, CyclinD1 and CyclinE1 were targeted by mir124, CDK2 and CyclinD1 were targeted by mir182 and mir27b, CyclinD1 was targeted by mirlet7b, P27 was targeted by mir221 and mir181a. [score:10]
Among these fourteen candidates, six miRNAs (hsa-mir-124-3p, hsa-mir-182-5p, hsa-mir-27b-3p, hsa-mir-let7b-5p, hsa-mir-221-3p and hsa-mir-181a-3p), which might target cell-cycle-regulatory genes according to bioinformatic algorithms, were selected for further study. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 13
hMSC were transfected with Inhibitor Control molecule 1 (IC1, 25 nM) or with a combination of inhibitors for miR-27 and -489 (i27a+i489, 12.5 nM each). [score:5]
Human miR-27a and -27b differ by a single nucleotide at position 19. miR-148a and -148b differ by two nucleotides at positions 7 and 8. We found that the miR-27b inhibitor induces a relatively small increase in AP activity in hMSC. [score:3]
HT1080 cells were transfected with Mimic Control molecule 1 (mc1, 12.5 nM) or with a combination of inhibitors for miR-27 and -489 (i27a+i489, 6.25 nM each) and with 3′UTR reporter constructs as imdicated. [score:3]
The miR-27 family is represented by two members, miR-27a and -27b. [score:1]
Based on these results both miR-27b and miR-148a were excluded from further study. [score:1]
[1 to 20 of 5 sentences]
48
[+] score: 13
miR-27b is involved in the regulation of transcription by inhibiting the expression of various transcription factors [13, 67- 70]. [score:6]
Here we confirm the role of miR-27b as an important transcriptional regulator, in addition, our predictions suggest that might be involved in the regulation of intracellular transport, apoptosis, kinase activity, protein complex assembly, cytoskeleton organization and other biological functions including DNA damage response, cell cycle, motility, nucleotide biosynthesis and protein phosphorylation (Figure  5, Additional file 9). [score:3]
[26]↑ pMyo diff [33]↑ muscle development [31]↓ muscle development [32]10 miR-27b↑(this study)↑ pMyo [13, 33] ↑ C2C12 diff [28, 33]  11 miR-28 (n)↑(this study)-  12 miR-29a↓(this study)↓ C2C12 diff [28] ↑ C2C12 diff [33]  13 miR-30a-5p↑↑(this study)↑ C2C12 diff [28, 33]  14miR-30a-3p↑(this study)↑ C2C12 diff [33]  15↑↑pMyo diff. [score:3]
These include [11], [12], miR-27b [13], miR-29b/c [14], miR-143 [15], miR-181 [16], miR-208b/499 [17],4 [18], miR-322/424 and miR-503 [19], miR-486 [20], miR-682 [21]. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 13
Figure S2 Expression levels of miR-27b, miR-151 and miR-152 in human circulating monocytes from postmenopausal women with low and high BMD as shown by qRT-PCR. [score:3]
Specifically, the expression levels of the four miRNAs between the low and high BMD groups as mean ± SD in the array analyses are miR-27b (2.48±2.05 vs. [score:3]
Figure S1 Expression levels of miR-27b, miR-151 and miR-152 in human circulating monocytes from postmenopausal women with low and high BMD as shown by miRNA array. [score:3]
In this study, we further selected four marginal differentially expressed miRNAs in the array study [23] for qRT-PCR validations, which are miR-27b, miR-422a, miR-151, and miR-152. [score:3]
the high BMD group of miR-27b (1.26±0.66 vs. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 13
Figure 4 A. Histograms of individual miRNA QPCR analysis showing circulating levels of randomly selected miRNAs (miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93) in the serum of animals with non-metastatic primary disease or with high-risk metastatic disease. [score:5]
Compared with the non-metastatic favorable disease animals, we observed marginal variations in the expression of miR-20a, miR-27b, miR-93, miR-1260, and miR-1224 (Figure 4A). [score:4]
For the present study, we used QPCR to confirm expression of selected miRNAs, including hsa-miR-1224-3p, hsa-miR-1260, hsa-miR-27b, hsa-miR-93, and hsa-miR-20a. [score:3]
B. Correlation analysis of the serum-circulating profiles of miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93 observed using the miRnome approach. [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 13
