sort by

54 publications mentioning mmu-mir-290a

Open access articles that are associated with the species Mus musculus and mention the gene name mir-290a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 324
Upon STI treatment (42 hrs, 1 µM) we observed a decrease in GFP expression relative to tomato red expression, in the miR290-5p or miR292-5p sponges, suggesting that the sponges were engaging with the target miRNAs (Figure S2). [score:7]
The NF-κB inhibitor, IκBα [29], is an interesting candidate for direct targeting by miR290-5p/292-5p. [score:6]
qPCR analysis of κGT expression in RNA purified from E2A+/+ AMuLV cells expressing a miR290-5p or miR292-5p sponge knockdown construct, and cultured in the presence of STI571 (2.5 µM) for the indicated lengths of time. [score:6]
analysis of HF4 AMuLV cells expressing His-FLAG-E2A, at endogenous levels, and over -expressing either miR129-2_3p, miR290-5p, or mir292-5p. [score:5]
Since both E2A and NF-κB binding activity can be regulated post-transcriptionally, we went on to ask whether miR290-5p/292-5p regulate the induction of κGT by inducing DNA binding activity of E2A and NF-κB to their target sequences in the kappa locus. [score:5]
3B, C. qPCR analysis of (B) κGT or (C) Rag1 expression in RNA purified from wild-type primary pro-B cells transduced with either a miR129-2_3p control knockdown sponge, or a miR290-5p or miR292-5p knockdown sponge. [score:5]
miR290-5p and miR292-5p are independently able to induce expression of κGT expression as well as increase DNA binding activity of NF-κB and E2A. [score:5]
This finding, together with the accumulation of the pre-B population in the miR290 cluster knockout mouse, underscores the potential of low -expressing miRNAs, such as miR290-5p/292-5p, that behave as modulators of pathways in developmental systems. [score:5]
Figure S3 Over -expression of miR290-5p or miR292-5p do not decrease E2A mRNA expression. [score:5]
In our studies we observed a decrease in IκBα protein expression upon miR290-5p/292-5p over -expression. [score:5]
To confirm our miRNA knockdown results that implicated both miR290-5p and miR292-5p as playing a role in activating the kappa locus, we used the miR290 cluster knockout mice to analyze κGT expression in pro-B, large pre-B (B220+, CD43−, IgM− FSC−Hi), and small pre-B cell (B220+, CD43−, IgM− FSC-Lo) populations. [score:5]
2A, B. qPCR analysis of (A) κGT or (B) Rag1 expression in RNA purified from E2A+/+ AMuLV cells over -expressing either miR290-5p or miR292-5p, cultured in the absence or presence of STI571 (2.5 µM, 12 hr). [score:5]
Over -expression of miR290-5p or miR292-5p induces κGT expression in AMuLV cells. [score:5]
To determine if factors upstream of NF-κB are affected by miR290-5p/miR292-5p expression, we examined IκBα (18035), a known inhibitor of NF-κB [29]. [score:5]
To determine if miR290-5p/292-5p over -expression increases expression of E2A, we performed qPCR. [score:5]
0043805.g002 Figure 22A, B. qPCR analysis of (A) κGT or (B) Rag1 expression in RNA purified from E2A+/+ AMuLV cells over -expressing either miR290-5p or miR292-5p, cultured in the absence or presence of STI571 (2.5 µM, 12 hr). [score:5]
It is possible that the target of miR290-5p/miR292-5p is an unknown inhibitor of one or both of these transcription factors, or a factor that is further upstream in the pathway. [score:5]
We note that miR290-5p/292-5p does not regulate Rag1/2 expression in cell culture systems. [score:4]
Together, these observations support our conclusion that members of the miR290 polycistronic cluster play a role in the developmental activation of kGT expression. [score:4]
We propose that E2A activation, upon IL7 attenuation, is regulated through miR290-5p/292-5p expression. [score:4]
To confirm that the apparent role of miR290-5p and miR292-5p in the activation of κGT observed in these experiments was not an artifact of over -expression, we generated miRNA sponge constructs to perform knockdown experiments. [score:4]
QPCR analysis of E2A+/+ AMuLV cells expressing either an empty vector control, miR290-5p, or miR292-5p for (A) E12 or (B) E47. [score:3]
A modest induction of miR290-5p/292-5p occurs in response to STI571 -inhibition of v-abl in transformed pro-B cell cultures, as well as in response to IL7 attenuation in primary B cell cultures. [score:3]
Luciferase activity was not repressed in cells overexpressing miR290-5p/292-5p by fusion of its cDNA to the IκBα 3′UTR (Fig. 4d). [score:3]
Figure S1 Expression of alternative miR290 cluster members. [score:3]
Using qPCR to analyze the precipitated DNA, we observed increased E2A-FLAG binding to Eκi in both miR290-5p and miR292-5p over -expressing cells (Fig. 4a). [score:3]
To confirm whether miR290-5p, miR292-5p, and more broadly the miR290 cluster are involved in B cell development, we analyzed B cell development in miR290 cluster knockout as compared to wild-type mice [7]. [score:3]
This study demonstrates that developing B cells induce expression of miR290-5p and miR292-5p at the pre-B stage to fully activate the germline Igκ locus, a critical event in the pro-to-pre-B cell transition. [score:3]
Together, these data indicate that members of the miR290 polycistronic cluster, miR290-5p and miR292-5p are involved in the activation of the kappa locus as indicated by expression of κGT. [score:3]
v-abl inhibition or IL7 attenuation likely induce additional signaling pathways, aside from miRNAs, that are synergistic with miR290-5p/292-5p, and necessary for full κGT induction. [score:3]
These data indicate that miR290-5p or miR292-5p expression induces binding of NF-κB to Eκi within the kappa locus. [score:3]
miR129-2_3p is expressed at similar levels as miR290-5p and miR292-5p at the pre-B stage, and is not induced at the pro-to pre-B stage in primary B cells or upon STI571 treatment of AMuLV-transformed pro-B cells (data not shown). [score:3]
The miR290 cluster members that share the seed sequence AAGUCC are expressed under different contexts. [score:3]
Immunoblot analysis of E2A+/+ AMuLV cells expressing either an empty vector control, miR290-5p, or miR292-5p and cultured in either the absence or presence of STI571 (2.5 µM, 12 hr). [score:3]
The differential expression of the CUCAAA and AAGUCC members in B cells may be attributed to differential maturation of the miRNAs in the miR290 cluster. [score:3]
We stably expressed miR129-2_3p, miR290-5p, or miR292-5p in this cell line and performed with anti-FLAG or anti-IgG antibodies. [score:3]
These data indicate that miR290-5p or miR292-5p expression induces binding of E2A to Eκi within the kappa locus. [score:3]
However, in the presence of the miR290-5p or miR292-5p sponges, IL7 withdrawal resulted in a significantly diminished induction of κGT expression (Fig. 3b). [score:3]
It is worth noting that in the ESC, the miR290 cluster AAGUCC members play the role of master regulators and strongly regulate proliferation. [score:3]
The remaining miR290 cluster members that share the seed sequence AAGUCC are expressed under different contexts. [score:3]
qPCR analysis of miR290-5p or miR292-5p expression levels in RNA purified from E2A+/+ AMuLV cells cultured in the absence or presence of STI571 (2.5 µM, 12 hr). [score:3]
We observed increased p50 binding to Eκi in both miR290-5p and miR292-5p over -expressing cells and this binding was further increased in the presence of STI571 (Fig. 4b). [score:3]
Over -expression of miR290-5p or miR292-5p induces activation of E2A and NF-κB. [score:3]
Two of the miRNAs identified in the screen as having expression consistently and significantly increased across all three independently transformed AMuLV-transformed pro-B cell lines (Fig. 1a) were miR290-5p and miR292-5p. [score:3]
Likewise, a known inhibitor of E2A, ID2 [28], has predicted binding sites for miR290-5p/miR292-5p in its 3′UTR, but the ID2 3′UTR was not repressed by the miRNAs. [score:3]
In miR290-5p/292-5p over -expressing cell lines we did not observe kappa locus rearrangements, despite κGT induction (data not shown). [score:3]
Together these data indicate that miR290-5p and miR292-5p independently contribute to the induction of κGT expression in primary pre-B cells. [score:3]
Upon stable over -expression of either miR290-5p or mir292-5p, we observed an induction in κGT (Fig. 2a), but not to the levels seen in wild-type AMuLV-transformed pro-B cells treated with STI571. [score:3]
Interestingly, we did not observe an increase in E2A mRNA levels upon miR290-5p/292-5p over -expression. [score:3]
We did not observe an increase in E2A mRNA levels upon miR290-5p/miR292-5p over -expression. [score:3]
The miR290 cluster is expressed as a single transcript encoding seven miRNAs. [score:3]
Using over -expression, we found that miR290-5p/292-5p contribute to full activation of κGT. [score:3]
qPCR analysis of miR291-5p, miR290-3p, and miR292-3p expression levels in RNA purified from primary wild-type pro-B (B220+, CD43+, IgM−) or pre-B (B220+, CD43−, IgM−) cells. [score:3]
miR290-5p/292-5p knockdown, in either STI571 -treated AMuLV-transformed pro-B cells or in an IL7 regulated primary B cell culture system, and germline- deletion of the miR290 cluster in mice, result in a blunting of κGT induction. [score:3]
The gene encoding a known inhibitor of E2A activity, ID2 [28] (15902), has predicted binding sites for miR290-5p/miR292-5p in its 3′UTR. [score:3]
NF-κB and E2A showed increased binding to Eκi in vivo, in response to miR290-5p/292-5p expression. [score:3]
These miRNAs are members of the murine miR290 polycistronic cluster, previously reported to be expressed only in gonads of both sexes, but not in other tissues examined [7]. [score:3]
This may be explained by the lack of Rag1/2 activation when miR290-5p/292-5p are over-expressed in AMuLV pro-B cells in the absence of STI571. [score:3]
analysis of E2A+/+ AMuLV cells over -expressing either miR129-2_3p, miR290-5p, or mir292-5p, in the absence or presence of STI571 (1 µM, 16 hr). [score:3]
Protein levels for IκBα are repressed upon miR290-5p or miR292-5p over -expression to similar levels as observed in the STI571 -treated control sample. [score:3]
There are few validated targets for miR290-5p or miR292-5p, but this group may include p16 [38] (12578) and Lats1 (16798), two genes implicated in cell cycling. [score:3]
So we asked if miR290-5p or miR292-5p over -expression enhances E2A binding to Eκi in vivo. [score:3]
