sort by

208 publications mentioning mmu-mir-34b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-34b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 333
The downregulation of CDK4 and CDK6 (Figure 7B), which downregulates Rb in turn, supports the notion that miR-34b/c can also inhibit cell proliferation through cell cycle protein regulation. [score:10]
Our results demonstrate that both miR-34b and miR-34c act as tumor suppressors in uveal melanoma cell proliferation and migration through the downregulation of multiple targets. [score:8]
In this study, we also demonstrated that downregulation of miR-34b/c in uveal melanoma, miR-34b/c suppressed cell proliferation and migration by targeting c-Met. [score:8]
miR-34b/c targeted c-Met, which in turn downregulated the downstream Akt signaling pathway, leading to the inhibition of cell proliferation and migration. [score:8]
of microRNA-34b/c downregulated c-Met, p-Akt, and cell cycle–related proteinsTo confirm that miR-34b/c was indeed responsible for the downregulation of c-Met in uveal melanoma cells, SP6.5 cells were transfected with the miR-34b/c or a negative control. [score:7]
Furthermore, miR-34b/c was confirmed to downregulate the expression of c-Met, p-Akt, and cell cycle–related proteins by western blotting. [score:6]
Recently, the miR-34 family was found to be involved in the p53 tumor suppressor gene effector network, as direct targets of p53 [10- 18]. [score:6]
A: miR-34b/c downregulated the expression of c-Met and p-Akt. [score:6]
Next, we examined the expression patterns of ERK1/2 and Akt after downregulation of c-Met by miR-34b/c. [score:6]
miR-34b/c expression, which was dramatically decreased in uveal melanoma cells and clinical samples, can be upregulated by doxorubicin and epigenetic drugs. [score:6]
Previous studies have identified miR-34b/c as a direct transcriptional target of p53 and an important component of the tumor suppressor network, which operates by modulating cell cycle progression, DNA repair, and apoptosis [10, 13]. [score:6]
These results indicate that miR-34b/c expression is frequently downregulated in human uveal melanoma. [score:6]
The expression of miR-34b/c was upregulated by doxorubicin (DOX) and epigenetic drugs. [score:6]
miR-34b/c, expressed in normal uveal melanocytes, is downregulated in both uveal melanoma cells and tumor specimens (Figure 1). [score:6]
MicroRNA-34b/c expression was downregulated in uveal melanoma cells and specimens. [score:5]
Moreover, we have provided strong evidence that miR-34b/c suppressed cell growth by inhibition of cell cycle G [1] arrest rather than the induction of apoptosis. [score:5]
As c-Met expression is directly regulated by miR-34b/c, its downstream effects are similarly altered in uveal melanoma cells. [score:5]
MicroRNA-34b/c expression was upregulated in uveal melanoma cells treated with DOX or epigenetic drugs. [score:5]
We detected the expression levels of miR-34b/c in SP6.5 cells treated with either DOX, 5-aza-dC (a DNA hypomethylating agent), and/or TSA (a histone deacetylase inhibitor). [score:5]
In addition to regulation of c-Met activity, introduction of miR-34b/c downregulated cell cycle–related proteins, including p-Rb, CDK4, and CDK6. [score:5]
Thus, miR-34b/c also downregulated cell cycle regulatory proteins in SP6.5 cells (Figure 7B). [score:5]
The possible potential target mRNAs, as well as the potential binding sites of miR-34b/c, were predicted by the TargetScan program. [score:5]
B: Cell cycle–related proteins CDK4, CDK6, and p-Rb were downregulated by miR-34b/c. [score:4]
These results demonstrated that c-Met was a direct target of miR-34b/c. [score:4]
First, we demonstrate that miR-34b/c was downregulated in uveal melanoma cells and clinical samples. [score:4]
Introduction of microRNA-34b/c downregulated c-Met, p-Akt, and cell cycle–related proteins. [score:4]
The activation of miR-34b/c by 5-aza-dC and TSA indicates that the epigenetic mechanism is responsible for the miR-34b/c downregulation in uveal melanoma cells. [score:4]
Mutations of the two 8 bp binding sites in c-Met 3′ UTR completely abolished miR-34b/c -mediated inhibition of luciferase activity (Figure 6C). [score:4]
To confirm that miR-34b/c was indeed responsible for the downregulation of c-Met in uveal melanoma cells, SP6.5 cells were transfected with the miR-34b/c or a negative control. [score:4]
These results indicate that miR-34b/c inhibits cell proliferation and plays an important role in regulating uveal melanoma cell cycle G [1] phase. [score:4]
Similarly, miR-34b/c was also upregulated by 5-aza-dC or TSA (Figure 2B). [score:4]
In addition, miR-34b/c can be dramatically upregulated by DOX, which provides another way to activate miR-34b/c in uveal melanoma. [score:4]
Figure 3Ectopic microRNA-34 b/c inhibited SP6.5 cell proliferation. [score:3]
Therefore, we examined the effect of miR-34b/c on c-Met expression and its pathway in uveal melanoma cells. [score:3]
Real-time reverse transcriptase (RT)- polymerase chain reaction (PCR) analysis was performed to detect miR-34b/c expression in five specimens of uveal melanoma. [score:3]
Real-time reverse transcriptase polymerase chain reaction (RT-PCR) was performed to detect the expression level of miR-34b/c in uveal melanoma cells and primary samples. [score:3]
Figure 6c-Met was a target of microRNA-34 b/c. [score:3]
Overall, these results demonstrated that the expression of miR-34b/c in uveal melanoma cells can be affected by DOX and epigenetic drugs. [score:3]
A: Real time reverse transcriptase (RT)-PCR analysis was performed to detect the expression of miR-34b/c in clinical samples. [score:3]
In addition to the effects on c-Met and p-Akt, we also examined the expression of cell cycle–related proteins after transfection with miR-34b/c into SP6.5 cells. [score:3]
Here, we demonstrated that miR-34b/c can inhibit uveal melanoma cell migration dramatically in an hepatocyte growth factor (HGF) -dependent fashion. [score:3]
To sum up, our results showed a low level of miR-34b/c expression in uveal melanoma, and provided the approaches to activate miR-34b/c. [score:3]
Restoration of miR-34b/c resulted in the inhibition of cell growth and migration. [score:3]
miR-34b/c expression level was determined by Real-time RT–PCR. [score:3]
In addition, miR-34b/c suppressed cell proliferation via cell cycle proteins CDK4, CDK6, and Rb. [score:3]
MicroRNA-34b/c inhibited uveal melanoma cell proliferation and induced G [1] cell cycle arrestAfter determining the miR-34b/c expression pattern, we sought to investigate the effects on uveal melanoma cells by restoration of miR-34b/c. [score:3]
A: Two specific binding sites of miR-34b/c in the c-Met 3′ untranslated region (UTR) was marked with black color. [score:3]
Expression of miR-34b/c increased after treatment with DOX at 24 h, with maximal induction at 48 h (Figure 2A). [score:3]
In addition, miR-34b/c inhibited cell migration. [score:3]
miR-34b/c target prediction. [score:3]
In summary, our study demonstrates that miR-34b/c can function as a tumor suppressor in uveal melanoma cell proliferation and migration. [score:3]
Furthermore, the introduction of miR-34b/c into tumor cells led to the inhibition of growth through cell cycle G [1] arrest, instead of the induction of apoptosis. [score:3]
A: Real time reverse transcriptase (RT)-PCR analysis was performed to detect the expression of miR-34b/c in uveal melanoma cell line SP6.5, after treatment with DOX for 24 h and 48 h. B: SP6.5 cells were treated with 5-aza-dC at 1 μM or 5 μM alone, TSA (100 ng/ml) alone, or combinations of both. [score:3]
Consistent with the results from primary samples, miR-34b/c was expressed in uveal melanocytes, but was dramatically decreased in the SP6.5 cell line (Figure 1B). [score:3]
c-Met was a target of microRNA-34b/c. [score:3]
Furthermore, the effect of drug combination seems to be additive on miR-34b/c expression (Figure 2B). [score:3]
Alignment between the predicted miR-34b/c target sites and miR-34b/c, the common 8 bp seed sequence for miR-34b/c:mRNA (mRNA) pairing is shown. [score:3]
Transfection of miR-34b/c into uveal melanoma cells inhibited cell cycle G [1] arrest and led to significant growth retardation (Figure 3). [score:3]
As expected, the luciferase activity of the wild-type pLuc-MET 3′ UTR construct was significantly suppressed following the transfection of miR-34b/c into SP6.5 cells, in contrast to the negative control (Figure 4C). [score:3]
miR-34b/c was expressed in uveal melanocytes but dramatically decreased in uveal melanoma cells. [score:3]
To explore the molecular mechanisms underlying miR-34b/c mediated cell proliferation and migration, we used TargetScan for. [score:3]
Thus, these analyses indicate that miR-34b/c inhibited uveal melanoma cell growth by cell cycle G [1] arrest rather than by inducing apoptosis. [score:3]
The mechanism by which miR-34b/c inhibited cell growth was attributed to induction of G [1] cell cycle arrest. [score:3]
As a result, miR-34b/c expression was dramatically decreased in specimens 1, 2, and 5, and undetectable in specimens 3 and 4, in contrast to normal tissues (Figure 1A). [score:3]
We also provide evidence that c-Met was a target of miR-34b/c, and miR-34b/c decreased endogenous c-Met, phosphorylated v-akt murine thymoma viral oncogene homolog (p-Akt), cyclin -dependent kinase (CDK) 4, and CDK6 protein levels in uveal melanoma cells. [score:3]
Met proto-oncogene (c-Met) was identified as a target of miR-34b/c in uveal melanoma cells. [score:3]
As expected, western blot analysis showed that c-Met expression was dramatically decreased in the cells transfected with miR-34b/c, as compared to negative control (Figure 7). [score:2]
MicroRNA-34b/c inhibited uveal melanoma cell proliferation and induced G [1] cell cycle arrest. [score:2]
MicroRNA-34b/c inhibited uveal melanoma cell migration. [score:2]
The target of miR-34b/c was predicted by bioinformatics and validated by luciferase assay. [score:2]
In contrast to other reports, our results indicated that miR-34b/c did not induce uveal melanoma cell apoptosis directly, but rather enhanced the cell sensitivity to DOX. [score:2]
In addition, the effect of miR-34b/c on c-Met, cell cycle-related proteins, v-akt murine thymoma viral oncogene homolog (Akt) and extracellular signal-regulated kinase (ERK) pathway was determined by western blotting. [score:2]
We also compared the expression of miR-34b/c in uveal melanoma cell line SP6.5 and primary uveal melanocytes by real-time RT–PCR. [score:2]
As shown in Figure 5, the migration of cells transfected with miR-34b/c was significantly inhibited, as compared with negative control (208±15 for NC, 122±10 for miR-34b, 116±9 for miR-34c, n=3 each, p<0.01). [score:2]
miR-34b/c caused cell cycle G [1] arrest rather than the induction of apoptosis. [score:1]
In this study, we demonstrated that the other two members of the miR-34 family—miR-34b and miR-34c—play an important role in uveal melanoma cell proliferation and migration with their effects related to the c-Met signaling pathway. [score:1]
Figure 4Transfection of microRNA-34 b/c did not induce cell apoptosis but did enhance cell sensitivity to DOX. [score:1]
The transfection of miR-34b/c into uveal melanoma cells leads to a significant reduction in cell growth and migration. [score:1]
Differences between groups transfected with miR-34b/c and a negative control were analyzed using the Student t test. [score:1]
miR-34b/c is also important in various types of cancer [28- 31]. [score:1]
As shown in Figure 7A, miR-34b/c caused a significant reduction of phosphorylated Akt in SP6.5 cells, but had no obvious effect on ERK1/2 phosphorylation. [score:1]
SP6.5 cells were transfected with miR-34b/c or a negative control. [score:1]
The value for miR-34b/c in SP6.5 cells without any treatment was set at 1, and the relative amounts of miR-34b/c in cells treated with drugs were shown as fold induction. [score:1]
For each well, 50 nM of miR-34b, miR-34c mimic, or a negative control was cotransfected with the reporter constructs. [score:1]
After determining the miR-34b/c expression pattern, we sought to investigate the effects on uveal melanoma cells by restoration of miR-34b/c. [score:1]
C: SP6.5 cells were transfected with miR-34b/c or NC. [score:1]
SP6.5 cells were transfected with miR-34b/c or a negative control (NC) for 24 h and plated on cultured inserts in DMEM containing 20 ng/ml of hepatocyte growth factor (HGF) to assess the number of migrating cells. [score:1]
In addition, we employed multiple approaches to reactivate miR-34b/c, including the use of 5-aza-dC, trichostatin A (TSA), and DOX. [score:1]
SP6.5 cells were seeded in 96-well plates and transfected with 50 nM of miR-34b/c mimic or negative control. [score:1]
Therefore, the introduction of miR-34b/c caused reduced cell migration in response to HGF. [score:1]
To further characterize the miR-34b/c -mediated inhibition of cell growth, we examined caspase activity to determine if apoptosis was also involved. [score:1]
The value for miR-34b/c in normal uveal tissue was set at 1, and the relative amounts of miR-34b/c in tumor tissues were shown as fold induction. [score:1]
As shown in the Figure 6A, two potential binding sites of miR-34b/c, as well as the miR-34b/c: mRNA pairing mo del, were predicted in the 3′ UTR of the c-Met mRNA (Figure 6A). [score:1]
B: Design of the pMIR luciferase reporter constructs, containing c-Met 3′ UTR, which was used to verify the putative miR-34b/c binding sites. [score:1]
To investigate the role of miR-34b/c in uveal melanoma, we first examined miR-34b/c expression in this case. [score:1]
To investigate whether miR-34b/c was involved in the tumorigenesis of uveal melanoma, we first examined miR-34b/c expression levels in primary samples. [score:1]
For each well, 50 nM of miR-34b/c mimic molecule (Ambion, Austin, TX) or a negative control (Ambion) was transfected into cells using Lipofectamine 2000 (Invitrogen). [score:1]
After 48 h, caspase 3/7 activity was significantly increased in miR-34b/c -transfected cells in comparison to negative control after DOX treatment (Figure 4B), which suggested that miR-34b/c enhanced cell sensitivity to DOX. [score:1]
B: The expression of miR-34b/c was measured by real time RT–PCR in uveal melanoma cell line SP6.5, as well as the primary uveal melanocytes. [score:1]
C: SP6.5 cells were cotransfected with miR-34b/c, pLuc-MET 3′ UTR, and a pRL-SV40 reporter plasmid. [score:1]
Figure 5 Transfection of microRNA-34 b/c reduced uveal melanoma cell migration. [score:1]
Following transfection with either miR-34b/c mimic or a negative control, SP6.5 cells were seeded on cultured inserts and the ability of cells to migrate to the underside of the inserts was assessed in the presence of HGF. [score:1]
SP6.5 cells were transfected with either the miR-34b/c mimic or a negative control. [score:1]
*: Differences in cell migration between miR-34b/c and negative control transfected cells were significant, p<0.01. [score:1]
A significant reduction in cell number persisted through day 5 (48.85±5.39% decrease for miR-34b and 61.72±3.6% for miR-34c, p<0.01, Figure 3A). [score:1]
Taken together, our findings suggest that miR-34b/c may play an important role in controlling the carcinogenesis of uveal melanoma. [score:1]
SP6.5 cells were grown to ~70% confluence and transfected with 50 nM miR-34b/c mimic or a negative control. [score:1]
SP6.5 cells were transfected with 50 nM of miR-34b/c mimic or a negative control. [score:1]
No significant difference in caspase 3/7 activity was observed between miR-34b/c transfected cells and negative control transfected cells (Figure 4A). [score:1]
As indicated, CDK4, CDK6, and phosphorylated retinoblastoma protein (p-Rb) were dramatically decreased in miR-34b/c -transfected cells (Figure 7B). [score:1]
*: Differences in luciferase activity between miR-34b/c and negative control transfected cells were significant, p<0.01. [score:1]
B: SP6.5 cells transfected with miR-34b/c or NC were seeded at low density. [score:1]
Specifically, we demonstrated the molecular mechanism of miR-34b/c in the modulation of uveal melanoma cell proliferation and migration. [score:1]
So far, however, little is known about the function of miR-34b/c in uveal melanoma. [score:1]
[1 to 20 of 114 sentences]
2
[+] score: 272
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a, mmu-mir-541
Figure 4 miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expression(A) TGIF2 mRNA expression of tumor tissues in each group nude mice by qRT-PCR; (B) TGIF2 protein expression of tumor tissues in each group nude mice by; (C) tumor volume of nude mice in each group; (D) apoptosis of tumor tissues in each group nude mice by flow cytometry; (E) caspase-3 expression by immunohistochemistry. [score:14]
They also suggested that up-regulation of miR-34 could play an inhibitory effect on gastric tumor metastasis and invasion by targetly suppression the expression of TGIF2. [score:12]
In addition, we further observed that TGIF2 was the target gene of miR-34, and the effect of miR-34 on inhibiting growth and promoting apoptosis of osteosarcoma was through targetly regulating TGIF2 expression. [score:10]
Figure 3 miR-34 regulated TGIF2 expression targetly(A) TGIF2 protein expression of tumor tissues in each group nude mice by; (B) TGIF2 positive cells proportion of tumor tissues in each group nude mice by immunofluorescence; (C) prediction of binding sites between TGIF2 and miR-34 by TargetScan; (D) dual luciferase reporter assay. [score:9]
The results also revealed that the mechanism of miR-34 inhibiting growth and promoting apoptosis of osteosarcoma in nude mice was through targetly regulating the expression of TGIF2. [score:8]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expression. [score:8]
All the above results indicated that miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expression. [score:8]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice through targetting regulated TGIF2 expressionFurther studies were conducted to investigate the mechanism of miR-34 in inhibiting growth and promoting apoptosis of osteosarcoma in nude mice. [score:8]
More importantly, miR-34 inhibited growth and promoted apoptosis of osteosarcoma through targetly regulating the expression of TGIF2. [score:8]
In this research, we also found a similar mechanism that miR-34 could inhibit growth and promoting apoptosis of osteosarcoma by targetly regulating the expression of TGIF2. [score:8]
miR-34 regulated TGIF2 expression targetlyAccording to, TGIF2 protein relative expression of tumor tissues of nude mice in miR-34 mimics group was dramatically lower than that in blank group and NC group (P<0.05) (Figure 3A). [score:8]
Figure 2 miR-34 inhibited osteosarcoma growth and promoted its apoptosis in nude mice(A) miR-34 expression of tumor tissues in each group nude mice by qRT-PCR; (B) tumor volume of nude mice in each group; (C) apoptosis of tumor tissues in each group nude mice by flow cytometry; (D) caspase-3 expression by immunohistochemistry. [score:7]
Figure 1 miR-34 expression by qRT-PCR(A) miR-34 expression in tumor tissues and non-tumor tissues of patients with osteosarcoma by qRT-PCR; (B) miR-34 expression in hFOB 1.19 cells and MG-63 cells by qRT-PCR. [score:7]
Above results suggested that up-regulation of miR-34 inhibited osteosarcoma growth and promoted its apoptosis in nude mice. [score:6]
Down-regulation of miR-34 in osteosarcoma tissues and cells miR-34 expression in tumor tissues and non-tumor tissues of patients with osteosarcoma was determined by qRT-PCR. [score:6]
The results illustrated that the expression of miR-34 in osteosarcoma tumor tissues was dramatically down-regulated. [score:6]
They also found that decreased non-small-cell lung cancer cell migration and invasion could be achieved by miR-34 overexpression or by down-regulation of PDGFR-α/β. [score:6]
Based on this, their further research identified the relationship between miR-34 and PDGFR-α/β that PDGFR-α/β was targetly regulated by miR-34, which provided a therapeutic target for the treatment of non-small-cell lung cancer. [score:6]
Up-regulation of miR-34 expression was successfully achieved by transfection. [score:6]
miR-34 regulated TGIF2 expression targetly. [score:6]
Tang et al. [10] revealed that miR-34 was a tumor suppressor gene, which could inhibit the development of human pancreatic cancer. [score:6]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude miceAmongst blank group, NC group, and miR-34 mimics group, miR-34 relative expression in miR-34 mimics group was obviously higher than that in the other two groups (P<0.05). [score:5]
However, dramatically lower luciferase activity was presented in WT + mimics group compared with that in WT + NC group (P<0.05) (Figure 3D), which indicated that miR-34 could targetly regulate TGIF2 expression. [score:5]
Chamani et al. [8] thought that miR-34 was one of the tumor suppressor miRNAs, which was expressed in majority of normal tissues. [score:5]
Target Scan was used to predict the targetted relationship between miR-34 and TGIF2, and 3′-UTR was the binding site of miR-34 and TGIF2. [score:5]
Down-regulation of miR-34 in osteosarcoma tissues and cells. [score:4]
Cheng et al. [11] demonstrated in their research that miR-34 could co-operate with p53 in suppression of prostate cancer by joint regulation of stem cell compartment. [score:4]
Our results were consistent with these previous studies that miR-34 was down-regulated in osteosarcoma tissues and cells. [score:4]
Garofalo et al. [26] researched that miR-34 was down-regulated in lung tumors. [score:4]
In conclusion, this article researched the effect of miR-34 on osteosarcoma and the results showed that miR-34 was down-regulated in osteosarcoma. [score:4]
They were used to transfect MG-63 cells, respectively and co-transfection was also conducted by using miR-34 mimics and TGIF2 expression vector. [score:3]
According to, TGIF2 protein relative expression of tumor tissues of nude mice in miR-34 mimics group was dramatically lower than that in blank group and NC group (P<0.05) (Figure 3A). [score:3]
miR-34 mimics (sense: CAAUCACUAACUCCACUGCCAU; antisense: GGCAGUGGAGUUAGUGAUUGUU), miR-34 negtive control (sense: UUCUCCGAACGUGUCACGUTT; antisense: ACGUGACACGUUCGGAGAATT) [14], as well as TGIF2 expression vector, were purchased from RiboBio, Guangzhou, China. [score:3]
miR-34 was reported to be declined in a variety of tumors, which was recommended as a tumor suppressor miRNA [23–25]. [score:3]
miR-34 expression in tumor tissues and non-tumor tissues of patients with osteosarcoma was determined by qRT-PCR. [score:3]
miR-34 inhibited growth and promoted apoptosis of osteosarcoma in nude mice. [score:3]
The results showed that miR-34 relative expression in tumor tissues was significantly lower than that in non-tumor tissues (P<0.05) (Figure 1A). [score:3]
In the present study, the expression level of miR-34 in osteosarcoma tumor tissues and cells was explored. [score:3]
Their results revealed that significant down-regulation of miR-34 occurred in tumor tissues compared with that in adjacent normal tissues. [score:3]
We further researched the above speculation with TargetScan, and found that 3′-UTR region was the binding site of TGIF2 to miR-34 (Figure 3C). [score:3]
Amongst blank group, NC group, and miR-34 mimics group, miR-34 relative expression in miR-34 mimics group was obviously higher than that in the other two groups (P<0.05). [score:3]
Kasinski and Slack [9] found that miR-34 could inhibit cancer initiation and progression in mouse mo dels of lung adenocarcinoma. [score:3]
These results illustrated that miR-34 had an impact on the expression of TGIF2. [score:3]
miR-34 expression by qRT-PCR. [score:3]
Several studies also explored the relationship between miR-34 and TGIF2 in regulating tumor development. [score:3]
miR-34 inhibited osteosarcoma growth and promoted its apoptosis in nude mice. [score:3]
To our knowledge, researches about the effects as well as mechanism of miR-34 on osteosarcoma development were very limited. [score:2]
In addition, miR-34 relative expression, prominently decreased, was also found in MG-63 cells compared with that in hFOB 1.19 cells (P<0.05) (Figure 1B). [score:2]
Many other similar studies have researched the impact of miR-34 on tumors development. [score:2]
also showed that the proportion of TGIF2 positive cells of tumor tissues of nude mice in miR-34 mimics group was significantly lower than that in blank group and NC group (P<0.05) (Figure 3B). [score:1]
Our study suggested that miR-34 might be used as a potential biomarker for osteosarcoma, which provided an important guiding significance for the treatment of osteosarcoma at the molecular level. [score:1]
Further studies were conducted to investigate the mechanism of miR-34 in inhibiting growth and promoting apoptosis of osteosarcoma in nude mice. [score:1]
They recommended miR-34 to be used as a prognostic marker for patients with gastric cancer. [score:1]
These transfected MG-63 cells were set as miR-34 mimics group, NC group, TGIF2 group and TGIF2 + mimics group, respectively based on different transfection types. [score:1]
