sort by

680 publications mentioning hsa-mir-200b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-200b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 432
To determine if the observed changes in morphology of LY2 cells were due to reduced expression of ZEB1, ZEB2, and mesenchymal markers and increased expression of epithelial marker, ZEB1/2, E-cadherin, and vimentin mRNA expression was examined in LY2 cells overexpressing miR-200b or miR-200c (Fig. 6A). [score:9]
Overexpression of miR-200b reduced ZEB2 expression while overexpression of miR-200c reduced vimentin (VIM) expression (Fig. 6A). [score:9]
Knockdown of ZEB1 in LY2 cells recapitulated the effect of miR-200b and miR-200c overexpression resulting in inhibition of LY2 cell proliferation by TAM and fulvestrant, but not the aromatase inhibitor exemestane. [score:8]
Since miR-200 family members repress ZEB1 expression [27], [30] and ZEB1 is expressed in LY2 cells (Fig. 2), we used siRNA to knockdown ZEB1 expression in LY2 cells and examined cell proliferation by BrdU incorporation. [score:8]
B, In endocrine-resistant cells that have undergone EMT, miR-200 family expression is low, resulting in increased ZEB1 protein which inhibits E-cadherin expression. [score:7]
Overexpression of miR-200b and miR-200c inhibits expression of mesenchymal markers and increases E-cadherin in LY2 cells. [score:7]
Slug directly inhibits miR-200b expression [69]. [score:6]
miR-200 family members regulate EMT by suppressing expression of transcriptional repressors ZEB1/2. [score:6]
Inhibitors of Deacetylation and Methylation Increase miR-200 Family Expression in LY2 Cells. [score:5]
Many studies have identified an inverse relationship between the expression of the miR-200 family and its targets ZEB1/2 in cells [27], [28], [29], [30], [31]. [score:5]
Further, overexpression of miR-200b and miR-200c also altered morphology of cells from a mesenchymal to an epithelial phenotype and reduced ZEB1/2 mRNA expression. [score:5]
Future experiments are needed to identify targets of miR-200b and miR-200c in antiestrogen sensitivity for targeted therapy. [score:5]
To determine if decreased expression of miR-200 family members in LY2 cells is due to methylation and histone deacetylation, LY2 cells were treated with 2.5 µM 5-aza-dC alone or in combination with 100 ng/µl TSA, a histone deacetylase (HDAC) inhibitor, for 72 h. TSA was added in the last 16 h of the treatment period [52]. [score:5]
0062334.g009 Figure 9A, In endocrine-sensitive breast cancer cells, e. g., MCF-7, miR-200b and miR-200c are expressed, resulting in low ZEB1 protein expression. [score:5]
Overexpression of miR-200b or miR-200c partially restores antiestrogen sensitivity to LY2 cells, but other molecules and/or pathways known to be involved in antiestrogen-resistance such as coregulators [40], [41], [42], altered growth factor signaling [43], [44], [45], NFκB activation [46], [47], or other dysregulated microRNAs in addition to the miR-200 family [32] may also be involved in the phenotype of these cells. [score:5]
We report that transient overexpression of miR-200b and miR-200c in LY2 cells sensitized the cells to inhibition by antiestrogens TAM and fulvestrant (ICI 182,780). [score:5]
A, In endocrine-sensitive breast cancer cells, e. g., MCF-7, miR-200b and miR-200c are expressed, resulting in low ZEB1 protein expression. [score:5]
Overexpression of miR-200b and miR-200c reduced ZEB1 and increased E-cadherin (CDH1) expression. [score:5]
Overexpression of miR-200b or miR-200c in LY2 cells altered cell morphology to a more epithelial appearance and inhibited cell migration. [score:5]
Overexpression of miR-200b increased LY2 cell sensitivity to inhibition by 4-OHT and fulvestrant. [score:5]
Further, miR-200 had pro-metastatic activity in a mouse mo del of breast cancer metastasis by targeting Sec23a, a suppressor of metastasis [68]. [score:5]
Concomitant with the increased expression of miR-200b and miR-200c, there was a decrease in expression of ZEB1 mRNA with 5-aza-dC and TSA treatment (Fig. 8C). [score:5]
Converse experiments were performed using anti-miR miRNA inhibitors to bind and inhibit endogenous miR-200b or miR-200c activity in MCF-7 cells. [score:5]
Our data indicate that reduced miRNA-200b and miR-200c expression contributes to endocrine resistance in breast cancer cells and that the reduced expression of these miR-200 family members in endocrine-resistant cells can be reversed by 5-aza-dC+TSA. [score:5]
Concomitant with the increase in miR-200b and miR-200c, ZEB1 expression was decreased and cells appeared more epithelial in morphology and were sensitized to TAM and fulvestrant inhibition. [score:5]
Overexpression of miR-200b and miR-200c enhanced the sensitivity of LY2 breast cancer cells to growth inhibition by antiestrogens 4-OHT and fulvestrant. [score:5]
10 nM E [2] and 100 nM 4-OHT significantly decreased miR-200a and miR-200b expression in MCF-7 cells, but had no effect on miR-200c expression. [score:5]
Overexpression of miR-200b or miR-200c in LY2 Cells Enhances Inhibition by 4-OHT or Fulvestrant. [score:5]
However, there was no further increase in the sensitivity of cells to inhibition by 4-OHT or fulvestrant after knockdown of miR-200b or miR-200c in MCF-7 cells as compared to the effect of 4-OHT and fulvestrant on control -transfected MCF-7 cells (Fig. 4B), indicating that other factors also contribute to the sensitivity of these cells to growth inhibition by antiestrogens. [score:5]
In endocrine-sensitive luminal breast cancer cells, expression of miR-200 family members represses ZEB1, thus E-cadherin is expressed and vimentin is repressed and cells have an epithelial phenotype. [score:5]
Although studies have identified a role for miR-200 as a suppressor of EMT, there is little evidence for a role of miR-200 as a suppressor of endocrine resistance in breast cancer cells, hence the novelty of these data. [score:5]
Our results show that there is an inverse relationship between the expression of miR-200 family expression and ZEB1 mRNA in LY2 cells. [score:5]
Further, miR-200b and miR-200c overexpression sensitized LY2 cells to growth inhibition by estrogen receptor (ER) antagonists TAM and fulvestrant. [score:5]
Microarray analysis of miRNA expression revealed low expression of miR-200a, miR-200b, and miR-200c in LY2 endocrine-resistant breast cancer cells compared to MCF-7 endocrine-sensitive breast cancer cells [32]. [score:4]
Here we examined the expression of miR-200a, miR-200b, and miR-200c and their regulation by estradiol (E [2]) and 4-hydroxytamoxifen (4-OHT), an active TAM metabolite, in a panel of ERα -positive breast cancer cell lines derived from MCF-7 endocrine-sensitive cells representing a cellular mo del of progression towards endocrine/TAM-resistance. [score:4]
Values are the mean ± SEM of 3 experiments and are expressed as fold relative to EtOH -treated MCF-7. *p<0.05 versus EtOH -treated MCF-7. To examine if expression of miR-200 family members affects sensitivity of endocrine-resistant LY2 cells to antiestrogens, cells were transiently transfected with precursors for miR-200a, miR-200b, and miR-200c and MTT cell viability assays were performed in cells treated with vehicle control, 4-OHT, or fulvestrant for 6 days (Fig. 3A). [score:4]
After 1, 5, or 11 d, RNA was isolated (as described above) to confirm knockdown or overexpression of miR-200b or miR-200c. [score:4]
This is the first report of 4-OHT regulation of miR-200 family expression in LCC1, LCC2, LCC9 and LY2 cells. [score:4]
Overexpression of miR-200b or miR-200c or knockdown of ZEB1 enhances sensitivity of LY2 cells to antiestrogens. [score:4]
As miR-200b and miR-200c share the same seed sequence [25], we suggest that the similarity in effects of miR-200b and miR-200c in enhancing antiestrogen-sensitivity and promoting a more epithelial cell morphology may be attributed to common target mRNAs involved in regulating cell morphology, such as genes encoding the actin cytoskeleton associated proteins WAVE3 and MSN (reviewed in [60]), but this speculation will require further research. [score:4]
Figure S1 Effect of E [2] and 4-OHT on the expression of miR-200 family members in MCF-7, LCC1, LCC2, LCC9, and LY2 cells. [score:3]
LY2 cells overexpressing miR-200b or miR-200c displayed a change in morphology from a spindle-shaped or mesenchymal phenotype to a ‘cobblestone’ or epithelial phenotype (Fig. 5). [score:3]
Expression of miR-200 Family in MCF-7, LCC1, LCC2, LCC9 and LY2 Human Breast Cancer Cells. [score:3]
However, there was no effect of E [2] and 4-OHT on the expression of miR-200 family in LCC2, LCC9 and LY2, reflecting their endocrine resistance. [score:3]
Demethylating agent 5-aza-2′-deoxycytidine (5-aza-dC) in combination with histone deacetylase inhibitor trichostatin A (TSA) increased miR-200b and miR-200c in LY2 cells. [score:3]
We suggest that in addition to being a biomarker for EMT, reduced miR-200 expression may serve as a prognostic marker in acquired endocrine resistance. [score:3]
Figure S2 Overexpression of miR-200b or miR-200c 11d after transfection of LY2 cells. [score:3]
Since overexpression of miR-200b and miR-200c enhanced antiestrogen-sensitivity of LY2 cells (Fig. 3A), we examined if these miRNAs affected cell morphology. [score:3]
Resistance of pancreatic cancer cells to gemcitabine was reduced by treatment with natural compounds such curcumin, which increased miR-200 expression [56], [57], [58], [59]. [score:3]
Figure S5 Overexpression of miR-200 in transfected cells. [score:3]
Expression of miR-200 family members in MCF-7, LCC1, LCC2, LCC9 and LY2 cells. [score:3]
Cells were serum-starved for 48 h and then treated with vehicle control EtOH, 10 nM E [2], or 100 nM 4-OHT for 6 h. miR-200 expression was quantified by qPCR. [score:3]
Overexpression of miR-200b and miR-200c decreased wound healing, a result in agreement with findings in other cell types, e. g., miR-200c transfection of BT549 breast cancer and Hec50 endometrial cancer cells [48]. [score:3]
Similarly, E [2] significantly decreased the expression of miR-200a, miR-200b, and miR-200c in estrogen-independent, but TAM-sensitive LCC1 cells. [score:3]
LY2 cells had undetectable levels of miR-200 family expression. [score:3]
Specific reduction of miR-200b and miR-200c expression was confirmed (Fig. 4A, Fig. S4). [score:3]
Increased miR-200a, miR-200b and miR-200c expression was confirmed by qPCR even 11 days after transfection, as well as earlier time points (Fig. S2 and data not shown). [score:3]
At the protein level, miR-200b and miR-200c transfection had the greatest impact on N-cadherin (∼50% reduced expression), while vimentin and Slug were reduced to a lesser extent (Fig. 6B). [score:3]
qPCR performed to confirm overexpression of miR-200a, miR-200b or miR-200c. [score:3]
miR-200 family members repress ZEB1 expression at the mRNA and protein levels [14], [26], [27], [28]. [score:3]
We and others previously reported that E [2] reduces miR-200 family expression in MCF-7 cells [32], [39]. [score:3]
For example, miR-200 family expression is a marker of poor prognosis and chemoresistance in ovarian cancer [64], [65], [66]. [score:3]
MCF-7 or LY2 cells were transfected with either miRNA inhibitors (Anti-miR [TM]s, Ambion, Austin, TX) or microRNA precursors (Pre-miR [TM]s, Ambion) for miR-200b or miR-200c using Lipofectamine RNAiMAX reagent (Invitrogen). [score:3]
In this study we report novel roles for miR-200b and miR-200c in inhibiting the sensitivity of endocrine-resistant LY2 breast cancer cells to 4-OHT and fulvestrant. [score:3]
Inhibition of miR-200b and miR-200c Activity does not Promote Resistance of MCF-7 Cells to Antiestrogens. [score:3]
LY2 cells were transfected with pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. RNA was harvested at 3 days and qPCR was used to confirm overexpression of miR-200. [score:3]
miR-200 family expression was progressively reduced in a breast cancer cell line mo del of advancing endocrine/tamoxifen (TAM) resistance. [score:3]
Decreased miR-200 family expression in LY2 cells could be due to epigenetic changes in the promoter, e. g., DNA methylation and histone deacetylation. [score:3]
Overexpression of miR-200b or miR-200c Changes LY2 Cell Morphology. [score:3]
Notably, there is an inverse relationship between the expression of miR-200 family and ZEB1 in LY2 cells (compare Fig. 1 and 2). [score:3]
The expression of miR-200b, miR-200c or ZEB1 mRNA was determined by qPCR. [score:3]
Our study agrees with these reports of epigenetic silencing of the miR-200 family, because we demonstrated that treatment of LY2 cells with 5-aza-dC+TSA increased miR-200b and miR-200c expression. [score:3]
Contrary to the expected decrease in miR-200 expression in metastatic cells, high levels of miR-200b and miR-200c were detected in 4T1 metastatic mouse mammary tumor cells [67]. [score:3]
Basal miR-200 and the effect of E [2] and 4-OHT on miR-200 expression was examined by qPCR in the cell lines described above (Fig. 1 and Fig. S1). [score:3]
5-aza-dC and TSA increase miR-200b and miR-200c expression in LY2 cells. [score:3]
These data suggest that methylation and deacetylation play a role in the reduced expression of miR-200b and miR-200c in LY2 cells. [score:3]
LY2 Cells Overexpressing miR-200b or miR-200c Exhibit Decreased Cell Motility. [score:3]
There was no difference in basal miR-200a, miR-200b, or miR-200c expression between MCF-7 and LCC1 cells. [score:3]
RNA was harvested at 11 days and qPCR performed to confirm overexpression of miR-200b or miR-200c. [score:3]
Similarly, gemcitabine-resistant pancreatic cancer is associated with decreased miR-200 expression [55]. [score:3]
Likewise, methylation of CpG islands in the promoter of the miR-200b cluster was inversely associated with miR-200b expression in breast cancer cells [51]. [score:3]
We report a progressive decrease in the expression of miR-200a, miR-200b, and miR-200c in an MCF-7-derived cell line mo del of TAM/endocrine resistance, i. e., decreasing from MCF-7, LCC1, LCC2, LCC9, to LY2, respectively. [score:3]
Concomitant with miR-200 decrease, there was an increase in ZEB1 mRNA expression. [score:3]
Our data showing a change in morphology and the decrease in N-cadherin, and to a lesser extent vimentin and Slug, of LY2 cells overexpressing miR-200b and miR-200c are in agreement with these observations, and are concordant with decreased ZEB1 and increased E-cadherin in these cells. [score:3]
Combined treatment with 5-aza-dC and TSA increased miR-200b and miR-200c (Fig. 8D, E), but did not alter the expression of ZEB1 in MCF-7 cells (Fig. 8F). [score:3]
Figure S6 Overexpression of miR-200 family after 3d of transfection. [score:3]
For example, overexpression of miR-200b and miR-200c caused MET in mesenchymal breast cancer cell lines MDA-MB-231 and BT549 by repressing ZEB1 and ZEB2 [27], [30]. [score:3]
Epigenetic changes in chromatin structure may be responsible for reduced expression of miR-200 family members in LY2 cells. [score:3]
The combined treatment of LY2 cells with 5-aza-dC and TSA increased the expression of miR-200b and miR-200c (Fig. 8A and 8B). [score:3]
Overexpression of miR-200 family changes LY2 cell morphology from a mesenchymal to an epithelial appearance. [score:3]
The decreased miR-200b and miR-200c in endocrine-resistant LY2 cells, caused at least in part by gene methylation and histone deacetylation, results in increased ZEB1 which represses E-cadherin expression, resulting in EMT. [score:3]
0062334.g001 Figure 1Cells were serum-starved for 48 h and then treated with vehicle control EtOH, 10 nM E [2], or 100 nM 4-OHT for 6 h. miR-200 expression was quantified by qPCR. [score:3]
Reduced expression of the miR-200 family has been observed in breast, ovarian, endometrial, lung and gastric cancer [26]. [score:3]
Overexpression of miR-200b or miR-200c in LY2 Reduces ZEB1 and Mesenchymal Markers and Increases E-cadherin. [score:3]
These data are in agreement with other reports showing an inverse correlation between miR-200 family and ZEB1 expression in basal-like, triple negative breast cancer (TNBC) cells such as MDA-MB-231 and BT549 [14], [28], [30], [31]. [score:3]
Overexpression of miR-200b and miR-200c, (Fig. S5, Fig. S6), altered LY2 cell morphology (Fig. 5, Fig. S7). [score:3]
Previously we reported that the expression of miR-200a, miR-200b, and miR-200c was lower in LY2 endocrine-resistant, mesenchymal breast cancer cells compared to parental, endocrine sensitive, epithelial MCF-7 breast cancer cells. [score:2]
Although miR-200 is considered a tumor suppressor miRNA, there are some reports of its role as an oncogene or oncomiR. [score:2]
Commensurate with reports that miR-200b has a higher percentage of CpG methylation than miR-200c [12], we detected a lower increase in relative miR-200b compared to miR-200c expression in LY2 cells. [score:2]
miR-200b and miR-200c inhibit LY2 cell migration in a wound healing assay. [score:2]
Knockdown of miR-200b or miR-200c does not promote resistance of MCF-7 to 4-OHT or fulvestrant. [score:2]
However, LCC2 and LCC9 cells had lower miR-200 family member expression compared to MCF-7 cells. [score:2]
Surprisingly, knockdown of miR-200b and miR-200c reduced basal MCF-7 cell viability by ∼15–20% (Fig. 4B). [score:2]
To determine if the loss of expression of miR-200b or miR-200c in LY2 affects cell motility, LY2 cells were transiently transfected with a negative control or with pre-miR-200b or pre-miR-200c and cell motility was examined by a wound healing assay (Fig. 7). [score:2]
Figure S4 Knockdown of miR-200b or miR-200c in MCF-7 cells. [score:2]
We observed greatly reduced ZEB1 protein and a concomitant increase in E-cadherin protein in LY2 cells transfected with pre-miR-200b or pre-miR-200c (Fig. 6C). [score:1]
To follow up on this initial observation, the expression of miR-200a, miR-200b and miR-200c was measured by qPCR in a panel of human breast cancer cell lines, i. e., LCC1, LCC2 and LCC9 cells that were derived from the parental MCF-7 cell line by propagation first as a xenograft in ovariectomized, athymic nude mice (LCC1), and then in long-term culture with tamoxifen (LCC2) or fulvestrant (LCC9) [33]. [score:1]
There were no statistical differences between cells transfected with pre-miR-200b versus pre-miR-200c. [score:1]
LY2 cells were untransfected or transfected with a negative control, pre-miR-200b, or pre-miR-200c for 48 h (see above). [score:1]
A previous report showed that transfection of MDA-MB-231 cells with pre-miR-200b or pre-miR-200c enhanced their sensitivity to doxorubicin [53], but the data summarized here are the first to indicate roles for miR-200b and miR-200c in antiestrogen sensitivity. [score:1]
MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c. [score:1]
0062334.g005 Figure 5 LY2 cells were either non -transfected (A), or transfected with control Pre-miR miRNA negative control #1 (Ambion) (B), pre-miR-200b (C), or pre-miR-200c (D) for 72 h. Images of LY2 cells captured using a light microscope (20× magnification, bar = 200 µm). [score:1]
0062334.g003 Figure 3 A, LY2 cells were either untransfected (No TF) or transfected with negative control (Neg control) or pre-miR-200a, miR-200b or miR-200c. [score:1]
The miR-200 family of miRNAs are transcribed from two chromosomal locations: miR-200b, miR-200a, and miR-429 are located on chromosome 1p36; while miR-200c and miR-141 are located on chromosome 12p13 [14]. [score:1]
Members of the miR-200 family and miR-221/222 are implicated in EMT and metastasis [9]. [score:1]
CT values for miR-200b and miR-200c in the cells transfected as indicated for 1 or 5 d. Values are the mean ± SEM of 3 determinations. [score:1]
These studies demonstrate that loss of miR-200 has roles in multiple types of drug resistance. [score:1]
0062334.g004 Figure 4MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c. [score:1]
0062334.g007 Figure 7 LY2 cells were plated in a 6-well plate (3000 cells/well), transfected with negative control, pre-miR-200b, or pre-miR-200c for 24 h. Cells were wounded by scratching using a p200 pipette tip at time zero (0 h). [score:1]
Our results are in agreement with these data and indicate that LY2 cells assume a more epithelial-like morphology with miR-200b or miR-200c transfection. [score:1]
LY2 cells were either non -transfected (A), or transfected with control Pre-miR miRNA negative control #1 (Ambion) (B), pre-miR-200b (C), or pre-miR-200c (D) for 72 h. Images of LY2 cells captured using a light microscope (20× magnification, bar = 200 µm). [score:1]
MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c and RNA was harvested 1 or 5 d after transfection. [score:1]
Our results reveal novel roles for miR-200b and miR-200c in conferring antiestrogen sensitivity to endocrine-resistant breast cancer cells (summarized in Fig. 9). [score:1]
LY2 cells were transfected either with pre-miR-200a, pre-miR-200b or pre-miR-200c. [score:1]
LY2 cells were transfected with negative control, pre-miR-200a, pre-miR-200b, or pre-miR-200c. [score:1]
The decrease in miR-200b and miR-200c also results in increased N-cadherin, vimentin, and Slug, hallmarks of the mesenchymal phenotype. [score:1]
Figure S7 LY2 cells were transfected with control Pre-miR miRNA negative control #1 (Ambion), pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. A–D. [score:1]
The appearance of LY2 cells changed from an elongated/fibroblastic-appearance to a more epithelial or ‘cobble-stone’ shaped appearance with miR-200b and miR-200c transfection (Fig. 5C and D). [score:1]
LY2 cells were plated in a 6-well plate (3000 cells/well), transfected with negative control, pre-miR-200b, or pre-miR-200c for 24 h. Cells were wounded by scratching using a p200 pipette tip at time zero (0 h). [score:1]
Mo del of function of miR-200 family members in endocrine resistance in breast cancer cells. [score:1]
These studies reflect cell context-specific roles for miR-200 family members that require further study. [score:1]
A role for miR-200 family in drug resistance, i. e., paclitaxel, was reported in ovarian cancer [54]. [score:1]
A, LY2 cells were either untransfected (No TF) or transfected with negative control (Neg control) or pre-miR-200a, miR-200b or miR-200c. [score:1]
LY2 cells were plated in six-well plates in phenol red-free IMEM +5% DCC-FBS for 24 h. Cells were transfected with a negative control or with pre-miR-200b or pre-miR-200c (see above) for 24 h. Cells were wounded by scratching with a p200 pipette tip and then washed with medium to remove displaced cells. [score:1]
Taken together, these results indicate that reduction of miR-200b and miR-200c contributes to the increase in ZEB1, N-cadherin, vimentin, and Slug and the reduction in E-cadherin in LY2 cells. [score:1]
A, CT values for miR-200b and miR-200c in the cells transfected as indicated for 1 or 5 d. Values are the mean ± SEM of 3 determinations. [score:1]
0062334.g006 Figure 6(A–C) LY2 cells were not transfected (Non-TF), Mock -transfected (RNAiMAX), or transfected with negative control, pre-miR-200b, or pre-miR-200c for 24 h before preparing RNA or WCE for subsequent analysis. [score:1]
Our results indicate a role for loss of miR-200 family members and increased ZEB1 in conferring resistance to antiestrogens in breast cancer. [score:1]
[1 to 20 of 138 sentences]
2
[+] score: 408
Other miRNAs from this paper: hsa-mir-139, hsa-mir-141, hsa-mir-200c, hsa-mir-200a, hsa-mir-429
In line with this observation, we found that the expression levels of the miR-200 family in a panel of HCC cell lines showed an opposite trend with the E-cadherin expression, and transient overexpression of miR-200a, miR-200b, and miR-200c precursors were all able to suppress the ZEB1/2 expression. [score:11]
These suppressive effects were significantly reduced in the miR-200a overexpressing cells or upon mutation of the miR-200b subfamily binding sequence, thus confirming the specificity of the miR-200b subfamily in regulating RhoA and ROCK2 expression (Figure 3a and 3b). [score:9]
In line with this observation, the endogenous expression of RhoA and ROCK2 mRNA was significantly inhibited in miR-200b- and miR-200c-stably overexpressing BEL7402 cells when compared to the empty vector and miR-200a-stably overexpressing controls (Figure 3c and 3d). [score:8]
Consistent with our findings, down-regulation of miR-200 family has been previously observed in HCC miRNA profiling and miR-200 expression studies reported by others [18- 20], suggesting that loss of miR-200 expression is a frequent event in liver carcinogenesis. [score:8]
Furthermore, we employed locked nucleic acid (LNA) miRNA inhibitors to specifically inhibit the expression of the miR-200 family members. [score:7]
Surprisingly, we found that although miR-200a, miR-200b and miR-200c all attenuated ZEB1/2 expression in HCC cells, only stable overexpression of miR-200b and miR-200c remarkably suppressed HCC cell migration. [score:7]
Since miR-200b subfamily was frequently down-regulated in human HCC samples and negatively regulated HCC cell proliferation and migration in in vitro experiments, we sought to investigate whether overexpression of miR-200b is sufficient to suppress in vivo tumorigenicity and extrahepatic metastasis in mouse mo del. [score:7]
Overexpression of miR-200b and miR-200c moderately suppressed HCC cell proliferation and colony formation, and drastically attenuated cell migration; all these effects were not seen in miR-200a overexpressing cells. [score:7]
We performed quantitative RT-PCR (qRT-PCR) to validate the expression of miR-200 family members in an expanded HCC cohort (n = 64) and found that, consistent to our miRNA profiling data, miR-200a, miR-200b, and miR-200c were all significantly down-regulated in primary HCC samples (Figure 1b, P < 0.001). [score:6]
Among all, two major components of the cytoskeletal regulatory pathway, RhoA and ROCK2, were suggested as specific targets of the miR-200b subfamily by different miRNA target prediction algorithms (Supplementary Figure 6). [score:6]
Indeed, down-regulation (> 2-fold) of all the miR-200 family members was detected in approximately 80% of primary HCC cases, suggesting that loss of miR-200 expression was a common event in human HCCs (Figure 1c). [score:6]
Consistently, inactivation of miR-200b and miR-200c resulted in up-regulation of endogenous RhoA and ROCK2 protein expression in immortalized hepatocyte cell line, MIHA (Figure 3f). [score:6]
The above findings thus confirmed that miR-200b subfamily specifically targeted RhoA and ROCK2 3′UTRs and negatively regulated their expression at both mRNA and protein levels. [score:6]
We found that the empty vector and miR-200a overexpressing cells were readily seeded onto the uncoated glass surface, exhibited an extended cell morphology and started to migrate within 12 hours, whereas miR-200b and miR-200c overexpressing cells failed to seed on the uncoated glass surface till the end of the experiment (Figure 5b and Supplementary Videos). [score:5]
As expected, overexpression of miR-200b resulted in a modest inhibition of HCC cell growth in hepatic microenvironment. [score:5]
By comparing the expression of miR-200 in a pair of HCC cell lines derived from the primary tumor and its portal vein metastasis of the same patient, we noted that the miR-200 family members were significantly down-regulated in the metastatic cell line (H2M) when compared to its non-metastatic counterpart (H2P), suggesting that loss of miR-200 family might play a role in HCC metastasis (Supplementary Figure 2). [score:5]
s showed that overexpression of miR-200b or miR-200c precursors significantly suppressed the luciferase signals of RhoA- and ROCK2- 3′UTR fusion reporters. [score:5]
The successful overexpression and post-translational gene regulatory activity of miR-200 family members in the stably infected cells were confirmed by qRT-PCR and luciferase reporter assays. [score:5]
In addition, miRNA specific sensors containing the complementary sequences to individual mature miR-200 family members were also cloned into the same vector and served as positive control for accessing the post-translational gene repression activity of ectopically expressed miR-200 family members. [score:5]
Overexpression of miR-200b and miR-200c modestly suppressed HCC cell proliferation. [score:5]
To interrogate the expression of miR-200 family members in human HCCs, we retrieved the data from our previous miRNA expression profiling of 20 pairs of primary HCCs and their corresponding non-tumorous livers [4]. [score:5]
Overexpression of miR-200b significantly suppressed the size of orthotopic tumors formed in nude mice. [score:5]
Overexpression of the miR-200b subfamily significantly suppressed Rho/ROCK mediated cytoskeletal reorganization, as evidenced by the loss of stress fiber and focal adhesion formations, and induced a dramatic cell morphological change. [score:5]
The miR-200b and miR-200c overexpressing cells exhibited a rounded morphology, in contrast to a flat and extended morphology of the empty vector and miR-200a overexpressing cells (Figure 5a lower panel). [score:5]
Overexpression of miR-200b and miR-200c significantly inhibited the luciferase activity associated with the wild-type 3′UTRs of RhoA and ROCK2. [score:5]
After 4 weeks of implantation, the size of tumors formed by the miR-200b- overexpressing cells was significantly smaller that than of the vector controls (Figure 6a), although the rate of tumor formation was comparable between these two groups (75% [12/16] in vector control group versus 65% [11/17] in the miR-200b -overexpressing group). [score:5]
The distinct function of miR-200a and miR-200b subfamilies on HCC cell growth and migration implied that miR-200b subfamily exerted its tumor suppressive functions via a mechanism beyond the inhibition of ZEB1/2 mediated EMT. [score:5]
Computer-aided cell migration tracking revealed that the cell migratory ability was modestly impaired in miR-200a overexpressing cells when compared to the empty control, but was drastically abolished in miR-200b and miR-200c overexpressing cells (Figure 5c). [score:4]
Loss of miR-200 family results in up-regulation of ZEB1 and ZEB2 and consequently leads to transcriptional repression of E-cadherin to facilitate EMT [5- 7]. [score:4]
Both down- and up-regulations of miR-200 family have previously been reported [10- 14]. [score:4]
The identification of RhoA and ROCK2 as the miR-200b subfamily specific targets highlighted the novel function of the miR-200b subfamily in regulating cytoskeletal organization. [score:4]
We found that the formations of stress fibers (stained by Phallodin) and focal adhesions (stained by anti-paxillin antibody) were profoundly impeded in miR-200b- and miR-200c -overexpressing cells as compared to the empty vector and miR-200a -overexpressing controls (Figure 4a and 4b). [score:4]
As illustrated by the heat map diagram, all five members of miR-200 family were profoundly down-regulated in human HCCs, suggesting that loss of miR-200 family might play a role in liver carcinogenesis (Figure 1a). [score:4]
These miR-200 family members negatively regulate the expression of transcription repressors ZEB1 and ZEB2. [score:4]
In summary, the work present here revealed that all the miR-200 family members were frequently down-regulated in human HCC. [score:4]
When seeded onto uncoated glass surfaces, miR-200b- and miR-200c -overexpressing cells exhibited a rounded morphology as compared to the flat and extended morphology of miR-200a -overexpressing cells and empty vector controls. [score:4]
In a pathway analysis, we found that down-stream targets of the miR-200b subfamily were specifically enriched in cytoskeleton proteins and participated in regulating small GTPase -mediated signal transduction. [score:4]
These findings collectively demonstrated the effects of the miR-200b subfamily in regulating Rho/ROCK -mediated cell cytoskeletal reorganization and provided a mechanistic explanation to the specific tumor suppressive functions of the miR-200b subfamily in HCC. [score:4]
Frequent down-regulation of miR-200 family in human HCCs. [score:4]
Second, both miR-200a and miR-200b subfamilies share the negative regulatory function on ZEB1/2 but only miR-200b subfamily suppressed HCC growth and migration, which implies that mechanisms in addition to the well-characterized miR-200s/ZEB1/2/E-cadherin axis may be involved to empower tumor suppressive functions specific to the miR-200b subfamily in HCC. [score:4]
MiR-200a, miR-200b and miR-200c genes were amplified from the genomic DNA of MIHA cells and sub-cloned into a lenti-viral based miRNA expression vector, pCDH-CMV-MSC-EF1-copGFP/Puro (System Biosciences) utilizing the EcoRI and NotI restriction sites. [score:3]
To further investigate the functions of miR-200 family in human HCC, miR-200a, miR-200b, and miR-200c were subcloned into a lenti-viral based expression vector (Supplementary Figure 4a) and stably overexpressed in HCC cell lines, BEL7402 and SMMC-7721. [score:3]
In silico analyses have revealed that the down-stream targets of miR-200a and miR-200b subfamilies are largely non-overlapping with each other. [score:3]
The data obtained from this in vivo orthotopic implantation mo del echoed the findings of our in vitro studies and together provided strong evidence to support the tumor suppressive functions of miR-200b subfamily in human HCC. [score:3]
In fact, we observed that the expression levels of mature miR-200a and miR-200b, both from the 1p36 cluster, significant correlated with each other in both non-tumorous livers and primary HCCs (R [2] = 0.691 and 0.603, respectively, P < 0.001, linear regression). [score:3]
Figure 2(a) Proliferation rate of miR-200 stably overexpressing cells. [score:3]
Overexpression of miR-200b and miR-200c, but not miR-200a, resulted in a moderate but significant reduction on cell proliferation and also impeded anchorage independent growth on soft agar (Figure 2a and 2b). [score:3]
MiR-200b subfamily negatively regulated RhoA and ROCK2 expression. [score:3]
Aberrant expression of either miR-200 family or ZEB1/2 will therefore feed-forward to disrupt the equilibrium and result in epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) [8, 9]. [score:3]
Finally, we employed an orthotopic implantation mo del to further demonstrate the functions of miR-200b in suppressing HCC tumorigenicity and metastasis in vivo. [score:3]
Among the candidate down-stream targets, we hypothesized that Rho -family small GTPase RhoA and its down-stream effector ROCK2 might be important for the miR-200b subfamily specific functions in HCC. [score:3]
MiR-200 family miRNA precursors and LNA inhibitors. [score:3]
12p13 cluster), whereas, at the functional level, the miR-200 family members are categorized into two other groups based on the sequence homology hence two distinct groups of targets involved (miR-200b subfamily and miR-200a subfamily) (Supplementary Figure 1a) [5, 6]. [score:3]
Stable overexpression of miR-200b and miR-200c profoundly abolished the stress-fiber and focal adhesion formation and induced morphological change in BEL7402 cells. [score:3]
For miR-200 overexpression, the cells were transfected with 30 ηM of designated miRNA precursors or pre-miR negative control 1 (Applied Biosystems) using X-tremeGENE siRNA transfection reagent (Roche). [score:3]
The candidature of RhoA and ROCK2 as miR-200b subfamily specific targets was further evaluated by TargetScan5 (http://www. [score:3]
Therefore, as proof-of-concept, miR-200a, miR-200b, and miR-200c were selected to represent each subgroup for expression and functional studies (Supplementary Figure 1b). [score:3]
This observation was reproducible by transiently overexpressing the miR-200 precursors in the same cell lines, thus ruling out the possibility of experimental artifacts that might be introduced by the lenti-viral vector or stable infection (Supplementary Figure 5). [score:3]
Gene ontology (GO) analysis further revealed that the down-stream targets of miR-200a and miR-200b subfamilies were enriched in different GO terms (Supplementary Table 1). [score:3]
These findings coherently echoed with our in vitro findings and together confirmed the tumor suppressive functions of miR-200b subfamily in HCC. [score:3]
Unsupervised clustering analysis revealed a profound differential expression of the miR-200 family members in primary HCCs. [score:3]
Interestingly, we found that only the miR-200b subfamily members exerted tumor suppressive functions in HCC cells. [score:3]
Only the miR-200b subfamily but not its closely related miR-200a subfamily possessed tumor suppressor functions in HCC. [score:3]
Wild-type and mutated miR-200b subfamily targeting sites on RhoA (132-153 nt. ) [score:3]
A delayed cell-substratum attachment was observed in miR-200b- and miR-200c -overexpressing cells. [score:3]
Interestingly, we noted that the down-stream targets of the miR-200b subfamily were significantly enriched in cytoskeleton genes and participated in small GTPase mediated signal transduction (P = 1.15 × 10 [−5] and 4.30 × 10 [−3], respectively). [score:3]
In this study, we demonstrated that all five members of miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were frequently down-regulated in human HCCs as compared to their corresponding non-tumorous livers. [score:3]
Figure 6(a) Vector control and miR-200b stably overexpressing, luciferase -labelled MHCC97L cells were orthotopically implanted into the livers of the nude mice. [score:3]
Overexpression of miR-200b dramatically abolished the incidence and severity of lung metastasis in this in vivo orthotopic implantation mo del. [score:3]
Altogether, these findings suggested that the miR-200a and miR-200b subfamilies acted differentially, with the miR-200b subfamily members specifically functioning as tumor suppressors in HCC. [score:3]
Moreover, the number of metastasized cells, as quantified by the bioluminescence, was also significantly reduced upon overexpression of miR-200b (Figure 6b). [score:3]
Our findings have demonstrated the functional discrepancy of miR-200 family members and provided a mechanistic explanation toward the miR-200b specific tumor suppressive function in HCC. [score:3]
Figure 1(a) Expression of the miR-200 family members in 20 pairs of primary HCCs and their corresponding non-tumorous livers. [score:3]
Both the size and number of colonies formed were significantly reduced in miR-200b- and miR-200c -overexpressing cells. [score:3]
Importantly, lung metastasis, as evidenced by ex-vivo bioluminescent imaging and histopathological analysis, was drastically reduced in miR-200b -overexpressing group. [score:3]
Importantly, the formation of lung metastasis was drastically abolished upon miR-200b overexpression. [score:3]
Figure 5(a) Cell morphology of miR-200 stably overexpressing BEL7402 cells was observed under phase-contrast microscope (20×) and scanning electron microscope (2500×). [score:3]
In the present study, using luciferase reporter assay, qRT-PCR, and Western blotting, we confirmed that the miR-200b sub -family interacted with RhoA and ROCK2 3′UTR and negatively regulated RhoA and ROCK2 expression at both mRNA and protein levels. [score:3]
The loss of stress fiber and focal adhesion complex resulted in dramatic morphological change of the miR-200b and miR-200c overexpressing cells (Figure 4), and the morphological change could be more clearly visualized under the scanning electron microscope (SEM) (Figure 5a). [score:3]
However, knowledge regarding the expression and functional implications of miR-200 family in human HCC is awaited for detailed elucidation. [score:3]
Figure 4(a) Stress-fibers (filaments across the cytosol) in miR-200 stably overexpressing BEL7402 cells were visualized by TRITC-Phalloidin staining. [score:3]
GFP maker was used to indicate the stable infection of miR-200 expression vectors. [score:3]
We further demonstrated by live cell imaging that inactivation of Rho/ROCK signaling, through miR-200b subfamily overexpression, attenuated cell-substratum adhesion and consequently hampered cell migration. [score:3]
We therefore hypothesized that such morphological change reflected a loss of cell-substratum attachment ability and consequently hampered the cell motility of the miR-200b subfamily overexpressing cells. [score:3]
We reasoned that, at the expression level, the miR-200 family can be categorized into two groups based on the chromosomal locations in which two different up-stream promoters are involved (Ch. [score:3]
Figure 3 expression(a) and (b)s. Wild-type and mutated RhoA or ROCK2 3′UTR were co -transfected with miR-200 precursors into BEL7402 cells. [score:3]
Lung metastasis was detected in only 27% (3/11) of the tumor bearing mice in the miR-200b overexpressing group, whereas, in the control group, 67% (8/12) of the tumor bearing mice developed lung metastasis. [score:3]
For miR-200 inactivation, cells were transfected with 50 ηM designed miRCURY LNA™ miRNA Inhibitor or LNA control (Exiqon). [score:3]
In this experiment, miR-200b and empty vector control were stably infected into luciferase labeled MHCC97L cells, which had a low miR-200b expression and exhibited frequent lung metastasis when orthotopically implanted into the livers of nude mice [17]. [score:3]
The homeostatic expression between miR-200 family and ZEB1/2 is critical for maintaining the stability of epithelial or mesenchymal phenotype of cells. [score:3]
Nevertheless, the expression of the miR-200 family in human cancer remains contentious. [score:3]
MiR-200b subfamily suppressed Rho/ROCK mediated cytoskeletal reorganization and cell motility. [score:2]
To further investigate the down-stream targets and molecular pathways specifically regulated by miR-200b subfamily, in-silico analysis was performed by using the EIMMO miRNA prediction server [16]. [score:2]
Interestingly, ZEB1 and ZEB2 are also involved in the transcriptional repression of the miR-200 family, thus the miR-200 family and ZEB1/2 form a double -negative feedback loop to regulate each other. [score:2]
MiR-200b subfamily suppressed HCC cell growth and metastasis. [score:2]
These findings recapitulated the previous reports and supported the negative regulatory functions of miR-200 family in ZEB1/2 mediated EMT (Supplementary Figure 3). [score:2]
This phenotype was similar to the morphological change we observed in RhoA and ROCK2 knockdown cells (Supplementary Figures 7 and 8), strongly suggesting that this miR-200b -mediated effect was attributed to the inactivation of Rho/ROCK mediated cytoskeletal reorganization. [score:2]
MiR-200b subfamily suppressed stress-fiber and focal adhesion formation mediated by Rho/ROCK in HCC cells. [score:2]
Altogether, these findings have uncovered a novel function of miR-200b subfamily in regulating Rho/ROCK mediated cytoskeletal reorganization and cell motility. [score:2]
MiR-200b stably expressing cells were established from luciferase labelled MHCC97L cells [17]. [score:2]
MiR-200b suppressed HCC tumorigenicity and lung metastasis in mouse mo del. [score:2]
Since EMT is a crucial step in cancer metastasis, the miR-200 family members have been considered as metastasis-suppressive miRNAs. [score:2]
MiR-200 family has recently been identified as a major regulator of epithelial-mesenchymal transition (EMT). [score:1]
MiR-200 family members are conventionally divided into two groups based on their genome locations clustered at 1p36 (miR-200a, miR-200b and miR-429) and 13p12 (miR-200c and miR-141), respectively. [score:1]
First, although the miR-200 family members are generally considered as functionally redundant paralogs, the miR-200a and miR-200b subfamilies in fact have distinct functions in regulating HCC cell growth and migration. [score:1]
In this sense, the miR-200 family can be sub-divided into the functionally miR-200a subfamily (miR-200a and miR-141) and miR-200b subfamily (miR-200b, miR-200c and miR-429). [score:1]
MiR-200b subfamily negatively regulated RhoA and ROCK2. [score:1]
With these miR-200s stably overexpressing cells, we then investigated the effects of miR-200 family in HCC cell growth. [score:1]
MiR-200 family consists of five evolutionarily conserved members located in two separate clusters in the human genome, with miR-200b, miR-200a, and miR-429 mapped to chromosome 1p36 (thereafter, referred as 1p36 cluster), and miR-200c and miR-141 mapped to chromosome 12p13 (henceforth, indicated as 12p13 cluster). [score:1]
MiR-200 family can also be sub-divided into two subfamilies according to their seed sequence homology, with miR-200a and miR-141 as a group (hereafter, denoted as miR-200a subfamily) and miR-200b, miR-200c, and miR-429 as another group (henceforward, named as miR-200b subfamily) (Supplementary Figure 1a) [5, 6]. [score:1]
To experimentally validate these in-silico prediction results, 3′UTRs of RhoA and ROCK2 were cloned into a luciferase reporter construct and co -transfected with miR-200 precursors in BEL7402. [score:1]
The identification of RhoA and ROCK2 as the miR-200b subfamily targets prompted us to further investigate the roles miR-200b subfamily in HCC cytoskeletal reorganization. [score:1]
15 ηM of each miR-200 precursors was first individually transfected into HCC cells using X-tremeGene. [score:1]
Also, the miR-200 family may play different roles in different cancers depending on their specific cellular contexts [15]. [score:1]
Among the 33,410 mRNA transcripts included in this analysis, 871 and 1488 mRNAs were predicted to harbor evolutionarily conserved binding site(s) of miR-200a and miR-200b subfamilies, respectively. [score:1]
Whether functional cross-talks exist between miR-200 subfamilies in both normal cells and during pathological conditions is an interesting question worthy to be further explored. [score:1]
Effects of the miR-200 family on HCC cell growth and migration. [score:1]
The miR-200b subfamily induced morphological change, attenuated cell-substratum adhesion and impeded cell migration in HCC cells. [score:1]
In this regard, immunofluorescence staining was performed to visualize the effects of miR-200 family on Rho/ROCK mediated stress fiber and focal adhesion formations. [score:1]
[1 to 20 of 119 sentences]
3
[+] score: 400
Moreover, the effects of upregulation (or downregulation) of miR-200b on E-cadherin expression are partially rescued by upregulation (or downregulation) of Suz-12. [score:15]
Also, overexpression of Suz-12 could rescue the increased mRNA and protein expression of E-cadherin in CSCs from SPC-A1/DTX cells induced by miR-200b upregulation, while silencing of Suz-12 could rescue the decreased mRNA and protein expression of E-cadherin in CSCs from SPC-A1/DTX cells induced by miR-200b downregulation (Fig. 6D and E ). [score:13]
As shown in Figure 2B, the relative expression level of miR-200b was significantly upregulated in docetaxel-resistant LAD cells stably transfected with pcDNA/miR-200b, while its relative expression level was significantly downregulated in those cells transiently transfected with anti-miR-200b. [score:11]
Enforced miR-200b expression mediates the upregulation of E-cadherin by directly inhibiting its targets such as ZEB1, ZEB2 and Suz-12. [score:11]
Thus, overexpression of Suz-12 could reverse the effects of miR-200b upregulation on the regulation of CSCs, suggesting that Suz-12 was a functional target of miR-200b in the regulation of CSCs from the docetaxel-resistant LAD cells. [score:10]
Third, Suz-12 is upregulated while miR-200b and E-cadherin are downregulated in CSCs, and CSCs differentiate back into docetaxel-resistant LAD cells which result in the repression of Suz-12 and upregulation of miR-200b and E-cadherin. [score:10]