We stably expressed miR129-2-_3p, miR290-5p, or miR292-5p in this cell line and performed with anti-p50 (18033) (an NF-κB subunit) or anti-IgG antibodies. [score:3]
Over -expression of miR290-5p or miR292-5p Induces Germline Igκ Transcription in AMuLV Cells. [score:3]
We propose a novel role for miR290-5p and miR292-5p in the activation of the kappa locus during B cell development. [score:2]
Interestingly, we also observed a blunted Rag1 induction in the small pre-B population of miR290 cluster knockout mice (Fig. 5d). [score:2]
We observed a blunted κGT induction in the small pre-B population of miR290 cluster knockout mice (Fig. 5c). [score:2]
Our studies have uncovered a novel role for miR290-5p and miR292-5p in this key developmental process. [score:2]
κGT induction is blunted upon knockdown of miR290-5p or miR292-5p. [score:2]
Despite having predicted miR290-5p/miR292-5p binding sites in its 3′UTR, a luciferase mRNA fused to the IκBα 3′UTR was not directly repressed by these miRNAs. [score:2]
In miR290 cluster knockout mice we observe diminished κGT levels in both pro-B and pre-B cells. [score:2]
This indicates that members of this pathway may be regulated by miR290-5p/292-5p (Fig. 4c). [score:2]
The miR290 cluster germline knockout displays partially penetrant embryonic lethality in which homozygotes survive gestation at only 7% of the predicted Men delian ratio [7]. [score:2]
This experiment has been repeated with four mice per genotype and data shown is representative of three out of four miR290 knockout mice. [score:2]
It was reported previously that upon IL7 withdrawal, the amount of bound E2A increases at Eκi [20] and knockdown of miR290-5p or mir292-5p upon IL7 withdrawal blunts κGT induction as shown above. [score:2]
Our studies are the first to describe a phenotype in lymphoid cells in the miR290 cluster knockout mice. [score:2]
This blunting of κGT induction upon knockdown of endogenous drug -induced miR290-5p or miR292-5p indicates that these miRNAs partially contribute to the activation of the kappa locus upon STI571 treatment of AMuLV-transformed cells. [score:2]
Germline knockout of the miR290 cluster affects the pre-B cell population. [score:2]
Knockdown strategies showed that miR290-5p/292-5p are necessary for full activation of κGT. [score:2]
In the miR290 cluster knockout mice we observed a modest accumulation of pre-B cells and a general blunting of κGT levels. [score:2]
To further test the role of miR290-5p and miR292-5p in the activation of the kappa locus observed in our AMuLV mo del system, we performed similar sponge knockdown experiments in a primary developing B cell culture system. [score:2]
were 6 week old miR290 cluster knockout or wild-type mice. [score:2]
In an effort to elucidate the pathway through which miR290-5p or miR292-5p induce κGT, we examined transcription factors known to be involved in the induction of κGT by direct binding to either the 3′ kappa enhancer (3′Eκ) or the kappa intronic enhancer (Eκi). [score:2]
As described above, the miR290 cluster germline knockout has a partially penetrant embryonic lethality in which homozygotes survive gestation at only 7% of the predicted Men delian ratio. [score:2]
This different effect on Rag1 may be attributed to the other miRNA members of the miR290 cluster also deleted in the miR290 cluster knockout mouse. [score:2]
However, in the miR290 cluster knockout mice we observe a blunting of Rag1 induction at the pro-B, large pre-B, and small pre-B stages. [score:2]
FACS analysis of 6 week old miR290 cluster knockout or wild-type mice. [score:2]
The miR290 Cluster in B Cell Development. [score:2]
Using specific Taqman qPCR assays, we confirmed that both miR290-5p and miR292-5p display a modest increase in expression upon STI571 treatment (Fig. 1c). [score:2]
These defects are obvious contributors to the reduced survival potential of homozygotes, and emphasize the importance of the miR290 cluster in development. [score:2]
Rag1 induction remained intact in both the AMuLV pro-B cells as well as the IL7 -dependent primary B cell cultures, upon knockdown of miR290-5p or mir292-5p, while κGT induction was blunted. [score:2]
This difference might be attributable to the other miR290 cluster members also deleted in the miR290 knockout. [score:2]
Figure S4 miR290-5p or miR292-5p do not directly repress the ID2 3′UTR. [score:2]
We then retrovirally transduced the expanded pro-B cell culture with either the negative control, miR290-5p, or miR292-5p sponges. [score:1]
It is possible that miR290-5p/miR292-5p induction upon STI571-treatment of Abelson cells and IL7 attenuation in primary B cell cultures, is a consequence of either cell cycle arrest or activation of the apoptosis pathway known to occur under these circumstances. [score:1]
They further speculate that this is the case in the miR290 cluster deletion. [score:1]
Schematic depiction of the shared seed sequence of the mature miR290-5p and miR292-5p microRNAs. [score:1]
In summary, we identified two miRNAs, miR290-5p and miR292-5p, that are induced in pre-B cells. [score:1]
We used a dual-luciferase assay to determine whether miR290-5p/292-5p can directly repress the IκBα 3′UTR. [score:1]
Binding sites were as follows: miR129-2_3p: ATGCTTTTTGTTTGAAGGGCTT, miR290-5p: AAAGTGCCCCACCCGTTTGAGT, miR292-5p: CAAAAGAGCCAAACGTTTGAGT. [score:1]
A third member of the miR290 polycistronic cluster with a similar seed sequence as miR290-5p/292-5p, miR291-5p, is also induced; however other members of the miR290 cluster with an alternate seed sequence did not increase upon STI571 treatment (Figure S1). [score:1]
It is important to note that IκBα has a predicted miR290-5p/292-5p binding site in exon 4 that has not been examined. [score:1]
The modest miR290-5p/292-5p induction may be a reflection of the partial role these miRNAs play in full κGT activation. [score:1]
In our study, miR290-5p/292-5p are thought to be similar in function since they share the seed sequence CUCAAA. [score:1]
miR290-5p and miR292-5p are members of the miR290 polycistronic cluster [6]. [score:1]
miR290-5p/292-5p share the seed sequence CUCAAA similar to miR291-5p (100049715, 100124471), AUCAAA. [score:1]
miR290-5p and miR292-5p are induced at the pro-B to pre-B transition. [score:1]
Therefore, we propose that loss of IL7 signaling activates miR290-5p/292-5p, that leads to induction of κGT. [score:1]
We sorted pro-B (B220+, CD43+, IgM−) and pre-B (B220+, CD43−, IgM−) cells from wild-type mouse bone marrow by flow cytometry, purified total RNA, and performed qPCR for quantification of miR290-5p and miR292-5p. [score:1]
Our screen identified two miRNAs, miR290-5p and miR292-5p, that originate from the miR290 Cluster transcript and share an identical seed-sequence. [score:1]
We found a moderate increase in the percentage of pre-B cells in the homozygous miR290 knockout mice, as compared to the wild-type mice (p = 0.05) (Fig. 5a, b). [score:1]
miR290 Cluster and its Members. [score:1]
In addition, preliminary experiments show that miR290-5p/292-5p are induced at an earlier time point than the onset of cell cycle arrest in STI-571 treated Abelson cells, therefore, making it unlikely that this miRNA cluster is induced as consequence of cell cycle arrest. [score:1]
Generally the CUCAAA miR290 cluster members and the AAGUCC members are not thought to overlap functionally. [score:1]
miR290-5p and miR292-5p Enhance DNA Binding Activity of E2A and NF-κB. [score:1]
The miR30 cassette was replaced with either miR129-2_3p, miR290-5p, or miR292-5p. [score:1]
A role for miR290 cluster members in lymphoid cells has not been described. [score:1]
Activation of NF-κB is due in part to miR290-5p/292-5p induction at the pre-B stage. [score:1]
E2A+/+ AMuLV cells were stably transduced with tandem tomato marked sponge constructs for miR129-2_3p, mir290-5p, or miR292-5p. [score:1]
However, we observed a blunting of normal κGT induction in the miR290-5p or miR292-5p sponge lines (Fig. 3a). [score:1]
qPCR analysis of miR290-5p or miR292-5p in primary wild-type pro-B (B220+, CD43+, IgM−) cells or pre-B (B220+, CD43−, IgM−) cells. [score:1]
Differential maturation may be due to pri-miRNA accessibility to Drosha, determined by the miR290 cluster tertiary structure, as is the case with the miR17∼92 cluster [34], among other possibilities. [score:1]
We sought to determine if miR290-5p/292-5p directly repress the ID2 3′UTR using a dual-luciferase assay. [score:1]
In our study we observe a more modulatory role for the CUCAAA members of this cluster, miR290-5p and miR292-5p. [score:1]
Interestingly, the AAGUCC miRNAs, including miR* counterparts miR290-3p and miR292-3p, are not detected in our system (Figure S1). [score:1]
[1 to 20 of 125 sentences]
2
[+] score: 221
miRNA target sites were inserted into pArg-FF (perfectly complementary miR-290–295 targets) or pArg-FF-P (perfectly complementary miR-371–373 targets, seed only targets and bulge targets) as synthetic oligonucleotides. [score:11]
All well-established biological functions of the miR-290–295/miR-371–373 cluster family - regulation of the G1/S transition in ES cells, suppression of apoptosis in ES cells, promoting iPS cell reprogramming, germ cell tumorigenesis and indirect effects on ES cell genome methylation – depend on target suppression via the 2–7 U seed [22]– [26]. [score:9]
Given the above findings, we reasoned that reporters containing target sites that pair only to the seed regions of miR-290–295/miR-371–373 (seed only targets) or to the seed regions as well as the 3′- regions of the miRNAs but not to the middle of the miRNAs (bubble mismatch targets) might respond to seed mismatches in a more qualitative manner. [score:7]
One strategy for the functional validation of proposed miRNA isoforms within miR-290–295 and miR-371–373 consists of mutating the seed regions of the perfectly complementary target sites described above with the expectation that mutations, which disrupt pairing of a single miRNA isoform to the target would be less deleterious than mutations, which interfere with the pairing of multiple overlapping miRNA isoforms produced from the same pre-miRNA. [score:7]
Indeed, miR-290–295/miR-371–373 family members directly control the G1-S cell cycle transition and inhibit apoptosis due to genotoxic stress in mouse ES cells, increase the efficiency of both mouse and human somatic cell reprogramming to induced pluripotent (iPS) cells and indirectly control the methylation of the mouse ES cell genome [22]– [26]. [score:5]