The exact mechanism of miR-34 on osteosarcoma growth and apoptosis in vivo by nude mice was also researched. [score:1]
A major breakthrough in the treatment of osteosarcoma will be achieved if the mechanism of miR-34 on osteosarcoma could be identified. [score:1]
Zhang et al. [27] explored the effect of miR-34 on the prognosis of patients with gastric cancer. [score:1]
Amongst these wide varieties of miRNA, miR-34 was reported to be associated with several tumors progress. [score:1]
Nude mice in vivo transplantation experiment results showed that, during 4–6 weeks, the tumor volume of miR-34 mimics group was significantly lower than that of blank group and NC group (P<0.05). [score:1]
In this paper, in vivo studies in nude mice were performed to research the effect of miR-34 on osteosarcoma growth and apoptosis, and related mechanism was also further studied. [score:1]
Flow cytometry showed that the percentage of apoptotic cells in miR-34 mimics group was much higher than that in blank group and NC group (P<0.05) (Figure 2C). [score:1]
These nude mice were also divided into blank group, miR-34 mimics group, NC group, TGIF2 group, and TGIF2 + mimics group based on the difference of injected cell suspension. [score:1]
Then the psiCHECK2 firefly luciferase reporter plasmids as well as miR-34 mimics or miR-34 negative control were used to transfect the MG-63 cells by Lipofectamine 2000 (Invitrogen, U. S. A. ). [score:1]
This result was also confirmed by immunohistochemistry that caspase-3 positive cells proportion of miR-34 mimics group was markedly higher than that of blank group and NC group (P<0.05) (Figure 2D). [score:1]
[1 to 20 of 64 sentences]
3
[+] score: 269
We detected modest upregulation of cMyc, E2f3, Met and Sirt1 in miR-34 -deficient MEFs, while Bcl2 was expressed at similar levels in wild-type and mutant cells (Figure 3K). [score:6]
Expression of members of the miR-34 family was similarly upregulated in response to p53 stabilization (Figure 3G). [score:6]
In addition, miR-449 expression is not substantially increased in miR-34 -null mice, and activation of the p53 pathway does not lead to significant upregulation of miR-449 (Figure S8). [score:6]
We also examined the consequences of miR-34 loss in MEFs on the expression of a subset of its previously reported direct targets [17], [20], [23], [25]. [score:6]
Thus, although a longer follow-up of miR-34 [T KO/T KO] mice may be needed to uncover very subtle defects in tumor suppression, we conclude that loss of miR-34 expression does not lead to a substantial increase in spontaneous tumorigenesis. [score:5]
Because previous work has relied on the use of miRNA antagonists to inhibit miR-34 function, it is possible that some of the previous observations reflected miR-34-independent off-target effects. [score:5]
With respect to the potential tumor suppressive role of miR-34, our experiments indicate that loss of miR-34 expression does not lead to an obvious increase in tumor incidence in mice and does not cooperate with Myc in the context of B cell lymphomagenesis. [score:5]
Importantly, in these three tissues, miR-34 expression is almost entirely p53-independent (Figure 1B–1D and [58]), a finding that suggests that additional transcription factors control the expression of this family of miRNAs in the absence of genotoxic or oncogenic stresses. [score:5]
Consistent with a possible tumor-suppressor role, loss of expression of members of the miR-34 family has been reported in human cancers. [score:5]
Here, we probe the tumor suppressive functions of the miR-34 family in vivo by generating mice carrying targeted deletion of the entire miR-34 family. [score:5]
The upregulation of Myc and E2f3 might contribute to the increased proliferation rate we have observed in miR-34 deficient MEFs. [score:4]
Importantly, homozygous deletion of miR-34a did not lead to compensatory up-regulation of miR-34b∼c, and vice versa (Figure 2D and data not shown). [score:4]
Consistent with previous reports indicating that miR-34a expression is under the direct control of p53 [13], [17], [18], we detected reduced levels of this miRNA in a subset of p53 -deficient tissues (heart, small and large intestine, liver and kidney), but the levels of both miR-34a and miR-34b∼c remained high in the brains, testes and lungs (Figure 1B–1D) of p53 [−/−] mice, a finding that suggests that p53-independent mechanisms determine basal miR-34 transcription in these tissues. [score:4]
Many of the predicted miR-34 target genes encode for proteins that are involved in cell cycle regulation, apoptosis, and growth factor signaling. [score:4]
Our results show that complete loss of miR-34 expression is compatible with normal development and that the p53 pathway is apparently intact in miR-34 -deficient mice. [score:4]
Canonical p53 -binding sites are located in the promoter regions of both miR-34a and miR-34b∼c, and these miRNAs are bona fide direct transcriptional targets of p53 [13], [17], [18]. [score:4]
miR-34 and tumor suppression in vivo To extend our analysis to an in vivo setting, we next examined whether miR-34 inactivation is sufficient to accelerate spontaneous and oncogene -induced transformation in mice. [score:3]
Although our observation that single KO and miR-34 [T KO/T KO] mice produce viable offspring argues against an essential role for miR-34 in these processes, members of the related miR-449 family, that are particularly highly expressed in the testis (Figure S8), could partially compensate for miR-34 loss in this context. [score:3]
Despite the growing body of evidence supporting this hypothesis, previous studies on miR-34 have been done in vitro or using non-physiologic expression levels of miR-34. [score:3]
p53 -dependent and p53-independent miR-34 expression in vivo. [score:3]
High contribution chimeras were crossed to Actin-flpe transgenic mice for germline transmission of the targeted allele and to delete the Neo cassette resulting in the miR-34b∼c [Δ] allele. [score:3]
Consistent with these results, doxorubicin treatment caused similar activation of p53 and of its downstream targets in wild-type and miR-34 [T KO/T KO] MEFs (Figure 3E and 3F). [score:3]
To test whether miR-34 plays a role in this context, we ectopically expressed oncogenic K-Ras in wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs. [score:3]
Next, we sought to determine whether loss of miR-34 expression affects the p53 response in vitro. [score:3]
Members of the miR-34 family (miR-34a, miR-34b, and miR-34c) have been wi dely speculated to be important tumor suppressors and mediators of p53 function. [score:3]
Complete loss of miR-34 expression in miR-34 [T KO/T KO] animals was confirmed by Northern blot and qPCR (Figure 2D). [score:3]
Figure S1 Relative miR-34 expression in mouse tissues upon irradiation. [score:3]
Although these observations point towards an important role for miR-34 members as critical downstream effectors of p53 and potential tumor suppressors, these hypotheses have not been formally tested using miR-34 -deficient animals and cells. [score:3]
Our results show that the miR-34 family is not required for tumor suppression in vivo, and they suggest p53-independent functions for this family of miRNAs. [score:3]
We have reported the generation of mice carrying targeted deletion of miR-34a, miR-34b and miR-34c, and we have investigated the consequences of loss of miR-34 expression on p53 -dependent responses in vitro and in vivo. [score:3]
In humans, for example, loss of miR-34 expression has been reported in a large fraction of primary melanomas, prostatic adenocarcinomas and small cell lung cancers [27], [28], among others. [score:3]
However, the tumor suppressive function of miR-34 might be restricted to specific tissues and loss of miR-34 might cooperate with specific oncogenic lesions. [score:3]
Ectopic expression of members of the miR-34 family is sufficient to induce cell cycle arrest or apoptosis, depending on the cellular context [14], [17]– [21]. [score:3]
To determine whether loss of miR-34 expression leads to increased spontaneous tumorigenesis, we aged a cohort of 14 miR-34 [T KO/T KO] and 12 wild-type mice. [score:3]
Targeted deletion of miR-34a and miR-34b∼c. [score:3]
miR-34 and tumor suppression in vitro. [score:3]
We show that under basal conditions the expression of both miR-34 loci is particularly elevated in the testes and, to a lesser extent, in the brains and lungs of mice. [score:3]
miR-34 and tumor suppression in vitro The p53 pathway provides a crucial barrier against the neoplastic transformation of primary cells [40]. [score:3]
In addition, inactivation of miR-34 expression has been recently shown to lead to accelerated neurodegeneration and ageing in Drosophila melanogaster [64]. [score:3]
miR-34 and tumor suppression in vivo. [score:3]
Introducing the miR-34 -null alleles we have generated into mouse mo dels of these types of human cancers will be important to fully explore the tumor suppressive potential of this family of miRNAs. [score:3]
MiR-34b∼c expression seems largely restricted to these three tissues, while miR-34a is detectable, albeit at lower levels, also in a variety of other organs (Figure 1B–1D). [score:3]
These results show that while miR-34 alone is not required for p53 -mediated tumor suppression in MEFs, its loss might cooperate with inactivation of the Rb pathway in promoting cellular transformation. [score:3]
P53 -dependent cell cycle arrest in miR-34 [T KO/T KO] MEFsNext, we sought to determine whether loss of miR-34 expression affects the p53 response in vitro. [score:3]
Under basal conditions, miR-34a and miR-34b∼c expression is particularly intense in the testis, brain, and lung of adult mice (Figure 1B–1D). [score:3]
p53 -dependent and p53-independent miR-34 expression in vivo To investigate the biological functions of miR-34, we first examined the expression of this family of miRNAs under basal conditions and in response to p53 activation in vivo. [score:3]
However, even in this context complete loss of miR-34 expression was not sufficient to accelerate tumor formation. [score:3]
Consistent with this mo del is our observation that while loss of miR-34 expression alone does not allow the transformation of primary cells by oncogenic K-Ras, it slightly increases the efficiency of transformation when combined with inactivation of the Rb pathway by E1A (Figure 5A, 5B). [score:3]
Recent reports have also implicated miR-34 in neuronal development and behavior [60], [61] and a role for miR-34c in learning and memory [62], as well as in stress -induced anxiety [63], has been reported. [score:2]
It is also possible that other miRNAs sharing sequence similarities with miR-34 may compensate for miR-34 loss in the knock-out animals. [score:2]
However, when MEFs were co-transduced with oncogenic K-Ras and E1A, which binds to and inhibits the retinoblastoma protein (pRb) [42], we observed a slight increase in the number of foci formed in miR-34 [T KO/T KO] MEFs compared to wild-type cells (Figure 5A, 5B). [score:2]
MiR-34 expression in wild-type and p53 [−/−] mouse tissues. [score:2]
Although we detected a remarkable induction of miR-34a and miR-34c expression in late-passage wild-type MEFs compared to early-passage MEFs (Figure 3A), miR-34 -deficient MEFs became senescent with a kinetic identical to wild-type MEFs (Figure 3B). [score:2]
To exclude the possibility that tissue culture conditions may have masked a physiologic role of miR-34 in modulating the p53 response, we next examined the consequences of p53 activation in miR-34 -deficient tissues directly in vivo. [score:2]
Generation of miR-34 constitutive and conditional knockout mice. [score:2]
In particular, three highly related miRNAs—miR-34a, miR-34b, and miR-34c (Figure 1A)—are directly induced upon p53 activation in multiple cell types and have been proposed to modulate p53 function [13]– [20]. [score:2]
Age range of the cohorts is 359–521 days (mean: 464 days) for wild-type and 359–521 days (mean: 445 days) for miR-34 [T KO/T KO]. [score:1]
Although it will be important to follow a larger cohort of animals over a more prolonged period, these results suggest that miR-34 does not provide a potent barrier to tumorigenesis in response to genotoxic stress in vivo. [score:1]
Although as predicted, p53 -null cells failed to arrest in G1 in response to doxorubicin treatment, the response of miR-34 [T KO/T KO] MEFs was indistinguishable from that of wild-type cells (Figure 3H–3I). [score:1]
Thymocytes were isolated from sex-matched, age-matched wild-type, miR-34 [T KO/T KO], and p53 [−/−] mice and seeded at a density of 1×10 [6] cells/ml in MEF medium. [score:1]
For example, p53 has been proposed to modulate autophagy [55] and stem cell quiescence [56], [57] and we cannot exclude that miR-34 plays an important role in these contexts. [score:1]
1002797.g005 Figure 5Oncogene -induced transformation in miR-34 [T KO/T KO] fibroblasts and mice. [score:1]
Age- and sex-matched wild-type, miR-34 [T KO/T KO] and p53 [−/−] mice were exposed to 10 Gy of ionizing radiation and euthanized 6 hours later. [score:1]
The precursors of these miRNAs are transcribed from two distinct loci: the miR-34a locus on chromosome 1p36 and the miR-34b∼c locus on chromosome 11q23. [score:1]
P53 -dependent cell cycle arrest in miR-34 [T KO/T KO] MEFs. [score:1]
Both wild-type and miR-34 -deficient mice appeared healthy throughout the follow-up period (Figure S7), in striking contrast with the ∼15 weeks reported median tumor-free survival of irradiated p53 [−/−] mice [52]. [score:1]
The miR-34b∼c [+/−] mice were intercrossed to obtain miR-34b∼c [−/−] animals. [score:1]
To extend our analysis to an in vivo setting, we next examined whether miR-34 inactivation is sufficient to accelerate spontaneous and oncogene -induced transformation in mice. [score:1]
Furthermore, loss-of-function studies using miR-34 antagonists have provided some evidence that this miRNA family is required for p53 function [13], [18], [22]– [24]. [score:1]
The miR-34a< floxed> mice and the miR-34b∼c−/− mice are available to the research community through The Jackson Laboratory (JAX Stock Numbers 018545 and 018546). [score:1]
The incidence and latency of B cell lymphomas was virtually identical in Eμ-Myc;miR-34 [T KO/T KO] and Eμ-Myc;miR-34 [+/+] mice (Figure 5C) and the resulting tumors displayed similar histopathological features and extent of spontaneous apoptosis (Figure 5D–5E). [score:1]
As expected, p53 [−/−] thymocytes were almost entirely resistant to irradiation -induced apoptosis; however, wild-type and miR-34 -deficient cells were equally sensitive to DNA damage -induced apoptosis, as judged by dose-response and time-course experiments (Figure 4A, 4B). [score:1]
Representative pictures of miR-34a [−/−] (E), miR-34b∼c [−/−] (F), and miR-34 [T KO/T KO] (G) males at 4 weeks of age. [score:1]
Samples obtained from sex- and age-matched adult (age range 3–16 months) wild-type and miR-34 [T KO/T KO] mice were subjected to a standard panel of serum chemistry tests to determine liver and kidney function (n≥5 per genotype). [score:1]
More difficult, however, is to reconcile our findings with previous reports of impaired p53-function in cells treated with miR-34 antagonists. [score:1]
Figure S5Serum chemistry of age- and sex-matched wild-type and miR-34 -deficient mice. [score:1]
Wild-type, miR-34 [T KO/T KO], p53 [−/−] MEFs were seeded at 70% confluence and infected with virus. [score:1]
For the irradiation experiments, 150,000 wild-type, miR-34 [T KO/T KO] and p53 [−/−] MEFs were seeded into each well of a 6-well culture plate and starved for 72 hours. [score:1]
For the miR-34 [T KO] allele (G), double heterozygous mice were inter-crossed. [score:1]
We next sought to determine whether loss of miR-34 might accelerate tumor formation in response to genotoxic stress. [score:1]
Based on these results we conclude that miR-34 function is not required for p53 -induced cell-cycle arrest and apoptosis in response to genotoxic stresses. [score:1]
Age range of the cohorts is 298–425 days (mean: 333 days) for wild-type and 387–425 days (mean: 401 days) for miR-34 [T KO/T KO]. [score:1]
An additional issue raised by the results presented in this manuscript relates to possible p53-independent functions of miR-34. [score:1]
Future studies using the miR-34 -deficient animals we have generated will be needed to test these possibilities. [score:1]
These findings highlight likely redundancies among p53's downstream effectors, show that the miR-34 family is largely dispensable for p53 function in vivo, and suggest possible p53-independent functions. [score:1]
MiR-34a [−/−] and miR-34b∼c [−/−] single KO mice were viable and fertile and were obtained at the expected Men delian frequency (Figure 2E, 2F). [score:1]
The animals were monitored for at least 12 months (wild-type = 359 days; miR-34 [T KO/T KO] = 359 days) and up to 17.3 months (wild-type = 521 days; miR-34 [T KO/T KO] = 521 days). [score:1]
Wild-type and miR-34 [T KO/T KO] MEFs were seeded into a 6-well plate (40,000 cells/well) and counted every day for the growth curves. [score:1]
Here we report the generation of mice carrying targeted deletion of all three members of the miR-34 family and systematically investigate the impact of miR-34 loss on the p53 pathway. [score:1]
To examine the consequences of complete loss of miR-34 function, we crossed miR-34a [−/−] and miR-34b∼c [−/−] mice to generate compound mutant animals carrying homozygous deletion of all three family members (miR-34 [T KO/T KO]). [score:1]
One notable exception is a recent elegant paper by Choi and colleagues demonstrating that miR-34 -deficient MEFs are more susceptible to reprogramming [30]. [score:1]
To investigate the physiologic functions of the miR-34 family and to determine the extent to which its induction is required for p53 function, we generated mice carrying targeted deletion of both miR-34a and miR-34b∼c loci (Figure 2A–2C). [score:1]
The results presented in this paper do not necessarily conflict with previous experiments showing that ectopic expression of miR-34 can induce many of the most characteristic consequences of p53 activation; here we have tested whether miR-34 is necessary for p53 function and not whether it is sufficient. [score:1]
Epigenetic silencing of miR-34 members has also been reported in human cancers. [score:1]
We next examined the role of miR-34 in the response to the DNA damaging agent doxorubicin. [score:1]
Peripheral blood samples obtained from sex- and age-matched adult (age range 3–16 months) wild-type (WT) and miR-34 -null (T KO) mice were subjected to complete blood cell count (n≥5 per genotype). [score:1]
For BrdU cell cycle analysis, wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs were plated in complete medium at 70% confluence, treated with varying doses of doxorubicin for 16 hours or treated at different time points, and pulsed with 10 µM BrdU for one hour. [score:1]
Finally, we sought to determine whether genetic ablation of miR-34 could contribute to tumor formation in cooperation with a defined oncogenic lesion. [score:1]
Response to p53 activation in miR-34 [T KO/T KO] mouse embryonic fibroblasts (MEFs). [score:1]
In particular, members of the miR-449 family (miR-449a, b and c) have the same “seed” sequence as miR-34, and miR-34 antagonists could in principle impair their function as well. [score:1]
The experiments described above were performed on asynchronously growing early-passage MEFs and as such may not be sensitive enough to detect a modest effect of miR-34 loss on the S-phase checkpoint. [score:1]
Oncogene -induced transformation in miR-34 [T KO/T KO] fibroblasts and mice. [score:1]
This interpretation is also consistent with the faster proliferation rate displayed by miR-34 -deficient MEFs (Figure 3B, 3C) and with the observation by Lal and colleagues that miR-34a is involved in modulating the cellular response to growth factors [38]. [score:1]
RNAs from miR-34 [T KO/T KO] tissues were included to control for cross-hybridization. [score:1]
Five Eμ-Myc;miR-34 [+/+] tumors and and four Eμ-Myc;miR-34 [T KO/T KO] tumors were analyzed. [score:1]
The most logical interpretation of these results is that miR-34 -deficient MEFs, rather than being more resistant to irradiation -induced cell cycle arrest, possess a slightly faster basal proliferation or more rapid re-entry into the cell cycle following serum starvation. [score:1]
P53 -dependent apoptosis in miR-34 [T KO/T KO] cells and mice Having established that miR-34 is not required for cell cycle arrest in response to genotoxic stress in MEFs, we next sought to determine whether this miRNA family might contribute to p53 -induced apoptosis. [score:1]
Ionizing radiation induced similar activation of the p53 pathway and of its downstream effectors in wild-type and miR-34 [T KO/T KO] mice (Figure 4C). [score:1]
The standard 3T3 protocol was followed to determine the cumulative population doublings of wild-type, miR-34 [T KO/T KO], and p53 [−/−] MEFs. [score:1]
To investigate the biological functions of miR-34, we first examined the expression of this family of miRNAs under basal conditions and in response to p53 activation in vivo. [score:1]
1002797.g003 Figure 3Response to p53 activation in miR-34 [T KO/T KO] mouse embryonic fibroblasts (MEFs). [score:1]
The sequence similarity between the three miR-34 family members (Figure 1A), which share the same “seed”, suggests that they may be functionally redundant. [score:1]
MiR-34 wild-type and miR-34 [T KO/T KO] MEF lines were also verified by qPCR. [score:1]
However, the consequences of miR-34 loss on p53 function were not examined in detail. [score:1]
Our observation that inactivation of miR-34 does not impair p53 -mediated responses in vitro and in vivo is particularly relevant because a key role for miR-34 in the p53 pathway had been previously proposed by a number of independent groups. [score:1]
Having established that miR-34 is not required for cell cycle arrest in response to genotoxic stress in MEFs, we next sought to determine whether this miRNA family might contribute to p53 -induced apoptosis. [score:1]
To generate mice carrying deletion of the miR-34b∼c bicistronic cluster, we used recombineering to replace a 1.3 kbp DNA region in BAC RP-23-281F13 containing pre-miR-34b and pre-miR-34c with a frt-Neo-frt cassette. [score:1]
Figure S4 Complete blood cell count of age- and sex-matched wild-type and miR-34 -deficient mice. [score:1]
The results are representatitve of two independent experiments performed on a total of four wild-type and four miR-34 [T KO/T KO] MEF lines. [score:1]
Experiments were performed on three independent wild-type and three independent miR-34 [T KO/T KO] MEF lines. [score:1]
Figure S7Overall survival of wild-type and miR-34 [T KO/T KO] cohorts. [score:1]
An analysis of the major myeloid and lymphoid populations of the bone marrow, spleen and thymus also did not reveal any statistically significant difference between wild-type and miR-34 [T KO/T KO] mice (Figure S6). [score:1]
Representative images of hematoxylin and eosin staining of heart, kidney, liver, lung, small intestine, ovary, testis, and spleen (black scale bar, 200 µm), brain (green scale bar, 2000 µm), and colon (red scale bar, 100 µm) from wild-type and miR-34 [T KO/T KO] mice. [score:1]
Analogous to what we observed in thymocytes in vitro, the apoptotic response was equally dramatic in wild-type and in miR-34 -deficient mice, while it was virtually absent in p53 [−/−] animals (Figure 4D–4G). [score:1]
Similarly, loss of 11q23, containing the miR-34b∼c locus, has been reported in prostate cancers [26]. [score:1]
P53 -dependent apoptosis in miR-34 [T KO/T KO] cells and mice. [score:1]
We therefore exposed a cohort of 14 miR-34 [T KO/T KO] and 11 wild-type mice to 1 Gy of ionizing radiation soon after birth and monitored them for 42–60 weeks. [score:1]
Notice the loss of signal for miR-449b in the miR-34 [T KO/T KO] lung and testis samples, which likely reflects cross-hybridization of the miR-449b probe to miR-34. [score:1]
Generation of miR-34 -deficient mice. [score:1]
miR-34 [T KO/T KO] embryos were obtained by intercrossing miR-34 mutant mice. [score:1]
We therefore examined the effects of DNA damage on thymocytes from wild-type, p53 [−/−], and miR-34 [T KO/T KO] mice. [score:1]
Figure S6Bone marrow, spleen and thymus analysis of age- and sex-matched wild-type and miR-34 [T KO/T KO] mice. [score:1]
A conclusive test for this hypothesis will require the generation of compound miR-34 and miR-449 mutant animals, but several lines of evidence suggest that this explanation is not particularly likely. [score:1]
A full histological examination (Figure S3), complete blood cell count (Figure S4), and serum chemistry analysis (Figure S5) did not detect any statistically significant defects in adult miR-34 [T KO/T KO] mice of both sexes. [score:1]
Promoter hyper-methylation of miR-34a is observed in non-small-cell lung cancers and melanomas [27], [28], and silencing of miR-34a and miR-34b∼c has been described in human epithelial ovarian cancers [29]. [score:1]
[1 to 20 of 135 sentences]
4
[+] score: 197
