sort by

24 publications mentioning dme-mir-277

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-277. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 240
Other miRNAs from this paper: dme-mir-1, dme-bantam, dme-let-7, dme-mir-137
These observations suggest that miR-277 could regulate Drep-2 and Vimar mRNAs differentially, with miR-277 regulating the expression of Drep-2 mainly at the mRNA level, and Vimar via translational suppression instead. [score:9]
In the presence of fragile X premutation rCGG repeats, overexpression of miR-277 will suppress the expression of both Drep-2 and Vimar, thereby altering anti-apoptotic activity as well as mitochondrial functions, which have been linked to neuronal cell death associated with neurodegenerative disorders in general (Figure 7). [score:8]
A. The two miR-277 target sites in the Drep-2 3′-UTR and three miR-277 target sites in the Vimar 3′-UTR were predicted by TargetScan. [score:7]
1002681.g005 Figure 5. A. The two miR-277 target sites in the Drep-2 3′-UTR and three miR-277 target sites in the Vimar 3′-UTR were predicted by TargetScan. [score:7]
We crossed miR-277SP transgenic flies with the flies expressing 90 CGG repeats and found that the expression of miR-277 sponge could consistently suppress rCGG -mediated neuronal toxicity (Figure 3B). [score:7]
C. Ectopic expression of hnRNP A2/B1 in fly brain could suppress the expression of miR-277, *-P<0.05. [score:7]
MiR-277 could recognize and bind to the 3′-UTR of its mRNA targets, such as Drep-2 and Vimar, to induce their mRNA degradation or translational suppression. [score:6]
Finally, we show that hnRNP A2/B1, an rCGG repeat -binding protein, can directly regulate the expression of miR-277. [score:5]
The suppression is specific to the miR-277 seed region within the Drep-2 3′-UTR, as deletion of the miR-277 target sites in the Drep-2 3′-UTR alleviated repression by miR-277. [score:5]
E. Endogenous Drep-2 mRNA expression was significantly altered in the flies expressing either miR-277 or miR-277 SP, *-P<0.05. [score:5]
These results together suggest that hnRNP A2/B1 could directly bind to the upstream region of miR-277 and regulate its expression. [score:5]
B. The expression of a luciferase reporter gene containing the Drep-2 3′-UTR was suppressed by miR-277 in HEK293FT cells. [score:5]
Furthermore, the ectopic expression of hnRNP A2/B1 in fly brain could reduce the expression of miR-277 (Figure 6C). [score:5]
Overexpression of miR-277 enhances rCGG repeat -induced neuronal toxicity, whereas blocking miR-277 activity could suppress rCGG repeat -mediated neurodegeneration. [score:5]
Our miRNA profiling and genetic interaction studies indicated that an increase in miR-277 expression in rCGG repeat flies could alter the expression of specific cellular mRNAs by miR-277, resulting in the enhanced rCGG -induced eye phenotype. [score:5]
To seek the mechanisms by which miR-277 modulates rCGG -mediated neurodegeneration, we searched the RNA network and referenced TargetScanFly 5.1 to identify potential miR-277 targets [44], [45]. [score:5]
We found that overexpression of miR-277 could suppress the R-Luc activity at 48 h post-transfection (Figure 5B and 5C). [score:5]
The role of miR-277 in rCGG -mediated neurodegeneration seems specific, since the other miRNAs we found with altered expression in the presence of fragile X premutation rCGG repeats, including bantam, let-7, and miR-1, had no effect on the rCGG [90] eye phenotype. [score:4]
As shown in Figure 2, flies co -expressing miR-277 and rCGG [90] consistently showed an aggravated eye phenotype, with enhanced disorganized, fused ommatidia compared with flies expressing rCGG [90] alone (Figure 2B and 2D). [score:4]
Furthermore, we identified Drep-2, which is associated with the chromatin condensation and DNA fragmentation events of apoptosis, and Vimar, a modulator of mitochondrial function, as two of the mRNA targets regulated by miR-277. [score:4]
Furthermore, when we mutated the seed regions of miR-277 located within the Drep2-3′-UTR reporter and Vimar-3′-UTR reporter, we saw that the mutation alleviated the miR-277 -mediated suppression of luciferase activity (Figure 5A–5C), suggesting the action of miR-277 is specific to the miR-277 seed region within the Drep-2 3′-UTR and Vimar 3′-UTR. [score:4]
Expression of miR-277 is regulated by hnRNPA2/B1. [score:4]
Expression of miR-277 is regulated by the rCGG repeat -binding protein hnRNP A2/B1. [score:4]
Our results indicate that hnRNP A2/B1 could participate in the transcriptional regulation of miR-277; however, it remains to be determined whether other loci could be directly regulated by hnRNP A2/B1, as well. [score:4]
The miR-277 target sites in the Drep-2 3′-UTR and Vimar 3′-UTR were deleted using QuikChange Site-Directed Mutagenesis Kits (Stratagene; Cat. [score:4]
Here we show that fragile X premutation rCGG repeats can alter the expression of specific miRNAs, including miR-277, in a FXTAS Drosophila mo del. [score:4]
Flies mutant in genes coding for different candidate miR-277 targets were obtained from Bloomington Stock Center. [score:3]
Since both Drep-2 and Vimar were predicted to be regulated by miR-277, by introducing 3′-UTR dual luciferase assays, we tested whether miR-277 could indeed target to Drep-2 or Vimar. [score:3]