The results consistent with the HLECs lymphatic tube formation and cell migration SMAD4 is a target of miR27 in HLECsTo identify possible miR-27a targets in lymphangiogenesis, we conducted microRNA target prediction with wi dely used tools, including DIANA, TargetScan, and PITA. [score:9]
SMAD4 is a target of miR27 in HLECs. [score:3]
Our results and others suggested pro-tumor function of miR-27 and anti-tumor function of SMAD4 in colon cancer. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Clusters mir-16-1-mir-15a, let-7f-let-7a-1, mir-181a-1-mir-181b-1, let-7j-let-7k, mir-23b-mir-27b-mir-24, and mir-16-2-mir-15b were down-regulated in lungs and mir-181a-1-mir-181b-1 was also down-regulated in tracheae with AIV infection. [score:7]
The miRNAs from five of these clusters (mir-16-1-mir-15a, mir-16-2-mir-15b, let-7f-let-7a-1, let-7j-let-7k and mir-23b-mir-27b-mir-24) identified in both lungs and tracheae were significantly down-regulated in infected lungs compared to non-infected lungs and also had higher expression levels in non-infected lungs than non-infected tracheae. [score:5]
[1 to 20 of 2 sentences]
53
[+] score: 12
Interestingly, some miRNAs which were upregulated in tDCs (miR-23b, miR-27b, miR-10a, and miR-30a) are described as negative regulators of TGF- β signaling pathway [43], while miR-196, which is in our study downregulated in tDCs, is negatively regulated by TGF- β [44]. [score:9]
Of note, our results show elevated miR-27b in 24 h tDCs expressed from the same cluster as miR-23b. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 12
Recently, overexpression and silencing studies revealed that miR-27b is an important suppressor of apoptosis triggered by TGEV, possibly by targeting the runt-related transcription factor 1 gene. [score:7]
Profiling studies of PRRSV-infected porcine alveolar macrophages revealed altered expression of 40 miRNAs, including miR-30a-3p, miR-132, miR-27b*, miR-29b, miR-146a, and miR-9-2, of which miR-147 could be shown to inhibit virus replication (172). [score:5]
[1 to 20 of 2 sentences]
55
[+] score: 12
Lee and colleagues showed that the epigenetically regulated miR-27b acts as a tumor suppressor in NB by inhibiting the tumor-promoting function of peroxisome proliferators-activated receptor (PPAR)y and blocking cell growth in vitro and tumor growth in mouse xenografts [127]. [score:6]
In addition, miR-27b indirectly regulates also NF-kB activity and transcription of inflammatory target genes, which triggers an increased inflammatory response. [score:5]
In addition to myomiRs, there are non-muscle-specific miRNAs that participate to skeletal muscle differentiation such as miR-181a/miR-181b, miR-27a, miR-27b, miR-26a and miR-29b2/miR-29c. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 12
We suggest that some miRNAs targeting this machinery (e. g., let-7, miR-27, miR-29, and miR-103) are expressed fairly wi dely, while others (e. g., miR-138 and miR-25) have lower and more restricted expression. [score:7]
Many Hox genes are conserved as targets, including the miR-196 targets, Hox-A4:miR-34a, Hox-C9:let-7b (near prefect complementary match), and Hox-B5:miR-27b. [score:5]
[1 to 20 of 2 sentences]
57
[+] score: 11
A large-scale analysis demonstrated that miRNA-27b, as well as 41 other miRNAs undergo down-regulation in human OA chondrocytes in response to IL-1β, a key cytokine in OA development. [score:5]
Akhtar N. Rasheed Z. Ramamurthy S. Anbazhagan A. N. Voss F. R. Haqqi T. M. MicroRNA-27b regulates the expression of matrix metalloproteinase 13 in human osteoarthritis chondrocytes Arthritis Rheum. [score:3]
IL-1β -dependent regulation of miRNA-27b is of great pathophysiological importance, as in silico analysis and luciferase reporter assays indicated that MMP-13 is targeted by this miRNA, with NF-kB functioning as a negative and positive modulator of miRNA-27b synthesis and MMP-13 secretion, respectively [57]. [score:3]
[1 to 20 of 3 sentences]
58
[+] score: 11
In addition, miR-27 reduces PPAR γ expression in LPS-stimulated macrophages, inhibiting its anti-inflammatory activity [92]. [score:5]