Importantly, HDAC1 is up-regulated in CSCs and downregulation of HDAC1 can significantly increase the level of miR-200b expression in CSCs. [score:9]
HDAC1 suppression -mediated miR-200b expression inhibits CSCs growth and reverses chemoresistance of CSCs by regulating Suz12/E-cadherin signaling. [score:8]
Actually, HDAC1 may not the specific HDACs accounting for histone modifications at the promoter region of Suz-12 and HDAC1 decreases Suz-12 expression by upregulating the certain miRNAs including miR-200b which then target at the 3′-UTR of Suz-12 mRNA. [score:8]
Also, our data showed that Suz-12 was down-regulated while E-cadherin and miR-200b were up-regulated in HDAC1-shRNA and miR-200b -expression groups compared with those in the corresponding control groups (Figure 9C and E ). [score:8]
Upregulation of miR-200b led to the decreased expression of Suz-12 in CSCs of SPC-A1/DTX and H1299/DTX cells, while silencing of miR-200b led to the increased expression of Suz-12 in those CSCs (Figure 3C and D ). [score:8]
As shown in figure 8E, repression of HDAC1 significantly reduced Suz-12 expression and increased E-cadherin expression while the effects were partially abrogated by miR-200b inhibition. [score:7]
Fifth, enforced miR-200b expression significantly decreases Suz-12 expression and increases E-cadherin expression, while miR-200b repression has opposite effects. [score:7]
48h after transfection, Western botting assay was performed to detect the expression of Suz-12 protein, and we showed that pcDNA/Suz-12 could reverse the decreased expression of Suz-12 in CSCs from the SPC-A1/DTX cells induced by miR-200b upregulation (Figure 5A ). [score:7]
These results suggested that miR-200b regulated CSCs via downregulation of E-cadherin, at least partially by targeting Suz-12. [score:7]
Previously, miR-200b has been reported to acts as a tumor suppressor that blocks CSC formation by inhibiting the PRC2 polycomb complex, and hence preventing the repression of E-cadherin and other critical target genes. [score:7]
HDAC1 repression -mediated miR-200b expression inhibits CSCs formation and reverses chemoresistance of CSCs by regulating Suz-12/E-cadherin. [score:6]
The miR-200 families target the multiple sites in the 3′UTRs of ZEB1 and ZEB2, which then regulate expression of E-cadherin [30], [32]. [score:6]
Taken together, HDAC1 repression -mediated overexpression of miR-200b inhibits maintenance of CSCs and reverses chemoresistance of CSCs both in vitro and in vivo by regulating Suz-12/E-cadherin signaling. [score:6]
Flow cytometry assay showed that upregulation of miR-200b significantly decreased the percentage of CD133 [+]/CD326 [+] CSCs growth in the docetaxel-resistant LAD cells and downregulation of miR-200b had the opposite effect (Figure 2C ). [score:6]
Previously, we have shown that upregulation of miR-200b can reverse chemoresistance of the docetaxel-resistant LAD cells by inhibiting cell growth, inducing cell cycle arrest and enhancing apoptosis. [score:6]
Meanwhile, overexpression of Suz-12 could not only reverse the decreased percentage of CD133 [+]/CD326 [+] CSCs growth and mammosphere forming ability, but also reverse the decreased growth capacity and IC [50] value of docetaxel in the CSCs from the SPC-A1/DTX cells induced by miR-200b upregulation (Figure 5B-E ). [score:6]
Suz-12 is upregulated in CSCs and identified as a functional target of miR-200b. [score:6]
HDAC1 repression or miR-200b upregulation reduces tumorigenicity and reverses chemoresistance of CSCs in vivo To explore the effects of HDAC1/miR-200b expression on CSCs in vivo, approximately 1.0×10 [3] CSCs from SPC-A1/DTX cells stably transfected with pSil/HDAC1-shRNA, pcDNA/miR-200b or their corresponding control vectors, were subcutaneously transplanted into nude mice. [score:6]
Both overexpression of miR-200b and silencing of Suz-12 induced the increased mRNA or protein expression of E-cadherin in CSCs, while silencing of miR-200b showed the opposite effects (Figure 6A, B and C ). [score:5]
Taken together, HDAC1 might be an important regulator of promoter activities of miR-200b by upregulating the histone H3-acetylation level at miR-200b promoters through the Sp1 -dependent pathway. [score:5]
Additionally, the effects of overexpressed miR-200b on CSCs self-renewal and growth could be partially rescued by Suz-12 overexpression. [score:5]
MiR-200b, an important member of miR-200 families, is located at miR-200b/c/429 gene cluster, acts as a tumor suppressor in a variety of human solid tumors and has the capability of inhibiting CSCs growth and reversing the EMT phenotype of CSCs [17], [18]. [score:5]
Overexpressed Suz-12 rescues the effects of enforced miR-200b expression on CSCs growth and chemoresistance. [score:5]
MiR-200b expression plasmid (pcDNA/miR-200b), the mock pcDNA -negative control (pcDNA/miR-NC), miR-200b inhibitor (Anti-miR-200b) and nonspecific miRNA control (Anti-miR-NC) were used as our previous described [18]. [score:5]
Also, we identify HDAC1 as a specific regulator involved in silencing of miR-200b through a Sp1 -dependent mechanism, and restoration of miR-200b mediated by HDAC1 repression significantly suppresses maintenance of CSCs and reverses chemoresistance of CSCs by regulating Suz-12-E-cadherin signaling. [score:5]
HDAC1 repression enhances miR-200b promoter activities and up-regulates the histone H3-acetylation level at the promoters through the Sp1 -dependent pathway. [score:4]
HDAC1 repression or miR-200b upregulation reduces tumorigenicity and reverses chemoresistance of CSCs in vivo. [score:4]
Next, we further revealed how miR-200b involved in regulation of E-cadherin by targeting Suz-12. [score:4]
These results suggested that Suz-12 might be a direct target of miR-200b in the CSCs derived from the docetaxel-resistant LAD cells. [score:4]
Moreover, downregulation of HDAC1 significantly enhanced promoter activities of miR-200b in CSCs through a Sp1 -dependent pathway (Figure 7C ). [score:4]
In previous report, we have shown that upregulation of HDAC1 is one of the specific mechanisms responsible for miR-200b repression in the docetaxel-resistant LAD cells. [score:4]
Figure S1 Suz-12 is inversely correlated with miR-200b, positively correlated with HDAC1 and up-regulated in docetaxel-insensitive human LAD tissues. [score:4]
HDAC1 repression enhances promoter activities of miR-200b by upregulating the histone H3-acetylation level at miR-200b promoters through a Sp1 -dependent pathway. [score:4]
Also, HDAC1 repression up-regulates the histone H3-acetylation level at the miR-200b promoters through the Sp1 -dependent pathway. [score:4]
To further confirm that Suz-12 was a functional target of miR-200b in the regulation of CSCs, pcDNA/Suz-12 or pcDNA/control was transfected into CSCs (SPC-A1/DTX) stably transfected with pcDNA/miR-200b or pcDNA/miR-NC. [score:4]
Therefore, we will determine whether downregulation of miR-200b promotes CSCs from docetaxel-resistant LAD cells through EMT induction. [score:4]
Importantly, differentiation of CSCs into docetaxel-resistant LAD cells resulted in the repression of Suz12 and upregulation of miR-200b and E-cadherin (Figure 6F, G 1 and G2). [score:4]
Suz-12, up-regulated in docetaxel-insensitive LAD tissues, is inversely correlated with miR-200b and positively correlated with HDAC1. [score:4]
MiR-200b inhibits CSCs by regulating Suz-12/E-cadherin signaling. [score:3]
Then, the ChIP-derived DNA immunoprecipitated from anti-acetyl-Histone H3 antibody was amplified with the primers that were designed to amplify the sequences containing the Sp1 binding sites at the promoters of miR-200b, which indicated that silencing of HDAC1 could upregulate the histone H3-acetylation level at the miR-200b promoters through the Sp1 -dependent pathway (Figure 7F ). [score:3]
However, whether miR-200b can target Suz-12 in the CSCs derived from the docetaxel-resistant LAD cells is unclear. [score:3]
Next, we focus on whether HDAC1 repression -mediated miR-200b expression has effects on CSCs formation and chemoresistance. [score:3]
In this study, we first show that miR-200b functions as a tumor suppressor both in vitro and in vivo in CSCs that are originated from human docetaxel-resistant LAD cells. [score:3]
In CSCs generated from transformed breast epithelial cells (MCF-10A), Suz-12 has been confirmed as a target gene of miR-200b. [score:3]
First, we analyzed the effects of miR-200b and Suz-12 on the protein expression of E-cadherin. [score:3]
Here, we showed that re -expression of miR-200b could reduce CSCs growth and reverse chemoresistance of CSCs both in vitro and in vivo. [score:3]
Fourth, enforced miR-200b expression significantly represses CSCs self-renewal, tumorigenicity and growth. [score:3]
Previously, Suz-12 has been confirmed as a perfectly homologous and highly conserved target gene of miR-200b in CSCs from transformed breast epithelial cells (MCF-10A). [score:3]
0109578.g009 Figure 9HDAC1 repression or miR-200b overexpression reduces tumorigenicity and reverses chemoresistance of CSCs in vivo. [score:3]
Identification of Suz-12 as a functional target of miR-200b in CSCs. [score:3]
Intriguingly, the effects of HDAC1 repression on CSCs growth and chemoresistance were partially abrogated by miR-200b inhibition (Figure 8A–D ). [score:3]
Then, we analyzed the effects of miR-200b on the expression of Suz-12 in CSCs. [score:3]
To the best of our knowledge, there have been no reports about HDAC1/miR-200b/Suz-12/E-cadherin regulatory network in regulating CSCs maintenance and chemoresistance in human LAD cells and the current work will provide a novel strategy for reversing chemoresistance of human LAD. [score:3]
HDAC1 repression or miR-200b overexpression reduces tumorigenicity and reverses chemoresistance of CSCs in vivo. [score:3]
Finally, ectopic miR-200b expression decreases Suz-12 binding and H3K27Me3 at the E-cadherin promoter in CSCs in vivo. [score:3]
To explore the effects of HDAC1/miR-200b expression on CSCs in vivo, approximately 1.0×10 [3] CSCs from SPC-A1/DTX cells stably transfected with pSil/HDAC1-shRNA, pcDNA/miR-200b or their corresponding control vectors, were subcutaneously transplanted into nude mice. [score:3]
Herein, Suz-12 is also identified as a functional target of miR-200b in the CSCs derived from the docetaxel-resistant LAD cells. [score:3]
Then, we further analyzed the effects of HDAC1 and miR-200b on in vivo chemoresistance of docetaxel-resistant LAD cells, and showed that H1299/DTX cells stably transfected with HDAC1-shRNA or pcDNA/miR-200b grew significantly more slowly than those stably transfected with the corresponding control groups while combined with DTX treatment, which indicated that silencing of HDAC1 or overexpression of miR-200b could significantly increase the in vivo chemosensitivity of CSCs to DTX (Figure 9B ). [score:3]
Furthermore, qRT-PCR assay indicated that silencing of HDAC1 significantly elevated the expression level of miR-200b in CSCs partially in the Sp1 -dependent manner (Figure 7G ). [score:2]
Recently, we have identified miR-200b as a key regulator of chemoresistance and restoration of miR-200b significantly reverses chemoresistance of docetaxel (DTX)-resistant LAD cells by inducing cell cycle arrest and apoptosis enhancement [19]. [score:2]
Taken together, the novel HDAC1/miR-200b/Suz-12/E-cadherin pathway may play essential roles in regulating maintenance, tumorigenicity and chemoresistance of CSCs in human LAD. [score:2]
To obtain further direct evidence that Suz-12 was a target of miR-200b, we investigated the binding site of miR-200b in the 3′-UTR sequence of Suz-12 mRNA. [score:2]
MiR-200b inhibits CSCs formation and reverses chemoresistance of CSCs. [score:2]
Then, we performed qRT-PCR assay to detect the expression of miR-200b in CSCs and the corresponding docetaxel-resistant LAD cells, and showed that the relative level of miR-200b in CSCs was lower than that in the docetaxel-resistant LAD cells (Figure 2A ). [score:2]
However, whether miR-200b regulates CSCs derived from docetaxel-resistant LAD cells is still poorly understood and needs to be further elucidated. [score:2]
Thus, silencing of Suz-12 could mimic the effects of miR-200b on CSCs growth and chemoresistance, suggesting that Suz-12 was engaged in the regulation of CSCs induced by miR-200b. [score:2]
However, whether HDAC1 mediates epigenetic regulation of miR-200b in CSCs remains unknown. [score:2]
To investigate the effect of miR-200b expression or HDAC1 repression on in vivo regulation of LAD cells, 3.0×10 [6] H1299/DTX cells stably transfected with sh-control, sh-HDAC1, miR-NC or miR-200b vectors, were subcutaneously transplanted into the right side of the posterior flank of nude mice. [score:2]
Thus, the HDAC1/miR-200b/Suz-12-E-cadherin signaling might be responsible for regulating growth and chemoresistance of CSCs derived from the docetaxel-resistant LAD cells. [score:2]
These results further indicated that dysregulation of HDAC1/miR-200b/Suz-12 pathway is correlated with responses of LAD patients to docetaxel -based chemotherapy. [score:2]
Previously, we have reported that HDAC1/4 is the specific regulator responsible for silencing of miR-200b in the docetaxel-resistant LAD cells. [score:2]
Increasing evidence has shown that miR200b/Suz-12/E-cadherin pathway is involved in the regulation of CSCs maintenance, tumorigenicity and chemoresistance. [score:2]
MiR-200b inhibits CSCs growth and reverses chemoresistance of CSCs. [score:2]
To further understand the clinical significance of the present work, 49 cases of clinical LAD tissues were gathered from patients at advanced stage and divided into “sensitive” and “insensitive” groups basing on the responses to the docetaxel -based chemotherapy, and then qRT-PCR assay was used to detect the expression of HDAC1, miR-200b and Suz-12. [score:2]
These data suggested that dysregulation of HDAC1/miR-200b could promote CSCs growth and chemoresistance in vivo. [score:2]
Then, we further analyzed the effects of HDAC1 repression -mediated miR-200b on Suz-12/E-cadherin signaling in CSCs. [score:1]
Furthermore, the levels of Suz-12 was inversely correlated with miR-200b and positively correlated with HDAC1 while miR-200b was inversely correlated with HDAC1 in 49 LAD tissues as determined by linear regression analysis (Figure S1C-E). [score:1]
Furthermore, HDAC1 repression significantly reduces the CSCs growth and self-renewal and reverses chemoresistance of CSCs in a miR-200b -dependent manner. [score:1]
Meanwhile, restoration of miR-200b could lead to the decreased IC [50] value of DTX in CSCs from SPC-A1/DTX or H1299/DTX cells (Figure 2E ). [score:1]
Therefore, HDAC1 mediates miR-200b repression in CSCs through the Sp1 -dependent pathway. [score:1]
Also, the percentage of CD133 [+]/CD326 [+] CSCs was decreased in HDAC1-shRNA or pcDNA/miR-200b -transfected groups than that in the corresponding control groups (Figure 9D ). [score:1]
As shown in Figure 9A, transfection of CSCs with HDAC1-shRNA or pcDNA/miR-200b vector could obviously block tumor initiation in nude mice. [score:1]
Our previous work has shown that miR-200b repression is linked to the chemoresistance of the clinical LAD tissues [19]. [score:1]
Luciferase reporter containing wild type 3′-UTR of Suz-12(pLUC/Suz-12/3′-UTR-wt) in which the nucleotides of the Suz-12-3′-UTR complementary to miR-200b were inserted into the pLUC vector, and we also generated a mutant reporter (pLUC/Suz-12/3′-UTR-mut), in which the first six nucleotides in the miR-200b seed region complementary sites were mutated. [score:1]
Furthermore, our clinical data show that HDAC1 is inversely correlated with miR-200b and positively correlated with Suz-12 in clinical LAD tissues. [score:1]
The Suz-12 level was normalized to GAPDH RNA while miR-200b was normalized to U6 RNA. [score:1]
Luciferase activity in the pLUC/Suz-12/3′-UTR-wt -transfected cells co -transfected with pcDNA/miR-200b was significantly decreased than that in the pLUC/Suz-12/3′-UTR-mut -transfected cells co -transfected with pcDNA/miR-200b (Figure 3E ). [score:1]
To perform tumorigenicity in nude mice, CSCs from SPC-A1/DTX cells stably transfected with miR-200b, miR-NC, sh-control or sh-HDAC1#2 vectors were subcutaneously injected into the right flank of nude mice. [score:1]
0109578.g002 Figure 2(A) qRT-PCR detection of miR-200b in CSCs. [score:1]
Moreover, our data indicate that both HDAC1 and Sp1 can co-localize to the two promoters of the miR-200b in vivo. [score:1]
Although miR-200b repression has been a crucial issue in maintenance, tumorigenicity and chemoresistance of CSCs, the molecular mechanisms responsible for miR-200b repression in CSCs remain unclear and need to be further elucidated. [score:1]
MiR-200b has effects on CSCs by regulating Suz-12/E-cadherin. [score:1]
Therefore, the miR-200b/Suz-12/E-cadherin pathway is responsible for maintenance, tumorigenicity and chemoresistance of CSCs. [score:1]
These results indicated that miR-200b might play a critical role in CSCs growth and chemoresistance of human LAD. [score:1]
Approximately 2.0×10 [3]/well CSCs were seeded into 96-well plates and then cotransfected with the specific luciferase reporter plasmids, miR-NC or miR-200b. [score:1]
Furthermore, Suz-12 repression can phenocopy the effects of miR-200b on CSCs. [score:1]
Recent studies have reported that miR-200b has two functional promoters, located ∼4 kb and ∼2 kb upstream of the 5′-stemloop, respectively [21]. [score:1]
We constructed a luciferase reporter (pLUC/Suz-12/3′-UTR-wt) in which the nucleotides of the Suz-12-3′-UTR complementary to miR-200b were inserted into the pLUC vector, and we also generated a mutant reporter (pLUC/Suz-12/3′-UTR-mut), in which the first six nucleotides in the miR-200b seed region complementary sites were mutated. [score:1]
The HDAC1 level was normalized to GAPDH while miR-200b was normalized to U6 RNA. [score:1]
Recent studies have highlighted that miRNAs including miR-200b have been firmly linked with chemoresistance of CSCs in many types of human tumors [30], [31]. [score:1]
[1 to 20 of 106 sentences]
4
[+] score: 370
In the current study, we present several novel findings: (1) HDAC inhibitors restore the expression of miR-200b and reverse chemoresistance of docetaxel-resistant LAD cells, (2) HDAC1/4 levels are upregulated in docetaxel-resistant LAD cells compared with parental cells, and inhibition of HDAC1/4 significantly increases the level of miR-200b and upregulates histone H3-acetylation level at miR-200b promoters partially via a Sp1 -dependent pathway, (3) negative regulation of HDAC1/4 suppresses cell proliferation, promotes cell apoptosis, induces G2/M cell cycle arrest and ultimately reverses in vitro chemoresistance of docetaxel-resistant LAD cells partially in a miR-200b -dependent manner, (4) HDAC1/4 suppression -induced miR-200b expression contributes to the downregulation of E2F3, survivin and Aurora-A, and upregulation of cleaved-caspase-3, (5) downregulation of HDAC1/4 or upregulation of miR-200b reverses in vivo chemoresistance of docetaxel-resistant LAD cells, and (6) HDAC1/4, inversely correlated with miR-200b, is upregulated in docetaxel-insensitive LAD tissues compared with docetaxel-sensitive LAD tissues. [score:33]
Here, HDAC1 repression significantly decreased E2F3 expression, which might be largely because of the following: first, HDAC1 might reduce E2F3 expression by recruitment of the corepressor complex to the E2F3 promoter region; second, HDAC1 might not be the specific HDAC responsible for histone modifications at the promoter region of E2F3, and instead HDAC1 decreases E2F3 expression by upregulation of certain miRNAs including miR-200b, which then post-transcriptionally regulate the expression of E2F3 gene. [score:13]
In our study, we showed that both HDAC1 and HDAC4 repression significantly inhibited survivin expression by reducing the activity of the survivin promoter via downregulating E2F3 expression in a miR-200b -dependent manner and reducing the amount of E2F3 protein binding to this promoter. [score:10]
In the present work, we showed that downregulation of HDAC1/4 inhibited E2F3 expression, suppressed cell proliferation, promoted cell apoptosis, and induced G2/M cell cycle arrest partially through the miR-200b pathway. [score:10]
Interestingly, only HDAC4 but not HDAC1 repression could inhibit Aurora-A expression by reducing the activity of Aurora-A promoter via downregulating E2F3 expression in a miR-200b -dependent manner and thus reducing the amount of E2F3 protein binding to this promoter. [score:10]
Treatment of TSA and VPA significantly upregulated miR-200b expression, compared to no effects with 5-aza-dC, which indicated that histone acetylation might be the potential epigenetic mechanism responsible for downregulation of miR-200b levels in docetaxel-resistant LAD cells (Figure 1C, 1B). [score:8]
To examine the potential epigenetic mechanisms responsible for downregulation of miR-200b in docetaxel-resistant LAD cells, histone deacetylase inhibitors (Trichostatin A, TSA, and valproic acid, VPA) or DNA methyltransferase inhibitor (5-aza-2'-deoxycytidine, 5-aza-dC) were administered to H1299/DTX and SPC-A1/DTX cells. [score:8]
HDAC4 suppression significantly decreased the luciferase activity of the Aurora-A and survivin promoters (P < 0.01, Figure 7A), and the downregulating effect was partially attenuated by miR-200b inhibitor. [score:8]
However, administration of a universal DNA methyltransferase inhibitor (5-aza-2'-deoxycytidine, 5-aza-dC) has no obvious effects on miR-200b expression in docetaxel-resistant LAD cells, suggesting that DNA methylation might not be the specific mechanism underlying downregulation of miR-200b in docetaxel-resistant LAD cells. [score:8]
Downregulation of HDAC1/4 suppresses expression of E2F3, survivin and Aurora-A partially through the miR-200b -dependent pathway. [score:8]
Previously, we have showed that miR-200b is significantly downregulated in docetaxel-resistant LAD cells, and restoration of miR-200b can enhance their in vitro and in vivo chemosensitivity by post-transcriptionally downregulating E2F3 [18]. [score:7]
Thus, upregulation of HDAC1/4, inversely correlated with downregulation of miR-200b in LAD tissues, was correlated with poor survival of patients who received docetaxel -based chemotherapies. [score:7]
qRT-PCR and western blot assays indicated that inhibition of HDAC4 led to the decreased mRNA and protein levels of E2F3, Aurora-A and survivin (Figure 6A, 6B), and the downregulating effects could be partially rescued by miR-200b inhibitor (Figure 6A, 6B). [score:7]
Downregulation of HDAC1/4 or upregulation of miR-200b chemosensitizes docetaxel-resistant LAD cells in vivo. [score:7]
Furthermore, E2F3 and survivin levels were downregulated in sh-HDAC1#2, sh-HDAC4#3 and miR-200b vector groups, but Aurora-A level was only downregulated in sh-HDAC4#3 and miR-200b vector groups (Figure 8C and Supplementary Figure 3). [score:7]
When H1299/DTX or SPC-A1/DTX cells were co -transfected with siRNA-HDAC1 or siRNA-HDAC4 and siRNA-Sp1, the upregulation of miR-200b induced by HDAC1/4 downregulation could be partially abrogated by Sp1 (Figure 3D). [score:7]
Suppression of HDAC1/4 or upregulation of miR-200b reverses in vivo chemoresistance of docetaxel-resistant LAD cells (H1299/DTX cells). [score:6]
These results indicate that suppression of HDAC1/4 or upregulation of miR-200b chemosensitizes docetaxel-resistant LAD cells in vivo. [score:6]
Together these findings suggest that repression of HDAC1/4 suppresses cell proliferation, promotes cell apoptosis, and induces G2/M cell cycle arrest by downregulation of E2F3, Aurora-A and survivin, at least partially through the miR-200b -dependent pathway. [score:6]
Also, downregulation of HDAC1/4 significantly reduced the colony formation capacities of H1299/DTX and SPC-A1/DTX cell lines, and these effects were also partially reversed by miR-200b inhibitor (P < 0.01, Figure 5B; Supplementary Figure 2A). [score:6]
Cell cycle analysis showed that downregulation of HDAC4 dramatically increased the percentage of cells in G2/M phase in H1299/DTX and SPC-A1/DTX cells, which could be partially reversed by miR-200b inhibitor (P < 0.01, Figure 5E, Supplementary Figure 2C). [score:6]
Notably, inhibition of HDAC1 or HDAC4 significantly upregulated the levels of miR-200b (Figure 2A). [score:6]
Nevertheless, the inhibition effects could be partially abrogated by miR-200b inhibitor (Figure 5A). [score:5]
Our study also revealed that HDAC1 and HDAC4 are significantly upregulated in docetaxel-resistant LAD cells compared with parental cells, and inhibition of HDAC1 or HDAC4 significantly enhances miR-200b levels, at least partially in a Sp1 -dependent manner. [score:5]
Histone deacetylase inhibitors (Trichostatin A, TSA, and valproic acid, VPA) elevate the expression of miR-200b and reverse chemoresistance of docetaxel-resistant LAD cells. [score:5]
The siRNA-HDACs, siRNA-NC, miR-200b inhibitor, miR-200b inhibitor control, miR-200b mimics, miR-200b mimics control and siRNA-Sp1 were purchased from GenePharma (Shanghai, China). [score:5]
The expression level of miR-200b was upregulated in sh-HDAC1#2, sh-HDAC4#3 and miR-200b vector groups compared with the control groups (Figure 8B). [score:5]
HDAC1/Sp1 and HDAC4/Sp1 involvement in the downregulation of miR-200b in docetaxel-resistant LAD cells. [score:4]
HDAC1/4 repression upregulates histone-H3 acetylation level at miR-200b promoters partially through the Sp1 -dependent pathway. [score:4]
Taken together, these data, along with previous observations that downregulation of miR-200b was involved in docetaxel resistance of LAD, support the hypothesis that the novel HDAC1/4/miR-200b/E2F3 signaling contributes to chemoresistance of LAD cells. [score:4]
To further determine the roles of HDAC1/4/Sp1/miR-200b signaling in the regulation of E2F3-related target genes, we analyzed the genomic sequences of promoters of Aurora-A and survivin as reported in previous studies [29, 30], and found multiple binding sites for the E2F3 transcription factor in Aurora-A and survivin promoters. [score:4]
The miR-200 family members, consisting of miR-200b, miR-200c, miR-429, miR-200a and miR-141, are considered tumor suppressor miRNAs that can differentially regulate cell viability, invasion, apoptosis, cell cycle progression and EMT during tumor development and progression [14- 16]. [score:4]
Thus, these results suggest that Sp1 is a crucial transcription factor responsible for regulating miR-200b expression by HDAC1/4 in docetaxel-resistant LAD cells. [score:4]
The purpose of this study was to investigate the possible molecular mechanisms by which HDACs negatively regulate miRNA-200b expression and elucidate the relationship between histone acetylation-modulated miR-200b expression and chemoresistance of LAD cells. [score:4]
Therefore, the HDAC1/4-Sp1 complexes negatively regulate miR-200b expression in docetaxel-resistant LAD cells. [score:4]
To determine the specific HDACs involved in the regulation of miR-200b expression, vectors containing siRNAs against each of the eleven isoforms of HDACs were transfected into H1299/DTX and SPC-A1/DTX cells. [score:4]
Nevertheless, the underlying molecular mechanisms responsible for downregulation of miR-200b in docetaxel-resistant LAD cells have not been fully illustrated. [score:4]
Intriguingly, the effects of upregulation of HDAC1 or HDAC4 on the IC [50] values could be partially abrogated by miR-200b mimics (Figure 5A). [score:4]
Next we focused on whether the HDAC1/4/Sp1/miR-200b pathway might be involved in the regulation of E2F3 and its downstream target genes. [score:4]
E2F3, a functional target of miR-200b [18], plays crucial roles in regulating the chemoresistance of LAD cells. [score:4]
Furthermore, we found that Sp1 was able to recruit HDAC1/4 to the promoters of miR-200b in vivo, and inhibition of HDAC1/4 increased the histone-H3 acetylation level at the miR-200b promoters in a Sp1 -dependent manner. [score:3]
HDAC1/4, inversely correlated with miR-200b, is upregulated in docetaxel-insensitive human LAD cases compared with docetaxel-sensitive LAD cases. [score:3]
MiR-200b, a potent tumor suppressor located in the miR-200b/c/429 gene cluster, has already been linked to chemoresistance of tumor cells by modulating cell viability, cell apoptosis, EMT and cancer stem cell self-renewal [13, 17]. [score:3]
Our previous work demonstrated that suppression of E2F3 is a potential mechanism by which miR-200b reverses chemoresistance of docetaxel-resistant LAD cells [18]. [score:3]
HDAC1/4/Sp1/miR-200b signaling is responsible for aberrant expression of E2F3, survivin and Aurora-A in docetaxel-resistant LAD cells. [score:3]
Our results showed that suppression of HDAC1 and HDAC4 significantly increased luciferase activities of the two miR-200b luciferase promoter constructs (Figure 3C). [score:3]
Inhibition of HDAC1/4 reverses chemoresistance of docetaxel-resistant LAD cells partially in a miR-200b -dependent manner. [score:3]
Effects of histone deacetylases (HDACs) on miR-200b expression. [score:3]
To further illustrate the roles of HDAC1/4/miR-200 in docetaxel-resistance of LAD patients, we evaluated the expression of HDAC1/4 in LAD tissues from patients who received docetaxel -based chemotherapies, and showed that the expression level of HDAC1/4 mRNA in docetaxel-sensitive LAD tissues was significantly lower than that in docetaxel-insensitive tissues. [score:3]
Histone deacetylase inhibitors elevate miR-200b levels and reverse chemoresistance of docetaxel-resistant LAD cells. [score:3]
Both TSA and VPA significantly restored the expression of miR-200b and reversed chemoresistance of docetaxel-resistant LAD cells. [score:3]
Figure 6(A) Relative mRNA expression of E2F3, survivin and Aurora-A as measured by qRT-PCR after transfection of sh-control, sh-HDAC1#2 or sh-HDAC4#3 vectors into H1299/DTX and SPC-A1/DTX cells, without (or with) previous transfection of miR-200b inhibitor. [score:3]
In this study, we identified multiple Sp1 binding sites in the two promoters of miR-200b, and inhibition of HDAC1 and HDAC4 significantly increased luciferase activities of luciferase constructs with the two indicated promoters in a Sp1 -dependent manner. [score:3]
Figure 1(A) qRT-PCR detection of relative miR-200b expression in docetaxel-resistant LAD cells (SPC-A1/DTX and H1299/DTX) and their parental LAD cells (SPC-A1 and H1299). [score:3]
HDAC1/4, inversely correlated with miR-200b, is upregulated in the docetaxel-insensitive LAD tissues compared with the docetaxel-sensitive LAD tissues. [score:3]
Figure 7(A) Luciferase activity assays revealed that downregulation of HDAC1/4 significantly elevated Aurora-A (left) or survivin (right) promoter activity partially in a miR-200b/E2F3 -dependent manner. [score:3]
Therefore, suppression of HDAC1/4 could reverse the in vitro chemoresistance of LAD cells, at least partially in a miR-200b -dependent manner. [score:3]
Several studies have demonstrated that DNA methylation is one of the potential molecular mechanisms controlling miR-200b expression in tumor cells [19, 20]. [score:3]
Likewise, the apoptosis-promoting effect was weakened when miR-200b inhibitor was previously transfected (Figure 5C; Supplementary Figure 2B). [score:3]
To further reveal the potential molecular mechanisms involved in transcriptional regulation of miR-200b, we analyzed the core regions of its promoters. [score:2]
Figure 3(A) Schematic representation of the human miR-200b promoters with the putative Sp1 -binding sites and the sequence of the point mutation. [score:2]
Together this suggests that histone acetylation might be an important molecular mechanism involved in regulation of miR-200b in docetaxel-resistant LAD cells. [score:2]
To the best of our knowledge, there have been no reports about HDAC -mediated silencing of miR-200b in regulating chemoresistance of LAD cells, and thus the present study could provide a novel strategy for reversing chemoresistance of LAD. [score:2]
The primers are listed in Supplementary Table 4. SPC-A1/DTX or H1299/DTX cells (4×10 [3]/well) were seeded into 96-well plates and cotransfected with luciferase reporter plasmids and sh -RNAs with (or without) miR-200b inhibitors. [score:2]
HDAC1/4 involvement in the regulation of survivin or Aurora-A through the miR-200b/E2F3 -dependent pathway (SPC-A1/DTX cells). [score:2]
Together these data indicate that HDAC1/4/Sp1/miR-200b signaling regulated the promoter activity of Aurora-A and survivin in an E2F3 -dependent manner. [score:2]
Taken together, we conclude that the novel HDAC1/4/Sp1/miR-200b/E2F3 regulatory axis contributes to chemoresistance of docetaxel-resistant LAD cells. [score:2]
ChIP assay also revealed that inhibition of HDAC1/4 increased the histone-H3 acetylation level of the miR-200b promoters at Sp1 -binding sites (Figure 4D). [score:2]
Schematics of the human miR-200b promoters are presented in Figure 3A and the putative Sp1 -binding sites and mutations are indicated. [score:2]
These data suggest that the HDAC1/4/Sp1/miR-200b signaling plays a critical role in the regulation of E2F3, survivin and Aurora-A in docetaxel-resistant LAD cells. [score:2]
The IC [50] values of docetaxel (or paclitaxel) in SPC-A1/DTX/sh-HDAC1#2, H1299/DTX/sh-HDAC1#2, SPC-A1/DTX/sh-HDAC4# Figure 5(A) The IC50 values for docetaxel or paclitaxel as determined by MTT assay after transfection of sh-control, sh-HDAC1#2 or sh-HDAC4#3 vectors into docetaxel-resistant LAD cells without (or with) previous transfection with miR-200b inhibitor. [score:2]
The IC [50] values of docetaxel (or paclitaxel) in SPC-A1/DTX/sh-HDAC1#2, H1299/DTX/sh-HDAC1#2, SPC-A1/DTX/sh-HDAC4# Figure 5(A) The IC50 values for docetaxel or paclitaxel as determined by MTT assay after transfection of sh-control, sh-HDAC1#2 or sh-HDAC4#3 vectors into docetaxel-resistant LAD cells without (or with) previous transfection with miR-200b inhibitor. [score:2]
Multiple Sp1 binding sites in the promoter regions could be identified, suggesting that Sp1 might be a key transcription factor of miR-200b. [score:1]
HDAC1/4 decreases miR-200b promoter activities. [score:1]
HDAC1/4 repression reverses the in vitro chemoresistance of LAD cells partially in a miR-200b -dependent manner. [score:1]
Approximately 5.0×10 [6] H1299/DTX cells stably transfected with sh-control, sh-HDAC1, sh-HDAC4 or miR-200b vectors were subcutaneously transplanted into the right side of the posterior flank of nude mice. [score:1]
HDAC1/4 repression reverses the in vitro chemoresistance of LAD cells partially in a miR-200b -dependent mannerTo confirm the effects of HDAC1/4 on regulating the chemoresistance of LAD cells, sh-control, sh-HDAC1#2 or shRNA-HDAC4#3 vectors were transfected into H1299/DTX and SPC-A1/DTX cells without (or with) previous transfection with miR-200b inhibitor, and the IC [50] values of docetaxel or paclitaxel were measured by MTT assay (Figure 5A). [score:1]
The two promoters of miR-200b, located ~4 kb and ~2 kb upstream of the 5′-stem loop, have been reported in previous studies [20, 48]. [score:1]
DNA hypermethylation -mediated silencing of miR-200b has been reported to be associated with cancer progression in primary lung tumors and advanced breast cancer [19, 20]. [score:1]
Figure 8(A) Growth of tumors in nude mice subcutaneously transplanted with H1299/DTX cells stably transfected with sh-control, sh-HDAC1#2, sh-HDAC4#3 or miR-200b vectors (six mice in each group). [score:1]
To confirm the effects of HDAC1/4 on regulating the chemoresistance of LAD cells, sh-control, sh-HDAC1#2 or shRNA-HDAC4#3 vectors were transfected into H1299/DTX and SPC-A1/DTX cells without (or with) previous transfection with miR-200b inhibitor, and the IC [50] values of docetaxel or paclitaxel were measured by MTT assay (Figure 5A). [score:1]
A statistically significant inverse correlation was observed between HDAC1 and miR-200b (r=-0.799, P < 0.01; Fig. 9C). [score:1]
The HDAC1/4 level was normalized to GAPDH and miR-200b was normalized to U6. [score:1]
HDAC1 (C) or HDAC4 (D) and miR-200b mRNA levels were inversely correlated in 68 LAD tissues as determined by linear regression analysis. [score:1]
A statistically significant inverse correlation was also observed between HDAC4 and miR-200b (r=-0.781, P < 0.01; Fig. 9D). [score:1]
However, when the Sp1 -binding sites were mutated, the effects of HDAC1 and HDAC4 on miR-200b promoters were attenuated (Figure 3C). [score:1]
When treated with docetaxel, tumors derived from H1299/DTX cells stably transfected with sh-HDAC1#2, sh-HDAC4#3 or miR-200b vector grew more slowly than controls (Figure 8A). [score:1]
Meanwhile, HDAC1/4 was inversely correlated with miR-200b in LAD tissues. [score:1]
[1 to 20 of 88 sentences]
5
[+] score: 335
Moreover, treatment with the DNA hypomethylating agent 5-AzaC increased the expression of miR-200b in HCC cell lines, whereas the expression of its target gene BMI1 was upregulated. [score:10]
B, D. of HepG2 cells with miR-200b mimics or miR-200b inhibitors specifically upregulated or downregulated miR-200b levels, respectively. [score:9]
The previously identified tumor suppressor miR-200b modulates tumor development and malignant progression by downregulating its target genes. [score:9]
Here, we demonstrated that miR-200b not only suppresses invasion but also inhibits the growth of HCC cells via the direct targeting of BMI1. [score:8]
In this study, we observed that the expression of miR-200b was downregulated in most of the HCC tissues tested and that the miR-200b level was inversely correlated with the expression level of BMI1. [score:8]
Downregulation of miR-200b in HCC is associated with BMI1 overexpressionThe expressions level of miR-200b and BMI1 in HCC tissues and human liver cancer cell lines were analyzed by qPCR. [score:8]
Collectively, the above results suggest that miR-200b not only suppresses growth but also inhibits the invasiveness of tumor cells by directly targeting BMI1. [score:8]
Taken together, these results indicate that miR-200b expression in HCC may be epigenetically downregulated via DNA methylation and that BMI1 was a functional downstream target of miR-200b. [score:8]
These results indicate that overexpression of miR-200b in HCC cells may contribute to decreased cell proliferation and colony formation via the functional downregulation of BMI1 expression. [score:8]
MiR-200b expression is downregulated in HCC and is associated with BMI1 overexpression. [score:7]
Consistent with the results of our in vitro study, enhanced expression of miR-200b or decreased expression of BMI1 in HCC cells significantly suppressed their tumorigenicity in vivo (Figure 3G; Figures S9 and S10). [score:7]
By contrast, the downregulation of miR-200b in HCC cells by a miR-200b inhibitor significantly increased the cell viability of these cells (Figure 3I; Figure S11). [score:6]
D. miR-200b expression was upregulated in HepG2 and SMMC-7721 cells upon treatment with 5-AzaC for 36h. [score:6]
In this study, we demonstrated that the tumor suppressor miR-200b represses HCC progression by directly targeting the oncogene BMI1. [score:6]
In addition, BSP revealed high levels of DNA methylation in HepG2 and SMMC-7721 cells, consistent with the downregulation of the expression of miR-200b in these cell lines. [score:6]
Downregulation of miR-200b in HCC is associated with BMI1 overexpression. [score:6]
The predicted targets of miR-200b and their target sites were analyzed usingmiRanda (http://www. [score:5]
C. The expression of miR-200b was negatively correlated with BMI1 expression in HCC tissues. [score:5]
The above findings were supported by loss-of-function studies in which a miR-200b inhibitor that significantly decreased endogenous miR-200b expression promoted in vivo tumorigenicity of HCC cells (Figure 3H; Figures S9 and S10). [score:5]
Generation of stably -transfected HCC cell lines for constitutive miR-200b and BMI1-shRNA expressionHuman miR-200b mimics/inhibitors and BMI1-shRNA oligoswere designed and cloned into the pGLV3/H1/GFP+Purolentiviral vector (between the BamHI and EcoRI site). [score:5]
Exogenous overexpression of miR-200b suppresses tumorigenicity in vivoThe in vitro findings were confirmed using animal mo dels. [score:5]
In general, the expression of miR-200b targets should decrease in cells after treatment with DNA hypomethylating drugs. [score:5]
In agreement with these data, qPCR and western blot analysis demonstrated that miR-200b could inhibit the mRNA and protein expression of BMI1 in HCC cells. [score:5]
Sun and colleagues [13] have demonstrated that miR-200b can inhibit chemotherapy -induced EMT in human tongue cancer cells by targeting BMI1. [score:5]
Exogenous overexpression of miR-200b suppresses tumorigenicity in vivo. [score:5]
Luciferase assays revealed direct inhibition of BMI1-3′-UTR expression by miR-200b. [score:5]
By contrast, a miR-200b inhibitor significantly enhanced the expression of BMI1 in HCC cells (Figure 2D, E and G; Figure S1). [score:5]
The crucial role of miR-200b and its target gene BMI1 in the progression of HCC prompted us to further explore the mechanisms underlying the aberrant expression of miR-200b in HCC. [score:5]
The miR-200 family plays a vital role in tumor suppression through the inhibition of EMT [6, 7]. [score:5]
Moreover, the expression of miR-200b was negatively correlated with the expression of BMI1 mRNA in HCC tissues in cohort 1 (Figure 1C). [score:5]
Ectopic overexpression of miR-200b also dramatically inhibited HCC cell proliferation and colony formation, thereby contributing to the delay in HCC progression. [score:5]
Our study revealed that hypermethylation of the CpG islands upstream of miR-200b led to the downregulation of miR-200b in 2 HCC cell lines and tissues from 4 HCC patients. [score:4]
Taken together, these results strongly suggest that in HCC, thus indicating the underlying mechanism by which miR-200b regulates BMI1 at both the transcriptional and post-translational levels. [score:4]
In summary, our results indicate that miR-200b is partially silenced by DNA hypermethylation and can repress tumor progression by directly targeting BMI1 in HCC. [score:4]
E. MiR-200b mimics/ BMI1-siRNA efficiently inhibited the expression of pRb. [score:4]
These findings indicate that the downregulation of miR-200b in HCC is due, at least in part, to the hypermethylation of CpG sequences in its promoter. [score:4]
Taken together, these data indicate that either the transfection of HCC cells with miR-200b or the knockdown of BMI1 in HCC cells significantly inhibits tumorigenicity in vivo. [score:4]
BMI1 is a direct target gene of miR-200b. [score:4]
F. Either miR-200b overexpression or BMI1 knockdown repressed the invasive capacity of HepG2 cells. [score:4]
However, the exact regulatory mechanisms of BMI1 expression and its relationship with miR-200b in the initiation and progression of HCC remain to be explored. [score:4]
The region of human BMI1-3′-untranslated region (UTR; bases 8334 to 10276) containing three putative miR-200b -binding sites (miRanda; Figure S12). [score:3]
D. Relative expression levels of miR-200b and BMI1 mRNA in human liver cancer cell lines and in the normal liver cell line L02. [score:3]
G, H. of LV-miR-200b mimics/LV- BMI1-shRNA suppressed tumor formation in a nude mouse xenograft mo del. [score:3]
In addition, the results of the qPCR and western blot analysis demonstrated that transfection with miR-200b mimics significantly reduced the mRNA and protein expression levels of BMI1 in HCC cells (Figure 2B, C and G; Figure S1). [score:3]
C, E, G. of HepG2 cells with miR-200b mimics or miR-200b inhibitors significantly modulated mRNA and protein levels of BMI1. [score:3]
In the present study, miR-200b -mediated BMI1 silencing sensitized HCC cells to 5-FU -induced apoptosis, whereas an inhibitor of miR-200b antagonized the pro-apoptotic effect, suggesting that miR-200b may increase chemotherapeutic drug -induced cytotoxicity. [score:3]
Human miR-200b mimics/inhibitors and BMI1-shRNA oligoswere designed and cloned into the pGLV3/H1/GFP+Purolentiviral vector (between the BamHI and EcoRI site). [score:3]
Collectively, these results suggest that miR-200b expression is inversely correlated with DNA methylation. [score:3]
Interestingly, co-transfection of the miR-200b mimics specifically decreased the luciferase expression of the BMI1-3′-UTR-wt reporter. [score:3]
The above findings indicate that miR-200b sensitizes HCC cells to chemotherapeutic drug -induced apoptosis via targeting of BMI1. [score:3]
However, no significant correlations between miR-200b or BMI1 expression and the available clinical parameters of patient cohort 1 were observed (Table S1). [score:3]
Generation of stably -transfected HCC cell lines for constitutive miR-200b and BMI1-shRNA expression. [score:3]
BMI1 is also reportedly a target gene of miR-200b in tongue and prostate cancer [13, 14]. [score:3]
The treatment with 5-AzaC increased the expression of miR-200b in both cell lines in a dose -dependent manner (Figure 4D). [score:3]
The expressions level of miR-200b and BMI1 in HCC tissues and human liver cancer cell lines were analyzed by qPCR. [score:3]
Figure 1 A. miR-200b was significantly downregulated in HCC tumor tissues (T) compared with respective adjacent non-cancerous liver tissues (N) and normal liver tissues (C). [score:3]
By contrast, knockdown of miR-200b by miR-200b inhibitors significantly increased the number and size of colonies compared with the controls (Figure 3C; Figures S3 and S4). [score:3]
We found that the expression of miR-200b mimics and BMI1-siRNA significantly decreased the proliferation capacity of HCC cells (Figure 3A and B; Figure S2). [score:3]
Importantly, miR-200b overexpression or BMI1 knockdown caused a significant decrease in the viability of HCC cells after 5-fluorouraci (5-FU) treatment compared with the respective controls. [score:3]
By contrast, only limited methylation was observed in the normal liver cell line L02 (Figure 4C), which highly express miR-200b. [score:3]
demonstrated that the levels of an apoptotic marker (Cleaved PARP) were significantly elevated in miR-200b mimic/ BMI1-siRNA -transfected cells, whereas pre-treatment with a miR-200b inhibitor significantly attenuated the levels of Cleaved PARP (Figure 3J; Figure S11). [score:3]
Our study suggests that miR-200b plays an important role in the progression of HCC and may be a potential therapeutic target in cancer progression. [score:3]
MiR-200b is activated in HCC cells after treatment with 5-AzaCand associated with silencing of BMI1To further determine if miR-200b is silenced through epigenetic mechanisms in HCC cells, we compared the expression of miR-200b in HepG2 and SMMC-7721 cells treated with 5-AzaC (a DNA hypomethylating agent) to that in untreated cells by qPCR. [score:2]
To further determine if miR-200b is silenced through epigenetic mechanisms in HCC cells, we compared the expression of miR-200b in HepG2 and SMMC-7721 cells treated with 5-AzaC (a DNA hypomethylating agent) to that in untreated cells by qPCR. [score:2]
To determine if miR-200b overexpression sensitizes HCC cells to chemotherapy, we evaluated the effect of miR-200b overexpression on cell apoptosis using an apoptosis assay. [score:2]
In this study, we examined the potential roles of miR-200b and BMI1 in the progression of HCC and explored the underlying regulatory mechanisms. [score:2]
Taken together, these results indicate that and can be negatively regulated by miR-200b. [score:2]
MiR-200b can restrain the process of EMT and consequently inhibit EMT -mediated tumor invasion and metastasis. [score:2]
MiR-200b suppresses proliferation, colony formation, cell cycle progression and invasion in vitro. [score:2]