Furthermore, we identified Drep-2 and Vimar as the functional miR-277 targets that could modulate rCGG repeat -induced neurodegeneration. [score:3]
Nevertheless, the data we present here suggest that the depletion of hnRNP A2/B1 could also directly impact the transcriptional regulation of specific loci, such as miR-277. [score:3]
Flies overexpressing miR-277 alone displayed a very mild rough eye phenotype (Figure 2C). [score:3]
MiR-277 regulates the expression of Drep-2 and Vimar post-transcriptionally. [score:3]
Importantly, they also suggest that Drep-2 and Vimar are the functional targets of miR-277. [score:3]
Sequestration of hnRNP A2/B1 could de-repress the expression of miR-277. [score:3]
C. Similar miR-277 -mediated suppression was observed with Vimar 3′-UTR constructs. [score:3]
In brief, we placed 10 repetitive sequences complementary to miR-277 with mismatches at positions 9–12 into the 3′ UTR of EGFP in a pUASP expression vector (Figure 3A). [score:3]
Next we went on to examine the steady-state levels of Drep-2 and Vimar mRNA in rCGG repeat flies (elav-GAL4;UAS-CGG [60]-EGFP), in which the expression of miR-277 is increased. [score:3]
Overexpression of miR-277 enhances rCGG -mediated neurodegeneration. [score:3]
We then carried out a genetic screen on the rCGG [90] neurodegenerative eye phenotype to identify potential miR-277 targets that could modulate rCGG -mediated neuronal toxicity. [score:3]
Mutant alleles corresponding to the mRNA targets of miR-277 used for genetic screen. [score:3]
We selected the top candidates for miR-277 target mRNAs with the mutant alleles available for further analyses (Table 1). [score:3]
Furthermore, ectopic expression of miR-277 or miR-277 sponge could alter the endogenous mRNA level of Drep2 while have no apparent effect on Vimar mRNA level (Figure 5E). [score:3]
We crossed gmr-GAL4, UAS-(CGG) [90]-EGFP transgenic flies with fly mutants in genes coding for the top candidates for miR-277 target genes (Table 1). [score:3]
Together, these data demonstrate that the effect of miR-277 on Drep-2 and Vimar expression is repressive and specific. [score:3]
Identification of miR-277 mRNA targets that modulate rCGG -mediated neurodegeneration. [score:3]
We generated UAS fly lines that could overexpress Drosophila miR-277, bantam, let-7, or miR-1, as well as bantam mutant lines (ban [12] and ban [20]) that we generated previously [41]. [score:3]
Blocking the activity of miR-277 suppresses rCGG -mediated neurodegeneration. [score:3]
Flies overexpressing miR-277 alone present with a mild rough eye phenotype (C). [score:3]
We introduced 10 repetitive miR-277 sponge sequences (TGTCGTACCAGGCGTGCATTTA) with a 4-nt linker between each repeat downstream of EGFP in a pUASP expression vector. [score:3]
The rCGG90 eye phenotype is enhanced by miR-277 overexpression with aggravated disorganized, fused ommatidia (D). [score:3]
Thus we tested whether hnRNP A2/B1 could interact directly with genomic regions proximal to miR-277. [score:2]
In the presence of fragile X premutation rCGG repeats, hnRNP A2/B1 will be sequestered, leading to the de-repression of the miR-277 locus. [score:2]
This result suggests that blocking the activity of miR-277 could mitigate the neurodegeneration caused by fragile X premutation rCGG repeats. [score:2]
Proposed mo del of miR-277 modulating fragile X premutation rCGG repeat -mediated neurodegeneration. [score:2]
Knockdown of miR-277 alone does not cause an abnormal eye phenotype. [score:2]
3′-UTR dual luciferase assays of candidate miR-277 target mRNA. [score:2]
By combining our genetic screen and reporter assays, we identified Drep-2 and Vimar as the functional targets of miR-277 that could modulate rCGG -mediated neurodegeneration. [score:2]
Our biochemical and genetic studies demonstrate a novel miRNA -mediated mechanism involving miR-277, Drep-2, and Vimar in the regulation of neuronal survival in FXTAS (Figure 7). [score:2]
To further explore the potential regulatory effect of miR-277 on rCGG -mediated neurodegeneration, we generated a transgenic miR-277 sponge (miR-277SP) line, which could block the activity of miR-277, to test for any blocking effect on the rCGG -induced neurodegenerative eye phenotype. [score:2]
Immunoprecipitation of chromatin chemically cross-linked to DNA with an hnRNP A2/B1-specific antibody demonstrated that a region 1.5 kb upstream of miR-277 was enriched ∼seven-fold relative to IgG control and adjacent regions (Figure 6A and 6B). [score:1]
Block of miR-277 activity by miR-277SP could rescue the rCGG -mediated neurodegenerative eye phenotype. [score:1]
We performed hnRNP A2/B1-specific chromatin immunoprecipitation (ChIP) followed by real-time quantitative PCR across a six-kb region surrounding miR-277. [score:1]
#301005) with psiCHECK-2-3′UTR or psiCHECK-2-3′ UTRΔmiR-277 and miR-277 duplex RNA (Qiagen; Cat# MSY0000338) or control miRNA duplex (Qiagen; Cat# 1027280). [score:1]
The UAS-miR-277-Sponge transgenic flies were generated as described previously [43]. [score:1]
Genotypes are B-gmr-GAL4,UAS-CGG [90]-EGFP/+; C -gmr-GAL4/UAS-miR-277; D-gmr-GAL4, UAS-CGG [90]-EGFP/UAS-miR-277; E- gmr-GAL4/+;UAS-bantam/+; F-gmr-GAL4,UAS-CGG [90]-EGFP/+;UAS-bantam/+; G- gmr-GAL4/+;UAS-Let-7/+; H-gmr-GAL4,UAS-CGG [90]-EGFP/+;UAS-Let-7/+; I- gmr-GAL4/UAS-GFP;UAS-miR-1/+; J-gmr-GAL4,UAS-CGG [90]-EGFP/UAS-GFP;UAS-miR-1/+; K-gmr-GAL4/+;ban [12]/+; L-gmr-GAL4,UAS-CGG [90]-EGFP/+;ban [12]/+; M-gmr-GAL4/+;ban [20]/+; N-gmr-GAL4,UAS-CGG [90]-EGFP/+;ban [20]/+. [score:1]