Co-transfection of miR-371–373 reporters harboring perfectly complementary miRNA binding sites and a miR-371–373 expression construct into miR-290–295 null ES cells resulted in efficient silencing of the miR-371-5p, miR-371-3p, miR-372-3p and miR-373-3p luciferase reporters but not of the reporter constructs carrying miR-372-5p and miR-373-5p target sites (Figure 3D, Figure S3B, Table S1). [score:5]
A hallmark feature of the evolution of the miR-290–295/miR-371–373 cluster family is the gradual addition of new miRNA seeds and it is tempting to speculate that the built in propensity of these clusters to generate co-expressed multiple distinct seeds reflects some undiscovered general property of the corresponding target interaction networks. [score:5]
In addition, miR-302 and miR-467a are expressed in mouse ES cells and supplement silencing of the miR-290–295 targets via the 2–7 U seed [16], [27]. [score:5]
However, the miR-371–373 cluster is expressed at much lower levels in human ES cells than miR-290–295 is expressed in mouse ES cells [12], [16], [27]. [score:5]
Given the quantitative rescue of reporter silencing by transfection of miR-290–295 expression constructs in miR-290–295 null mouse ES cells we reasoned that the shortest route to determining which strands of pre-miR-371–373 yield active miRNAs would be via their heterologous overexpression in mouse ES cells. [score:5]
The expression pattern of miR-290–295/miR-371–373 is, thus, consistent with functions during early embryonic development and/or the development of the germ line as well as the maintenance and/or differentiation of stem cell lines derived from the early embryonic lineages. [score:5]
Thus, we were able to confirm that the perfectly complementary targets are silenced by their cognate miRNAs by performing rescues with various mutant miR-290–295 expression constructs (Figure 3C). [score:5]
As development proceeds miR-290–295/miR-371–373 expression becomes restricted to the germ line with high levels reported in primordial germ cells and the stem cell compartment of the adult testis [19]– [21]. [score:4]
Indeed, expression of miR-294 in miR-290–295 knockout ES cells resulted in robust silencing of the 2-7C-S reporter, but not of the 3-7C-S reporter (Figure 4C, +miR-294 rescue) strongly suggesting interactions with positions 2–8 of miR-294-3p0. [score:4]
Importantly, the inefficient silencing of the 4-7CG-B reporter demonstrates that 6mer seed (positions 2–7) pairing of any putative 3p+2 isoforms does not contribute significantly to the silencing of 7mer target 3-7CG-B. Rescue experiments in miR-290–295 knockout ES cells confirmed that silencing of the 3-7CG-B reporter depends on pre-miR-292 and silencing of the 4-7CGC-B reporter depends on pre-miR-293 (Figure 5C, D). [score:4]
Co-transfection of a miR-290–295 expression vector and the miR-290–295 luciferase reporters into miR-290–295 knockout ES cells quantitatively rescues silencing (Figure 3A, compare datasets “WT ES cells” and “ KO ES cells + Rescue”). [score:4]
Here, we address these questions by studying the silencing of synthetic reporters targeted specifically by the various predicted miR-290–295 and miR-371–373 isoforms. [score:3]
miR-290–295 are also expressed in trophoblastic stem (TS) cells and extraembryonic endoderm (XEN) cells [15], [17]. [score:3]
Given that the corresponding position 8 is not well conserved in the pre-miR-290–295/pre-miR-371–373 cluster family, 7mer seed target recognition by such 3p+1 isoforms would have to be species specific (Figure 1A, Figure S2). [score:3]
Silencing of luciferase reporters containing perfectly complementary miR-290–295 and miR-371–373 target sites in mouse ES cells. [score:3]
Thus, single perfectly complementary miR-290–295/miR-371–373 target sites should confer silencing that is specific to the individual pre-miRNA hairpins and can be used to determine the strand(s) of each hairpin stem that yield active miRNA species. [score:3]
The pre-miRNA relationships deduced from the seed expression data are also consistent with the clustering of pre-miR-371, pre-miR-290, pre-miR-292 and pre-miR-293 in a separate branch of the multiple sequence alignment UPMGA tree (Figure 1A). [score:3]
Thus, the silencing of perfectly complementary target sites strongly suggests that despite their different pre-miRNA organization the miR-290–295 and miR-371–373 clusters have very similar if not identical seed repertoires. [score:3]
In this case pre-miR-295 and pre-miR-372 would express the same single 2-7U 7mer seed, which is shared with pre-miR-291a, pre-miR-294 and pre-miR373 and, importantly, is represented in all homologous miR-290–295/miR-371–373 loci. [score:3]
As with miR-290–295, dilution of the miR-371-373 reporter constructs had no effect on the relative silencing of the reporters confirming that the failure to silence the miR-372-5p and miR-373-5p reporters is not due to excess of the mRNA targets over the hypothetical miRNAs. [score:3]
miR-290–295 is among the first genes expressed after fertilization with de novo synthesis of the corresponding mature miRNAs commencing at the two cell stage [18]. [score:3]
Furthermore, the lack of high confidence targets for the pre-miR-290/pre-miR-292/pre-miR-293 seeds in HITS-CLIP data from mouse ES cells suggests that the corresponding miRNAs might be physiologically relevant in other biological contexts such as the extraembryonic lineages and/or TS and XEN cells. [score:3]
Figure S2 Multiple sequence alignment of the perfectly complementary target sites, in miRNA sense orientation (Table 1 ), designed to detect 5p (A) and 3p (B) miRNAs processed from miR-290–295 and miR-371–373. [score:3]
miR-290–295/miR-371–373 short RNA sequencing data include datasets representing total short RNA from mouse and human ES cells, total short RNA from ectopic overexpression experiments in HEK-293 cells as well as high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) data representing RNAs crosslinked to the Argonaute component of miRISC [6], [12], [16], [27]. [score:3]
miR-290–295 are the most abundant miRNAs in mouse embryonic stem (ES) cells where they comprise approximately a third of the total miRNA pool but their expression ceases rapidly upon retinoic acid induced differentiation in vitro [13], [16]. [score:3]
If this is indeed the case then the targeting properties of the seven pre-miRNA miR-290–295 and the three pre-miRNA miR-371–373 are not just similar but identical and the two clusters are functionally equivalent. [score:3]
From the 5p-reporters, only the miR-290-5p and miR-292-5p target sites confer robust silencing despite the fact that all 5p-reporters are highly similar to each other (Figure 1A, Figure S2). [score:3]
Thus, present mo dels of miR-290–295/miR-371–373 function focus on relatively ancient miR-290–295/miR-371–373-target interaction networks involving the 2–7 U seed family. [score:3]
Mo dels of the miR-290–295/miR-371–373 target interaction networks should incorporate the pre-miR-371/pre-miR-290/pre-miR-292/pre-miR-293 seeds. [score:3]
The miR-290–295 and miR-371–373 expression constructs, pArgF101-290–295 and pArgF101-371–373, consist of PCR amplified BAC fragments inserted into the pArgoP derivative pArgF101+, which has an added polyomavirus origin of replication [45]. [score:3]
The target sites correspond to defined 5′ and 3′ blocks within the pre-miR290–295/pre-miR-371–373 multiple sequence alignment and span all 5′- and 3′- isomiRs implied by the sequencing data (Figure 1A, Figure S2, Table S1). [score:3]
Given the involvement of the 2-7U seed in cell proliferation and survival, it is likely that the phenotypes caused by the loss of the 2-7U seed miRNAs in the miR-290-295 knockout mouse mask any specific phenotypes due to the loss of function of pre-miR-290, pre-miR-292 and pre-miR-293 [20]. [score:2]
As expected, none of the reporters were significantly silenced when transfected in miR-290–295 knockout ES cells (Figure 3A, KO ES cells) [20], [26]. [score:2]
Indeed, co-transfection of a miR-371–373 rescue construct into miR-290–295 knockout ES cells resulted in silencing of the 3-7CG-B and 4-7CGC-B reporters (Figure 5E, F). [score:2]
If this hypothesis is correct, then processing of the corresponding mouse pre-miR-290, pre-miR-292 and pre-miR-293 might also be differentially regulated. [score:2]
Co-transfection of a miR-371–373 rescue construct into miR-290–295 knockout ES cells resulted in silencing of the 2-7C-S reporter (Figure 4D). [score:2]
Silencing of bulge-mismatch reporters specific for the 3p+1 and 3p+2 seeds in miR-290–295/miR-371–373. [score:1]
From the 5p- short RNA species only miR-290-5p and miR-292-5p represent active miRNAs. [score:1]
The miR-292-3p+1/miR-371-3p+1 bulge reporter 3-7CG-B and its corresponding position 2 mismatch control 4-7CG-B (C, E) or the miR-293-3p+2/miR-371-3p+2 bulge reporter 4-7CGC-B and its position 2 mismatch control 5-7CGC-B (D, F) were co -transfected as in Figure 3C, E. Our results demonstrate that despite their different pre-miRNA organization the seed repertoires of miR-290–295 in the mouse and miR-371–373 in human are very similar if not identical (Figure 1A, Table 1). [score:1]
The multiple sequence alignments of pre-miR-290–295/pre-miR-371–373 suggest that pre-miR-371 in the human cluster is capable of producing isomiRs with seeds corresponding to the mouse miR-292-3p0, miR-292-3p+1 and miR-293-3p+2, implied by the sequencing data. [score:1]
Silencing of seed only miR-290–295/miR-371–373 reporters. [score:1]
Within miR-290–295 and miR-371–373 the individual pre-miRNA hairpin sequences are homologous to each other and this homology together with the conservation of the putative promoter element as well as the synteny of the corresponding genomic loci is used to define miR-290–295/miR-371–373 cluster homologs in other species [15]. [score:1]
pre-miR-290, pre-miR-292 and pre-miR293 are co-orthologs of pre-miR-371: evolution of miR-290-295 from a three-hairpin ancestor. [score:1]
0108519.g004 Figure 4(A) Sequence variation between multiple sequence alignment positions 3p0 and 3p+9 in pre-miR-290–295/pre-miR-371–373. [score:1]
This dinucleotide is only present in the promoter-proximal pre-miRNAs of the miR-290–295/miR-371–373 cluster family (pre-miR-290 and pre-miR-371 in human) and the additional paralogs in the mouse miR-290–295 (pre-miR-292 and pre-miR-293). [score:1]