As expected, transfection of HCC cells with miR-200b mimics or BMI1-siRNA notably suppressed their invasion ability compared with normal control cells (Figure 3F; Figures S7 and S8). [score:2]
and is negatively regulated by miR-200b in human liver cancer cell lines. [score:2]
Members of the miR-200 family are key regulators of epithelial-mesenchymal transition (EMT), an important step in the progression of primary tumors to distant metastasis. [score:2]
The bioinformatics of miR-200b. [score:1]
A. Results of the MSP analysis of miR-200b in HCC tissues. [score:1]
As shown in Figure 4A, all cancerous samples exhibited miR-200b promoter methylation, whereas no methylation was detected in adjacent non-cancerous liver tissues. [score:1]
Because miR-200b is a negative regulator of BMI1, we performed an in vitro cell invasion assay to further determine if miR-200b affects cell invasion. [score:1]
Subsequently, BSP was used to analyze the methylation status of all the CpG sites of the miR-200b promoter to precisely quantify the degree of methylation of the miR-200b promoter in one HCC sample and in two HCC cell lines. [score:1]
However, little is known about the specific role of miR-200b in human hepatocellular carcinoma (HCC) [6, 7]. [score:1]
Primer sequences for amplification of BMI1-3′-UTR are listed in Table S5 (BMI1-3′-UTR-mut4: three putative miR-200b -binding sites are all mutated by double mutation). [score:1]
To investigate the mechanisms underlying the aberrant expression of miR-200b in HCC, we analyzed the promoter methylationstatus of miR-200b by MSP. [score:1]
We search and obtain the 2kb DNA gene sequence of 5′-upstream of miR-200b by bioinformatics genome database UCSC (http://genome. [score:1]
Analysis of miR-200b methylation status in HCC tissues and cell lines. [score:1]
Nude mice were injected subcutaneously in opposite flanks with control lentiviral vector-infected cells and miR-200b mimics/ BMI1-shRNA vector-infected cells. [score:1]
Figure 4 A. Results of the MSP analysis of miR-200b in HCC tissues. [score:1]
By contrast, the luciferase activities of the four BMI1-3′-UTR-mut reporters and the psiCHECK-2 control reporter were unaffected by the simultaneous transfection of the miR-200b mimics, which suggests that (Figure 2A). [score:1]
D. miR-200b retarded G1/S cell cycle transition. [score:1]
After removal of aphidicolin, transfection of miR-200b mimics or BMI1 siRNA triggered significant growth arrest of HCC cells at G1 phase, suggesting that the G1/S cell cycle transition is slowed by miR-200b -mediated BMI1 silencing (Figure 3D; Figures S5 and S6). [score:1]
Hypermethylation of the miR-200b gene promoter in HCC. [score:1]
As shown in Figure 3C, miR-200b -transfected cells and BMI1-siRNA -transfected cells displayed much fewer and smaller colonies than control -transfected and non -transfected cells. [score:1]
Furthermore, our data indicate that miR-200b is partially silenced by DNA hypermethylation. [score:1]
[1 to 20 of 90 sentences]
6
[+] score: 320
Downregulation of miR-200b expression correlates with upregulation of ATG12 expression, decreased sensitivity to docetaxel and poor prognosis in lung adenocarcinoma tissues. [score:11]
Enhanced ATG12 expression corresponded with decreased miR-200b expression, implying that an early decrease in miR-200b expression may regulate the magnitude of ATG12 gene expression. [score:10]
As a final confirmation of the inhibitory effect of miR-200b on ATG12, we performed rescue experiments by overexpressing ATG12 in SPC-A1/DTX and H1299/DTX cells, which largely negated miR-200b -dependent autophagy suppression, as demonstrated by elevated LC3-II expression, which approached the level in control cells, and the increased percentage of GFP -positive cells (Fig. 2F, 2G). [score:9]
Downregulation of miR-200b upon autophagy stimulation might remove translational inhibition on ATG12 and subsequently promote autophagosome formation. [score:8]
Using microarrays, we previously showed that 6 of 52 miRNAs were differentially expressed more than two fold in docetaxel-resistant SPC-A1/DTX cells compared with parental SPC-A1 cells, including three upregulated miRNAs (miR-192, miR-424 and miR-98) and three downregulated miRNAs (miR-200b, miR-194 and miR-212) [16]. [score:8]
Downregulation of miR-200b correlates with upregulation of ATG12, decreased sensitivity to docetaxel and poor prognosis in lung adenocarcinoma tissues. [score:7]
In LAD cells, endogenous miR-200b was downregulated in response to cellular stress caused by starvation and rapamycin, followed by upregulation of ATG12. [score:7]
Consistently, overexpressing miR-200b or a specific siRNA that targets ATG12 inhibited starvation -induced conversion of LC3-I to LC3-II, prevented p62 degradation and reduced the number of punctate GFP -positive cells (Fig. 3B, 3C and Supplementary Fig. 4B, 4C). [score:7]
In an in vivo setting, miR-200b overexpression drastically attenuated ATG12 expression and subsequent autophagy activity, preventing long-term tumor cell survival by exposing them to metabolic stress and suppressing eventual tumor regrowth following docetaxel treatment. [score:7]
SPC-A1/DTX cells with a relatively higher LC3-II/LC3-I ratio were transfected with PmiR-200b to upregulate miR-200b expression. [score:6]
Based on our previously reported miRNA microarray -based profile between docetaxel-sensitive SPC-A1 cells and resistant SPC-A1/DTX cells, we hypothesized that the differentially expressed miRNAs are associated with docetaxel resistance, with miR-200b being the most significantly down-regulated miRNA in SPC-A1/DTX cells. [score:6]
Herein, we report that miR-200b, a down-regulated miRNA in docetaxel-resistant LAD cells, remarkably inhibits autophagy activation and enhances sensitivity to multiple antitumor drugs. [score:6]
Additionally, overexpression of miR-200b decreased ATG12 mRNA and protein levels in both SPC-A1/DTX and H1299/DTX cells, whereas silencing endogenous miR-200b increased ATG12 expression in parental cells (Fig. 2D and Supplementary Fig. 1C). [score:5]
MiR-200b inhibits autophagy by directly targeting ATG12. [score:5]
Therefore, these data strongly suggest that decreased miR-200b expression, which is inversely correlated with ATG12 expression in LAD patients, is linked to poor prognosis (Table 1). [score:5]
In contrast, suppressing miR-200b (by transfecting a miR-200b inhibitor (AmiR-200b) into SPC-A1 cells) resulted in elevated turnover of LC3-II and increased the percentage of punctate GFP -positive cells (Fig. 1B, 1C). [score:5]
MiR-200b increases chemosensitivity of LAD cells by targeting ATG12 in vitroBased on the finding that miR-200b was the most greatly downregulated miRNA in SPC-A1/DTX cells compared with parental SPC-A1 cells, we sought to evaluate whether miR-200b -induced chemosensitivity was dependent on ATG12 suppression. [score:5]
D. The Kaplan–Meier survival curve shows that patients with high miR-200b expression have shorter progression-free survival (PFS) than those with low miR-200b expression (log-rank test, P = 0.021). [score:5]
In the present study, we uncovered a novel role for miR-200b in autophagy regulation and identified ATG12 as a direct miR-200b target. [score:5]
Exogenous miR-200b was transfected into cells at 4 h. The relative expression levels of miR-200b mRNA and ATG12 mRNA were assessed by qRT-PCR, with expression in the control set as 1.0. [score:5]
Patients with a low miR-200b expression (n = 34) had a shorter progression free survival (PFS) than those patients with high miR-200b expression (n = 26; median: 3.4 months vs. [score:5]
Exposing cells to nutrient starvation (using Hank's balanced salt solution), caused a decrease in endogenous miR-200b expression after 1 hour, and a delayed response in increased ATG12 mRNA expression, which returned to near basal levels about 4 hours after the addition of exogenous miR-200b to SPC-A1 cells (Fig. 3A). [score:5]
MiR-200b suppresses autophagy by directly targeting ATG12. [score:5]
H1299/DTX cells exhibited a 2.81-fold downregulation in miR-200b expression compared with parental H1299 cells (Supplementary Fig. 1B). [score:5]
MiR-200b inhibits ATG12 expression, which leads to a decrease in autophagy that contributes to chemoresistance. [score:4]
Figure 8 MiR-200b inhibits ATG12 expression, which leads to a decrease in autophagy that contributes to chemoresistance. [score:4]
Taken together these results demonstrate that ATG12 is a direct target of miR-200b. [score:4]
Specifically, we report for the first time that ATG12 is a direct target of miR-200b in LAD. [score:4]
According to the data in Fig. 7A, miR-200b mRNA expression was markedly decreased in the “insensitive” group compared with the “sensitive” group, and vice versa in the case of ATG12 mRNA expression. [score:4]
We demonstrate miR-200b -dependent downregulation of ATG12, which blocks autophagy and resensitized LAD cells to chemotherapy both in vivo and in vitro. [score:4]
demonstrated that, compared with a nonspecific mimic or inhibitor -negative control, the miR-200b mimic (PmiR-200b) exhibited maximum inhibitory potency against autophagy activity, as demonstrated by the significant decrease in the conversion of LC3-I to LC3-II (Fig. 1A). [score:4]
The miR-200 family is aberrantly expressed in a variety of cancers [27, 28], and regulates multiple pathway components including a number of transcription factors involved in tumor migration and invasion [29] [30]. [score:4]
Correlation between miR-200b expression and clinicopathological factors of LAD patients. [score:3]
Therefore, targeting miR-200b-ATG12 signaling may be a potential strategy for reversing chemoresistance in combating LAD. [score:3]
Figure 7 A. qRT-PCR was performed to analyze the relative mRNA expression of miR-200b and ATG12 in docetaxel-sensitive (n = 27) and insensitive (n = 33) LAD tissues. [score:3]
Similar to the results in SPC-A1/DTX cells, forced expression of miR-200b limited autophagy activity in H1299/DTX cells even when treated with cytotoxic agents, as shown by diminished LC3-II/LC3-I ratios and the reduction in punctate GFP -positive cells (Supplementary Fig. 2A, 2B). [score:3]
Specifically, a relative increase in miR-200b coupled with a decrease in ATG12 expression was observed in tissue samples from docetaxel-sensitive patients. [score:3]
Here, we show that introduction of exogenous miR-200b into SPC-A1/DTX cells suppressed autophagy activity and resensitized cells to chemotherapy. [score:3]
Moreover, patients with relatively lower levels of miR-200b expression had poorer prognosis. [score:3]
Interestingly, another miRNA, miR-23b, has also been reported to target ATG12 with different 3′UTR sequences (bases 172–178 and 1281–1288) than miR-200b (bases 946–952) [32]. [score:3]
Based on the finding that miR-200b was the most greatly downregulated miRNA in SPC-A1/DTX cells compared with parental SPC-A1 cells, we sought to evaluate whether miR-200b -induced chemosensitivity was dependent on ATG12 suppression. [score:3]
Co-transfection with a miR-200b mimic markedly inhibited luciferase activity in the reporter vector containing the wild-type ATG12 3′UTR but not the mutant 3′UTRs in both SPC-A1/DTX and HEK-293 cells (Fig. 2B and Supplementary Fig. 3). [score:3]
ATG12 protein levels were reduced in both parental cells overexpressing miR-200b, both in the presence or absence of rapamycin. [score:3]
A. qRT-PCR was performed to analyze the relative mRNA expression of miR-200b and ATG12 in docetaxel-sensitive (n = 27) and insensitive (n = 33) LAD tissues. [score:3]
LAD tissue samples were next categorized as miR-200b -high or -low using the median miR-200b mRNA expression level as threshold (median = 1.86, normalized to U6 snRNA). [score:3]
The association of miR-200b expression with patient survival was further analyzed. [score:3]
Similar to miR-200b overexpression, silencing ATG12 prevented both LC3-II accumulation and P62 degradation in docetaxel-resistant cells (Fig. 2E). [score:3]
Remarkably, SPC-A1/DTX-derived tumor outgrowth was prevented when docetaxel treatment was administered in a miR-200b -overexpressed genetic background (Fig. 6A, 6B). [score:3]
However, further introduction of exogenous miR-200b greatly decreased ATG12 expression and blocked starvation and rapamycin -induced autophagy. [score:3]
Low miR-200b expression was significantly correlated with advanced clinical stage and poor response to docetaxel -based chemotherapy (Fig. 7D). [score:3]
Forced expression of miR-200b blocks autophagy in LAD cells. [score:3]
Restoration of miR-200b or ATG12 knockdown caused cell death and suppressed growth of SPC-A1/DTX and H1299/DTX cells, as shown by MTT and colony formation assays, respectively (Fig. 4A, 4B and Supplementary Fig. 5A, 5B). [score:3]
This inverse association between miR-200b and ATG12 expression was significant based on linear regression analysis (Fig. 7C). [score:3]
Additionally miR-200b -dependent inhibition of autophagy was confirmed by GFP-LC3 fluorescence microscopy, where the percentage of punctate GFP [+] SPC-A1/DTX cells was reduced (Fig. 1C). [score:3]
To further investigate the mechanisms of miR-200b -dependent inhibition of autophagy, we sought to identify putative autophagy-related targets of miR-200b, based on the miRNA database(http://microRNA. [score:3]
However, we did not find a putative miR-200b -binding site within the 3′UTR of HMGB1 or significant changes in HMGB1 levels when modulating miR-200b expression (Data not shown). [score:3]
Taken together, the present work demonstrates for the first time that miR-200b could decrease autophagy activity and increase chemotherapy -induced cell death by targeting ATG12 in LAD cells. [score:3]
Forced expression of miR-200b blocks autophagy in SPC-A1/DTX cells. [score:3]
Meanwhile, transfection of SPC-A1 and H1299 cells with the miR-200b inhibitor substantially diminished drug -induced apoptosis (Fig. 5C, 5D and Supplementary Fig. 6C, 6D). [score:3]
Both ATG12 silencing and miR-200b overexpression significantly sensitized SPC-A1/DTX and H1299/DTX cells to docetaxel and cisplatin. [score:3]
Conversely, LC3-II accumulation was not affected by Baf A1 when administering AmiR-200b, suggesting that the increased in LC3-II was caused by autophagy induction as opposed to inhibition of autophagosome clearance mediated by miR-200b (Fig. 1E). [score:3]
Our study confirms the importance of miRNAs in autophagy control and provides the first evidence for miR-200b -dependent regulation of autophagy. [score:2]
MiR-200b increases chemosensitivity of LAD cells by targeting ATG12 in vitro. [score:2]
Collectively, these data indicate that miR-200b negatively regulates autophagy in LAD cells. [score:2]
MiR-200b inhibits starvation and rapamycin -induced autophagy. [score:2]
MiR-200b increases the sensitivity of SPC-A1/DTX cells to apoptosis by targeting ATG12. [score:2]
MiR-200b increases chemosensitivity of SPC-A1/DTX cells by targeting ATG12. [score:2]
Furthermore, using a dual-luciferase reporter system we demonstrated that miR-200b binds directly to the 3′UTR of ATG12 mRNA. [score:2]
Hence, miR-200b regulates both starvation- and rapamycin -induced autophagy. [score:2]
Immunohistochemistry and western blot analysis of the tumor specimens confirmed diminished ATG12 expression and decreased autophagy activity in pcDNA/miR-200b -transfected tumors in response to docetaxel when compared with pcDNA/miR-NC -transfected tumors (Fig 6B, 6C). [score:2]
MiR-200b inhibits starvation and rapamycin -induced autophagy in SPC-A1 cells. [score:2]
Compared with the control group, miR-200b overexpression resulted in increased apoptosis of docetaxel-resistant cells when exposed to cytotoxic agents, as indicated by an enhanced percentage of Annexin V-stained cells and a massive cleavage of PAPR and caspase-3 (Fig. 5A, 5B and Supplementary Fig. 6A, 6B). [score:2]
Taken together, our data therefore provide, for the first time, evidence that miR-200b could significantly affect LAD chemosensitivity through negative regulation of autophagy-related genes (Fig. 8). [score:2]
We therefore selected miR-200b to further explore the influence of miRNAs on autophagy. [score:1]
Mechanism whereby miR-200b modulates ATG12 -dependent chemoresistance. [score:1]
By contrast, miR-200b silencing led to the activation of autophagy, which was further enhanced when exposed to antitumor drugs (Supplementary Fig. 2A, 2B). [score:1]
Inversely, silencing endogenous miR-200b induced autophagy in SPC-A1 cells and increased resistance to chemotherapy. [score:1]
Ectopic miR-200b attenuated the conversion of LC3-II to LC3-I and prevented P62 degradation with or without treatment with docetaxel or cisplatin (Fig. 1B). [score:1]
These results reveal a tight relationship between miR-200b and autophagy activation in LAD. [score:1]
Taken together, these data indicate that miR-200b enhances the chemosensitivity of LAD cells in an ATG12 -dependent manner. [score:1]
These observations provide further evidence for the role of miR-200b in determining the response of NSCLC cells to docetaxel in vivo. [score:1]
Next we determined the effect of miR-200b on apoptosis. [score:1]
A. Nude mice were subcutaneously injected with 5 × 10 [6] cells stably transfected with pcDNA miR-200b or pcDNA miR-NC and treated with docetaxel (1mg/kg) beginning at day eight. [score:1]
The miR-200b seed sequence matched nucleotides in the ATG12 sequence (Fig. 2A). [score:1]
Figure 6MiR-200b enhances the antitumor efficacy of docetaxel in vivo A. Nude mice were subcutaneously injected with 5 × 10 [6] cells stably transfected with pcDNA miR-200b or pcDNA miR-NC and treated with docetaxel (1mg/kg) beginning at day eight. [score:1]
Figure 2 A. Predicted miR-200b consensus sequences in the ATG12 3′UTR. [score:1]
C. Expression levels of miR-200b and ATG12 mRNA were inversely correlated among tissue samples as measured by linear regression analysis. [score:1]
Tumors derived from pcDNA/miR-200b -transfected SPC-A1/DTX cells were substantially smaller than the control group. [score:1]
Approximately 5 × 10 [6] SPC-A1/DTX/pcDNA miR-200b or SPC-A1/DTX/miR-NC cells were subcutaneously transplanted into twelve 6-week-old BALB/c mice (six mice for SPC-A1/DTX/pcDNA miR-200b cells, and six for SPC-A1/DTX/miR-NC cells). [score:1]
In each of the group transplanted with SPC-A1/DTX/pcDNA miR-200b cells or SPC-A1/DTX/miR-NC cells, three mice were injected with docetaxel and three were injected with 0.9% normal saline as control. [score:1]
TUNEL staining of xenografts showed higher apoptosis in the pcDNA/miR-200 group than in the control group following treatment with docetaxel (Fig. 6C). [score:1]
We next examined the effect of miR-200b on autophagy induced by another stimulus, the mTOR blocker rapamycin [19]. [score:1]
Consistent with these findings, miR-200b was inversely correlated with ATG12 in clinical docetaxel -treated LAD tissue samples. [score:1]
A. Predicted miR-200b consensus sequences in the ATG12 3′UTR. [score:1]
The miR-200b-ATG12 and HMGB1-MEK/ERK1/2-Beclin1/PI3K-III pathways seem to be concurrently implicated in autophagic abnormalities of LAD cells. [score:1]
To further investigate the relationship between miR-200b and ATG12 expression in vivo, tissue samples were obtained from 60 clinical LAD cases from patients diagnosed with advanced lung adenocarcinoma. [score:1]
Conversely, ki67 (a marker of cell proliferation [21]) was clearly diminished in pcDNA/miR-200b -transfected tumors (Fig. 6C). [score:1]
Following docetaxel treatment, LC3-II accumulation was further enhanced in Baf A1-pretreated control SPC-A1/DTX cells, but only minimally altered in miR-200b -transfected cells (Fig. 1E). [score:1]
[1 to 20 of 98 sentences]
7
[+] score: 293
As shown in Figure 4, a time -dependent increase of miRNA-200b expression in the pre-miR-200b group was observed, with maximal miRNA-200b expression occurring at 72 h. The expression of miR-200b in the pre-miR-200b group was significantly up-regulated by 6.862 ± 0.725 and 6.819 ± 0.838-fold as compared with that of the control and pre-miR-con groups, respectively (Figure 4). [score:9]
AGE -induced miR-200b and miR-200c down-regulation leads to an increase in the expression of their target genes, RhoA and ROCK II in HUVEC, respectively. [score:8]
Following miRNA-200b inhibitor transfection, a time -dependent decrease of miR-200b expression was observed, with nadir levels obtained at 72 h, and the expression of miR-200b increasing thereafter (Figure 4). [score:7]
Similarly, advanced glycation end (AGE) induced down-regulation of miR-200b in HUVEC (Wu et al., 2014) and a down-regulation of miR-200b was observed in the retina in a diabetic rat mo del (McArthur et al., 2011). [score:7]
MiR-200b is down-regulated in glioma tissues and this down-regulation is correlated with a poor prognosis in gliomas (Peng et al., 2013a; Liu et al., 2014). [score:6]
Direct targeting of SUZ12/ROCK2 by miR-200b/c inhibits cholangiocarcinoma tumourigenesis and metastasis. [score:6]
Figure 10 MiR-200b inhibits the expression of RhoA and ROCKII by targeting their 3′-UTR. [score:6]
Microarray, combined with confirmatory quantitative RT-PCR analyses revealed a significant deregulation in miR-200b in the RMP7 group, which led to an increased expression of their target genes, RhoA and ROCK II. [score:6]
MicroRNA-200b suppresses arsenic-transformed cell migration by targeting protein kinase Cα and Wnt5b-protein kinase Cα positive feedback loop and inhibiting Rac1 activation. [score:6]
MiR-200b directly targeted RhoA and ROCKII, initiating a signaling cascade that resulted in changes of RhoA and ROCKII gene expression, stress fiber formation, TJ protein disassembly and an increase in BTB permeability. [score:5]
Overexpression or silencing of MiR-200b regulates the expression of RhoA and ROCKII. [score:5]
After being treated with RMP7, the expression of miR-200b was significantly down-regulated by 3.3 ± 0.6-fold as compared with that of the BTB control group (Figure 1B). [score:5]
The expression of miR-200b in the anti-miR-200b group was significantly down-regulated by 0.210 ± 0.027 and 0.207 ± 0.027-fold as compared with that of the control and anti-miR-con groups, respectively (Figure 4). [score:5]
The target genes of miR-200b were predicted with the help of Bioinformatics software: miRTarBase, MiRDB, Targetscan, Miranda and Pictar (http://mirtarbase. [score:5]
Our current data also demonstrate that overexpression of miR-200b could inhibit endothelial leakage and restore normal TEER values in the BTB. [score:5]
Similar results were observed for miR-200b, in that it was also shown to simultaneously regulate ROCKII and SUZ12 gene expression at the post-transcriptional level (Peng et al., 2013b), where ROCKII can participate in the regulation of cytoskeletal signaling events. [score:5]
MicroRNA-200b regulates cyclin D1 expression and promotes S-phase entry by targeting RND3 in HeLa cells. [score:5]
These studies demonstrate that miR-200b and other miRNAs could regulate the Rho-ROCK signal pathway by directly targeting RhoA and ROCK. [score:5]
To further verify whether miR-200b directly targeted RhoA and ROCKII through the predicted binding site, luciferase reporter plasmids containing the Mut-type 3′-UTR of RhoA and ROCKII (RhoA-3′UTR-Mut and ROCKII-3′UTR-Mut) were constructed. [score:4]
Microarray analysis revealed 34 significantly deregulated miRNAs including miR-200b in the BTB as induced by RMP7 and 8 significantly up-regulated miRNAs in the BTB by RMP7 as compared with that observed within the BTB control (Figure 1B). [score:4]
Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion. [score:4]
This assay was used to detect mRNA expression levels of miR-200b in GECs, the efficiency of miR-200b transfection and mRNA expression levels of RhoA and ROCKII in GECs of the BTB. [score:4]
Antagonistic function of the RNA -binding protein HuR and miR-200b in post-transcriptional regulation of vascular endothelial growth factor-A expression and angiogenesis. [score:4]
Recent findings have demonstrated miR-200b results in F-actin rearrangement by directly targeting PKCα (Wang et al., 2014b). [score:4]
MicroRNA-200b targets CREB1 and suppresses cell growth in human malignant glioma. [score:4]
Here we provide evidence demonstrating that miR-200b simultaneously regulated the expression of RhoA and ROCKII which results in F-actin rearrangement, relocalization of occludin and claudin-5, TJ opening and increased BTB permeability. [score:4]
Our results suggest that RMP7 induced miR-200b down-regulation as revealed by microarray and quantitative RT-PCR. [score:4]
These results indicate that RhoA and ROCKII were direct targets of miR-200b with the specific binding site being located at the seed sequence. [score:4]
It has also been reported that miRNA-200b could promote cell cycle and actin cytoskeletal rearrangement by directly targeting RND3, which was considered to be a natural endogenous antagonist of RhoA (Xia et al., 2010). [score:3]
Figure 5 Changes in BTB integrity and permeability after overexpression or silencing of miR-200b. [score:3]
Figure 6 IDV ratio of IS and S in occludin and claudin-5 as detected by Western blot after overexpression or silencing of miR-200b. [score:3]
Figure 7 analysis of occludin, claudin-5 and F-actin in GECs after overexpression or silencing of miR-200b. [score:3]
The sequence of miRNA-200b mimic and inhibitor were as follows: UAAUACUGCCUGGUAAUGAUGAAUCAUUACCAGGCAGUAUUAUU and UCAUCAUUACC AGGCAGUAUUA, respectively. [score:3]
Consistent with our results, Wu et al found that miR-200b and miR-200c mimics also inhibited AGE -induced increases in HUVEC permeability (Wu et al., 2014). [score:3]
These results suggest that miR-200b inhibited the 3′-UTR function of RhoA and ROCKII. [score:3]
The exact mechanism(s) through which RMP7 repressed miR-200b expression as well as an assessment of these effects in in vivo mo dels remains to be determined in future studies. [score:3]
In order to assess whether RhoA and ROCKII were functional targets of miR-200b, luciferase reporter plasmids containing the wild-type 3′-UTR of RhoA and ROCKII (RhoA-3′UTR-Wt and ROCKII-3′UTR-Wt) were constructed. [score:3]
As based upon the results of these analyses, binding of miRNA-200b to both RhoA and ROCKII was observed using MiRDB, Miranda and TargetScan, while use of miRTarBase indicated that binding of miRNA-200b was observed only to ROCKII, and Pictar indicated an absence of miRNA-200b binding to either RhoA or ROCKII. [score:3]
Figure 2 Relative expression of miR-200b as detected by quantitative RT-PCR. [score:3]
Figure 4 Transfection efficiency for miR-200b mimics and inhibitors as detected by quantitative RT-PCR. [score:3]
After transfection for 72 h, the medium was replaced with fresh EBM-2 medium containing 5% fetal bovine serum and the cells were incubated for 96 h. The transfected efficacy of miRNA-200b mimics and miRNA-200b inhibitors were analyzed by real-time PCR. [score:3]
Thereafter, miR-200b expressions gradually increased and were restored to their original basal levels. [score:3]
As shown in Figure 2, RMP7 significantly induced a time dependent decrease in miR-200b mRNA expression, with nadir values being obtained at 10 min after RMP7 treatment. [score:3]
Gnen Sequence Amplicon size Genbank accession number Annealing Temperature RhoA(F) 5′-TCTGTCCCAACGTGCCCATC -3′ (R) 5′-CCCAAAAGCGCCAATCCTGT -3′ 149 NM_001664.2 60°C ROCKII(F) 5′-CTCCATTTTATGCGGATTCACTTG-3′ (R) 5′-TGATTTCTTCCACCCCATTTCTC-3′ 171 NM_004850.3 60°C GAPDH(F)5′-AAATCCCATCACCATCTTCCAG -3′ (R) 5′-TGATGACCCTTTTGGCTCCC -3′ 149 NM_002046.4 60°C The miRNA-200b mimics (GenePharma, Shanghai, China), miRNA-200b inhibitors (GenePharma, Shanghai, China) and their negative control molecules were synthesized by GenePharma. [score:3]
When collating these findings with our current results it appears that low expressions of miRNA-200b play a key role in a number of physiological and pathological processes. [score:3]
As indicated by gene ontology analysis, a predominant effect of miR-200b targets involve that of a widespread, coordinated control of actin cytoskeleton dynamics. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
miR-200b as a prognostic factor targets multiple members of RAB family in glioma. [score:3]
MiR-200b directly targeted RhoA and ROCK by binding to specific sites which mediate RMP7 -induced changes in actin cytoskeleton rearrangement, TJ -associated protein redistribution and BTB permeability. [score:3]
The miR-200 family was recently identified as a suppressor of EMT (Park et al., 2008). [score:3]
Expression levels of miR-200b and other genes were normalized to that of the U6 housekeeping gene and GAPDH by the delta Ct value, respectively. [score:3]
Figure 9 Alteration of RhoA and ROCKII in GECs of the BTB after overexpression or silencing of miR-200b. [score:3]
Quantitative RT-PCR was performed to detect the transfected efficacy of miRNA-200b mimics and miRNA-200b inhibitors. [score:3]
This reduction in miR-200b expression ranked third when considering all deceased miRNAs as determined by gene chip. [score:3]
The seed regions of miR-200b and miR-200c that bind to the RhoA 3′-UTR position in the process of suppressing hepatocellular carcinoma metastasis are also in accordance with our findings, but the seed regions of miR-200b and miR-200c that bind to the ROCKII 3′-UTR position in above-mentioned process were at position 1006-1013, which is inconsistent with our results (Wong et al., 2015). [score:3]
In the present study, we found that RMP7 -induced a decrease in miR-200b expression within GECs of the BTB. [score:3]
RhoA and ROCKII were direct targets of MiR-200b. [score:3]
MiR-200b/200c/429 subfamily negatively regulates Rho/ROCK signaling pathway to suppress hepatocellular carcinoma metastasis. [score:3]
Moreover, miR-200b was shown to have a putative binding site at the 3′-UTR region of RhoA and ROCKII with a 100% conserved sequence as revealed by TargetScan (data not shown). [score:3]
Those transfected with miRNA precursors were divided into 5 groups: (1) controls with no miRNA precursor but containing PBS, (2) pre-miR-con containing a pre-miR negative control precursor, (3) pre-miR-200b containing a miR-200b precursor, (4) anti-miR-con containing an anti-miR negative control precursor, and (5) anti-miR-200b containing a miR-200b inhibitor precursor. [score:3]
An inverse relationship was present between the miR-200b and expressions of RhoA and ROCKII. [score:3]
The miR-200b/c 429 cluster is considered to have the same seed region that binds to the target gene mRNA. [score:2]
Tumour angiogenesis regulation by the miR-200 family. [score:2]
Overexpression or silencing of MiR-200b significantly changed a shift from insoluble to soluble fractions in occludin and claudin-5 distribution. [score:2]
Regulation of vascular endothelial growth factor signaling by miR-200b. [score:2]
Our results demonstrate that miR-200b directly binds to RhoA and ROCKII 3′-UTR at positions 133–139 and 912–918, respectively. [score:2]
RMP7 decreased the expression of MiR-200b in GECs. [score:2]
MiR-200b mimics and inhibitors were transfected into GECs. [score:2]
These studies suggest that miR-200b might regulate certain functions of endothelial cells. [score:2]
Verification of transfected efficiency for MiR-200b mimics and inhibitors. [score:2]
Overexpression or silencing of MiR-200b significantly changed the integrity and permeability of BTB. [score:2]
pre-miR-200b group. [score:1]
Co-transfection of miR-200b and RhoA-3′UTR-Mut or ROCKII-3′UTR-Mut did not change luciferase activity (Figures 10B,D). [score:1]
In addition, miR-200b expression was depleted within arsenic-transformed human bronchial epithelial cells showing highly migratory and invasive characteristics (Wang et al., 2014b). [score:1]
The seed for miR-200b to RhoA and ROCKII 3′-UTR is shown in Figures 10A,C. [score:1]
org/) available on the public miRNA databases were used to predict a binding site between the seed region of miR-200b and 3′-UTR of RhoA and ROCKII. [score:1]
Snail promotes the cell-autonomous generation of Flk1(+) endothelial cells through the repression of the microRNA-200 family. [score:1]
A change (loss or gain) in the miR-200 family of miRNAs is associated with cancer invasion (Magenta et al., 2011). [score:1]
Anti-miR-200b induced formation of stress fibers in the center of the cell (O) and is accompanied by a redistribution of occludin and claudin-5 from cellular membranes to the cytoplasm and nucleus (E,J). [score:1]
Taken together, these results suggest that miR-200b significantly changes the integrity and permeability of the BTB or endothelium. [score:1]
Furthermore, pre-miR-200b decreased the redistribution of occludin and claudin-5 from cellular membranes to the cytoplasm and nucleus and enhanced cellular membrane localization of occludin and claudin-5 in GECs of the BTB (C,H). [score:1]
Anti-miR-200b induced the formation of stress fibers within the center of the cell (Figure 7O), which was accompanied by a redistribution of occludin and claudin-5 from cellular membranes to the cytoplasm and nucleus (Figures 7E,J). [score:1]
Accordingly, these studies lend credence to the possibility that miRNA-200b was closely related to molecular events involved with cytoskeletal rearrangement. [score:1]
HEK 293 T cells were seeded and cultured in 96-well microtiter plates (Corning, NY) for 24 h. HEK 293 T cells were then transfected with the pmirGLO empty vector (marked as “Control”), co -transfected with the wild-type or mutated RhoA and ROCKII 3′-UTR reporter plasmids or transfected with pre-miR-200b or pre-miR-con precursors. [score:1]
pre-miR-200b groups were significantly decreased in comparison with that of the RhoAwt. [score:1]
RhoA and ROCKII were predicted to harbor one highly conservative miR-200b binding site in the 3′-UTR at position 133–139 and 912–918, respectively. [score:1]
Functional characterizations of these miR-200b targets indicate that they constitute sub-networks that underlie the ability of cancer cells to migrate and invade, including the coordination of effects on Rho-ROCK signaling, cytoskeletal remo deling, invadopodia formation and MMP activity (Bracken et al., 2014). [score:1]
The miR-200 family of miRNAs, which includes miR-200c and miR-141 on chromosome 12 and miR-200a/b and miR-429 on chromosome 1, have been extensively studied as related to the epithelial-to-mesenchimal transition (EMT) of cancer cells. [score:1]
Wild-type RhoA and ROCKII 3′-UTR reporter plasmids (RhoA wt and ROCKII wt) and mutated-type RhoA and ROCKII 3′-UTR reporter plasmids (RhoA mut and ROCKII mut) were cloned to pmirGLO-promoter vector according to the miR-200b seed sequence (GenePharma, Shanghai, China). [score:1]
As shown in Figure 9, both mRNA and protein expressions of RhoA and ROCKII were decreased in the pre-miR-200b group as compared with the control and pre-miR-con groups, but increased in the anti-miR-200b group as compared with the control and anti-miR-con groups. [score:1]
As shown in Figure 6, a clear shift from insoluble to soluble fractions of occludin and claudin-5 distribution was observed in the pre-miR-200b and anti-miR-200b groups as revealed by Western-blot. [score:1]
Furthermore, pre-miR-200b decreased the redistribution of occludin and claudin-5 from cellular membranes to the cytoplasm and nucleus while enhancing cellular membrane localization of occludin and claudin-5 in GECs of the BTB (Figures 7C,H). [score:1]
pre-miR-200b con. [score:1]
MicroRNA-200b regulates vascular endothelial growth factor -mediated alterations in diabetic retinopathy. [score:1]
Moreover, miR-200b mimics prevent glucose -induced increases in permeability and angiogenesis within the retina of diabetic rats (McArthur et al., 2011). [score:1]
pre-miR-200b and ROCKII wt. [score:1]
Pre-miR-200b reduced the number of central stress fibers and strongly enhanced cell peripheral localization of F-actin in GECs of the BTB (M). [score:1]
Moreover, findings demonstrating that the seed region of miR-200b binds to the RhoA 3′-UTR position are consistent with our findings (Peng et al., 2013b). [score:1]
Pre-miR-200b reduced the number of central stress fibers and strongly enhanced cell localization of F-actin within the periphery of GECs in the BTB (Figure 7M). [score:1]
[1 to 20 of 99 sentences]
8
[+] score: 286
In addition, high expression of miR-200b inhibited cell proliferation, induce apoptosis and act on cell cycle by targeting Sp1, which was identified as a direct and functional target of miR-200b. [score:10]
Taken together, these results suggested that miR-200b down-regulated Sp1 expression by directly targeting its 3′UTR. [score:9]
By employing open access softwares (TargetScan, miRBase Targets and PicTarget), transcription factor Sp1 was chosen as a preferred candidate target gene of miR-200b because of the 3 complementary sites of miR-200b in its 3′-UTR (Fig. 4A). [score:9]
To better understand the role of miR-200b in the development of BC, we transfected the cell line MCF-7 (as mo del cell lines for miR-200b high expression) with 50 nM miR-200b inhibitor, and MDA-MB-231 cells (as mo del cell lines for miR-200b low expression) were transfected with miR-200b mimics as well as their NCs, respectively. [score:8]
As miR-200b is down-regulated in BC and targets Sp1 by binding to its 3′UTR, we next determined whether Sp1 mRNA expression is negatively associated with miR-200b levels in the BC tissue samples. [score:8]
To determine whether deregulation of Sp1 is involved in regulation of cell growth, apoptosis and cell cycle by miR-200b, we cotransfected MCF-7 cells with miR-200b inhibitor and si-Sp1 as described in Figure 6C, the expression of Sp1 was confirmed by Western blotting. [score:7]
As shown in this research, enforced miR-200b expression significantly inhibited BC cell growth, induce apoptosis and arrest cell cycle by targeting Sp1. [score:7]
miR-200b down-regulate Sp1 by directly targeting its 3′UTR. [score:7]
On the contrary, transfection of anti-miR-200b resulted in an up-regulation in the Sp1 mRNA expression in MCF-7 (P < 0.05). [score:6]
Fig 5Relative expression levels of miR-200b and Sp1 up-regulation in breast cancers. [score:6]
In agreement with the above study, our data showed that high Sp1 expression was associated with low miR-200b levels in BC (P < 0.001) and Sp1 is a direct functional target of miR-200b. [score:6]
The results demonstrated that patients with low miR-200b expression had a significantly poorer prognosis than those with a high miR-200b expression. [score:5]
MiR-200b expression affects cell proliferation, apoptosis and cell cycle distribution in vitroIn addition, the expression of miR-200b in four BC cell lines and normal breast epithelial cell line was determined by qRT-PCR. [score:5]
We found that the expression of miR-200b was suppressed in both BC tissues and cancer cell lines. [score:5]
Taken together, these data demonstrated that Sp1 was a functional target of miR-200b and involved in miR-200b -induced suppression of BC cell growth. [score:5]
Similarly, western blot analysis showed that enforced expression of miR-200b triggered a silencing effect on the endogenous Sp1 protein expression (Fig. 4B). [score:5]
Supporting this notion, we and colleagues used TargetScan algorithm to search for putative protein-coding gene targets of miR-200b, especially for those that have the abilities to promote tumour cell proliferation and apoptosis. [score:5]
To further confirm the possibility that miR-200b targets Sp1, the target sequences of Sp1 3′UTR (WT) or the mutant sequence (mutant type, MUT) were cloned into the luciferase reporter vector, respectively. [score:5]
Previous study reported that miR-200 high expression inhibited tumour growth and metastasis in lung adenocarcinoma 29. [score:5]
Cell proliferation and flow cytometric analysis showed that si-Sp1 could inhibit BC cell growth, increase cancer cell apoptosis, affect cell cycle (Fig. 6B, D and E), which resembled the inhibitory effects of miR-200b on the BC cell. [score:5]
To analyse the mechanisms by which ectopic miR-200b expression inhibited cell proliferation, flow cytometric analysis of cell cycle and apoptosis was applied. [score:5]
Meanwhile, the miR-200b inhibitor decreased the miR-200b expression by 1.51-fold in MCF-7 (Fig. 3B, P < 0.01). [score:5]
In our study, high expression of miR-200b significantly suppressed cell proliferation of MDA-MB-231 cell by 11.69 ± 2.17% compared with its control. [score:4]
Those results suggested that the Sp1 expression is regulated by miR-200b in BC. [score:4]
Sp1 was up-regulated in BC tissues and was inversely correlated with miR-200b levels. [score:4]
Furthermore, high expression of miR-200b significantly suppressed cell proliferation of MDA-MB-231 cell by 11.69 ± 2.17% compared with its control (P < 0.01, Fig. 3D). [score:4]
To further examine whether miR-200b exerts its tumour suppressor function through dysregulation of Sp1, we performed functional analyses on Sp1. [score:4]
In this study, we found that miR-200b was frequently down-regulated in both BC tissues and cell lines. [score:4]
The low miR-200b expression group showed a reverse correlation with higher incidence of late TNM stage (P = 0.0136), negative ER (P = 0.0115) and positive HER-2 status (P < 0.001) respectively. [score:3]
Expression of miR-200b is decreased in BC tissues. [score:3]
Moreover, miR-200b showed tumour-suppressive activity in human malignant glioma 30. [score:3]
And the miR-200b inhibitor promoted the growth of MCF-7 cells by 21.93 ± 2.07% respectively (P < 0.05, Fig. 3E). [score:3]
Furthermore, the low expression of miR-200b was associated with late TNM stage, negative oestrogen receptor (ER), positive human epidermal growth factor receptor 2 (HER-2) status. [score:3]
Furthermore, the MDA-MB-231 cell was transfected with miR-200b and then examined for Sp1 expression by qRT-PCR and western blot. [score:3]
In our study, we found that miR-200b was down-regulated in both BC tissues and cell lines compared with their corresponding non-tumourous controls. [score:3]
Accordingly, these results suggest that miR-200b might be useful as a prognostic marker to predict survival and a novel tumour suppressor miRNA in BC. [score:3]
In addition, high expression of miR-200b could affect cell proliferation, apoptosis and cell cycle distribution of BC. [score:3]
Fig 1Relative expression levels of miR-200b in both breast cancer tissues and cell lines. [score:3]
In addition, the expression of miR-200b in four BC cell lines and normal breast epithelial cell line was determined by qRT-PCR. [score:3]
MiR-200b, a member of miRNA-200 family, functions as tumour suppressor in a wide range of human malignances, including BC, colorectal cancer, pancreatic cancer 14– 16. [score:3]
As shown in Figure 4C, the miR-200b transfection led to an obvious decrease in SP1 mRNA expression (P < 0.05). [score:3]
Therefore, the expression level of miR-200b was significantly decreased in BC tissues. [score:3]
All the RNA oligonucleotide sequences used were as follows: hsa-miR-200b mimics: 5′-CAUCUUACUGGGCAGCAUUGGA-3′; miR-NC: 5′-UUCUCCGAACGUGUCACGUTT-3′, miR-200b inhibitor: 5′-UCAUCAUUACCAGGCAGUAUUA-3′. [score:3]
Recently, the expression pattern and function of the miR-200 family has been wi dely studied in various cancers but remains controversial. [score:3]
And in the cell line MCF-7, however, the relative expression level for miR-200b was significantly increased (Fig. 1B). [score:3]
To explore the molecular mechanism of miR-200b in BC, we searched for putative protein-coding gene targets of miR-200b. [score:3]
To gain insights into the role of miR-200b in breast tumourigenesis, we assessed its expression in 278 pairs of BC tissues and their matched non-tumourous breast tissues using qRT-PCR. [score:3]
Only very recently, Natasha Kolesnikoff et al. reported that Sp1 binds to the miR-200b proximal promoter and activates miR-200 expression in epithelial cells, which has implications in cancer early differentiation and for designing interventions to prevent cancer metastasis 32. [score:3]
Breast cancer cells were collected after 48 hrs treatment with 50 nM miR-200b mimic or miR-200b inhibitor and corresponding controls. [score:3]
In addition, a statistically significant inverse correlation was observed by Spearman's correlation analysis between expression levels of miR-200b and Sp1 mRNA in BC tissue (r = −0.6531, P < 0.0001, Fig. 5B). [score:3]
Fig 6Involvement of Sp1 in miR-200b -induced suppression of breast cancer cell growth. [score:3]
Sp1 is involved in miR-200b–induced suppression of BC cell growth. [score:3]
Our results indicated that expression levels of miR-200b were significantly associated with patients' overall survival. [score:3]
In conclusion, miR-200b may not only be a potential prognostic marker for predicting the survival and relapse but may be also a tumour suppressor modulator in BC. [score:3]
Our data confirmed the regulatory function of miR-200b in cancer development and progression step further. [score:3]
As shown in Figure 3A, the miR-200b mimics caused a 3.62 folds increase in the miR-200b expression in MDA-MB-231 cell compared to their NCs (P < 0.01). [score:2]
Furthermore, enforced expression of miR-200b resulted in a dramatic increase of apoptosis in MDA-MB-231 cell compared with its negative control, but also an increased percentage of cells in G2/M phase and a decreased population in S phase, which was accordance with the above studies. [score:2]
Recent study 25 also reported that miR-200b was a valuable marker for gastric cancer prognosis and played an important role in the development and progression of human gastric cancer. [score:2]
MiR-200b expression affects cell proliferation, apoptosis and cell cycle distribution in vitro. [score:2]
And the deregulated miR-200b was correlated with late TNM stage, negative ER and positive HER-2 status. [score:2]
Taken together, these results showed that the miR-200b deregulation may play important roles in BC carcinogenesis, progression and was correlated with a worse prognosis. [score:2]
In view of the vital importance of miR-200b, we further explored the molecular mechanisms underlying BC cell biological behaviour by the regulation of miR-200b. [score:2]
The miR-200 family consists of five members: miR-200a, miR-200b, miR-200c, miR-429 and miR-141, which regulate the transcription factors Zeb1 and Ets-1 as well as Suz12, a subunit of the polycomb repressor complexes 12, 13. [score:2]
Opposite results were obtained in MCF-7 cells, the miR-200b inhibitor significantly reduced the apoptosis rate (25.37 ± 1.83% versus 6.17 ± 1.06%) as compared to that of the anti-miR-NC. [score:2]
As shown in Figure 1A, the results showed that miR-200b expression was significantly decreased in BC tissues compared to that of matched non-tumourous breast tissues with the median fold change, 1.63 (P < 0.01). [score:2]
Mutation was generated in the Sp1 3′UTR by mutating 3 nt that is recognized by miR-200b. [score:2]
And the deregulated miR-200b in BC was correlated with late TNM stage, negative ER and positive HER-2 status. [score:2]
As shown in Figure 3C and F, enforced expression of miR-200b resulted in a dramatic increase of apoptosis in MDA-MB-231 cell from 4.07% ± 0.95% to 16.29% ± 1.64% compared with NC, but also an increased percentage of cells in G2/M phase from 11.69% ± 1.33% to 24.95% ± 2.31% and a decreased population in S phase from 39.67% ± 3.50% to 27.83% ± 1.10%. [score:2]
In a well-characterized series of ovarian carcinomas, low tumoural expression of miR-200 family was significantly associated with high b-tubulin III protein content and had a trend towards poor progress-free survival (PFS) 24, suggesting the potential significance of miR-200 family members as new biomarkers. [score:1]