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34c, mmu-mir-34a, hsa-mir-34b, hsa-mir-34c
We next examined whether SAMe and MTA treatment might influence miR-34a and miR-34b expression because they inhibit IL-6/STAT3 activation [6], which inhibits miR-34a expression [5], and they lower MAT2A expression [7], which contains possible binding sequences in its 3’UTR for miR-34a and miR-34b. [score:11]
MAT2A and MAT2B expression is upregulated in human prostate and pancreas cancers and down-regulated by SAMe, MTA, miR-34a and miR-34b. [score:9]
We suspect MTA is the mediator of SAMe on miR-34a and miR-34b expression, as MTA is a potent inhibitor of methylation [20] and previous studies have shown inhibiting DNA methylation raised the expression of both miRNAs [18, 19]. [score:9]
The aims of the current work were to examine whether miR-34 family members regulate MAT2A and MAT2B expression and whether SAMe and MTA target this axis in multiple human cancers where miR-34a has been reported to be down-regulated. [score:9]
In cancer cells miRNA-34a and miR-34b are often down-regulated, releasing the inhibition on MAT2A expression. [score:8]
In normal non-hepatic tissues, miR-34a and miR-34b negatively regulate MAT2A expression mainly by suppressing its protein translation. [score:8]
Figure 12 In normal non-hepatic tissues, miR-34a and miR-34b negatively regulate MAT2A expression mainly by suppressing its protein translation. [score:8]
MAT2A and MAT2B expression is down-regulated by SAMe, MTA, miR-34a and miR-34b in pancreatic cancer cell line. [score:6]
All three family members are direct transcriptional targets of p53 and many of the targets of the miR-34 family members are involved in cell cycle, apoptosis, invasion and migration [2, 4]. [score:6]
MAT2A and MAT2B expression is down-regulated by SAMe, MTA, miR-34a and miR-34b in prostate cancer cell line. [score:6]
SAMe and MTA induce the expression of miR-34a and miR-34b and all four treatments lower the expression of MAT2A and MAT2B. [score:5]
There are consensus binding sites for miR-34a and miR-34b in the MAT2A 3’-UTR based on three different miRNA prediction target databases (TargetScan, mirDB, miRSVR, Segal Lab of Computational Biology). [score:5]
Treatment with SAMe, MTA, overexpression of miR-34a or miR-34b lowered the expression of MAT2A and MAT2B mainly at the protein levels in both CWR22Rv-1 (Figure 8A and 8B) and MIA PaCa-2 (Figure 9A and 9B) cells. [score:5]
MiR-34 family members are transcriptional targets of p53 and p53 was shown to inhibit CRC metastasis by inducing miR-34a [5]. [score:5]
These findings raised the questions whether 1) SAMe and MTA can inhibit migration and invasion, 2) miR-34a and miR-34b can target MAT2A, and if so, 3) what is the role of MAT2A in mediating the effects of miR-34a/b. [score:5]
Overexpressing miR-34a or miR-34b reduced R KO cell migration, invasion and growth; whereas overexpressing either MAT2A or MAT2B had the opposite effects (Figure 4A–4C). [score:5]
In summary, we have identified MAT2A and MAT2B as direct and indirect targets of miR-34a and miR-34b, and that the two MAT proteins are important mediators of the effect of miR-34a/b on cancer cell growth, migration and invasion. [score:5]
SAMe and MTA induce the expression of miR-34a and miR-34b and all four treatments induce apoptosis and inhibit growth of colon cancer cells. [score:5]
When compared side by side, SAMe and MTA treatment for 24 hours exerted comparable effects on apoptosis and growth inhibition as overexpressing either miR-34a or miR-34b (Figure 2C and 2D). [score:4]
This signaling pathway is known to suppress miR-34a [5] but whether it regulates miR-34b is unknown. [score:4]
Thus, miR-34a and miR-34b could impact MAT2B expression and its downstream signaling pathway indirectly via MAT2A. [score:4]
Overexpressing either miR-34a or miR-34b had minimal to no influence on MAT2A mRNA levels but they reduced MATα2 levels by 45-60% (Figure 3A and 3B). [score:3]
Co -expressing either miR-34a or miR-34b with MAT2B had no influence on MAT2B’s inductive effect on migration, invasion or growth (Figure 4A–4C). [score:3]
CWR22Rv1 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Figure 8CWR22Rv1 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Both agents also lower MAT2A expression [7] and consensus binding sites for miR-34a and miR-34b are present in the MAT2A 3’-UTR. [score:3]
MIA PaCa-2 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Figure 9MIA PaCa-2 cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Similar to the CRCs, SAMe and MTA treatment raised miR-34a and miR-34b expression (Figures 8C and 9C). [score:3]
The finding that overexpressing miR-34a or miR-34b had minimal to no influence on the inductive effect of MAT2A/MAT2B on CRC growth, migration or invasion supports an important role of these two MAT proteins in mediating the effects of miR-34a/b on these parameters. [score:3]
MiR-34a and miR-34b were overexpressed as describe above. [score:3]
Treatment with SAMe or MTA in cancer cells increases the expression of miR-34a and miR-34b. [score:3]
R KO (A) and SW620 (B) cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
Both miR-34a and miR-34b have also been shown to behave as tumor suppressors in prostate and pancreatic cancers [1, 3, 27, 28]. [score:3]
Effects of SAMe, MTA, miR-34a and miR-34b on MAT2A and MAT2B expression. [score:3]
Figure 3R KO (A) and SW620 (B) cells were treated with 250 μM SAMe or MTA, or overexpression of miR-34a or miR-34b as described in Methods for 24 hours. [score:3]
We found both SAMe and MTA inhibited CRC cell migration and invasion, which may be in part mediated by its inductive effect on miR-34a and miR-34b. [score:3]
Co -expressing miR-34b with MAT2A only reduced the effect of MAT2A on migration slightly, but had no effect on invasion or growth. [score:3]
Most of the published literature shows miR-34 family members as tumor suppressors [2, 4]. [score:3]
MATβ is a regulatory subunit that interacts with MATα2 [13] and there is no consensus binding site in the 3’UTR of MAT2B for either miR-34a or miR-34b. [score:2]
While miR-34a’s role in tumorigenesis has received a lot of attention, less is known about miR-34b. [score:1]
MiR-34a is part of a family that includes miR-34b and miR-34c, with miR-34a having its own transcript while the other two share a common primary transcript [4]. [score:1]
MiR-34a, miR-34b and empty vectors were purchased from Origene (Rockville, MD) and GeneCopoeia (Rockville, MD), respectively. [score:1]
R KO (C) and SW620 (D) cells were treated with 250 μM SAMe or MTA, overexpression of miR-34a or miR-34b as described in Methods for 24 hours and were processed for apoptosis, growth by BrdU, miR-34 and miR-34b transfection efficiency measurements. [score:1]
Silencing of miR-34b in CRC and miR-34a in Hodgkin lymphoma has been reported to be related to CpG island methylation [18, 19], which appears to contradict the role of SAMe as a methyl donor. [score:1]
Figure 4R KO cells were transfected with empty vector (EV), miR-34a, miR-34b, MAT2A or MAT2B expression vectors alone or in combination for 24 hours for measurement of cell migration (A), invasion (B) and growth (C) as described in Methods. [score:1]
SAMe and MTA treatment for 24 hours increased the mRNA levels of miR-34a and miR-34b in both CRC cell lines (Figure 2A) and a direct effect of miR-34a and miR-34b on MAT2A 3’UTR was confirmed using reporter assay (Figure 2B). [score:1]
Effects of MAT2A, MAT2B, miR-34a and miR-34b in colon cancer cell migration, invasion and growth. [score:1]
R KO cells were transfected with empty vector (EV), miR-34a, miR-34b, MAT2A or MAT2B expression vectors alone or in combination for 24 hours for measurement of cell migration (A), invasion (B) and growth (C) as described in Methods. [score:1]
[1 to 20 of 49 sentences]
5
[+] score: 168
About half the mRNAs down-regulated by miR-34b or miR-34c were also down-regulated by miR-34a, but less than a fifth (91 of 482) of the genes down-regulated after miR-34a overexpression were down-regulated by miR-34b or miR-34c (Fig 2A), suggesting that individual miR-34 miRNAs regulate unique targets. [score:18]
Activation of p53 by cellular stress leads to transcription of miR-34 miRNAs, which in turn can enhance p53 function by: (1) miR-34a -mediated inhibition of multiple negative regulators of p53 to further increase p53 transcriptional activity; and (2) miR-34a -mediated increase of p53 protein stability (miR-34a feed-forward loops); or inhibit p53 function by: (3) direct miR-34a -mediated inhibition of TP53; and (4) direct miR-34 inhibition of many p53-activated genes (negative feedback loops). [score:12]
Although mature miR-34b and miR-34c have sequences almost identical to miR-34a even outside the seed, over -expression of miR-34b or miR-34c, unlike over -expression of miR-34a, had little effect on p53 promoter activity and only weakly up-regulated the mRNA levels of p53 transcriptional targets. [score:10]
Consistent with this result, induction of 6 p53 transcriptional targets in HCT116 cells was significantly less after miR-34b or miR-34c overexpression than after miR-34a overexpression (Fig 1D), despite highly elevated miRNA overexpression (S1A Fig). [score:9]
Although miR-34b/c suppressed genes were also enriched for involvement in the cell cycle, most of the over-represented processes of the miR-34b/c suppressed genes had non-overlapping functions in protein metabolism/translation, cell adhesion/motility/migration, and apoptosis/cell death (Fig 2C and 2D), some of which are related to impaired development of ciliated tissues seen in KO mice [6, 7]. [score:8]
Although all three family members regulated cell cycle progression, miR-34b/c over -expression down-regulated mRNAs that mostly function in different biological processes than miR-34a. [score:7]
Functional Annotation Analysis of downregulated genes in HCT116 cells overexpressing miR-34 using DAVID Bioinformatics tool. [score:6]
482, 163 and 29 mRNAs were significantly down-regulated (fold decrease ≥ 1.5 fold relative to miRNA control) after miR-34a, miR-34b or miR-34c overexpression, respectively (Fig 2A and S1 Table). [score:6]
Genes down-regulated by miR-34 over -expression in HCT116 cells. [score:6]
As expected, miR-34 overexpression decreased the miR-34a target gene CDK6 and increased the p53-activated gene CDKN1A, assessed as controls. [score:5]
In mice, miR-34a is expressed in most tissues, while miR-34b/c are predominantly expressed in lung and testis [4, 5]. [score:5]
miR-34b-5p (hereafter designated miR-34b) overexpression had a modest, but significant, effect on 2 of the 4 promoters, while miR-34c did not significantly increase activity of any (Fig 1C), even though it was over-expressed more than a hundred fold above its endogenous level after genotoxic stress (data not shown). [score:5]
We set out to study how the different miR-34 miRNAs contribute to p53 function, analyze whether they regulate overlapping sets of targets and determine if miR-34 is essential for p53 -mediated function in human cells. [score:4]
To determine whether the miR-34 family might regulate non-overlapping mRNAs, we performed gene microarray analysis of HCT116 cells overexpressing each family member (S1B Fig). [score:4]
In addition, the lack of a strong effect of genetic deletion of miR-34a could also be secondary to functional redundancy provided by the other miR-34 members or other p53-regulated tumor suppressor miRNAs [45– 49] or by the p53-independent miR-449 family, which shares a seed sequence with miR-34 [50]. [score:4]
In mice, miR34b/c and the related miR-449 cluster are expressed specifically in multiciliated epithelia and their KO causes infertility and respiratory dysfunction [6, 7], supporting their distinct roles. [score:3]
A better knowledge of the mutual functional dependence between miR-34 and p53 will help to understand miR-34 tumor suppressor function. [score:3]
We next used luciferase reporter promoter assays, in p53-sufficient HCT116 cells, to assess whether miR-34 overexpression enhanced promoter activities of a sequence of 13 tandem repeats of the p53 binding site (pG13-luc) [16] or the promoters of p53-regulated genes, PUMA, CDKN1A (the gene encoding p21/WAF1) and BAX. [score:3]
Our observation that only miR-34a overexpression enhances p53 -mediated transcription was surprising since the miR-34 family active strands are highly homologous—the seed (residues 2–9) and residues 11–17 and 19–21 are identical (Fig 1C). [score:3]
An unexpected finding of this study was the weak effect of miR-34b or miR-34c over -expression on p53 function. [score:3]
Analysis of miR-34 levels in miR-34 over -expressing samples. [score:3]
Of note, for both experiments, miR-34c expression is ~ 9 fold less than in miR-34b transfected samples. [score:3]
Ectopic expression of miR-34a, but not miR-34b/c, increases p53 transcriptional activity. [score:3]
0132767.g002 Fig 2 (A) Overlap of genes down-regulated ≥ 1.5 fold in miR-34 OE HCT116 cells compared to control -transfected cells. [score:3]
Single colonies were tested for miR-34 expression by qRT-PCR and negative colonies were verified by sequencing. [score:3]
Overexpression of miR-34a, but not miR-34b/c, enhances p53 transcription in HCT116 cells. [score:3]
Since their initial identification as p53 transcriptional targets, the three members of the miR-34 family have been considered crucial mediators of the p53 response [39]. [score:2]
miR-34a and miR-34b/c regulate different biological processes. [score:2]
Here, we provide evidence showing that, despite sharing an identical seed sequence, miR-34b/c do not enhance p53 transcriptional activity and they regulate non-overlapping genes, involved in distinct biological processes. [score:2]
Multiple miRNAs, including the miR-34 family, are transcriptionally activated by p53. [score:1]
These data together suggest that miR-34a and miR-34b/c serve different biological functions. [score:1]
Our results showing that miR-34a is not essential for the p53 mediated response to stress are in agreement with data published by Concepcion et al reporting intact p53 function in miR-34 deficient mice [12]. [score:1]
The miR-34 family consists of 3 miRNAs—miR-34a on human chromosome 1p36 and miR-34b/c, co-transcribed on human chromosome 11q23. [score:1]
Genome-wide transcriptome analysis of miR-34 OE HCT116 cells. [score:1]
Thus sequence determinants outside the seed might profoundly affect miR-34 family function by an unknown mechanism that is worth exploring. [score:1]
Future experiments with miR-34 -deficient human cells should address the contribution of miR-34 in these other scenarios. [score:1]
Mean +/- SD of three independent experiments is shown in cells transfected with miR-34 family or cel-miR-67 (M-control) mimics. [score:1]
Thus miR-34 -mediated increased p53 transcription is largely limited to miR-34a. [score:1]
Because their levels are so low, endogenous miR-34b/c are unlikely to function in these cells. [score:1]
miR-34—a microRNA replacement therapy is headed to the clinic. [score:1]
Normalized Firefly luciferase activity, relative to Renilla luciferase activity, after miR-34 transfection is plotted as fold change relative to control miRNA -transfected sample. [score:1]
Alignment of the miR-34 family with the seed sequence highlighted in red is shown at top. [score:1]
miR-34b/c levels were analyzed by qRT-PCR. [score:1]
WT cells have <1 copy/cell of miR-34b and miR-34c, which only increases to 5 and 10 copies/cell, respectively, after DOX (Fig 6C). [score:1]
Three chromosome 5q11.2 miRNAs (miR-449a/b/c) share a seed sequence with miR-34, and have a tissue distribution similar to that of miR-34b/c [6, 7]. [score:1]
miR-34 levels in transfected samples from Fig 1D (A) and Fig 2 (B), analyzed by qRT-PCR. [score:1]
In this regard, it has been shown recently that somatic cells from miR-34 deficient mice can be reprogrammed more efficiently [51]. [score:1]
Here, we investigated in detail how the different miR-34 family members contribute to p53 function, the miR-34a targets that are relevant for its contribution and how much p53 relies on miR-34a. [score:1]
Although antagonizing miR-34a in human cells impairs p53 function in a few studies [4, 10, 11], mice genetically deficient in all miR-34 family genes have unimpaired stress responses [12]. [score:1]
[1 to 20 of 49 sentences]
6
[+] score: 149
S3 Fig (Panel A) The indicated cell lines were transfected with precursor miR-34b (p-miR-34b-3p), miR-34b inhibitor (a-miR-34b-3p) or with a non -targeting molecule (Ctrl) and analyzed for miR-34b-3p expression by qPCR. [score:7]
In summary, using an integrated discovery platform that included defined cell lines, a genetic mouse mo del of aggressive disease and clinically annotated human samples, we identified downregulation of miR34b and reciprocal increased levels of Sox2 as a biomarker of progressing prostate cancer while still at an androgen -dependent stage. [score:6]
Mechanistically, this pathway reflects epigenetic silencing and DNA copy number loss of the MIR34B/C locus on chromosome 11, resulting in deregulated expression of the downstream stemness target, Sox2 in PCa. [score:6]
Our findings that deregulation of a miR-34b/Sox2 axis occurs early during disease progression, selectively in androgen -dependent cells, suggests that this process may contribute to resistance to androgen ablation therapy, thus heralding an incurable disease stage. [score:6]
β-tubulin was a loading control (Panel C) Heatmap of miR-34b-3p predicted target genes (c-Myc, Met and Sox2) or of known Notch1 responsive genes (Hes-1 and CDKN1A) in prostate cell lines transfected with precursor, antagonist miR-34b or control molecules as in panel B. Red and blue represent high or low gene expression, respectively. [score:5]
For miRNA transfection, cells were seeded at a 5x10 [5] per well in six-well plates, and transfected with 150 pmol of miR-34b inhibitor (a-miR-34b; HSTUD0511), or miR-34b precursor (p-miR34b; HMI0511), or corresponding non -targeting sequences (a-Ctrl or p-Ctrl, respectively HMC0002 and NCSTUD001) in the presence of Lipofectamine 2000 (Life Technologies Inc. [score:5]
These findings may offer a straightforward molecular signature to identify patients at risk of aggressive disease, whereas it may be possible to therapeutically manipulate miR-34b levels as a strategy to oppose disease progression [49]. [score:5]
miR-34b targets expression analysis. [score:5]
Consistent with these observations, forced expression of miR-34b precursor sequences in different prostate cell lines but not antagonist (Panel A in S3 Fig), potently repressed endogenous Sox2 levels in BPH-1 cells (Fig 6A) whereas did not modulate the expression levels of c-Myc, Notch1 and Met (Panels B,C in S3 Fig). [score:5]
Consequently, loss of miR-34b inversely correlated with Sox2 expression in PCa and PIN lesions in humans, while undetectable in normal or hyperplastic epithelium and weakly expressed in myoepithelial cells as also previously described [31, 36, 38]. [score:5]
Consistent with these observations, we have shown here that forced expression of miR-34b potently suppressed the endogenous levels of the stemness factor, Sox2 [33, 34], selectively in androgen -dependent cells. [score:5]
Both CNV#1 and #2 were lost in BPH-1 and LNCaP cell lines, potentially reflecting simultaneous down-regulation of miR-34b/c. [score:4]
Importantly, deregulated miR-34b signaling appears to selectively segregate with androgen -dependent prostate cells, suggesting a potential role of this pathway in disease relapse and potentially in the transition to castrate-resistant stage. [score:4]
MiR-34b and miR-34c are transcribed from the same locus on chromosome 11 (cytogenetic band 11q23.1; Fig 5A), and their expression is regulated by epigenetics, such as CpG island methylation [29], and p53 function [32]. [score:4]
miR-34b expression modulation in prostate cell lines. [score:3]
Lastly, expression of miR-34b-3p accurately discriminated PIN or PCA samples from BPH, by ROC analysis (p<0.0001; S2 Fig). [score:3]
In this analysis, reduced miRNA levels correlated with clinico-pathological progression of PCa (Table 2), and differential expression of mir-31, miR-34b-3p and miR-452 could significantly discriminate patients according to biochemical relapse (Fig 4A). [score:3]
Together, these data suggest that decreased expression of miR-34b in PCa may involve a combination of epigenetic silencing and DNA copy number loss (S2 Table). [score:3]
MiR-34b-3p regulates the expression of stem cell-related factors, including c-Myc, Sox2, Met and Notch1 [33, 34], which have also been implicated in prostate cancer [35– 37]. [score:3]
0130060.g006 Fig 6 A) Sox2 expression was analyzed by immunoblotting in BPH-1 or DU145 cells after transfection with miR-34b mimics or control sequence for 72 h. Untr. [score:3]
The miR-34 family of miRNAs has been previously reported to suppress tumorigenesis by different mechanisms, including modulation of cell cycle transitions, EMT, metastasis, or cancer stemness [33]. [score:3]
In contrast, DU145 cells did not exhibit modulation of miR-34b/c expression, or allelic copy number loss (Fig 5D and 5E). [score:3]
Both miR-31 and miR-34b-3p were differentially expressed between PIN or PCa samples and BPH (p<0.001 by Mann Whitney test; Fig 4B). [score:3]
Sox2 is a miR-34b target in prostate cancer. [score:3]
Conversely, androgen-independent DU145 cells did not exhibit miR34b-modulation of Sox2 expression (Fig 6A), and LNCaP cells had no detectable levels of Sox2 (S4 Fig). [score:3]
p-miR-34b or a-miR-34b, precursor or antagonist miR-34b; p-Ctrl or a-Ctrl, non -targeting controls for precursor or antagonist molecules. [score:3]
Summary of epigenetic and genomic status of MIR34B/C locus according to miR-34b expression in the indicated prostate tissues or cell lines. [score:3]
MiR-31, miR-34b-3p, miR-205, miR-224 and miR-452 showed differential expression levels between normal, PIN and PCa matched samples (p<0.01 by Friedman test; Fig 3). [score:3]
Protein levels of the predicted target c-Myc and Notch1 were analyzed by western blotting (Panel B) in the indicated cell lines modulated for miR-34b levels. [score:3]
A) Sox2 expression was analyzed by immunoblotting in BPH-1 or DU145 cells after transfection with miR-34b mimics or control sequence for 72 h. Untr. [score:3]
Altogether this evidence suggests that miR-34b/Sox2 axe might be involved in the transition from indolent disease (hormone-sensitive PCa) to more aggressive phases. [score:3]
B, C) miR-34b-3p and miR-34c-5p expression in the indicated samples of normal prostate (pool of 10 specimens), benign hyperplasia (BPH), prostate cancer (PCa) or non-neoplastic (RWPE-1), hyperplastic (BPH-1) or tumor (LNCaP, DU145) prostate cell lines. [score:3]
Hyperplastic (BPH-1) or tumor (LNCaP and DU145) prostate cell lines were transfected with miR-34b mimic/inhibitor or controls for 72 hours and total RNA was purified as described above. [score:3]
In this analysis, only four miRNAs were differentially expressed in both human prostate cancer cell lines and tumor samples from TRAMP mice, including miR-34b-3p, miR-34c-5p, miR-138, and miR-224 (Fig 2C and 2D). [score:3]
MicroRNA-34b and MicroRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth. [score:2]
A miR-34b-3p-SOX2 axis is selectively deregulated in androgen -dependent PCa. [score:2]
miR-34b-3p is a biomarker of prostate cancer progression. [score:1]
A partial degree of methylation could be detected in all cell lines but BPH-1, in which MIR34B/C locus was epigenetically silenced (Fig 5F and 5G). [score:1]
In this study, we have shown that loss of miR-34b is associated with progression of prostate cancer, and can accurately discriminate between benign hyperplasia and PIN lesions or infiltrating prostatic adenocarcinoma in humans. [score:1]
S2 Fig Receiver operating curves (ROC) analysis was used to assess the accuracy of miR-34b-3p to discriminate between prostatic intraepithelial neoplasia (PIN), or prostatic carcinoma (PCa) and benign prostatic hyperplasia (BPH). [score:1]
When analyzed for epigenetic status by methylation-specific PCR, the CpG island upstream of the MIR34B/C locus (Fig 5F) was significantly more methylated in prostate cancers than normal or hyperplastic prostate samples (50% versus 30% or 0% respectively, p = 0.026 by chi-square test; Fig 5G). [score:1]
miR-34b-3p levels correctly discriminate between benign and neoplastic prostatic lesions. [score:1]
Therefore, we examined the BPH patients, a subset of PCa samples (randomly selected from series B; Table 1), normal prostate specimens, and non-tumorigenic or invasive prostate cell lines for potential allelic copy number variation, and methylation status of the CpG island of the MIR34B/C locus (Fig 5B–5G). [score:1]
F, G) Analysis of MIR34B/C CpG island epigenetic status was performed by methylation specific PCR in matched normal or neoplastic (PCa) prostate parenchyma, benign hyperplastic samples and prostate cell lines. [score:1]
0130060.g005 Fig 5 A) Schematic diagram of human MIR34B/C locus on chromosome 11q. [score:1]
MIR34B/C gene analysis in prostate cells and human tissues. [score:1]