We created the mutant Drep-2 3′-UTR (Drep-2 3′-UTR [ΔmiR-277]) with two miR-277 binding sites deleted and the mutant Vimar 3′-UTR (Vimar 3′ UTR [ΔmiR-277]) with three miR-277 binding sites deleted, as shown. [score:1]
These data together suggest that miR-277 could be involved in rCGG -mediated neurodegeneration. [score:1]
We demonstrate that miR-277 modulates rCGG -mediated neurodegeneration. [score:1]
We show that miR-277 plays a significant role in modulating rCGG repeat -mediated neurodegeneration. [score:1]
The closest ortholog of miR-277 in human is miR-597 based on the seed sequence. [score:1]
Our genetic modifier screen revealed that miR-277 could modulate rCGG repeat -mediated neurodegeneration. [score:1]
The rest of our work focused on the role of miR-277 and its potential mechanisms in modulating rCGG -mediated neurodegeneration. [score:1]
[1 to 20 of 72 sentences]
2
[+] score: 147
From our previous studies and TargetScan predictions, we selected a group of microRNAs as potential regulators of Drosophila muscleblind and confirmed that sponge constructs for dme-miR-277 and dme-miR-304, which had the highest expression among the sponge constructs tested, reduced the abundance of their respective target miRNAs and achieved upregulation of muscleblind at the RNA and protein levels. [score:11]
Deletereous effects of miR-277SP could originate from overexpression of several targets in addition to musclebind, as dme-miR-277 is one of the miRNAs with highest expression in muscle 35. [score:7]
dme-miR-277 or dme-miR-304 silencing upregulates Muscleblind expression in a Drosophila DM1 mo del. [score:6]
Taken together, these results demonstrate that endogenous Muscleblind isoforms can be upregulated by blocking dme-miR-277 and dme-miR-304 inhibitory activity. [score:6]
dme-miR-277 silencing in muscle caused an upregulation of the mblB isoform whilst expression levels of the mblC and mblD isoforms were reduced in miR-277SP flies. [score:6]
dme-miR-277 inhibition induced a reduction of 15% in IFM area, in comparison to flies expressing scramble-SP as control. [score:5]
The fact that dme-miR-277 and dme-miR-304 silencing cause isoform-specific changes in muscleblind expression levels suggest that these miRNAs directly regulate the mbl transcripts. [score:5]
However, we have observed a slight but significant decrease of mblD transcript as a result of miR-277SP, which might be explained by an inter-isoform regulation as dme-miR-277 also produces a strong upregulation of the mblB isoform, which might have a negative effect on mblD. [score:5]
As we were not interested in a complete description of muscleblind regulation by microRNAs but in providing proof of concept of their usefulness as therapeutic targets in DM1, we continued our studies with the two confirmed muscleblind regulators; miR-277 and miR-304. [score:5]
Importantly, profiling of Drosophila microRNA expression in dissected thoracic muscles, had previously demonstrated miR-124, miR-100, miR-277 and miR-304 expression in these muscles 35. [score:5]
Tissue-specific silencing of dme-miR-277 and dme-miR-304 upregulates muscleblind mRNA and protein in Drosophila muscle. [score:4]
Thus, muscleblind upregulation triggered by dme-miR-277 or dme-miR-304 silencing, improved survival of DM1 mo del flies. [score:4]
dme-miR-277 and dme-miR-304 silencing upregulates Muscleblind proteins with different subcellular localization. [score:4]
Therefore, silencing of dme-miR-277 or dme-miR-304 upregulates Muscleblind levels and rescues its subcellular distribution in DM1 fly muscles. [score:4]
Analyses of muscleblind transcript levels by qRT-PCR showed that silencing of dme-miR-277 or dme-miR-304 upregulated muscleblind in DM1 flies (Fig. 3a). [score:4]
dme-miR-277 silencing increased median survival by eight days while an increase of six days was detected for DM1 flies expressing miR-304SP. [score:3]
Importantly, survival curves for flies expressing miR-277SP or miR-304SP in otherwise wild type muscle were not different to scramble-SP control indicating that dme-miR-277 or dme-miR-304 silencing did not alter lifespan (Fig. 5c,d). [score:3]
Inhibition of dme-miR-277 or dme-miR-304 improved locomotion and survival of DM1 mo del flies. [score:3]
dme-miR-277 or dme-miR-304 silencing enhance muscleblind expression and rescues missplicing events in a DM1 background. [score:3]
Histogram showing dme-miR-277 (d) and dme-miR-304 (e) relative expression levels according to qRT-PCR data. [score:3]
Muscleblind levels were 14-fold higher when dme-miR-277 was inhibited while dme-miR-304 silencing resulted into a 6-fold increase. [score:3]
Intriguingly, expression level of mblC, an isoform with no predicted recognition sites for dme-miR-277, were significantly reduced in Mhc-Gal4 miR-277SP flies. [score:3]
We confirmed direct binding of dme-miR-277 to the 3′ UTR of the mbl B and D isoforms and direct binding of dme-miR-304 to mbl isoforms C and D. Accordingly, the mblB and mblC isoforms were increased by miR-277SP and miR-304SP, which reduced the levels of these microRNAs. [score:3]