Available RNA sequencing data imply functional non-equivalence of the individual miR-290–295/miR-371–373 pre-miRNAs but are not sufficient to determine their precise seed repertoire. [score:1]
Schematic representations of the miR-371–373 (top) and miR-290–295 (bottom) clusters are shown together with the active miRNA isoforms processed from each pre-miRNA hairpin and their corresponding seeds. [score:1]
The multiple sequence alignment of the miR-290–295/miR-371–373 pre-miRNAs reveals considerable variation in the middle of the predicted mature miRNA sequences (Figure 1, Figure S2). [score:1]
The active seeds in miR-290–295 and miR-371–373 and the corresponding miRNA isoforms identified in this study are summarized in Table 1. 10.1371/journal. [score:1]
0108519.g001 Figure 1Comparisons of the miR-290–295/miR-371–373 clusters in Placentalia. [score:1]
Reads that originate from the mouse pre-miR-290 and the human pre-miR-371 (the most upstream hairpins in the clusters) map predominantly to the 5′- strand of the hairpin stem, suggesting that miR-290-5p and miR-371-5p and not the corresponding 3p- isomiRs are the active mature miRNA species and most sequencing data imply that miR-293-3p+2 is the sole isomiR processed from pre-miR-293 (Figure 2, pre-miR-293). [score:1]
However, discrepancies between the various datasets, make the unambiguous assignment of active mature miRNAs to each pre-miRNA hairpin difficult (Figure 2, total RNA datasets for pre-miR-291a, pre-miR-293, pre-miR-294 and total RNA versus HITS-CLIP data for pre-miR-290). [score:1]
Furthermore it is not a priori clear whether all seeds that are implied by the sequencing data for the seven pre-miRNAs in the mouse miR-290–295 are also present in the three pre-miRNAs of the human miR-371–373. [score:1]
The discovery of a putative miR-290–295/miR-371–373 homolog in the armadillo which represents Xenarthrans and the absence of miR-290–295/miR-371–373 homologs in marsupials, thus, suggests that the miR-290–295/miR-371–373 cluster family has appeared after the marsupial-placental split of ancestral mammals (Theria) but possibly prior to the basal Xenarthra- Epitheria split of placentals. [score:1]
Finally, we note that neither the miR-291b-5p nor the miR-291b-3p reporters were silenced in any of the above experiments, which is consistent with the fact that pre-miR-291b sequences represent about 0.1% of all reads that map to the entire miR-290–295 locus in the various sequencing datasets (Figure S1, note that the 5′- end distributions are different in the different libraries and, thus, indicative of noise due to non-specific pri -RNA degradation). [score:1]
Schematic representations of the miR-290–295/miR-371–373 homologs in placental mammals are shown together with the postulated miRNA isoforms and corresponding seed sequences processed from the individual pre-miRNA hairpins. [score:1]
Overall the 5′-ends of RNAs in the sequencing data map predominantly to the 5p0 and 3p0 positions of pre-miR-290–295/pre-miR-371–373 and more reads map to the 3p- than the 5p- strands of the hairpin stems. [score:1]
The presence of many more 3p- sequences than 5p-sequences in the pre-miR-292 HITS-CLIP data is likely due to the inefficient crosslinking of the active miR-292-5p, whereas the crosslinking of the active miR-290-5p is probably so inefficient that it is close to the background library contamination by inactive miR-290-3p sequences resulting in similar abundance of pre-miR-290 5p- and 3p- reads in the HITS-CLIP dataset (Figure 2). [score:1]
The elucidation of the seed repertoires of miR-290–295 and miR-371–373, however, provides additional information that allows the reconstruction of the miR-290–295/miR-371–373 cluster family evolution by focusing on the acquisition of new seeds. [score:1]
While the seven-hairpin arrangement of the mouse miR-290–295 cluster is conserved in the rat genome (data not shown), in most species the miR-290–295/miR-371–373 clusters contain either three (the most common arrangement) or two (in orders Artiodactyla, Afrosoricida and Proboscidea) pre-miRNA hairpins (Figure 1B). [score:1]
Thus, given the conservation of all other miR-290–295/miR-371–373 seeds we favor a mo del in which both miR-295-3p+1 and miR-373-3p+1 are not active. [score:1]
Sequencing data suggest that both the production of isomiRs with alternative 5′-ends and the loading of alternative strands of the pre-miRNA stems into miRISC cause considerable seed diversification of the homologous pre-miR-290–295 and pre-miR-371–373 hairpins [12], [16], [27]. [score:1]
In the mouse, their seeds are represented by miR-290-5p0/miR-292-5p0, miR-292-3p+1 and miR-293-3p+2 respectively (Figure 1A, Table 1). [score:1]
The miR-290–295 cluster in the mouse and its miR-371–373 homolog in human are the founding members of the miR-290–295/miR-371–373 cluster family [13]– [15]. [score:1]
The discrepancies between the luciferase data presented above and the total RNA sequencing datasets are likely due to PCR amplification artifacts, whereas discrepancies with the HITS-CLIP data are best explained by a propensity of the 5p- miR-290–295 isoforms to crosslink much less efficiently to the Argonaute miRISC component than the 3p- miRNAs. [score:1]
The fact that in most species the miR-290–295/miR-371–373 clusters consist of only two or three pre-miRNA hairpins (Figure 1B), raises the question of whether all the distinct miRNA seeds that could potentially be encoded by the mouse miR-290–295 cluster are also encoded by its homologs in other species. [score:1]
Comparisons of the miR-290–295/miR-371–373 clusters in Placentalia. [score:1]
Functional assignment of active miRNAs narrows down the potential seeds within the miR-290–295 cluster. [score:1]
Active seeds in miR-290–295 and miR-371–373. [score:1]
The first step in addressing this question is the experimental identification of functionally active miRNAs within miR-290–295 and miR-371–373. [score:1]
0108519.g006 Figure 6(A) Functional homologies between the miR-290–295 and miR-371–373 pre-miRNAs. [score:1]
The miR-290–295/miR-371–373 loci in placental mammals. [score:1]
J1 and miR-290–295 ES cells were a gift from Rudolf Jaenisch and Phillip Sharp and were propagated by standard protocols [20], [26], [43], [44]. [score:1]
In fact, the seven-hairpin structure of miR-290–295 is not even common to all rodents as evidenced by the three-hairpin organization of the locus in the squirrel (Figure 1B, ict_tri). [score:1]
However, as reported previously, neither BLAST nor HMMER identify miR-290–295/miR-371–373 homologs in the genomes of marsupials and non-mammalian vertebrates [15]. [score:1]
Evolutionary relationships in the miR-290–295/miR-371–373 cluster family. [score:1]
Short RNA 5′-end distributions in pre-miR-290–295 and pre-miR-371–373 sequencing data. [score:1]
Together the 5p- and 3p- miRNAs processed from the mouse miR-290–295 cluster are capable of producing a total of between 5 and 9 distinct seeds depending on the seed definition, sequencing dataset and criteria used to identify active miRNA species (Compare Figure1A and Figure 2). [score:1]
The proposed nomenclature is based on the miR-290–295/miR-371–373 multiple sequence alignment and can be applied to any cluster of homologous pre-miRNAs that yields alternative miRNA isoforms. [score:1]
Reporter nomenclature follows the notation introduced above for the miR-290–293/miR-371–373 seeds and Figure 4A can be used to track the miRNA - seed interactions detected by the various reporters. [score:1]
The 7mer seed regions that correspond to the putative miR-295-3p+1 and miR-372-3p+1 isoforms are not conserved in the miR-290–295/miR-371-373 cluster family (Figure 1A). [score:1]
The active seeds in miR-290–295 and miR-371–373 and the corresponding miRNA isoforms identified in this study are summarized in Table 1. 10.1371/journal. [score:1]
Functional equivalence of miR-290–295 and miR-371–373. [score:1]
Only two active miRNAs, miR-290-5p0 and miR-292-5p0, which share the same (5p)2-7C seed, are processed from the 5p- strands of the pre-miR-290-295 stems in the mouse. [score:1]
Evolution of the miR-290–295/miR-371–373 family in Placentals. [score:1]
In summary, the reporter silencing data presented above unambiguously identify the strands of the pre-miR-290–295 stems that produce active miRNAs. [score:1]
All of the 3p-reporters except miR-290-3p and miR-291b-3p were robustly silenced in wild type ES cells. [score:1]
miRNA isoform and seed nomenclature for the homologous pre-miR-290–295/pre-miR-371–373. [score:1]
Our results demonstrate that despite their different pre-miRNA organization the seed repertoires of miR-290–295 in the mouse and miR-371–373 in human are very similar if not identical (Figure 1A, Table 1). [score:1]
Functional assignment of active miRNAs within miR-371–373 implies conservation of most, if not all, miR-290–295 seeds. [score:1]
We designate the first nucleotide position within the conserved ACUCAAA block found in the 5′- strands of the pre-miR290–295/pre-miR-371–373 stems 5p0 and the first position of the conserved AAAGUGC block present in the 3′- strands of the pre-miRNAs 3p0 (Figure 1A). [score:1]
Our data strongly suggest that the mouse pre-miR-290, pre-miR-292 and pre-miR-293 have taken over specialized functions from the single human pre-miR-371 hairpin. [score:1]
Our functional validation eliminates miR-290-3p as an active miRNA, but the maximum theoretical 3p- seeds remain between 4 and 5, depending on seed definition. [score:1]
We implemented this strategy by inserting sequences perfectly complementary to miR-290–295 downstream of a firefly luciferase reporter driven by the CAG promoter [32]. [score:1]
Thus, the two-hairpin structure of the miR-290–295/miR-371–373 clusters in Afrosoricida and Proboscidea on the one hand and Artiodactyla on the other reflects completely different evolutionary events. [score:1]
Deletion of the miR-290–295 cluster results in partially penetrant embryonic lethality and female-specific sterility due to inefficient colonization of the embryonic gonad by primordial germ cells [20]. [score:1]
Previously miR-290–295/miR-371–373 homologs were identified in four distinct mammalian orders by a combination of BLAST and HMMER searches [15], [28]. [score:1]
[1 to 20 of 102 sentences]
3
[+] score: 92