Methylation analysis of MIR34B/C CpG island. [score:1]
p-miR-34b, precursor-miR-34b; a-miR-34b, antagomiR-34b; Ctrl, mock -transfected control. [score:1]
A) Schematic diagram of human MIR34B/C locus on chromosome 11q. [score:1]
[1 to 20 of 49 sentences]
7
[+] score: 129
Inhibition of the entire miR-34 family improved cardiac function, and this was associated with reduced fibrosis, decreased Anp expression, increased angiogenesis, maintenance of Serca2a expression, and up-regulation of several direct targets, including VEGFs, Pofut1, Notch1 and Sema4b [10]. [score:13]
In recognition that cardiovascular disease and cardiac remo deling is associated with simultaneous dysregulation of several miRNAs (e. g. miR-1, miR-34a, miR-133, miR-199b, miR-320 [11], [15], [36]– [38]) or miRNA families (e. g. miR-34 family [10], miR-208 family [39]), tiny 8-mer seed -targeting LNA-antimiRs could provide an advantage by simultaneous inhibition of entire miRNA seed families [10], [27]. [score:8]
Since the miR-34 family has approximately 31–55% more targets in humans (which is dependent on the particular target prediction algorithm used) than miR-34a alone, interventions that modulate the entire miRNA family have greater theoretical potential to generate off-target effects. [score:7]
Whilst inhibition of miR-34a and the miR-34 family is protective in the hearts of mice [10], [11], the effect of prolonged/chronic inhibition of miR-34a and its family members may not be ideal because of its ability to drive tumorigenesis [40], [41], although a recent study has shown that the miR-34 family is not required for tumor suppression in mice [42]. [score:7]
In addition to the tumor suppressive role of miR-34a, miR-34 expression is important for long-term maintenance of the brain, healthy aging and modulation of protein homeostasis with age in Drosophila [47], and miR-34b and miR-34c are key regulators of skeletogenesis [48]. [score:6]
Given the current enthusiasm and anticipation regarding therapeutic development of miR-34a and miR-34 family -targeted antimiRs [11], [21]– [23], and the differences in cardiac protection in acute versus chronic settings [10], [11], it is important to assess the therapeutic potential of inhibiting miR-34a in more sustained pathological settings. [score:6]
Greater therapeutic benefit of inhibiting the entire miR-34 family may be related to the regulation of more target genes. [score:6]
Thus, drugs that target the entire miR-34 family are likely to have greater therapeutic benefit in settings of sustained cardiac stress and severe pathology than inhibition of miR-34a alone. [score:5]
Bar graphs showing the number of predicted targets of miR-34a versus the miR-34 family using three target prediction algorithms in mice and humans (MiRanda 4.0, PicTar, DIANA microT v5.0). [score:5]
All miR-34a targets are also predicted targets of miR-34 family. [score:5]
Furthermore, expression of miR-34 family members was found to be elevated in cardiac tissue from patients with heart disease [19], [20]. [score:5]
Inhibition of the miR-34 family also improved cardiac function and attenuated LV remo deling in a mouse mo del with pre-existing pathological cardiac remo deling and dysfunction due to pressure overload by transverse aortic constriction (TAC) [10], however the therapeutic impact of inhibiting miR-34a alone was not assessed in that study. [score:5]
Identified targets of miR-34a and the miR-34 family which have been associated with improved cardiac outcomes due to their roles related to cell survival, proliferation, cardiac repair and regeneration, maintenance of cardiac function, and angiogenesis include vinculin (Vcl), phosphatase 1 nuclear targeting subunit (also known as PNUTS), vascular endothelial growth factor–A and B (Vegfa, Vegfb), Cyclin D1, Sirt1, Notch1, protein O-fucosyltransferase 1 (Pofut1) and semaphorin 4b (Sema4b) [10], [11]. [score:5]
A possible explanation for the reduced capacity of LNA-antimiR-34a to provide protection in chronic or severe settings of cardiac pathology may be due to increased expression of two other miR-34 -family members, miR-34b and miR-34c (ranging from a ∼1.7 to 4-fold increase in MI or TAC [10]). [score:3]
Thus, this could explain why pharmacologic inhibition was not effective in the TAC severe mo del, and only partially protective in the TAC moderate mo del of pressure overload, which had increased levels of all miR-34 family members (i. e. miR-34a, miR-34b and miR-34c). [score:3]
In a previous study, we reported that inhibition of the miR-34 family attenuated LV remo deling and atrial enlargement in mouse mo dels with established cardiac dysfunction due to MI or pressure overload [10]. [score:3]
This is in contrast to the more favorable effect of inhibiting the entire miR-34 family in the pressure overload mouse mo del in our previous report [10]. [score:3]
Since we identified only modest protection in the moderate mo del of TAC, and no protection in the severe mo del of TAC with LNA-antimiR-34a administration in the present study, we analyzed the expression of the other miR-34 family members (i. e. miR-34b and -34c) in control mice, TAC moderate LNA-control and TAC severe LNA-control mice. [score:3]
The current study and our previous work [10] highlight a different therapeutic benefit of inhibiting a single miRNA (miR-34a) or a miRNA family (miR-34 family) in moderate and severe mo dels of sustained cardiac stress. [score:3]
Expression of miR-34 family members, miR-34b and miR-34c, is elevated in moderate and severe mo dels of pressure overload. [score:3]
We recently found that inhibition of the miR-34 family, but not miR-34a alone, displayed a therapeutic benefit in a chronic mo del of myocardial infarction (MI, with pre-existing cardiac dysfunction and significant left ventricular (LV) remo deling; antimiR delivered 2 days after MI) [10]. [score:3]
Therefore, while miR-34 has marked therapeutic potential in conditions of heart stress, it will be critical to assess the impact of miR-34 in brain, bone and other organs during its development as a therapeutic agent, or may require the development of cardiac-specific approaches [27, 32, 45,] [49]. [score:3]
We have previously shown that LNA-antimiR-34a does not inhibit miR-34b and miR-34c [10], which were both elevated in the TAC severe mo del in this study. [score:3]
Figure S3 Number of predicted targets of miR-34a versus the miR-34 family. [score:3]
We have previously shown that expression of other miR-34 family members, miR-34b and miR-34c, are elevated in settings of cardiac stress [10], [18]. [score:3]
We and others have previously shown that expression of miR-34a is elevated in settings of cardiac stress [10], [18] and ageing [11], and that miR-34 family members, 34b and 34c, are also elevated in the mouse heart following a cardiac insult [10], [18]. [score:3]
Expression of miR-34a, miR-34b and miR-34c in control and TAC mice. [score:3]
As shown by miRNA target prediction databases based on different algorithms (MiRanda, DIANA, PicTar), the miR-34 family is predicted to repress 24–40% (mouse) or 31–55% (human) more mRNAs than miR-34a alone (Figure S3). [score:3]
We have previously shown that LNA-antimiR-34a does not significantly silence miR-34b and miR-34c in the heart [10]. [score:1]
[1 to 20 of 29 sentences]
8
[+] score: 121
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34c, mmu-mir-34a, hsa-mir-34b, hsa-mir-34c
The relative intensity was normalized to the expression of the control sample Fig. 6 a Western blot analysis after Ant34 treatment (50 nM for 7 days as described above), b miR34 transduction and c p63 expression after Numb overexpression. [score:7]
In an opposite way as the inhibition, miR34 overexpression induces a downmodulation of cKit, Notch, and hey-1 expression (Fig.   5b). [score:7]
The mRNA expression on different LNA34 -treated CDCs showed that miR34 inhibition causes an increase of cKit, Notch-1 and hey-1 expression (Fig.   5a). [score:7]
Protein expression analysis after mir34 inhibition, overexpression or Numb transduction. [score:7]
The relative intensity was normalized to the expression of the control sample a Western blot analysis after Ant34 treatment (50 nM for 7 days as described above), b miR34 transduction and c p63 expression after Numb overexpression. [score:7]
It has been demonstrated in mouse mo del that miR34 inhibition reduces cardiac dysfunction 6, 7. Boon and coworkers [7] found that miR34 is implicated in cardiac aging and its downmodulation through LNA inhibition supports cardiac repair in mice after AMI. [score:5]
We observed an increased Numb expression by miR34 inhibition (Fig.   6a). [score:5]
It is worthy to note that LNA34 treatment enhances not only Notch mRNA, but also hey-1 expression, indicating that the Notch pathway is activated after miR34 inhibition. [score:5]
Gene expression analysis after mir34 inhibition or transduction. [score:5]
MiR34 expression directly correlates with age in human biopsies (r = 0.125037328, p = 0.010672365) On the basis of this evidence, we silenced miR34 using an LNA 8mer (Ant34). [score:4]
This indicates an indirect correlation between miR34 expression and proliferation in these cell populations. [score:4]
Our data demonstrate not only that Numb is regulated by miR34 in cardiac stem cells, but also that Numb overexpression itself induces an increase in cardiac progenitors growth (revised by Wu and Li [19] in other mo dels as mouse and drosophila). [score:4]
To confirm the regulative activity of miR34, we overexpressed in CDCs mature miR34 with lentiviral vector. [score:4]
It is possible to assess that in the dividing population miR34 is less expressed compared with the quiescent population (result of three independent experiments on five different CDCs populations p ≤ 0.05) We tested in our specimens the relation between age and miR34 relative expression [7]. [score:4]
Our study represents the first evidence that miR34 inhibition in human cardiac progenitor/stem cells could be proficiently employed in new therapeutic interventions for human cardiac pathologies. [score:3]
It is possible to observe a clear incorporation of Numb after overexpression, Rab5 was used as exosomal protein normalizer A recent report has demonstrated that the miR34 downmodulation after MI induces a functional recovery and an increase in the scar reduction in mice [7]. [score:3]
The two separated populations were examined for the ability to form spheres in culture (Fig.   1b) and for miR34 relative expression (Fig.   1c). [score:3]
Growth rate after mir34 inhibition. [score:3]
Moreover, by overexpressing miR34 we observed that Numb was also specifically downmodulated (Fig.   6b). [score:3]
Boon et al. [7] have shown that miR34 is involved in cardiac aging and its downmodulation through LNA inhibition supports cardiac repair in mice after AMI (acute myocardial infarction). [score:3]
The indication of this downmodulation by miR34 prompted us to test if the role of miR34 can be due to the Numb overexpression after Ant34 treatment. [score:3]
The ability of miR34 to downmodulate c-Kit has been demonstrated in colon cancer cells [16], where it has been linked to p53 expression. [score:3]
It is possible to assess that in the dividing population miR34 is less expressed compared with the quiescent population (result of three independent experiments on five different CDCs populations p ≤ 0.05) Real-time PCR of total RNA from 32 biopsies. [score:2]
Mir34 expression in cardiac human specimens vs age. [score:2]
MiR34 has been reported to target different genes in various cellular system that can account its function. [score:2]
In these cells, miR34 modulates, in vitro, various genes that are clearly involved in cardiac development and/or repair. [score:2]
As already found in cancer stem cells [17], miR34 plays an apparent bimodal role, regulating as Notch as Numb pairwise. [score:2]
MiR34 expression in Cardiac stem cells subpopulation. [score:2]
We observed that the less proliferating (CSFE++) cells had a higher expression of miR34 compared with the more proliferating cells (CSFE--). [score:2]
Our results show that miR34 has a complex role in human cardiac progenitor cells, where its downmodulation induces a cascade essential for cardiac repair, as assessed in mouse mo dels [7]. [score:1]
First, we tried to evaluate the miR34 expression in proliferating CSs cells. [score:1]
MiR34 expression directly correlates with age in human biopsies (r = 0.125037328, p = 0.010672365) a FACS analysis to evaluate Ant34a 5' FITC-LNA’s ability to enter into human CDCs/CSs by gymnosis after treatment (50 nM for 24 h). [score:1]
One of the most promising miRNAs in this regard is miR34 (reviewed by Li et al. [4]), which acts as a controller in reprogramming efficiency, while miR34 ablation shows a higher susceptibility to induced progenitor stem cells (iPSC) generation without compromising self-renewal and differentiation [5]. [score:1]
We observed, after miR34 downmodulation, an increase of Notch and its downstream-activated gene hey-1. In cardiac progenitor cells Notch-1 activation, with the nuclear translocation of Notch-1 intracellular domain (N1ICD), stimulates proliferative signaling such as G1/S cyclins and p38 (revised by Li and coworkers [24]) in vitro, induces myocytes differentiation [25], MAPK activity and promotes immature cardiomyocytes expansion. [score:1]
In particular, our results indicate that miR34 downmodulation plays a role in human cardiac progenitor proliferation. [score:1]
The authors deduced that the repair activity could be also due to the increased vascularization in the infarcted zone in in vivo mouse mo del, where LNA34 antisense (Ant34) treatment induces angiogenesis and promotes proliferation in endothelial progenitor cells and Human Umbilical Vein Endothelial Cells (HUVECs) 7, 8. The aim of this work was to establish whether the cardiac repair activity of miR34 inhibition could be used for human heart treatment, evaluating in vitro the influences of Ant34 in human heart cardiac stem cells. [score:1]
Our study indicates, for the first time, to the best of our knowledge, that the role of miR34 downmodulation in cardiac repair can also be held by Numb, which has been found to be important in cardiac morphogenesis [19]. [score:1]
[1 to 20 of 37 sentences]
9
[+] score: 120
In conclusion, we verified that miR-34b/c and miR-449a inhibit glycolysis through targeting LDHA in NPC, thereby suppressing the tumor proliferation and progression. [score:7]
The expression levels of miR-34b/c cluster and miR-449a were significantly and gradually reduced with advancing stages of NPC, with the lowest expression at the latest stage IV (Figure 1, Upper line; * P < 0.05, ** P < 0.01; *** P < 0.001), indicating gradual loss of miR-34b/c cluster and miR-449a expression with the progression of NPC. [score:7]
In addition, we found that LDHA was a direct target of miR-34b/c cluster and miR-449a and was overexpressed in NPC. [score:6]
Further tandem mass tags isotope labeling and LC-MS/MS analysis revealed that miR-34b/c and miR-449a regulated the expression of 15 potential targeted genes, mainly clustered in key enzymes of glycolysis metabolism, including LDHA. [score:6]
To clarify the mechanisms of miR-34b/c and miR-449a in the suppression function of NPC, we used tandem mass tags (TMT) isotope labeling technology and LC-MS/MS analysis to explore miR-34b-3 potential target genes. [score:5]
In this study, we found that loss of miR-34b/c and miR-449a was related with the progression of NPC, and overexpression of miR-34b/c and miR-449a inhibited the proliferation, migration and invasion of NPC cells in vitro and tumor size in vivo. [score:5]
In this study, we showed that the expression levels of miR-34b/c cluster and miR-449a were significantly and gradually reduced with advancing stages of NPC, with the lowest expression at stage IV. [score:5]
Collectively, these results clearly indicate that LDHA is a direct target of miR-34b/c cluster and miR-449a. [score:4]
LDHA is a direct target of miR-34b/c and miR-449a. [score:4]
In the regulation of spermatogenesis, miR-34b/c and miR-449a have redundant function through targeting of the E2F-Rb pathway [27– 28]. [score:4]
To explore the molecular mechanisms of miR-34b/c and miR-449a as anti-oncogene in NPC, we used quantitative proteomics to find the direct targets of miR-34b/c and miR-449a. [score:4]
MiR-34b/c cluster and miR-449a are down-regulated in NPC samples and NPC cell lines. [score:4]
miR-34b/c cluster and miR-449a are down-regulated in NPC. [score:4]
These data provided strong evidence that miR-34b/c cluster and miR-449a were downregulated in NPC. [score:4]
On the contrary, miR-34b/c is mainly expressed in lung, ovary, testes, and trachea [48], which may explain the obvious reduction of miR-34b/c but not miR-34a in NPC. [score:3]
Among these 15 genes, LDHA, LDHB, PGK1 and PHGDH were predicted to have complementary sequences in their 3′UTR with miR-34b/c or miR-449a by one or more Targetscan, Pictar, and miRanda databases. [score:3]
These data suggest an important role for miR-34b/c and miR-449a in the suppression of the tumorigenesis of NPC. [score:3]
The miR-34 family consists of miR-34a, miR-34b and miR-34c, which are directly regulated by p53 [19– 21]. [score:3]
Two sets of NPC samples were collected for this study: Set 1, including tissue biopsies of 45 NPC and 10 non-tumor nasopharynx epithelial tissue samples to verify miR-34 and miR-449a expression with qRT-PCR; Set 2, including 20 paraffin-embedded NPC and 4 non-tumor nasopharynx epithelial tissue samples for LDHA detection with IHC. [score:3]
Using a stem-loop RT-PCR or miRNA microarray assay respectively, our previous study and other four independent labs revealed that miR-34b/c and miR-449a are down-regulated in NPC tissues [14– 18]. [score:3]
MiR-449a is located at 5q11.2 and shares a very similar “seed” sequence and a cohort of targets genes with miR-34b/c [23– 26]. [score:3]
Compared with the immortalized normal nasopharynx epithelial NP69 cells, miR-34b/c cluster and miR-449a were also significantly down-regulated in NPC cell lines (Figure 1, Bottom line). [score:3]
Our miRNA microarray assay (GSE32906) [14] has shown that miR-34b/c, but not miR-34a is down-regulated in NPC. [score:3]
Figure 1(Upper line) The real time RT-PCR determination of miR-34 cluster and miR-449a expression in different development stages of NPC (n = 45) compared with the non-tumor nasopharyngeal epithelial (normal, n = 10). [score:3]
Our previous miRNA array analysis showed that miR-34b/c cluster and miR-449a have low expression in NPC [14]. [score:3]
Here, we further verified the expression levels of miR-34 cluster and miR-449a by RT-PCR in another cohort of NPC samples including 45 NPC tissues of different stages and 10 non-tumor nasopharyngeal epithelial. [score:3]
For the convenience of gene annotation, corresponding Entrez gene IDs of the proteins were used for further bioinformatics analysis and these genes were predicted whether have matching sequence with miR-34b/c and miR-449a by 3 common databases such as Targetscan, Pictar, and miRanda. [score:3]
From meta-analysis, miR-34a, miR-34b and miR-34c are dysregulated simultaneously in most cancers, such as non-small cell lung cancer, endometrial carcinoma, colorectal cancer, ovarian carcinoma, osteosarcoma [46]. [score:2]
The double knock out mice of miR-34b/c and miR-449 show basal forebrain structures, absence of motile cilia in trachea and oviducts, and severe disruption of spermatogenesis, but no spontaneous tumor formation [49]. [score:2]
In this study we firstly examined the roles of miR-34b/c and miR-449a in the dynamic development of NPC. [score:2]
MiR-34b/c has tissue specific functions and different expression patterns in various cancers. [score:2]
In mammalians, miR-34a is located on chromosome 1p36, while miR-34b and miR-34c are located at chromosome 11q23 and have a common primary transcript [22]. [score:1]
MiR-449 cluster have very similar sequences and secondary structures belonging to the miR-34 family. [score:1]
Indeed, miR-449a has the same tissue distribution as miR-34b/c and they form a functionally related miRNA family. [score:1]
However, the precise function and molecular mechanisms of miR-34b/c and miR-449a in the initiation and progression of NPC remain unclear. [score:1]
[1 to 20 of 35 sentences]
10
[+] score: 101
In line with our RNA-seq data, in situ hybridization targeting miR-34a-5p and miR-34b-5p showed low expression in control cortex for both miRNAs (Fig.   4a,e) and high expression in TSC tubers, specifically dysmorphic neurons, giant cells and in cells with astroglial morphology (Fig.   4b,d,f,h). [score:7]
Both miR-34a and miR-34b have been previously identified as overexpressed miRNAs in tubers [15], as well as key tumour suppressors downstream of the p53 pathway and have been suggested as potential targets of therapy in several cancers 65, 66. [score:7]
Overexpression of miR-34b increases expression of IL1B in human foetal astrocytesTo study the impact of miR-34a-5p and miR-34b-5p overexpression in foetal astrocytes two different assays were performed. [score:6]
Overexpression of miR-34b increases expression of IL1B in human foetal astrocytes. [score:5]
Control cortex (e) shows moderate expression of miR-34b-5p in neuronal cells (arrows); very low expression is observed in control white matter (g). [score:5]
In particular, we identified significant indirect negative correlations between the glutamate receptor signalling and neurogenesis modules with expression indices of miR-193, miR-200, and the miR-34 families (Pearson’s correlation) (Supplementary Fig.   5 and Supplementary Table  3). [score:4]
Foetal astrocytes transfected with the miR-34b-5p mimic had an associated up-regulation of IL1β (~4-Fold, p-value < 0.03) and the inflammatory marker IL6 (~2.3-fold, p-value < 0.03), (Supplementary Figure  6). [score:4]
We found no significant correlation (Pearson’s correlation) between expression patterns of miR-34 family members and age (r < 0.41, p-value > 0.05) (Supplementary Fig.   4). [score:3]
Members of the miR-34 family have also been shown to regulate key pathways in neurodevelopment and cortical neurogenesis, such as the Notch 67– 69 and the Wnt signaling pathway 70, 71. [score:3]
No overlap was found between the putative miR-34 family targets in the modules neurogenesis and glutamate receptor signalling and any cell-specific genes. [score:3]
No increase in the expression levels of miR-34a-5p and miR-34b-5p due to IL1 β were observed. [score:3]
Considering our analysis was centered upon complex brain tissue, which encompasses multiple cell-types, we here sought to gain insight into the cell-specific patterns of selected miRNA expression in TSC and control brain tissue, that is, the miR-34 family members, miR-34a and miR-34b. [score:3]
First, in an attempt to induce miR-34a-5p and miR-34b-5p expression foetal astrocytes were stimulated with IL1β. [score:3]
Highly expressed miRNAs in TSC subjects included, miR-34a (3.1-fold), miR-34b (2.6-fold), miR-34c (2.5-fold), miR-302a (2.2-fold), miR-577 (4-fold) and miR-21 (2.9-fold) (Fig.   2c), all members of the miR-34 family were validated using RT-qPCR (Supplementary Fig.   3). [score:3]
Panels f and h (TSC) show expression of miR-34b-5p within the dysplastic region with several positive dysmorphic neurons [arrows; insert in f: miR-34b-5p in a NeuN positive cell] and glial cells [arrowheads in f and insert (a) in h; insert (b) in h shows colocalization with GFAP]; arrow in h shows a positive giant cell within the tuber white matter. [score:3]
Using the miR-Walk 2.0 database [29] we identified multiple genes in the neurogenesis and glutamate receptor signalling modules that are predicted targets of miR-34a, miR-34b and/or miR-34c (Fig.   3d, Supplementary Table  4). [score:3]
This suggests that an overexpression of miR-34b-5p in astrocytes could activate an inflammatory response in astrocytes. [score:3]
Previously reports of age dependent miRNA expression patterns in the brain and cardiac tissue 24, 25, notably of miR-34a [26], coupled with the variability of age in our study cohort motivated us to evaluate the association of age to expression patterns of miR34a and the other members of the miR-34 family members. [score:3]
These predictions were further tested experimentally using a miR-34b-5p overexpression system in mouse hippocampal neurons, demonstrating that miR-34b-5p can modulate neurite outgrowth. [score:3]
Panels b and d (TSC) show strong expression of miR-34a-5p within the dysplastic region with several positive dysmorphic neurons (arrows in b) and glial cells (arrowheads in b, d); insert in b: miR-34b-5p in a NeuN positive cell; insert in d shows colocalization with GFAP. [score:3]
In this particular study epileptogenic tubers were compared to adjacent non-tuber tissue indicating that elevated expression of miR-34 members may indeed represent an important feature of tuber physiology rather than an effect of AED treatment. [score:2]
miRNAs (miR-34a-5p, miR-34b-5p, miR-34c-5p, miR-302a-3p, miR-21-5p and the reference small nuclear RNAs, Rnu6B and Rnu44) expression was analyzed using Taqman micro RNA assays (Applied Biosystems, Foster City, CA). [score:2]