To widen the search of miRNA set of candidates, we used TargetScan 34 to analyze miRNA recognition sites in the muscleblind 3′UTR and identified sites for two additional miRNAs: dme-miR-277 and dme-miR-304 (Table 1). [score:3]
These experiments confirmed direct binding of dme-miR-277 to the 3′ UTR of the mblB and D isoforms and direct binding of dme-miR-304 to mbl isoforms C and D (Fig. 1e,g). [score:3]
qRT-PCR analyses revealed that the level of mblB significantly increased when dme-miR-277 was inhibited. [score:3]
To test whether Muscleblind increase, triggered by dme-miR-277 or dme-miR-304 silencing, was enough to rescue missplicing in the DM1 mo del flies we studied two altered splicing events (Fig. S2g) and the alteration in the expression level of a specific transcript. [score:3]
dme-miR-277 and dme-miR-304 regulate different Muscleblind isoforms. [score:2]
To determine which muscleblind isoforms are regulated by dme-miR-277 or dme-miR-304, we used the Miranda algorithm 39 to identify dme-miR-277 and dme-miR-304 recognition sites in Muscleblind isoform 3′ UTRs (Table 1, Fig. 1e). [score:2]
To further analyze the effect of dme-miR-277 or dme-miR-304 silencing we stained Muscleblind distribution in longitudinal sections of indirect flight muscles (IFMs). [score:2]
The expression analysis of dme-miR-277 and dme-miR-304 was performed by real-time PCRs with specific miRCURY LNA microRNA PCR primers (Exiqon) according to the manufacturer’s instructions. [score:2]
We found one potential recognition site for dme-miR-277 in the mblA isoform and two in mblB and mblD. [score:1]
dme-miR-277 was silenced ~60% while a robust reduction of ~80% was detected for dme-miR-304. [score:1]
In control flies (b) silencing of either dme-miR-277 or dme-miR-304 had no effect on climbing velocity. [score:1]
dme-miR-277 or dme-miR-304 silencing rescues muscle atrophy and motor function in a Drosophila mo del of DM1To assess the functional relevance of Muscleblind increase achieved by the expression of specific sponge constructs, we studied the effect of dme-miR-277 or dme-miR-304 silencing on muscle atrophy, which is a characteristic alteration in DM1 individuals. [score:1]
Of note, binding sites of dme-miR-277 and dme-miR-304 overlap in the mblD 3′ UTR, which could explain the difference observed between in vivo and luciferase assays for mblD regulation by dme-miR-277. [score:1]
57. miRNA sponge lines (UAS-miR-SP) for dme-miR-92a, dme-miR-100, dme-miR-124, dme-miR-277, dme-miR-304 and scramble-SP (control) were obtained from Dr. [score:1]
In control individuals (a) dme-miR-277 silencing decreased landing height while dme-miR-304 silencing did not affect flight. [score:1]
Significantly reduced relative luminescence compared to empty vector (pCMV-MIR, control) reveals direct binding of dme-miR-277 to m blB and m blD 3′UTRs and of dme-miR-304 to m blC and m blD 3′ UTRs. [score:1]
A total of 500 ng/well of pEZX-MT05 vector containing mblA, mblB, mblC or mblD were cotrasfected with 500 ng/well of pCMVMIR vector (Blue Heron) containing dme-miR-277 or dme-miR-304, using X-tremeGENE TM HP DNA Transfection Reagent (Sigma-Aldrich). [score:1]
Functional depletion of dme-miR-277 or dme-miR-304 extends lifespan of DM1 fliesMuscle wasting, particularly in the respiratory system, is the leading cause of death in DM1. [score:1]
In these DM1 mo del flies, we found that tissue-specific silencing of dme-miR-277 or dme-miR-304 was enough to rescue muscle area percentage significantly (Fig. 4e–h). [score:1]
To assess the functional relevance of Muscleblind increase achieved by the expression of specific sponge constructs, we studied the effect of dme-miR-277 or dme-miR-304 silencing on muscle atrophy, which is a characteristic alteration in DM1 individuals. [score:1]
Therefore, these results demonstrate that silencing of dme-miR-277 or dme-miR-304 derepresses muscleblind. [score:1]
dme-miR-277 or dme-miR-304 silencing rescue muscle atrophy in mo del flies. [score:1]
Silencing of dme-miR-277 or dme-miR-304 derepresses muscleblind in Drosophila muscle. [score:1]
dme-miR-277 or dme-miR-304 silencing rescues muscle atrophy and motor function in a Drosophila mo del of DM1. [score:1]
Interestingly, dme-miR-277 and dme-miR-304 exhaustion, had different effects on Mbl protein distribution. [score:1]
Functional depletion of dme-miR-277 or dme-miR-304 extends lifespan of DM1 flies. [score:1]
To study the effect of dme-miR-277 or dme-miR-304 silencing on Muscleblind subcellular localization in DM1 flies, we examined Muscleblind protein distribution by inmunodetection in IFMs. [score:1]
dme-miR-277 silencing increased cytoplasmic Mbl, (Fig. 2d–f), while a strong nuclear localization was detected in Mhc-Gal4 miR-304SP flies (Fig. 2g–i). [score:1]
Silencing of dme-miR-277 or dme-miR-304 derepresses muscleblind in Drosophila muscleMuscleblind sequestration in RNA foci and subsequent loss of function of the protein is a main triggering factor in DM1 molecular pathology. [score:1]
To study whether dme-miR-277 or dme-miR-304 silencing rescues lifespan of DM1 flies, we performed survival curves analyses in flies of different genotypes. [score:1]
[1 to 20 of 53 sentences]
3
[+] score: 48
When the reporter contained the miR-277 binding sites, YFP expression was repressed in the eye but readily visible in the antennae, indicating that miR-277 is expressed in the eye (loqs/CyO, Figure 7A and B). [score:5]