By extension, it can be inferred that many common targets of miR-302 and miR-290 are likely to undergo similar differences in expression in tissues or cell types showing sex-related polymorphism of miR-302 expression, including EGs (Figure 3G) and, presumably, PGCs. [score:7]
These observations together with the results of the present study thus predicted that some shared targets of the miR-302 and miR-290 clusters should be specifically downregulated in male embryonic stem and germ cells, in which the miR-302 family accumulates at much higher levels than in female cells. [score:6]
Dataset S2 Predicted target transcripts from the EIMMo target prediction software for miR-290 cluster (Sheet 1), miR-293 (Sheet 2), and miR-302 cluster (Sheet 3). [score:5]
This miRNA shows the opposite pattern to all of the other highly expressed members of the miR-290 cluster (increase throughout differentiation, PAM class B, Figure 1B), suggesting drastically distinct targets and cellular functions for this specific miRNA. [score:5]
Dataset S3 Predicted target transcripts from the Pictar target prediction software for miR-290 cluster (Sheet 1), miR-293 (Sheet 2), and miR-302 cluster (Sheet 3). [score:5]
In the mouse, miR-290 targets key cell cycle regulators (including Cdkn1 or P21) and transcriptional repressors including Rb1, Rbl1, and Rbl2, also resulting in enhanced G1-S phase transition [4]. [score:4]
The mouse miR-290 cluster was recently shown to target several key cell cycle regulators and transcriptional repressors to enable rapid G1-S transition and maintenance of DNA de-methylation, two defining features of stem cells [19], [31]. [score:4]
On the one hand, only a fraction of miRNAs that accumulate at saturating levels (eg the miR-290 cluster) might effectively recruit miRNPs for target regulation. [score:4]
In this context, identification of Arid4 as a novel target of both miR-290 and miR-302 is entirely consistent with the established role of ARID4 as an Rb -mediated repressor of E2F -dependent transcription, which is mandatory for the G1-S phase transition in the cell cycle [44]. [score:3]
This idea was recently given some experimental support by the demonstration that certain proliferation defects of Dgcr8 [−/−] mouse ES cells are rescued to a similar extent through ectopic expression of individual members of either the mouse miR-302 or miR-290 clusters [32]. [score:3]
We also used a miR-291a-3p duplex as a representative of the miR-290 family, of which several members are also predicted to target Arid4b owing to seed identity with miR-302 (Figure 4D, Dataset S2 and Dataset S3). [score:3]
Interestingly, both studies involved the rescue of either Dicer [−/−] or Dgcr8 [−/−] ES cell defects through ectopic expression of the entire miR-290 cluster or some of its highly abundant members [20], [32]. [score:3]
These and other studies thus point to the effects of the miR-290 cluster being due to a single, coordinated expression unit with functionally redundant products. [score:3]
In agreement with these previous studies, separate time-course analyses of each member revealed that only 4 miRNAs, which share the same AAAGUGC 5′ seed sequence (miR-291a-3p, miR-292-3p, miR-294, miR-295, Figure 2A, blue), likely contribute significantly to the global trend of miR-290 cluster expression (reduced throughout differentiation, PAM class A; Figure 2A, grey). [score:3]
In any case, these results show that the contribution of the miR-290 cluster to pluripotency cannot be interpreted in terms of a single, coordinated expression unit with redundant products. [score:3]
Other high-scoring candidates included a set of genes that had been previously validated as targets for miR-290 in mice. [score:3]
Perhaps even more compelling, the analysis of the miR-290 cluster also revealed an unexpected expression profile for the highly abundant miR-293. [score:3]
Together with our ES cell time-course analysis (Figure 3B and 3D; Figure 4C) these results strongly suggest (i) that Arid4b is a common mRNA target of miR-302 and miR-290 family members and (ii) that the differences in Arid4b levels between male and female D2 and D5 ES cells are due to the male-specific accumulation of miR-302. [score:3]
We first focused our attention on the highly expressed miR-290 cluster located on chromosome 7, a potent marker of mouse ES cell pluripotency (Figure 1A–1B) [17], [22]. [score:3]
Thus, in contrast to the complex situation described above for the miR-290 cluster, in this particular case the PAM analysis of temporal miRNA/target variations shows that the effect of a miRNA gene cluster can be probably equated to that of a single miRNA member within it. [score:3]
Interestingly, all members of the miR-302 cluster share the same AAGUGC(U/C) 5′ seed sequence with the highly expressed members of the miR-290 cluster (with the notable exception, of course, of miR-293; Figure 2A–2B). [score:3]
These data can now be assembled into a comprehensive, albeit still speculative mo del, integrating the possible overlapping functions of miR-290 and miR-302 in mouse cell totipotency during early development (Figure S9). [score:2]
Figure S9Putative interactive mo del between miR-302 and miR-290 families and cell cycle regulation. [score:2]
Several recent reports underscore important roles for miRNAs in preventing differentiation of ES cells, most notably through the activity of the pluripotency miR-290 cluster [17]– [20]. [score:1]
Members of the miR-302 and miR-290 clusters can individually rescue the proliferation defects of mouse Dgcr8 [−/−] ES cells [32]. [score:1]
Moreover, these 3 presumptive miRNA* and the class C miR-290-5p all have the same 5′ seed sequence ACUCAAA(C/A), a feature also shared by the class A miR-292-5p (Figure 2A, yellow boxes). [score:1]
Accordingly, a seed inspection uncovered a completely different sequence for miR-293 (Figure 2A, red), thereby confirming its singular status within the miRNA-290 cluster. [score:1]
A recent study also showed that several miRNA of the miR-290 cluster could individually help reprogramming mouse fibroblasts into induced pluripotent cells [34]. [score:1]
The miR-290 cluster comprises two pri-miRNA giving rise to six pre-miRNAs, of which pre-miR-293, premir-294 and premiR-295 are produced from the same primary transcript [17], [18]. [score:1]
We decided to focus on the Arid4b gene, whose 3′-UTR contains three evolutionary conserved matches for the seed shared by miR-302 and miR-290 (Figure 4A–4B). [score:1]
A recent study indicates that members of the miR-290 and of the oncogenic miR-17_92 cluster are among the most abundant miRNAs found in proliferating mouse PGCs [39]. [score:1]
Given its abundance, single chromosomal location and well-defined composition, studies of the miR-290 cluster in the ES cell -based system described here could help addressing these important issues further. [score:1]
[1 to 20 of 32 sentences]
4
[+] score: 73
As presented in Table 2, MAPKAPK3 and IL25, the targets of up-regulated miRNA miR-691; SOCS4, the target of up-regulated miRNAs miR-377; CCR10 and NFAT5, the targets of up-regulated miRNA miR-1935; VEGFA, the target of up-regulated miRNA miR-203; and CD40, the target of up-regulated miRNA miR-290-5p, were found to be down-regulated. [score:29]
These included FASL IL18RAP, and KITL, which are targets of miR-377; IL25 IL12A TNFSF14, and CLCF1, which are targets of miR-691; CCR10, a target of miR-1935; CXCL16, a target of miR-190; IL24 IFNG CXCL16, and CD40LG, targets of miR-135a*; IL18R1 CD40 CXCL12, and CSF, targets of miR-290-5p; and IL24 XCL1, and IL12B, targets of miR-203 (Table 1). [score:15]
In this study, the target genes of modulated miRNAs were found to be involved in Jak-STAT signaling, including JAK2 SOCS4, which are targets of miR-377; TYK2 and IL12A, targets of miR-691; IL6, a target of miR-190; IFNAR2, a target of miR-135a*; IFNGR2 and AKT1, targets of miR-290-5p; and SOCS3 and AKT2, targets of miR-203. [score:15]
These included SPRED2, a target of miR-691, MAP3K12, a target of miR-1935, MAPKAPK3 and MAP3K1, targets of miR-290-5p, and MAP3K13 MAP4K3, and MAP3K1, targets of miR-203 (Table 1). [score:9]
As shown in Figure 2B, nine miRNAs, miR-691, miR-377, miR-1935, miR-190, miR-1902, miR-135a*, miR-203, miR-2138, and miR-290-5p, were found to be significantly up-regulated. [score:4]
73 ± 1.42×,↑ VEGFANM_0010252571.37×,↓4.87 ± 1.96×,↓mmu-miR-290-5pMI00003882.44×,↑6.79 ± 2.31×,↑ CD40NM_0116111.3×,↓5.43 ± 2.76×,↓ mmu-miR-145 MI0000169 0.40×,↓ 4.82 ± 1.58×,↓ ARF6 NM_007481 1.21×,↑ 5.38 ± 2.77×,↑ Data from qRT-PCR are shown as mean ± standard deviation (SD) of one representative experiment. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 58
In agreement with their in vitro expression pattern, the expression of miR-290 cluster miRNAs is already upregulated in four-cell stage mouse embryos and reaches the highest level in the blastocyst, whereas miRNAs of the miR-302 cluster begin expression later at E6.5 and reach their expression peak at E7.5 [4, 42, 43]. [score:12]
Interestingly, upon knockdown of β-catenin, the expression of all tested miR-302 cluster miRNAs dramatically decreased, whereas the expression of the miR-290 cluster miRNAs did not change, suggesting that β-catenin specifically regulates the expression of the miR-302-cluster miRNAs (Figure 2E). [score:9]
To determine whether β-catenin regulates the expression of the two miRNA clusters, we knocked down β-catenin in mouse ESCs (Figure 2A,B) and analyzed the expression of the mature miR-302 and miR-290 cluster miRNAs by real time RT-PCR. [score:7]
The expression of both the primary transcript and the mature miRNAs of the miR-302 cluster, but not the miRNAs of the miR-290 cluster, were significantly downregulated when compared to the control cells (Figure 3C,D). [score:5]
In contrast, the expression of miRNAs of the miR-290 cluster did not change, indicating that Wnt signaling specifically activated expression of the miR-302 gene (Figure 3B). [score:5]
Members of the miR-302 and miR-290 clusters share the same seed sequence, and therefore, it has been proposed that they also share targets and act redundantly. [score:3]
The expression of the miR-302 and miR-290 cluster miRNAs (also known as ESCC miRNAs) correlated with active β-catenin in ESCs, embryonic carcinoma cells and the developing mouse embryo (Figure 1A,B [4, 15]). [score:3]
In contrast to the miRNAs of the miR-302 cluster, however, the miRNAs of the miR-290 cluster did not alter their expression upon β-catenin depletion from mESCs or P19 cells. [score:3]