Kim, N. H. et al. p53 and MicroRNA-34 Are Suppressors of Canonical Wnt Signaling. [score:2]
To study the impact of miR-34a-5p and miR-34b-5p overexpression in foetal astrocytes two different assays were performed. [score:2]
In so doing, we uncovered the miR-34 family (miR-34a, miR-34b and miR-34c) as predicted modifiers of neurogenesis and glutamate receptor signalling transcriptional output. [score:1]
mouse neuronal cultures prepared from the hippocampi of postnatal day 0 (P0) C57Bl/6 mice were transfected at 1 day in vitro with either the miR-34b-5p mimic or the miRNA mimic negative control (Scr) and analyzed for neurite outgrowth at 4 days in vitro. [score:1]
Cultures were co -transfected at 1 day in vitro with miR-34b-5p miR-Vana mimic (Applied Biosystems, Life Technologies Europe BV, Bleiswijk, Netherlands) or the miR-IDIAN miRNA mimic negative control #1 (Dharmacon, GE Healthcare Europe, Eindhoven, the Netherlands) and a green fluorescent protein (GFP) vector at 50 pmol/well using Lipofectamine®-2000 (Thermo Fisher Scientific) as transfection reagent for 1 hour at 37 °C and 5% CO2. [score:1]
Figure 5Neurite outgrowth modulated by transfection with miR-34b-5p in mouse hippocampal neurons (a, b) Representative images of mouse hippocampal dissociated neurons cotransfected with GFP vector and mimics for miR-34b-5p (miR-34b) or NC-1 (negative control; Scr); Scale bar, 100 µm. [score:1]
In situ hybridization In situ hybridization (ISH) for miR-34a-5p and miR-34b-5p were performed on 5 μm thick FFPE tissue using 5′ - 3′ double digoxygenin (DIG)-labeled probes as described previously 97, 98. [score:1]
Moreover, our study predicts an important role for the miR-34 family (miR-34a, miR-34b and miR-34c) as modifiers of neurogenesis and glutamate receptor signaling in TSC, which may potentially provide an epigenetic -driven therapeutic tool for epilepsy and cognitive disabilities in TSC. [score:1]
Panels e-h: miR-34b–5p. [score:1]
Cells were harvested after 24 hours of stimulation/transfection for and RT-qPCR (miR-34a-5p, miR-34b-5p, IL1β, IL6, COX2). [score:1]
For transfection Foetal astrocyte cultures were transfected with either mirVana [TM] miR-34b-5p miRNA mimic or mirVana™ miRNA Mimic, Negative Control #1 (both from ThermoFisher Scientific, Landsmeer, Netherlands) at a final concentration of 50 nM using Lipofectamine® 2000 transfection reagent (ThermoFisher Scientific, Landsmeer, Netherlands). [score:1]
In situ hybridization (ISH) for miR-34a-5p and miR-34b-5p were performed on 5 μm thick FFPE tissue using 5′ - 3′ double digoxygenin (DIG)-labeled probes as described previously 97, 98. [score:1]
In particular we investigated the impact of miR-34b overexpression on neurite outgrowth in a mouse hippocampal neuron mo del. [score:1]
The probe sequences used were: miR-34b-5p: 5′ DIG-AugGcaGugGagTuaGugAuuG-DIG;from Ribotask ApS (Odense, Denmark) and miR-34a-5p: 5′ DIG- AcaAccAgcTaaGacAcuGccA-DIG (Exiqon A/s, Vedbaek, Denmark) (capital letter = LNA modification, small letter = 2-o-methyl modification). [score:1]
Based on these predictions miR-34 family members, notably miR-34b, were assessed by functional in vitro studies and shown to possess a capacity to modulate neurite outgrowth and to activate an inflammatory response in astrocytes. [score:1]
Figure 4 In situ hybridization of miR-34a-5p and miR-34b-5p in Tuberous Sclerosis Complex (TSC) cortical tubers. [score:1]
miR-34b modulates neurite outgrowth in mouse hippocampal neuronal cultures. [score:1]
Subsequently, the foetal astrocytes were transfected with a miR-34a-5p and a miR-34b-5p mimic. [score:1]
[1 to 20 of 40 sentences]
11
[+] score: 93
Eight targets resulted significantly downregulated after treatment with 5′-AZA: CDK6 and DNMT3B (validated targets of miR-29a-3p), E2F3 (validated target of miR-34b-3p), and OLFM3 and IFNAR1 (predicted targets of miR-517a-3p) were downregulated in both cell lines. [score:15]
DNMT3A (validated target of miR-29a-3p), BCL2 (validated target of both miR-34b-3p and miR-181c-5p), CCNE2 (validated target of miR-34b-3p) were downregulated only in SH-SY5Y (Figure 1). [score:10]
In silico analysis of DE miRNAs targets allowed to select four validated targets for both miR-29a-3p (CDK6, DNMT3A, DNMT3B, RAN) and miR-181c-5p (BCL2, GATA6, KIT, SIRT); five validated targets for miR-34b-3p (BCL2, CCNE2, CDK4, E2F3, MYB); four predicted targets for miR-517a-3p (IFNAR1, OLFM3, TNIP1, WEE1) (Supplementary Table S4). [score:9]
CDK6, DNMT3A, DNMT3B (targets of miR-29a-3p) and CCNE2, E2F3 (targets of miR-34b-3p) were downregulated in both cell lines after transfection with the respective miRNAs mimics, compared to matched scramble -transfected cells in at least one time point (Figure 2). [score:7]
Expression of miR-34b-3p is known to be epigenetically regulated by 5′-AZA [23], but to date its altered expression has not been associated with neuroblastoma. [score:6]
Single TaqMan expression assays (STAs), extended to miR-34b (another member of the miR-34 cluster), revealed that miR-29a-3p, 34b-3p, 181-c-5p and 517a-3p are upregulated in at least three different neuroblastoma cell lines (Table 1). [score:5]
A network of protein-protein interactions was generated from nodes CDK6, DNMT3A, DNMT3B (targets of miR-29a-3p) and CCNE2 and E2F3 (targets of miR-34b-3p) and extended to their first neighbor interactants. [score:5]
CDK6, DNMT3A, DNMT3B (targets of miR-29a-3p), CCNE2 and E2F3 (targets of miR-34b-3p) were given as input and interactions among them and their first interactants were automatically retrieved. [score:5]
MiR-34a (another member of the miR-34 family) is a known tumor suppressor in neuroblastoma; it has been suggested as an epigenetic target for treatment of diffuse large B-cell lymphoma by 5′-AZA [10, 24, 25]. [score:5]
A similar consideration may be made for CDK6, DNMT3A, DNMT3B and E2F3, which we propose as targets for miR-29a-3p and miR-34b-3p: their increased expression is related to poor prognosis. [score:5]
Our data suggest tumor-suppressor properties also for miR-34b-3p in neuroblastoma: its increased expression is linked to decreased levels of neuroblastoma cell viability. [score:5]
A negative correlation (even though statistically not significant) among miR-29a-3p, DNMT3A (r = −0.48) and DNMT3B (r = −0.60), as well as among miR-34b-3p and its candidate targets CCNE2 (r = −0.14) and E2F3 (r = −0.19) was observed. [score:3]
MiR-34b-3p was significantly downregulated in SK-N-BE(2)-C and GI-ME-N (Supplementary Figure S2A). [score:3]
In conclusion, our experimental data demonstrate that miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p are involved in neuroblastoma and are potential new therapeutic targets in neuroblastoma. [score:3]
Expression profiling of 754 miRNAs, combined with methylation assays of specific CpG islands and in silico analyses, allowed us to focus on miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p. [score:2]
MiR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p regulate neuroblastoma cell viability. [score:2]
Cells were transiently reverse -transfected with 30 pmoles of miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics or equal amounts of scrambled molecules for 24h and 48h, by using siPORTNeoFX Transfection Agent (Ambion [®], Austin, TX), according to the manufacturer's instruction. [score:1]
Transfection with miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics determined a significant decrease of cell viability, both in SK-N-BE(2)-C and in SH-SY5Y. [score:1]
Briefly, 1.2 x 10 [4] cells / well were reverse -transfected with miR-29a-3p, miR-34b-3p, miR-181c-5p and miR-517a-3p mimics or equal amounts of scrambled molecules and were grown for 24h and 48h. [score:1]
[1 to 20 of 19 sentences]
12
[+] score: 89
Strikingly, 13 of the 22 upregulated genes contained 3′UTR miR-34 ‘seed’ matches and were predicted targets of the miR-34 family (Fig. 5 A–B). [score:6]
We performed a microRNA -expression screening and identified 5 members of the miR-34 family (miR-34bc and miR-449abc) as highly expressed from late meiosis to the sperm stage. [score:5]
MiR-34b/c stood out from this analysis due to the binary nature of their expression, essentially being absent in SSCs to representing one of the most abundantly expressed miRNAs in post mitotic germ cells (Fig. 2A–B). [score:5]
The miR-34b/c -targeted mice were then crossed to the FLP expressing transgenic mice (FLPeR) [42] to remove the frt flanked neo [r] cassette, resulting in the generation of the miR-34bc [Fl] allele. [score:5]
Mice heterozygous for the miR-34bc [Fl], targeted Dcr and miR-449 targeted alleles were crossed to Deleter Cre [43] to generate the miR-34b [−], Dcr [FH] and miR-449 [−] alleles, respectively. [score:5]
From the 9 validated miR-34 target genes identified, the forkhead transcription factor FoxJ2 merits special interest as it contains two highly conserved miR-34 binding sites and has been shown that transgenic levels of FoxJ2 overexpression are incompatible with male fertility [40]. [score:5]
In contrast, miR-449a displayed the binary expression as miR-34b/c during spermatogenesis but had an overall lower expression (Fig. 2A–B). [score:5]
MiR-34a and miR-34b/c loci are direct p53 target genes with the ability to repress induced reprogramming [33]– [35]. [score:4]
The word corresponding to seed matching miR-34 family (Red) is enriched in the up-regulated genes. [score:4]
With the similarity of expression of miR-34b/c and miR-449 loci and their potential to be functionally redundant with respect to spermatogenesis, we generated miR-34bc [−/−];449 [−/−] mice (Fig. 3A) that were born in Men delian ratios. [score:3]
The expression of the miR-34 family members is summarized from the array data. [score:3]
Both the miR-34b/c and miR-449 showed highly restricted expression profiles across an assortment of mouse tissues (Fig. 2C) [32]. [score:3]
miR-34b/c and miR-449 are selectively expressed in post-mitotic spermatogenesis. [score:3]
For the miR-34bc loss of function allele, the targeting strategy allows for Cre -mediated deletion of the hairpins that encode both miR-34b and miR-34c. [score:3]
Our analysis identifies miR-34b/c and miR-449 loci as specifically and abundantly expressed in post-mitotic germ cells. [score:3]
To generate this allele, a targeting construct was generated that contains the 5′ 3.65 kb and 3′ 4.6 kb homology arms, an frt flanked neo cassette with a loxP site 5′ of the miR-34b/c encoding sequences and a second 3′ loxP site. [score:3]
Northern blotting of testicular RNA revealed the robust expression of miR-34b/c and miR-449a at postnatal day 14, a time when the appearance of pachytene spermatocytes is observed. [score:3]
The onset of the phenotype in miR-34bc [−/−];449 [−/−] mice perfectly coincided with the expression domain of miR34b/c observed in wild type adult spermatogenesis. [score:3]
Next we wanted to determine the precise onset of miR-34b/c and miR-449a during spermatogenesis and we decided to take advantage of the first wave of spermatogenesis, as it proceeds in a near synchronous manner with the appearance of successive spermatogenic populations across juvenile mouse development (Fig. S1A). [score:2]
Thus in combination with the histological analysis we can conclude that the miR-34 family has multiple functions during spermatogenesis both in regulating meiosis as well as the later stages of spermiogenesis (Fig. 4F). [score:2]
This unbiased approach revealed a highly significant enrichment (p = 2.44×10 [−9]) for the complementary seed match of miR-34 family (CACTGCC) in the cohort of most unregulated genes (Fig. 5D). [score:2]
Representative images from one of three independent experiments are shown for panel E and F. The miR-34 family genes are proven important regulators of cell fate and physiology. [score:2]
The miR34a locus also regulates cardiac function upon aging, however none of the individual miR-34 family gene disruptions affects fertility in mice (Fig. S2) [32], [34]– [36]. [score:2]
Position of the DNA encoding the pre-miR-34b and pre-miR-34c are indicated. [score:1]
Our study identifies the miR-34b/c and miR-449 as the first miRNA loci required for mammalian spermatogenesis. [score:1]
The miR-34b/c miRNAs are part of a miR-34 family encompassing six miRNAs (miR-34a, b, c and 449a, b, c) encoded by three distinct loci (miR-34a, miR-34b/c and miR-449) (Fig. 2B). [score:1]
Also indicated is the gene function as well as number of miR-34 binding sites. [score:1]
Representative images from one of three independent experiments are shown for panel E and F. (A) qRT-PCR of miR-34a, miR-34b, miR-34c and miR-449a from control (Ctl) and miR-34bc [−/−];449 [−/−] adult testis. [score:1]
A 9 kb DNA fragment corresponds to the wild-type miR-34b/c locus, integration of the loxP site 3′ of introduces an additional HindIII site, thus decreasing the size of the HindIII DNA fragment recognized to 5 kb. [score:1]
Having established that loss of both miR-34b/c and miR-449 loci results in oligoasthenoteratozoospermia, we next wanted to define the etiology of this disorder. [score:1]
The miR-34b and miR-34c miRNAs are derived from a single non-coding transcriptional unit. [score:1]
[1 to 20 of 31 sentences]
13
[+] score: 78
Identical expression profiles between miR-34b/c and miR-449a/b/c, and the upregulation of miR-34b/c in miR-449 KO testes (Bao et al., 2012), strongly suggest that these two miRNA clusters might be functionally redundant. [score:6]
The five miRNAs encoded by the two miRNA clusters, i. e., miR-34b/c and miR-449a/b/c, belong to the same miRNA family because they share the same “seed sequence” and target the same sets of mRNAs. [score:3]
Both miR-34b/c- and miR449 -null sperm can fertilize wild type oocytes and support embryonic developmentTo test if miR-34b/c- and miR-449 -null sperm can fertilize WT oocytes and support preimplantation development, we performed ICSI using epididymal sperm isolated from these two KO males. [score:3]
MicroRNA-449 and microRNA-34b/c function redundantly in murine testes by targeting E2F transcription factor-retinoblastoma protein (E2F-pRb) pathway. [score:3]
As described above, these miRNA KO sperm lacked expression of either miR-34b/c or miR-449 (Fig.  1B). [score:3]
Using TaqMan -based miRNA qPCR analyses, we examined expression levels of miRNA-34b/c and miR-449a/b/c in mouse sperm and oocytes (Fig.  1A). [score:3]
miR-34b/c and miR-449a/b/c are expressed in sperm, but absent in oocytes. [score:3]
Fertilization and development of WT oocytes injected with WT or miR-d KO (miR-34b/c [−/−];miR-449 [−] [/−]) spermatozoa. [score:2]
Term development of mouse embryos developed from the oocytes fertilized by injection of WT and miR-d KO (miR-34b/c [−/−]; miR-449 [−/−]) round spermatids. [score:2]
Computer-assisted sperm analyses (CASA) of epididymal sperm collected from wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice. [score:2]
Our data demonstrate that miR-34b/c and miR-449a/b/c are essential for normal spermatogenesis and male fertility, but their presence in sperm is dispensable for fertilization and preimplantation development. [score:2]
Fig. 3. Computer-assisted sperm analyses (CASA) of epididymal sperm collected from wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice. [score:2]
To test if miR-34b/c- and miR-449 -null sperm can fertilize WT oocytes and support preimplantation development, we performed ICSI using epididymal sperm isolated from these two KO males. [score:2]
However, miR-34b/c and miR-449 double knockout (miR-d KO) males were infertile due to severe spermatogenic disruptions and oligo-astheno-teratozoospermia. [score:2]
The fact that both miR-34b/c -null and miR-449 -null spermatozoa perform as efficiently as the WT spermatozoa in ICSI demonstrates that a lack of either of the two miRNA clusters does not affect fertilization and early development either in vitro or in vivo. [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
miR-449 and miR-34b/c knockout mice were generated as described (Choi et al., 2011; Bao et al., 2012). [score:2]
Both miR-34b/c- and miR449 -null sperm can fertilize wild type oocytes and support embryonic development. [score:2]
Thus, all five sperm-borne miRNAs, including miR-34b/c and miR-449a/b/c, are dispensable for the first cleavage division and subsequent early embryonic development. [score:2]
Here, we show that both miR-34b/c- and miR-449 -null male mice displayed normal fertility, and that intracytoplasmic injection of either miR-34b/c- or miR-449 -null sperm led to normal fertilization, normal preimplantation development and normal birth rate. [score:2]
To test whether sperm lacking all five functionally related miRNAs (miR34b/c and miR-449a/b/c) could fertilize WT oocytes and support early embryonic development, we performed ICSI using miR-d KO sperm and WT oocytes (Table 1). [score:2]
Despite their presence in sperm, miR-34b/c and miR-449a/b/c are not required for fertilization, first cleavage division, or subsequent development. [score:2]
Testicular and epididymal histology and sperm morphology of wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice at the age of 10 weeks. [score:2]
These negative data are consistent with the normal fertility test results (supplementary material Table S1), demonstrating that a lack of either miR-34b/c or miR-449a/b/c in sperm does not affect oocyte activation, first cleavage division, or subsequent preimplantation development both in vivo and in vitro. [score:2]
Fig. 2. Testicular and epididymal histology and sperm morphology of wild-type (WT), miR-34b/c knockout (KO), miR-449 KO, and miR-34b/c;miR-449 double KO (miR-d KO) male mice at the age of 10 weeks. [score:2]
By injecting miR-34b/c -null sperm into WT or miR-34b/c -null oocytes, we evaluated the potential of preimplantation development from 2-pronuclear (2PN) to blastocyst stages, and no significant differences were noted between WT control and the miR-34b/c -null sperm groups (supplementary material Table S2; Fig. S1), suggesting that the miR-34b/c -null sperm are competent for fertilization and the subsequent preimplantation development. [score:1]
Two miRNA clusters consisting of five miRNAs (miR-34b/c and miR-449a/b/c) are present in sperm, but absent in oocytes, and miR-34c has been reported to be essential for the first cleavage division in vitro. [score:1]
Bars represent proportions of red, yellow/orange, or red sperm in WT, miR-34b/c KO, miR-449 KO, and miR-d KO mice. [score:1]
Fig. 4. Histological and TUNEL analyses on developing testes of wild-type (WT) and miR-34b/c;miR-449 double KO (miR-d KO) male mice and the acridine orange (AO) staining of WT and miR-d KO spermatozoa. [score:1]
To evaluate whether miR-34c and the other 4 members of the miRNA family have an essential role in the first cleavage division both in vivo and in vitro, we analyzed miR-34b/c (Choi et al., 2011) and miR-449 (Bao et al., 2012) knockout mice, and also generated miR-34b/c; miR-449 double knockout (herein called miR-d KO) mice. [score:1]
miR-449 KO mice are viable and fertile (Bao et al., 2012), and here we show that miR-34b/c global KO mice also display normal fertility. [score:1]
Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 loci. [score:1]
Inactivation of either the miRNA-34b/c or the miR-449 miRNA cluster does not affect fertilityAs reported previously, global miR-34b/c KO and miR-449 KO mice are viable (Choi et al., 2011; Bao et al., 2012). [score:1]
Since the five miRNAs (miR-34b, miR-34c, miR-449a, miR-449b and miR-449c) share the same seed sequence of “GGCAGUG”, we analyzed two possible 6nt seed sequence combinations, including one with the 1 [st]–6 [th] nt and the other with the 2 [nd]–7 [th] nt (“selected words”). [score:1]
miR-34 miRNAs provide a barrier for somatic cell reprogramming. [score:1]
Moreover, miR-34c belongs to a family of five miRNAs including miR-34b, miR-34c, miR-449a, miR-449b, and miR-449c, which are encoded by two miRNA gene clusters: miR-34b/c and miR-449. [score:1]
Histological and TUNEL analyses on developing testes of wild-type (WT) and miR-34b/c;miR-449 double KO (miR-d KO) male mice and the acridine orange (AO) staining of WT and miR-d KO spermatozoa. [score:1]
Inactivation of either the miRNA-34b/c or the miR-449 miRNA cluster does not affect fertility. [score:1]
Fig. 1. (A) qPCR analyses of levels of miR-16 (positive control), miR-34b/c and miR-449a/b/c in wild-type (WT) mouse sperm and oocytes. [score:1]
As reported previously, global miR-34b/c KO and miR-449 KO mice are viable (Choi et al., 2011; Bao et al., 2012). [score:1]
Adult (6–8 weeks) WT, miR-449 KO and miR-34b/c KO female mice were superovulated using pregnant mare's serum gonadotropin (PMSG, 5 IU/mouse, i. p. ), followed by human chorionic gonadotropin (hCG, 5 IU/mouse i. p. ) 48 h later. [score:1]
We observed no differences between WT controls and mating pairs with different combinations between KO and WT mice, suggesting that both miR-34b/c and miR-449 global KO males and females both have normal fertility. [score:1]
In summary, although either of the two miRNA clusters (miR-34b/c and miR-449) is dispensable for male fertility, ablation of both results in disrupted spermatogenesis and male infertility. [score:1]
[1 to 20 of 43 sentences]
14
[+] score: 74
Recently, a number of studies have provided compelling evidence that members of the miRNA-34 family (hereafter abbreviated as miRNA-34) such as miRNA-34a, miRNA-34b and miRNA-34c are direct transcription targets of the tumor suppressor protein p53, having the potential to regulate both apoptosis and cell proliferation [12]. [score:7]
A further increase in miRNA-34a expression and an elevated expression of miRNA-34b and miRNA-34c were detected in p53 [+/+ ]embryos exposed to 20 mg/kg, a dose, to which a part of embryos are still able to resist. [score:5]
Therefore, our question was whether miRNA-34 may be among targets engaged by p53 to regulate teratologic susceptibility of embryos. [score:4]
Given the potential involvement of miRNA-34, miRNA-125b and miRNA-155 in the mechanisms regulating teratologic susceptibility of embryos, we chose to explore whether CP alters the expression of the miRNAs in the embryonic limbs and how the alterations correlate with the embryonic p53 genotype and CP -induced limb phenotypes. [score:4]
We observed that the expression of all tested miRNA-34 family members was elevated in the limbs of CP -treated p53 [+/+]embryos. [score:3]
The expression of miRNA-34b and miRNA-34c was not altered in the limbs of embryos exposed to 12.5 mg/kg CP (Figure 1). [score:3]
Yet, in the studies cited above and studies addressing the expression of miRNA-34a only [32], DNA-damaging stress -induced activation of the miRNA-34 family was found to be highly p53 dependent. [score:3]
The objectives of this study were formulated as follows: 1) to evaluate whether CP -induced teratogenic insult alters the expression of several miRNAs (miRNA-34, miRNA-125b and miRNA-155) in mouse embryonic limbs and to what extent these alterations are mediated by p53; and 2) to estimate how CP -induced alterations in the expression of the miRNAs correlates with CP -induced limb phenotypes. [score:3]
On the other hand, unlike miRNA-34 ability to act in concert with p53, miRNA-125b and miRNA-155 seem to have the potential to function as inhibitors of CP -induced p53 -mediated apoptosis. [score:3]
No differences in the levels of miRNA-34b and miRNA-34c expression were observed in fore- and hindlimbs of control p53 [+/+ ]and p53 [-/- ]embryos (data not presented). [score:3]
At the same time, the expression pattern of the miRNA-34 did not change in embryos exposed to a dose of 40 mg/kg severely affecting all embryos. [score:3]
This study demonstrates that teratogen -induced limb dysmorphogenesis may be associated with alterations in miRNA-34, miRNA-125b and miRNA-155 expression. [score:3]
When females were treated with 20 mg/kg CP, the level of miRNA-34b and miRNA-34c expression in the limbs of p53 [+/+ ]embryos were statistically significantly higher than that in the limbs of controls but obviously lower than miRNA-34a levels. [score:3]
In the light of the above data, the activation of miRNA-34 and suppression of miRNA-125b and miRNA-155 in the limbs of CP -treated embryos may be suggested as pathogenetic events in CP -induced apoptosis and, hence, CP -induced limb dysmorphogenesis. [score:3]
Yet, the levels of miRNA-34, miRNA-125b and miRNA-155 expression were found to be practically identical in the hindlimbs and the forelimbs of p53 -positive embryos. [score:3]
These data are in agreement with those obtained in earlier studies that addressed the effect of p53 on miRNA-34 expression in mice exposed to ionizing radiation [29, 30]. [score:3]
Influence of CP on miRNA-34b and miRNA-34c expression. [score:3]
Increased miRNA-34b and miRNA-34c expression was also observed. [score:3]
Figure 1Expression of miRNA-34, miRNA-125b and miRNA-155 in the forelimbs (FL) and hindlimbs (HL) of p53 [+/+ ]and p53 [+/+ ]embryos of mice exposed to different doses of CP. [score:3]