The control animals expressing YFP without the miR-277 target sites contained a pBAC3xP3-EYFP, p-Gal4Δ-K10 insertion on the X chromosome [66]. [score:5]
This transgenic reporter expresses in the eye a YFP mRNA bearing four miR-277 binding sites in its 3′ UTR. [score:3]
Subsequently, the Pax6/EYFP/miR-277-target/SV-40-polyA cassette [68– 70] was cloned into pPCar20.1 [71] creating pKF77. [score:3]
Then the vector was digested with NotI/XbaI and the annealed oligonucleotides 5′-GGC CTG TCG TAC CAG AGG ATG CAT TTA CAG TGT CGT ACC AGA GGA TGC ATT TAT GTC GTA CCA GAG GAT GCA TTT ACA GTG TCG TAC CAG AGG ATG CAT TTA-3′ and 5′-CTA GTA AAT GCA TCC TCT GGT ACG ACA CTG TAA ATG CAT CCT CTG GTA CGA CAT AAA TGC ATC CTC TGG TAC GAC ACT GTA AAT GCA TCC TCT GGT ACG ACA-3′ inserted, appending four miR-277 target sites to the 3′ UTR. [score:3]
The vector for the expression of miR-277-responsive myc-YFP was constructed by first inserting the annealed oligonucleotides 5′-CAT GGA ACA AAA ACT TAT TTC TGA AGA AGA CTT GGG-3′ and 5′-CAT GCC CAA GTC TTC TTC AGA AAT AAG TTT TTG TTC-3′ into NcoI-cut pBSII-ITR1.1k-EYFP (a kind gift from Dr. [score:3]
A strong mutation in r2d2 did not comparably alter repression of the miR-277-regulated YFP reporter. [score:3]
The four miRNA -binding sites pair with all but the central three nucleotides of miR-277 and are, therefore, predicted to repress reporter mRNA translation rather than trigger mRNA cleavage (Figure 7A). [score:3]
To assess the function of loqs in miRNA biogenesis, we isolated total RNA from loqs [f00791] males and determined the steady-state levels of mature and pre-miRNA for miR-277 and bantam (Figure 2A), which are both expressed in adult tissues. [score:3]
The exposure time for the unregulated YFP reporter strain was one-fourth that used for the miR-277-responsive YFP strain. [score:2]
We detected a 100-fold increase in pre-miR-277 and a 12-fold increase in pre- bantam RNAs in homozygous mutant loqs [f00791] males, but not in heterozygous loqs [f00791] or heterozygous or homozygous r2d2 mutant males. [score:1]
The following probes were used for detection: 5′-UCG UAC CAG AUA GUG CAU UUU CA-3′ for miR-277; 5′-CAG CTT TCA AAA TGA TCT CAC T-3′ for bantam; 5′-ACA ACA AAA UCA CUA GUC UUC CA-3′ for miR-7; 5′-TAC AAC CCT CAA CCA TAT GTA GTC CAA GCA-3′ for 2S rRNA. [score:1]
In contrast, the amount of mature miR-277 or bantam was only slightly reduced in the loqs [f00791] homozygotes. [score:1]
Eight days after incubating S2 cells with dsRNA corresponding to the first 300 nucleotides of the loqs coding sequence, we determined the steady-state levels of pre-miRNA and mature miRNA for miR-277 and bantam. [score:1]
Figure 2(A) Northern analysis of total RNA from wild-type, loqs [f00791] heterozygotes and homozygotes, and r2d2 heterozygotes and homozygotes for whole males, probed for miR-277 and bantam. [score:1]
In heterozygous loqs [f00791]/CyO flies bearing a miR-277-responsive, Pax6-promotor -driven, YFP transgene, YFP fluorescence was visible in the antennae but was repressed in the eye. [score:1]
RNAi of dcr-2, r2d2, or drosha did not alter pre-miRNA levels for either miR-277 or bantam, nor did it alter Dcr-1 or Loqs levels. [score:1]
Relative to an unrelated dsRNA control, dsRNA corresponding to dcr-1 caused a approximately 9-fold and approximately 23-fold increase in steady-state pre-miR-277 and bantam levels, respectively, and dsRNA corresponding to loqs caused a approximately 2-fold and approximately 6-fold increase in steady-state pre-miR-277 and bantam levels, respectively. [score:1]
Thus, Loqs is required for production in vivo of normal levels of miR-7, miR-277, and bantam, and the efficient conversion of pre- let-7 to mature let-7 in vitro. [score:1]
shtml) accession numbers for the genes and gene products discussed in this paper are: bantam (MI0000387), let-7 (MI0000416), miR-277 (MI0000360), miR-7 (MI0000127), and TAR (RF00250). [score:1]
This allele reduced miR-277 levels in the soma approximately 2-fold (see Figure 2B); fluorescence in the eye of homozygous mutant loqs flies was 1.8 ± 0.17 (average maximum intensity ± standard deviation; n = 13) times greater than in the eyes of their age-matched heterozygous siblings. [score:1]
Silencing of the miR-277-responsive YFP reporter in the eye was reduced in loqs [f00791] homozygous mutant flies (loqs/ loqs, Figure 7A, B and C). [score:1]
The membrane was first hybridized with the miR-277 probe, stripped and probed for 2S rRNA as a loading control, then stripped again and probed for bantam miRNA. [score:1]
YFP fluorescence was readily detected in the eye and antennae in control flies in which the 3′ UTR of the YFP transgene lacked the four miR-277 binding sites (Figure 7A). [score:1]
As a positive control for miR-277 hybridization, 10 fmol of phosphorylated miR-277 synthetic oligonucleotide (Dharmacon, Lafayette, Colorado, United States) was included on the gel. [score:1]
[1 to 20 of 25 sentences]
4
[+] score: 44
Therefore the normal expression of miR-277–3p would be achieved through a balance between upregulation by Pacman (perhaps due to increased processing from precursors) and downregulation by Dis3 (most likely due to indirect transcriptional effects). [score:10]