More recently, miR-27 has been implicated in downregulation of PPAR γ in cardiomyocytes and also in neuroblastoma and breast cancer [95, 97]. [score:4]
PPAR γ is negatively regulated by miR-27 and miR-130 family members in preadipocytes, hampering adipocyte differentiation [92– 97]. [score:2]
[1 to 20 of 3 sentences]
59
[+] score: 11
Highest-ranking miRNAs included miR-16/15a (46 targets), miR-27b (44 targets), let-7f (35 targets), miR-26b (33 targets), and miR-25 (30 targets). [score:11]
[1 to 20 of 1 sentences]
60
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Among the down-regulated miRNAs, miR-361-5p [47] and miR-27b (homologous to miR-27a, sharing 20 out of 21 nts) [48] were reported as tumor suppressors. [score:6]
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 2 sentences]
61
[+] score: 11
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
In the mammary glands of lactating goats, we found that miRNAs associated with cell proliferation (miR-26a, miR-21), conferring epithelial phenotype (miR-29a, miR-30a/d), immune response and development (miR-181, let-7a/b/f/g/i) were abundantly expressed, as well as miRNAs involved in lipid metabolism (miR-103, miR-23a, miR-27b, miR-200a/b/c). [score:4]
From the top 30 miRNAs, we found six miRNAs (e. g., miR-23a, miR-27b, miR-103, miR-200a/b/c) to be related to lipid metabolism in human adipocyte cells: miR-23 enhances glutamine metabolism [38]; miR-27 decreases fat accumulation [27]; miR-103 regulates triglyceride content during cell differentiation [39]; and miR-200 affects insulin signaling [40]. [score:2]
[1 to 20 of 3 sentences]
62
[+] score: 11
Several members of the let-7 family (let-7a, let-7b, let-7c, let-7d, let-7e and let-7f), were downregulated (p<0.05) by all three treatments, consistent with published data in human breast cancer cells [36], and miR-15b (p<0.005) and miR-27b (p<0.01) were also downregulated by the three treatments (Table 2). [score:7]
For example, E [2] caused a down-regulation of miR-21 in MCF-7 cells, as seen by others [17], [45], while a unique E [2] -mediated decrease in miR-27b was observed. [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 10
Lin X Chen L Yao Y Zhao R Cui X Chen J Hou K Zhang M Su F Chen J Song E CCL18 -mediated down-regulation of miR98 and miR27b promotes breast cancer metastasisOncotarget. [score:6]
CCL18 -mediated down-regulation of miR98 and miR27b promotes breast cancer metastasis [21]. [score:4]
[1 to 20 of 2 sentences]
64
[+] score: 10
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
MiR-143, miR-27, miR-335, miR-14, and miR-205 have been recently associated with lipid metabolism and adipocyte differentiation [91]. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 10
A number of the top expressing miRNAs, such as miR-27b-3p and miR-140-3p, have been extensively studied in the context of chondrocyte function and OA pathogenesis 17, 21. [score:3]
A 3′ diadenylated isoform of miR-27b-3p was the only high expressing miRNA (>1000 mean read count) that showed a significantly lower enrichment in IL-1β -treated chondrocytes compared to untreated control cells (log [2] fold change, −1; p-value, 1.43E-08). [score:2]
Our present study further corroborates those observations and highlights the significant physiological roles of miR-27b-3p in chondrocytes. [score:1]
AGO2-RIP-Seq Log2Fold (Control vs IL-1β), Q-value 1 mir-27b-3p 11Yes [21] −1, 1.43E-08 2 mir-10b-5p 2 No NS 3 let-7a-5p 9 No NS 4 mir-22-3p —Yes [43] NS 5 mir-26a-5p 5Yes [48] NS 6 mir-100-5p 14 No NS 7 let-7f-5p 18 No NS 8 mir-140-3p 1Yes [20] NS 9 mir-148a-3p —Yes [13] NS 10 mir-125a-5p — No NS 11 mir-21-5p 15Yes [13] NS 12 mir-199a-3p — No NS 13 mir-125b-5p 12Yes [13] NS 14 mir-222-3p —Yes [49] NS 15 let-7i-5p — No 1.01, 1.12E-23 16 let-7c-5p 17 No NS 17 mir-99b-5p 20 No NS 18 mir-92a-3p —Yes [50] 0.94, 4.87E-07 19 mir-99a-5p —Yes [51] NS 20 mir-92b-3p — No 1.35, 3.31E-09 NS, non-significant. [score:1]
For miR-27b, miR-10b, miR-199a-1 and miR-99a most of the miRNA pool was contributed by 3′ addition isomiRs. [score:1]