Furthermore, Sp1 was characterized as the functional target of miR-200b. [score:1]
The final concentration of miR-200b mimic and anti-miR-200b was 50 nm. [score:1]
A total of 100 ng wild-type (WT) or mutant (MUT) reporter constructs were cotransfected with lipofectamine 2000 transfection reagent into the cells with 50 nM miR-200b or miR-NC according to the manufacturer's instruction. [score:1]
TNM stage, ER and HER-2 status, as well as miR-200b, were independent prognostic factors as well (as shown in Table 2). [score:1]
Interestingly, we found that the proliferation, apoptosis and cell cycle promoting effects of anti-miR-200b were partially attenuated by si-Sp1 (Fig. 6F and G). [score:1]
To analyse the significance of miR-200b further in terms of clinical prognosis, a Kaplan–Meier survival analysis was performed (Fig. 2). [score:1]
Meanwhile, the final Cox's multivariate mo del revealed that reduced miR-200b level in tumours were independent predictors of shorter survival. [score:1]
Based on this rationale, four candidate genes GATA4, ROCK1, SP1 and WNT1 were selected in our prophase investigation and finally validated Sp1 was one of targets of miR-200b in BC (data not shown). [score:1]
Furthermore, we studied the correlation between miR-200b expression and clinical pathological characteristics of BC. [score:1]
Clinicopathologic significance of miR-200b in BC patients. [score:1]
Hence, our study was aimed to identify the role of miR-200b in BC. [score:1]
Our results indicate that the expression level of miR-200b might provide useful information in the evaluation prognosis and follow-up schedule guiding for BC patients. [score:1]
Better understanding of the precise molecular mechanism for aberrant miR-200b signalling pathway may help design effective therapeutic modality to control BC. [score:1]
Together with our results, these data suggest that miR-200b may have potential to serve as prognostic biomarker for various cancers including BC. [score:1]
There is growing evidence to suggest that members of miR-200 family are implicated in diverse biological and pathological processes 18. [score:1]
To date, ground-breaking studies have established that miR-200b has been found to be involved in epithelial to mesenchymal transition, formation and maintenance of cancer stem cells, invasion of prostate cancer cells and gastric carcinoma 19. [score:1]
[1 to 20 of 85 sentences]
9
[+] score: 266
They found that miR-200 family inhibitors down-regulated pro-SP-C and SP-B expression. [score:8]
Of note, we did not observe upregulation of the primary direct targets of the miR-200 family in the transcriptome analysis of miR-200b [−/−] lungs. [score:7]
Others have shown that miR-200 is down-regulated in a mouse mo del of fibrotic lung disease and human patients with idiopathic pulmonary fibrosis (IPF) [21]. [score:6]
Our immunofluorescence studies indicate that Vimentin and Twist expression are upregulated in the peripheral lung tissues of miR-200b [−/−] mice. [score:6]
Down-regulation of CDH26 in our knockout lungs can explain the fibroblast-like phenotype of the lungs in our knockout mice and the role of miR-200b in maintaining an epithelial cell phenotype. [score:6]
Knocking down miR-200b in our mice resulted in down-regulation of mature miR-200a and miR-429. [score:5]
Although miR-200a and miR-429 were expressed lower in miR-200b [−/−] lungs, their expression was not undetectable like miR-200b. [score:5]
We transfected BEAS-2B cells with miR-200b inhibitors and 18 h later, we observed 25% less scratch wound closure in the control group, whereas, in cultures transfected with miR-200b inhibitors, wound closure was enhanced by 75%. [score:5]
Xiao P Liu W Zhou H miR-200b inhibits migration and invasion in non-small cell lung cancer cells via targeting FSCN1Mol. [score:5]
Therefore, changes in proteins of the direct gene targets of the miR-200 family might not be reflected in the transcriptome of miR-200b [−/−] lungs. [score:4]
We generated a miR-200b [−/−] (KO) mouse by replacing the complete miR-200b gene by targeted homologous recombination in C57Bl/6N mouse embryonic stem cells using the NorCOMM knockout cassette (online data supplement). [score:4]
The targeted miR-200b gene was highlighted in the resulting knockout allele (KO Allele). [score:4]
Cadherin-26 (CDH26) is another significantly down-regulated mRNA in the miR-200b [−/−] lungs. [score:4]
Palate lung and nasal epithelial clone (Plunc) is one of the mRNAs that was down-regulated more than four times in miR-200b [−/−] lungs. [score:4]
Generation of C57BL/6; miR-200b [tm1.1(NCOM)MFGC] miceWe generated a miR-200b [−/−] (KO) mouse by replacing the complete miR-200b gene by targeted homologous recombination in C57Bl/6N mouse embryonic stem cells using the NorCOMM knockout cassette (online data supplement). [score:4]
miR-200b deficient mice had stiffer lungs due to disturbed distal airway branching, thicker alveolar walls and downregulation of epithelial cell differentiation. [score:4]
Our data suggests that miR-200b is involved in the translation regulation of these genes in the lung. [score:4]
Down-regulation of CYP2A5 suggests the involvement of miR-200b in lung metabolism. [score:4]
Based on our studies, we cannot exclude that downregulation of miR-200a and miR-429 contributed to the observed lung phenotype in miR-200b deficient mice. [score:4]
miR-200b is highly expressed during different stages of lung development. [score:4]
These include the developing inner ear [24], palate [25] and mammary buds [26] (Supplementary Fig. 3), consistent with prior reports suggesting that miR-200b expression is highly coordinated and associated with control of the development of these organs 27– 29. [score:4]
We confirmed complete knockout of miR-200b expression by RT-qPCR in fetal lungs (Fig.   1f) and lungs from 8-week old mice (Supplementary Fig. 5). [score:4]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 Family and Its Targets Regulate Type II Cell Differentiation in Human Fetal LungJ. [score:4]
Yao, Y. et al. MiR-200b expression in breast cancer: a prognostic marker and act on cell proliferation and apoptosis by targeting Sp1. [score:4]
Notably, we observed high LacZ-miR-200b expression in other organs where development also hinges on epithelial-mesenchymal interactions and branching morphogenesis. [score:4]
This down-regulation can result from the removal of the miR-200b gene on the promotor activity or can be a post transcriptional effect of miR-200b on processing of the other microRNAs. [score:4]
Members of the miR-200 family are down-regulated in the lungs of patients with IPF and a mouse mo del of lung fibrosis [21]. [score:4]
Cyp2a5 (cytochrome P450, family 2, subfamily a, polypeptide 5) mRNA is one of the most down-regulated mRNAs in miR-200b [−/−] lungs. [score:4]
We found that miR-200b inhibitors promoted accumulation of fibroblast cell markers following down regulation of miR-200b (Fig.   3g). [score:4]
Based on this high and dynamic expression of miR-200b, we focused first on the role of miR-200b during the early stages of lung development. [score:4]
However, it is unclear at this point what the influence of downregulation of miR-200a and miR-429 on the lung phenotype of miR-200b deficient mice is. [score:4]
Our data suggest that miR-200b is required to achieve the necessary balance in development of lung epithelial cells and fibroblasts to ensure development of a structurally and functionally effective respiratory organ. [score:3]
Our in vivo studies demonstrate a new role for miR-200b in distal lung airway development by regulating epithelial and fibroblast cell differentiation. [score:3]
The cell cultures were washed with PBS to remove the debris followed by transfection with miR-200b inhibitors. [score:3]
Our miR-200b deficient mice have lung function abnormalities, surfactant biophysical dysfunction with compromised pro-Surfactant Protein-C and surfactant protein-B expression. [score:3]
We generated miR-200b [−/−] mice by targeted deletion of miR-200b in ES cells. [score:3]
Here, we show that miR-200b [−/−] lungs have dysfunctional surfactant and compromised expression of these two proteins. [score:3]
Human bronchial epithelial cells, BEAS-2B (ATCC, Manassas, VA, USA), cells were transfected with 0.01 μg/ml of LNA-hsa-miR200b inhibitor or negative control oligonucleotides Exiqon, Denmark). [score:3]
Also, miR-200b can inhibit migration and invasion of non-small cell lung cancer cells [22]. [score:3]
We generated miR-200b [−/−] (KO) mice by replacing the complete miR-200b gene with a LacZ-reporter by targeted homologous recombination in C57Bl/6N mouse embryonic stem cells using the NorCOMM cassette (Fig.   1a,b, Supplementary Fig.   1). [score:3]
Briefly, BEAS-2B cells were plated in 12 well plates and transfected with 0.01 μg/ml of LNA-hsa-miR200b inhibitors or negative control oligonucleotides. [score:3]
In the same study, we found that higher miR-200b expression in the fetal tracheal fluid of CDH fetus is associated with a better response to fetoscopic endoluminal tracheal occlusion (FETO, a prenatal therapy to promote lung growth) [16]. [score:3]
The complete miR-200b non-coding gene (WT allele) was replaced by a NorCOMM cassette via targeted homologous recombination in C57Bl/6N mouse C2 ES cells. [score:3]
We demonstrate for the first time that miR-200b plays a role in peripheral lung development by maintaining an epithelial cell phenotype. [score:2]
To evaluate if the absence of miR-200b resulted in compensatory upregulation of other family members, we assessed the abundance of all family members in fetal lung explants using RT-qPCR (Fig.   1f). [score:2]
Also, miR-200b [−/−]lungs showed higher expression of Twist 1 protein – a transcription factor and marker for EMT - compared to miR-200b [+/+] lungs (Fig.   3e,f). [score:2]
The role of miR-200b during normal lung development has yet to be defined. [score:2]
Shin JO MiR-200b is involved in Tgf-β signaling to regulate mammalian palate developmentHistochem. [score:2]
Using human fetal lung cultures, Benlhabib, et al. showed previously that miR-200 family members regulate epithelial type II cell differentiation and function [33]. [score:2]
Du, J. T. et al. MicroRNA-200 family members are weakly expressed in the neurosensory epithelia of the developing zebrafish (Danio rerio) inner ear. [score:2]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] fetal lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members. [score:2]
The goal of this study was to delineate the role of miR-200b during lung development using loss of function mo dels in vivo. [score:2]
Consistent with development of a low compliance or “fibrotic” lung, miR-200b [−/−] mice also showed significantly higher tissue elastance upon MCh-challenge (12 mg/ml and higher) (Fig.   2b). [score:2]
MiR-200b belongs to the miR-200 family (miR-141, miR-429, miR-200a, miR-200b and miR-200c) and regulates epithelial-to-mesenchymal transition (EMT) in cancer and organ fibrosis 17– 20. [score:2]
Our data suggest a functional role for miR-200b in development of surfactant properties, resulting in reduced lung compliance in miR-200b [−/−] mice. [score:2]
In contrast to miR-200b/miR-429 [−/−] mice reported by others [23], our miR-200b [−/−] mice carried a lacZ-reporter gene that we exploited to localize miR-200b promoter activity during development (Fig.   1c). [score:2]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cellsSome of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Newborn miR-200b [+/−] and miR-200b [−/−] mice did not display any breathing difficulties after birth, and together, these results indicate that proximal airway branching is not influenced by absence of miR-200b during development. [score:2]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members (Fig.   1f and Supplementary Fig. 5). [score:2]
Mature microRNAs transcribed in the same cluster–miR-200a and miR-429–were still expressed, albeit lower compared to miR-200b [+/+] lungs (wt). [score:2]
We showed that mature microRNAs transcribed in the same cluster - miR-200a and miR-429 - were still expressed, albeit lower compared to miR-200b [+/+] lungs (Fig.   1f, Supplementary Fig. 5). [score:2]
Some of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
MiR-200b [−/−] lungs have decreased distal airway branching, a denser lung parenchyma with thicker alveolar walls, a higher number of fibroblast-like cells and over -expression of a marker for EMT: Twist. [score:2]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungsIn order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
At baseline, airflow resistance in conducting airways (Newtonian resistance) was not different between different groups of mice, but was significantly higher in miR-200b [−/−] mice challenged with high concentrations of MCh (Fig.   2c). [score:1]
miR-200b absence does not affect proximal airway branching. [score:1]
Therefore, we assessed the biophysical function of surfactant from miR-200b [−/−] and miR-200 [+/+] lungs using capillary surfactometry. [score:1]
Using PANTHER Gene Ontology classification system [31], we identified Notch and Wnt signalling among the most affected biological pathways and cytoskeletal as well as immunity proteins among the most affected protein class in miR-200b [−/−] lungs compare to miR-200b [+/+](Fig.   4b,c). [score:1]
These findings suggest a “partial EMT” in the lung parenchyma of miR-200b deficient mice. [score:1]
Generation of C57BL/6; miR-200b [tm1.1(NCOM)MFGC] mice. [score:1]
Finally, miR-200b [−/−] mice demonstrated significantly lower hysteresivity (elastic hysteresis) in pressure-volume loops obtained before and after MCh challenge, consistent with the increased elastance we observed in these animals (Fig.   2d, Supplementary Fig. 4). [score:1]
Thus, both studies suggest that the observed peripheral airway obstruction is due to thicker alveolar walls reducing the airspace inside miR-200b [−/−] lungs. [score:1]
We recently discovered that miR-200b is elevated in abnormal lungs of human CDH babies. [score:1]
Eight-week-old male miR-200b [+/+](wt) or miR-200b [−/−] (ko) mice (at least six mice for each group) were anesthetized with intra-peritoneal sodium pentobarbital (90 mg/kg). [score:1]
For mice lung explant culture, lungs were isolated from E11.5 embryos (offspring from a miR-200b [+/−] cross) and transferred to porous membranes (IsoporeTM) filters with dimensions of 1 mm × 1.5 mm pore size (Millipore, USA) in a 12-well plate for a semidry floating explant culture and cultured for four days in a 1:1 mixture of DMEM and Ham’s F-12 Nutrient supplemented with 100 μg/ml streptomycin, 100 units/ml penicillin, 0.25 mg/ml ascorbic acid. [score:1]
miR-200b [−/−] mice have higher lung tissue damping and elastance with lower hysteresivity. [score:1]
Three miR-200b [−/−] and three miR-200b [+/+] 8-week-old lungs were inflation-fixated and embedded in paraffin. [score:1]
To evaluate the effect of miR-200b on maintaining human bronchial epithelial cell phenotype, we transfected BEAS-2B cells with miR-200b inhibitors and performed double-immunofluorescence with cytokeratin and vimentin to mark epithelial cells and fibroblasts, respectively. [score:1]
Using in vivo micro-CT scanning on alive animals, we found higher parenchymal density with significantly less air-filled distal alveoli in miR-200b [−/−] mice. [score:1]
miR-200b absence was confirmed. [score:1]
Although miR-200c has the exact same seed sequence as miR-200b, the abundance of this microRNA along with miR141 was not changed in lungs and kidneys of 8-week old miR-200b [−/−] mice suggesting the absence of any compensatory effects of these two miR-200 family members in miR-200b deficient mice. [score:1]
Our miR-200b [−/−] mice did not show any obvious breathing problems after birth, but lung function studies demonstrated severe peripheral airway obstruction in 8-week-old miR-200b [−/−] mice. [score:1]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cells. [score:1]
Our current findings revealed that the three most affected biological processes in miR-200b [−/−] mice lungs were related to cell cycle, apoptosis and protein transport (Fig.   4d). [score:1]
Hertzano R Cell type-specific transcriptome analysis reveals a major role for Zeb1 and miR-200b in mouse inner ear morphogenesisPLoS Genet. [score:1]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungs. [score:1]
Removal of the hβact promoter driven ∆TK1-T2A-neomycin cassette was performed by mating male miR200b [tm1(NCOM)MFGC] mice harboring the miR-200b KO allele with female CMV-Cre transgenic mice. [score:1]
Taken together, these results indicate that even though miR-200b [−/−] mice do not experience obvious breathing difficulties, their lungs display a functional phenotype similar to lung fibrosis and lung hypoplasia observed in children with CDH. [score:1]
Three 8-week-old miR-200b [−/−] or miR-200b [+/+] lungs were inflated intratracheally with 1 ml of 10% formalin via the cannula by gentle infusion. [score:1]
Using NGS analysis, we identified changes in the transcriptome in miR-200b [−/−] lungs. [score:1]
At rest, miR-200b [−/−] mice did not exhibit altered peripheral tissue/airway resistance (tissue damping), however after challenge with methacholine (MCh; 6 mg/ml and higher) a substantive increase in tissue damping was revealed (Fig.   2a). [score:1]
miR-200b maintained human bronchial epithelial phenotype and function. [score:1]
Three miR-200b [−/−] and three miR-200b [+/+] male mice were anesthetized in an anesthetic chamber with 5% isoflurane and scanned for 32 minutes, while the mice were breathing normally under an anesthetic mask, using the SkyScan 1176 x-ray microtomography system equipped with a large format 11 megapixel x-ray camera (Small animal mo del imaging core facility, University of Manitoba). [score:1]
In order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
Like what we observed in fetal lungs, adult miR-200b [−/−] lungs had lower miR-200ba and miR-429 abundance, but no changes in miR-200c and miR-141 abundance (Supplementary Fig. 5). [score:1]
We then scanned three complete sections per lung of three miR-200b [+/+] and three miR-200 [−/−] lungs using an Axio Scan. [score:1]
Others have suggested a role for miR-200b in lung fibrosis before [21]. [score:1]
Taken together, the observed lung function abnormalities in miR-200b [−/−] mice can be due to a mesenchymal-skewed, “fibrosis”-like lung phenotype. [score:1]
We found that the surface tension-reducing capacity of surfactant in miR-200b [−/−] mice was markedly reduced (Fig.   2e), a finding that correlated with compromised labeling of Surfactant protein-B (SP-B) (Fig.   2f,g) and pro-Surfactant Protein-C (SP-C) in these lung tissues. [score:1]
Figure 4Next Generation Sequencing and Gene ontology (GO) showed the most affected pathways in the lungs of miR-200b [−/−] mice. [score:1]
We also observed lower miR-200a and miR-429 in kidney tissues of miR-200b [−/−] mice (Supplementary Fig. 6). [score:1]
These two miR-200 family members share the same transcript with miR-200b. [score:1]
Our lung morphometry studies corroborated these results by showing that the percentage of airspace in miR-200b [−/−] lungs was lower than in miR-200b [+/+] lungs. [score:1]
MiR-200b knockout (ko) mice have denser lung parenchyma (gray area in the peripheral area) and a lower number of distal airways (smaller distance between the large airways). [score:1]
Interestingly, this was not confirmed in our NGS studies of miR-200b [−/−] lungs. [score:1]
To examine if the absence of miR-200b influenced the expression of other family members and therefore contributed to the observed phenotype, we measured the abundance of all miR-200b family members in 8-week-old wt and miR-200b [−/−] lungs. [score:1]
We observed lower percentages of airspace in miR-200 [−/−] lungs (Fig.   3d). [score:1]
Immunofluorescence studies for vimentin showed that miR-200b [−/−] lungs have more vimentin -positive cells, suggesting an increased presence of fibroblasts-like, mesenchymal cells (Fig.   3c,d). [score:1]
Gene ontology analysis showed that different signaling pathways are affected by miR-200b absence. [score:1]
Figure 1Generation and validation of miR-200b [−/−] mice (miR200b [tm1.1(NCOM)MFGC]). [score:1]
Lower levels of Plunc can explain the increased elastance and airway resistance observed in the miR-200b [−/−] lungs. [score:1]
Genotyping data from breeding miR-200b [+/−] x miR-200b [+/−] mice revealed an expected Men delian distribution, indicating that these mice experience no embryonic lethality, and they were viable, fertile and appeared morphologically normal. [score:1]
[1 to 20 of 112 sentences]
10
[+] score: 229
Studies showed that miR-200 inhibits EMT by targeting ZEB1 and ZEB2[52] and our studies showed that overexpression of miR-200a, miR-200b, miR-15a, miR-429, and miR-203 decreased the protein expression of Mesenchymalmarkers i. e. N-cadherin, Vimentin, Snail, β-Catenin (Fig 3A, 3B and 3C) showing these miRNAs can promote mesenchymal to epithelial transition (MET). [score:9]
Ourstudies show that altering the expression of a group of miRNAs that include miR-15a, miR-200a, miR-200b, miR-429, and miR-203 produced a significant down-regulation of the expression of BMI1 in the breast cancer cell lines, MDAMB-231 and BT549. [score:8]
Overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 not only down-regulated the expression of BMI1protein, but also that of RING1A and RING1B, which also belong to PRC1 complex(Figs 1B, 2A and 2B). [score:8]
Interestingly, overexpression of miR-200a, miR-200b and miR-203 in MDAMB-231 cells followed by treatment with SAHA lead to a down-regulation of HDAC1, HDAC2, HDAC6 and HDAC8 protein expression levels when compared to SAHA treated control cells transfected with scramble miRNAas well as cells that were treated with SAHA alone (Fig 6E). [score:7]
Overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 leads to inhibition ofPRC-1 group of protein expression. [score:7]
Our previous experiments demonstrated that the ectopic expression of miR-200a, miR-200b, miR-15a, miR-429, miR-203 inhibited the expression of PRC1 group of protein BMI1. [score:7]
A significant down-regulation in the expression of BMI1 was seen in cells having the ectopic expression of miR-15a, miR-200a, miR-200b, miR-429 and miR-203 when compared to control cells transfected with scrambled miRNAs (Fig 1B). [score:7]
Our results uniquely showed that miR-200a, miR-200b, miR-15a, miR-429, miR-203 significantly down-regulatedprotein expression levels of Ub-H2A in MDAMB-231 and BT-549 cells (Fig 2A and 2B). [score:6]
Interestingly, overexpressionof miR-200a, miR-200b, miR-15a, resulted in the down-regulation of BMI1 and UbH2A in the CD44+ Cancer Stem Cell population of MDAMB-231 cells(Fig 6A, 6B and 6C) demonstrating a definite role in maintaining gene silencing and maintainingcancer stemness. [score:6]
Protein expression of BMI1wasanalyzed by performing western blotting in BT-549 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203. [score:5]
0190245.g002 Fig 2 Expression of BMI1, RING1A, RING1B and Ub-H2A in MDAMB-231(A) and BT549 (B) cells having overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
Protein expression of various HDACs in cells having overexpression of miR-200a, miR-200b and miR-203. [score:5]
S5 Fig Expression of CD44 in CSCs cells having overexpression miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
Expression of BMI1, RING1A, RING1B and Ub-H2A in MDAMB-231(A) and BT549 (B) cells having overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
miR-200a, miR-200b, miR-15a inhibits CD44 expression in CSCs. [score:5]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 were overexpressed in MDAMB-231 cells and the expression of mesenchymal markers, N-cadherin, Vimentin, ZEB-1, snail andβ-catenin were checked at protein level. [score:5]
miR-200a, miR-200b and miR-15a down-regulated BMI1 and Ub-H2A116, CD44 expression when compared to other miRNAs and scramble transfected control cells (Fig 6C and S5 Fig). [score:5]
0190245.g003 Fig 3 Level of expression of N-cadherin, Vimentin, β-Catenin, ZEB-1, Snailin MDAMB-231cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203(A). [score:5]
Our studies with qRT-PCR show that a limited set of miRNAs(miR-200a, miR-200b, miR-15a, miR-429, and miR-203)are up-regulated upon knock-downof PRC1 complex of protein BMI1(Fig 1A). [score:5]
Expression of BMI1, Ub-H2A protein in MDAMB-231cells transfected with Anti-miR- 200a, Anti-miR-200b, Anti-miR-15a, Anti-miR-449, Anti-miR-203 (C) BMI1, RING1A localization in MDAMB-231 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-449, miR-203under confocal microscopy (D, E). [score:5]
Level of expression of N-cadherin, Vimentin, β-Catenin, ZEB-1, Snailin MDAMB-231cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203(A). [score:5]
We also show for the first time that the sensitivity of MDAMB-231 cells to cisplatinand histone deacetylase inhibitor (HDACi) SAHAis elevated upon overexpressing miR-15a and miR-200a, miR-200b, miR-203. [score:5]
The miR-200 family suppresses Epithelial to Mesenchymal Transition (EMT) by regulating ZEB1 and ZEB2transcription factors. [score:4]
We have shown that the miR-200a, miR-200b, miR-15a, miR-429 and miR-203 coordinately regulate expression of PRC1 group of proteins and also affect the rate of Mesenchymal to Epithelial transition (MET) in MDAMB-231 cells. [score:4]
Only miR-200a, miR-200b and miR-203 were up-regulated when MDAMB-231 and BT-549 cells were treated with SAHA, aHDACi. [score:4]
Cooperative effect ofmiR-200a, miR-200b, miR-203 and SAHA down-regulate HDACs inMDAMB-231 cells. [score:4]
To confirm that miR-15a, miR-200a, miR-200b, miR-203 and miR-429, have the binding sites in 3′UTRs of BMI1 and regulates the expression of BMI1 in MDAMB-231, cells were seeded in 12-well plates and co -transfected with the individual miRNA along with wild (wt) BMI1in psiCHECK2 vector as well as with mutant (Mut) BMI1psiCHECK2 reporter plasmids separately. [score:4]
S2 Fig data showing expression of RING1B in MDAMB-231cells upon transfection with miR-15, miR-200a, miR-200b, miR-429 and miR-203. [score:3]
miR-200a, miR-200b, miR-15a, miR-429, miR-203 inhibits migration and cell proliferation. [score:3]
MDAMB-231cells having overexpressedmiR-200a, miR-200b, miR-15a, miR-429, miR-203 were allowed to incubate for 48hrs and plated in a Transwell chamber and further allowed to incubate for 24hrs. [score:3]
indicated a significant increase in miR-200a, miR-200b and miR-203 expression whereas miR-15a, miR-429, did not show any significant change(Fig 6D). [score:3]
miR-200a, miR-200b, miR-15atargets BMI1 in CD44 enriched cancer stem cells (CSCs). [score:3]
After 24 hrs, miR-15a, miR-200a, miR-200b, miR-429 and miR-203 were ectopically expressed and the cells were incubated for 48 hrs. [score:3]
Both MDAMB-231 and BT-549 cells were treated with 2μM of SAHA and the expression levels of miR-200a, miR-200b, miR-15a, miR-429, and miR-203 was checked. [score:3]
Antagonizing miR-15a, miR-200a, miR-200b, miR-429, and miR-203 reversed the effects generated by overexpression of these miRNAsconfirming the roles of these miRNAs on BMI1 protein and Ub-H2A116 (Fig 2C). [score:3]
Expression of miR-15a, miR-200a, miR-200b, miR-429, miR-203 were elevated in BMI1 knock-down samples in both MDAMB-231 and BT-549 cells compared to un -transfected MDAMB-231 and BT-549 cells that served as control(Fig 1A). [score:3]
After 24 hrs, miR-15a, miR-200a, miR-200b, miR-429 and miR-203 were ectopically expressed and the cells were incubated for 24 hrs. [score:3]
studies showed a reduced N-cadherin, Vimentin signal upon miR-200a, miR-200b, miR-15a, miR-15a, miR-429, and miR-203 overexpression compared to control cells transfected with scramble miRNA vector(Fig 3B and 3C) confirming that miR-200a, miR-200b, miR-15a, miR-429, and miR-203 plays a very crucial role in METby regulating BMI1. [score:3]
Cells were transfected with overexpressedmiR-200a, miR-200b, miR-15a, miR-429, miR-203, and subjected to treatment with 5 μg/ml of cisplatin. [score:3]
Tocorroborate specifically that these miRNAstarget BMI1, MDAMB-231 cells were transfected with anti-miR-15a, anti-miR-200a, anti-miR-200b, anti-miR-429 and anti-miR-203. [score:3]
Protein expression of BMI1 and Ub-H2A in CD44+ population transfected with miR-200a, miR-200b, miR-15a, miR-429 and miR-203 (C). [score:3]
To see whether these miRNAs have any effect on the expression of Ki-67, which in turn controls cell proliferation, we performedimmunocytochemistry and western blotting studies in MDAMB-231 cells transfected withmiR-200a, miR-200b, miR-15, miR-429, miR-203. [score:3]
Cell viability assay upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 miR-302 in MDAMB-231 cells. [score:2]
S6 Fig cell proliferation assay upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-302 in MDAMB-231 cells. [score:2]
miR-200a, miR-200b, miR-15a, miR-429, miR-203 regulate PRC1 proteins in MDAMB-231 cells. [score:2]
S7 Fig Trypan Blue assay shows cell viability upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-302 in MDAMB-231 cells. [score:2]
Also to check the cell viability upon overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203 we perfomed the trypan blue assay. [score:2]
Anti-proliferative activity of miR-200a, miR-200b, miR-15a, miR-429, miR-203 in various cancers has been previously reported [25, 27]. [score:1]
To further our observation we next performed immunocytochemistry in MDAMB-231 cells transfected with miR-200a, miR-200b, miR-15a, miR-429, and miR-203. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 reduces rate of migration invasion and anchorage-independent growth ofMDAMB-231 cells. [score:1]
After 24 hrs, cells were transfected with miR-200a, miR-200b, miR-15a, miR-429 and miR-203. [score:1]
The binding sites of the miR-200a, miR-200b, miR-15a, miR-203 and miR-429 on BMI1 3’ UTR and EZH2 3’ UTR were identified with the help of the software tool, miRTarBase (http://mirtarbase. [score:1]
Here we illustrate the unique role of miRNAsin their dramatic participation in breast cancer cells and our data demonstrates that the levels of PRC group of proteins in breast cancer cell lines MDAMB-231 and BT-549 can be altered by using the miRNAs i. e. miR-200a, miR-200b, miR-15a, miR-429and miR-203 which have possible binding sites at the 3’UTR sequences of BMI1. [score:1]
These results conclude that miR-200a, miR-200b, miR-15acould reduce cancer stemness thorough repressing BMI1 protein. [score:1]
No significant change was observed upon co-transfection of Mut-3’BMI1 UTR with miR-15a, miR-200a, miR-200b, miR-429, and miR-203(Fig 1D). [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-302 reduced cell proliferation in MDAMB-231 cells. [score:1]
To see whether the same set of miRNAs produce any effect on anchorage independent growth, MDAMB-231 cells transfected with miR-15a, miR-200a, miR-200b, miR-429, miR-203were trypsinized after 48hrsof incubation and further allowed to incubate in soft agar for 3 weeks. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, miR-203reduces cell proliferation of MDAMB-231 cells. [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-203 weretransfected into both MDAMB-231(Fig 2A) and BT-549 (Fig 2B) cells. [score:1]
The vector with the wild-type BMI1 3’UTR was co -transfected along with miR-15a, miR-200a, miR-200b, miR-429, and miR-203 respectively into MDAMB-231 cells. [score:1]
miR-200a, miR-200b, miR-15a, miR-429and miR-203 promote Mesenchymal to Epithelial transition. [score:1]
Antagonizing miR-200a, miR-200b, miR-15a, miR-429, and miR-203 enhances BMI1. [score:1]
4100372–001), anti-miR-200b (Exiqon, cat #. [score:1]
miR-15a, miR-200a, miR-200b, miR-429 and miR-203 showed a clear binding to the 3’UTR of BMI1 (S1 Fig). [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-203 were transfected to BT-549 and MDAMB-231cells in 60 mm dishes and the cells were incubated for 48 hrs. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 could bring an exciting new dimension in the field of clinical management of human cancer in coming future. [score:1]
wt-BMI1 3’ UTR and Mut-BMI1 3’UTR were overexpressed along with miR-200a, miR-200b, miR-15a, miR-429, miR-203 and luciferase activity was measured (C,D). [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 were transfected into the cells. [score:1]
PMIRH200PA-1, miR-200b Cat#. [score:1]
miR-200a, miR-200b, miR-429, and miR-203 induce Mesenchymal to Epithelial transition. [score:1]
Levels of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 in MDAMB-231 and BT-549 cells treated with SAHA. [score:1]
[1 to 20 of 71 sentences]
11
[+] score: 207
Importantly, overexpression of miR-200b in MDA-MB-231 and 4T1 cells inhibited Kindlin-2 expression, concomitant with downregulation of EMT genes, while it also resulted in a significant reduction of the metastatic burden in vivo. [score:10]
Mechanistically, we found the Kindlin-2 regulation of EMT is mediated through microRNA miR-200b, an established master regulator of EMT 9, 14. miR-200b specifically targets and regulates Kindlin-2 expression through a conserved seed sequence in the 3′UTR in both the human and mouse FERM2 genes, and expression levels of miR-200b inversely correlate with that of Kindlin-2 and with the aggressiveness of BC cell lines. [score:10]
In addition, targeting and inhibition of Kindlin-2 by miR-200b in BC also resulted in the regulation of the EMT program leading to the inhibition of BC invasion and metastasis in vivo. [score:8]
Our study revealed similar activity of miR-200b in BC by targeting Kindlin-2 in vitro; loss of adhesion and spreading, inhibition of focal adhesion formation, and inhibition of invadopodia and extracellular degradation. [score:7]
Thus, miR-200b specifically binds to its target sequence within the 3′UTR of Kindlin-2 and inhibits its expression. [score:7]
Figure 6The miR-200b -mediated downregulation of Kindlin-2 inhibits BC metastasis. [score:6]
The miR-200b -mediated downregulation of Kindlin-2 inhibits BC metastasis. [score:6]
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
In fact, the miR-200 microRNAs have been established as master regulators of the EMT program in both physiological and pathological conditions 19, 21, 27, 31. miR-200b was recently shown to suppress invasiveness and to modulate the cytoskeletal and adhesive machinery by targeting Kindlin-2 in oesophageal squamous cell carcinoma cells [32]. [score:6]
Zhang HF miR-200b suppresses invasiveness and modulates the cytoskeletal and adhesive machinery in esophageal squamous cell carcinoma cells via targeting Kindlin-2Carcinogenesis. [score:5]
Expression levels of N-Cadherin, Fibronectin and Vimentin were significantly downregulated (p < 0.05) in the tumours derived from the miR-200b-overexressing MDA-MB-231 (miR200) cells compared to the tumours from the control (Scram) counterparts (Fig.   6F–H, respectively). [score:5]
Finally, we assessed the effect of overexpression of miR-200b on expression of EMT markers in the tumours using qt-RT-PCR. [score:5]
MDA-MB-231 cells, which express very low levels of miR-200b, were engineered to express a pmirGlo construct where the wild-type form of Kindlin-2 3′-UTR (Wild-type K2-3′UTR) was subcloned upstream of the luciferase gene (231-wild-type K2-3′UTR). [score:5]
In silico analyses, using several microRNA prediction algorithms (Target Scan, miRanda and PITA), identified microRNA miR-200b as one of the top predicted microRNAs that targets Kindlin-2 (Fig.   5A). [score:5]
Thus, inhibition of Kindlin-2 expression is induced by miR-200b. [score:5]
Overexpression of miR-200b slowed the growth of primary tumours; at the 5-week time point when all the primary tumours were removed, the average volume of the tumours derived from the miR-200 -overexpressing MDA-MB-231 cells (miR200b) was more than 3-fold less (p < 0.01) than those derived from the control (Scram) cells (Fig.   6A). [score:5]
We found the amounts of human DNA present in the lungs of mice injected with the miR-200b-overexpressin MDA-MB-231 (miR200b) to be more that 120-fold less than in the control (Scram) counterparts (Fig.   6D), confirming the inhibitory effect of miR-200b on metastasis. [score:5]
First, we quantified the expression levels of Kindlin-2 and miR-200b in representative BC cell lines, and found Kindlin-2 expression levels to be low in the non-aggressive MCF7 and SKBR3 cells while it was comparatively high in the more aggressive and metastatic BT549 and MDA-MB-231 cells (Fig.   5B). [score:5]
We showed that (i) Kindlin-2 enhances tumour cell adhesion and spreading, as well as formation of focal adhesion complexes; (ii) Kindlin-2 activates the formation of invadopodia structures that are required for the degradation of the ECM; (iii) in in vivo mouse mo dels, Kindlin-2 is required for the spreading and metastasis of BC tumours; (iv) the extent of tumour metastasis depends on the activation of the EMT program as measured by the expression of EMT markers; and (v) the Kindlin-2 -mediated regulation of the EMT program depends on the capacity of miR-200b to regulate the expression levels of Kindlin-2 in tumour cells. [score:5]
Figure 5Kindlin-2 is a direct target of microRNA miR-200b. [score:4]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Having demonstrated that miR-200b specifically targets and inhibits Kindlin-2 expression in vitro, we extended our investigation to in vivo setting in the spontaneous metastasis assay. [score:4]
Kindlin-2 is a direct target of microRNA miR-200b. [score:4]
Collectively, our data provide the underpinnings of a new signalling axis, in which miR-200b regulates Kindlin-2, which in turn regulates EMT, thereby suggesting a novel role of Kindlin-2 in the regulation of BC progression and metastasis. [score:4]
Conversely, when we transfected MCF7, a cell line that expresses high levels of miR-200b, with anti-miR-200b oligonucleotides (Fig.   5F), we observed a ~2-fold increase (p < 0.05) in Kindlin-2 transcript levels compared to the parental MCF7 cells or MCF7 cells transfected with the non -targeting microRNA (NT-miR). [score:4]
MDA-MB-231 cells with stable expression of miR-200b mimics or a scrambled control were injected into the mammary fat pads NSG mice and the metastasis burden was assessed 3 weeks after resection of the primary tumours by quantifying the number of lung metastasis foci. [score:3]
For co-transfection experiments, microRNA mimics or miR negative control (5 nM) or anti-miR200b microRNA inhibitor or anti-miR negative control (20 nM) were added to the transfection mix. [score:3]
Mutation of the seed sequence of miR-200b in the 3′-UTR of K2 (K2 3′UTR with scrambled miR-200 seed sequence) abrogated the effect of the exogenous miR-200b (Fig.   5H); the levels of luciferase activity did not show any significant difference when compared to the control cells or those treated with the non -targeting microRNA (Fig.   5H). [score:3]
To verify that miR-200b represses expression of Kindlin-2 by binding directly to Kindlin-2 transcripts, we used a luciferase gene reporter assay (pmirGlo [25]). [score:3]
Together, these data demonstrate that Kindlin-2 modulates the growth and metastasis of BC tumours through the regulation of the EMT program and this regulation takes place downstream of miR-200b microRNA. [score:3]
Of note, expression levels of miR-200b in these cell lines showed an inverse pattern: High in MCF7 and SKBR3, and low in BT549 and MDA-MB-231 cells (Fig.   5C). [score:3]
Thus, we demonstrate an inverse correlation between Kindlin-2 and miR-200b in the aggressive and mesenchymal BC cells vs their non-aggressive and epithelial counterparts, which strongly suggest the involvement of Kindlin-2 in the miR-200b -mediated regulation of the EMT and that miR-200b is involved in the regulation of Kindlin-2 during this process. [score:3]
Park SM Gaur AB Lengyel E Peter ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2Genes Dev. [score:3]
In fact we showed that the seed sequence of miR-200b is a perfect match to a target sequence in the 3′UTR of Kindlin-2 (Fig.   5A). [score:3]
These cells remained either untreated (Ctrl) or transfected with either a non -targeting micro -RNA (NT-miR) or the miR-200b mimics (miR200). [score:3]
Next, using both western blot (Fig.   5E) and qRT-PCR (Fig.   5F) analyses, we showed that transient transfection of MDA-MB-231 cells with miR-200b resulted in ~60% knockdown (p < 0.05) of Kindlin-2 protein levels (Fig.   5E), compared to the parental cells or those transfected with non -targeting microRNA (NT-miR). [score:3]
Further reinforcing our focus on miR-200b as a potential regulator of Kindlin-2 in BC are published findings that this microRNA is a master regulator of EMT in several cancer types 14, 19– 21. [score:3]
The present study demonstrated that Kindlin-2 function is involved in the enhancement of BC metastasis by regulating the EMT program downstream of microRNA miR-200b. [score:2]
qt-RT-PCR analyses of total RNA from the primary tumours showed that Kindlin-2 mRNA levels were significantly lower in the tumours derived from the miR-200b -expressing MDA-MB-231 (miR200) cells (Fig.   6E) compared to those derived from the control (Scram) counterparts. [score:2]
The miR-200b/Kindlin-2/EMT signalling axis may not be the only mechanisms through which Kindlin-2 regulates cancer metastasis. [score:2]
miR-200b showed a negative correlation: its expression levels were more that 5-fold lower in the 4T07 cells compared to 67NR and was almost undetectable in the 4T1 cells. [score:2]
This study demonstrates that Kindlin-2 supports BC metastasis and does so at least in part by regulating the EMT program downstream of microRNA miR-200b. [score:2]
In the present study, we show that Kindlin-2 is also involved in the process of BC metastatic colonization to the lung by regulating the EMT program downstream of miR-200b. [score:2]
Sossey-Alaoui K Bialkowska K Plow EF The miR200 family of microRNAs regulates WAVE3 -dependent cancer cell invasionJ Biol Chem. [score:2]
Therefore, our study together with the data published by Yu et al. [33] show that EMT and the resultant invasion metastasis cascade in BC seems to be regulated trough a miR-200b/Kindlin-2 feedback loop. [score:2]
We used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), as per the manufacturer’s instructions, to generate the K2 3′-UTR variants, where seed sequences that are recognized by miR200 microRNA were deleted. [score:2]
Thus, we have established a miR-200b ⇔ Kindlin-2 signalling axis as key regulator of the EMT program, which in turn modulates BC tumours progression and metastasis. [score:2]
More importantly the number of lung metastasis foci was reduced by ~4-fold (p < 0.01) in the mice injected with the miR-200b -overexpressing MDA-MB-231 cells (miR200b), compared to their control (Scram) counterparts (Fig.   6B,C). [score:2]
Burk U A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cellsEMBO Rep. [score:1]
Kindlin-2 was also reported to promote BC invasion through epigenetic silencing of members of the miR-200 gene family [33]. [score:1]
In contrast, transfection of the 231-wild-type K2-3′UTR cells with miR-200b mimics (miR200) resulted in ~60% reduction (p < 0.05) in luciferase activity (Fig.   5G). [score:1]
Spaderna S Brabletz T Opitz OG The miR-200 family: central player for gain and loss of the epithelial phenotypeGastroenterology. [score:1]
On the other hand, anti-miR-200b had no significant effect on Kindlin-2 protein levels (Fig.   5E). [score:1]
Korpal M Kang Y The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
The nucleotide sequence and location of the seed sequence with respect to the 3′UTR is shown, as well as its alignment with the miR-200b sequence. [score:1]
The miR-200 family is no stranger to EMT. [score:1]
In fact, miR-200b was almost undetectable in these aggressive BC cell lines, which are of mesenchymal phenotype 22, 23, while it was abundant in the MCF7 and SKBR3 which are of epithelial phenotype (Fig.   5C) 22, 23. [score:1]
[1 to 20 of 57 sentences]
12
[+] score: 204
Interestingly, miR-200b levels were notably decreased after E2F3b up-regulation in SPC-A1 and H1299 cells (p<0.01), while few changes were observed after E2F3a up-regulation (Figure 2B). [score:7]
According to our results, up-regulation of miR-200b or down-regulation of E2F3b could not only enhance docetaxel-resistant LAD cell apoptosis but also arrest cells at G2/M phase, suggesting a stonger mitotic checkpoint and a lower threshold of apoptosis activation brought by the miR-200b/E2F3 feedback loop. [score:7]
In SPC-A1/DTX and H1299/ DTX cells, down-regulation of E2F3b significantly lessened the colony formation amount, and the effect could also be partially reversed by miR-200b inhibitor introduction (p<0.01) (Figure 5C). [score:6]
Coincide with our previous study, the expression levels of miR-200b were enormously down-regulated in both SPC-A1/DTX and H1299/DTX cells in comparison with the parental SPC-A1 and H1299 cells, respectively (p<0.01) (Figure 2A). [score:6]
In both SPC-A1 and H1299 cells, introduction of E2F3b, not E2F3a, resulted in a pronounced up-regulation of miR-200b expression (p<0.01). [score:6]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vitroReal-time quantitative RT-PCT (qRT-PCR) and Western Blot analysis showed that E2F3a and E2F3b levels were notably up-regulated at both mRNA and protein levels in docetaxel-resistant LAD cells compared with the parental cell lines (p<0.01) (Figure 3A). [score:6]
The above results suggested that E2F3b, rather than E2F3a, could negatively regulate miR-200b expression and docetaxel chemosensitivity of LAD cells through direct binding upon miR-200b gene. [score:5]
Moreover, when the binding sequences were mutated, the suppressive effects of E2F3b on luciferase activity were attenuated (Figure 2E), suggesting the direct negative regulation of E2F3b on the promoter region of miR-200b. [score:5]
Quantifications of miR-200b expression in docetaxel-resistant LAD cells (SPC-A1/DTX and H1299/DTX) and their parental cells (SPC-A1 and H1299) before A. and after B. manipulated E2F3a and E2F3b expressions were achieved by qRT-PCR. [score:5]
In addition, miR-200b expression levels were remarkably up-regulated in pSil/shE2F3 groups compared with the control groups in both SPC-A1 (p<0.05) and SPC-A1/DTX cells (p<0.01) via qRT-PCR (Figure 6C). [score:5]
Figure 2Quantifications of miR-200b expression in docetaxel-resistant LAD cells (SPC-A1/DTX and H1299/DTX) and their parental cells (SPC-A1 and H1299) before A. and after B. manipulated E2F3a and E2F3b expressions were achieved by qRT-PCR. [score:5]
Peng et al. reported that miR-200 and its targets Sox2 and E2F3 were engaged in an unilateral negative feedback loop to direct cell-cycle exit and differentiation of neural progenitors [42]. [score:4]
Restoration of miR-200b could boost in vitro and in vivo chemosensitivity of LAD cells by, at least partially, post-transcriptional down-regulation of E2F3, which was critical for the maintenance of normal cell cycle progression [21]. [score:4]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vitro. [score:4]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vivoTo better understand the biological mechanisms underlying E2F3b-related docetaxel resistance of LAD cells in vivo, pSil/shE2F3 and pSil/shE2F3-NC–transfected SPC-A1 and SPC-A1/DTX cells were subcutaneously inoculated into nude mice. [score:4]