For miR-277–3p, miR-987–5p and miR-34–5p their cognate miRNA precursors also increase upon Dis3 knockdown, suggesting that Dis3 normally affects their expression via indirect means, perhaps by increasing the expression of specific transcription factors. [score:7]
In contrast, the levels of the pri/pre-miRNAs are increased in levels in Dis3 -depleted cells for miR-277–3p, miR-34–5p, miR-317–5p and miR-987–5p suggesting that these miRNAs are not direct targets of Dis3. [score:4]
The 5′-3′ exoribonuclease Pacman (Xrn1) regulates expression of the heat shock protein Hsp67Bc and the microRNA miR-277-3p in Drosophila wing imaginal discs. [score:4]
Of these, 5 miRNAs (miR-987–5p, miR-277–3p, miR-958–3p, miR-956–3p, miR-252–5p) were upregulated ≥4-fold in Dis3 -depleted discs. [score:4]
Validation of the miRNA using qRT-PCR shows that this novel miRNA is expressed at similar levels to miR-277–3p in all samples. [score:3]
In contrast, in the hypomorphic pcm [5] mutant, where activity of the 5′-3′ exoribonuclease Pacman (Xrn1) is decreased, mature miR-277–3p is decreased in expression by 5.6-fold, while the level of pre-miR-277–3p remains unchanged. [score:3]
Using this stringent filtering method, we identified 6 miRNAs whose expression increased ≥2-fold in the knockdown samples compared to both parental controls (miR-277–3p, miR-987–5p, miR-252–5p, miR-34–5p, and miR-7–3p and miR-317–5p). [score:3]
miR-277–3p increases 3.8-fold (by qRT-PCR, Fig.  6C) upon Dis3 knockdown, with this increase most likely to be due to an indirect effect on transcription. [score:3]
The set of miRNAs that increase ≥2-fold; by RNA-seq upon Dis3 depletion are miR-277–3p, miR-987–5p, miR-252–5p, miR-34–5p and miR-317–5p (Table 2). [score:1]
* miR-317 is located in close proximity to miR-34 and miR-277. [score:1]
Esslinger SM, Schwalb B, Helfer S, Michalik KM, Witte H, Maier KC, Martin D, Michalke B, Tresch A, Cramer P, et al. Drosophila miR-277 controls branched-chain amino acid catabolism and affects lifespan. [score:1]
[1 to 20 of 12 sentences]
5
[+] score: 35
Other miRNAs from this paper: mmu-mir-122, dme-mir-289, dme-bantam, mmu-mir-16-1, mmu-mir-16-2
Direct inhibition or overexpression of miR-289 and miR-277 does not influence ARE reporters. [score:6]
In contrast to miR-289, miR-277 was readily detectable in control cells and transfection of an analogous vector expressing the miR-277 hairpin precursor resulted in strong overexpression of mature miR-277 (Fig. 3C). [score:5]
Neither treatment led to an increase in ARE reporter gene expression, while a miR-277 reporter construct [17] was strongly de-repressed by the miR-277, but not the miR-289 inhibitor (Fig. 3A). [score:5]
A) Response of the GFP reporters (stable, polyclonal cell lines; miR-277 reporter: stable clonal cell line) to direct inhibition of miR-277 or miR-289; an antisense oligonucleotide directed against part of the firefly luciferase coding sequence served as control for normalization; values are the mean of two experiments. [score:5]
B) Response of the GFP reporters (same as in A) to overexpression of miR-277 or miR-289 (transient transfection); an unrelated plasmid (pUC18) served as control for normalization; values are the mean of two experiments. [score:3]
In addition, overexpression of miR-289 or miR-277 did not result in any change of GFP-ARE fluorescence (Fig. 3B). [score:3]
Vectors for miRNA overexpression were described previously for miR-277 [17]; for miR-289 an analogous vector was prepared by amplifying a 300 nt fragment of genomic DNA surrounding the miR-289 sequence by PCR with the oligonucleotides 5′-GAT GGA TCC TAA GCA GGC AGC ATG TCA TC-3′ and 5′-GCG GCC GCA CCA CTT CCA GCA CGT TTT T-3′. [score:3]
We therefore treated our reporter-cell lines with 2′- O-methyl -modified RNA oligonucleotides directed against miR-289 as well as miR-277, a second miRNA that potentially base-pairs with ARE containing sequences. [score:2]
The following probes were used for detection: 5′-TGT CGT CCA GAT AGT GCA TTT A-3′ for miR-277; 5′-AGT CGC AGG CTC CAC TTA AAT ATT TA-3′ for miR-289; 5′-CAG CTT TCA AAA TGA TCT CAC T-3′ for bantam. [score:1]
For comparison, the miR-277 precursor is annotated with 340786 reads. [score:1]
-CAU CAC GUA CGC GGA AUA CUU CGA AAU GUC C-3′ for luciferase control, 5′-Chol-UCU AGU CGC AGG CUC CAC UUA AAU AUU UAC U-3′ for as-miR-289 and 5′-Chol-UCU UGU CGU CCA GAU AGU GCA UUU ACU-3′ for as-miR-277 (all bases were 2′- O-methyl modified). [score:1]
[1 to 20 of 11 sentences]
6
[+] score: 18
Other miRNAs from this paper: dme-mir-10, dme-mir-34, dme-mir-190
Amongst the common targets of GlyGCC and mir-277, we observed Dlg (FBgn0001624), coding for the Drosophila discs large tumor suppressor protein (see Fig.   6a). [score:5]
Further, we found that these target lists overlap (with up to 29 targets) with the well-studied miRNAs mir-34, mir-277, mir-190, and mir-10. [score:5]
For example, both GlyGCC and mir-277 seeds overlap by 5 nts and this sometimes led to their complementarity against the same target (Fig.   6a). [score:3]
Of note, this gene is located in the Drosophila genome in the immediate vicinity (a few hundred basepairs) of mir-34 and mir-277, hinting at a potentially deeper regulatory connection. [score:2]