miR-27b-3p was the most abundant miRNA in these samples followed by miR-10b-5p and let-7a-1-5p with a percent contribution of 11.82, 9.9 and 8.4, respectively (Fig.   1B, Supplementary Table  1). [score:1]
The role of miR-27b in chondrocyte function and OA pathogenesis has been previously studied 21, 46. [score:1]
[1 to 20 of 7 sentences]
66
[+] score: 10
We first determined the expression levels of six miRNAs (miR-103a-3p, miR-27b-3p, miR-126-3p, miR-34b-5p, miR-223-3p, and miR-150-5p) and a snoRNA (SNORD44) in human HEK293A cells. [score:3]
The expression levels of miR-103a-3p, miR-27b-3p, miR-126-3p, miR-34b-5p, miR-223-3p, miR-150-5p and SNORD44 in (B, C) were determined using total RNAs isolated from human HEK293A cells. [score:3]
Similar to HEK293A cells, miR-223-3p displayed the largest difference in Ct value (2.00), and miR-27b-3p the smallest (1.11), with 2.2 ~ 4.0-fold differences in sensitivity between S-Poly(T) and S-Poly(T) Plus methods. [score:1]
Six miRNAs (miR-92a-3p, miR-16-5p, miR-27b-3p, miR-210-3p, miR-103a-3p and miR-126-3p) and two snoRNAs (SNORD44 and SNORD47) were selected for this purpose. [score:1]
Four miRNAs (miR-27-3p, miR-103a-3p, miR-126-3p and miR-150-5p) and a spiked-in cel-miR-54-5p were tested. [score:1]
We first performed first screen by pooling serum samples of 24 healthy subjects and 24 patients with CHD-PAH and fourteen miRNAs (miR-451a, miR-9, miR-424, miR-223, miR-204, miR-150, miR-328, miR-21, miR-34a, miR-34b, miR-26a, miR-27b, miR-126 and miR-20a) changed more than 1.5-fold. [score:1]
[1 to 20 of 6 sentences]
67
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Activation of CD4+ T-cells has been shown to down-regulate miR-27b, subsequently up -regulating Cyclin T1. [score:5]
miR-27b has been reported to inhibit the expression of Cyclin T1 in resting CD4 [+] T-cells. [score:5]
[1 to 20 of 2 sentences]
68
[+] score: 10
On the one hand, these 4 miRNAs (hsa-miR-221, hsa-miR-27a, hsa-miR-27b and hsa-miR-29b) were down-expressed in VP and ART (block1-group1) and up-expressed in EC and HIV- (block2-group1). [score:5]
Moreover, hsa-miR-29b and hsa-miR-27b have been described to repress the translation of cellular cofactor cyclin T1 in resting and activated CD4+ T-cells. [score:3]
On the one hand, EC showed up-expressed levels of hsa-miR-221, hsa-miR-27a, hsa-miR-27b and hsa-miR-29b compared to VP. [score:2]
[1 to 20 of 3 sentences]
69
[+] score: 10
Moreover, microRNAs (miRNAs) including miR-27, miR-25 and miR-223 have been reported to be involved in regulating the expression of FBW7 [24- 27]. [score:4]
Accumulated evidence has also shown that multiple miRNAs including miR-27 and miR-223 could regulate FBW7 expression [24, 91]. [score:4]
Regulation of FBW7 by miRNA-27. [score:2]
[1 to 20 of 3 sentences]
70
[+] score: 10
Other miRNAs from this paper: hsa-mir-27a, mmu-mir-27b, mmu-mir-27a
Reduced miR-27 was shown to directly target key components of brown adipose transcription, such as Pparα and Creb1 [46]. [score:4]
Possibly, since miR-27 is downregulated following prolonged cold exposure, and HD mice show progressive hypothermia [38], altered levels of miR-27 in HD mice could be involved in browning of their WAT. [score:4]
A recent study highlighted miR-27 as a transcriptional regulator of brown adipogenesis [46]. [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 10
For example, MMP16, predicted target of miRs miR-27, miR-30 and miR-140, is an important protein regulating bone homeostasis through regulating osteocyte differentiation [58]. [score:5]
Among the miR expression of which was differentially expressed in the osteogenic tissues from adult and old donors, miRs with known function in bone biology were validated: let-7 [52], miR-21 [53], miR-30 [54], miR-96 [55], miR-27 [56], and miR-140 [57]. [score:5]
[1 to 20 of 2 sentences]
72
[+] score: 10
In our analysis, curcumin downregulated two members of the clusters, miR-23b and miR-27b, which were upregulated by H [2]O [2] -mediated oxidative stress. [score:7]