Figure 5The role of miR-200b in the in vitro regulation of E2F3b on LAD cellsPcDNA-NC, pcDNA/E2F3b vectors were transfected into SPC-A1 and H1299 cells without (or with) previous transfection of miR-200b mimics; sh-NC, pSil/shE2F3 vectors were transfected into SPC-A1/DTX and H1299/DTX cells without (or with) previous transfection of miR-200b inhibitors. [score:4]
On the other hand, in both SPC-A1/DTX and H1299/DTX cells, miR-200b expression levels were significantly increased after artificial knockout of E2F3 gene (p<0.01) (Figure 3C). [score:4]
The primers used for pSil/shE2F3-1∼3 and pSil/shcontrol were presented in Supplementary Table 1. MiR-200b mimics, miR-200b mimics control, miR-200b inhibitor, and miR-200b inhibitor control were all purchased from GenePharma (Shanghai, China). [score:4]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vivo. [score:4]
The regulation of E2F3a/b on miR-200b expression and chemosensitivity of LAD cells. [score:4]
Now we further demonstrate that miR-200b expression is negatively regulated by E2F3b, suggesting a double -negative feedback loop between E2F3b and miR-200b, which could be a potential mechanism for reversing chemoresistance of LAD. [score:4]
Cell cycle analysis showed that up-regulation of E2F3b dramatically decreased the percentage of cells in G2/M phase in SPC-A1 and H1299 cells, which could be partially reversed by miR-200b introduction (p<0.01), vice versa in SPC-A1/DTX and H1299/DTX cells (p<0.01) (Figure 5E). [score:4]
Based on our previous study, E2F3 was validated as a direct target of miR-200b [21]. [score:4]
The primers used for pSil/shE2F3-1∼3 and pSil/shcontrol were presented in Supplementary Table 1. MiR-200b mimics, miR-200b mimics control, miR-200b inhibitor, and miR-200b inhibitor control were all purchased from GenePharma (Shanghai, China). [score:4]
The sequence of miR-200b inhibitor was 5′-UCAUCAUUACCAGGCA GUAUUA-3′. [score:3]
Based on our previous miRNA microarray data, miR-200b was identified as the most down-regulated miRNA in docetaxel-resistant human lung adenocarcinoma (LAD) SPC-A1/DTX cells compared with parental SPC-A1 cells [20]. [score:3]
In detail, pcDNA-NC, pcDNA/E2F3b vectors were transfected into SPC-A1 and H1299 cells without (or with) previous transfection of miR-200b mimics; sh-NC, pSil/shE2F3 vectors were transfected into SPC-A1/DTX and H1299/DTX cells without (or with) previous transfection of miR-200b inhibitors. [score:3]
C. Quantifications of miR-200b expression in different manipulated LAD cell lines as indicated was also achieved by qRT-PCR. [score:3]
The miRNA 200 family members, consisting of miR-200b, miR-200c, miR-429, miR-200a and miR-141, were considered to be tumor suppressor miRNAs in cancer development and progression [25, 26]. [score:3]
The in vivo effects of E2F3b on miR-200b expression and chemosensitivity of LAD cells. [score:3]
The augment of E2F3b significantly suppressed the luciferase activity of miR-200b luciferase promoter constructs (p<0.01). [score:3]
Figure 6The in vivo effects of E2F3b on miR-200b expression and chemosensitivity of LAD cellsSPC-A1 and SPC-A1/DTX cells were transfected with pSil/shE2F3 or pSil/shE2F3-NC and injected subcutaneously into nude mice. [score:3]
A. Quantification of miR-200b expression was achieved by qRT-PCR. [score:3]
Similarly, the increased colony formation capacity of SPC-A1 and H1299 cells owing to overexpression of E2F3b could be decayed after miR-200b mimics introduction. [score:3]
PcDNA-NC, pcDNA/E2F3b vectors were transfected into SPC-A1 and H1299 cells without (or with) previous transfection of miR-200b mimics; sh-NC, pSil/shE2F3 vectors were transfected into SPC-A1/DTX and H1299/DTX cells without (or with) previous transfection of miR-200b inhibitors. [score:3]
This anti-apoptotic effect was also observed after co-transfection of pSil/shE2F3and miR-200b inhibitors in docetaxel-resistant LAD cells (p<0.01) (Figure 5D). [score:3]
In conclusion, we describe here a novel mechanism in which E2F3b and miR-200b each suppresses the other, suggesting a novel functional double -negative feedback loop. [score:3]
Functional identification of the direct binding of E2F3b upon miR-200b gene. [score:2]
For instance, the regulatory feedback loops such as Notch/miR-326 [32], E2F1/miRNA-223 [33], NF-κB/miR-200b [34], ZEB/miR-200 [22], p53/miR-200 [35] and C/EBPα-miR-34a-E2F3 [36] have been illuminated their molecular networks one after another. [score:2]
S-M Ahn et al. concluded that Smad3 could directly bind to a Smad -binding element located in the promoter region of miR-200b/a and function as a transcriptional activator [29]. [score:2]
Previous studies have explored some possible mechanisms of miR-200 dysregulation in cancer cells at both transcription and epigenetic modification levels. [score:2]
It was found that inhibition of E2F3 significantly elevated the levels of miR-200b in both SPC-A1/DTX and H1299/DTX cells compared with the control groups (p<0.01). [score:2]
QRT-PCR results indicated that the negative regulation of E2F3b upon miR-200b in SPC-A1 and H1299 cells could be abolished by co-transfection of miR-200b mimics, vice versa in SPC-A1/DTX and H1299/DTX cells (p<0.01) (Figure 5A). [score:2]
To further confirm the direct binding and function of E2F3b upon miR-200b, both wild and mutated miR-200b promoter sequences (towards P1 and P2, respectively) were designed and cloned into the pGL4 basic firefly luciferase reporters and co -transfected with E2F3b plasmid vectors into SPC-A1 and SPC-A1/DTX cells (Figure 2D). [score:2]
For instance, Bracken CP et al. showed that ZEB1 and SIP1 could negatively regulate miR-200b∼200a∼429 transcription in Madin-Darby canine kidney (MDCK) cells and human breast cancer cells by binding paired E-box sites [22]. [score:2]
Functional evidence of the direct binding of E2F3b upon miR-200b gene. [score:2]
Bioinformatical evidence of the direct binding of E2F3 upon miR-200b gene. [score:2]
D. Schematic representation of miR-200b gene promoter with the putative E2F3b -binding sites and the sequences of the point mutations. [score:2]
The role of miR-200b in the in vitro regulation of E2F3b on LAD cells. [score:2]
Bioinformatical identification of the direct binding of E2F3 upon miR-200b gene. [score:2]
The results of the present study confirmed the existance of this feedback loop and showed, for the first time, that the double -negative feedback loop between E2F3b and miR-200b could regulate docetaxel chemosensitivity of human LAD cells mainly through cell proliferation, cell cycle distribution and apoptosis. [score:2]
Artificial controls on this circuit through ectopic miR-200b delivery or E2F3b knockoff may be potential reversal strategies in overcoming lung cancer chemoresistance. [score:2]
MiR-200b inhibitor/NC sequence was 5′-UUCUCCGAACGUGUCACGUTT-3′. [score:2]
Moreover, E2F3 was bioinformatically identified as a potential transcriptional regulator of pre-miR-200b gene promoter, suggesting a double -negative feedback minicircuitry comprising E2F3b and miR-200b. [score:2]
E2F3b exerts in vitro functions in a miR-200b -dependent manner in LAD cells. [score:1]
Intriguingly, the increasing effects of E2F3b on the IC50 values for docetaxel could be partially abrogated by co-transfection of miR-200b mimics in SPC-A1 and H1299 cells (p<0.01), vice versa in SPC-A1/DTX and H1299/DTX cells (p<0.01) (Figure 5B). [score:1]
edu/tools/CoreBoost_HM/), two separated promoters (P1 and P2) of miR-200b were identified 4.5 kb and 2 kb upstream the miR-200b gene, respectively (Figure 1A), which was in accordance with previous studies [22, 23]. [score:1]
To determine whether E2F3 could directly interact with miR-200b promoter, chromatin immunoprecipitation (ChIP) assay was applied. [score:1]
C. Quantification of miR-200b in the transplanted tumor tissues by qRT-PCR. [score:1]
On miR-200b/E2F3 signaling pathway [21], E2F3 is a member of the transcription factor E2F family and has two distinct isoforms, E2F3a and E2F3b, which share DNA binding, heterodimerisation and pocket protein binding domains and differ only in their N-termini [37]. [score:1]
Emily C. Knouf et al. identified p73 and p63 as activators of miR-200 family transcription [28]. [score:1]
It was therefore concluded that E2F3b affected cell proliferation, apoptosis, cell cycle distribution, and docetaxel chemosensitivity of LAD cells in vitro, at least partially, in a miR-200b -dependent manner. [score:1]
edu/tools/CoreBoost_HM/) on-line analysis was used to identify the promoter regions of miR-200b (named as P1 and P2). [score:1]
6 and 7 primers corresponding areas within the promoter site of miR-200b, while in SPC-A1/DTX cells, E2F3 regulation site was only located in no. [score:1]
Furthermore, immunostaining analysis and TUNEL staining revealed a lower positive rate of proliferating cell nuclear antigen (PCNA) and Ki67 as well as a higher apoptotic rate of tumors formed from pSil/shE2F3 transfected LAD cells in comparison with the control groups (Figure 6D), suggesting the critical role of E2F3b/miR-200b axis in modulating chemosensitivity of docetaxel-resistant LAD cells in vivo. [score:1]
no:8090/cgi-bin/CONSITE/consite) on-line softwares were performed to find the potential E2F3 binding sites in miR-200b promoter. [score:1]
To determine whether E2F3b affected LAD cell proliferation, apoptosis, and cell cycle distribution in a miR-200b -dependent manner, rescue experiments were performed. [score:1]
Among them, miR-200b was validated as a chemosensitivity restorer in cancers including NSCLC, mainly via signaling pathways of epithelial-mesenchymal transition (EMT), cancer stem cell self-renewal, angiogenesis, cell cycle distribution, and apoptosis [12, 27]. [score:1]
The pLUC firefly luciferase vectors contained empty, wild-type, and mutant miR-200b 3′-UTR sequence, respectively. [score:1]
E2F3b exerts in vitro functions in a miR-200b -dependent manner in LAD cellsTo determine whether E2F3b affected LAD cell proliferation, apoptosis, and cell cycle distribution in a miR-200b -dependent manner, rescue experiments were performed. [score:1]
[1 to 20 of 70 sentences]
13
[+] score: 194
Concurrent down-regulation of TGF-β pathway genes and high levels of E-cadherin and miR-200 expression were revealed in the cancerous cysts by gene expression profiling. [score:8]
The expression of miR-200 targets, ZEB2 and TGF-β2, were increased several folds, without any change in the expression of epithelial protein E-cadherin [87]. [score:7]
Second, kidney tubule-specific knockout of Dicer, the miRNA biogenesis enzyme, led to significant down-regulation in the expression of all five members of the miR-200 family and formation of kidney tubule-derived cysts [16]. [score:7]
Most of the studies on the miR-200 family in cancer research have been focused on the function of this miRNA family in suppressing EMT, leading to E-cadherin overexpression, epithelial cell identity, and cancer metastasis inhibition [3, 18, 19]. [score:7]
Our analysis of the miR-200 expression levels in ovarian cell lines growing in three-dimensional (3D) cultures suggests that the expression of miR-200s shows cluster -dependent co-regulation [6]. [score:6]
This interesting study suggests a mo del for the combined regulatory activity of miR-200c and HuR on TUBB3 expression in ovarian cancer that may not happen in other cell types and provides additional insight into studying potential player(s) that may affect the outcome of miR-200 interaction with target genes. [score:6]
Increased expression of E-cadherin through ZEB1 repression by miR-200b was associated with increased expression of pro-apoptotic genes in the p53 apoptotic pathway and re-sensitized the cancer cells to doxorubicin in breast cancer [110]. [score:5]
A study to analyze miR-200 expression in tissue from patients with or without relapse showed that miR-200b and miR-200c were down-regulated in relapsers compared with non-relapsers. [score:5]
However, studies of clinical samples are not conclusive to relate the expression level of miR-200 family with disease stage. [score:5]
miR-200 family is one of the several miRNAs that have been studied for the diagnosis and prognosis of ovarian cancers [2] and also well known as the master suppressor of epithelial-mesenchymal transition (EMT) for the expression of E-cadherin, the classical calcium -dependent cell–cell adhesion protein to maintain epithelial cell phenotype [3]. [score:5]
Hales et al. reported expression of miR-200a, miR-200b and miR-429 were significantly up-regulated in ovarian tumors compared to normal ovaries [28]. [score:5]
Conversely, Cao et al. reported that elevated expression of miR-200a and miR-200b was associated with advanced stage and high-grade tumors, while high miR-200c expression was only associated with advanced tumors [72]. [score:5]
We have also shown by quantitative reverse transcription-polymerase chain reaction (RT-PCR) that miR-200 pathway genes are up-regulated in microdissected cells derived from ovarian tumor tissues and serous tubal intraepithelial carcinoma (STIC), a precursor lesion for high-grade serous ovarian carcinoma (HGSOC) [32, 33, 45, 46, 47], relative to normal ovarian surface epithelial (OSE) and fallopian tube epithelial (FTE) cells. [score:4]
Tryndyak V. P. Beland F. A. Pogribny I. P. E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cellsInt. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Interestingly, increased expression of miR-200 and E-cadherin was also identified in the laying hen mo del of spontaneous ovarian carcinoma [27, 28], implicating the importance of this conserved pathway in ovarian cancer development. [score:4]
Third, miR-200 knockdown in cultured renal epithelial cells inhibited tubulogenesis and produced cyst-like structures. [score:4]
Hajarnis S. S. Patel V. Aboudehen K. Attanasio M. Cobo-Stark P. Pontoglio M. Igarashi P. Transcription factor hepatocyte nuclear factor-1β (HNF-1β) regulates microRNA-200 expression through a long noncoding RNAJ. [score:4]
Moreover, Sun et al. reported that miR-200b and miR-15b were significantly down-regulated in the chemoresistant tongue squamous cell carcinoma [111]. [score:4]
Regulation of miR-200 family on EMT and E-cadherin expression is well documented [2, 3, 18, 19]. [score:4]
Intriguingly, another study by Zhang et al. showed an opposite function of miR-200 target ZEB1 in EGFR-mutated lung cancer cells. [score:3]
There is no direct evidence on linking miR-200s to ovarian inclusion cyst formation; several lines of emerging evidence suggest that the miR-200 family plays an important role in renal tubule development, renal cyst pathogenesis and spermatogenic cyst formation in yellow catfish. [score:3]
Zuberi M. miR R. Das J. Ahmad I. Javid J. Yadav P. Masroor M. Ahmad S. Ray P. C. Saxena A. Expression of serum miR-200a, miR-200b, and miR-200c as candidate biomarkers in epithelial ovarian cancer and their association with clinicopathological featuresClin. [score:3]
Application of miR-200 antagomirs can reverse EMT caused by the depletion of ERRα molecules, with an increase of Snail expression [68]. [score:3]
The recent Cancer Genome Atlas (TCGA) genomic study of uterine carcinomasarcomas has also shown that sarcomas and uterine carcinosarcomas with extensive sarcoma components showed enhanced promoter methylation and down -expression of miR-200 family [41]. [score:3]
Depletion of IRS-1 partially inhibited the miR-200 -dependent AKT activation [57]. [score:3]
First, the expression of miR-200 family members is reduced in injured kidney tubules, but highly enriched in the normal kidney tubules. [score:3]
2009.11.020 20005803 8. Beclin C. Follert P. Stappers E. Barral S. Nathalie C. de Chevigny A. Magnone V. Lebrigand K. Bissels U. Huylebroeck D. miR-200 family controls late steps of postnatal forebrain neurogenesis via zeb2 inhibitionSci. [score:3]
Ectopic expression of miR-200b and miR-15b with miRNA mimics effectively sensitized the tongue squamous cells to chemotherapy. [score:3]
For ovarian cancer prognosis, several studies have studied the association between circulating miR-200 levels and disease prognosis. [score:3]
In a study to compare pre/post-treatment variations of plasma miR-200b levels in ovarian cancer, patients with reducing plasma miR-200b levels showed a longer progression-free survival than those patients with increasing miR-200b levels, and the patients with increasing miR-200b levels had a higher risk of disease progression [125]. [score:3]
ZEB2 has two predicted miR-200a/141 and five miR-200b/200c/429 seed matches in its 3′ untranslated region (3′-UTR). [score:3]
Pandey A. Singh P. Jauhari A. Singh T. Khan F. Pant A. B. Parmar D. Yadav S. Critical role of the miR-200 family in regulating differentiation and proliferation of neuronsJ. [score:2]
Pecot C. V. Rupaimoole R. Yang D. Akbani R. Ivan C. Lu C. Wu S. Han H. D. Shah M. Y. Rodriguez-Aguayo C. Tumour angiogenesis regulation by the miR-200 familyNat. [score:2]
Further studies with more cell lines and co-culture experiments are required to provide insight into whether exosomal miR-200 transcript levels are associated with ovarian cancer development. [score:2]
HNF-1β binds to a promoter region upstream of the miR-200 genes and directly controls the transcription of the miR-200a/b/429 cluster. [score:2]
miR-200s are highly conserved among vertebrate species and even in bilaterian animals, with miR-8 being the sole homolog of miR-200 in Drosophila melanogaster [7], implying that they possess important functions in a diversity of developmental processes. [score:2]
The miR-200 family is a master regulator of EMT in epithelial ovarian cancer. [score:2]
Gregory P. A. Bracken C. P. Smith E. Bert A. G. Wright J. A. Roslan S. Morris M. Wyatt L. Farshid G. Lim Y. Y. An autocrine TGF-β/ZEB/miR-200 signaling network regulates establishment and maintenance of epithelial-mesenchymal transitionMol. [score:2]
Furthermore, a study to characterize the function of an epithelial cell transcription factor implicated in cancer progression, grainhead-like 2 (GRHL2) in ovarian cancer showed that GRHL2 bound to miR-200 promoters, intronic enhancer of CDH1, and promoters of ErbB3 and other epithelial cell-related genes and positively regulated their expression [78]. [score:2]
Brozovic A. Duran G. E. Wang Y. C. Francisco E. B. Sikic B. I. The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cellsMol. [score:2]
Chung V. Y. Tan T. Z. Tan M. Wong M. K. Kuay K. T. Yang Z. Ye J. Muller J. Koh C. M. Guccione E. GRHL2-miR-200-ZEB1 maintains the epithelial status of ovarian cancer through transcriptional regulation and histone modificationSci. [score:2]
As ErbB3 is essential for growth of EGFR-mutated lung cancer cells, the ZEB1/miR-200 negative feedback loop might potentially provide a cell context -dependent regulation of ErbB3. [score:2]
In our sequential in vitro 3D mo del in collagen I matrix, we noted that migrating HGSOC spheroids tended to release some single cells in the later phase of migration [6], and quantitative real-time PCR also demonstrated that HGSOC samples had a lower level of expression of miR-200 pathway genes compared to other histologic subtypes of ovarian tumors. [score:2]
Herein we review the function of miR-200 on both pathogenesis and other aspects of ovarian cancer, and the potential utility in clinical diagnosis and therapies. [score:1]
miR-200 was reported to associate with chemoresponse in various types of cancer [109]. [score:1]
In human ovary, miR-200 may also have a role in ovarian cyst formation. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. SpadeRNA S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes emt and invasion in cancer cellsEMBO Rep. [score:1]
Two evolutionary-conserved binding sites for the miR-200 members were identified in the 3′-UTR of the polycystin 1 (PKD1) gene. [score:1]
In ovarian cancer, Taylor et al. reported that exosomal miR-200 levels were more elevated in sera from ovarian cancer patients than samples from benign controls [106]. [score:1]
miR-200b, miR-200c and miR-429 (Functional Group I) all share the same seed sequence (5′-AAUACUG-3′), while miR-200a and miR-141 (Functional Group II) both share the same seed sequence (5′-AACACUG-3′), with the two functional groups differing in the seed sequence only by one nucleotide [5]. [score:1]
Moreover, Kan et al. [124] revealed that individual levels of miR-200a, miR-200b and miR-200c normalized to serum volume and miR-103 were significantly higher in the sera of the serous ovarian cancer cohort. [score:1]
In a study of serum miR-200 levels in 74 ovarian cancer patients, both miR-200c and miR-141 were significantly elevated in cancer sera than in healthy control [126]. [score:1]
Koutsaki M. Spandidos D. A. Zaravinos A. Epithelial-mesenchymal transition -associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: Prognostic value and prospective role in ovarian cancer therapeuticsCancer Lett. [score:1]
Despite increase in tumor growth, the miR-200 -dependent stress response could also enhance sensitivity to chemotherapy, indicating its dual function in tumors. [score:1]
Korpal M. Kang Y. The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
The levels of miR-200a in cancer sera samples were found to be six-fold, while the levels of miR-200b and miR-200c were three-fold higher than the levels in normal controls. [score:1]
However, the two miR-200 members showed discordant prognostic values. [score:1]
Feng B. Wang R. Chen L. B. Review of miR-200b and cancer chemosensitivityBiomed. [score:1]
A multivariate mo del combining miR-200b and miR-200c readings showed good predictive power to discriminate serous ovarian cancer patients and healthy controls. [score:1]
Kapetanakis et al. showed that plasma miR-200b levels were significantly higher in ovarian cancer patients than in patients with benign tumors, and suggested that miR-200b can be a complementary biomarker to CA125 [125]. [score:1]
Alternatively, the miR-200 family members can also be categorized in two functional groups based upon the similarities of their seed sequences. [score:1]
Li Z. Yin H. Hao S. Wang L. Gao J. Tan X. Yang Z. miR-200 family promotes podocyte differentiation through repression of RSAD2Sci. [score:1]
2. miR-200 and Ovarian Cancer. [score:1]
ZEB1 carries five putative miR-200b/200c/429 and three miR-200a/141 sites in its 3′-UTR [3]. [score:1]
However, in our view, miR-200 function in epithelial cell identity and maintenance has a positive effect on ovarian cancer cell growth and collective movement in metastasis. [score:1]
Cao Q. Lu K. Dai S. Hu Y. Fan W. Clinicopathological and prognostic implications of the miR-200 family in patients with epithelial ovarian cancerInt. [score:1]
These five miRNAs form two clusters: cluster 1 of miR-200b, miR-200a and miR-429 maps to chromosome 1 (1p33.36), while the miR-200c and miR-141 cluster maps to chromosome 12 (12p13.31) [4]. [score:1]
2.1. miR-200, EMT, and Epithelial Nature of Ovarian Cancer Cells. [score:1]
As mentioned in the Exosome section, Taylor et al. identified elevated exosomal miR-200 levels in the sera of ovarian cancer patients than in benign controls, and the circulating miRNA profiles accurately reflected the miRNA profiles in the tumors [106]. [score:1]
Taken together, the current studies have shown promising results for serum or plasma miR-200 levels as diagnostic and prognostic biomarkers. [score:1]
2.2. miR-200, Collective Movement, and Ovarian Cancer Metastasis. [score:1]
miR-200c and miR-141, but not miR-200b, were reported to be associated with chemosensitivity in ovarian cancer. [score:1]
With the involvement of only two cell lines, Kobayashi’s study is not conclusive to associate the relationship between ovarian cancer cell invasiveness with miR-200 contents in the secreted exosomes. [score:1]
This miRNA family consists of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR429. [score:1]
[1 to 20 of 75 sentences]
14
[+] score: 192
Other miRNAs from this paper: hsa-mir-223, hsa-mir-145, hsa-mir-200c, hsa-mir-494
Taken together, the results suggest that during low oxygen conditions which could occur in various lung pathologies, miR-200b is upregulated and has a direct inhibitory effect on CFTR message and protein expression in human airway epithelial cells. [score:9]
Our studies show that HIF-1 induces miR-200b expression and binds to the target sequence (TS miR-200b) located at the 3′UTR of CFTR mRNA, which further decreases CFTR mRNA and protein expression 1: Figure S1. [score:7]
Analysis of each of the epithelial cell types during prolonged hypoxia revealed that CFTR expression decreased after 12 h during a time when miR-200b was continuously upregulated. [score:6]
b The comparison of miR-200b and miR-200c seed sequences is shown Next, we tested the effects of miR-200b overexpression and inhibition on CFTR mRNA levels after 12 h of hypoxia. [score:5]
The miR-200b target site was predicted in human CFTR 3′UTR only, Hypoxia -induced changes in the expression profiles of miR-200b and miR-200c in Calu3 and 16HBE14o- cells are shown. [score:5]
Using the 3′UTR CFTR luciferase constructs we also demonstrated that miR-200b had a direct effect on luciferase expression, and this clearly established a direct effect on CFTR message levels. [score:5]
In summary, our studies suggest that the HIF-1 dependent physiological changes in miR-200b levels in human airway epithelia under hypoxia contribute directly to CFTR downregulation during hypoxia. [score:5]
b The comparison of miR-200b and miR-200c seed sequences is shown Next, we tested the effects of miR-200b overexpression and inhibition on CFTR mRNA levels after 12 h of hypoxia. [score:5]
Furthermore, stabilization of CFTR protein levels during hypoxia through inhibition of miR-200b’s actions may provide a novel therapeutic opportunity for increasing CFTR expressions levels during various lung pathologies. [score:5]
However, miRNA expression, as well as HIF-1 activity, is often tissue-specific, and therefore we tested whether the induction of HIF-1 activity would affect miR-200b expression in lung epithelial cells. [score:5]
CFTR HIF-1 micro -RNA 200b hsa-miR-200b-3p Cystic fibrosis is a lethal monogenic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) [1]. [score:5]
Since the expression of miR-200b and miR-200c was previously reported to be hypoxia -dependent in human endothelial cells, we tested their expression profiles during hypoxia in the Calu3 and 16HBE14o- cells. [score:5]
Fig. 7Mo del for negative regulation of CFTR expression during hypoxia by HIF-1 and miR-200b. [score:4]
Furthermore, the increase in miR-200b levels correlated negatively with the respective decrease in CFTR mRNA and protein, and supported miR-200b’s role in regulating CFTR expression. [score:4]
The miR-200b upregulation with mimic reduced CFTR mRNA in hypoxia and normoxia in both Calu3 and 16HBE14o- (Fig.   5a). [score:4]
Furthermore, manipulation of the miRNA levels during normoxia and hypoxia using miR-200b mimics and antagomirs decreased and increased CFTR mRNA levels, respectively, and thus established that miR-200b downregulates CFTR message levels during hypoxic conditions. [score:4]
As shown in Fig.   4a, miR-200b overexpression resulted in significantly reduced luciferase expression compared to the no treatment control. [score:4]
Furthermore, in Guimbellot et al. ’s analysis of HT29 colonic epithelial cells, they identified 28 miRNAs that were upregulated during hypoxia, and miR-200b was one of them [4]. [score:4]
Importantly, our results obtained in primary human lung cells confirmed that miR-200b regulates CFTR expression. [score:4]
Using in silico analysis (miRANDA and TargetScan algorithms) of miRNAs induced during hypoxia, we identified miR-200b as a potential novel regulator of CFTR mRNA levels. [score:4]
Furthermore, a similar experiment with miR-200c that has only one base difference in seed sequence from miR-200b did not result in a luciferase signal reduction (Fig.   4b), confirming the direct interaction between miR-200b and its target site at 3′UTR of CFTR mRNA. [score:4]
Hence, in order to exclude indirect effects of miR-200b on CFTR expression, we utilized 3′UTR luciferase reporter. [score:4]
HEK293 cells were used since they express very low endogenous levels of miR-200b/c. [score:3]
Inhibition of miR-200b by antagomiR, however, significantly increased CFTR mRNA levels in both conditions (Fig.   6b), confirming the physiological relevance of results obtained in immortalized cell lines. [score:3]
Briefly, a plasmid containing the 3′ UTR of human CFTR gene was tested in a luciferase gene construct that was co-expressed in human embryonic kidney cells 293 (HEK293) in the presence and absence of a miR-200b analog (mimic). [score:3]
Significant changes (P < 0.05) are marked with an asterisk Given that miRNA levels and function in cancer cell lines often differs from primary cells, we examined miR-200b’s impact on CFTR expression in primary human lung cells (NHBEC Normal Human Bronchial Epithelial Cells) obtained from 3 donors. [score:3]
Similar experiments were performed on control vector that did not contain the miR-200b/miR-200c target site (not shown). [score:3]
a The predicted target site of miR-200b in CFTR 3′UTR is shown above. [score:3]
Significant changes (P < 0.05) are marked with an asterisk Although in our previous studies in human primary endothelial cells (HUVECs), we identified a HIF response element (HRE) consensus in the proximity of miR-200b sequence, the hypoxia mimetics had limited impact on miR-200b’s expression [24]. [score:3]
Significant changes (P < 0.05) are marked with an asterisk Given that miRNA levels and function in cancer cell lines often differs from primary cells, we examined miR-200b’s impact on CFTR expression in primary human lung cells (NHBEC Normal Human Bronchial Epithelial Cells) obtained from 3 donors. [score:3]
miR-200b levels from 2 independent experiments (n = 8) are plotted normalized to RNU48 levels and expressed as a fold change over the NHBEC levels. [score:3]
Importantly, we were able to observe a significance decrease in CFTR protein levels with miR-200b overexpression during normoxia, and a decrease during hypoxia, though it was not significant (P = 0.08) in NHBECs (Fig.   6c). [score:3]
Whereas in Calu3 cells, mimic only had an effect during normoxia, although both cell lines had elevated CFTR protein with the antagomir treatment during hypoxia, confirming the physiological effect of miR-200b CFTR expression during low oxygen levels. [score:3]
The data suggest that miR-200b may be a suitable target for modulating CFTR levels in vivo. [score:3]
The miR-200b levels were elevated to a maximum level at 4 h and that correlated well with HIF-1’s maximal expression, and importantly, miR-200b levels remained elevated throughout the 24-h test period. [score:3]
Furthermore, the inhibition of miR-200b activity with antagomiR increased CFTR mRNA in both cell lines (Fig.   5a). [score:3]
Using this approach, we identified a potential target site for miR-200b/200c at position 529 bases from the stop codon in the 3′UTR of CFTR mRNA (Fig.   3). [score:3]
Final support for the role of miR-200b comes from the negative and positive effects of miR-200b mimics and antagomirs on CFTR expression changes, including the results in the primary airway cells. [score:3]
As shown in Fig.   5b, in normoxia and during hypoxia, miR-200b overexpression resulted in the reduction of CFTR protein levels in 16HBE14o- cells. [score:3]
miR-200b levels from 2 independent experiments (n = 8) are plotted normalized to RNU48 levels and expressed as a fold change over the transfection control. [score:3]
Significant changes (P < 0.05) are marked with an asterisk Although in our previous studies in human primary endothelial cells (HUVECs), we identified a HIF response element (HRE) consensus in the proximity of miR-200b sequence, the hypoxia mimetics had limited impact on miR-200b’s expression [24]. [score:3]
a The levels of miR-200b after 12 h of hypoxia in NHBECs from 3 independent experiments (n = 6) are plotted normalized to RNU44 levels and expressed as a fold change over the normoxia control. [score:3]
Our in silico predictions indicated that miR-200b and miR-200c were putative candidates for CFTR posttranscriptional regulation. [score:2]
We utilized in silico predictive protocols to establish potential miRNAs that could potentially regulate CFTR message stability and identified miR-200b as a candidate molecule. [score:2]
As shown in Fig.   3a, miR-200b was induced up to 2-fold during the hypoxia time course in both cell lines, whereas miR-200c was not elevated and therefore probably not involved in CFTR regulation during hypoxia. [score:2]
a Calu3 and 16HBE14o- cells were transfected with miR-200b mimic or antagomir and the mRNA levels were monitored in qRT-PCR experiments in normoxic conditions and after 12 h of hypoxia. [score:1]
Endogenous levels of miR-200b in NHBEC, Calu3 and 16HBE14o- cells. [score:1]
In parallel, we followed miR-200b analogs effect on CFTR protein levels. [score:1]
miR-200b binds to CFTR’s 3′UTR. [score:1]
Fig. 3Hypoxia induces miR-200b in human airway epithelial cells in a HIF-1 -dependent manner. [score:1]
a HEK293 cells were transfected with 3′UTR CFTR luciferase reporter construct alone (white) or together with miR-200b mimic (grey, left panel) or miR-200c mimic (grey, right panel). [score:1]
miR-200b is induced by hypoxia in a HIF-1 -dependent manner in human lung epithelial cells. [score:1]
miR-200b/c mimics and antagomiRs were used at final concentrations of 10 nM and 20 nM, respectively. [score:1]
TaqMan probes ids used were: CFTR - Hs00357011_m1; 18S - Hs99999901_s1; TBP - Hs4332659_m1; RNU48 – 001006; miR-200b – 002251; miR-200c - 002300. miR-200b mimic (id MC10492) and antagomiR (id MH10492), as well as miR-200c mimic (id MC11714) and antagomiR (id MH11714), were purchased from Ambion. [score:1]
This suggested that miR-200b could have effects on CFTR mRNAs in more than just airway epithelia. [score:1]
miR-200b antagomiR treatment resulted in a significant increase in CFTR protein levels during both normoxia and hypoxia and this supported by the changes in CFTR mRNA as well. [score:1]
miR-200b and miR-200c levels were measured in 3 independent experiments (n = 10) and are plotted relative to RNU44 levels and expressed as a fold change over the untreated controls. [score:1]
miR-200b mimic was used at final concentration of 10 nM. [score:1]
As shown in Fig.   6a, miR-200b was significantly induced ~2.5-fold during hypoxia in NHBECs, while the CFTR mRNA reduced by about 50% during normoxia (P = 0.07) and less so during hypoxia (Fig.   6b). [score:1]
For the specified experiments, miR-200b and miR-200c analogs were cotransfected. [score:1]
Experimental validation was confirmed in two human epithelial cell lines and in human primary lung epithelial cells and the results indicate that during hypoxia, miR-200b decreases CFTR mRNA levels in a time-course dependent manner. [score:1]
As shown in Fig.   3b, CoCl [2] induced HIF-1 activity and resulted in the elevation of miR-200b levels in both Calu3 and 16HBE14o- cells, suggesting that hypoxic induction of this miRNA is HIF-1 dependent. [score:1]
b NHBEC cells were transfected with miR-200b mimic or antagomir and the mRNA levels were monitored in qRT-PCR experiments in normoxic conditions and after 12 h of hypoxia. [score:1]
To differentiate between miR-200b and miR-200c, we found that miR-200b was elevated in both cell lines during hypoxia, whereas miR-200c was not. [score:1]
[1 to 20 of 64 sentences]
15
[+] score: 192
Other miRNAs from this paper: hsa-mir-141, hsa-mir-200c, hsa-mir-200a, hsa-mir-429
H. pylori Up-regulates miR-200b/cThe above data show that the mesenchymal morphology of AGS cells driven either by H. pylori or miR-200b/c loss of function is involving ZEB1 up-regulation, and suggest that miR-200b/c down-regulation could also participate to ZEB1 induction upon infection. [score:10]
ZEB1 expression is inversely correlated to that of miR-200 in the different cell lines tested, with high miR-200b and -200c and low ZEB1 expressions in the human gastric epithelial cell lines, and low miR-200b and -200c and high ZEB1 expressions in HeLa or HEK293 cells (Fig. S3A), accordingly to the reciprocal negative feedback loop linking ZEB1 and the miR-200. [score:7]
The above data show that the mesenchymal morphology of AGS cells driven either by H. pylori or miR-200b/c loss of function is involving ZEB1 up-regulation, and suggest that miR-200b/c down-regulation could also participate to ZEB1 induction upon infection. [score:7]
MiR-200 regulate ZEB1 expression in basal conditions and are up-regulated by H. pylori. [score:6]
In turn, miR-200 post-transcriptionaly silence ZEB1/2 by inhibiting translation of their mRNA. [score:5]
Upper panel, endogenous expression of mature miR-200b or-200c determined by RT-qPCR; bars indicate mean ± SD of miRNA expression normalized to U6 snRNA (n = 5). [score:5]
ZEB1/2 are reciprocally linked to the miR-200 family members in a negative feedback loop, each strictly regulating the expression of the other, thereby controlling both the stability and reversibility of the epithelial versus mesenchymal phenotypes [16]; [20]. [score:4]
In parallel to enhanced mature miRNA levels, up-regulation of the primary miR-200b-200a-429 transcript leading to mature miR-200b production is likewise dependent on H. pylori cagPAI (Fig. 2F), since the isogenic mutants deleted for either cagA or cagE are twice less or not efficient, respectively, for enhancing pri-miR-200b levels. [score:4]
H. pylori Up-regulates miR-200b/c. [score:4]
We identified a mechanism that partly could explain the paradoxical miR-200 up-regulation in infected cells: analyzing miR-200b-a-429 promoter, we unveiled a NF-κB binding site stimulating promoter activity and pri-miR-200b-200a-429 synthesis, and leading to higher miR-200b levels. [score:4]
MiR-200b/c up-regulation was also observed in our previous comparative deep-sequencing data on the miRNome of AGS co-cultured with or without H. pylori [24]. [score:4]
Finally, at 24 hrs post-infection, all the markers were up-regulated: the pri-miR-200b and ZEB1, along with IL-8, by both wt and the CagA- deleted strain, E-cadherin and vimentin by the wt bacteria only. [score:4]
Note worthily, the pri-miR-200b appears then to be transiently down-regulated by 30–40% (Fig. 4B). [score:4]
The mature miR-200b and -200c levels were significantly decreased in AGS and NCI-N87 cells, suggesting that these cell lines keep a track of their previous infection despite the apparent reversibility of ZEB1 up-regulation. [score:4]
To confirm this hypothesis, we analyzed the activity of the miR-200b-200a-429 promoter using the pGL3-prom200b luciferase reporter driven by the 461 base pairs minimal promoter of that cluster, which contains the regulatory elements responsible of epithelial-specific expression [22]. [score:4]
MiR-200 are microRNA (miRNA), small noncoding RNA molecules that post-transcriptionaly regulate gene expression in a variety of biological process [21]. [score:4]
In basal conditions, AGS, MKN-74 and NCI-N87 cell lines perfectly fit to this mo del, since EMT and ZEB1 up-regulation can be achieved solely by manipulation of miR-200b/c levels using antisense oligonucleotides, as in other epithelial cell lines [22]; [23]. [score:4]
In order to understand the mechanism whereby H. pylori paradoxically up-regulates miR-200b, we searched putative binding sites for transcription factors within the pri-miR-200b-200a-429 promoter region, in addition to the paired E-boxes to which ZEB1 must bind to achieve transcriptional repression [22]. [score:4]
An attractive hypothesis of the role of that regulation could be that enhanced cdh1 and miR-200 gene expression in H. pylori-challenged epithelial cells could provide a feedback control that would keep in check the effects of excessive NF-κB -mediated ZEB1 production, impede EMT progression and allow the process to stay reversible. [score:4]
In MKN74 cells, ZEB1 starts rising at 6 hours post-infection independently on CagA, and the pri-miR-200b, E-cadherin and vimentin up-regulations were noticeable only at 24 hrs post-infection with the wt bacteria (Fig. 4 B and C). [score:4]
Figure S4 Up-regulation of miR-200b and miR-200c in MKN-74 and NCI-N87 cells 24 h post infection with cagPAI+ H. pylori (Hp WT) at MOI 100 bacteria/cell. [score:4]
These combined results indicate that 1) the ZEB1 -mediated mesenchymal transition of infected AGS cells depends on NF-κB activation and 2) while stimulating this EMT inducer, NF-κB is also responsible for enhanced expression of the EMT negative regulator miR-200b. [score:4]
Thus, while the activation of the NFκB-ZEB1-miR-200 axis and the concomitant up-regulations of both epithelial and mesenchymal markers upon 24 hr infection is a common feature of the three gastric cell lines, each of them displays specific kinetics in the early time points of infection, likely dependent on their genetic background and their sensitivity to the pathogen. [score:4]
In AGS and MKN74 cells, miR-429, which shares the same seed sequence than miR-200b and -200c, is likewise up-regulated upon infection with wt H. pylori. [score:4]
ZEB1 and miR-200b Up-regulation Both Depend on NF-κB Activation. [score:4]
Figure S3 Post-transcriptional regulation of ZEB1 expression by miR-200b&c. [score:4]
The IκB-related inhibition of the miR-200b promoter activity may be partly due to the inhibition of general transcription activity, since pGL3-p vector activity is also reduced in IκB -transfected cells as compared to control cells (Fig. 3D). [score:4]
CagPAI -dependent miR-200b and -200c up-regulations are also observed in infected MKN-74 and NCI-N87 cells (Fig. S4). [score:4]
We show here that these EMT-like morphological changes, specifically induced by cagPAI+ H. pylori in gastric epithelial cells, are associated to enhanced expression of mesenchymal genes and are regulated by a tripartite NF-κB/ZEB1/miR-200 signaling pathway. [score:4]
This is likely to occur in the co-culture experiments as soon as the first hours of infection and detection of pathogen -associated motives, as well in the inflamed gastric mucosa of chronically infected patients, in which concomitant NFκB activation and ZEB1 and miR-200b over -expressions can be observed. [score:3]
Unexpectedly, we observe a significantly enhanced expression of both miR-200b and miR-200c by wt H. pylori, but not by the Δ cagA or Δ cagE mutants (Fig. 2E). [score:3]
ZEB1 and miR-200 are Overexpressed in Human Gastric Mucosa in the Context of H. pylori -driven Inflammation. [score:3]
Our previous data on AGS miRNA profile indicated that these cells express mainly miR-200b and miR-200c of that family, which share a quite similar sequence [24]. [score:3]
These histological observations of simultaneous NFκB activation and ZEB1, E-cadherin, miR-200 expressions in areas of H. pylori colonization and associated chronic inflammation corroborate our in vitro data on gastric cell lines. [score:3]
Table S2 Expression of the miR-200 family members in gastric epithelial cell lines. [score:3]
Changes in mesenchymal and epithelial gene expression and miR-200 levels. [score:3]
Kinetics of changes in IL-8 induction (A), ZEB1 and pri-miR-200b (B) and E-cadherin and vimentin (C) expressions upon infection. [score:3]
To assess whether ZEB1 is regulated at a post-transcriptional level by the endogenous miR-200b/200c levels, we evaluated ZEB1 translation efficiency using the psiZEB1 luciferase sensor containing ZEB1 3′UTR, which harbors 8 miR-200b/200c pairing sites, downstream to Renilla luciferase coding sequence (Fig. S3C). [score:2]
MiR-200b detected by ISH coupled to phosphatase alkaline activity (in dark blue) is highly expressed in gastric glands of H. pylori–infected case. [score:2]
This promoter region produces a noticeable luciferase activity reaching 50 and 80% of that of the SV40 promoter in AGS and MKN-74 cells, respectively, but not in HEK293 cells (Fig. S5A), in direct relationship with miR-200b levels and inverse relationship with their transcriptional repressor ZEB1 (Fig. S3A). [score:2]
This result excludes that activation of the miR-200b promoter results from enhanced general transcriptional activities in infected cells, and confirms that miR-200b biosynthesis was specifically stimulated upon infection. [score:1]
Luciferase activity generated by psiZEB1 is repressed by 50% as compared to the control vector and totally de-repressed in as200b/c -treated cells, but not in sc200 -treated cells (Fig. S3D), correspondingly to the post-transcriptional regulation of ZEB1 by endogenous miR-200b/c levels. [score:1]
However, the effects of miR-200 overproduction seem to be dominated by those of ZEB1, since infected cells nevertheless undergo an EMT. [score:1]
The miR-200 are produced from two miRNA clusters, miR-200b-200a-429 and miR-200c-141, the promoters of which harbor ZEB1/2 binding sites and are repressed by ZEB1/2 [22]; [23]. [score:1]
See material & Methods S1 for histology processing, immunohistochemistry, in situ hybridization of miR-200b and Helicobacter detection. [score:1]
In AGS cells, both the pri-miR-200b RNA and ZEB1 mRNA start rising during the 2 to 4 hrs post-infection in a quite CagA-independent way, thus paralleling IL-8 changes (Fig. 4B). [score:1]
Collectively, these findings demonstrate the existence of NF-κB/ZEB/miR-200 signaling network that initiates mesenchymal transition of H. pylori-infected gastric cells. [score:1]
Next, we analyzed changes in miR-200b and -200c levels upon infection. [score:1]
The kinetics studies emphasize the temporal relationship between IL-8, ZEB1 and pri-miR-200b changes, all occurring in the first hours of co-culture and likely mediated by the early NFκB activation upon detection of the microbial virulence factors. [score:1]
Contrarily to the miR-200 levels, which appear to be more versatile, ZEB1 could constitute an early marker of these preneoplastic lesions in cagPAI + H. pylori-infected mucosa. [score:1]
Combined to our miR-200b promoter analysis, this points NF-κB as a common transactivator of zeb1 and primiR-200b-200a-429, along with the pro-inflammatory IL-1β, IL-6, or IL-8 genes. [score:1]
This suggests that the enhanced mature miR-200b levels may result from enhanced transcription of its gene cluster in a cagPAI -dependent manner. [score:1]
ZEB1 and miR-200 are Overexpressed in Human Gastric Mucosa in the Context of H. pylori -driven InflammationTo evaluate the in vivo relevance of these findings, ZEB1, miR-200b, E-cadherin expressions and the activation of NFκB were investigated on gastric mucosa tissue sections from patients infected with H. pylori (all with cagPAI positive strains, n = 3) or uninfected (n = 3). [score:1]
Whereas scrambled control oligonucleotide (sc200) affect neither miR-200 levels (Fig. S3B), nor the original cobblestone cell morphology, antisense oligonucleotides (as200b, as200c) specifically decreases by 75% the detectable miR-200b and miR-200c levels (Fig. S3B) and dramatically affects cell morphology, which turns for 62.88±28.53% cells (versus 3.44±1.85% in sc200 -treated cells, n = 9, p<0.001) in an extremely elongated shape similar to the one provoked by H. pylori (Fig. 2A). [score:1]
Human Gastric Tissue Immunohistochemistry and in situ Hybridization of miR-200b. [score:1]
Conversely, global miRNA analyses of H. pylori-infected human gastric mucosa revealed 30 miRNAs significantly decreased in the H. pylori -positive group, among which all the miR-200 family members [40]. [score:1]
In all experiments, AGS cells were infected or not (NI) with cagPAI+ H. pylori (WT) at MOI 100 bacteria/cells for 24 h. (A) Activities of SV40 promoter (pGL3-p), or miR-200b-200a-429 promoter wild type (pGL3-prom200b) or mutated on the NF-κB site (pGL3-prom200b mut); bars represent mean ± SD of relative luciferase activities of each promoter reporter normalized to that of NI pGL3-p transfected cells (n = 3; ** p<0.01). [score:1]