Interestingly, miRNA-34a was identified as being strongly regulated by p53 regardless of cell type or stress [31], and in our study, the magnitude of CP -induced activation of miRNA-34a in the limbs of p53 [+/+ ]embryos was also significantly higher than that of miRNA-34b and miRNA-34c. [score:2]
In a large number of studies, members of the microRNA (miRNA)-34 family such as miRNA-34a, miRNA-34b, miRNA-34c, as well as miRNA-125b and miRNA-155, have been shown to be regulators of apoptosis. [score:2]
The analysis of studies addressing the biological activities of miRNA-34, miRNA-125b and miRNA-155 strongly suggests that all tested miRNAs may be involved in the mechanism of determining the response of the embryo to CP -induced teratogenic stimuli. [score:1]
Whereas the levels of miRNA-34 increased in CP -treated embryos, miRNA-125b and miRNA-155 levels clearly tended to decrease in the limbs of p53 [+/+]embryos exposed to 40 mg/kg CP. [score:1]
Evaluation of the expression of miRNA-34, miRNA-125b and miRNA-155 was performed in the fore- and hindlimbs of p53 [+/+ ]and p53 [-/- ]embryos collected 24 hours after CP injection. [score:1]
The miRNA-34 is activated by p53 being able to mediate p53 -induced proapoptotic and antiproliferative effects. [score:1]
Of note, this miRNA is suggested to be the most stress-sensitive member of the miRNA-34 family [31], whereas the dose of 12.5 mg/kg is a threshold teratogenic dose for these embryos. [score:1]
[1 to 20 of 26 sentences]
15
[+] score: 50
miR-449 and miR-34 have the same inhibitory seed sequence and function together in mouse development, such that knockout of either miR-449 or miR-34 paralogs alone does not yield a detectable developmental phenotypes, whereas knockout of both sets of miRNAs mice show defects in brain development and spermatogenesis caused, at least in part, by defective microtubule and associated cilia function [22]. [score:8]
Among hundreds of miRNAs detected, multiple members of the miRNA family miR-34/449, which all code for the same mRNA inhibitory seed sequence, had the most significant differences in expression between the ACE groups. [score:5]
Here, we find that severe early life stress is associated with a reduction in sperm of both mice and men of the levels of multiple members of 34/449 miRNA family that all have the same seed sequence and function together to influence brain development and spermatogenesis 22, 23. miR-34 expression has also been implicated in stress regulation in the adult brain 24– 26. [score:5]
Interestingly, among identified sperm miRNAs, only miR-449a/b and miR-34b/c have been shown to be expressed specifically in sperm, not eggs, and are present in zygotes, supporting a mechanism for how the small amounts of these miRNAs in sperm can impact early development. [score:4]
The fact that we detect reduction in expression of paralogs of both miR-34 and miR-449 genes in sperm of men with high ACE scores, as well as in sperm of mice exposed to sociability stress and in embryos derived from them, adds to the potential functional significance of these findings. [score:3]
b– c Correlation plot comparing relative expression of miR-449a to miR-449b (b) and miR-34b to miR-34c (c) for individual samples fitted with single-variable linear regression. [score:3]
Interestingly, miR-34 paralogs have also been implicated in regulating the stress response in adult mice, although the findings are somewhat contradictory 24– 26. [score:2]
A distinguishing feature of miR-449a/b and miR-34b/c is that they are among a small set (14) of miRNAs in mice that are not present in oocytes but delivered to them from sperm upon fertilization [34], suggesting that changes in these miRNAs observed in sperm of stressed males may influence subsequent generations via alterations in early development. [score:2]
To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Moreover, in humans, sperm miR-34b/c levels correlate with day-3 embryo quality, implantation rate, and pregnancy after intra-cytoplasmic sperm injection (ICSI) procedures used in fertility treatment, implying this sperm derived miRNA influences early development in humans [37]. [score:2]
d–e qPCR analysis of miR-152-3p and miR-375-3p, data analyzed as in a, b To determine whether early life stress also regulates sperm miR-449 and miR-34 in mice, we exposed adolescent males to chronic social instability (CSI) stress [33], which induces sociability defects in male mice for at least 1 year after stress ceases. [score:2]
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
Second, complete knockout of all miR-34 paralogs has no effect on basal anxiety, only changes induced by acute stress [22]. [score:2]
Fig. 1 a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
One set includes two of the three paralogs of miR-449, miR-449a, and miR-449b, and the other set, two of the three paralogs of miR-34, miR-34b, and miR-34c. [score:1]
a qPCR analysis of miR-449a, miR-449b-5p, miR-34b-3p, miR-34c-5p, miR-152-3p, and miR-375-3p in sperm RNA from low ACE group (score 0–1, n = 5) vs. [score:1]
However, to date we have not been able to detect significant changes in its levels in brain regions of adult females derived from these embryos, where these studies have documented the consequences of altering all three paralogs of miR-34. [score:1]
Interestingly, both sharply reduced levels of sperm miR-449 and miR-34 family members and severe stress have been found to be associated with reduced sperm quality and fertility in men 32, 36. [score:1]
The discovery that low levels of multiple members of the miR-34/449 gene family are associated with men’s high ACE scores also has potential implications for the next generation. [score:1]
Moreover, previous studies found that neither smoking nor obesity influence the levels of sperm miR-449a/b or miR-34b/c 30, 32. miRNA expression was also not associated with behavioral characteristics, such as alcohol and drug use, sperm count, or sperm motility. [score:1]
Because the relative levels of miR-449a and miR-449b, as well as miR-34b and miR-34c, were similar to each other in almost every sample (Fig. 1b, c) miR-449a and miR-34c were used as representatives of each family. [score:1]
[1 to 20 of 21 sentences]
16
[+] score: 50
The miR-34 family is worth special attention because two of its members, mmu-miR-34a and mmu-miR-34b-5p, were significantly up-regulated one day after ENU exposure and maintained increased expression at the 5 subsequent time points up to PTD 30, while another family member, mmu-miR-34c, displayed significant over -expression at multiple time points from PTD 3 to 30. [score:8]
The miR34 family genes are the direct transcription targets of tumor suppressor p53 [32, 38]. [score:6]
Two miRNAs, mmu-miR-34a and mmu-miR-34b-5p, were up-regulated at all posttreatment time points except day 120. [score:4]
Up-regulation of miR-34a and miR-34b/c caused a cell-cycle arrest in the G1 phase [32]. [score:4]
Their expressions were enhanced by 3.21-fold (miR-34a), 3.11-fold (miR-34b) and 2.37-fold (miR-34c) on PTD 1 and the fold changes continued to increase and peaked at PTDs 7 or 15. [score:3]
TaqMan qPCR confirmation of the temporal expression changes of miR-34 family miRNAs. [score:3]
miR-34b/c inhibits cell proliferation and colony formation in soft agar [39]. [score:3]
TaqMan MicroRNA Assays were used to confirm the temporal expression changes of 3 miR-34 family members, mmu-miR-34a, mmu-miR-34b-5p, and mmu-miR-34c, as well as a miR-762 family member, mmu-miR-762. [score:2]
Confirmation of the temporal expression changes of three miR-34 family miRNAs and one miR-762 family miRNA by individual TaqMan assays. [score:2]
Figure 3 The temporal expression changes of three miR-34 family members and one miR-762 family member as determined by PCR arrays and individual TaqMan assays. [score:2]
A comparison of miR-34 family miRNA expression measured by the two different platforms is shown in Figure 3. The results from the two real-time PCR assay platforms are very consistent and show similar temporal kinetics of miRNA expression for miR-34 family miRNAs, rising from day 1 or 3, reaching peaks at day 15, and decreasing until the end of observation, day 120. [score:2]
Among these miRNAs, the miR-34 family is worth special attention. [score:1]
Interestingly, our results found that miR-34b and miR-34c changed in correlated manner at all the sampling time points (Figure 3). [score:1]
Our results indicate that the miR-34 family of miRNAs seems to have the potential to be valuable biomarkers for toxicological application. [score:1]
These biological processes controlled by miRNAs in the miR-34 family are related to ENU cytotoxicity, genotoxicity, and carcinogenicity. [score:1]
miR-34b-5p + + + + + + + + + + +Induction of cell cycle arrest by joining p53 network [55]. [score:1]
Moreover, miRNAs in the miR-34 family worth further study to explore their potential as biomarkers for exposure of genotoxic carcinogens. [score:1]
miRNAs in miR-34 family play important roles in various p53-initiated biological processes. [score:1]
Introduction of miR-34a and miR-34b/c into primary human diploid fibroblasts induces cellular senescence [35]. [score:1]
Another miRNA, mmu-miR-762 that is not similar with miR-34 family miRNAs in sequence, were also examined to confirm the array data. [score:1]
miR-34b and miR-34c are encoded by the same primary transcript from chromosome 11 in human or chromosome 9 in mouse while miR-34a is located in a different chromosome [35]. [score:1]
The promoter region of miR-34a and miR-34b/c each contain a palindromic sequence that matches the canonical p53 binding site and can be bound by p53 as shown by chromatin immunoprecipitation [32]. [score:1]
[1 to 20 of 22 sentences]
17
[+] score: 50
In return, some validated targets of miR-34b are anti-apoptotic factors and post-translational p53 inhibitors, which indicate that miR-34b can stabilize p53 in response to genotoxic stress [51]. [score:7]
Among the differentially expressed miRNAs in control and exposed mice, precursor and mature forms of miR-34b-5p were up-regulated in EDC-exposed animals (Table  2). [score:6]
Once activated, miR-34b and p53 may contribute directly to the regulation of apoptosis, cell cycle, and proliferative gene targets [50]. [score:5]
We selected miR-34b-5p since its precursor and mature form were up-regulated and it had been implicated in apoptosis, a process that was seen to increase after exposure to the mixture of EDCs. [score:4]
In conclusion, chronic exposure to a mixture of five EDCs induces changes in the expression profiles of specific miRNAs (such as miR-34b-5p, miR-7686-5p and miR-1291), along with alterations in the miRNAs/isomiRs association (in particular for miR-15b-5p, miR-18b-5p, miR-20b-5p, and miR-1981-5p) regulating mRNAs implicated in key biological process in the testes (Table  3). [score:4]
Besides miR-34b-5p, we found that miR-7686-5p levels were significantly up-regulated in exposed mice (Table  2). [score:4]
Thus, it is possible that the up-regulation of miR-34b-5p explains in part the increase of germ cell apoptosis that we observe in exposed testes. [score:4]
One of them, miR-34b-5p, was abundantly expressed in the testes. [score:3]
Hence, we suggest an important relationship between exposure to mixtures of EDCs and testicular damage due to changes in the expression of miRNAs, such as miR-34b-5p. [score:3]
Wu J Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesisProc. [score:2]
Furthermore, miR-34b is an important factor in the maintenance of spermatogenesis as it is necessary to the control of post-mitotic germ cell development and apoptosis. [score:2]
miR-34b-5p is involved in the regulation of genes relevant for cell cycle control, apoptosis, and infertility 23, 24. [score:2]
The results of RT-qPCR showed that miR-34b-5p, miR-7a-1-3p, and miR-99b-5p levels were similar to those found using sncRNA-Seq. [score:1]
Previous reports revealed that miR-34b/c deficiency is correlated with oligoasthenoteratozoospermia and infertility in mice 23, 24 along with “Sertoli cell only” syndrome, mixed atrophy, and arresting of germ cell differentiation in the biopsies of infertile patients 45, 46. [score:1]
Comazzetto S Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 lociPLoS Genet. [score:1]
These reports and our in silico analysis (Table  3) indicate that miR-34b-5p could be a pro-apoptotic factor induced in germ cells after EDCs exposure. [score:1]
[1 to 20 of 16 sentences]
18
[+] score: 47
Furthermore, seven miRNAs were expressed more highly in C57BL/6J mice and were mainly downregulated across the time course (miR-92b-3p, miR-34b-5p, miR-672-5p, miR-31-5p, miR-34c-5p, miR-34b-3p, and miR-182-5p; listed in descending order according to the heat map in Figure 5). [score:6]
Five of these [miR-34b-3p, miR-34c-5p, miR-34b-5p, miR-92b-3p, and miR-182-5p; as well as miR-31-5p, which was identified through literature search (41)] belonged to the aforementioned seven miRNAs which were expressed more highly in the C57BL/6J mice and downregulated throughout the time course. [score:6]
These are comprised of miRNAs with a lower (miR-34b-5p and miR-92b-3p) or higher (miR-467e-5p) expression in DBA/2J vs C57BL/6J mice throughout the time course and those that are more highly expressed at 48 or 120 hpi only (miR-223-3p and miR-21a-3p). [score:5]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
The RT-qPCR analysis confirmed the higher expression of miR-223-3p, miR-21a-3p, and miR-467e-5p in DBA/2J and the lower expression of miR-34b-5p and miR-92b-3p after infection, compared to C57BL/6J (Figure 8B). [score:4]
When FC values were used, RT-qPCR detected changes in miR-21a-3p, miR-223-3p, and miR-34b-5p expression in the same direction as measured by RNAseq, whereas no significant regulation was observed for miR-467e-5p and miR-92b-3p (Figure 8A). [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
These 20 miRNAs (which included miR34 families, which are strongly associated with regulation of apoptosis and the PI3k-Akt pathway [e. g., Figure 6]) thus constituted part of a highly regulated response that can predominate in either strain, depending on the time after infection, and is likely to play a role in host susceptibility. [score:3]
The RT-qPCR data differed in a minor way from the RNAseq data in that expression of miR-34b-5p and miR-92b-3p at t = 0 did not differ significantly between the mouse strains (Figure 8B). [score:3]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
Higher abundance of antiapoptotic (e. g., miR-467 family) and lower abundance of proapoptotic miRNAs (e. g., miR-34 family) and those regulating the PI3K-Akt pathway (e. g., miR-31-5p) were associated with the more susceptible DBA/2J strain. [score:2]
The miR-34 and miR-449 families control epithelial barrier repair (65) and regulate multiciliogenesis via the Delta/Notch pathway (66, 67), which might help transport virions out of the respiratory tract (68) and reduce end-organ damage. [score:2]
Of note, miR-31-5p, miR-379-5p, miR-7a-5p, as well as some members of the miR-449 (-5p) and miR-34 (-5p) families were moderately to highly abundant (>10 CPM), making it more likely that they would bind to a biologically relevant number of viral RNAs. [score:1]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
[1 to 20 of 14 sentences]
19
[+] score: 47
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-10b, mmu-mir-34c, mmu-mir-34a
The miR-34 family targets MCM5 directly, and overexpression of these miRNAs causes downregulation of other MCMs and DNA replication genes to negatively regulation cell cycle progression [25, 33, 47, 48]. [score:10]
Furthermore, overexpression of the miR-34 miRNAs, but not other miRNAs, significantly inhibited DNA replication (Fig 7A). [score:5]
Although miR-34 mainly repressed MCM5 as indicated by the luciferase assay (Fig 6B), supporting the finding that it is a direct target of miR-34a in the context of the RISC [47], overexpression of the miR-34s individually diminished MCM2-7 mRNA and protein (Fig 6D and 6E). [score:5]
Among the miRNAs that are significantly upregulated by endogenous and exogenous RS, we found miR-10b, 27b, 181a and all the members of the miR-34 family miRNAs. [score:4]
Trp53 -dependent microRNAs represses MCM2-7 expression in response to RSWe previously reported that MCM2-7 repression in Chaos3 cells occurs at the post-transcriptional level, is dependent upon Drosha and Dicer, and is paralleled by an increased levels of the miR-34 family of microRNAs [33]. [score:3]
Numerous reports demonstrated that miR-34 miRNAs impact cell cycle progression partly by targeting DNA replication genes, including MCMs [25, 47, 48]. [score:3]
miR-34 deletion partially rescued MCM2-7 pan-reduction in HU -treated primary WT MEFs (Fig 7B), complementing the previous experiments in which overexpression of miR-34s decreased MCM levels. [score:3]
Among the RS responsive miRNAs we studied, only the miR-34 family miRNAs caused MCM2-7 pan-reduction upon ectopic expression (Fig 6D and 6E), a scenario similar to MCM2-7 repression after RS induction. [score:3]
We also found potential targeting of the Mcm7 3’UTR by miR-34, despite the lack of in silico-predicted binding sites (Fig 6B). [score:3]
These results indicate that miR-34 expression contributes to both endogenous and exogenous RS -induced MCM2-7 repression in vivo and in vitro. [score:3]
Primary WT MEFs transfected with miR-34 miRNA mimics for 48h significantly inhibit DNA replication (two sided t-test, *, p<0.05, **, p<0.005), but not miR-10b, 27b or 181a mimics. [score:3]
We previously reported that MCM2-7 repression in Chaos3 cells occurs at the post-transcriptional level, is dependent upon Drosha and Dicer, and is paralleled by an increased levels of the miR-34 family of microRNAs [33]. [score:1]
The 34T KO reduced MN levels in Chaos3 mice by ~20% (Fig 7D), and this reduction in MN was sensitive to miR-34 genetic dosage (S6 Fig). [score:1]
[1 to 20 of 13 sentences]
20
[+] score: 43
Kumamoto K Nutlin-3a activates p53 to both down-regulate inhibitor of growth 2 and up-regulate mir-34a, mir-34b, and mir-34c expression, and induce senescenceCancer Res. [score:11]
Recent reports demonstrate that inhibition of the miR-34 family does not promote tumorigenesis, supporting the potential for therapeutic suppression of this family as a treatment for BPD [56]. [score:5]
To address whether miR-34 expression was required and sufficient for the hyperoxia -induced lung injury and inflammation leading to the BPD pulmonary phenotype, we next asked whether only miR-34a overexpression itself was sufficient, in the absence of hyperoxia i. e., in RA. [score:5]
Given that the miR-34 family has been implicated in the p53 tumor suppressor network, and that p53 pathway defects are common features of human cancer [25], miR-34 inhibition therapy is considered a promising therapeutic approach [26]. [score:4]
Of note, miR-34 family members also have been recognized as tumor suppressor miRNAs. [score:3]
miR-34 overexpression in RA restores the BPD phenotype. [score:3]
Bernardo BC Therapeutic inhibition of the miR-34 family attenuates pathological cardiac remo deling and improves heart functionProc. [score:3]
a Representative graphs showing miR-34 expression in WT NB mice exposed to hyperoxia for 2, 4, and 7 days after birth and in the BPD mo del. [score:3]
In addition, in the PN7 HALI mo del, Ang1 treatment showed improved Ki67 staining levels similar to that of the miR-34 (−/−) mice lungs (Supplementary Fig.   7). [score:1]
b The wild-type Ang1 3′ UTR reporter vector was co -transfected into the MLE12 cells with either the N. C. mimic or miR-34a mimic c The WT Tie2 3′ UTR reporter vector was co -transfected into the MLE12 cells with either the N. C. mimic or miR-34-a mimic. [score:1]
Choi YJ miR-34 miRNAs provide a barrier for somatic cell reprogrammingNat. [score:1]
Concepcion CP Intact p53 -dependent responses in miR-34 -deficient micePLoS Genet. [score:1]
In addition, miR34a−/− mice [71] and conditional miR-34 [fl/fl] [72] (JAX laboratory) and SPC-CreER (gift from Brigid Hogan, PhD, Duke University, USA) were housed in the Yale and Drexel Universities Animal Care Facilities (New Haven, CT and Phila delphia, PA, respectively). [score:1]
Representative bar graph showing tamoxifen deletion of miR-34a in Spc CRE positive miR-34 KO lungs (T2-miR34a [−/−]). [score:1]
[1 to 20 of 14 sentences]
21
[+] score: 37
Therefore, different sensitivity of these two groups of target genes, one regulating cilia assembly and the other regulating cell cycle and DNA damage response, to miR-34 suppression underlies the different phenotypic consequences brought about by overexpression and deletion of this family of miRNAs. [score:9]
Our study suggests that different functions of miR-34 family miRNAs in these overexpression and deletion studies can be explained by different sensitivity of target genes to miR-34 suppression. [score:7]
When miR-34 family miRNAs are overexpressed at levels much higher than WT levels, another group of target genes, which are less sensitive and only respond to higher than WT levels of miR-34, are suppressed. [score:7]
As a representative example, early studies have shown that overexpression of members of the miR-34 family miRNAs has potent tumor suppressor function downstream of p53 [121]. [score:5]
This group contains positive regulators of cell cycle and DNA-damage responses (i. e. Cdk4, Ccne2, and Met), whose suppression bestows anti-tumor functions to miR-34 family miRNAs [121]. [score:4]
However, mice carrying target deletion of all miR-34 genes display normal p53 responses to a variety of cellular insults, including ionizing radiation and oncogenic stress [123]. [score:3]
Deletion of all miR-34/449 family genes results in de-repression of these genes and impaired cilia assembly [122]. [score:1]
Another study reported that mice deficient of all the six miRNAs in the miR-34/449 family exhibited postnatal mortality, infertility and strong respiratory dysfunction caused by defective mucociliary clearance, resulting from a significant decrease in cilia length and number [122]. [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 37
Other miRNAs from this paper: mmu-mir-155, mmu-mir-34c, mmu-mir-34a, mmu-mir-223
MiR-34b was demonstrated to induce cell cycle abnormalities, reduced anchorage independent growth, and altered CREB target gene expression, suggesting its potential to act as a tumor suppressor. [score:6]
Decreased expression of miR-34b also correlated with increased levels of CREB protein confirming the relationship between CREB expression and miRNA regulation. [score:6]
They found that miR-34b a possible candidate to target CREB by in silico and gene expression analyses. [score:5]
MiR-34b was expressed at lower levels in myeloid leukemia cell lines compared to healthy bone marrow, in agreement with other experiments that described low levels of the expression of the miR-34 family of miRNA in other human cancers [60]. [score:4]
Treatment of AML cell lines with a demethylating agent and studies of the CpG island at the miR-34b/34c promoter confirmed that methylation might be one of the mechanisms of miR-34b downregulation. [score:4]
At this time, there is no evidence of miR-34b downregulation, apart from the frequent deficiency of functional p53 that drives their transcription in several cancer cells. [score:4]
In fact, expression levels of miR-34b were decreased in AML patients compared to healthy bone marrow samples. [score:2]
The restoration of miR-34b revealed a direct interaction with the CREB-3’UTR, with reduction of the CREB protein levels in vitro. [score:2]
6. Mir-34b Regulation of CREB. [score:1]
Moreover, demethylation treatment leads to a decrease in CREB protein levels, suggesting that miR-34b is epigenetically modified in myeloid leukemia cells to maintain tumor progression [63]. [score:1]
The molecular mechanism by which miR-34 family of miRNAs suppress tumors is currently under investigation for many cancers [61, 62]. [score:1]
Colorectal cancer studies previously identified a methylated miR-34b/34c promoter at chromosome 11q23, which might have reduced p53 transcriptional activity due to deletion of this region [63]. [score:1]
[1 to 20 of 12 sentences]
23
[+] score: 33
Other miRNAs from this paper: hsa-mir-34a, mmu-mir-34c, mmu-mir-34a, hsa-mir-34b, hsa-mir-34c
A key regulator of tumor suppression, miR-34 is a direct transcriptional target of the tumor suppressor p53, given that the miR-34a promoter region contains a p53 -binding site [17]. [score:9]
Given that miR-34 was a candidate regulator, we determined PRKD1 mRNA expression and protein translation levels following ectopic expression of miR-34a, miR-34b, and miR-34c. [score:8]
Expression levels of miR-34b and miR-34c were also detected, however, no significant downregulation of either variant in MCF-7-ADR cells was observed (Supplementary Figure 1A, 1B). [score:6]
Although miR-34a, miR-34b, and miR-34c have the same seed sequence, the results indicated that PKD/PKCμ was downregulated only by miR-34a (Figure 1B). [score:4]
β-actin was used as the loading control and qRT-PCR was performed to validate PRKD1 mRNA and miR-34 variant expression. [score:3]