a Both GlyGCC and mir-277 having a 7mer-m8 match, b mt:SerGCT 7mer-m8 match and c GlyGCC having a 7mer-1a match and mt:SerGCT having a 8mer-1a match, with additional A for the 1a matches are also highlighted (mt:SerGCT) or bolded (GlyGCC)Notably, some seeds showed overlap with the seed of either another tRF or a miRNA (Fig.   6a and c). [score:1]
An overlap of the tRF seed with that of mir-277 is of importance, as it may relate one of the most abundant tRFs (GlyGCC) to brain deterioration, since mir-277 has been reported to modulate neurodegeneration [42]. [score:1]
a Both GlyGCC and mir-277 having a 7mer-m8 match, b mt:SerGCT 7mer-m8 match and c GlyGCC having a 7mer-1a match and mt:SerGCT having a 8mer-1a match, with additional A for the 1a matches are also highlighted (mt:SerGCT) or bolded (GlyGCC) Notably, some seeds showed overlap with the seed of either another tRF or a miRNA (Fig.   6a and c). [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 17
Among these identified miRNAs, we found 12 pairs of miRNAs and miRNA*s. revealed that some B. mori miRNA genes were expressed only during specific stages, indicating that B. mori miRNA genes (e. g., bmo-miR-277) have developmentally regulated patterns of expression. [score:7]
bmo-miR-277 was expressed only in moth and not detected in larva and pupa; the precursor of bmo-miR-277 was also detected [see Figure S1 of Additional file 1]. [score:3]
For example, bmo-miR-277 was expressed only during the moth stage. [score:3]
Figure 1 displayed the result of analysis for bmo-miR-277. [score:1]
Members of the bantam, mir-71, mir-275, mir-277, mir-279 miRNA families have a high degree of similarity in their precursor sequences. [score:1]
bmo-miR-279 and other mir-279 precursor sequences have sequence similarities of >55%; bmo-miR-277 precursors share >56% sequence similarity; bmo-miR-27 precursors share >57% sequence similarity; bmo-miR-71 precursors share >59% sequence similarity; and bmo-bantam precursors share >60% sequence similarity. [score:1]
We designated these sequences bmo-miR-13a*, bmo-miR-14, bmo-miR-46, bmo-miR-46*, bmo-miR-71, bmo-miR-277 and bmo-bantam. [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 14
The functional enrichment of its target set suggests a much broader role for miR-277, perhaps acting as a general metabolic switch, slowing down metabolic activity by repressing translation of these genes. [score:5]
The predicted target set for worm miR-277 (the union of conserved sets for GCAUUUA, UGCAUUU) is highly enriched with fatty acid metabolism (p < 10 [−15]), carboxylic acid metabolism (p < 10 [−10]), and branched chain family amino acid metabolism (p < 10 [−8]). [score:3]
In a recent computational study, several enzymes of the branched chain amino acid degradation pathway were proposed to be targets for miR-277 [9]. [score:3]
Consistent with previous observations [17], target sites for miR-2a/2b/2c/6/13a/13b (UGUGAUA, K box) and miR-277 (AGCUUUA, Brd box) are significantly coconserved within fly 3′UTRs (p < 10 [−17]). [score:3]
[1 to 20 of 4 sentences]
9
[+] score: 14
Lane 1: 100 bp ladder marker; Lane 2: miR-315; Lane 4: miR-1; Lane 6: miR-9a; Lane 8: PC-5p-113190_15; Lane 10: PC-3p-2743_844; Lane 12: miR-7; Lane 14: miR-8; Lane 16: miR-277; Lane 18: Let-7. The other uneven lanes were negative controls for each target miRNA. [score:3]
The relative miRNA expression, including miR-277 (B), miR-1 (C), miR-7 (D), Let-7 (E), miR-9a (F), miR-315 (G), miR-8 (H), PC-5p-113190_15 (I), and PC-3p-2743_844 (J) at two wing morph was normalized to the wingless adult. [score:3]
Additionally, expression of miR-277 shortens Drosophila lifespan and is synthetically lethal with reduced insulin signaling 45. [score:3]
This study shows that miR-277 and Let-7 are significantly down-regulated among wingless S. avenae (Table 2, Fig. 4B,E), which may be related to the generally observed increased lifespan of winged compared to wingless S. avenae. [score:3]
The RT-PCR amplified products for seven conserved miRNAs (Let-7, miR-1, miR-7, miR-277, miR-8, miR-9a and miR-315) and two novel miRNAs (PC-5p-113190_15 and PC-3p-2743_844) showed a single band in the expected size (60–100 bp) (Fig. 4A and S4). [score:1]
The highest RT-qPCR Log [2] fold-changes were observed in miR-277 and miR-1 that respectively showed reductions amongst wingless adults of 73.2- (Fig. 4B) and 47.5-fold (Fig. 4C). [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 9
Although miR-277 is upregulated, miR-34 is downregulated and miR-317 is steadily expressed after HS in the w [1118] strain. [score:9]
[1 to 20 of 1 sentences]
11
[+] score: 8
Our analysis with the miR-277 perfect match reporter cell line suggested that upon knockdown of the splicing factors, the core RNAi pathway is unaffected and reporter expression is unchanged (S1 Table). [score:4]
We also counter-screened the entire set of candidates with a cell line where a GFP reporter is repressed by two perfect matches to miR-277 in its 3’-UTR; expression of this reporter is driven by the same promoter as the Renilla luciferase in the screen. [score:3]
Since miR-277 is processed by Dcr-1, then loaded into Ago2 via the Dcr-2/R2D2 complex, we could distinguish between core RNAi pathway components or factors that non-specifically activate transcription of our reporter and those factors that are specifically required for DNA damage -induced siRNA biogenesis. [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 6