Based on statistical significance (p<0.05) and 2 -FC, curcumin pretreatment attenuated the H [2]O [2] -induced expression of 17 miRNAs (miR-15b, miR-17, miR-21, miR-26b, miR-27b, miR-28–3p, miR-30b, miR-30d, miR-92a, miR-125a-5p, miR-141, miR-196b,, miR-195, miR-302a, miR-302c, miR-320a, and miR-9), which were also significantly reduced by the curcumin treatment alone (Figure 4, Table 2). [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 10
However, another study showed a downregulated expression of miR-27b in both the tumor tissues and the plasma of OSCC patients [74]. [score:6]
In addition, increased expression of miR-27b in saliva of OSCC patients was suggested as a valuable biomarker to identify OSCC patients by ROC curve analyses [73]. [score:3]
Further research is therefore required to validate the above findings and elucidate the molecular mechanism of different levels of miR-27b in saliva and plasma in OSCC. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 10
Increasing evidence suggests that several miRNAs can reduce tumor progression via direct repression of VEGF-C. miR-27b, miR-101, miR-128 and miR-206 have been shown to inhibit lymphangiogenesis and metastasis in a variety of human cancer cells, via the targeting of VEGF-C. 27, 37, 38 This current study demonstrates that BDNF markedly inhibited the expression of miR-624-3p in human chondrosarcoma cells and specimens. [score:10]
[1 to 20 of 1 sentences]
75
[+] score: 10
8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation. [score:7]
The expression patterns of hsa-miR-27b-5p was not in line with the microarray results. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 10
An increase in miR27b is required for expression if inducible nitric oxide synthase (iNOS) during infection of epithelial cells by Crytosporidium parvum: miR27b decreases expression of a negative regulator [61], [62]. [score:6]
In contrast, mir27b decreased in HAT patient peripheral blood. [score:1]
Three individual miRNAs (miR-199a-3p, miR-27b and miR-126*) were able to differentiate all patients from controls (group C) (p<0.05) (Figure 1 & Figure 2). [score:1]
For miR-199a-3p and mir27b, the average differences were only 2-fold (p-values 0.03 and 0.01 to distinguish between patient (HAT) and control (C)). [score:1]
Mir27b is enriched in liver cells, is a negative regulator of several mRNAs involved in lipid metabolism [59], and is also involved in the control of angiogenesis [60]. [score:1]
[1 to 20 of 5 sentences]
77
[+] score: 9
By means of suppressing mitochondrial respiratory complex (MRC I), 6G induced the generation of reactive oxygen species (ROS) followed by DNA damage and up-regulation of miR-27b, and in turn, miR-27b inhibits the PPARy-NF-κB pathway and leads to the apoptosis of myeloid leukemia cells [16]. [score:8]
Results revealed that DHA both increases exosome secretion and miRNAs (let-7a, miR-21, miR-23b, miR-27b, and miR-320b) levels in exosomes and these miRNAs are also increased in the endothelial cells by DHA treatment of MCF7 cells. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 9
Notably the microRNAs upregulated in the control fascia accounting for the greatest differential in read count are heavily enriched in previously validated anti-fibrotic extracellular matrix targeting microRNAs (Table  1), including let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [27, 28], miR-27a-3p, miR-27b-3p [29, 30], miR-10a-5p [31], miR-26a-5p [32– 35], miR-101-3p [36– 39], and miR-10b-5p [40], as well as anti-proliferative microRNAs including, miR-126-3p [41– 47], miR-99a-5p [48– 54], miR-125a-5p [55– 59], and miR-139-5p [60– 62]. [score:6]
Graham JR Williams CM Yang Z MicroRNA-27b targets gremlin 1 to modulate fibrotic responses in pulmonary cellsJ Cell Biochem. [score:2]
Established anti-fibrotic microRNAs identified in our analysis include let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [28, 29], miR-27b-3p [30, 31], miR-10a-5p [33], miR-26a-5p [37– 40], miR-101-3p [41– 44], miR-27a-3p and miR-10b-5p [45]. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Six (bta-miR-148a, miR-26a, miR-21-5p, miR-27b, le-7f and let-7a-5p), four (bta-miR-30a-5p, miR-26a, miR-21-5p and let-7a-5p) and five (bta-miR-148a, miR-26a, let-7a-5p, miR-143 and miR-21-5p) of the highly expressed miRNAs in our study are also among the top 10 highly expressed miRNAs detected respectively in bovine mammary epithelial cells (MAC-T) [43] and lactating glands [24, 48]. [score:5]