HEK293T cells were transiently transfected with 3′-UTR reporter constructs (1.5 μg/well in 6-well plates) and 15 nM of miR-34 family precursors (Ambion), using Lipofectamine 2000 (Invitrogen). [score:1]
The seed sequences of miR-34 from PRKD1 were mutated using PCR -based methods and the reporter constructs were verified by sequencing. [score:1]
B. Proteins, mRNAs and totalRNAs were obtained after 48-h transfection of miRNA-34 variants. [score:1]
[1 to 20 of 8 sentences]
24
[+] score: 31
Three members of the mir-34 family were downregulated: mmu-miR-34b-3p was down 11.5-fold and 18-fold by RMA and LVS, respectively, whereas mmu-miR-34b-5p and mmu-miR-34c-5p show relatively high expression and 7 to 9-fold downregulation during pneumonia. [score:9]
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
Confirming the results of the gene profiling, mmu-miR-15b-5p and mmu-miR-223-3p were significantly upregulated during pneumonia, and mmu-miR-34b-5p and mmu-miR-126-3p were significantly downregulated. [score:7]
miR-34 has been shown previously to be suppressed by NF-κB activation and is a known inhibitor of the inflammatory response [31]. [score:5]
Others have been previously identified as prominent regulators of inflammatory pathways, including miR-34 [31],miR-3960 and miR-2861 [48], miR-126 49– 51 and let-7f [52]. [score:2]
These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p). [score:1]
[1 to 20 of 6 sentences]
25
[+] score: 29
Using miR-34 direct up-regulation by doxorubicin, we show here that p53 induction results in the down-regulation of Dll1 via miR-34 transcriptional control. [score:8]
For this reason, we performed additional Dll1 3’-UTR reporter activity assays using miR-34b- and miR-34c-containing expression constructs, and showed that both miR-34b and miR-34c down-regulate Dll1 3’-UTR to the same levels as those seen with miR-34a (Fig. S5D). [score:5]
An additional question was raised whether other miR-34 family members can have synergistic actions on Dll1 down-regulation. [score:4]
We thus asked whether by targeting Dll1, miR-34 can impair the proliferation rate of MB cells. [score:3]
The MiR-34 family is directly regulated by the transcription factor p53 [9], [10], [11], and all of the members of this family (miR-34a, mi-R34b and miR-34c) share high sequence similarities [12]. [score:3]
These data provide further supporting evidence that the whole miR-34 family (miR-34a, miR-34b and miR-34c) can regulate Notch signaling through Dll1 in MB. [score:2]
This activation can be explained by the relatively high expression of miR-34 in this clone, as compared to clone #2 (Fig. S1C). [score:2]
This evidence led to a mo del for the potential therapeutic use of miR-34 as a radio-sensitizing agent in p53-mutant breast cancer [14]. [score:1]
Several studies have confirmed that the miR-34 family is required for normal cell responses to DNA damage following irradiation in vivo. [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 27
HEK293 cells were co -transfected with the miR-34a -expressing shuttle plasmid (FIVGFP34a) and Psicheck2™-34T (with two miR-34a perfect target sites), or Psicheck2™ with the Numbl 3'UTR, or the Numbl 3'UTR mutated in the first or second miR-34 binding site, cloned 3' of the firefly luciferase coding region. [score:5]
0038562.g004 Figure 4HEK293 cells were co -transfected with the miR-34a -expressing shuttle plasmid (FIVGFP34a) and Psicheck2™-34T (with two miR-34a perfect target sites), or Psicheck2™ with the Numbl 3'UTR, or the Numbl 3'UTR mutated in the first or second miR-34 binding site, cloned 3' of the firefly luciferase coding region. [score:5]
org we noticed that several genes in the Notch pathway [32] are predicted murine targets of miR-34, including the anti-differentiation factors, Notch1, Notch2, and Cbf1(Rbpj), the pro-differentiation factors Numbl and Mash1(Ascl1), and the Notch ligands Jag1 and Dll1. [score:3]
To eliminate Numbl miR-34 target sites, 4 bases within the seeds were mutated using QuikChange mutagenesis (Agilent Technologies, Santa Clara, CA), changing 5'-ca ctgcc-3' to 5'-ca gacgc-3'. [score:3]
NPC were transduced with the indicated miR-34 -expressing lentiviral vector its control counterpart. [score:3]
The Notch1 3'UTR harbors predicted miR-34 binding sites, and recent studies in cancer cell systems show that miR-34a directly represses Notch1/2, to slow proliferation [46] or invasiveness [47]. [score:2]
Bommer et al. [17] assayed mouse tissues and found miR-34a expression to be highest in the brain, while miR-34b and c were highest in lung, but low in brain. [score:2]
MiR-34 family members have been extensively studied in cancer studies where their expression has been found to impact cell cycle and apoptotic cellular pathways [23], [24]. [score:2]
Reduction or deletion of miR-34 is associated with higher pathologic grade and worse prognosis of many cancers, including small lung cell cancer [17], pancreatic cancer [25] and neuroblastoma [26], [27]. [score:1]
In vertebrates the miR-34 family has three members, miR-34a, b, an c, arising from two distinct loci (miR-34a from one locus and miR-34b,c from a separate locus). [score:1]
[1 to 20 of 10 sentences]
27
[+] score: 26
Both the miR-34 family and miR-204 miRNAs are well known tumor suppressors in several cancers (He et al., 2007; Li et al., 2016) and have been linked to suppression of epithelial to mesenchymal transition (EMT; Hahn et al., 2013; Morizane et al., 2014; Li et al., 2016; Liu et al., 2016). [score:5]
This suggests that controlled upregulation of miR-34 family miRNAs is important, both in embryonic and adult animals. [score:4]
The authors also find DCX to be a direct target of the miR-34-5p/449-5p family. [score:4]
The authors found that miR-34 over -expression ameliorated age-related neurodegeneration and increased median lifespan. [score:3]
In a study by Liu et al. (2012), Drosophila miR-34 was found to display increased brain expression, specifically in old animals. [score:3]
A recent paper reported that inactivation of two miRNA clusters, miR-34b/c and miR-449 clusters, with identical seed sequences, affected brain development, and microtubule dynamics (Wu et al., 2014). [score:2]
Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis. [score:2]
Altogether, every member of the miR-34-5p/449-5p family of miRNAs, all sharing identical seed sequences, have been found to affect brain development. [score:2]
The microRNA miR-34 modulates ageing and neurodegeneration in Drosophila. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 26
For example, miR200 targets snai2, zeb1 and zeb2 mRNA [57– 59] whereas miR203 targets snai1 and zeb2 mRNA [59], and miR34 targets snai1 mRNA [60]. [score:7]
The miR200 expression can also be induced by p63 and p73 proteins, while miR34 is only induced by p73 but is down-regulated by p63 [65– 67]. [score:6]
The different isoforms of AKT seem to have opposing roles in the regulation of microRNAs: AKT1 inhibits miR34 and activates miR200 while AKT2 inhibits miR200 and activates miR34 [81]. [score:6]
To make our mo delling more insightful, we reduced the complexity by lumping variables into modules corresponding to signalling pathways: the TGF-β pathway (TGFb_pthw consisting of TGFbeta, SMAD), Notch pathway (Notch_pthw, includes activated Notch intracellular domain (NICD), the WNT pathway (WNT_pthw consisting of DKK1, CTNNB1), the p53 pathway (p53, consisting of p53), the p63-p73 proteins (p63_73 consisting of p63 and p73), the miRNA (miR34, miR200, miR203), the EMT regulators (EMT_reg including Twist1, Zeb1, Zeb2, Snai1, Snai2, Cdh2, Vim), E-cadherin (Ecadh with Cdh1), growth factors (GF), the ERK pathway (ERK_pthw: ERK), p21 is included in the CellCycleArrest phenotype, AKT1 module and AKT2 module. [score:2]
miR34 & ! [score:1]
miR203 CellCycleArrest (miR203 | miR200 | miR34 | ZEB2 | p21) & ! [score:1]
If approximately 49% of changes in the logical rules have minor or no effect onto the Metastasis phenotype probability, some modifications in some rules changed the Metastasis phenotype to zero (implicating p63, p73, AKT1 variables of the mo del and, to a lesser extent, CTNNB1, miR34, p53). [score:1]
miR34 & ECM p21 ((SMAD & NICD) | p63 | p53 | p73 | AKT2) & ! [score:1]
AKT1 Apoptosis (p53 | p63 | p73 | miR200 | miR34) & ! [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 24
Since our in vitro study has shown that overexpressing miR-34 inhibits muscle development, we believe the miR-34c overexpression experiment alone would be sufficient to demonstrate the role of miR-34c in vivo. [score:8]
Another miR-34 family member miR-34c also has been shown to inhibit rat vascular smooth muscle cell proliferation [27]. [score:3]
The full-length blot images are presented in Supplementary Figure  1. Overexpressing miR-34c inhibits PSCs proliferation in vitroFirst, we investigated the role of miR-34 in PSCs proliferation. [score:3]
But, the role of miR-34 plays in pig skeletal muscle development has not been reported. [score:2]
Through the dual-luciferase reporter assay, we found N1ICD decreased the pGL3-basic-miR-34 upstream recombinant vector relative luciferase activity, but this inhibition was abolished by the mutated CSL-N1ICD complex binding site (GTGGGAA) (Fig.   6F). [score:2]
In human, three miR-34 precursors are produced from two transcriptional units, miR-34a precursor is transcribed from chromosome 1, and miR-34b and miR-34c precursors are co-transcribed from a region on chromosome 11 [23]. [score:1]
As shown in Fig.   6E the miR-34 upstream of its genomic site (about 4600 bp) is inserted into the pGL3-basic vector. [score:1]
So we constructed the pGL3-basic-miR-34 upstream recombinant vector (pGL3-basic-miR-34 upstream). [score:1]
The miR-34 family members (miR-34a, miR-34b, and miR-34c) were discovered computationally [20] and later verified by experiment 21, 22. [score:1]
N1ICD with pGL3-basic-miR-34 upstream recombinant vector relative or pGL3-basic-miR-34 upstream (mut) recombinant vector were transfected into HEK-293T cells respectively. [score:1]
Lanes 1–7 represent DL 10000, pGL3-basic, double digested pGL3-basic, double digested miR-34 upstream of its genomic site, pGL3-basic-miR-34 upstream recombinant vector, double digested pGL3-basic-miR-34 upstream recombinant vector, DL5000, respectively. [score:1]
[1 to 20 of 11 sentences]
30
[+] score: 24
c-Myc overexpression partially rescued RhoA expression (Fig. 5A, compare lane 4 with 3) and miR-34 -induced suppression of invasion (Fig. 5B), suggesting that miR-34a inhibits invasion, at least partially, via RhoA reduction by targeting c-Myc. [score:11]
c-Met reversed miR-34 -induced suppression of invasion, indicating that miR-34a inhibits invasion, at least partially, by targeting c-Met (Figs. 7B and C). [score:7]
p53 has been found to target the miR-34 family [4], [5], [6] and the ectopic expression of miR-34 genes has drastic effects on cell proliferation and survival. [score:5]
The results clearly revealed that miR-34 reduced invasion of PC-3 cells to 20% of that of controls (Figs. 2A and B). [score:1]
[1 to 20 of 4 sentences]
31
[+] score: 23
Although the expression levels of miR-449b, miR-449c, miR-34b and miR-34c were much lower than that of miR-449a, the expression abundance of miR-34a was comparable to that of miR-449a in developing thymus (data not shown). [score:5]
Clues from the expression profiling of miR-449/34 cluster during thymus development, miR-34 may function at early stage before E15.5 while miR-449 may regulate late differentiation of mTECs. [score:5]
We then analyzed the expression of miR-34 cluster members in TECs during thymus development at E14.5, E16.5, 3-week, 7-week and 12-week. [score:4]
Unlike miR-449a, expression of miR-34a, miR-34b and miR-34c remained unchanged or undetectable (Fig.   1B). [score:3]
Unlike miR-449 cluster, expression of miR-34 cluster was consistently decreased from the detecting point E14.5 (Fig.   2B). [score:3]
Mir-34b and miR-34c also showed an increase in E16.5 thymus but not in postnatal thymus (Fig.   6A). [score:1]
In silico analysis identified that members of the miR-449 cluster and miR-34 cluster possess similar mature sequences and seed regions (Fig.   6B). [score:1]
MiR-449 cluster members (miR-449c/449b/449a) share similar seed sequence with miR-34 cluster members (miR-34a, miR-34b/34c) and constitute a conserved miRNA family 38– 40. [score:1]
[1 to 20 of 8 sentences]
32
[+] score: 23
The mature miR-34 incorporates in the RISC complex and mediates the inhibition of translation or RNA degradation of their targets, such as Bcl-2 and Cyclin D1 [31]. [score:7]
The activation of the miR34 family then regulates their target proteins such as CDK4 and Rb to regulate the cell cycle. [score:5]
The activation of p53 increases the levels of the miR34 family, which are direct targets of p53. [score:4]
After exposure to gamma radiation, p53 is activated through ATM-kinase and transactivates the expression of different members of the miR34 family through consensus binding sites. [score:3]
Among the miRNAs in the plasma, many have been shown to have differential expression in cells or tissue after ionizing radiation, such as miR-142-5p [27], miR-339, hsa-miR-342, hsa-miR146a, hsa-miR-29c, hsa-miR155, hsa-miR-197, hsa-miR-34b [28], and miR-29c [29]. [score:3]
miR34 genes are then processed by DROSHA and DICER complexes. [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
Similarly, miR-34, an established p53 effector that is typically downregulated in malignant lung cancer [105], was upregulated in microadenomas but not in adenomas, as demonstrated in the present study. [score:7]
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
Thus, maintenance of miR-34 expression is a prerequisite to avoid the passage from benign to malignant cancer lesions in lung tissue. [score:3]
The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung. [score:2]
[1 to 20 of 5 sentences]
34
[+] score: 21
The aforementioned result suggested that miR-34a, miR-34b, and miR-34c not only target Myc in human derived cells as described previously [35]– [37], but also negatively regulate Myc expression in mouse species. [score:6]
Furthermore, we also detected the repression of miR-34a, miR-34b, and miR-34c on Myc protein expression. [score:3]
Subsequently, we constructed the miRNA expression vectors of those predicted miRNAs and named those as pCDH-mir34a, pCDH-mir34b, pCDH-mir34c, pCDH-mir340, and pCDH-mir135b. [score:3]
The result indicated all of this three miRNAs can reduce the expression of Myc and the function of miR-34b was most significantly (Figure 4O). [score:3]
The result showed that miR-34a, miR-34b, and miR-34c can repress the expression by 15%, 55%, and 25%, respectively. [score:3]
By combining our sequencing data with the predicted result, we selected miR-34a, miR-34b, miR-34c, miR-340, and miR-135b to conduct further research. [score:1]
48 h after transfection, miR-34a, miR-34b, and miR-34c can reach a 30% to 40% reduction, and miR-340 and miR-135b also showed slight reduction on the luciferase activity of Myc reporter (Figure 4J). [score:1]
48 h after transfection, miR-34a, miR-34b, and miR-34c showed approximately 50% reduction effect, whereas miR-340 and miR-135b showed approximately 20% reduction (Figure 4M). [score:1]
[1 to 20 of 8 sentences]
35
[+] score: 20
In addition to potential tumor/metastasis suppressor ORFs naturally expressed in neural cells, both ATF-126 and Maspin cDNA up-regulated miRNAs previously associated with tumor suppression in many types of cancers, including miR-1 [23], [24] and miR-34 [25]. [score:10]
Interestingly, both, ATF-126 and Maspin cDNA, up-regulated miRNAs with potential tumor suppressive functions, such as miR-1 [23], [24] and miR-34 [25], while down -regulating oncogenes and metastasis promoters, including miR-10b [26] (Fig. 6C ). [score:7]
Similarly, miR-34 has been shown to target Actin in mouse neuronal cells [44]. [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 20
Interestingly, most of these differentially expressed miRNAs belonged to miRNA families, including miR-8 and miR-132 families overexpressed in FCx and miR-34 family overexpressed in HP, or miRNA clusters transcribed from the same locus (miR-182|miR-183|miR-96 cluster overexpressed in FCx). [score:9]
In the dopamine pathway (Figure 5) miR-34b-5p was predicted to regulate Calcyon, Ppp2r, and Ppp1, miR-34b-3p to regulate Prka, and miR-34 c to regulate Calcyon, Ppp2r and Ppp1. [score:4]
Mir-34 family transcribed from a chromosome 9 cluster and including miR-34c, miR-34c*, miR-34b-3p, and miR-34b-5p was expressed on a higher level in HP. [score:3]
Another interesting pathway we identified is the dopamine receptor 1/calcyon signaling pathway regulated by members of the miR-34 family expressed on a higher level in HP compared to FCx. [score:3]
These included miR-8, miR-132, and miR-34 families and the miR-182|miR-96|miR-183 cluster. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 20
In mice, miR-34a is ubiquitously expressed with the highest expression in the brain [7], whereas miR-34b and c are mainly expressed in lung tissue [8]. [score:7]
Importantly, several reports showed that members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [8]– [13]. [score:7]
In addition, members of the miR-34 family have been identified as direct p53 targets. [score:4]
miR-34a is a member of the miR-34 family, which in mammals also includes miR-34b, and -34c [6]. [score:1]
miR-34a is encoded by its own transcript, whereas miR-34b and miR-34c share a common primary transcript. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 19
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
MiR-15a [11], miR-21 [12, 13], miR-34 [14], members of the miR-200 family [12, 15], miR-214 [11], miR-221 [16], members of the let7 family [15], and miR-320c [17] have been reported to play roles in gemcitabine chemoresistance in pancreatic cancer. [score:1]
In contrast, the chemoresistance to gemcitabine was merely slightly repressed in human PDAC cells treated with miR-34-5p or miR-203 mimics (Supplementary Figure 2). [score:1]
[1 to 20 of 6 sentences]
39
[+] score: 18
Therefore, the p53 network suppressed tumor formation through a number of coordinated interactions and several transcriptional targets including the role played by miR-34 family members in inhibiting unregulated cell proliferation and tumor development [58, 59]. [score:9]
The authors compared microRNA expression profile of wild-type and p-53 -deficient cells and found that the expression of microRNA family members (miR-34a-c) reflected the p53 status and the genes encoding miR-34 family members were transcriptional targets of p53 in vivo and in vitro. [score:6]
The first microRNAs involved in the p-53 tumor suppressor network were reported in 2007 and they belong to the miR-34 family, these being miR-34a, miR-34b, and miR-34c [57]. [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 18
In this sense, it was recently shown that in the settings of heart disease where miR-34a is elevated, targeting the entire miR-34 family (that includes miR-34a, -34b and 34-c), proved more effective than targeting miR-34a alone [38]. [score:7]
Ooi, J. Y. et al. Identification of miR-34 regulatory networks in settings of disease and antimiR-therapy: Implications for treating cardiac pathology and other diseases. [score:6]
miR-34a-5p is described in many studies pointing towards a role in cancer proliferation, and it is also found dysregulated in muscular dystrophies, neurodegenerative diseases and myocardial dysfunction 43, 44. miR-34a is known to regulate more than 30 oncogenes and, recently, a liposome encapsulated mimic of miR-34 (MRX34) has entered clinical trials, where it has demonstrated clinical proof of concept for solid tumors and hematological malignancies (clinicaltrials. [score:5]
[1 to 20 of 3 sentences]
41
[+] score: 18
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-21a, mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
Recent studies from this laboratory have also demonstrated that CDF inhibits the growth of CR colon cancer cells and also upregulates the expression of miR-34, which is downregulated in colon tumors [20]. [score:11]
Additionally, we found CDF to up regulate the expression of miR-34 [20], which is reported to be downregulated in colon cancer [21]. [score:7]
[1 to 20 of 2 sentences]
42
[+] score: 17
The top 5 miRNAs with the highest expression values were miR-19b, miR-125b, miR-17, miR-214 and miR-34b; miR-19b was most substantially expressed with a copy number of 11,333 per cell. [score:5]
Based on computational predictions from miRBase, there are a total of 11 potential target mRNAs for miR-34 within our data displaying decreased expression. [score:5]
The miR-34 family was first identified as transcriptional targets of p53 [46], [47]. [score:3]
MiR-34b-3p in particular was very highly expressed and dramatically increased after c-Myc depletion. [score:2]
In our real-time PCR miRNA array data, miR-34a, miR-34b-3p and miR-34c were increased when c-Myc was depleted in BASCs (Figure 5C). [score:1]
In our study, three miR-34 members including miR-34a, miR-34b-3p and miR-34c were increased with Myc depletion in BASCs, supporting the concept that all three members have potent anti-proliferative affects with miR-34a additionally promoting apoptosis [48], [49]. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 16
Intriguingly, miR-34 and HMGA1 generate an intricate regulatory loop since HMGA1 is able to negatively regulate the expression of miR-34 (Puca, unpublished observations) and p53 (61), being the latter able to induce the expression of miR-34. [score:7]
In this process, HMGA1 has a central role since, upon its overexpression, alters miR-34 pathway by acting directly and indirectly on it, through the repression of p53 (Figure 1C). [score:5]
MicroRNAs of the miR-34b family have been found regularly underexpressed in human carcinomas and the attempt to restore their physiological levels in cancer cells currently would represent an innovative and fascinating cancer therapy (60). [score:3]
Several recent reports have highlighted the post-transcriptional repression of HMGA proteins by non-coding RNAs and, in particular, numerous miRNAs with this activity have been identified (let-7a, miR-15, miR-16, miR-26a, miR-34b, miR-196a2, miR-326, miR-432, miR-548c-3p, miR-570, miR-603) (53, 54). [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 16
miR-34b and miR-34c were up-regulated in our AD mo del mice and have been reported to be up-regulated in AD patients [18] (Additional file 4: Table S4). [score:7]
miR-34b, which interacts with genes in the brown and pink modules, has been proposed as a key regulator to integrate age -associated diseases in the vertebrate brain [18– 20]. [score:4]
Aging and neurodegeneration seem to be modulated by miR-34 expression through microglial activation [23, 24] and activation of microglial chemokine receptor 1 (CX3CR1) is known to lead to neuronal death in AD. [score:3]
Our results predicted that miR-34b was involved in the regulation of colony stimulating factor 1 receptor (CSF1R), which has been reported to be critical for survival and proliferation of microglia [22]. [score:2]
[1 to 20 of 4 sentences]
45
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Expression of the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218 is upregulated in luminal cells of Ezh2 -deficient samples compared to littermate controls. [score:5]
For example, expression of the BTG4 gene, which harbors the MaSC/basal-specific miRNAs miR-34b and miR-34c, and the TRP3 gene that encompasses miR-204, is not detectable in mammary epithelium. [score:3]
MiR-34b, miR-204 and miR-218 are expressed highly in the MaSC/basal subset. [score:3]
MiRNAs were extracted from MaSC/basal and luminal cells sorted from either control or Ezh2 -deficient mouse mammary glands, and quantitative RT-PCR was then performed for the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218, as their promoter regions were enriched for H3K27me3 marks in the luminal subsets (Fig.   6a). [score:1]
Moreover, H3K4me3 was found to be associated with active miRNAs in colorectal cancer cell lines, whereas hypermethylation of promoter CpG islands caused epigenetic silencing of miR-124 and mir-34b/c [68– 71]. [score:1]
Suzuki H Yamamoto E Nojima M Kai M Yamano HO Yoshikawa K Methylation -associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defectCarcinogenesis. [score:1]
Toyota M Suzuki H Sasaki Y Maruyama R Imai K Shinomura Y Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancerCancer Res. [score:1]
a Track files or read coverage graphs for H3K4me3 and H3K27me3 marks present in the 3 kb upstream region of miR-34b (top panel), miR-204 (middle panel) and miR-218 (bottom panel) in each epithelial subset. [score:1]
[1 to 20 of 8 sentences]
46
[+] score: 16
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a
p53 upregulates the immune checkpoint molecules programmed cell death-1 (PD-1) and its ligand PDL-1 [46] but p53 also upregulates mir-34, which binds the 3′-untranslated region of PDL-1 to downregulate expression [47]. [score:14]
Cortez, M. A. et al. PDL1 regulation by p53 via miR-34. [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 14