At last, we demonstrated that ZEB1 and miR-200 were both dependent on cagPAI, which activates NF-κB. [score:1]
0060315.g005 Figure 5 H. pylori, ZEB1, p65 NF-κB, E-cadherin immunostaining and miR-200b in situ hybridization in non infected human gastric mucosa (left pannels) or mucosa infected with cagPAI+ H. pylori (right pannels). [score:1]
The other miR-200 family members miR-200a, -141 or -429 are diversely affected by the infection (Table S2B). [score:1]
However, despite ZEB1 induction by H. pylori, the activity of the miR-200b promoter is stimulated in infected AGS (Fig. 3A), as well as in infected MKN-74 cells (Fig. S5B), whereas the SV40 promoter of the pGL3-p reporter remains insensitive to the bacteria. [score:1]
This prompted us to analyze changes in miR-200b/c levels upon infection. [score:1]
At last, chromatin immunoprecipitation (ChIP) assays shows that AGS cells recruit 3 to 4 fold more endogenous NF-κB onto miR-200b, ZEB1 and IL-8 promoters upon wt H. pylori infection (Fig. 3F), indicating that NF-κB directly binds on each of these promoters. [score:1]
Moreover, it abolishes miR-200b promoter activity in both basal and H. pylori-stimulated conditions (Fig. 3E) and subsequently pri-miR-200b-200a-429 overproduction (Fig. 3D). [score:1]
In NCI-N87 cells, miR-200a and miR-141, which belongs to the same clusters than miR-200b and miR-200c, respectively, are also positively affected by infection. [score:1]
This is also the case of the pri-miR-200b RNA in AGS cells. [score:1]
However, in H. pylori-infected conditions, miR-200b/c are increased despite ZEB1 accumulation in the gastric cell lines and their mesenchymal transition. [score:1]
0060315.g003 Figure 3In all experiments, AGS cells were infected or not (NI) with cagPAI+ H. pylori (WT) at MOI 100 bacteria/cells for 24 h. (A) Activities of SV40 promoter (pGL3-p), or miR-200b-200a-429 promoter wild type (pGL3-prom200b) or mutated on the NF-κB site (pGL3-prom200b mut); bars represent mean ± SD of relative luciferase activities of each promoter reporter normalized to that of NI pGL3-p transfected cells (n = 3; ** p<0.01). [score:1]
H. pylori, ZEB1, p65 NF-κB, E-cadherin immunostaining and miR-200b in situ hybridization in non infected human gastric mucosa (left pannels) or mucosa infected with cagPAI+ H. pylori (right pannels). [score:1]
ZEB1 is Repressed by miR-200 in Gastric Epithelial Cells. [score:1]
[1 to 20 of 70 sentences]
16
[+] score: 189
These findings suggest that dysregulation of the three miRNA clusters, namely the downregulation of the miR-200 clusters and the upregulation of the miR-221-222 cluster, is involved in the suppression of apoptosis in both breast CSCs and normal mammary stem/progenitor cells. [score:10]
miR-22 targets the methylcytosine dioxygenase TET (ten-eleven translocation) family members, inhibits the demethylation of the miR-200 promoter, and suppresses the expression of miR-200 [65]. [score:9]
The miR-200 family miRNAs downregulate ZEB1 and ZEB2 expression, and effectively upregulate the cellular E-cadherin level to maintain a cell in a more epithelial-like state (Figure 3). [score:9]
The multiple miRNAs dysregulated in the breast CSCs, such as miR-142, miR-146, miR-200, and miR-141, cooperatively activate the Wnt signaling pathway by targeting or upregulating the expression of its components. [score:9]
ZEB1 suppresses the expression of all miR-200 family members (miR-141, miR-200a,b,c and miR-429), which in turn inhibits the translation of ZEB1 mRNA, resulting in the double -negative ZEB/miR-200 feedback loop [160]. [score:9]
Expression of the miR-200 family miRNAs is downregulated in the breast CSCs and normal mammary stem/progenitor cells, and is upregulated in the more differentiated counterparts. [score:9]
These findings suggest that the downregulation of miR-200 members and upregulation of miR-146 are involved in the activation of the Notch signaling pathway in the breast CSCs and normal mammary stem/progenitor cells. [score:7]
The miRNAs coded in the miR-200b-200a-429, miR-200c-141 and miR-183-96-182 clusters are downregulated, and those in the miR-221-222 cluster are upregulated in the human breast CSCs. [score:7]
These findings suggest that the three miRNA clusters, namely two miR-200 clusters and one miR-183 cluster, coordinately upregulate the expression of Bmi1 to enhance the stem cell self-renewal abilities in both breast CSCs and normal mammary stem/progenitor cells. [score:6]
miR-200 family miRNAs that are downregulated in human breast CSCs and normal mammary stem/progenitor cells function as the suppressors of the Wnt signaling pathways (Figure 3 and Figure 4). [score:6]
miR-8, a Drosophila homologue of miR-200, targets TCF transcription factor and suppresses the Wnt signaling activities [152]. [score:5]
Among them, miR-200b, miR-200c, miR-141, and miR-183 are specifically downregulated in the human breast CSCs and normal mammary stem/progenitor cells [24], suggesting that miRNAs are important regulators of self-renewal abilities in breast CSCs and normal mammary stem/progenitor cells (Figure 3). [score:5]
miR-200 family miRNAs suppress the Notch signaling by targeting Notch pathway components, such as JAG1 and the mastermind-like Notch coactivators, Maml2 and Maml3 (Figure 3) [170]. [score:5]
miR-200b, miR-200c and miR-141 target Bmi1 which suppresses p53 -mediated cell cycle arrest and apoptosis by repressing p19 [Arf](Figure 2 and Figure 3). [score:5]
Downregulation of miR-200 family miRNAs and let-7 family miRNAs is observed in the CSCs of other cancers, such as colon cancer and Wilms tumor, and is associated with cancer progression [48, 49]. [score:4]
The expression of Bmi1 is regulated by miRNAs, such as miR-128, miR-200b/c, miR-141, miR-15, miR-16, miR-203, miR-183, miR-194, and miR-218 [24, 67, 121, 122, 123, 124, 125]. [score:4]
The miR-200 family miRNAs are involved in the regulation stem cell functions by targeting the genes and pathways important for stem cell maintenance, such as self-renewal factor Bmi-1, the apoptosis signaling pathway, the canonical Wnt signaling pathway, EMT and the Notch signaling pathway. [score:4]
The expression of the miR-200 family members can be regulated through interactions with transcriptional factors, modifications of their promoter regions, and Polycomb-group-gene -mediated repression. [score:4]
Because the expression of miR-200 family is downregulated in breast CSCs, analyses of the metastatic CSCs will be required to further characterize the roles of miR-200 family miRNAs in colonization and metastases to distant organs. [score:4]
The mammalian miR-200 clusters are expressed as two separate polycistronic pri-miRNA transcripts. [score:3]
A large number of studies demonstrate the strong suppressive effects of miR-200 on cell transformation, cancer cell proliferation, migration, invasion, tumor growth and metastasis [61]. [score:3]
ZEB1 and ZEB2 can inhibit the transcription of the entire miR-200 family [58]. [score:3]
The miR-200b, -200c and -429 subgroup miRNAs, but not the miR-200a and -141 subgroup miRNAs, target PLCγ1, reduce cell viability and induce apoptosis [71]. [score:3]
The mammalian miR-200 family gained particular prominence because it is involved in the regulation of EMT, EGF signaling, regulation of stem cell characters, and somatic cell reprogramming into induced pluripotent stem cells [24, 56, 66, 67, 68, 69, 70, 71, 72]. [score:3]
The miR-200 family is highly expressed within epithelial cells and miR-200c and miR-141 have both been strongly linked to epithelial integrity [158, 159]. [score:3]
These eight miRNAs are located on the three miRNA clusters and two of the three clusters are the miR-200 clusters, suggesting that the suppression of miR-200 family miRNAs is critically important in the maintenance of stem cell functions. [score:3]
The mammalian miR-200 family clusters are expressed as two separate polycistronic pri-miRNA transcripts: miR-200b-200a-429 and miR-200c-141 clusters (Figure 1). [score:3]
The miR-200 cluster is an extensively studied tumor-suppressive miRNA cluster in the genome (Figure 1). [score:3]
miR-22 targets the ten-eleven-translocation (TET) family of methylcytosine dioxygenases and demethylates the promoter region of the miR-200 precursor [161]. [score:3]
Figure 3 Targeting of the genes and pathways for stem cell maintenance by miR-200 family miRNAs. [score:3]
Kolesnikoff N. Attema J. L. Roslan S. Bert A. G. Schwarz Q. P. Gregory P. A. Goodall G. J. Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: Implications for epithelial-mesenchymal transition J. Biol. [score:3]
The promoter regions of the miR-200 family are bound by multiple transcription factors, including zinc finger E-box binding homeobox 1 (ZEB1) and 2 (ZEB2, also known as SIP1), specificity protein 1 (Sp1), Smad3, Wnt inhibitory factor 1 (WIF1) and p53. [score:3]
The modifications to the promoter regions of each of the miR-200 clusters cause the loss of the expression of the miR-200 family miRNAs in cancer. [score:3]
Therefore, the interplay between the miR-200 family, miR-22, and ZEB1/ZEB2 plays an important role in the stemness regulation and EMT. [score:2]
Brabletz S. Brabletz T. The ZEB/miR-200 feedback loop—A motor of cellular plasticity in development and cancer? [score:2]
Wang G. Guo X. Hong W. Liu Q. Wei T. Lu C. Gao L. Ye D. Zhou Y. Chen J. Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2 -induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generation Proc. [score:2]
The miR-200c-141 cluster is silenced by promoter hypermethylation, whereas the miR-200b-200a-429 cluster is silenced primarily through Polycomb-group–mediated histone modifications [64]. [score:1]
The miR-200 family miRNAs have been highly conserved in deuterostome from Echinodermata and Chordata to all Vertebrata classes, including fish, amphibians, reptiles, birds and mammals [55]. [score:1]
Interestingly, the cooperation between miR-22 and the miR-200 family results in EMT, an elevated pool of stem cells and increased tumorigenesis. [score:1]
Among them, miR-200a, miR-200b and miR-429 are found in all deuterostomes including Echinodermata, Chordata and Vertebrata, but miR-200c and miR-141 are only detected in cephalochordates, teleosts and mammals or in tunicates, teleosts and mammals, respectively. [score:1]
The miR-200 family in mammals is composed of five miRNAs: miR-200a, miR-200b, miR-200c, miR-141, and miR-429. [score:1]
Le M. T. Hamar P. Guo C. Basar E. Perdigao-Henriques R. Balaj L. Lieberman J. miR-200-containing extracellular vesicles promote breast cancer cell metastasis J. Clin. [score:1]
3.1. miR-200 Clusters. [score:1]
The miR-200 family members can also be divided into two subgroups based upon their seed sequences that differ by only 1 nt between the subgroups: miR-200b, -200c, and -429 (AA UACUG) and miR-200a and -141 (AA CACUG). [score:1]
Thus, ZEB1 and ZEB2 keep a cell in a mesenchymal phenotype by repressing the transcription of both E-cadherin and the miR-200 family miRNAs. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells EMBO Rep. [score:1]
The tricistronic miR-200b-200a-429 cluster is located on mouse chromosome 4 and human chromosome 1p36, whose length of transcript is 6464 bp [57]. [score:1]
Furthermore, the metastatic mouse mammary tumor 4T1 cells, but not the poorly metastatic mammary tumor 4TO7 cells, can secrete miR-200 family miRNAs into exosomes [190]. [score:1]
In addition, miR-200 family miRNAs are involved in colonization and metastases to distant organs [195]. [score:1]
Sp1 activates the transcription of the miR-200b-200a-429 [59]. [score:1]
Mongroo P. S. Rustgi A. K. The role of the miR-200 family in epithelial-mesenchymal transition Cancer Biol. [score:1]
Lim Y. Y. Wright J. A. Attema J. L. Gregory P. A. Bert A. G. Smith E. Thomas D. Lopez A. F. Drew P. A. Khew-Goodall Y. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state J. Cell Sci. [score:1]
Trumbach D. Prakash N. The conserved miR-8/miR-200 microRNA family and their role in invertebrate and vertebrate neurogenesis Cell Tissue Res. [score:1]
Furthermore, miR-200 family members belonging to either seed sequence subgroup do not show a clear phylogenetic relationship, suggesting that the 1 nt difference between the two subgroups arose independently in different lineages [56]. [score:1]
The roles of miR-200 family miRNAs in breast CSCs are described in more detail later in Section 4. The miR-183 cluster, which is comprised of miRNA-183, -96 and -182, is a miRNA family with sequence homology (Figure 1). [score:1]
The poorly metastatic 4TO7 cells can take up miR-200 from the exosomes of 4T1 cells and become metastatic in a miR-200 -dependent manner. [score:1]
[1 to 20 of 56 sentences]
17
[+] score: 188
Furthermore, downregulating paracrine TGF-β can inhibit and reverse EMT by downregulating ZEB1 and ZEB2 and upregulating miR-200b and miR-200c [26]. [score:12]
For example, in one study, overexpression of Stat3 [44], PDGF-D [45], Notch-1 [46], and DCLK1 [47] in cancer cells led to significant downregulation of miR-200 family members; this resulted in up-regulation of ZEB1, ZEB2, and SNAI2 expression and acquisition of the EMT phenotype. [score:11]
A plethora of miRNAs, including miR-200 family members and miR-506, have been found to directly regulate the expression of the target genes that are known to play critical roles in EMT regulation (Figure  4). [score:8]
Similarly, NPV-LDE-225 suppressed EMT by upregulating E-cadherin and inhibited N-cadherin, Snail, Slug, and ZEB1 by increasing miR-200a, miR-200b, and miR-200c [43]. [score:8]
MiR-200 can directly target β-catenin mRNA, inhibiting its translation and blocking Wnt/β-catenin signaling in meningioma [24]. [score:7]
IDH1 and IDH2 mutants also caused an EMT-like phenotype; this phenotype was dependent on upregulation of the transcription factor ZEB1 and downregulation of miR-200 family members [48]. [score:7]
A report suggested that miR-200b and miR-200c were significantly associated with survival in gastric cancer patients; miR-200b suppressed ZEB1, augmented E-cadherin, inhibited cell migration, and suppressed tumor growth in a mouse mo del [97]. [score:7]
Inhibition of the Smad signaling pathway completely blocked the TGF-β1 -mediated decrease in miR-200, suggesting that TGF-β1 -induced suppression of the miR-200 family is regulated via Smad [27]. [score:6]
Pathways that promote EMT by suppressing miR-200 and upregulating ZEB1 and ZEB2. [score:6]
The results of another report suggested that miRNA-200b suppresses TGF-β1 -induced EMT by directly targeting the 3′UTR of fibronectin [92]. [score:6]
Furthermore, a recent study illustrated that miR-200 members can target Jagged1, thereby mediating the downregulation of ZEB1 [23]. [score:6]
Pathways that suppress EMT by upregulating miR-200 and repressing ZEB1 and ZEB2. [score:6]
Several molecules have been found to upregulate the miR-200 family and consequently suppress EMT. [score:6]
p53 has been reported to transactivate miR-200 family members by directly binding to the promoters that repress ZEB1 and ZEB2 expression, leading to inhibition of EMT [41, 42]. [score:6]
Exposing epithelial cells to TGF-β promotes the loss of epithelial morphological features, the increased expression of EMT marker genes such as ZEB1 and ZEB2, and the decreased expression of miR-200 [25]. [score:5]
MiRNAs other than miR-200 inhibit EMT by targeting ZEB1 and ZEB2. [score:5]
The results of recent studies suggest that members of the miR-200 family play a critical role in suppressing EMT and cancer invasion and metastasis [34] by targeting transcriptional repressors of ZEB1 and ZEB2 [35]. [score:5]
In addition to miR-200 family members, other miRNAs have been identified that regulate EMT by directly targeting ZEB1 and ZEB2. [score:5]
While SNAI2 is targeted by miR-200, SNAI2 directly binds E-boxes in the miR-200a/b promoter regions and represses miR-200a/b transcription. [score:4]
Moreover, some signaling pathways, including p53, regulate EMT by regulating the miR-200-ZEB1 and ZEB2 regulatory loop. [score:4]
Meanwhile, ZEB1 can directly suppress miRNA-200 family members in cancer cells, including miR-141 and miR-200c [36, 37]. [score:4]
Members of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) have emerged as important regulators of EMT, in part by targeting ZEB1 and ZEB2. [score:4]
The miR-200 family is usually downregulated in human cancer cells and tumors as a result of aberrant epigenetic gene silencing. [score:4]
Other miRNAs can induce EMT by downregulating miR-200 through DICER, such as miR-103 or miR-107 [49]. [score:4]
Smad3 was also reported to upregulate miR-200 family members at the transcriptional level in a TGF-β-independent manner [40]. [score:4]
Similarly, it was reported that EGF and EGFR can promote EMT by downregulating the miR-200 family in anaplastic thyroid cancer cells [32]. [score:4]
It was also reported that ZEB1 and ZEB2 repressed the expression of miR-200a, miR-200b, and miR-429 by binding to a conserved pair of ZEB-type E-box elements located proximal to the transcription start site in the promoter region [38]. [score:3]
All of these findings indicate that these molecules promote EMT by suppressing miR-200. [score:3]
In addition to their role in regulating EMT, miR-200 family members are negatively regulated by multiple signaling pathways. [score:3]
ZEB1 and Twist1 bound the E-box consensus in the promoters proximal to the putative miR-200 TSS and repressed miR-200 expression. [score:3]
Therefore, ZEB1 and ZEB2 and miR-200 family members repress expression of each other in a reciprocal feedback loop, which may lead to amplification of EMT. [score:3]
Epigenetic regulation of miR-200. [score:2]
Twist1 was also reported to directly associate with miR-200 promoters as a transcriptional repressor of miR-200 [56] (Figure  3A). [score:2]
In another double-feedback loop, miR-200 and SNAI2 regulate EMT. [score:2]
Therefore, SNAI2 and miR-200 act in a self-reinforcing regulatory loop that leads to amplification of EMT [71]. [score:2]
Moreover, SNAI1 can repress transcription of miR-34 genes, resulting in a SNAI1/miR-34 feedback loop that is analogous to the reciprocal ZEB/miR-200 feedback loop [66]. [score:1]
Studies have illustrated DNA methylation in two regions (#1 and #2) of a 2.5-kb large CpG island that is 2 kb upstream in miR-200b ~ 429 and in smaller CpG-enriched regions associated with miR-200c ~ 141. [score:1]
Similarly, miR-130b silencing can restore DICER1 to a threshold level that allows miR-200 family members to repress EMT in endometrial cancer [50]. [score:1]
The miR-200 family consists of five members in two clusters: miR-200b ~ 200a ~ 429 and miR-200c ~ 141. [score:1]
Figure 3 MiR-200 and miR-506 DNA methylation genomic loci and promoters of E- and N-cadherin. [score:1]
Aberrant DNA methylation of the CpG island or the CpG-enriched regions is closely linked to miR-200 inappropriate silencing in cancer cells [57]. [score:1]
Other factors may also be involved in miR-200 repression, such as ZEB1 and Twist1. [score:1]
A. Graphical depiction of the miR-200b ~ 429 and miR-200c ~ 141 genomic loci, with putative transcription start sites (TSS) indicated by arrows. [score:1]
Furthermore, delivery of miR-200 members into the tumor endothelium resulted in marked reductions in metastasis and angiogenesis [98]. [score:1]
A recent study showed that induction of ZEB1 and ZEB2 increased the methylation of miR-200 promoters [58]. [score:1]
MiR-200 family members can also be epigenetically regulated. [score:1]
[1 to 20 of 46 sentences]
18
[+] score: 181
Other miRNAs from this paper: hsa-mir-146a, hsa-mir-200c, hsa-mir-200a
Increased miR-200b expression was observed with decreased VEGF mRNA and protein, a target of miR-200b, providing evidence to support the hypothesis by showing a cause-and-effect relationship by using loss-of -inhibition. [score:7]
Since PRC2 was hypothesized to negatively inhibit miR-200b, through its repressing methylation-mark, increased expression of miR-200b would be expected by inhibiting PRC2. [score:7]
These observations show increased expression of the PRC2 components, which were hypothesized to negatively regulate miR-200b expression. [score:6]
A: After 1 month of diabetes, VEGF expression was increased and miR-200b expression was decreased. [score:5]
siRNA against EZH2 and SUZ12 were used because these targets have been directly linked to regulating miR-200b in neoplasia. [score:5]
HRMECs treated with SUZ12 siRNA demonstrate increased miR-200b expression, decreased VEGF expression and decreased endothelial branching. [score:5]
Therefore, aberrant miRNA expression in disease processes can disrupt normal cell physiology and mediate pathogenetic processes [21, 22] One miRNA of importance in diabetic retinopathy is miR-200b. [score:5]
Using a chemical inhibitor of PRC2 and H3K27me3, DZNep, miR-200b expression in HG was significantly increased while VEGF mRNA and protein were decreased in parallel. [score:5]
[NG = 5mM D-glucose, HG = 25mM D-glucose, NG+DMSO = 5mM D-glucose + 0.05% DMSO, HG+DMSO = 25mM D-glucose + 0.05% DMSO, NG+DZNEP = 5mM D-glucose + 5μM DZNep, HG+DZNEP = 25mM + 5μM DZNep; identical letters represent groups that are not significantly different; p < 0.05; n = 6; data expressed as mean ± SEM, normalized to β-actin for VEGF and U6 for miR-200b, expressed as a fold change of NG]. [score:5]
HRMECs treated with 3-Deazaneplanocin A (DZNep) chemical inhibitor demonstrated increased miR-200b and decreased VEGF expression. [score:5]
In HG, HRMECs transfected with control siRNA showed a significant decrease in miR-200b expression and increase in VEGF expression (Fig 5C and 5D). [score:5]
This project has demonstrated that PRC2 negatively regulates miR-200b and thus appears to be a good therapeutic target in diabetic retinopathy. [score:4]
Loss of Function Analysis Using DZNep Inhibitor Demonstrates a Cause-And-Effect Relationship between PRC2 and MiR-200b Expression. [score:4]
However, in HG, silencing of SUZ12 produced significantly increased miR-200b and decreased VEGF expression compared to control siRNA, and similar expression to control siRNA in NG. [score:4]
VEGF expression was found to be increased while miR-200b expression was found decreased in the retinas of diabetic mice compared to controls (Fig 6A). [score:4]
Furthermore, RNA Pol2 association at the same promoter region was decreased in HG, further suggesting that heterochromatin was formed and that decreased expression of miR-200b in HG is regulated at the genome level. [score:4]
Our key findings are: 1) miR-200b and VEGF are altered in HRMECs exposed to glucose, 2) PRC2 component mRNA and activity at the miR-200b promoter region is in HRMECs exposed to glucose, 3) treatment with DZNep inhibitor and transfection of SUZ12 siRNA increased miR-200b and decreased VEGF levels, and 4) PRC2 components are altered in retinal tissues from diabetic animals and other endothelial cell types exposed to high glucose. [score:3]
To demonstrate a cause-and-effect relationship between PRC2 and miR-200b, a chemical inhibitor for H3K27me3, DZNep, was used. [score:3]
Furthermore, since this type of methylation is believed to be repressing and is associated with closed chromatin, the observation of decreased Pol2 association at the miR-200b promoter region further supports the mechanism and accounts for the decrease in miR-200b expression demonstrated earlier. [score:3]
Altogether, this data suggests that SUZ12 is important in regulating miR-200b in HG, as knockdown of SUZ12 corrected miR-200b and VEGF levels. [score:3]
EZH2 is often regarded as the most important component for PRC2 regulation, however in our study SUZ12 was shown to be important for miR-200b regulation. [score:3]
In all groups, VEGF and miR-200b expression was altered. [score:3]
To verify the effects of glucose exposure on miR-200b expression, HRMECs were exposed to 25mM D-glucose for 24 and 48 hours. [score:3]
Furthermore, in human fibroblasts, increased H3K27me3 was found at the promoter regions of the miR-200 gene cluster with correlating decreased expression relative to epithelial cells, illustrating a mechanism for how miR-200b becomes repressed [38]. [score:3]
To further eludicate the role of specific components of PRC2 in the regulation of miR-200b, siRNA -mediated gene knockdown of EZH2 and SUZ12 was performed. [score:3]
We have previously demonstrated that VEGF and miR-200b expression is altered in the retinas of diabetic rats (21). [score:3]
High levels of glucose alter VEGF and miR-200b expression in HRMECs. [score:3]
This increase in H3K27 methylation, a repressing type of methylation, suggests formation of closed, inaccessible chromatin and accounts for the decreased expression of miR-200b. [score:3]
We hypothesize that glucose induces increased PRC2 expression and activity, which causes alteration of miR-200b levels. [score:3]
miR-200b expression was quantified using this method and normalization was performed to house keeping gene U6. [score:3]
These findings further strengthen the relationship between hyperglycemia and decreased miR-200b expression in the context of diabetic retinopathy. [score:3]
0123987.g007 Fig 7 (A) Glucose -induced increased PRC2 expression and activity causes alteration of miR-200b levels. [score:3]
When EZH2 was silenced in HG, miR-200b and VEGF showed no differences in expression compared to HRMECs treated with control siRNA in HG (Fig 5C and 5D). [score:2]
Therefore, this increase of the H3K27me3, which is specific to the PRC2 complex, demonstrates a strong regulatory relationship between PRC2 and miR-200b at the level of chromatin modification. [score:2]
Overall, these experiments provide correlational evidence linking PRC2 to negatively regulating miR-200b in HG, though additional supporting evidence is necessary. [score:2]
HRMECs cultured for 24 hours and 48 hours in HG showed significantly decreased levels of miR-200b with parallel increased levels of VEGF expression compared to NG and OSM. [score:2]
Altogether, these results paint a picture of the genomic events occurring at the miR-200b promoter region in HG, and further support that PRC2 may regulate miR-200b in diabetes. [score:2]
miR-200b has been shown to regulate VEGF [15]. [score:2]
While there is limited understanding as to why microRNAs like miR-200b become repressed in diabetic complications, based on the above discussion, it is possible that the underlying regulation of miR-200b may involve PRC2. [score:2]
These findings are consistent with the in vitro data produced in this project and suggests that PRC2 -mediated regulation of miR-200b may be relevant in vivo. [score:2]
However why miRNAs, like miR-200b, become dysregulated in diabetes is poorly understood. [score:2]
Cause-and-effect experimentation was important to further demonstrating a regulatory relationship between PRC2 and miR-200b. [score:2]
Loss of Function with SiRNA Demonstrates That SUZ12 Is of Importance in PRC2-Mediated Regulation of miR-200b. [score:2]
In summary, we show that PRC2 regulates miR-200b in retinal endothelial cells through H3K27me3 repression (Fig 7). [score:2]
Most importantly, PRC2, and specifically the EZH2 and SUZ12 subunits, have been shown to regulate miR-200b in the context of neoplasia [36, 37]. [score:2]
This is interesting because EZH2 is the major methyltransferase component for PRC2 and has been demonstrated to regulate miR-200b in neoplasia. [score:2]
These negative control experiments further support that PRC2 specifically regulates miR-200b in HG, as these changes in H3K27me3 and Pol2 association are specific to certain genomic regions and are not global. [score:2]
Since PRC2 mediates this type of methylation, this observation further strengthens the hypothesis that PRC2 regulates miR-200b in response to hyperglycemia. [score:2]
Finally, these changes in qPCR appear to be specific to the miR-200b promoter region. [score:1]
Furthermore, recent evidence from cancer research suggests that the major methyltransferase complex for H3K27 trimethylation, PRC2, is involved in silencing several miRNA involved in cancer, including miR-200b. [score:1]
Thus, silencing of SUZ12 prevents methylation at the miR-200b promoter region by preventing overall recruitment of PRC2, while silencing of EZH2 may be compensated by EZH1. [score:1]
These cells show similar alterations in VEGF and miR-200b as in HRMECs (Fig 6C, 6D and 6E). [score:1]
High levels of glucose alter H3K27me3 and RNA polymerase 2 association at the miR-200b promoter region. [score:1]
0123987.g003 Fig 3 A: ChIP-qPCR analysis of H3K27 trimethylation (H3K27me3) at the miR-200b promoter region. [score:1]
Most importantly, H3K27me3 was increased in HG specifically at the miR-200b promoter region, just upstream of the transcriptional start site. [score:1]
B: ChIP-qPCR analysis of RNA polymerase 2 (Pol2) at the miR-200b promoter region. [score:1]
0123987.g004 Fig 4 A: After 24 exposure to DZNep in HG, miR-200b levels were significantly increased. [score:1]
This is the first time miR-200b decrease has been observed in human endothelial cells isolated from the retina. [score:1]
A: After 24 exposure to DZNep in HG, miR-200b levels were significantly increased. [score:1]
Thus, PRC2 and miR-200b may be important in other complications of diabetes. [score:1]
Intravitreal injections of miR-200b were protective by reducing VEGF as well as vessel permeability [15]. [score:1]
A: ChIP-qPCR analysis of H3K27 trimethylation (H3K27me3) at the miR-200b promoter region. [score:1]
C,D,E: Real time RT-PCR analysis of VEGF, miR-200b and PRC2 components in HDMECs of various origins. [score:1]
One possibility is that silencing of EZH2 in HG is insufficient to restore miR-200b levels to normal levels because SUZ12 is still able to occupy the miR-200b promoter region. [score:1]
15 McArthur K, Feng B, Wu Y, Chen S, Chakrabarti S. MicroRNA-200b regulates vascular endothelial growth factor -mediated alterations in diabetic retinopathy. [score:1]
Our laboratory has shown decreased miR-200b in bovine retinal endothelial cells exposed to high levels of glucose, as well as in retinal tissue of streptozotocin -induced (STZ) diabetic rats at 1 month following diabetes induction. [score:1]
However, silencing of SUZ12 increased miR-200b and decreased VEGF, with levels similar to HRMECs transfected with control siRNA in NG (Fig 5C and 5D). [score:1]
miR-200b is just one miRNA which shows particular relevance in the context of diabetic retinopathy. [score:1]
Therefore, H3K27me3 is increased specifically, while Pol2 association is decreased specifically, at the miR-200b promoter region. [score:1]
[1 to 20 of 69 sentences]
19
[+] score: 180
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
On the contrary, DLX5 overexpression did not induce changes in miR-200 expression, either in SH-SY5Y (Fig.  2d) or in GN11 (neuroendocrine) or in U2OS (osteosarcoma) cells (data not shown). [score:5]
For miR-200b/ c/ 429/ 548a, the enriched functional categories included forebrain generation of neuron, cell motility, projection development, regulation of locomotion, regulation of phosphorylation and regulation of transcription (Suppl. [score:5]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
miR-200a, miR-200b, miR-141 and miR-429 share the same seed sequence and likely target the same mRNAs; for this reason they are grouped in a single miR class (named miR-200-class). [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Instead, we could easily monitor the number and position of early GFP -expressing neurons, and noted that upon depletion of miR-200 class they appear reduced in number but normally clustered. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
In the same cells, the expression of pre -miR-200 led to a 3.9-fold decrease in Foxg1 proteins level (Fig.  3c). [score:3]
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
Another indication comes from a study in zebrafish, showing a role of miR-200-class for olfactory development (Choi et al., 2008). [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
It has also been shown that miR-200 represses neural induction of human embryonic stem cells, via modulation of Pax6 and Zeb transcription factors (Du et al., 2013). [score:1]
miR200a and miR200b could not be tested by in situ hybridization due to high sequence conservation between all members of the miR-200-class. [score:1]
To complement the previous (static) data with live images of the migrating GnRH3 neurons, we carried out few time-lapse video recordings on untreated (4) and z- miR-200-class MO injected (4) embryos at earlier ages (36–52 hpf), in order to observe the first appearance of these neurons. [score:1]
We depleted the miR-200 class in fish zygotes, by injecting a mix of anti -miR-200 MO previously described and found to efficiently down-modulate several miR of the class-200 and to affect ORN differentiation (Choi et al., 2008). [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The abundance of z-hoxa-7a and z-hoxa-10b mRNAs did not greatly change, indicating that the differentiation delay observed upon depletion of miR-200-class is specific. [score:1]
We carried out the same prediction and categorization analyses for the miR of the -200 class; in this case the two subfamilies (miR-141/ 200a and miR-200b/ c/ 429/ 548a) were examined separately, and indeed yielded lists which were similar but not identical. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Since miR-200a, miR-200b, miR-141 and miR-429 share very similar seed sequences (Suppl. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Previous results in which zebrafish embryos were injected with anti- miR-200 class MOs found a delayed ORN differentiation, but axonal organization and GnRH neuron migration was not assessed (Choi et al., 2008). [score:1]
com/request/, while the anti- z-miR-200 MO mix was as previously published (Choi et al., 2008). [score:1]
Similarly, the depletion of miR-200-class (N = 23) resulted in a reduced number of GFP + neurons in 22% of GFP + embryos with the phenotype “reduced number” and 50% of the cases showing the phenotype “scattered position” (Fig.  7). [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
In Danio rerio (zebrafish) the miR-200-class is required for the proliferation, differentiation and survival of ORNs (Choi et al., 2008). [score:1]
Upon injection of the anti-miR-200 MO mix, only about 24% of examined embryos turned out CFP + (vs. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
Recently, miR-200b and miR-429 have been linked to pituitary endocrine functions controlling ovulation and fertility in female mice (Hasuwa et al., 2013). [score:1]
[1 to 20 of 62 sentences]
20
[+] score: 174
Down-regulation of ADAM12-L by miR-29b/c and miR-200b/c occurred at the post-transcriptional level and was mediated through direct targeting of the ADAM12-L 3′UTR, resulting in either target mRNA degradation or decreased translation, depending upon the cell line studied. [score:11]
Thus, low expression levels of miR-200 family members, together with low expression of miR-29, may create permissive conditions for high expression of ADAM12-L in claudin-low tumors and cell lines. [score:7]
We have selected to study two representative miRNAs from each family: miR-29b (a potent inhibitor of breast tumor metastasis [34]) and miR-29c (associated with a significantly reduced risk of dying from breast cancer [41]), miR-30b and miR-30d (both significantly down-regulated in ER -negative and progesterone receptor (PR) -negative breast tumors [42]), and miR-200b and miR-200c (both representing key negative regulators of EMT and anoikis resistance [30- 32]). [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
These results suggest that the main mechanism by which miR-200b/c reduced ADAM12-L expression in Hs578T cells was most likely through the inhibition of ADAM12-L mRNA translation. [score:7]
The question of why the inhibition of ADAM12-L by miR-200b/c expression in some cells (such as Hs578T) occurs at the translational level, and why in other cells (such as SUM159PT and SUM1315MO2) involves a decrease in steady-state ADAM12-L mRNA levels, remains open. [score:7]
To assess the clinical relevance of our results on the regulation of ADAM12-L expression in breast cancer cell lines, we analyzed publicly available expression data for a cohort of 100 breast cancer patients and found negative correlations between ADAM12-L mRNA and miR-29b, miR-200b, and miR-200c. [score:6]
To determine whether miR-29b/c, miR-30b/d, or miR-200b/c might regulate ADAM12-L expression in breast cancer patients in vivo, we examined the relationship between these miRNAs and ADAM12-L mRNA in a cohort of 100 breast cancer patients for which mRNA/miRNA expression data were publicly available (GEO: GSE19536) [44]. [score:6]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
Targeted down-regulation of ZEB1 by miR-200b/c was used as positive control. [score:6]
Mutations within these two miR-200 target sites abolished the effect of transfected miR-200b/c mimics, suggesting direct interaction between miR-200b/c and the ADAM12-L 3′UTR. [score:5]
The miR-200 family, by forming a double -negative feedback loop with transcription factors of ZEB1 and ZEB2, is a key negative regulator of EMT and is down-regulated in breast cancer stem-like cells and in normal mammary stem/progenitor cells [29- 33]. [score:5]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
The third miRNA family tested here, miR-200, has not been previously reported to regulate ADAM12 expression. [score:4]
Similar to miR-29, the miR-200 family is down-regulated in claudin-low tumors and cell lines. [score:4]
Interestingly, ADAM12-L protein levels in SUM159PT, SUM1315MO2, or HS578T cells were strongly down-regulated after transfection of miR-200b/c mimics (Figure  4B), despite modest or negligible effects of these mimics on ADAM12-L mRNA levels. [score:4]
This apparent discrepancy between the effects of miR-200b/c on ADAM12-L protein and mRNA levels led us to investigate whether miR-200b/c might block translation of ADAM12-L mRNA, as miRNA are known to regulate mRNA stability and/or translation [43]. [score:4]
The transfection conditions used throughout the paper to target ADAM12-L caused ZEB1 protein knock-down to undetectable levels by miR-200b/c mimics in SUM159PT, SUM1315MO2, and Hs578T cells, and decreased the ZEB1 3′UTR reporter in SUM159PT cells by 50%. [score:4]
The ADAM12-L 3′UTR is a direct target of miR-29 and miR-200 family members. [score:4]
These results are consistent with a role of miR-29b and miR-200c (and possibly miR-200b) in the regulation of ADAM12-L expression in breast tumors. [score:4]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
Figure 4 ADAM12-L, but not ADAM12-S, is a target for miR-200b/c. [score:3]
Since miR-200b/c mimics had no detectable effect on ADAM12-L mRNA level but they strongly reduced ADAM12-L protein in Hs578T cells, we asked whether miR-200b/c might have reduced the rate of ADAM12-L translation in Hs578T cells. [score:3]
miR-200b/c inhibitor increased ADAM12-L by ~20%, but this effect did not reach the level of statistical significance (Figure  5B). [score:3]
miR-29b/c and miR-200b/c also significantly decreased the activity of an ADAM12-L 3′UTR reporter, and this effect was abolished when miR-29b/c and miR-200b/c target sequences were mutated. [score:3]
In Hs578T cells, miR-200b/c mimics impeded translation of ADAM12-L mRNA. [score:3]
Both miR-200b and miR-200c mimics elicited a statistically significant, ~50% decrease in the luciferase activity, which was abolished when the two putative miR-200b/c target sites were destroyed (Figure  4C). [score:3]
To study the effects of miR-200b/c mimics, we selected SUM159PT, SUM1315MO2, and Hs578T cells, which all express low levels of endogenous miR-200b/c (Figure  1D). [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
The 3′UTR of human ADAM12-L contains well conserved potential target sites for miR-29b/c, miR-30b/d, and two poorly conserved potential sites for miR-200b/c (Figure  1C). [score:3]
miRNA profiling of 51 breast cancer cell lines has previously established that miR-29b/c, miR-30d, and miR-200b/c are under-expressed in claudin-low breast cancer cell lines (ref. [score:3]
Finally, the ADAM12-L 3′UTR reporter activity was significantly reduced by miR-200b/c, despite the fact that the two predicted miR-200 target sites present in the ADAM12-L 3′UTR are not well conserved between species. [score:3]
Transfecting miR-200b/c diminished ADAM12-L expression by ~20-30% in SUM159PT and SUM1315MO2 cells. [score:3]
Targeting the 3′UTR of ADAM12-L by miR-200b/c was further assessed by luciferase reporter assays in SUM159PT cells. [score:2]
The decrease in ADAM12-L mRNA was, however, more modest or, in the case of Hs578T cells, no change in ADAM12-L was detected in miR-200b/c -transfected cells. [score:1]
miR-29b/c, miR-30b/d, miR-200b/c, or control miRNA mimics were transfected into SUM159PT, BT549, SUM1315MO2, or Hs578T breast cancer cells. [score:1]
Importantly, both miR-29b/c and miR-200b/c strongly decreased steady state levels of ADAM12-L protein in all breast cancer cell lines tested. [score:1]
ADAM12-L, but not ADAM12-S, levels were also significantly diminished by miR-200b/c in SUM1315MO2 cells. [score:1]
Strikingly, Hs578T cells showed no change in ADAM12-L levels after transfection of miR-200b/c mimics. [score:1]
Cells were transfected with miR-200b/c mimics (or control mimic) and, three days later, we performed metabolic cell labeling with [35]S cysteine/methionine. [score:1]
Since the miR-29 and miR-200 families play important roles in breast cancer progression, these results may help explain the different prognostic and chemopredictive values of ADAM12-L and ADAM12-S in breast cancer. [score:1]
We have found that two members of this family, miR-200b and miR-200c, strongly diminished ADAM12-L protein in SUM159PT, SUM1315MO2, and Hs578T cells. [score:1]
Indeed, we observed a slower rate of ADAM12-L protein synthesis in Hs578T cells treated with miR-200b/c mimics than in cells treated with control miRNA mimics. [score:1]
We observed that the amount of [35]S-labeled nascent form of ADAM12-L protein in miR-200b/c mimic -transfected cells was substantially lower than the amount of [35]S-labeled ADAM12-L in control mimic -treated cells (Figure  4D). [score:1]
We established that transfection of miR-29b/c and miR-200b/c mimics strongly decreased the level of ADAM12-L protein in claudin-low SUM159PT, BT549, SUM1315MO2, and Hs578T cells, while miR-30b/d mimics had a more modest effect. [score:1]
There was a significant negative correlation between miR-29b and ADAM12-L (P = 0.0001), between miR-200c and ADAM12-L (P = 0.0002), and a weaker but significant correlation between miR-200b and ADAM12-L (P = 0.0464) (Figure  5A). [score:1]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
[1 to 20 of 49 sentences]
21
[+] score: 165
Other miRNAs from this paper: hsa-mir-200c, hsa-mir-200a, dre-mir-200a, dre-mir-200b, dre-mir-200c
The reconstitution of SMAD3 in A549-LG cells increased endogenous miR-200b expression (Fig.   5e), downregulated Zeb1 expression, and upregulated the expressions of E-cadherin and β-catenin (Fig.   5f). [score:13]
Downregulation of E-cadherin and β-catenin through G6PD knockdown via the inhibition of the Smad3/miR-200b pathwayUpon delineating the possible mechanism through which G6PD affects E-cadherin expression, Zeb1, a well-known transcription inhibitor of E-cadherin, was examined. [score:11]
Moreover, E-cadherin expression could be downregulated by miR-200b LNA and upregulated by ZEB1 siRNA even in the presence of Δ1339 or HTG6PD A549-LG cells (Supplementary Figure  5). [score:9]
Further study of the miR-200 family, the regulatory miRNAs targeting ZEB1 and modulating the expression of β-catenin [20], revealed that miR-200b was downregulated in A549-LG cells (Fig.   5b). [score:9]
MiR-200b expression was highly correlated with (Fig.   7b), and G6PD reconstitution upregulated E-cadherin and β-catenin expression and increased the expression of Smad3 and p22 [phox] (Fig.   7c). [score:9]
Inhibition of G6PD downregulated the expression of miR-200b via the Smad3 pathway in A549 cells. [score:8]
Moreover, the transcriptional (Fig.   5c) and translational levels (Fig.   5d) of Smad3, the upstream regulator of miR-200b, were also downregulated in A549-LG cells. [score:7]
G6PD knockdown decreased Smad3 expression concomitant with miR-200b downregulation (Fig.   2). [score:7]
Downregulation of E-cadherin and β-catenin through G6PD knockdown via the inhibition of the Smad3/miR-200b pathway. [score:7]
Fig. 8 When the G6PD level is downregulated in cells, the cellular function of NOX is impaired, leading to the loss of redox signaling to induce the expressions of Smad3 and miR-200b. [score:6]
The expression of miR-200b induces the pluripotency of somatic cells through Oct4 and Sox2 upregulation [49], the two major focuses of stem cell biology [50]. [score:6]
When the G6PD level is downregulated in cells, the cellular function of NOX is impaired, leading to the loss of redox signaling to induce the expressions of Smad3 and miR-200b. [score:6]
G6PD knockdown impaired p22 [phox] expression, the common subunit of NOX1, NOX2, NOX3, and NOX4, and thus decreased the expression of E-cadherin and β-catenin via redox -mediated signaling, possibly by modulating the Smad3/miR-200b pathway. [score:6]
Quantification was conducted by counting migrated cells in five different fields of each independent experiment, and the results are presented as mean ± SD (* p < 0.05) Increased E-cadherin/β-catenin expression by G6PD reconstitution in A549-LG cells through NOX/Smad3/miR-200b signalingWe further reconstituted G6PD expression in A549-LG cells, using Δ1339 as the dominant negative control (1339G>A, classic I G6PD deficiency). [score:5]
G6PD reconstitution in A549-LG cells repaired the protein expressions of the NOX/Smad3/miR-200b axis and increased E-cadherin/β-catenin expression. [score:5]
These data indicate that the modulation of the EMT process through G6PD knockdown may partly occur due to the downregulation of the NOX/Smad3/miR-200b pathway. [score:5]
These data suggest that G6PD plays an important role in regulating embryonic development, as an integral part of the NOX/Smad3/miR-200b axis for modulating the expression of adhesion molecules. [score:5]
The impaired NOX/Smad3/miR-200b axis is, in part, the mechanism through which G6PD knockdown impairs E-cadherin and β-catenin expression. [score:4]
These results indicate that G6PD knockdown functionally modulates EMT by inhibiting the Smad3/miR-200b pathway. [score:4]
c The level of miR-200b expression was determined in p22 [phox]-knockdown and control A549 cells through real-time PCR. [score:4]
The level of miR-200b was also downregulated in p22 [phox]-knockdown A549 cells (Fig.   6c), and increased migration over a membrane by 23 ± 5.7%, compared with the scramble control group (Fig.   6d, p < 0.05). [score:4]
Taken together, G6PD plays a cytoregulatory role in producing a low concentration of ROS to affect the Smad3/miR-200b pathway through the modulation of NOX -mediated signaling during embryonic development. [score:3]
e Ectopic Smad3 was expressed in SMAD3 -overexpressing A549-LG cells, and the transcript levels of miR-200b were analyzed through real-time PCR, normalized to RNU6, and calculated relative to the vector control (set to 1). [score:3]
Increased E-cadherin/β-catenin expression by G6PD reconstitution in A549-LG cells through NOX/Smad3/miR-200b signaling. [score:3]