For miR-277, we recovered all nine predicted targets and found five additional genes (CG3267, CG4389, CG4600, CG6638, and CG8778) at p < 10 [−7]. [score:3]
Our data were consistent with and extended results from a recent study that used GO functional analysis to predict microRNA target genes [4], in which miR-7 was predicted to be active in Notch signaling and miR-277 in valine, leucine, and isoleucine degradation. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 6
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, hsa-mir-210, dme-mir-184, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-bantam, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-184, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-33b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-1000, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
In Drosophila, miR-277 has predicted targets in metabolic pathways [20] while miR-8 plays a role in Wnt signaling [36]. [score:3]
Five miRNAs, miR-184, miR-275, miR-277, miR-276, and miR-92, were sequenced >500 times and were readily detectable in total RNA isolated from C7/10 cells (Figure 3A). [score:1]
Five miRNAs, miR-1, miR-317, miR-277, miR-989, and miR-92 were sequenced >120 times and were readily detectable in total RNA isolated from Cx. [score:1]
albopictus C710 cells, these two species shared five out of the top ten most frequently occurring miRNAs: miR-184, miR-317, miR-277, miR-275, and miR-8 (Tables 1, 2). [score:1]
[1 to 20 of 4 sentences]
14
[+] score: 4
Other miRNAs from this paper: dme-mir-1, hsa-mir-1-2, hsa-mir-1-1
Jones C. I. Grima D. P. Waldron J. A. Jones S. Parker H. N. Newbury S. F. The 5′-3′ exoribonuclease Pacman (Xrn1) regulates expression of the heat shock protein Hsp67Bc and the microRNA miR-277–3p in Drosophila wing imaginal discs RNA Biol. [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 4
Jones CI The 5′-3′ exoribonuclease Pacman (Xrn1) regulates expression of the heat shock protein Hsp67Bc and the microRNA miR-277-3p in Drosophila wing imaginal discsRNA Biol. [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 4
The 5′-3′ exoribonuclease Pacman (Xrn1) regulates expression of the heat shock protein Hsp67Bc and the microRNA miR-277-3p in Drosophila wing imaginal discs. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 4
Early manifestations of the miRNA world emerged from pervasive control of the C. elegans heterochronic pathway [67] and the D. melanogaster Notch pathway [1], [46] by miRNAs, and a few similar situations have been documented, i. e. direct targeting throughout the branched amino acid catabolism pathway by miR-277 [47] or repression of multiple components of fatty acid metabolism by miR-33 [68]. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 4
Two of the microRNAs, mir-283 and mir-277, were detected at very low levels in unfertilized eggs (Table S1) and have a greater expression level later on during embryonic development (Figure 1). [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 4
The 5′-3′ exoribonuclease Pacman (Xrn1) regulates expression of the heat shock protein Hsp67Bc and the microRNA miR-277–3p in Drosophila wing imaginal discs. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other examples of clustered miRNAs or multicopy miRNAs include: novel miRNA C5152a antisense to C5152b; novel C5303 overlapping ame-mir-137; ame-mir-9b overlapping the ame-mir-79 locus, but on the opposite strand; ame-mir-12 near ame-mir-283; ame-mir-275 near ame-mir-305; ame-mir-277 near ame-mir-317 and ame-mir-34; C1504 near ame-mir-375; and ame-let-7 on the same scaffold as ame-mir-100. [score:1]
Ame-mir-34, ame-mir-277 and ame-mir-317 all occupy intron 3 of GB10191. [score:1]
Ame-mir-277, ame-mir-317 and ame-mir-34 occur in the same intron of GB10191 - a core component of the RNA polymerase II complex. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 3
Identification of cis-regulatory elements responsible for ecdysone -mediated repression of miR-34 The miR-34 genomic locus contains two additional miRNA genes, miR-277 and miR-317, as well as a protein-coding gene Fmr1 (Fig 6A). [score:2]
The miR-34 genomic locus contains two additional miRNA genes, miR-277 and miR-317, as well as a protein-coding gene Fmr1 (Fig 6A). [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 2
Other miRNAs from this paper: dme-mir-34, dme-bantam, dme-let-7
On the other hand, miR-277 is an atypical miRNA that is sorted into both AGO1 and AGO2 effectors (22), for which the AGO1 -loaded population is sensitive to ß-elimination while the AGO2 -loaded population is resistant (Figure 5A). [score:1]
A substantial portion of miR-277, which is sorted into both AGO1 and AGO2, was not ß-eliminated. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 1
The copy numbers of ast-miR-8*, and ast-mir-277* are less than those of ast-miR-8 and ast-miR-277, respectively. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
In D. melanogaster larvae, Mir-8 has been related to the regulation of growth factors in body fat [29] and with body size [30], whereas Mir-278 and Mir-277 influence energy homeostasis [31, 32]. [score:1]
[1 to 20 of 1 sentences]