We could not detect has-mir-34b-3p using TargetScan software, and we were unable to identify potential targets of mmu-mir-34b-3p related to angiogenesis. [score:5]
Using gene array analysis, we found that mir-125a-5p expression was 1.26 times higher, while mir-34b-3p expression was 7.69 times higher in OECs compared with YECs. [score:4]
However, hsa-mir-34b-3p was not found in searches of TargetScan (http://www. [score:3]
One of the miRNAs showing the highest increase was mir-34b-3p. [score:1]
Interestingly, the mir-34 family has been shown to induce growth arrest and apoptosis in cancer cells (Hermeking, 2010). [score:1]
[1 to 20 of 5 sentences]
48
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Down-regulation of the tumor suppressors miR-34b and miR-34c has been described in PD and linked to decreased expression of parkin protein (Minones-Moyano et al., 2011). [score:8]
MicroRNA profiling of Parkinson’s disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial function. [score:6]
[1 to 20 of 2 sentences]
49
[+] score: 14
It was already demonstrated that p53 directly regulated the expression of tumor-suppressor miRNAs as the miR-34 family members [34], or mir-16 and mir-145, through a Drosha -mediated mechanism [35]. [score:7]
As a key transcription factor, p53 could directly regulate the expression of selected miRNAs, such as the mir-34 family (mir-34a, mir-34b, and mir-34c), which is involved in cell-cycle arrest or cell death [14, 21]. [score:5]
Cortez M. A. Ivan C. Valdecanas D. Wang X. Peltier H. J. Ye Y. Araujo L. Carbone D. P. Shilo K. Giri D. K. PDL1 regulation by p53 via mir-34 J. Natl. [score:2]
[1 to 20 of 3 sentences]
50
[+] score: 13
miRNAs that showed approximately 2-fold upregulation include members of the miR-29 family and miR-34 family, which have been demonstrated to be involved in cellular senescence and apoptosis in cell lines, tissues, and organisms during aging [48]– [51]. [score:4]
miR-34 mediates the downstream effects of p53 by suppressing a number of genes including CDK4/6, Cyclin E2, MET, and Bcl-2, thereby promoting apoptosis [56], [57]. [score:3]
Studies have shown that p53 can bind directly to the promoter and activate miR-34 genes in response to DNA damage and oncogenic stress. [score:2]
A number of other miRNAs including the miR-29 family, miR-34 family, miR-15/16, miR-17-92 cluster, miR-146a/b, and miR-200 family are all known to be involved in networks regulating cell senescence and death [8]– [10]. [score:2]
miR-34 family members participate in downstream signaling of the p53 pathway [55]. [score:1]
Both miR-29 and miR-34 can affect genes that activate or enhance p53 pathways. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 13
miR-34 family are reportedly as tumor-suppressor miRNAs implicated in reduced CSC properties and increased sensitivity to drug treatment by directly targeting NOTCH1 46. miR-100 is also upregulated in the TR subpopulation, and its expression levels relate to the cellular differentiation state, with lowest expression in cells displaying stem cell markers 47. [score:13]
[1 to 20 of 1 sentences]
52
[+] score: 13
Direct targets of p53 include the already mentioned miR-34 and also miR-192, miR-194 and miR215, which then modulate MDM2 expression [15]. [score:6]
These studies highlight the microRNAs miR-34a and miR-34b/c as direct, conserved p53 target genes that presumably mediate many of the activities of p53 in response to stress stimuli [13]. [score:4]
It is now known that p53 induces the expression of miRs such as the miR-34 family [17]. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 13
Previous reports showed that treatment with the DNA methylation inhibitor, 5-aza-2′-deoxycytidine (5-AZA), restored expression of miR-34b, a tumor suppressor that inhibits EC cell growth and invasion [8]. [score:9]
We observed a dose -dependent increase in miR-34b expression in SPAC-1-L and HOUA-I cells treated with 5-AZA (Supplementary Figure 10). [score:3]
miR-34b silencing in EC cells through DNA methylation can be recovered via 5-AZA treatment [8], although 5-AZA cannot reactivate all genes silenced by methylation, possibly due to retention of the repressive histone marker, H3K27me3 [23]. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 12
Genes encoding miRNAs in the miR-34 family are direct transcriptional targets of p53, which suppresses tumor formation through integration of multiple transcriptional targets, and miR-34 may act in concert with other effectors to inhibit inappropriate cell proliferation 39. miR-885-5p leads to the accumulation of p53 protein and activates the p53 pathway, subsequently inhibiting proliferation and interfering with cell cycle progression and cell survival 40. [score:12]
[1 to 20 of 1 sentences]
55
[+] score: 12
For instance, miR-103 and miR-107, having very similar mature sequence and expression levels (Figure 6c), are two known miRNAs that have the same roles in regulating insulin sensitivity and promoting metastasis of colorectal cancer [20], [21]; miR-34b and miR-34c, having very similar mature sequence and expression levels (Figure 6c), are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth [22]; let-7a/b/c were also claimed to reduces tumor growth in mouse mo dels of lung cancer [23] and miR-29a/b/c reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B [24] while these two miRNA clusters have very similar mature sequences and expression levels (Figure 6d). [score:12]
[1 to 20 of 1 sentences]
56
[+] score: 11
In many tumors, there is either overexpression of so-called oncogenic miRNAs (e. g., miR-155, miR-17−5p and miR-21) [15, 16] or downregulation of tumor suppressor miRNAs (e. g., miR-34, miR-15a, miR-16−1 and let- 7) [17– 20]. [score:8]
Consequently miRNAs have been demonstrated to act either as oncogenes (e. g., miR-155, miR-17−5p and miR-21) [15, 16] or tumor suppressors (e. g., miR-34, miR-15a, miR-16−1 and let- 7) [17– 20]. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 11
Increasing evidences have suggested that miRNAs are deregulated or upregulated in all types of cancers, acting either as tumor suppressors (e. g. miR-34, miR-15/16, let-7, miR 200 family) or as oncogenes (e. g. miR-155, miR-222/221, miR-17-5p, miR-21) [1], [3], [8], in which the miRNAs play key roles in important aspects of tumorigenesis, such as cancer initiation, differentiation, growth and progression [3], [5], [8], mainly by interfering with the expression of target genes involved in cell cycle, apoptosis, cell migration and invasion, angiogenesis. [score:11]
[1 to 20 of 1 sentences]
58
[+] score: 11
Members of the miR-34 family are direct p53 targets, and their upregulation induces apoptosis and cell cycle arrest [14- 19]. [score:7]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
[1 to 20 of 2 sentences]
59
[+] score: 11
Levels of hsa-miR-34 expression in pre-miR-34c transfected PBMCs were confirmed by the increase in fold expression of this miR using TaqMan microRNA real-time RT-PCR. [score:5]
Figure 1C shows the fold expression changes (as log 2-transformed values) for hsa-miR-34a, miR-34b, miR-34c, miR-214 and miR-155 under these conditions. [score:3]
C: Differential expression of hsa-miR-34a, miR-34b, miR-34c and other miRs when donor PBMCs are exposed to HMGB1 [+/+] or HMGB1 [−/−] lysates for 8 hrs. [score:3]
[1 to 20 of 3 sentences]
60
[+] score: 11
Interestingly, they share the same seed sequence as the miR-34 family and are hence expected to regulate overlapping cohorts of target genes (figure 2a). [score:4]
SIRT1 and HDAC1 are deacetylases which inhibit, among others, the activation of p53 and miR-34 has been shown to repress SIRT1[34]. [score:3]
Figure 2 miR-449 is part of the miR-34 family and inhibits cell proliferation. [score:3]
A - miR-449 is part of the miR-34 family and is evolutionarily conserved. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 10
Thus, both miR-335 and miR-582 were down-regulated at 7 dpi; while miR-21 was up-regulated, miR-34b and miR-542 were down-regulated at 15 dpi. [score:10]
[1 to 20 of 1 sentences]
62
[+] score: 10
Other miRNAs from this paper: mmu-mir-34c, mmu-let-7b, mmu-mir-34a
Both let-7b and miRNA 34 have been shown to target KRAS [15], and both miR34 and p53 can act synergistically to suppress tumor growth [16]. [score:5]
miRNA34 has been shown to inhibit SIRT1 [75] and we previously reported that miR34 levels are markedly reduced in women with endometriosis [13], likely regulated by inflammation [76]. [score:4]
We previously showed that miRNA34b was dramatically decreased in eutopic endometrium of women with endometriosis [13]. [score:1]
[1 to 20 of 3 sentences]
63
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
64
[+] score: 9
Treatment days miRNAExpression change [#] Predicted mRNA target(s)Expression change [#]GD 8/11 [†] miR-1192 ↑ Atf1, Gng4, Map3k1, Rpe, Setd2, Stxbp6, Zc3h6 ↓ miR-532-5p ↑ Atf1, Itpripl2, Stxbp6 ↓GD 14/16 [*] miR-10b ↓ Aak1 ↑ miR-184 ↓ Myl9 ↑ miR-302c ↑ Ccdc6, Mfap3, Ptpro, Rnd3, Rpl36a/r, Sema3c, Stoml3, Supt3h ↓ miR-342-5p ↓ Aak1, Cables2, Rhog ↑ miR-343 ↑ Asic4, Dcn, Gpr116, Ptpro, Stoml3 ↓ miR-449b ↓ Ina ↑PD 4/7 [†] miR-26b ↑ Adam9, Chsy1, Cnr1, Exoc8, Hs6st1, Lingo1, Map3k7, Mras, Pfkfb3, Ppm1b, Rhou, Sema6d, Shank2, Tab3, Tdrd7, Ube2j1 ↓ miR-34b-5p ↓ Kitl ↑ miR-184 ↑ Ncor2, Prkcb ↓ miR-721 ↑ Akap11, B4galt, Cnr1, Efnb2, Fam20b, Ino80, Irf1, Lrrk2, Ncoa3, Pfkfb3, Ppargc1a, Rbm9, Shank2, Spen, Sphk2, Tsc1, Wdfy3 ↓ miR-1970 ↓ Arhgap6 ↑ # Significance for expression change was 1.2-fold, p < 0.05. [score:9]
[1 to 20 of 1 sentences]
65
[+] score: 9
Frequent downregulation of miR-34 family in human ovarian cancers. [score:4]
miR-34 miRNAs provide a barrier for somatic cell reprogramming. [score:1]
The miR-34 family in cancer and apoptosis. [score:1]
Intact p53 -dependent responses in miR-34 -deficient mice. [score:1]
miR-34 is a p53 responsive miRNA family and its members, notably miR-34a, have been observed to be lost in pancreatic, colon, breast and liver cancers, and is a predictor of poor prognosis in CLL (Chim et al., 2010; Christoffersen et al., 2010; Corney et al., 2010; Hermeking, 2010; Choi et al., 2011; Fabbri et al., 2011). [score:1]
Repression of c-Kit by p53 is mediated by miR-34 and is associated with reduced chemoresistance, migration and stemness. [score:1]
[1 to 20 of 6 sentences]
66
[+] score: 8
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a
Androgen deprivation does not affect nutlin -induced miR-34 expression. [score:3]
It has been shown previously that nutlin activates miR-34(a-c) expression [30]. [score:3]
These experiments suggest that androgen deprivation does not affect miR-34 induction by non-genotoxic p53 activation. [score:1]
Therefore, we examined if the combination of nutlin and CSS can affect miR-34 levels. [score:1]
[1 to 20 of 4 sentences]
67
[+] score: 8
The proliferation data showed that miR-20a and miR-290 did not affect cell proliferation as expected, the down regulated miR-28 and miR-34 significantly reduced the proliferation of immortalized MEF with similar efficiency, while miR-21 did not inhibit cell proliferation (Fig. 3C). [score:4]
Interestingly, the switch of p21 expression was accompanied by the change of the signature of miRNAs related to MEF senescence, including the p53 -dependent miR-34 and miR-28 [20]. [score:3]
MiR-20a, miR-21, miR-28, miR-34, miR-290 and miR-NC (negative control) (GenePharma Shanghai, China) MEF were isolated from 13.5d mouse embryos, expanded and then replated every three days (6T3 protocol). [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 8
Based on these findings, upregulation of miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214 may have therapeutic potential against mutant HTT, REST, HDAC4, apoptosis, and other pathobiological factors in HD. [score:4]
These functional data support some (miR-22, miR-125b, miR-146a, miR-150) and contradict other (miR-34b, miR-148a, and miR-214) Table 2 miRNA targets. [score:3]
The effects of psychotropics on the other miRNAs listed in Table 2, particularly miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214, as well as on REST, deserve study in HD mo dels. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 8
In addition, miR expression of transcriptional targets of p53 (i. e. miR-34b and miR-34c) is markedly down-regulated in human EOC tissues [42]. [score:8]
[1 to 20 of 1 sentences]
70
[+] score: 8
The results showed that miR-134, miR-155 and miR-222 were down-regulated while miR-34 was up-regulated in the HIFU group (Figure 3). [score:7]
These included miR-34, miR-106a, miR-126a, miR-134, miR-155, miR-181a, miR-221, and miR-222. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 8
Conversely, the transcription factors Snail bound to E-boxes in the miR-34 promoters, thereby repressing miR-34 expression [39]. [score:3]
Recent researches have identified a link between p53, microRNA miR-34, and Snail in the regulation of cancer cell EMT programs. [score:2]
So, miR-34 and Snail form a double -negative feedback loop to regulate epithelial-mesenchymal transitions. [score:2]
In the absence of wild-type p53 function, Snail -dependent EMT is activated in cancer cells as a consequence of a decrease in miR-34 levels [38]. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 8
This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis. [score:5]
In addition, a number of studies have reported that c-Myc expression is repressed by let-7, that p53 interacts with miR-34, and that growth arrest can be induced by miR-34 through modulation of the E2F pathway in human colon cancer cells [46], [47], [48]. [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 8
Moreover, miR-34 also downregulates several cyclin -dependent kinases, cyclins, and E2Fs 38, 39, leading to cell cycle arrest. [score:4]
In addition, the miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family, which was found to be a p53-responsive gene cluster 35, 36. miR-34 targets the histone deacetylase SIRT1 [37], leading to the accumulation of acetylated and therefore highly active p53. [score:3]
The miR-449 cluster contains sequences and secondary structures similar to those of the miR-34 family and has therefore been classified as a single family of miRNAs. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 8
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a, mmu-mir-449a, mmu-mir-449c, mmu-mir-449b
JAM‐A protein was significantly upregulated in cortices of miR‐34/449 KO mice (Fig  4I), confirming the regulation of JAM‐A by miR34/449 in vivo. [score:5]
We found at least three members of the miR‐34/449 family, miR449a, miR34a, and miR34b, expressed at levels similar to those of miR‐7‐a‐1 (Fig  2A). [score:3]
[1 to 20 of 2 sentences]
75
[+] score: 8
Among the miRNAs with down-regulated expression levels in the whole blood, miR-690, miR-34b-3p, and miR-34b-3p also showed low expression in the liver, lung, and spleen, respectively. [score:8]
[1 to 20 of 1 sentences]
76
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
MiR-34, which is up-regulated with aging and modulates neurodegeneration in Drosophila and in aged heart by regulating cardiac aging [24], was also increased in aged skeletal muscle. [score:4]
For example, in the liver, age-regulated miRNAs such as miR-34, -93, and -214 target a gene important for oxidative stress defense and decrease its activity with aging [7]. [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 7
For instance, miR-34 was identified as a direct p53 target that regulates apoptosis, cell-cycle arrest, or senescence, contributing to tumor suppression [25- 27]. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
We confirmed that six of the eight selected down-regulated hsa-miRNAs (miR-145, miR-497, miR-150, miR-342-5p, miR-34b* and miR-100) were significantly down-regulated in NPC tissues, whereas miR-195 and miR-143 exhibited no significant difference between the two groups of subjects (Fig. 1D). [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-21a, mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
Similar to diabetic mice, kallistatin inhibits miR-34 and superoxide formation but stimulates sir-2.1 synthesis in C. elegans. [score:3]
Indeed, miR-34a levels are underexpressed in a variety of human tumors, and low levels of miR-34 have been related to poor clinical outcome of cancer patients [66, 67]. [score:3]
Furthermore, human kallistatin treatment prolongs the lifespan of wild-type C. elegans under heat or oxidative stress conditions but has no effect on miR-34 or sir-2.1 (SIRT1 homolog) C. elegans mutants. [score:1]
[1 to 20 of 3 sentences]
80
[+] score: 7
Collectively, the results display 1700020I14Rik interacts with miR-34-5p by both directly targeting and Ago2 -dependent ways in DN. [score:4]
By online databases (USCS, miRbase and BiBiserv2 software) prediction, ten candidates of putative targets for 1700020I14Rik were predicted and miR-34-5p was chosen for further study for being a DN-related miRNA 17, 18 and containing three binding sites in 1700020I14Rik transcript. [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 7
A previous paper showed that the miR-34 family, which is a direct transcriptional target of p53, might induce cell cycle progression [42]. [score:4]
miR-34 has been reported to be differentially regulated after ionizing radiation in different cell lines, as well as in mouse spleen and brain, indicating the importance of this miRNA gene family in the response to ionizing radiation. [score:2]
In the present investigation, differential expression of miR-34 was not observed. [score:1]
[1 to 20 of 3 sentences]
82
[+] score: 7
A number of studies have shown that miRNAs, such as miR-34, miR-125, miR-200, miR-205, miR-328, and miR-30, were down-regulated and acted as tumor suppressors in breast cancer [16– 22]. [score:6]
The miR-34 family, including miR-34a, miR-34b/c, plays an important role in the p53 networking [17, 23– 25]. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 6
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a
MiR-34a (chromosome 1p36) and family-members miR-34b/c (co-transcribed from 11q23) have similar functions but have distinct expression patterns 43. [score:3]
A mo del describing miR-34/AXL function in DCs. [score:1]
OT-II T cells on a CD45.1 background (at 0.5 and 1.5 × 10 [6]) were injected into the tail vain of WT and miR-34 [−/−] mice on day 0. On day 1, mice were injected with 100 μg of OVA peptide or PBS per mouse (Cambridge Reserved Biochemical) in complete Freunds adjuvant (0.5 mg ml [−1]; Sigma) in 0.2 ml into the right leg muscle. [score:1]
For the evaluation of miR-34 and AXL mRNA expression in PB, SF and synovial tissue, samples were obtained from healthy donors, RA patients and PsA patients at Rheumatology clinics (Glasgow, UK) and from the Division of Rheumatology, Fondazione Policlinico Universitario A. Gemelli, Catholic University of the Sacred Heart (Rome, Italy). [score:1]
[1 to 20 of 4 sentences]
84
[+] score: 6
Other miRNAs from this paper: mmu-mir-141, mmu-mir-34c, mmu-mir-34a, mmu-mir-199b
As stated above, several components of the Notch signaling are target of the miR-34 family members [15, 31, 33, 34]. [score:3]
MiR-34 family members were first identified as tumor suppressors [10, 11] and are associated with a variety of tumors [17]. [score:2]
The miR-34 family members share high sequence homology [9]. [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 6
Li et al. observed that the rno-miR-34 family was significantly up-regulated in dimethylnitrosamine -induced hepatic fibrosis, and suggested that miR-34 family members may be involved in the process by targeting acyl-CoA synthetase long-chain family member 1 (ACSL1) [40]. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
Oncogenic miRs are frequently over-expressed in cancer tissues, including miR-21, miR-17-92, miR-155 and miR-372, while miRs such as miR-34 and the let-7 family miR-15a and miR-16-1 are considered as tumor suppressors and their expression is often reduced in cancer tissues [27]. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
Axl expression is also negatively regulated by the microRNAs (miR) miR-34 and miR-199a/b, with an inverse correlation between AXL protein levels and miR-34a expression found in a panel of cancer cell lines [53]. [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
Other miRNAs from this paper: mmu-mir-34c
Injection of miR-34c inhibitor into zygotes inhibits first cleavage division, suggesting that miR-34c has important role in the first cleavage division in mice [27], but the miR-34b/c knockout mice displayed normal fertility [13]. [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
Zeb1 represses the expression of miR-34a and miR-34b/c, and miR-34a conversely down-regulated Zeb1 and c-Myc to decrease the migration and invasion of cancer cells [34]. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
Other miRNAs involved in the inhibition of EMT, such as miR-200 and miR-34, were not found altered in Nanog -overexpressing papillomas. [score:5]
In contrast, miRNAs from the miR-200 and miR-34 families were essentially unchanged between CTR and TG samples (Supplementary Figure S3C). [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 6
In contrast, only four miRNA seed sequences specific to RI mice were successfully validated for differential expression using quantitative RT-PCR as shown in Fig 6 (miR-34b-3p, miR-3082-5p, miR-130a and miR-1912). [score:3]
Our miRNA expression microarray and validation experiments, conducted on serum exosome samples, identified four miRNA seed sequences that corresponded significantly to RI mice (miR-34b-3p, miR-3082-5p, miR-130a and miR-1912), and two miRNA seed sequences that corresponded significantly to CI mice (miR-690 and miR-223). [score:3]
[1 to 20 of 2 sentences]
92
[+] score: 6
Miñones-Moyano E MicroRNA profiling of Parkinson's disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial functionHum. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
The differential expression of miR-181a, miR-133a, miR-26a, miR-499, miR-34b and miR-30c was validated in muscle during ageing (Fig.   3a, b). [score:3]
5 microRNAs with a role in muscle biology: miR-26a (Dey et al. 2012), miR-499 (van Rooij et al. 2009a), miR34b (Roberts et al. 2012), miR-30c (Ketley et al. 2013) and miR-181a (Naguibneva et al. 2006) were validated as differentially expressed during ageing in the skeletal muscle of mice (Fig.   3a). [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
A previous study showed that runx2 is a target of miR-30c, miR-135a, miR-204, miR-133a, miR-217, miR-205, miR-34, miR-23a and miR-338 [34]. [score:3]
[1 to 20 of 2 sentences]
95
[+] score: 6
Especially, an upregulation of miR-21, and of the miR-29 family, as well as a downregulation of the miR-34 family and of miR-124a in tumor specimens are considered as prognostic markers in CRC [25– 28]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a
We next focus on how LF-MF regulates miR-34 expression. [score:4]
Cortez, M. A. et al. PDL1 Regulation by p53 via miR-34. [score:2]
[1 to 20 of 2 sentences]
97
[+] score: 6
In addition to tissue-specific ageing, it is increasingly evident that many miRNA regulate gene expressions in well-known ageing pathways, most notably in the p53 tumor suppressor pathway (miR-34, miR-29 and miR-217, etc. ) [score:6]
[1 to 20 of 1 sentences]
98
[+] score: 6
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34a
Overall, our preclinical data form a solid foundation that could promote the clinical translation of clinically available miR-34 mimic for the treatment of a still incurable disease such as DMPM and, on the other hand, provide the first evidence of a possible cytoprotective/resistance mechanism that may arise towards miRNA -based therapeutics. [score:5]
In addition, a liposomal nanoparticle-formulated synthetic miR-34 (MRX34) recently entered a phase I clinical study for patients with different tumor types [9]. [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 6
Genes mir-34b and mir-34c are located within a single non-coding precursor with a transcriptional start site adjacent to a predicted p53 -binding site [86]. [score:1]
These are mir-26b, mir-29a, mir-34b, mir-92-1, mir-93, mir-133a-1, mir-133a-2, mir-193, mir-221, mir-223, mir-301, mir-323 and mir-346. [score:1]
High levels of miR-34 are consistent with the biology of PEL and KS, which are unusual among human cancers because they almost universally retain fully functional, wild type p53 [88], [89]. [score:1]
Three different miR-34 genes are present in the human genome. [score:1]
Additionally, mir-34b and mir-92-1 fell into this group upon clustering of only the endothelial cell data. [score:1]
The miR-34 promoter is p53-responsive [61], [64], [84], [85], [86], [87]. [score:1]
[1 to 20 of 6 sentences]
100
[+] score: 6
Of the p53 -upregulated miRNAs, miR-34a/b/c-5p [39], miR-145-5p [40], miR-199a-2-3p [41], miR-34b-5p, miR-34c-5p and miR-145-5p, but not miR-34a-5p and miR-199a-2-3p, showed at least two-fold reduced expression at the Thy1- to SSEA1+ transition. [score:6]
[1 to 20 of 1 sentences]