The downstream targets in G6PD -mediated NOX signaling are Smad3 and miR-200b. [score:3]
Ahn SM Smad3 regulates E-cadherin via miRNA-200 pathwayOncogene. [score:2]
Taken together, these data strongly suggest that in embryonic development, G6PD plays an essential role as an integral component of the NOX/Smad3/miR-200b axis. [score:2]
Moreover, G6PD knockdown modulates the EMT process by impairing NOX/Smad3/miR-200b signaling. [score:2]
The modulation of EMT through G6PD knockdown is correlated with the impairment of NOX/Smad3/miR-200b signaling. [score:2]
Smad3 modulates EMT in a TGF-β-independent manner through the regulation of miR-200 clusters [43]. [score:2]
b The transcript levels of miR-200b in A549-LS and -LG cells were validated through real-time PCR and normalized to RNU6. [score:1]
Feng B miR-200b Mediates Endothelial-to-Mesenchymal Transition in Diabetic CardiomyopathyDiabetes. [score:1]
Together, these data provide novel information concerning the role of G6PD in modulating the EMT process through the NOX/Smad3/miR-200b pathway. [score:1]
[1 to 20 of 33 sentences]
22
[+] score: 159
Other miRNAs from this paper: hsa-mir-200c, hsa-mir-200a
To further confirm that LDHA is a direct target of miR-200b, qRT-PCR and western blot analyses were performed to detect whether the expression of LDHA was regulated by miR-200b. [score:7]
To identify miRNAs that directly bind to the 3′-UTR of LDHA, we used the mRNA target-predicting algorithms (TargetScan, PicTar and miRanda) and a miR-200b -binding site was found in the 3′-UTR of LDHA (Figure 3A). [score:6]
We reported previously that miR-200b suppressed cell growth in human malignant glioma through directly targeting CREB1 [15]. [score:6]
Finally, when we overexpressed miR-200b in glioma cells, the increased cell glycolysis, proliferation and invasion caused by LDHA were inhibited (Figure 4). [score:5]
U87 and U251 cells were transfected with control vector, LDHA -expressing vector, control vector + scramble control or LDHA -expressing vector + miR-200b mimics. [score:5]
U251 cells were transfected with LDHA -expressing vector, control vector or LDHA -expressing vector + miR200b mimics. [score:5]
A total of 1 × 10 [7] U251 cells infected with LDHA -expressing vector, control vector or LDHA -expressing vector + miR-200b mimics were inoculated subcutaneously into the dorsal flanks of nude mice (five in each group). [score:5]
Then we explored whether miR-200b could inhibit cell proliferation through targeting LDHA. [score:5]
Our findings may provide significant evidence regarding miR-200b as an important tumor suppressor in glioma through targeting LDHA. [score:5]
U87 and U251 cells were transfected with control vector, LDHA -expressing vector, LDHA -expressing vector + miR-200b mimics or control vector + scramble control respectively. [score:5]
D. U87 and U251 cells were transfected with control vector, LDHA -expression vector, control vector + scrambled control or LDHA -expression vector + miR-200b mimics respectively. [score:5]
The above results prompted us to validate that miR-200b could indeed inhibit glycolysis and cell proliferation of glioma by targeting LDHA. [score:5]
E. U87 and U251 cells transfected with LDHA -expression vector, control vector or LDHA -expression vector + miR-200b mimics were injected subcutaneously into nude mice (five in each group). [score:5]
LDHA is a direct target of miR-200b and is negatively correlated with miR-200b in glioma. [score:4]
Moreover, we observed a down-regulation of miR-200b in glioma samples, which was inversely correlated with LDHA levels (Figure 3E & 3F). [score:4]
Taken together, these results indicated that LDHA was a direct target of miR-200b and was negatively correlated with miR-200b in glioma. [score:4]
To test whether the regulations described above for glioma cell lines are also clinically relevant, qRT-PCR was used to detect the expression level of miR-200b in 73 glioma samples and 30 unmatched normal cerebrum samples as described before. [score:4]
To verify whether LDHA is a direct target of miR-200b we performed luciferase reporter assays in glioma cell line U251. [score:3]
miR-200b markedly suppressed luciferase activity in LDHA-wt reporter constructs. [score:3]
The alteration of miR-200b was confirmed by qRT-PCR B. U87 and U251 cells were transfected with control vector or LDHA -expression vector followed by miR-200b mimics, miR-200b-LNA or respective control. [score:3]
F. qRT-PCR showed that mRNA levels of LDHA were inversely related to the expression of miR-200b in 73 glioma samples. [score:3]
F. U87 and U251 cells were transfected with control vector or LDHA -expressing vector followed by scramble control or miR200b mimics. [score:3]
Taken together, these results demonstrate that LDHA acts as a tumor promoter in glioma and can be targeted by miR-200b. [score:3]
Inhibiting LDHA through miR-200b could be a promising strategy in treating glioma. [score:3]
For this purpose, U87 and U251 cells were transfected with control vector or LDHA -expression vector followed by miR-200b mimics, miR-200b-LNA or respective control. [score:3]
U87 and U251 cells were transfected with control vector or LDHA -expressing vector followed by scramble control or miR200b mimics. [score:3]
LDHA -induced glycolysis, cell proliferation and invasion can be inhibited by miR-200b. [score:3]
The results showed that the enhanced U87 and U251 cell invasion capacity induced by ectopic expression of LDHA could be abrogated by miR-200b (Figure 4F). [score:3]
E. The expression levels of miR-200b in 73 glioma samples and 30 unmatched normal cerebrum samples were assessed using qRT-PCR. [score:3]
The results showed that ectopic expression of LDHA in U251 cells led to a significant increase in tumor size and tumor weight and transfection of miR200b could abrogate this effect caused by LDHA (Figure 4E). [score:3]
miR-200b, like the other members of the miR-200 family, is found to be dysregulated in multiple cancers. [score:2]
And when we knocked down miR-200b, cell glycolysis was further improved. [score:2]
Recently, dysregulation of miR-200 family members, miR-200b especially, has been reported in various human cancers [9, 10]. [score:2]
Additionally, mutation of the putative miR-200b sites in the 3′-UTR of LDHA abrogated the luciferase response to miR-200b (Figure 3B). [score:2]
Moreover, increasing evidence has demonstrated that the dysregulation of miR-200b largely influences cell proliferation, cell cycle, cell invasion, EMT and chemoresistance of cancer cells [11– 14, 29– 31]. [score:2]
Here, we investigated the expression and function of LDHA and the regulation of miR-200b to LDHA in glioma. [score:2]
A LDHA-mut vector in which the first five nucleotides complementary to the miR-200b seed-region were mutated by site-directed mutagenesis (Stratagene) served as a mutant control. [score:2]
Indeed, we found that expression levels of miR-200b in normal samples were higher compared to glioma samples (Figure 3E). [score:2]
It's been reported that miR-200b acts as an important regulator in cell cycle, epithelial-to-mesenchymal transition (EMT) and chemosensitivity [11– 14]. [score:2]
For miR-200b, reverse transcription and qRT-PCR reactions were performed using a qSYBR-green-containing PCR kit (GenePharma, Shanghai, China). [score:1]
Thus, miR-200b might be a new weapon to better treat glioma. [score:1]
The results show that increased cell proliferation induced by LDHA could be repressed by miR-200b (Figure 4D). [score:1]
A. U87 and U251 cells were transfected with miR-200b mimics, miR-200b-LNA or respective control. [score:1]
Figure 4 A. U87 and U251 cells were transfected with miR-200b mimics, miR-200b-LNA or respective control. [score:1]
Spearman's correlation tests were used to evaluate the pair-wise expression correlation between miR-200b and LDHA. [score:1]
But how miR-200b functions in glioma metabolism is still unclear. [score:1]
Moreover, we analyzed the correlation between the level of LDHA and miR-200b in 73 glioma samples, and detected a negative correlation between them (Figure 3F). [score:1]
The results show that increased glycolysis induced by LDHA could be repressed by miR-200b, leading to decreased glucose uptake (Figure 4B) and lactate production (Figure 4C). [score:1]
B. on U251 cells co -transfected with miR-200b mimics or scramble control and a luciferase reporter containing the full length of LDHA 3′-UTR (LDHA-wt) or a mutant (LDHA-mut) in which the first five nucleotides of the miR-200b binding site were mutated. [score:1]
The relative luciferase activity of U251 cells transfected with the wild-type 3′-UTR of LDHA and miR-200b mimics exhibited an approximately 50% reduction relative to control group (Figure 3B). [score:1]
The alteration of miR-200b was confirmed by qRT-PCR (Figure 4A). [score:1]
Figure 3 A. The predicted binding site of miR-200b on LDHA mRNA is shown. [score:1]
Then we performed luciferase activity assays, qRT-PCR, western blot assays to confirm that LDHA indeed was targeted by miR-200b (Figure 3B, 3C & 3D). [score:1]
LDHA-wt or LDHA-mut were co -transfected with miR-200b mimics or the scramble control into U251 cells. [score:1]
A. The predicted binding site of miR-200b on LDHA mRNA is shown. [score:1]
Here, we investigated the expression pattern and function of LDHA in glioma and explored the possible correlation between miR-200b and LDHA in glioma. [score:1]
[1 to 20 of 56 sentences]
23
[+] score: 144
Shown in Figure 3D and 3E, overexpression of miR-200b/a/429 cluster dramatically inhibited the invasion, while overexpression of miR-205 was only moderately inhibitory. [score:9]
As shown in Figure 3A, miR-200b, miR-200a, miR-429 are highly expressed in VCaP and LNCaP cells, moderately expressed in 22RV1 cells, and weakly expressed in DU145 and PC3 cells. [score:7]
One exciting finding of our study is that ERG directly up-regulates the tumor suppressive miR-200b subfamily of miRNAs in prostate cancer. [score:7]
The miR-200 family inhibits cancer cell invasion and metastasis by suppressing epithelial-mesenchymal transition through targeting ZEB1 and ZEB2 [21– 24]. [score:7]
The remaining expression of miR-200b subfamily in VCaP cells after ERG knockdown is in agreement with a previous report that SP1 controls the basal epithelial expression of miR-200b subfamily [20]. [score:6]
However, the expression levels of miR-200b, miR-200a, miR-429, and miR-205 in transgenic mice are similar to that of wild type litter mates, indicating that ERG cannot induce the expression of these four miRNAs in murine prostate. [score:5]
In this study, we found that, out of 369 miRNAs, the expression levels of four miRNAs, including three members of the miR-200b subfamily and miR-205, are positively associated with ERG expression in MSKCC prostate cancer data sets. [score:5]
In agreement with its tumor suppressor role, the expression of miR-200 family members has been associated with favorable clinical outcome in many cancers [27– 29]. [score:5]
The second possibility is that ERG might also regulate the expression of protein-coding genes in prostate cancer, in addition to miR-200b subfamily. [score:4]
Regulation of miR-200b/200a/429 cluster gene expression by ERG at the transcriptional level. [score:4]
Shown in Figure 3C, overexpression of miR-200b/a/429 gene cluster alone, or in combination with miR-205, significantly inhibited the cell proliferation rate as determined by the MTT assay. [score:4]
Although induction of the tumor suppressive miR-200b subfamily of miRNA by oncogenic ERG appears to be counterintuitive, it is consistent with the slow-growing nature of the vast majority of primary prostate tumors. [score:3]
Genome-wide analysis of miR-200 targets in living cells has confirmed that miR-200 prevents cell migration and invasion through a coordinate control of actin cytoskeleton dynamics [25]. [score:3]
Taken together, our results indicate that miR-200b, miR-200a, and miR-429 are directly and positively regulated by ERG at the transcriptional level in VCaP cells. [score:3]
To express all four miRNAs, 410 bp of human miR-205 genomic DNA was amplified by PCR and cloned into BamHI/NotI site of the pCDH-miR-200b/a/429 vector, resulting in pCDH-miR-200b/a/429/205. [score:3]
Figure 3(A) Expression levels of miR-200a, miR-200b, miR-429, miR-205, and ERG in commonly used prostate cancer cell lines, including LNCaP, VCaP, 22RV1, PC3, DU145. [score:3]
To construct a lentiviral vector for the simultaneous expression of miR-200b, miR-200a and miR-429 in mammalian cells, 2310 bp of human miR-200b/a/429 genomic DNA was amplified by PCR and cloned into EcoRI/BamHI site of the pCDH-CMV-MCS-Puro vector (System Biosciences, Mountain View, CA, USA), resulting in pCD-HmiR-200b/a/429. [score:3]
Using lentivirus, we generated stable cell lines that express miR-200b/a/429 cluster and/or miR-205 in PC3 cells. [score:3]
In this study, we provide definitive evidence that the miR-200b/a/429 subfamily is an ERG target gene in human prostate cancers. [score:3]
As shown in Figure 1, out of 369 miRNAs, the average expression levels of four miRNAs including miR-200a, miR-200b, miR-429, and miR-205 were significantly higher in ERG -positive human prostate cancer samples. [score:3]
The expression level of miR-200b/a/429 primary transcript was also significantly reduced after VCaP cells were treated with ERG siRNA for three days (Figure 2F). [score:3]
In addition, miR-200 family members can block tumor angiogenesis by targeting interleukin-8 and CXCL1 [26]. [score:3]
These protein-coding target genes might increase the risk of cancer recurrence and progression and therefore offset the beneficial effect of the miR-200b subfamily. [score:3]
Log2 values of average expression for ERG positive/negative PCa and p-value for the four miRNAs that are the focus of this study are: miR-200a (10.85/9.49, p = 1.88e-05), miR-200b (11.99/10.51, p = 1.42e-06), miR-205 (11.50/9.84, p = 9.85e-04), miR-429 (9.73/8.22, p = 1.59e-05). [score:3]
Although the miR-200 family of miRNAs can also be regulated at post-transcriptional levels [46], our evidence indicate that ERG can directly bind to miR-200b/a/429 promoter to facilitate its transcription in prostate cancer cells. [score:3]
Our results are in agreement with numerous previous reports that the miR-200 family members inhibit cancer cell invasion in many cancer types. [score:3]
As shown in Figure 2E, treatment of VCaP cells with two individual ERG siRNAs (Stealth siRNA, Invitrogen) for four days caused approximately 40% reduction in the expression levels of miR-200b, miR-200a, and miR-429. [score:3]
Previous reports show that miR-200 could promote breast cancer metastatic colonization by targeting Sec23a [54]. [score:3]
Another family of well-established tumor suppressive miRNAs is miR-200, consisting of miR-200a, −200b, −200c, −141, and −429, which are clustered at two genomic locations. [score:3]
Real-time qPCR was used to determine expression levels of human ERG, and mouse miR-200b, miR-200a, miR-429 and miR-205. [score:3]
To measure the expression level of miR-200b/a/429 primary transcript after ERG knockdown, VCaP cells were transiently transfected with 50 nM of ERG siRNAs. [score:2]
Finally, miR-200b subfamily members and miR-205 are not induced by ERG in murine prostate derived from the pbsn-ERG transgenic mice, suggesting that ERG transgenic mice do not fully mimic the TMRPSS2/ERG -dependent prostate cancer development in human. [score:2]
Strikingly, miR-200a, miR-200b and miR-429 are known to be transcribed as a single polycistronic transcript, suggesting that these three miRNAs are regulated by ERG at the transcriptional level. [score:2]
We retrieved the data sets from both studies and examined the ERG sites in the mir-200b/a/429 gene cluster and miR-205HG gene using the UCSC genome browser. [score:1]
Within the ERG binding site in the miR-200b/200a/429 gene promoter, we identified two potential ERG binding sequences, ETS-1 and ETS-2 (Figure 2A), that match the canonical ERG binding sequences derived from genome-wide ERG ChIP-seq analyses [41] (Figure 2B). [score:1]
This is probably due to the lack of ERG binding motifs in the promoter region of murine mir-200b/a/429 gene (data not shown). [score:1]
As a result, the activity of enhancing metastatic colonization by miR-200b at late stage may offset its anti-invasion activity at early stage. [score:1]
Next, we tested the functions of miR-200b/a/429 and miR-205 in human prostate cancer cell lines. [score:1]
71001) and miR-200b promoter region. [score:1]
168 bp of miR-200b/a/429 promoter region that contains ETS-1 and ETS-2 was amplified by PCR and cloned into Acc65I/XhoI site of pGL3-Basic vector (Promega). [score:1]
Effects of miR-200b/a/429 cluster and miR-205 on prostate cancer growth and migration. [score:1]
By taking advantage of published ERG chromatin immunoprecipitation (ChIP-Seq) data sets, we investigated if ERG directly binds to the regulatory regions near the miR-200b/a/429 cluster and miR-205 gene in prostate cancer cells. [score:1]
miR-200b/200a/429 subfamily and miR-205 are not induced by ERG in the prostate of Pbsn-ERG transgenic mice. [score:1]
In the human genome, miR-200b, −200a, and −429 are located on chromosome 1 and transcribed by RNA Polymerase II as a single long primary miRNA transcript [20], while miR-200c and −141 are clustered on chromosome 12. [score:1]
First, it is possible that the miR-200b subfamily has tumor stage -dependent activity (53). [score:1]
Four stable cell lines, PC3-vec, PC3-miR-200b/a/429, PC3-miR-205, and PC3-miR-200b/a/429/205. [score:1]
The roles of miRNA-200 family and miR-205 have been studied in many cancer types. [score:1]
High levels of miR-200 predict favorable survival in many cancers [27– 29]. [score:1]
Shown in Figure 2A, based on ERG ChIP-seq results [36], we nominated an ERG binding peak immediately proximal to the transcription start site (TSS) of mir-200b/a/429 gene cluster (Figure 2A). [score:1]
Role of miR-200b subfamily and miR-205 on prostate cancer proliferation and invasion. [score:1]
Identification of ERG binding motifs in the promoter region of miR-200b/a/429 gene cluster. [score:1]
[1 to 20 of 51 sentences]
24
[+] score: 144
Other miRNAs from this paper: hsa-mir-200c, hsa-mir-200a
From the top 5000 genes most anti-correlated with expression of miR-200b, we additionally considered genes positively correlated with ZEB1 expression (p < 0.0001, Pearson’s), predicted miR-200b target genes (by TargetScan, miRanda, and miRDB), and genes associated with worse prognosis (p < 0.05, univariate Cox) in lung adenocarcoinomas 25. [score:8]
Given the remarkable pleiotropy of the miR-200 family in regulating genome-wide targets to suppress EMT, the regulation of specific cellular functions is still being elucidated. [score:7]
Based upon our previously published findings that the KP tumors have significantly elevated levels of TGFβ as a driver of EMT and metastasis 30 and that metastatic cell lines from the mo del can be alternately shifted in their phenotype by miR-200 expression (Supp Fig. S3h) or treatment with TGFβ, we probed the effect of TGFβ -induced EMT on the 344SQ murine cells and demonstrated robust up-regulation of signaling through the FAK/CRKL pathway (Fig. 5g). [score:6]
Either intrinsic dysregulation of Zeb1 or TGFβ -mediated suppression of miR-200 can de-repress CRKL expression to drive subsequent collagen I -mediated ITGβ1-FAK signaling. [score:6]
As a functional consequence, in vitro migration and invasion were enhanced in the previously non-invasive 393P cells, and suppressed upon miR-200 re -expression (Fig. 1e). [score:5]
Additionally, across the TCGA datasets (n = 9105 tumor specimens), CRKL levels negatively correlated with the miR-200 family levels, positively correlated with the expression of ZEB1, an EMT gene expression signature, and the p-Src Y416 levels (Fig. 4b). [score:5]
CRKL contains two predicted target sites in the 3′ untranslated region (3′ UTR) for miR-200b/c, one with a P [CT] of 0.29 and the other of 0.91 36. [score:5]
Because neither Itgβ1 nor FAK are predicted miR-200 family targets and neither correlated with the EMT status of the cells, we analyzed the pan-cancer TCGA datasets 34 and a separate compendium of publically-available lung cancer datasets 25 for genes with negative correlation to miR-200 family expression, high correlation to ZEB1, and predicted miR200b sites in the 3′ UTR by three different prediction algorithms (Fig. 4a and Supplemental Table 2). [score:5]
Upon re -expression of miR-200 the cells displayed a more organized epithelial acinar structure in Matrigel culture, with pronounced cortical actin staining, and suppression of the collagen -induced protrusions (Fig. 2a, bottom row). [score:5]
In this manner, direct regulation by miR-200 of the CRKL adaptor suppresses FAK/Src complex formation at the membrane and subsequent downstream signaling from collagen I-Itgβ1. [score:5]
Conversely, the ability of miR-200 expression to suppress cellular response to the ECM also explains the normalizing effects of laminin-rich matrices on tumor cells 30, a counter-balancing effect that enhances tumor cell adaptability to the microenvironment and facilitates the later steps in metastasis, such as distant colonization. [score:5]
This MET with expression of miR-200 significantly suppressed the migratory and invasive ability of the H157 cells (Fig. 1h). [score:5]
The generation of the genetically modified 393P and 344SQ cell lines stably expressing ZEB1 or the miR-200b, −200a, −429 cluster, respectively, are described in previous publications 30 42, while the H157 cells with doxycycline-inducible expression of miR-200a, −200b or the combination were previously described in 32 and 43. [score:5]
Consistently, the importance of miR-200 in modulating CRKL regulation of collagen I-Itgβ1 -dependent cell signaling was emphasized by results from multiple different experimental systems, including 2D and 3D in vitro assays with murine and human cells, knockdown -based strategies at several points in the pathway, and in vivo metastasis driven by loss of miR-200 expression in the syngeneic KP mo del. [score:4]
CRKL is a miR-200 target that regulates integrin -dependent signaling and is prognostic of patient outcome. [score:4]
Biochemically, the increased matrix responsiveness of tumor cells upon Zeb1 expression was due to enhanced FAK signaling, which was essentially shutoff with high miR-200 levels and phenocopied by CRKL or Itgβ1 knockdown. [score:4]
A very recent study from the Goodall lab 41 using breast cancer cells to identify transcriptome-wide miR-200 targets by an Ago-HITS-CLIP and sequencing approach identified multiple genes involved in invadopodia formation, MMP activity, and regulation of actin cytoskeletal dynamics. [score:4]
CRKL is a miR-200 target that regulates integrin -dependent signaling and correlates with patient outcome. [score:4]
However, the full complement of cellular functions altered during EMT that are specifically regulated by gain of Zeb1 expression and loss of miR-200 is unclear. [score:4]
The morphologic changes observed with Zeb1 expression were concordant with an EMT, as judged by the mRNA and protein levels of epithelial and mesenchymal markers (Fig. 1c) and decreases in the miR-200 family members (Fig. 1d). [score:3]
The morphologic changes, signaling activation and focal adhesion formation were completely abrogated by constitutive miR-200 expression in the cells (Fig. 5g,h and Supp Fig. S3i). [score:3]
Given the enhanced focal adhesion complex formation and signaling observed in 2D cultures, we studied the importance of the ECM in regulating tumor cell behavior in coordination with Zeb1/miR-200 expression changes in a well-established assay 33. [score:3]
The luciferase reporter assay confirmed that wild-type CRKL is a direct miR-200b/c target. [score:3]
This change was partially reversed by re -expression of miR-200, which restored cell-cell junctions (lower panel of Fig. 1a). [score:3]
Immunofluorescent staining demonstrated that the mesenchymal, invasive 344SQ and 393P_ZEB1 cells display extended cell protrusions, long actin stress fibers and thin cell bodies with enhanced cell matrix contact, while miR-200 expression produced rounded, clustered cells with cortical actin staining and minimal matrix contact (393P_vec or 344SQ_miR-200) (Fig. 1b). [score:3]
Zeb1 expression induces EMT/miR-200 repression and FAK pathway activation in previously non-invasive cells. [score:3]
Moreover, in the genetically manipulated 393P cells (Fig. 3b) and the inducible miR-200 -expressing human H157 cells (Fig. 3c) we observed an inverse correlation between the activation of this pathway and the miR-200 levels, with no clear relationship to the levels of Itgβ1 or total FAK. [score:3]
Our extensive prior bioinformatic analyses incorporating mRNA and proteomic profiles of tumor cells with high/low miR-200 expression revealed genome-wide changes altering the balance of cell-cell and cell-matrix interactions, along with substantial effects on the surrounding ECM composition 23. [score:3]
How to cite this article: Ungewiss, C. et al. The microRNA-200/Zeb1 axis regulates ECM -dependent β1-integrin/FAK signaling, cancer cell invasion and metastasis through CRKL. [score:2]
Two point mutations were introduced in each miR-200 seed sequence (red). [score:2]
Based upon the multiple lines of in vitro and in vivo data included herein, a schema is presented that outlines our working mo del for the role of miR-200 in regulating tumor cell activation by interactions with the ECM (Fig. 5j). [score:2]
As a master EMT regulator, the Zeb1-miR-200 double -negative feedback loop has been shown by multiple groups to play a prominent role in tumor invasion and metastasis. [score:2]
To test whether total CRKL levels are regulated by miR-200, and could therefore modulate signaling downstream of Itgβ1, we constructed a luciferase reporter containing the wild-type CRKL 3′ UTR. [score:2]
These results suggest that miR-200 repression produces a cellular EMT while also potentiating the response of the cells to external stimulation from the collagen I-containing ECM, both of which are required to produce an invasive phenotype. [score:1]
miR-200 repression alters collagen I -dependent cell-matrix interactions. [score:1]
Zeb1/miR-200 balance induces a functional EMT in non-invasive epithelial tumor cells. [score:1]
In contrast, concomitant changes in the miR-200 levels and manipulation of the matrix composition by inclusion of type I collagen produced robust invasion. [score:1]
Two isogenic cell line pairs (344SQ_vector vs 344SQ_miR-200 and 393P_vector vs 393P_Zeb1) were used to measure the expression levels of six candidates, which again identified CRKL in strong relationship with Zeb1 and miR-200 levels (Fig. 4d and Supp. [score:1]
These findings suggest that during tumor progression miR-200 loss controls cell-intrinsic EMT features and coordinates complementary changes in the surrounding tumor microenvironment. [score:1]
The CRKL 3′UTR contains two predicted miR-200b/c/429 sites at the indicated locations. [score:1]
Our previous work with metastasis-prone tumor cells from the KP murine mo del revealed that miR-200 repression is necessary in a subset of cells at the tumor periphery to produce EMT, invasion and distant metastasis 30 31. [score:1]
miR-200 repression potentiates cells to collagen I -dependent interactions. [score:1]
s of 344SQ, paralleling the normal changes in miR-200 levels upon 3D growth (Supp Fig. S1a). [score:1]
We wanted to further assess the importance of repression of this particular pathway as a key mediator of miR-200 action. [score:1]
[1 to 20 of 44 sentences]
25
[+] score: 135
Other miRNAs from this paper: hsa-mir-200c, hsa-mir-200a
On the other hand, PI3K or Akt inhibitor and siRNA reversed CCL5 -inhibited miR-200b expression (Fig. 4G&H), indicating CCL5 suppressing miR-200b expression via PI3K/Akt pathway. [score:11]
In the current study, cells incubation with PI3K and Akt inhibitor or siRNA reversed CCL5-reduced miR-200b expression indicating CCL5 inhibited miR-200b expression through PI3K/Akt pathway. [score:9]
One mechanism underlying CCL5 increased VEGF production and angiogenesis by down -regulating miR-200b through PI3K and Akt signaling pathway, rendering CCL5 a novel target for chondrosarcoma angiogenesis and metastasis The newly identified small noncoding miRNAs, a novel class of gene regulators, control gene expression by binding to complementary 3′UTR sequences of target mRNA [18, 19]. [score:9]
We also gauged hemoglobin content and miR-200b expression to find CCL5 increasing chondrosarcoma -induced angiogenesis but reducing miR-200b expression in vivo (Fig. 7B-C); hemoglobin content inversely correlated with miR-200b expression (Fig. 7D). [score:7]
The miR-200 family is well known to inhibit epithelial-mesenchymal transition and tumor metastasis [38]; miR-200b is cited as negative regulator of VEGF expression and angiogenesis in lung adenocarcinoma [39], but its effect on human chondrosarcoma is largely unknown. [score:6]
These indicate CCL5 promoting angiogenesis through down-regulation of miR-200b expression in vivo. [score:6]
miR-200b directly represses VEGF expression via binding to 3′UTR of human VEGF-A. CCL5 boosts angiogenesis and tumor growth, down -regulating miR-200b in vivo. [score:5]
We saw exogenous or overexpression of CCL5 reducing miR-200b expression. [score:5]
Exogenous or overexpressed CCL5 reduced miR-200b expression (Fig. 4A). [score:5]
Whether PI3K/Akt control miR-200b expression through transcriptional or posttranscriptional regulation is needs further examination. [score:4]
We observed CCL5 inducing VEGF expression and subsequently promoting angiogenesis and tumor growth through down -regulating miR-200b via PI3K/Akt signaling pathway (Fig. 8). [score:4]
We likewise indicated miR-200b directly repressing VEGF-A protein expression, binding with 3′UTR of human VEGF-A gene to negate VEGF -mediated angiogenesis and tumor growth. [score:4]
Figure 5miR-200b directly represses VEGF expression via binding to 3′UTR of human VEGF-A(A) Schematic 3′UTR representation of human VEGF-A containing miR-200b binding site. [score:4]
Here we find CCL5 enhancing VEGF expression and subsequently angiogenesis by down -regulating miR-200b through PI3K/Akt signaling pathway. [score:4]
Taken together, data indicate miR-200b directly repressing VEGF-A protein expression via binding to 3′UTR of human VEGF-A gene. [score:4]
CCL5 promotes VEGF expression and angiogenesis, down -regulating miR-200b. [score:4]
To explore miR-200b involvement in CCL5 -induced VEGF and angiogenesis, miR-200b mimic was used; transfection with miR-200b mimic diminished CCL5 -induced VEGF expression, EPCs migration and tube formation (Fig. 4B-F). [score:3]
Cotransfection with miR-200b mimic abolished CCL5 -mediated VEGF expression and angiogenesis. [score:3]
Figure 4(A) Cells were incubated with CCL5 (100 ng/mL) for 24 h or JJ012/vector, JJ012/CCL5, SW1353/vector and SW1353/CCL5 cells cultured for 24 h, miR200b expression examined by qPCR (n=5). [score:3]
Anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase, rabbit polyclonal antibodies specific for p-p85, p85, p-Akt, Akt, β-actin and CD31 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); CCL5 and VEGF antibodies from Abcam (Cambridge, MA); recombinant human VEGF and BX759 from R&D Systems (Minneapolis, MN); recombinant human CCL5 and VEGF ELISA kit from PerpoTech (Rocky Hill, NJ); miR-200b mimic, miR-200b inhibitor, Lipofectamine 2000, and Trizol from Life Technologies (Carlsbad, CA). [score:3]
Correlation between hemoglobin level and miR-200b expression was shown in (D). [score:3]
Positive correlation between CCL5 and VEGF versus negative between CCL5 and miR-200b (Fig. 7E-F) indicated CCL5 promoting VEGF -dependent angiogenesis and tumor growth by down -regulating miR-200b in vivo. [score:2]
To learn whether miR-200b regulates 3′UTR of VEGF, we constructed luciferase reporter vectors harboring wildtype 3′UTR of VEGF mRNA (wt-VEGFA-3′UTR) and vector containing mismatches in predicted miR-200b binding site (mt-VEGFA-3′UTR) and transfected vectors into JJ012/CCL5 and control cells (Fig. 5A). [score:2]
In addition, miR-200b regulating VEGF -dependent metastasis, tumorigenesis and angiogenesis is documented [32- 35]. [score:2]
Figure 6CCL5 promotes angiogenesis by down -regulating miR-200b in vivo(A&B) Chick embryos were incubated with indicated chondrosarcoma CM for 4 days, then resected, fixed, and photographed by stereomicroscope. [score:2]
Correlation between CCL5/VEGF (E) and CCL5/miR-200b (F) in chondrosarcoma cases (n=10), results expressed as mean ± S. E. M. *, p < 0.05 compared with control. [score:2]
We next performed Matrigel implant assay in mice to further confirm CAM mo del results: Matrigel mixed with CM from JJ012/CCL5 cells increased microvessel formation (including Matrigel plugs analyzed for CD31 expression and hemoglobin content); miR-200b mimic abolished this effect (Fig. 6C-D). [score:2]
CCL5 promotes angiogenesis by down -regulating miR-200b in vivo. [score:2]
CCL5 enhances VEGF -dependent angiogenesis in human chondrosarcoma cells by down -regulating miR-200b through PI3K/Akt signaling pathway. [score:2]
Figure 7CCL5 increases tumor -associated angiogenesis and tumor growth by down -regulating miR-200b in vivoCells were mixed with Matrigel and injected into flank sites of mice sacrificed after six weeks. [score:2]
CCL5 increases tumor -associated angiogenesis and tumor growth by down -regulating miR-200b in vivo. [score:2]
Figure 8 CCL5 enhances VEGF -dependent angiogenesis in human chondrosarcoma cells by down -regulating miR-200b through PI3K/Akt signaling pathway. [score:2]
We next correlated among miR-200b, VEGF, and CCL5 in chondrosarcoma. [score:1]
CCL5 boosts angiogenesis and tumor growth, down -regulating miR-200b in vivoEffect of CCL5 on angiogenesis in vivo was rated by CAM assay in vivo mo del. [score:1]
JJ012/vector and JJ012/CCL5 cells were transfected with miRNA control or miR-200b mimic for 24 h. CM was then collected after 2 days. [score:1]
The 3′UTR-luciferase reporter constructs containing 3′UTR regions of VEGF with wild type and mutant binding sites of miR-200b were amplified by PCR method, cDNAs obtained from H293T cells. [score:1]
We hypothesized miR-200b mediating CCL5-promoted VEGF -dependent angiogenesis in human chondrosarcoma. [score:1]
It was clearly noted that CM from JJ012/CCL5 cells increased CAM angiogenesis, and cotransfection with miR-200b mimic blocked CCL5 -mediated angiogenesis (Fig. 6A-B). [score:1]
Cotransfection with miR-200b mimic reduced luciferase activity in wt-VEGFA-3′UTR plasmid but not in mt-VEGFA-3′UTR plasmid (Fig. 5B). [score:1]
[1 to 20 of 39 sentences]
26
[+] score: 135
These results suggest that miR-152 and miR-200b might play an essential role in gastric carcinogenesis and that HP infection may downregulate miR-152 and miR-200b expression resulting in a significant upregulation of B7-H1 expression in gastric cancer. [score:11]
Our data indicated that HP inhibited miR-152 and miR-200b expression in gastric cancer cells, and miR-152 and miR-200b target B7-H1 and suppress B7-H1 expression in gastric cancer cells. [score:11]
These results indicate that miR-152 and miR-200b indeed suppress B7-H1 expression in AGS cells, and support our conclusion that HP infection promotes B7-H1 expression through the downregulation of miR-152 and miR-200b in gastric cancer cells. [score:10]
Taken together, the findings of our study suggest that B7-H1 expression in gastric cancer cells can be upregulated by HP infection via the suppression of miR-152 and miR-200b. [score:8]
MiR-152 and miR-200b target B7-H1 and suppress B7-H1 expression in gastric cancer cells. [score:7]
We found that miR-152 and miR-200b expression levels were significantly decreased in HP-related gastric cancer and that miR-152 and miR-200b suppressed B7-H1 expression in gastric cancer cells. [score:7]
To determine whether the HP -induced increase in B7-H1 expression in human gastric cancer cells occurs via miRNAs targeting B7-H1, we studied two candidate B7-H1 miRNAs (miR-152 and miR-200b) that were predicted byTargetScan and PicTar in AGS cells after HP infection. [score:7]
In contrast to transfection with the control nucleotides, transfection of the cells with miR-152 and miR-200b markedly inhibited B7-H1 expression, leading to only 21–22% of the cells expressing B7-H1 with IFN-γ treatment. [score:7]
These results further support our conclusion that HP infection promotes B7-H1 expression via the downregulation of miR-152 and miR-200b in human gastric cancer cells. [score:6]
To confirm the regulation of B7-H1 expression by miR-152 and miR-200b, we investigated using a luciferase reporter system whether these miRNAs can bind to the 3' UTR of B7-H1 mRNA and inhibit its translation (Fig 5A). [score:6]
Many studies have indicated that miR-152 and miR-200b potentially function as tumor suppressors and are downregulated in various tumor types. [score:6]
These results suggest that HP infection may stimulate B7-H1 expression through the inhibition of miR-152 and miR-200b in gastric cancer cells. [score:5]
B7-H1 expression in AGS cells after treatment with mimics or inhibitors of miR-152 and miR-200b. [score:5]
In contrast, the treatment of the cells with inhibitors of miR-152 and miR-200b increased the expression of B7-H1 (Fig 4B). [score:5]
It can be postulated that the hypermethylation of miRNA promoters caused by HP stimulating DNMT1 expression through the AKT-NFκB pathway may be the mechanism whereby HP downregulates miR-152 and miR-200b, which requires further investigation. [score:4]
MiR-200b, a member of the miRNA-200 family, also functions as a tumor suppressor in a wide range of human malignances, including breast, colorectal and pancreatic cancer [40– 42]. [score:3]
However, this effect was markedly eliminated when inhibitors of miR-152 and miR-200b were transfected together. [score:3]
Thus, miR-152 and miR-200b function as important tumor suppressors in HP-related gastric cancer. [score:3]
Further studies should also determine the mechanisms by which HP infection decreases miR-152 and miR-200b expression and the role of miRNAs in host anti-HP immunity. [score:3]
In the miR-152 and miR-200b plus B7-H13’UTR groups, the luciferase activity was significantly inhibited. [score:3]
We determined the levels of miR-152 (Fig 6A) and miR-200b (Fig 6B) in 20 human gastric cancer samples using a qPCR assay and then analyzed their correlation to B7-H1 expression levels. [score:2]
The 3′UTR of B7-H1 mRNA containing the miR-152 and miR-200b target sequences were cloned into the XhoI and NotI sites of psiCHECK-2 (Promega) using the primers B7-H1 3’UTR F1 and B7-H1 3’UTR R1 to generate a B7-H1 reporter. [score:2]
Levels of miR-152 and miR-200b in gastric cancer cells after HP infection or IFN-γ treatment. [score:1]
To investigate the role of miR-152 and miR-200b in the elevation of B7-H1 expression in AGS cells, we treated the IFN-γ -treated AGS cells with several miRNAs, including miR-152 and miR-200b, and then determined the level of B7-H1 on the surface of the treated cells using flow cytometry. [score:1]
We found that HP infection reduced both miR-152(Fig 3A) and miR-200b (Fig 3B). [score:1]
The percentages of B7-H1 -positive cancer cells, as determined by double immunofluoresence, in 20 human gastric cancer samples were plotted against the levels of miR-152 (A) and miR-200b (B), as determined by qPCR. [score:1]
In the present study, we investigated the mechanism whereby HP promotes B7-H1 expression through miR-152 and miR-200b. [score:1]
0168822.g005 Fig 5 (A) Schematic of B7-H1 mRNA showing potential miR-152 and miR-200b binding sites in the 3’-UTR and schematic of the luciferase reporter. [score:1]
These results indicate that both miR-152 and miR-200b can bind to the 3’ UTR of B7-H1 mRNA (Fig 5B). [score:1]
Binding of miR-152 and miR-200b to B7-H1 mRNA. [score:1]
0168822.g006 Fig 6 The percentages of B7-H1 -positive cancer cells, as determined by double immunofluoresence, in 20 human gastric cancer samples were plotted against the levels of miR-152 (A) and miR-200b (B), as determined by qPCR. [score:1]
Correlation between the B7-H1 -positive rate and miR-152 and miR-200b levels in human gastric cancer tissue samples. [score:1]
The complementary miR-152 and miR-200b binding sites in the B7-H1 3’ UTR were inserted downstream of a luciferase reporter. [score:1]
[1 to 20 of 33 sentences]
27
[+] score: 133
Targeting inhibition of translation of Snail1 by miR-153, Slug by miR-506 and ZEB1 by miR-200b in HCC cells. [score:7]
For example, miR-200 family has been shown to inhibit ZEB1 and ZEB2 [19– 23], miR-506 has been shown to block Slug translation [24– 27], and miR-153 has been shown to suppress Snail1 and ZEB2 [28]. [score:7]
Three miRNAs (miR-153, miR-506 and miR-200b) that target 3′-UTR of Snail1, Slug and ZEB1 mRNAs, respectively, were found to be induced by KLF4 overexpression, and suppressed by KLF4 depletion, in HCC cells. [score:7]
The luciferase activities were quantified in these cells, suggesting that miR-200b targets 3′UTR of ZEB1 mRNA to inhibit its translation (Figure 2E). [score:7]
Targeting and inhibition of translation of Snail1 by miR-153, Slug by miR-506 and ZEB1 by miR-200b in HCC cells. [score:7]
These data suggest that miR-153, miR-506 and miR-200b overexpression inhibits HCC cell growth. [score:5]
These data suggest that miR-153, miR-506 and miR-200b overexpression suppresses HCC cell invasion. [score:5]
By bioinformatics analyses, we found that miR-153 bound to 3′UTR of Snail1 mRNA at 440-448 base site (A), miR-506 bound to 3′UTR of Slug mRNA at both 439-446 and 843-849 base sites (B), and miR-200b bound to 3′UTR of ZEB1 mRNA at both 463-479 and 892-898 base sites (C) D. We either overexpressed miR-153, miR-506 and miR-200b, or inhibited miR-153, miR-506 and miR-200b in both. [score:5]
Figure 7 KLF4 may suppress the HCC cell growth and invasion through miR-153, miR-506 and miR-200b -mediated suppression of Snail1, Slug and ZEB1, respectively. [score:5]
KLF4 may suppress the HCC cell growth and invasion through miR-153, miR-506 and miR-200b -mediated suppression of Snail1, Slug and ZEB1, respectively. [score:5]
MiR-153, miR-506 and miR-200b overexpression inhibits HCC cell growth. [score:5]
In a loss-of-function experiment, we suppressed the levels of miR-153, miR-506 and miR-200b in KLF4 -overexpressing HCC cells, which completely abolished the effects of KLF4 on cell growth and invasion. [score:5]
In order to confirm that these specific bindings (miR-153/Snail1, miR-506/Slug, miR-200b/ZEB1) are functional, we either overexpressed miR-153, miR-506 and miR-200b, or inhibited miR-153, miR-506 and miR-200b in both. [score:5]
MiR-153, miR-506 and miR-200b overexpression suppresses HCC cell invasion. [score:5]
We found that miR-153, miR-506 and miR-200b depletion abolished the suppressive effects of KLF4 on HCC cell growth (Figure 6A) and invasion (Figure 6B), suggesting that KLF4 may inhibit the HCC cell growth and invasion through miR-153, miR-506 and miR-200b. [score:5]
Moreover, Dhayat et al. reported that miR-200a and miR-200b were significantly downregulated in HCC, and could be served as an early marker for cirrhosis -associated HCC [32]. [score:4]
In order to confirm that KLF4 may affect the HCC cell growth and invasion through miR-153, miR-506 and miR-200b, we overexpressed the antisense for miR-153, miR-506 and miR-200b in KLF4 -expressing HepG2 cells, and compared to HepG2-KLF4 cells and HepG2-scr cells. [score:4]
Wong et al. showed that miR-200b negatively regulated Rho/ROCK signaling pathway to suppress metastases of HCC [33]. [score:4]
Figure 5In order to confirm that KLF4 may affect the HCC cell growth and invasion through miR-153, miR-506 and miR-200b, we overexpressed the antisense for miR-153, miR-506 and miR-200b in KLF4 -expressing HepG2 cells, and compared to HepG2-KLF4 cells and HepG2-scr cells. [score:4]
Target sequence was inserted into pGL3-Basic vector (Promega, Madison, WI, USA) to obtain pGL3-Snail1-3′UTR, pGL3-Slug-3′UTR or pGL3-ZEB1-3′UTR, which contain the miR-153, miR-506 or miR-200b binding sequence, respectively. [score:3]
For example, miR-200 family has been shown to inhibit ZEB1 and ZEB2 [19– 23]. [score:3]
From all the miRNA candidates, we specifically found that KLF4 overexpression increased the levels of miR-153, miR-506 and miR-200b in both, while KLF4 depletion decreased the levels of miR-153, miR-506 and miR-200b in both (Figure 1C). [score:3]
Preparation of miR-153, miR-506 and miR-200b overexpressing HepG2 cells. [score:3]
Transfection with either KLF4, scr, shKLF4, miR-153, as-miR-153, null, miR-506, as-miR-506, miR-200b, or as-miR-200b -expressing plasmids was performed with Lipofectamine-2000 (Invitrogen). [score:3]
In order to confirm that KLF4 may affect the HCC cell growth and invasion through miR-153, miR-506 and miR-200b, we overexpressed the antisense for miR-153, miR-506 and miR-200b in KLF4 -expressing HepG2 cells (Figure 5A– 5B), and compared to HepG2-KLF4 cells and HepG2-scr cells in both MTT and transwell cell migration assay. [score:3]
MiR-153, miR-506 and miR-200b depletion abolishes the suppressive effects of KLF4 on HCC cell growth and invasion. [score:3]
The effects of modifications of miR-153, miR-506 and miR-200b on cell growth in an, in both HepG2 cells (A) and Huh7 cells (B) *p<0.05. [score:1]
Depletion of miR-153, miR-506 and miR-200b abolished the effects of KLF4 on HCC cell growth in an. [score:1]
By bioinformatics analyses, we found that miR-153 bound to 3′UTR of Snail1 mRNA at 440-448 base site (Figure 2A), miR-506 bound to 3′UTR of Slug mRNA at both 439-446 and 843-849 base sites (Figure 2B), and miR-200b bound to 3′UTR of ZEB1 mRNA at both 463-479 and 892-898 base sites (Figure 2C). [score:1]
Then we examined the effects of miR-153, miR-506 and miR-200b on HCC cell growth in an. [score:1]
and C. The levels of miR-153, miR-506 and miR-200b were shown in KLF4-modifed. [score:1]
The miR-200b -modified HCC cells were transfected with 1μg of ZEB1-3′UTR luciferase-reporter plasmid. [score:1]
Depletion of miR-153, miR-506 and miR-200b abolishes the effects of KLF4 on HCC cell growth and invasion. [score:1]
Figure 6Depletion of miR-153, miR-506 and miR-200b abolished the effects of KLF4 on HCC cell growth in an. [score:1]
KLF4 increases levels of miR-153, miR-506 and miR-200b in HCC cells. [score:1]
The sequences encoding miR-153, antisense (as)-miR-153, miR-506, as-miR-506, miR-200b, or as-miR-200b were similarly cloned into pLVX-ZsGreen1-C1 vector. [score:1]
Similarly, the miR-200b -modified HCC cells were then transfected with 1μg of ZEB1-3′UTR luciferase-reporter plasmid. [score:1]
[1 to 20 of 37 sentences]
28
[+] score: 126
In addition, downregulation of miR-200 family members has been associated with resistance to cytotoxic chemotherapeutic agents and EGFR inhibitors [16, 22, 31, 49, 50]. [score:6]
The miR-200 family acts as key inhibitors of epithelial-to-mesenchymal transition (EMT) by directly targeting transcriptional repressors of E-cadherin, ZEB1, and ZEB2 [5]. [score:6]
In addition, the miR-200 family inhibits EMT by regulating a number of target genes such as ZEB1 and ZEB2 [5]. [score:6]
The tumor-suppressive roles of the miR-200 family have also been reported in gastric [8], breast [9], endometrial, [10] pancreatic cancers [11, 12], hepatocellular carcinoma [13], gliomas [14], and lung cancer [15, 16]. [score:3]
Supplementary Figure 3: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing miR-200 family members according to individual tissue miRNA levels. [score:3]