In mESCs derived from the E3.5 blastocyst, the miR-290 cluster miRNAs are expressed at much higher levels than the miRNAs of the miR-302 cluster [41]. [score:3]
This observation was in contrast to findings in human studies that showed that Wnt/β-catenin signaling regulates the transcription of the miR-371-373 cluster, the human ortholog of the mouse miR-290 cluster [44]. [score:2]
In contrast, we focused on transcriptional regulation of the miR-290 cluster in mESCs and mouse embryonic carcinoma cells. [score:2]
Several of the miR-302 and miR-290 cluster miRNAs share similar seed sequences, and it has been suggested that miRNAs of the two clusters act redundantly [12]. [score:1]
Therefore, it was of general interest to determine whether, in addition to the miR-302 gene, the miR-290 gene was under the transcriptional control of the Wnt/β-catenin pathway. [score:1]
Reintroducing miRNAs from the miR-302 or miR-290 clusters rescued the proliferation defect in these cells. [score:1]
The miR-290 cluster miRNAs may have important functions in mESCs and in vivo in the blastocyst, whereas miR-302 cluster miRNAs may be important at later stages. [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 44
Dkk-1, which is directly targeted by the member of the miR-290 cluster, was down-regulated after ACAR treatment. [score:7]
The mir-290 cluster was expressed abundantly in mouse ES cells; this cluster can promote mouse ES cell pluripotency and reprogramming by directly targeting key regulators of cell cycle and ensuring rapid G1-S transition [25]. [score:7]
Cell cycle inhibitors p21 and Lats2 are direct targets of miR-290 cluster. [score:6]
By contrast, some miRNAs that are significantly up-regulated were also observed, including miR-290 cluster members, miR-291a and miR-291b, miR-129-1-3p, miR-129-2-3p, miR-23a-3p, miR-434-3p, miR-145-5p, and miR-203-3p. [score:4]
In our study, almost all members of the miR-290 cluster were up-regulated after. [score:4]
Considering the importance of the miR-290 cluster in mouse ES cell pluripotency maintenance, we also detected the expression level of other miR-290 cluster members by real-time PCR. [score:3]
Furthermore, Dkk1 was the miR-290 target, and this marker functioned by preventing ES cell differentiation into mesoderm and germ cell [25]. [score:3]
In mouse ES cells, the miR-290 cluster is the most abundantly expressed miRNA, which measured up 60% to 70% of the total expressed miRNA [39]. [score:3]
Furthermore, we also examined the expression of miR-290 -associated genes (Figure 2D). [score:3]
Therefore, Lats2 was not only regulated by the miR-290 cluster, but also functioned in other cellular processes. [score:2]
As a result, a large number of ES cell-specific miRNAs, such as the members of miR-290 cluster, have been identified as important for ES cell stemness [11]. [score:1]
MiR-290 clusters were reported to be key regulators of the G1-S transition, and Cyclin E/Cdk2 has critical functions in this process [11]. [score:1]
[1 to 20 of 12 sentences]
7
[+] score: 30
We found that the expression of miR-20a, miR-21, miR-28 and miR-290, all involved in MEF senescence, were deregulated in coincidence with p21 down regulation and increase of cell proliferation. [score:5]
The proliferation data showed that miR-20a and miR-290 did not affect cell proliferation as expected, the down regulated miR-28 and miR-34 significantly reduced the proliferation of immortalized MEF with similar efficiency, while miR-21 did not inhibit cell proliferation (Fig. 3C). [score:4]
In addition we tested miR-20a and miR-290 whose expression was not affected by the immortalization. [score:3]
It is worth noting that the up regulation of miR-21 and miR-28 is in agreement with findings in MEF replicative senescence, while miR-290 down regulation is the opposite of previous observations because we have shown that miR-290 steadily increased when either spontaneous or nocodazole -induced MEF G1 blocked tetraploid cells were present [4]. [score:3]
The miRNA signatures changed markedly after p6: while miR-20a and miR-290 remain down regulated, although to a lesser extent, miR-21 and miR-28 switched from up to down regulation (Fig. 3A). [score:3]
Conversely miR-290 and miR-20a involved in culture and stress induced senescence of primary MEF were not able to inhibit proliferation of immortal MEF in keeping with the idea that miRNAs behave differently in different cellular context [33]. [score:3]
The analysis showed that while miR-20a and miR-290 were down regulated till p6 (Fig 3A) miR-21 and miR-28 were up regulated. [score:3]
We found that under 6T15 protocol no significant accumulation of G2/M cells was observed (Fig. 3B) suggesting that the failed accumulation of G2/M cells was responsible for the lack of miR-290 up regulation. [score:2]
The following oligonucleotides were used: p19ARF, forward (F) (5'-CATGGGTCGCAGGTTCTTG-3') and reverse (R) (5'-GCTCGCTGTCCTGG GTCTC-3'); p16, F (5'-CGACGGGCATAGCTTCAG-3') and R (5'-GCTCTGCTCTTGGGATTGG-3'); p21, F (5'-TCCACAGCGATATCCAGACA-3') and R (5'-GGACATCACCAGGATTGGAC-3'); p53, F (5'-ATGCCCATGCTACAGAGGAG-3') and R (5'-AGACTGGCCCTTCTTGGTCT-3'); GAPDH, F (5'-GCCTTCCGTGTTCCTACCC-3'), R (5'-TGCCTGCTTCACCACCTTC-3'); miR-20a, F (5'-TAAAGTGCTTATAGTGCAGGTAG-3'); miR-21, F (5'-TAGCTTATCAGACTGATGTTGA-3'), miR-28, F (5'-AAGGAGCTCACAGTCTATTGAG-3'); miR-34a, F (5'-TGGCAGTGT CTTAGCTGGTTGT-3'); miR-290, F (5'-gctaatcttctctgtatcgttccaa-3'); U6, F (5'-CGCAAGGATGACACGCAAATTC-3'). [score:1]
Mature miR-20a, miR-21, miR-28, miR-34a and miR-290 were quantified using the miScript System: 1μg of total RNA was retrotranscribed with miScript Reverse Transcription Kit (Qiagen) and qRT-PCR was carried out using miScript SYBR Green PCR Kit (Qiagen). [score:1]
Figure 3 (A) Quantification of miR-20a, miR-21, miR-28, miR-290 and miR-34a per passage normalized to that of MEF at passage 0. Dashed lines indicate the transition from passage 5 to 6. (B) phase distribution (%) of MEF from p1 to p5. [score:1]
MiR-20a, miR-21, miR-28, miR-34, miR-290 and miR-NC (negative control) (GenePharma Shanghai, China) MEF were isolated from 13.5d mouse embryos, expanded and then replated every three days (6T3 protocol). [score:1]
[1 to 20 of 12 sentences]
8
[+] score: 29
Our in vitro expression data (Fig. 3e) coupled with our embryo expression data suggest that the miR-290 cluster may play a critical role in early development and is likely to be expressed throughout the early embryo. [score:8]
e) miRNA 290 cluster (miRNA-290, 291a–3p, 292–3p, 293, 294, 295) Comparative marker selection score plot for miRNAs differentially expressed between 0 and 44 hrs of HRas/Q61L induction (a) and for miRNAs showing expression difference between undifferentiated TS-cells and TS-cells induced to differentiate by withdrawal of FGF4 (b). [score:5]
We observed expression of the miR-290 cluster beginning at the 4-cell stage, and steadily increasing through the blastocyst stage. [score:3]
Expression of the miR-290 cluster was comparable in iRas-ESCs, iRas-ES+Dox_48 hrs, and BD-TS cells (Fig. 3e). [score:3]
We began by analyzing expression of the miR-290, miR-302, and miR-17∼92 clusters in staged embryos. [score:3]
Consistent with this observation, the miR-290 cluster has been reported to be expressed in both ESCs and BD-TS cells [46]. [score:3]
We compared expression of miRNAs from three different ESC -associated miRNA clusters: (miR-302 cluster [44]; miR-290 cluster [23]; miR17-92 cluster [45]) in iRas-Dox, iRas+Dox_48 h, and BD-TS cells. [score:2]
Consistent with this notion, a genetic knockout of the miR-290 cluster is early embryonic lethal [47]. [score:2]
[1 to 20 of 8 sentences]
9
[+] score: 27
Further studies will determine whether the downregulation of EZH2 is responsible for the upregulation of miR-290 in senescent MEF. [score:7]
miR-290/371 cluster post transcriptionally represses Mbd2, leading to the downregulation of MBD2 protein and reactivation of Mbd2 target gene Myc. [score:6]
The other miRNAs of the miR-290-295 cluster (miR-290-5p, miR-291a-5p, miR-291b-5p, miR-292-5p, miR-293, miR-293 [*], miR-294 [*], and miR-295 [*]) differing in their seed sequences, are still highly expressed in ESCs with the exception of the hardly detectable [22] minor forms of miR-293, miR-294, and miR-295 (miR-293 [*], miR-294 [*], and miR-295 [*]). [score:3]
More interestingly, Rizzo demonstrated that the EZH2 is a target of miR-290 [85]. [score:3]
A working mo del of the miR-290-Mbd2-Myc axis in regulating metabolism and reprogramming. [score:2]
miR-290-291a unit replication formed miR-292-291b, and then miR-290, miR-291a and miR-292 (as the same unit) replication resulted in the formation of miR-293, miR-294 and miR-295 ESC and iPSC self-renewals need to eliminate differentiation signal and obtain the pluripotency signal, in addition, the differentiation process trigger the closure of pluripotency procedure and the induction of lineage specification. [score:1]
The miR-290-291 unit replication forms miR-292-291b, and then the miR-290, miR-291a and miR-292 (as the same unit) replication results in the formation of miR-293, miR-294 and miR-295, finally forming the present miR-290-295 cluster [21] (Fig.   1). [score:1]
Luningschror P miR-290 cluster modulates pluripotency by repressing canonical NF-kappaB signalingStem Cells. [score:1]
Based on sequence comparison and repeat analysis, it is proved that the miR-290-295 cluster originates from the miR-290-291a, which codes 7 miRNA precursors that give rise to 14 highly related miRNAs. [score:1]
Within the miR-290-295 cluster, the seed sequences of ‘AAGUGC’ hexamer are found in miR-290-3p, miR-291a-3p, miR-291b-3p, miR-292-3p, miR-294, and miR-295. [score:1]
Zovoilis A Members of the miR-290 cluster modulate in vitro differentiation of mouse embryonic stem cellsDifferentiation. [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 16
Moreover, so-called "ES Cell Cycle Control" (or ESCC) miRNAs in the miR-290 family stimulate ES cell proliferation by indirectly activating c-Myc and N-Myc, and thus by extension Myc targets, while also blocking p21 translation and inhibiting the Myc inhibitor miRNA let-7 (Gilchrist et al., 2008, 2010; Kumar et al., 2007). [score:10]
Our analysis of miRNAs in Sin3a -null ICMs revealed no induction of miR17-5p nor increased expression of miR-20a or miR-290 family miRNAs, thereby demonstrating that the apoptosis and repression of Myc/E2F targets we observe in Sin3a null ICMs are not due to misregulation of these miRNAs. [score:6]