Furthermore, miR-148a can repress WNT (Wingless/INT-1) signaling and thus promote adipogenesis [53] while miR-27b can repress human adipocyte differentiation by directly targeting PPARγ [54]. [score:4]
[1 to 20 of 2 sentences]
80
[+] score: 9
Interestingly, Zhou suggested that the up-regulation of genes in the Dicer KO cells could be a direct result of the loss of relevant mature miRNAs found to be overexpressed in Treg cells by Cobb et al. ; specifically suggesting that CD127 and IFN-γ could be potentially targeted by miR-214 and miR-27b 25, 26. [score:9]
[1 to 20 of 1 sentences]
81
[+] score: 9
In contrast to this set of miRNAs, many other “non-muscle specific” miRNAs exert an active role in muscle differentiation through different mechanisms: miR-24, for example, has been shown to be essential for the modulation of transforming growth factor β/bone morphogenetic protein (TGF-β/BMP) pathway, a well-known inhibitor of differentiation, although its specific muscular targets are yet unknown [44]; miR-26a is involved in TGF-β/BMP pathway, where it negatively regulates the transcription factors Smad1 and Smad4, critical components of that signaling; miR26a targets the polycomb complex member Ezh2, involved in chromatin silencing of skeletal muscle genes [45, 46]; miR-27b promotes entry into differentiation program both in vitro and in vivo regenerating muscles by down -regulating Pax3 [47]; miR-29 in general is defined as an enhancer of differentiation. [score:9]
[1 to 20 of 1 sentences]
82
[+] score: 9
Other miRNAs from this paper: hsa-mir-27a
This includes the EBER1 and EBER2 RNAs encoded by the Epstein–Barr Virus that have been determined to be associated with the particular viruses latency and malignancy (Nanbo et al., 2005; Iwakiri et al., 2009; Iwakiri and Takada, 2010); beta 2.7 RNA encoded by the Cytomegalovirus, which prevents the host cell from undergoing apoptosis following infection and ensuring cell survivability conducive to the virus (Reeves et al., 2007; Zhao et al., 2010); HSUR1 and HSUR2 encoded by the Herpesvirus genome, that mimics the target for the microRNA mir-27 and hence, modulates the T-cell gene expression (Cook et al., 2005; Buck et al., 2010; Cazalla et al., 2010) and lastly, VAI and VAII coded for by the human adenovirus and implicated as key determinants in the suppression of host cell-derived RNAi response following viral replication (Andersson et al., 2005; McKenna et al., 2006; Sano et al., 2006; Xu et al., 2007). [score:7]
Post-transcriptional regulation of miR-27 in murine cytomegalovirus infection. [score:2]
[1 to 20 of 2 sentences]
83
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
miR-27a and miR-27b regulate autophagic clearance of damaged mitochondria by targeting PTEN -induced putative kinase 1 (PINK1). [score:4]
miRNA-27a and miRNA-27b play a vital role in the autophagic clearance of injured mitochondria by targeting PTEN -induced PINK1 in PD (Kim et al., 2016). [score:3]
Kim et al. (2016) demonstrated that miRNA-27a and miRNA-27b plays a crucial role in the regulation of autophagy for clearing damaged mitochondria via PTEN -induced putative kinase 1 (PINK1) gene. [score:2]
[1 to 20 of 3 sentences]
84
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
MiR-23b was found to interact with TGF bata signaling by down -regulating Smads in fetal hepatocytes [56], while miR-27b was involved in myogenic differentiation [31] as well as fast-specific and glucocorticoid -dependent myostatin expression [30], both of which were highly expressed at 35 dpc and down-regulated thereafter (Figure 5D), suggesting their roles played in porcine embryonic myogenesis. [score:9]
[1 to 20 of 1 sentences]
85
[+] score: 9
In gluteal tissue, hsa-miR-27b, hsa-miR-196b and hsa-miR-28-5p were found to be both associated with their target mRNAs, as well as being tissue differentially expressed. [score:5]
Seven of the miRNAs that were differentially expressed in both studies, have previously been reported to play a role in tissue development, obesity, T2D and metabolic disturbances (hsa-miR-34a [23], [32], hsa-miR-28-5p [32], hsa-miR-27b [13], [15], hsa-miR-326 [21], hsa-miR-204 [22], [23], hsa-miR-195 [32], hsa-miR-519d [29]). [score:4]
[1 to 20 of 2 sentences]
86
[+] score: 9
The expressions of 17 of the dysregulated miRNAs (miR-145*, -145, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -125a-5p, let-7b, miR-24-1*, -1979, and -768-3p) were significantly lower in both colon and rectal cancers compared with normal tissues, but of the remaining 5, miR-133a and miR-140-3p were found significantly downregulated (P<0.05) only in rectal cancers, and miR-27b*, miR-30a, and miR-29b-2* were significantly downregulated only in colon cancers (P<0.05; Figure 1). [score:9]
[1 to 20 of 1 sentences]
87
[+] score: 9
Other miRNAs from this paper: mmu-mir-27b
Human MSC applied systemically were found in the liver potentially mediated by mir-27b down-regulation in liver and up-regulation of SDF1 expression. [score:9]
[1 to 20 of 1 sentences]
88
[+] score: 8
The expression level of four miRNAs (miR-424-5p, miR-27b-3p, miR-377-5p, miR-3680-5p) in the peripheral blood mononuclear cells samples from LTBI and healthy participants reflected the altered patterns observed in the microarray profile. [score:3]
The expression level of seven miRNAs (miR-424-5p, miR-493-5p, miR-296-5p, miR-27b-3p, miR-377-5p, miR-3680-5p, miR-191-5p) were validated by qRT-PCR. [score:3]
The miR-424-5p (previous ID: miR-424), miR-493-5p (previous ID: miR-493*), and miR-296-5p were reported as potential to discriminate between latent TB and healthy by the previous study [12], the other four miRNAs (miR-27b-3p, miR-377-5p, miR-3680-5p, miR-191-5p) were randomly selected. [score:1]
01720Xhsa-miR-652-3p0.1640.00214Xhsa-miR-1273 g-3p0.3820.005491hsa-miR-21-5p0.1650.0005917hsa-miR-4668-5p0.3860.000139hsa-miR-142-5p0.1750.0005617hsa-miR-20b-3p0.3900.01073Xhsa-miR-36530.1780.0011722hsa-miR-148a-3p0.3910.000757hsa-miR-27b-3p0.1880.001339hsa-miR-483-3p0.3921.4E-0511hsa-miR-299-3p0.1910.0011214hsa-miR-44500.3930.000684hsa-miR-1260a0.1937.5E-0514hsa-miR-93-5p0.4000.007367hsa-miR-4445-5p0.2028.2E-053hsa-miR-56840.4050. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 8
Accumulating evidences further indicate that numerous miRNAs can impede cancer progression via direct suppression of VEGF-C. miR-27b, miR-101, miR-128, miR-206 and miR-1826 have been reported to inhibit tumor growth, lymphangiogenesis and metastasis by targeting VEGF-C in a variety of human cancer cells [20– 22, 38– 40]. [score:8]
[1 to 20 of 1 sentences]
90
[+] score: 8
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-15b, hsa-mir-23b, hsa-mir-106b, hsa-mir-503
Pitx2c modulates Pax3+/Pax7+ cell populations and regulates Pax3 expression by repressing miR27 expression during myogenesis. [score:6]
This control is exercised by balancing Pax3+ /Pax7+ myogenic population in vivo as well as regulating key myogenic transcription factors such as Pax3 through the repression of miR-27 (Lozano-Velasco et al., 2011; Figures 3A1,A2). [score:2]
[1 to 20 of 2 sentences]
91
[+] score: 8
Other miRNAs tested, miR-27 and miR-25/32/92/363/367 have highly conserved binding sites but did not have an effect on reporter gene expression in HEK293 or 501mel cells. [score:3]
The other miRNAs tested, miR-27, miR-32 and miR-101 did not show significant effects on luciferase expression in this assay (Fig. 2B). [score:2]
All Mitf 3′UTR sequences in 11 vertebrate species analysed contain the miR-27, miR-25/32/92/363/367 and the miR-101/144 binding sites (Fig. 1B). [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
[1 to 20 of 5 sentences]
92
[+] score: 8
Meanwhile, overexpression of miR-27b provokes a decrease of mitochondria content and diminishes expression of FOXJ3 both at mRNA and protein levels by directly targets the 3’-UTR of FOXJ3 [173]. [score:8]