[1 to 20 of 2 sentences]
11
[+] score: 16
Therefore, higher expression of C19MC members, but not human miR-371-373 or mouse miR-290 members, in iPSCs indicates that the acquired functions of C19MC members may contribute to the biological significance of different expression levels in ES and iPS cells. [score:5]
However, the miR-371-373 cluster (humans and mice) and miR-290 cluster (mice) did not show significant differences in expression between iPS and ES. [score:3]
Other previously identified miRNAs are a chromosome 19 microRNA cluster (C19MC) including miR-517a, miR-519b, miR-520b, miR-520b, and miR-521, which were found to be highly expressed in human stem cells [10]; the miR-290 cluster was only detected at high levels in mouse stem cells [11]. [score:3]
In addition, other miRNAs—such as miR-17, -20a, -93, -106b, -106a, and -20b, and miR-302 members—which share the same sequence as the miR290 cluster, the miR-371 cluster, and C19MC, and were detected at high levels in both human and mouse ES/iPS cells, were shown to mediate reprogramming by targeting Tgfßr2 and p21 during the mesenchymal-to-epithelial transition during the initiation stage of reprogramming [6]. [score:3]
In the mouse list (Fig. 6A), six of the top eight mouse-specific miRNAs are members of the miR-290 cluster. [score:1]
The human miR-371 cluster was predicted to exist based on sequence similarity to members of the mouse miR-290 cluster [36], [37]; indeed, one of the members of the miR-371 cluster, miR-372, is 33 [rd] in the human miRNA list (Fig. 6A). [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 16
Other miRNAs from this paper: mmu-mir-290b
More specifically, it has been proposed that Mir290 (microRNA 290) cluster miRNA deficiency results in an upregulation of a target transcript encoding the transcriptional suppressor RBL2 (retinoblastoma-like 2), with increased RBL2 in turn suppressing Dnmt gene transcription and lowered DNMT protein. [score:10]
While a loss in RNAi -mediated pathways of heterochromatin formation could be involved, particularly at MajS repeats, the predominant cause has been proposed to be a downregulation in Dnmt gene activity primarily due to the loss of Mir290 cluster miRNAs. [score:4]
Mir290 cluster miRNAs were essentially undetectable in our Dicer1 [−/−] lines (Figure 1B). [score:1]
These ES cells are defective in the G1-S phase transition due to the loss of Mir290 family miRNAs, and consequently have a greatly extended cell cycle [46]. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 13
We chose to profile the ubiquitously expressed miR-16, five ESC-specific miRNAs (miR-290, miR-291-3p, miR-292-3p, miR-294, and miR-295) [23], [24], and two miRNAs that are upregulated in ESCs undergoing differentiation (miR-21 and miR-22) [23], [24]. [score:6]
Thus, based on the 95 [th] percentile confidence interval, it appears that RNU6b is significantly less abundant than several of the miRNAs tested except miR-22, miR-290, and miR-291. [score:1]
The abundance of several miRNAs (miR-290, miR-291-3p, miR-292-3p, miR-294, and miR-295) increased in MEFs as early as 1 hour after incubation, suggesting transfer. [score:1]
RNU6b is significantly less abundant than all miRNAs tested except for miR-22, miR-290, and miR-291. [score:1]
The difference in Ct values between the negative control (MEFs alone) and each experimental group (miR-290, miR-291-3p, miR-292-3p, miR-294, miR-295, miR-16, and RNU6b) is shown. [score:1]
The relative abundance of all tested miRNAs overlaps except for that of miR-295, which is significantly more abundant than miR-290 and miR-291 (Figure 5B). [score:1]
The majority of miRNAs tested do not differ significantly from one another except for miR-295, which is significantly more abundant than miR-290 and miR-291. [score:1]
The miRNAs tested include miR-16 (lane 1), miR-21 (lane 2), miR-22 (lane 3), miR-290 (lane 4), miR-291-3p (lane 5), miR-292-3p (lane 6), miR-294 (lane 7), miR-295 (lane 8), and the small nuclear RNA, RNU6b (lane 9). [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 13
Among 87 unique miRNA expression signatures for maintenance of the iPS state, we found that all 7/7 members of the miR-290 family and all 5/5 members of the miR-8 family are up-regulated; we also found 10/12 members of the let-7 family are down-regulated (Table 2). [score:9]
In addition, high level of the miR-290 and miR-8 families (including the miR-200 clusters) and low levels of the let-7 family play much more important roles in the maintenance steps of pluripotency by regulating axon guidance and MAPK signaling, respectively. [score:2]
We also found a Sox2 binding site in the promoter region of the mir-429-200 cluster and Oct4, Sox2, and Nanog binding sites in the promoter region of the mir-290 cluster. [score:1]
Our conclusion was supported by the finding that the embryonic stem cell-specific miR-290 family can promote induced pluripotency [9]. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 12
Other miRNAs from this paper: mmu-mir-291a, mmu-mir-290b
lncRNA long noncoding RNA, NC normal controlcMyc is another important transcriptional factor essential for mESC pluripotency, and its expression decreases upon Dicer loss, an effect due to loss of miR-290 cluster expression as documented previously [19]. [score:5]
lncRNA long noncoding RNA, NC normal control cMyc is another important transcriptional factor essential for mESC pluripotency, and its expression decreases upon Dicer loss, an effect due to loss of miR-290 cluster expression as documented previously [19]. [score:5]
Indeed, Gas5 was repressed in miR-291a (the most abundant miRNA of the miR-290 cluster in mESCs) KD mESCs (Fig. 5b). [score:1]
Since the miR-290 cluster is the major miRNA in mESCs and it is known that the miR-290 cluster is Dicer -dependent in mESCs [18], we hypothesized that loss of the miR-290 cluster might also affect Gas5. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 11
Other miRNAs from this paper: mmu-mir-290b
The miR-290 cluster, though not sufficient to maintain ES cell pluripotency alone, inhibits ES cell differentiation when over-expressed [51, 52]. [score:5]
Our mo del predicts previously validated enhancers as well as novel enhancers around Oct4, Sox2, Nanog, Phc1, Lefty1, Lefty2, miR290, Tet1, and Zic3, all of which have important regulatory roles in regulating ES cell pluripotency. [score:3]
Detailed coverage plots of novel enhancer regions identified including (A) multiple putative enhancers upstream of miR-290 cluster, (B) multiple contiguous enhancer regions upstream of Tet1 and around a non-coding small nuclear RNA, U6, (C) two putative enhancers around Zic3, and d) the putative enhancer region located 10kb upstream of C80913. [score:1]
Plot showing novel putative enhancers around miR-290 (A), Tet1/ U6 (B), Zic3 (C), and C80913 (D). [score:1]
Four of the seven identified high probability Enh regions (prob ≥ 0.8) upstream of miR-290 overlap with MTL (Figure 7Additional file 7: Figure S6A). [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 9
A similar suppressed G1/S restriction is observed in cancer cells [54], and it is interesting to note that miR-106b promotes cell cycle progression in a breast cancer cell line [55], by mechanisms similar to the miR-290 cluster in ES, indicating similarities in the molecular control of the cell cycle of embryonic and cancer cells [56]. [score:3]
The miR-290 cluster maintains a very short cell cycle in ES by suppressing the G1/S restriction. [score:3]
Perhaps the most interesting miRNA for embryonic development is mmu-miR-294, a member of the miR-290 cluster. [score:2]
It has been estimated that the miR-290 cluster alone makes up greater than 70% of the total quantity of miRNAs in ES [53]. [score:1]
[1 to 20 of 4 sentences]
18
[+] score: 9
Again, overexpression of two miRNAs in the cluster, miR-290-3p and miR-295, reduced the rate of apoptosis (Figure 5D, Figure S7A and S7B). [score:3]
Within the mir-290-295 cluster, the ‘AAGUGC’ seed is found in miR-290-3p, miR-291a-3p, miR-291b-3p, miR-292-3p, miR-294, and miR-295. [score:1]
Relative to control siRNAs, transfection of miR-290-3p or miR-295 drastically decreased the apoptosis response of Dcr KO cells to gamma irradiation (Figure 4B, Figure S6A and S6B). [score:1]
A. Dcr KO cells were treated with 5-Gy radiation 24 hours after transfection of 50 nM miR-295 or miR-290-3p. [score:1]
B. Dcr KO cells were treated with 5-Gy radiation 24 hours after transfection of 50 nM miR-295, miR-290-3p, Bim siRNA, Casp2 siRNA or Ei24 siRNA. [score:1]
A. 295 KO cells were treated with 5-Gy radiation 24 hours after transfection of 50 nM of miR-295 or miR-290-3p. [score:1]
More specifically, they include “miR-291b-3p/519a/519b-3p/519c-3p”, “miR-290-3p/292-3p/467a”, “miR-467cd”, “miR-106/302”, and “miR-467b”. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 9
qPCR results confirmed that BIO upregulated miR-302a-5p, miR-302b-5p, miR-302c-5p and miR-302d-5p (Fig. 3i) and that CHIR significantly downregulated the expression of miR-290-5p, miR-106a-3p, miR-106b-3p, miR-302b-5p, miR-302c-5p, and miR-93-5p (Fig. 3j). [score:9]
[1 to 20 of 1 sentences]
20
[+] score: 7
TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi. [score:5]
We therefore postulate that the increase of certain stem cell -associated miRNAs (e. g. miR-290) promotes the stemness of cells during influenza -induced lung repair [30– 32]. [score:1]
These additional criteria narrowed the selection down to 3 miRNAs at 7 dpi (miR-290, miR-1940, miR-505) which were marked to be crucial in the early repair phase. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 7
For instance, mmu-miR-290 was up-regulated in all organs except forestomach; mmu-miR-465 was down-regulated in lung, spleen and glandular stomach. [score:7]
[1 to 20 of 1 sentences]
22
[+] score: 7
Other miRNAs from this paper: mmu-mir-290b
Inherited variation in miR-290 expression suppresses breast cancer progression by targeting the metastasis susceptibility gene Arid4b. [score:7]
[1 to 20 of 1 sentences]
23
[+] score: 7
During development of germ cells, miR-17-92 cluster, which is thought to promote cell cycling, and the ES cell-specific cluster encoding miR-290 to -295 (miR-290-295 cluster) were highly expressed in primordial germ cells (PGCs) and spermatogonia. [score:4]