[1 to 20 of 1 sentences]
93
[+] score: 8
As a consequence, several of the miR-27 target genes, including Prdm16, peroxisome proliferator-activated receptor alpha (Pparα), cAMP response element -binding protein (Creb) and peroxisome proliferator-activated receptor gamma coactivator 1-beta (Pgc1β) are upregulated, and enhance brown adipogenesis. [score:6]
Several miRNAs controlling mouse brown adipocyte development and function have been identified in mice, including miR-27, −34a, −133, −155, −182, −193b-365, −196, −203 and miR-378 [14, 16– 23]. [score:2]
[1 to 20 of 2 sentences]
94
[+] score: 8
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-143
Expression of miR-27 suppresses the translation of peroxisome proliferator-activated receptor-γ (PPARγ) and is an essential early regulator of adipogenesis [71]. [score:8]
[1 to 20 of 1 sentences]
95
[+] score: 8
NO has been shown to inhibit the adipogenesis of mesenchymal fibro-adipogenic progenitors by inducing expression of miR-27b and downregulating PPARγ. [score:8]
[1 to 20 of 1 sentences]
96
[+] score: 8
However, we found a lack of agreement between the in vitro and ex vivo results for miR-27b-3p (Fig. 3B) that may be justified because its expression was 18-fold lower than miR-27a-3p in HUVECs (Fig. 3C), which is in accordance with published results 24. [score:3]
Therefore it is expected that, in physiological conditions, the lower concentration of miR-27b-3p in HUVECs may explain its lack of association with TFPI levels and potentially a minor role in regulating TFPIα in ECs. [score:2]
For miR-27b and miR-24 the same scrambled control was used. [score:1]
Levels of miR-27a-3p (A), miR-27b-3p (B), miR-19b (E) and miR-24 (F) were measured by qRT-PCR and correlated with TFPI mRNA expression in 74 HUVEC samples obtained from umbilical cords. [score:1]
Indeed, miR-27a and miR-27b were not correlated (Fig. 3D). [score:1]
[1 to 20 of 5 sentences]
97
[+] score: 8
In fact, the up-regulation of mir-27b-3p was exclusive to the fibrosis category, confirmed pathologically in the lungs [54]. [score:4]
A recent study that investigated miRNA/mRNA expression profiles also reported the overexpression of mir-27b-3p in the blood from mice exposed to MWCNT via Inhalation [54]. [score:3]
Several of these mRNAs, including cytokines (e. g., IL6, CSF2, CXCL2), growth factors (e. g., VEGFA, PDGFA), and miRNAs (e. g., hsa-mir-21-5p, has-mir-27b-3p) are all known to increase inflammation and/or fibrosis. [score:1]
[1 to 20 of 3 sentences]
98
[+] score: 8
Of the miRNAs expressed, miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c expression were significantly increased (p< = 0.05) in human macropahge after exposure to Toxoplasma infection for 24 h (Figure  1A). [score:5]
Increased expression of miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c were noted in human macrophage at 6 h and 12 h postinfection, the abundance of these miRNAs significantly increased by ~23.5-fold at 24 h postinfection. [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 8
Together with miR-27b, they were dysregulated showing up- and down-regulation respectively, between high-grade dysplasia and esophageal cancer 48. [score:5]
TF BRG1, TF CEBPA, miRNA miR-27b and miRNA miR-30 family members recurred with relatively high degrees. [score:1]
Moreover, we examined pivot miRNA miR-181 family (miR-181b, miR-181c and miR-181d), miR-27b and miR-200c, which significantly connected to the module subnetwork (Fig. 4). [score:1]
Among these pivots, we showed that TF BRG1 and CEBPA and miRNA miR-27b and miR-30 family members recurred with relatively high degrees between the two different patterns, which thus turned out to be promising candidates for further confirmation. [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 8
In addition, miR-27b also showed down-regulation after treatment in all three analyzed cell lines. [score:4]
MiR-27b is considered as a regulator of CYPB1 and acts as a tumor suppressor that is suppressed in breast cancer [44]. [score:4]
[1 to 20 of 2 sentences]