MiRNAs belonging to miR-17-92 and miR-290-295 clusters were still highly expressed in neonatal spermatogonia and at almost the same levels as those in E13.5 PGCs (Figure 4E), although miR-290 and miR-291-3p were not detectable. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 6
In agreement with the literature [34, 35], members of the miR-302/367 cluster, which are more expressed in EpiSC, and the miR-290/295 cluster, which are more abundant in ES cells, were up- and down-regulated, respectively, at the ES–ELA transition. [score:6]
[1 to 20 of 1 sentences]
25
[+] score: 6
This appears to occur through down regulation of miR-290, which functions as a suppressor of the expression of p130. [score:6]
[1 to 20 of 1 sentences]
26
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For example, members of the miR-290 family positively regulate G1 to S phase transition by inhibiting cyclin -dependent kinase inhibitors such as p21, during embryonic stem cell differentiation [140]. [score:6]
[1 to 20 of 1 sentences]
27
[+] score: 6
For instance, introduction of a subset of the miR-290 cluster is able to rescue the cell cycle defects in Dgcr8 -deficient ES cells [39]. [score:1]
a. Four microRNAs: miR302 (cluster), miR-25/93, miR-290 and miR-298 were able to improve reprogramming. [score:1]
Although miR-290 itself was not known to promote reprogramming, several members of the miR-290 family, miR-291-3p, miR-294 and miR-295, enhance reprogramming of MEFs in the absence of c-Myc [41]. [score:1]
Identification of miR-302 and miR-290 in our screen confirmed the previous studies [41], [42]. [score:1]
0040938.g002 Figure 2 a. Four microRNAs: miR302 (cluster), miR-25/93, miR-290 and miR-298 were able to improve reprogramming. [score:1]
Four out of the 52 tested miRNAs or miRNA clusters: the miR-302 cluster, miR-25, miR-290 and miR-298, gave substantially more Puro [r] iPSC colonies (2–4 fold) than the control where only the four factors were used (PB-CAG-OCKS) (Fig. 2a). [score:1]
[1 to 20 of 6 sentences]
28
[+] score: 5
Half of them (miR-290, -292-5p, -294, -295) were down-regulated in the delayed implanting blastocysts after estrogen administration. [score:4]
These include the miR-17∼92 (miR-17-5p, -18, -19b, -20), 15a/16 (miR-15a, -15b), and 290–295 (miR-290, -294, -295) clusters. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 5
For example, stem cell specific miRNAs of the miR-290 family (miR-291–295, [24]) were detected to be about 25-fold overexpressed in mouse embryonic stem cells, while brain-specific miR-124 and miR-9 were about 14-fold overexpressed in mouse brain (Supplementary Table  2). [score:5]
[1 to 20 of 1 sentences]
30
[+] score: 5
The miRNA-290 cluster acts through multiple mechanisms to promote pluripotency state and oppose differentiation of ESCs and is down-regulated upon differentiation and undetectable in adult organs [28]. [score:4]
Moreover, several members of the miRNA-290 cluster have been shown to enhance the efficiency of generation of induced pluripotent stem cells from adult somatic cells [42]. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 5
There were also two interesting differentially expressed microRNAs: miR290 and miR138-2 (Table 1). [score:3]
miR290 is associated with gene regulation in the early embryo and the maintenance of the pluripotent cell state [43], [44] and miR138, the mature form of miR138-2, is associated with the size of dendritic spines in rat hippocampal neurons [45]. [score:2]
[1 to 20 of 2 sentences]
32
[+] score: 5
This observation is similar to those of Zovoilis et al., [28], [44] who found that maGS cells resembled ES cells, but the expression of certain miRNAs such as miR-290 cluster was retained during their in vitro differentiation. [score:3]
The maGS cells also expressed higher level of germ cell markers characteristic of primordial germ cells and spermatogonia compared with ES cells [28], although the expression pattern of the ES cell-specific miR-290 and miR-302 cluster of miRNA in maGS cells resembled that of the ES cells [27]. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 5
Our results revealed that the top miRNAs such as miR-290 and miRNA-302 cluster do not directly target any core pluripotent factors during the pluripotent state (Fig.   4). [score:4]
MiRNA-290 cluster has been proposed to regulate the core pluripotency factors like Pou5f1 [7– 9]. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 4
By studying systems such as these it has become apparent that one of the most highly expressed mouse ES cell miRNA clusters (the miR-290 cluster [21]) plays a fundamental role in the regulation of the mouse ES cell cell-cycle and differentiation [22], [23]. [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 4
A similarly primed state was determined by changes in miRNA expression reflecting a shift towards miRNAs that have been previously linked to germ cell and neural development while the main mES cell miRNA cluster (miR-290–295 cluster) was not altered significantly. [score:4]
[1 to 20 of 1 sentences]
36
[+] score: 4
Members of the miR-290-295 cluster (miR-290, miR-291a, miR-292, miR-291b, miR-293, miR-294 and miR-295-1) were the most abundant among known miRNAs that were upregulated in rat PSCs. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
Interestingly, among the miRNAs found to be upregulated in exosomes in response to cytokines, several of them including miR-146a, miR-146b, miR-195, miR-290a-3p, miR-362-3p and miR-497 are known to be involved in cell death [29- 34]. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
Other miRNAs from this paper: mmu-mir-290b
C. Screening and identification of miRNA-84 and miRNA-290 in stable CagA -expressing AGS cells. [score:3]
Total RNA from 9 pairs of human primary colon cancer tissues were isolated and real-time PCR was performed for miRNA-84 and miRNA-290. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 4
miRNAs found in hESCs belong mostly to the miR-302 and miR-290 families expressed from miR-302/367 and miR-371–373 clusters, respectively [13, 14]. [score:3]
One of those fluctuating TFs is NANOG [73], which is also involved in activation of ES cell miRNAs miR-290 and miR-302 [74]. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 3
The increased expression level of miR-196a near the eight-cell stage of embryogenesis potentially indicates miR-196a involvement in maternal transcript degradation during the maternal-to-zygotic transition, as was observed for miR-430 in zebrafish [10] miR-427 in Xenopus [38] and miR-290 in mouse [20]. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
These genes were mapped to the eQTL for miR-290 on chromosome 4 and miR-126 on chromosome 10, suggesting that Lin28 might modulate the expression of other miRNAs as well. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Five miRNAs (miR-290, miR-720, miR-29c, miR-152 and miR-101a) showed inverse expressions, whereas 23 candidates showed comparable results (r = 0.62, p ≤ 0.0005; Spearman rho). [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
A similar expression pattern was observed for miR-430 in zebrafish [18], miR-427 in Xenopus [19] and miR-290 in mouse [21], which are known to play a key role in promoting maternal transcript turnover during maternal-zygotic transition. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
Significant changes were noted in the expression pattern of let-7 family, miR-200 and miR-290 family in SiPS in comparison with the native SMs. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 2
Recently, CTCF was found to be involved in the regulation of miR-125b1, miR-375, and the miR-290 cluster in breast cancer cells and stem cells [43]. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
Various epi-miRNAs, including miR-29, miR-152, and miR-290, have been shown to play pivotal roles in regulating the epigenetic modifications that occur through DNA methylation (Ji et al., 2013). [score:2]
[1 to 20 of 1 sentences]
47
[+] score: 2
Other miRNAs from this paper: mmu-mir-290b
Recently, a comprehensive study demonstrated that in the process of murine ESC differentiation, p21 accumulation (under regulation of mir-290 miRNA) results in the inactivation of Cdk2 and cyclin E, leading to a delay in the G1-to-S phase transition; these results suggest interdependence between G1 length and differentiation [18, 19]. [score:2]
[1 to 20 of 1 sentences]
48
[+] score: 2
Many embryo miRNAs, such as miR-293, miR-290-3p or miR-290-5p were in cluster C. Cluster C also included miR-106a which is believed to be both ES cell-specific and cardiac-related [26]. [score:1]
miR-291a-3p, miR-291a-5p, miR-292-3p, miR-290-5p and miR-293 belong to the miR-290-295 cluster [27]. [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 2
Other miRNAs from this paper: mmu-mir-291a, mmu-mir-291b, mmu-mir-219b, mmu-mir-290b
For instance, several transcription factors including c-Myc and CTCF have been indicated in the regulation of miR-290 family 35 36. [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 2
In mouse mo dels, studies on the miR-290∼295 cluster revealed a crucial role in pluripotency and differentiation [39], [40], [42], [43]. [score:1]
Consistent with this, members of the miR-290∼295 cluster have been shown to promote the G1-S transition and thereby promote the rapid proliferation of mouse ES cells [43]. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 1
The functional importance of the miR-290 cluster in stem cell pluripotency has been demonstrated previously [48]. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
Hsa-miR-371 is part of the miR-290 family, in agreement with alignments and phylogenetic Stem Loop (SL)-miR trees (Fig. S3), but also inherits, what we would suggest, a newly identified “Wnt-activator associated signature” (GUGCNNCCN(N)(N)UUU(N)NNG). [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
A previous screening -based study, which examined the effect of 461 individually re-introduced miRNAs on the proliferation of DGCR8 -null cells showed that the defective proliferation was rescued by 14 different miRNAs, including miR-290, miR-302 and the miR-17-92 cluster (40 and refs therein). [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
Because of a gap in the corresponding genomic region in the mm8 assembly, 7 miRNAs from the mir-290 family could not be mapped. [score:1]
[1 to 20 of 1 sentences]