Quantitative real-time PCR was performed in 22 studies, in situ hybridization in 2 studies, and two separate techniques in 2 studies to assess miR-200 family expression. [score:3]
MiR-200 family members are also likely downregulated during tumor progression. [score:3]
The results of this meta-analysis showed a pooled HR of 0.70 (95% CI 0.54–0.91), demonstrating that increased miR-200 family expression in cancer tissues is associated with a favorable outcome (P = 0.007). [score:3]
Moreover, expression of miRNA, including miR-200, may be an early predictor of chemotherapy outcomes in prostate and esophageal cancers [35, 37]. [score:3]
Overall Effects of miR-200 Expression in Cancer Tissues on OS and PFS. [score:3]
Supplementary Figure 2: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing serum miR-200 family members according to tumor type. [score:3]
Overall Effects of Circulating miR-200 Expression on OS and PFS. [score:3]
In addition, the PFS analysis of seven studies revealed a protective role for increased miR-200 tissue expression (pooled HR = 0.63, 95% CI 0.52–0.76), as determined using a random-effects mo del (P = 0.03, I [2] = 44%; Figure 2(b)). [score:3]
The pooled results showed that high miR-200 expression was a favorable prognostic factor in patients with various types of cancer (pooled HR = 0.70, 95% CI 0.54–0.91). [score:3]
In the stratified analyses of PFS, increased tissue miR-200 expression was significantly associated with increased PFS in the ovarian cancer subgroup (pooled HR = 0.50, 95% CI 0.35–0.72) with low heterogeneity (P = 0.26, I [2] = 21%; Supplementary Figure  1B). [score:3]
Supplementary Figure 4: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing miR-200 family members according to individual serum miRNA levels. [score:3]
In the breast cancer subgroup, circulating miR-200 expression showed a significantly negative correlation with PFS (pooled HR = 2.87, 95% CI 1.43–5.73) with low heterogeneity (P = 0.69, I [2] = 0%, Supplementary Figure  2B). [score:3]
This systemic review and meta-analysis showed that elevated cancer tissue expression of miR-200 was associated with longer survival in patients with multiple carcinoma types. [score:3]
Thus, expression of miR-200 family members could influence the cancer phenotype and prognosis of cancer patients [5]. [score:3]
A number of studies showed that miR-200 family members are aberrantly expressed in multiple human malignancies, suggesting that these miRNAs play a role in tumor pathogenesis during all stages of carcinogenesis. [score:3]
The pooled outcome from the OS and PFS analyses revealed HRs of 1.68 (P = 0.007) and 2.62 (P < 0.001), respectively, showing that increased circulating miR-200 family expression is associated with unfavorable survival. [score:3]
Supplementary Figure 1: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing tissue miR-200 family members according to tumor type. [score:3]
Tissue (in 26 studies), serum (in 9 studies), and both tissue and serum samples (in 1 study) were used to determine miR-200 expression. [score:3]
We found that higher expression of circulating miR-200 significantly predicted poor OS (pooled HR = 1.68, 95% CI 1.15–2.46; Figure 3(a)). [score:3]
Pooled analyses of the brain tumor and pancreatic cancer subgroups indicated that tissue miR-200 family expression was positively correlated with OS (pooled HR = 0.51, 95% CI 0.32–0.82 in brain tumor subgroup; pooled HR = 0.35, 95% CI 0.21–0.60 in pancreatic cancer subgroup), with low heterogeneity among the studies analyzed (P = 0.71, I [2] = 0% in brain tumor subgroup; P = 0.26, I [2] = 26% in pancreatic cancer subgroup; Supplementary Figure  1A). [score:3]
These finding suggest that the miR-200 family members function as tumor suppressor genes. [score:3]
The decreased tumor expression of the miR-200 family was significantly associated with poor survival in patients with brain, pancreas, and ovarian cancers. [score:3]
In contrast, a pooled analysis of the colorectal cancer subgroup showed that serum miR-200 expression was negatively correlated with OS (pooled HR = 2.50, 95% CI 1.50–4.18) with low heterogeneity (P = 0.44, I [2] = 0%; Supplementary Figure  2A). [score:3]
The miR-200 family has regulatory functions in diverse biological processes. [score:2]
The authors proposed that the miR-200 family is potentially involved in promoting the last step of the metastatic cascade in the development of macroscopic metastatic masses at distant sites. [score:2]
Taken together, the miR-200 family can affect cancer progression by regulating various cell signaling and genetic pathways. [score:2]
MiR-200 expression is correlated with metastasis and relapse in breast cancer [34]. [score:2]
org/10.1155/2017/1928021): miR-141, miR-200, or miR-429 combined with prognostic, prognosis, survival, tumor, cancer, neoplasm, or carcinoma. [score:1]
The miR-200 family includes five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and can be divided into two clusters based on chromosomal location. [score:1]
Of the remaining 145 studies, 74 were excluded because they did not have the survival data associated with miR-200 family. [score:1]
Although the miR-200 family is a determinant of epithelial cell phenotypes, its prognostic role has not yet been elucidated. [score:1]
Twenty-five studies on miR-200 expression in tissue samples were evaluated for OS analysis (Figure 2(a)) using a random-effects mo del due to high heterogeneity (OS, P < 0.00001, I [2] = 85%). [score:1]
In contrast, low circulating miR-200 levels were associated with a positive prognosis in patients with colon and breast cancers. [score:1]
PFS analysis of three studies (Figure 3(b)) demonstrated a significant association between circulating miR-200 levels and PFS (pooled HR = 2.62, 95% CI 1.68–4.07). [score:1]
Articles meeting the following criteria were included: (1) human patient versus animal study on any type of malignant cancer or neoplasm and (2) assessment data on patient survival (overall survival [OS] and progression-free survival [PFS]) and the miR-200 family with multivariate hazard ratios (HRs) included. [score:1]
However, due to small sample sizes and different detection methods used in previous studies, the prognostic role of miR-200 has not been clearly elucidated. [score:1]
Le et al. reported that miR-200 family members are secreted by highly metastatic epithelial breast cancer cells and that the secretion of these miRNAs results in increased metastatic potential in xenograft mo dels [45]. [score:1]
The miR-200 family was first reported to play a role in olfactory neurogenesis [7]. [score:1]
In addition, increasing evidence suggests that miRNAs have different roles in tumor tissues and blood [44, 45], and thus the prognostic roles of miR-200 family members in both tumor and serum samples were analyzed in this study. [score:1]
Interestingly, the miR-200 levels in plasma and tumor tissues had opposing associations with survival in this study. [score:1]
In contrast, high levels of miR-200 in serum were associated with poor prognosis. [score:1]
Therefore, we performed a literature -based meta-analysis of eligible studies to obtain evidence -based results on the prognostic role of miR-200 family members in various types of malignancies. [score:1]
The miR-200b/a/429 cluster is comprised of miR-200a, miR-200b, and miR-429 and is located on chromosome 1p36. [score:1]
In conclusion, our meta-analysis suggests that the miR-200 family members are potential biomarkers and accurate prognostic predictors in patients with various carcinomas. [score:1]
For future clinical application, large prospective studies are needed to validate the prognostic values of circulating miR-200 in individual cancer types. [score:1]
Therefore, further clarification on the clinical roles of circulating miR-200 family members in well-designed prospective studies is needed. [score:1]
Subgroup analyses also showed that miR-141 and miR-200b were associated with favorable OS, with pooled HRs of 0.40 and 0.58, respectively. [score:1]
For example, Song et al. identified a signature of 17 miRNAs, which included the miR-200 family, in patients with gastric cancer [24]. [score:1]
In addition, the high miR-200b subgroup showed a longer PFS than that of the low miR-200b subgroup (pooled HR = 0.71, 95% CI 0.54–0.94), which was determined using a fixed-effects mo del given the low heterogeneity among the studies (P = 0.68, I [2] = 0%; Supplementary Figure  3B). [score:1]
MiR-200b, miR-200c, and miR-429 have the same seed region (nucleotides 2–7), and miR-200a and miR-141 share a seed region with a difference in only the fourth nucleotide (U to C) among these regions [6]. [score:1]
Some studies have shown no correlation between miR-200 levels in serum and tumor tissues [53]. [score:1]
Recently, two meta-analyses on the prognostic value of miR-200 were published. [score:1]
[1 to 20 of 57 sentences]
29
[+] score: 123
This suggested to us that aberrant overexpression of CREB1 in gastric cancer may be partially due to the downregulation of miR-27b/miR-200b in gastric cancer, and miR-27b/miR-200b could be potential CREB1 inhibitors to suppress carcinogenesis and tumor progression. [score:10]
We suspect that this may be due to the fact that miR-27b has already strongly inhibited the expression of CREB1 by ~50% or more in gastric cancer cells; therefore, it's hard to see evidently stronger inhibitory effect of miR-27b/miR-200b co-transfection on CREB1 expression. [score:9]
These data suggest that CREB1 is a direct target of miR-27b/miR-200b, and is downregulated by miR-27b/miR-200b. [score:7]
In addition, we identified a regulatory mechanism of CREB1 expression that was inhibited by miR-27b and miR-200b. [score:6]
Furthermore, our data suggest that CREB1 is directly targeted and inhibited by miR-27b and miR-200b. [score:6]
Therefore we could not conclude that miR-27b and miR-200b have synergistic roles in inhibiting CREB1 expression in gastric cancer. [score:5]
Furthermore, Western blot analysis validated that miR-27b and miR-200b could significantly inhibit the expression of CREB1 protein in SGC7901 cells, with the decrease of 59.20 ± 2.46% and 34.77 ± 8.94% respectively (Figure 4D, 4E, P = 0.0003 and 0.0165). [score:5]
In this study we showed that CREB1 was a target of miR-27b and miR-200b, and inhibited by miR-27b/miR-200b in both mRNA and protein levels. [score:5]
In this study we found that miR-27b and miR-200b inhibited CREB1 expression in gastric cancer. [score:5]
However, in the present study, we did not observe synergistic action of miR-27b and miR-200b in inhibiting CREB1 expression in gastric cancer. [score:5]
To test whether miR-27b and miR-200b decreased CREB1 expression at mRNA level, we detected the CREB1 mRNA expression in gastric cancer cells transfected with miR-27b/miR-200b. [score:5]
Although miR-27b/miR-200b co-transfection seemed to show more power than miR-200b in suppressing the expression of CREB1, it displayed less activity than miR-27b. [score:5]
In these previous studies, decreased expression of miR-27b/miR-200b was identified as an unfavorable prognostic factor and miR-27b/miR-200b reduced cellular proliferation, migration and invasion, suggesting potentially tumor-suppressing roles of miR-27b/miR-200b in human cancers. [score:5]
Recently, miR-200b and miR-22 have been shown to synergistically suppress Wnt-1 in gastric cancer, indicating an additive effect of miRNAs in modulating gene expression via a fine-tuning manner [35]. [score:5]
CREB1 expression was inhibited by miR-27b and miR-200b. [score:5]
Inhibition of miR-27b and miR-200b on CREB1 expression was also seen in MKN45 cells (Supplementary Figure S3). [score:5]
Subsequently, we tested whether miR-27b and miR-200b could synergistically inhibit CREB1 expression in gastric cancer. [score:5]
B. miR-27b, miR-200b, and miR-27b/miR-200b co-transfection could suppress the luciferase activity in pmirGLO-CREB1 transfected SGC7901 cells by 46.29 ± 8.20% 36.06 ± 3.07%, and 41.14 ± 7.80% respectively (* P < 0.05, ** P < 0.01, *** P < 0.001, N. S. = nonsignificant). [score:3]
D, E. miR-27b, miR-200b, and miR-27b/miR-200b co-transfection led to dramatic reduction of CREB1 protein expression in SGC7901 cells with the decrease of 59.20 ± 2.46%, 34.77 ± 8.94% and 48.76 ± 4.49% respectively (* P < 0.05, ** P < 0.01, *** P < 0.001, N. S. = nonsignificant). [score:3]
We found that miR-27b and miR-200b could dramatically reduce the CREB1 mRNA expression by 57.81 ± 5.74% and 49.98 ± 9.29% respectively in SGC7901 cells (Figure 4C, P = 0.0025 and 0.0011). [score:3]
We found that miR-27b and miR-200b co-transfection led to significant decrease of luciferase activity (41.14 ± 7.80%), CREB1 mRNA expression (53.92 ± 11.2%) and CREB1 protein level (48.76 ± 4.49%) in SGC7901 cells (Figure 4, P < 0.05). [score:3]
The luciferase assays revealed that miR-27b and miR-200b (Figure 4, Supplementary Figure S3), rather than miR-214, miR-32, and miR-429 (Supplementary Figure S2, P > 0.05) could significantly suppress the luciferase activity in pmirGLO-CREB1 (3′-UTR) and miRNAs co -transfected cells. [score:2]
C. Compared with negative control, miR-27b, miR-200b, and miR-27b/miR-200b co-transfection could significantly reduced the CREB1 mRNA expression in SGC7901 cells by 57.81 ± 5.74%, 49.98 ± 9.29% and 53.92 ± 11.2% respectively (* P < 0.05, ** P < 0.01, *** P < 0.001, N. S. = nonsignificant). [score:2]
The gastric cancer cells were co -transfected with miR-27b (15 nM) and miR-200b (15 nM), and subjected to luciferase assay and CREB1 expression detection. [score:2]
Based on these data and the previous reports about the candidate miRNAs' function, we chose 5 cancer-related or tumor-suppressing miRNAs, including miR-214, miR-200b, miR-27b, miR-32, and miR-429, for further investigation. [score:1]
MiR-27b and miR-200b have been reported to be downregualted in numerous human tumors, including gastric cancer [30– 33]. [score:1]
Our findings suggest that CREB1, as a valuable biomarker of gastric cancer prognosis, may be a promising approach to gastric cancer treatment through the miR-27b/miR-200b-CREB1 pathway. [score:1]
Figure 4 A. Sequence alignment of miR-27b and miR-200b with the 3′-UTR of CREB1. [score:1]
However, miR-27b/miR-200b co-transfection did not show stronger ability than miR-27b or miR-200b alone (Figure 4, P > 0.05). [score:1]
A. Sequence alignment of miR-27b and miR-200b with the 3′-UTR of CREB1. [score:1]
Specifically, miR-27b and miR-200b transfection led to 46.29 ± 8.20% and 36.06 ± 3.07% decrease of luciferase activity in SGC7901 cells respectively (Figure 4A, 4B, P = 0.0016 and 0.0054). [score:1]
[1 to 20 of 31 sentences]
30
[+] score: 119
In the dataset we analysed in [86], all members of the miR-200 family appear to be highly up-regulated in cancer tissues (from 4- to 8- folds) and this up-regulation is counteracted by a similar, even if not comparable, overexpression of PVT1 that in cancer tissues appears to increase of about two folds. [score:9]
This observation is highly consistent with our hypothesis that the up-regulation of PVT1 in tumour samples is mostly due to the up-regulation of isoforms of the gene devoid of the key exons exerting the sponge activity on miR-200 family members. [score:7]
A large number of studies showed that the down-regulation of the miR-200 family members appears to promote the epithelial-mesenchymal transition, proving their suppressive effects on cancer cell proliferation, migration, and invasion [115– 118]. [score:6]
This up-regulation is counteracted by a similarly, but even more significant, overexpression of the miR-200 family members (see Fig 3A and 3C for the representative case of the miR-200b). [score:6]
Moreover, it revealed, in normal MMI-network, a net binding preference towards the miR-200 family, which it antagonizes to regulate the expression of hundreds of mRNAs known to be related to the cancer development and progression (e. g. GATA3, CDH1, TP53, TP63, TP73, RUNX1, and RUNX3). [score:5]
However, Park et al. [119] experimentally demonstrated how the down-regulation of all members of the miR-200 family would result in mesenchymal cell lines, while a their up-regulation would appear characteristic of an epithelial phenotype. [score:5]
From one hand, the absence in two PVT1 isoforms of the exon where the MREs for the all members of the miR-200 family reside could lead to support the hypothesis of a preferential expression in cancer tissues of these two isoforms, thus justifying the lack of the miRNA/target interaction with a consequent breakdown of the PVT1 ceRNA activity (i. e. the exon skipping mechanism). [score:5]
Specifically, PVT1 emerged as a putative ceRNA modulating the activity of all members of the miR-200 family on their target mRNAs, which are well-known to be drastically involved in breast cancer morphogenesis and development. [score:4]
The question, then, arises: if PVT1 and the miR-200 family are both up-regulated in cancer, why PVT1 stops working as sponge in cancer? [score:4]
From the other hand, the observation of a simultaneous up-regulation of the PVT1 gene and the miR-200 family members could lead to support the alternative hypothesis of different relative concentrations between each isoform and the miR-200 family members. [score:4]
This consideration together with the observed synchronised up-regulation of the PVT1 gene and the miR-200 family members encouraged us to hypothesize different scenarios that could be in principle compatible with the ceasing of the PVT1 sponge activity in breast cancer tissues. [score:4]
Interestingly, such a sponge mechanism resulted completely abolished in cancer tissues, although both PVT1 and the miR-200 family members appeared up-regulated in the pathological condition. [score:4]
This suggests the following argument of plausibility of the PCA analysis results: the first PC, which explain by alone about the 60% of the total variance of the analysed data (S2 Table), corresponds to the variation of the isoform that, missing the binding site, does not interact with the miR-200 family; while the second PC, explaining by alone about the 20% of the total variance of the analysed data (S2 Table), represents the variation of the isoform that, hosting the binding site for the miR-200b/200c/429 cluster, could be act as competitors of the targets of these miRNAs. [score:3]
Moreover, comparing the relative expression levels of these two isoforms both in normal and cancer tissues with respect to the ones of the one representative member of the miR-200b/200c/429 cluster (i. e. miR-200b), we found a drastic drop, in the pathological condition, in the relative concentration of the PVT1 isoform hosting the binding site for the miR-200b. [score:3]
The observation that both the isoforms, with and without the exons where the MREs of the miR-200 family memebrs reside, resulted expressed in both cancer and normal breast tissues undermine the truthfulness of the hypothesis rested on the exon skipping mechanism and corroborates the proposal based on the relative concentrations of the PVT1 isoforms and the miR-200 family members. [score:3]
PVT1 and miR-200b expression levels in human breast cancer tissues. [score:3]
In particular, inspiring by our amazing results of [86] and by the growing interest of the scientific community in the oncogenic role of the lncRNA PVT1, we focused on its activity as sponge modulator of the activity of the miR-200 family members on their targets and on the withdrawal of its decoy service in breast cancer tissues. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
S4 TableThis table reports the variations between cancer and normal tissues of the expression levels of all the PVT1 isoforms with respect to the variation of the TCONS_147501 isoform lacking the binding site for the miR-200 family members, showed in Fig 7A. [score:3]
According to that, a substantial decrease in cancer tissues of the relative variation of the isoform harbouring the binding site for one or more members of the miR-200 family could be due to a huge increase of the miR-200 family associated with a moderate growth in cancer of the expression levels of this PVT1 isoform. [score:3]
In particular, we thoroughly studied the intriguing phenomenon of the breakdown of the PVT1 functioning as sponge of the miR-200 family members in the breast invasive carcinoma by analysing the expression data of its multiple isoforms (S1 Table). [score:3]
We speculate that in the normal tissues only the red isoform of PVT1 gene acts as sponge regulator of the miR-200 family members. [score:2]
We speculate that the TCONS_147426 isoform acts as sponge regulator of the miR-200b in normal breast tissues, while the sponge mechanism is broken down in cancer tissues because this isoform shows a much lower concentration with respect to the miR-200b (Fig 8A). [score:2]
In particular, the principal component analysis suggested that the variations between cancer and normal breast tissues of all PVT1 isoforms can be explained by only two principal components: one corresponding to the isoform harbouring the binding site for the miR-200b/200c/429 cluster and the other one representing the isoform missing the binding site for any member of the miR-200 family members. [score:1]
On the basis of the similarities of their seed sequences (i. e. 6 nucleotides at positions 2-7 from the miRNA 5’-end [113]), the miR-200 family members can be clustered into two groups only differing for one nucleotide in the seed sequence: miR-200a/141 (AA CACU) and miR-200b/200c/429 (AA UACU) [114, 115]. [score:1]
In both panels, the red slice corresponds to the isoform (TCONS_147426) with seed match for the miR-200b/200c/429 cluster and the blue slice corresponds to the isoform (TCONS_147501) lacking the binding site for any member of the miR-200 family. [score:1]
In this plot, it is possible to group isoforms in three classes: the isoform missing the binding site for the miR-200 family members (blue isoform, TCONS_147501), the isoform with the seed match for the miR-200b/200c/429 cluster (red isoform, TCONS_147426), and all the others. [score:1]
S2 File This file contains the full genome sequences (in FASTA format) of the two PVT1 isoforms that mostly change between normal and cancer tissues: TCONS_147501 (missing the binding site for miR-200 family members) and TCONS_147426 (harbouring the binding site for the miR-200b/200c/429 cluster). [score:1]
0171661.g008 Fig 8 (A) The ratio between the abundance of the red isoform (harbouring the binding site for the miR-200b/200c/429 cluster) over the abundance of the miR-200b in both normal (striped rectangle) and cancer tissues (full boxes). [score:1]
In order to understand the meaning of these two PCs, we drew the score plot (Fig 6B and S2 Table) and found that the first PC is able to separate the contribution of the isoform missing the binding site for any members of the miR-200 family from the others, while the second PC is able to separate the contribution of the isoform hosting the binding site for the miR-200b/200c/429 cluster from the others. [score:1]
The analysis of the PVT1 genomic locus showed the existence of multiple isoforms (Fig 4 and S2 Fig) representing all the possible configurations: hosting the binding site for some (e. g. Iso6 or Iso7 in Fig 4) or all members of the miR-200 family (e. g. Iso1 in Fig 4); missing the binding site (e. g. Iso11 and Iso12 in Fig 4). [score:1]
The miR-200 family consists of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
It is connected to 753 different mRNAs (∼ 50% of total mRNAs in the network) and the miR-200 family members are arbitrating over the 80% of these interactions (Fig 2A). [score:1]
To shed light on which of the two hypothesised mechanisms lies the origin of the PVT1 stoppage as sponge, we looked at the PVT1 abundance in terms of its isoforms and we found that in both normal (Fig 5A and S3 Table) and cancer tissues (Fig 5B and S3 Table) only two isoforms represent the biggest slices: the first largest slice—which corresponds to the 50% (48%) of the PVT1 total abundance in normal (cancer) breast samples—represents the isoform missing the binding site for the miR-200 family (TCONS_147501); the second largest slice—which corresponds to the 15% (17%) of the PVT1 total abundance in normal (cancer) breast samples—represents the isoform hosting the binding site for the miR-200b/200c/429 cluster (TCONS_147426). [score:1]
0171661.g003 Fig 3The main actors of the normal MMI-network are the miR-200 family members and the long non-coding PVT1. [score:1]
edu/) in order to obtain the S2 Fig. (GTF) This file contains the full genome sequences (in FASTA format) of the two PVT1 isoforms that mostly change between normal and cancer tissues: TCONS_147501 (missing the binding site for miR-200 family members) and TCONS_147426 (harbouring the binding site for the miR-200b/200c/429 cluster). [score:1]
The main actors of the normal MMI-network are the miR-200 family members and the long non-coding PVT1. [score:1]
More than the 80% corresponds to the miR-200 family members. [score:1]
Among them, there are all members of the miR-200 family, whose importance in breast cancer is well-known and is related to the epithelial-mesenchymal transition. [score:1]
The ratio between the blue isoform and the miR-200b does not change, while the ratio between the red isoform and the miR-200b shows a drastic fall in cancer tissues. [score:1]
In particular, the analysis of the normal miRNA -mediated interactions network, built in [86], pointed out how the main actors of this rewiring were PVT1 and the miR-200 family members. [score:1]
So, our analysis supports the hypothesis that the “on/off” switch from normal to cancer state of the PVT1 sponge activity is mostly due to the variation of the relative concentration of PVT1 isoform hosting the binding site for the miR-200b/200c/429 cluster. [score:1]
Studying the variation of each PVT1 isoform between normal and cancer breast tissues with respect to the variation of TCONS_147501, the results of PCA seems to be confirmed (Fig 7 and S4 Table): the isoform harbouring the binding site for the miR-200b/200c/429 cluster and the isoform missing the binding site for any member of the miR-200 family, are the only isoforms that change (Fig 7A). [score:1]
Red boxes correspond to the binding sites for the miR-200 family members. [score:1]
In cancer tissues it stops working as sponge since its concentration is much lower than the concentration of the miR-200 family members (here is reported only the case of miR-200b). [score:1]
The role of the miR-200 family in epithelial-mesenchymal transition. [score:1]
The miR-200 family is one of the most wi dely studied for its crucial role in cancer initiation, metastasis, diagnosis, and treatment. [score:1]
0171661.g007 Fig 7(A) The variations between cancer and normal tissues of all the PVT1 isoforms with respect to the variation of the blue isoform lacking the binding site for the miR-200 family members (S4 Table). [score:1]
[1 to 20 of 48 sentences]
31
[+] score: 111
The western blot analysis further showed that knockdown of lncRNA HOXA11-AS down-regulated EMT markers N-cadherin and Vimentin expression and up-regulated the E-cadherin expression, however, co -transfected with si-HOXA11-AS and miR-200b inhibitor dismissed the effects in A549 and H1299 cells (Fig.   5d, e). [score:14]
Our results demonstrated that inhibition of lncRNA HOXA11-AS significantly up-regulated the miR-200b expression level in A549 and H1299 cells (Fig.   4d). [score:8]
Our results showed that up-regulation of lncRNA HOXA11-AS predicted a poor prognosis and lncRNA HOXA11-AS promoted cell epithelial–mesenchymal transition (EMT) by inhibiting miR-200b expression in NSCLC. [score:8]
Moreover, knockdown of lncRNA HOXA11-AS inhibited cell invasion ability, however, co -transfected with si-HOXA11-AS and miR-200b inhibitor dismissed the effects in A549 and H1299 cells (Fig.   6a–d). [score:6]
miR-200b inhibits migration and invasion in NSCLC cells via targeting FSCN1 [25]. [score:5]
miR-200b has been found to be involved in the tumor invasion and EMT, such as, MicroRNA-200b suppresses cell invasion and metastasis by inhibiting the EMT in cervical carcinoma [23]. [score:5]
In the study, we demonstrated that lncRNAHOXA11-AS interacted with EZH2 and DNMT1 and inhibited miR-200b expression levels in NSCLC cells. [score:5]
Thus, these results confirmed that lncRNA HOXA11-AS promoted cell EMT and suppressed miR-200b expression by interacting with EZH2 and DNMT1 in NSCLC cells. [score:5]
LncRNA HOXA11-AS suppresses miR-200b expression by interacting with EZH2 and DNMT1 in NSCLC cells. [score:5]
miR-200b had been found to suppressed cell EMT process and functioned as a target of EZH2, such as, DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression [17]. [score:5]
Data show a representative of three independent experiments Next, we explored whether lncRNA HOXA11-AS regulated miR-200b expression by recruiting EZH2 and DNMT1 to the promoter of miR-200b. [score:4]
Moreover, knockdown of EZH2 also increased the miR-200b expression in A549 and H1299 cells (Fig.   4e). [score:4]
Furthermore, we found that knockdown of lncRNA HOXA11-AS suppressed cell invasion and EMT phenomenon by repressing miR-200b in NSCLC. [score:4]
Data show a representative of three independent experiments Next, we explored whether lncRNA HOXA11-AS regulated miR-200b expression by recruiting EZH2 and DNMT1 to the promoter of miR-200b. [score:4]
Cheng YX Zhang QF Hong L Pan F Huang JL Li BS Hu M MicroRNA-200b suppresses cell invasion and metastasis by inhibiting the epithelial–mesenchymal transition in cervical carcinomaMol Med Rep. [score:4]
Thus, the above results indicated that lncRNA HOXA11-AS could regulate the miR-200b expression interacted with EZH2 and DNMT1in NSCLC cells. [score:4]
Data show a representative of three independent experiments Fig.  6LncRNA HOXA11-AS promoted cell invasion abilities by inhibiting miR-200b in NSCLC. [score:3]
The mechanistic findings showed demonstrated that HOXA11-AS interacted with EZH2 and DNMT1 and recruited them to the miR-200b promoter regions to repress miR-200b expression in NSCLC cells, which promoted cell EMT in NSCLC. [score:3]
LncRNAHOXA11-AS promoted cell EMT process by inhibiting miR-200b in NSCLC. [score:3]
2 × 10 [5] A549 and H1299 cells were seeded in 6-well plates and were incubated overnight, and then transfected using 100 nmol/L of small-interfering si-HOXA11-AS-1 or si-HOXA11-AS-2, miR-200b inhibitor and a negative control (NC) that were purchased from RiboBio (Guangzhou, China). [score:3]
MicroRNA miR-200b affects cell proliferation, cell invasion and stemness of endometriotic cells by targeting ZEB1, ZEB2 and KLF4 [24]. [score:3]
RIP and Chromatin immunoprecipitation assays were performed to analyze the association between lncRNA HOXA11-AS and miR-200b expression in NSCLC cells. [score:2]
Furthermore, we demonstrated that HOXA11-AS promoted cell invasive ability and epithelial–mesenchymal transition (EMT) process by repressing miR-200b via interacting with EZH2 and DNMT1 in NSCCL cells. [score:1]
The ChIP assays revealed that EZH2 and DNMT1 could bind to the promoter region of miR-200b in A549 and H1299 cells (Fig.   5a), and knockdown of significantly decreased the binding of EZH2 and DNMT1 to the promoter of miR-200b (Fig.   5b, c). [score:1]
HOXA11-AS Epithelial–mesenchymal transition EZH2 DNMT1 miR-200b Lung cancer -associated mortality is the most common cause of cancer death worldwide [1]. [score:1]
Fig.  5LncRNA HOXA11-AS epigenetically silenced miR-200b transcription by binding to EZH2 and DNMT1 in NSCLC cells. [score:1]
[1 to 20 of 26 sentences]
32
[+] score: 110
29, 30 The regulating relationship between miR-200b-3p and lncRNA XIST was confirmed by the following evidences: (1) miR-200b-3p expression was markedly increased upon knockdown of lncRNA XIST; (2) ectopic expression of miR-200b-3p obviously decreased the expression of lncRNA XIST, whereas inhibition of miR-200b-3p increased the expression of lncRNA XIST; (3) an inverse association existed between the expression level of lncRNA XIST and miR-200b-3p in CRC tissues; (4) luciferase activity assay confirmed that miR-200b-3p could directly bind to the 3′-end of lncRNA XIST. [score:15]
Knockdown of lncRNA XIST could significantly increase the expression of miR-200b-3p level in CRC cell lines HCT116 (* P<0.05, Figure 5b), and ectopic expression of miR-200b-3p could obviously reduce the expression of lncRNA XIST, whereas inhibition of miR-200b-3p could increase the expression of lncRNA XIST in CRC cells (* P<0.05, Figure 5b). [score:12]
In conclusion, we provided the first evidence that lncRNA XIST was overexpressed in CRC tissues, and lncRNA XIST upregulated the miR-200b-3p target gene ZEB1 by way of competitively ‘sponging’ miR-200b-3p, and then promoted cell proliferation, invasion, EMT and stem cell formation in vitro as well as tumorigenesis and metastasis in vivo (Figure 8). [score:8]
What’s more, the suppression of tumor phenotype by knockdown of lncRNA XIST could be restored by ectopic expression of ZEB1 or inhibition of miR-200b-3p (* P<0.05, Figures 7d and e). [score:8]
Knockdown of lncRNA XIST could significantly reduce the mRNA level of ZEB1 in CRC cells, and the reduced level of ZEB1 mRNA induced by lncRNA XIST knockdown could be restored by ectopic expression of ZEB1 or inhibition of miR-200b-3p (* P<0.05, Figure 7c). [score:7]
To our interest, ectopic expression of miR-200b-3p could decrease whereas inhibition of miR-200b-3p could increase the expression of ZEB1 mRNA level in CRC cells (* P<0.05, Figure 6b). [score:7]
Luciferase activity assay showed that ectopic expression of miR-200b-3p and/or knockdown of lncRNA XIST could significantly decrease the luciferase activity of the wild-type ZEB1 3′-UTR, but not of the mutant type ZEB1 3′-UTR; moreover, the reduced luciferase activity caused by lncRNA XIST knockdown could be restored by inhibition of miR-200b-3p (* P<0.05, Figure 6c). [score:6]
Western blot analysis indicated that ectopic expression of miR-200b-3p and/or knockdown of lncRNA XIST significantly reduced the protein level of ZEB1, whereas inhibition of miR-200b-3p increased the protein level of ZEB1 in CRC cells (Figure 6d). [score:6]
The 3′-end fragment from lncRNA XIST containing the predicted miR-200b-3p -binding site was amplified using PCR and subcloned into a pmirGLOluciferase Target Expression Vector (Promega, Madison, WI, USA) to form the XIST wild-type (pmirGLO-XIST-wt) vector. [score:5]
To our interest, miR-200b-3p was one of the miRNAs that could be potentially regulated by lncRNA XIST, and miR-200b-3p has been found to be downregulated in CRC and other tumors. [score:5]
lncRNA XIST could indirectly regulate ZEB1 expression by way of sponging to miR-200b-3p. [score:5]
32, 33 In this study, we found that ZEB1 was directly targeted by miR-200b-3p. [score:4]
Taken together, these data showed that lncRNA XIST functioned as a ceRNA for miR-200b-3p to regulate ZEB1 expression. [score:4]
In addition, an inverse correlation was found between the expression of lncRNA XIST and miR-200b-3p in CRC tissues (r=-0.73, * P=0.013, Figure 5d). [score:3]
lncRNA XIST acts as a ceRNA for miR-200b-3p to modulate ZEB1 expression in CRC cells. [score:3]
were performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with a final concentration of 50 nM and collected for assays after 48 h. The miR-200b-3p mimic, miR-200b-3p inhibitor and negative control (NC) oligonucleotides were purchased from Ribobio (Guangzhou, China). [score:2]
We then explored the genes that were potentially regulated by miR-200b-3p. [score:2]
The All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, Montgomery, USA) was used to detect the miR-200b-3p level according to the provider’s instructions; U6 small RNA was used as the positive control. [score:1]
cn/), we found that lncRNA XIST formed complementary base pairing with miR-200b-3p (Figure 5a). [score:1]
However, no obvious reduction was observed in cells transfected with miR-200b-3p mimics and pmirGLO-XIST-wt (* P<0.05, Figure 5c). [score:1]
The miR-200b-3p/ZEB1 axis mediated the lncRNA XIST’ oncogenic effect in CRC cells. [score:1]
We found that miR-200b-3p mimics markedly reduced the luciferase activities of pmirGLO-XIST-wt. [score:1]
To confirm the direct binding relationship between lncRNA XIST and miR-200b-3p, a luciferase activity assay was performed. [score:1]
As shown in Figure 6a, there are several miR-200b-3p -binding sites in the 3′-UTR of ZEB1. [score:1]
The mutated miR-200b-3p -binding sequence was constructed that was named as pmirGLO-XIST-mt vector. [score:1]
[1 to 20 of 25 sentences]
33
[+] score: 110
To determine whether EZH2 could inhibit miR-200b expression at the promoter level, we co -transfected non -targeting control siRNA or EZH2 siRNA with miR-200b promoter constructs into MPNST724 and S462 cells. [score:7]
In addition to EZH2 knockdown, we also tested the effects of EZH2 inhibitor DZNep treatment on miR-200b promoter activity and miR-200b target reporter activity in MPNST cells. [score:6]
showed that EZH2 knockdown significantly increased miR-200b promoter activity in both cell lines, suggesting that EZH2 suppresses miR-200b expression at the transcription level (Figure  6C). [score:6]
Our study has shown that EZH2 directly inhibits miR-200b expression in MPNST, which may ultimately also contribute to EMT progression, MPNST invasion and metastasis. [score:6]
However, miR-200b target reporter activity was significantly inhibited by DZNep treatment in S462 cells (Figure  6 F). [score:5]
In addition, we demonstrated that EZH2 transcriptionally inhibits miR-200b expression and induces epithelial-mesenchymal transition in MPNST cells. [score:5]
Additionally, miR-200b is known to act as an inhibitor of EMT by targeting the transcription faction ZEB1/2 and then by activating E-cadherin [15, 16]. [score:5]
Our data also showed that EZH2 suppressed miR-200b expression and induced epithelial-mesenchymal transition in MPNST cells. [score:5]
Our previous miRNA microarray analyses also showed that miR-200b was upregulated when EZH2 was knocked down in MPNST724, S462, and STS26T cells [5]. [score:5]
In an independent experiment, miR-200b expression increased significantly in EZH2-knockdown cells compared with non -targeting siRNA control cells in the MPNST724, S462, and STS26T cell lines (Figure  6A). [score:5]
Figure 6 EZH2 regulated miR-200b expression and mesenchymal-epithelial transition in MPNST cells. [score:4]
EZH2 regulates miR-200b expression in MPNST cells. [score:4]
We further investigated whether EZH2 knockdown induced functional miR-200b expression through the use of miR-200b target reporter systems. [score:4]
Therefore, we determined whether miR-200b upregulation by EZH2 siRNA had similar effects in MPNST cells. [score:4]
It has been shown that miR-200b reduced epithelial–mesenchymal transition by modulating vimentin and E-cadherin expression [15, 16]. [score:3]
miR-200b expression was normalized to SNORD47. [score:3]
Therefore, these reporter constructs served as functional targets for miR-200b in transfected cells. [score:3]
We also determined whether the miR-200b level is increased as EZH2 is inhibited by DZNep treatment. [score:3]
These results indicated that EZH2 suppressed miR-200b transcription in MPNST cells. [score:3]
We co -transfected control or EZH2 siRNA with miR-200b target reporter into MPNST724 and S462 cells. [score:3]
Quantitative RT-PCR analyses showed that miR-200b expression was significantly increased by DZNep treatment in a dose -dependent manner in MPNST724 and S462 cells (Figure  6B). [score:3]
We here confirmed the miR-200b expression results by qRT-PCR analyses. [score:3]
Based on miR-200b sequences, three repeats of miR-200b perfect match target sequences were designed and cloned into the pLightSwitch reporter vector. [score:3]
miR-30d and miR-200b target sequence reporters were constructed by cloning 3 repeats of miR-30d and miR-200b perfect binding sequences into the 3’ end of the luciferase gene of an empty pLightSwitch vector (SwitchGear Genomics) using Xba I and Xho I sites (Additional file 1: Table S1). [score:3]
This suggested that EZH2 knockdown induced functional miR-200b in MPNST cells. [score:2]
Luciferase activity assays showed that by silencing EZH2, miR-200b target reporter activity was significantly reduced (Figure  6D). [score:2]
Together with our findings, these data suggest that EZH2-regulated miR-200 and miR-30 family members may modulate cell survival and EMT in numerous different cancers. [score:2]
The miR-200 and miR-30 families have been shown to induce mesenchymal-epithelial transition [25]. [score:1]
Promoter regions of miR-200b were amplified by genomic PCR with use of specific primers and cloned into the pGL vector directionally at Nhe I and Bgl II sites (Additional file 1: Table S1). [score:1]
showed that DZNep treatment significantly induced miR-200b promoter activity in S462 cells (Figure  6E). [score:1]
[1 to 20 of 30 sentences]
34
[+] score: 108
2016.00140/full#supplementary-material Figure S1 miR-200 inhibitors up-regulate PTEN expression. [score:8]
Taken together, the miR-200 family, especially miR-200c, directly targets the 3′UTR of PTEN and inhibits its protein expression. [score:8]
To identify the binding site of miR-200 that plays the most important role in miR-200-regulated PTEN protein expression, we generated three different site-directed mutations on PTEN 3′UTR. [score:6]
To explore the potential roles of miR-200 family members in translational regulation of PTEN expression, we co -transfected a luciferase reporter construct containing PTEN 3′UTR together with different miR-200 family members. [score:6]
We provided evidence showing that upregulation of miR-200 family by ER stress exhibited protective roles via PTEN suppression in early phase of AD. [score:6]
In order to understand the role of miR-200 family in AD development, we employed the TargetScan (version 6.2, 2012) database to predict potential miR-200 target genes. [score:6]
On the other hand, transfection of miR-200 inhibitors to HCT116 colon cancer cells that have high endogenous levels of miR-200 resulted in increased expression of PTEN (Figure S1). [score:5]
Overexpression of miR-200 family inhibitors dramatically enhanced luciferase reading (Figure 1C). [score:5]
Our results showed that miR-200b, c and 429 mainly target site I and II, whereas miR-141, 200a mainly target site III (Figures 1D–F). [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
Among them, microRNA-200 family showed a dynamic expression profile during AD development in the APPswe/PSΔE9 transgenic mice. [score:4]
Among the three sites, site II seems to have the most important role in the regulation of PTEN expression by miR-200 family. [score:4]
Among them, miR-200a/b/c, miR-141, and miR-429 in the miR-200 family were significantly upregulated in early age AD in mice. [score:4]
In this study, we identified PTEN as a target of miR-200 family in neuronal cells. [score:3]
As predicted by Targetscan (version 6.2, 2012), three miR-200 family bind sites (Site I and Site III for miR-141/200a, Site II for miR-200b/c/429) are highlighted. [score:3]
HCT-116 cells were transfected with different combinations of miR-200 inhibitors as indicated. [score:3]
Identification of PTEN as a target of miR-200 family. [score:3]
Database prediction indicated that PTEN has three miR-200 family binding sites in its 3′UTR and may be one of the potential targets of miR-200 family (Figure 1A). [score:3]
Among miR-200 family, miR-200c is the major microRNA that targets PTEN. [score:3]
Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Among the five miR-200 family members, miR-200c plays the most important regulatory role and was used to represent miR-200 family in the following parts of the study (Figures 1D–F). [score:2]
Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. [score:2]
In nerve system, miR-200 family is enriched in olfactory and has been implicated in neuronal proliferation and differentiation (Choi et al., 2008; Pandey et al., 2015). [score:1]
pMIR-Reporter constructs containing either wild type or mutant fragments of PTEN 3′UTR were co -transfected into 293T cells with miR-200 family miRs (miR-141/200a, miR-200b/c/429, or miR-200c). [score:1]
For luciferase activity assay, we introduced mutations on each miR-200 family miR binding site by overlap PCR. [score:1]
Name of miRs/siRNAs Sequence miR-200a 5′-UAACACUGUCUGGUAACGAUGU miR-200b 5′-UAAUACUGCCUGGUAAUGAUGA miR-200c 5′-UAAUACUGCCGGGUAAUGAUGGA miR-141 5′-UAACACUGUCUGGUAAAGAUGG miR-429 5′-UAAUACUGUCUGGUAAUGCCGU miR-NC 5′-UAACGUGUCACGUCUCCGACUA Anti-miR-200c 5′-UAACACUUGCCGGGUAAUGGUGUA Anti-miR-NC 5′-UCUUGCCGGGCCCGAUCCAACGA siCont 5′-UUCUCCGAACGUGUCACGU siPTEN 5′-AACCCACCACAGCUAGAACUU 2.3 kb PTEN 3′UTR was amplified by PCR from a human cDNA library. [score:1]
MiR-200 family can be divided into two groups according to the seed sequences (group I: miR-141 and miR-200a; group II: miR-200b, miR-200c, and miR-429). [score:1]
Cotransfection of miR-200b, miR-200c, a mixture of group I, group II or the whole family of miR-200s all resulted in a decrease in luciferase activity (Figure 1B). [score:1]
A series of truncations containing different miR-200 family binding sites were also amplified and cloned into the pMIR-REPORT vector. [score:1]
[1 to 20 of 30 sentences]
35
[+] score: 100
Upon removal of Dox on day 18, the Dox+/− cells gradually returned to an epithelial expression signature when analyzing all the parameters examined in the EMT process i. e. direct miR-200 targets (Zeb1, Zeb2, FHOD1, PPMIF and FN-1mRNA), Zeb1/Zeb2 regulated genes (miR-200c/141 locus, ESA, ESRP1, E-cadherin and Vimentin), splicing isoforms of CD44 and p120 catenin and the SRF target gene, CTGF (Figs 3 and 4). [score:9]
Expression levels of the indicated mRNAs after TuD-141/200c induction and a release from the functional inhibition of the miR-200 family. [score:5]
Protein expression levels of the indicated genes after a release from the functional inhibition of the miR-200 family. [score:5]
Expression levels of specific genes after TuD-141/200c induction and a release from the functional inhibition of the miR-200 family. [score:5]
Overall, these findings indicated that the inhibition of miR-200 family activity alone can trigger several layers of molecular events in a sequential manner including RNA interference, transcriptional repression and activation, switching of splicing isoforms and probably actin remo deling and subsequent SRF target gene induction. [score:5]
Our current results indicate that EMT induced by TuD -mediated miR-200 family inhibition is fairly reversible after a release from this inhibition. [score:5]
It was also recently reported that because of a single nucleotide difference in their core sequences (2 to 8 nt from the 5′ end), miR-200a and miR-200b have distinct target specificities, whereas a considerable number of target genes overlap between them 10. [score:5]
Since each MBS in TuD can efficiently suppress the activity of miRNAs with the same core sequence 17, this TuD hybrid, TuD-141/200c, would therefore efficiently suppress almost the entire miR-200 family (Fig. 1a). [score:5]
Of note, CTGF mRNA was induced by the miR-200 inhibition and repressed by the release from this inhibition with a slightly delayed kinetics compared with those of vimentin. [score:4]
EMT and MET induced by the regulated inhibition of miR-200 family activity. [score:4]
This would lead to the down-regulation of endogenous miR-200c/-141 production, confirming the establishment of a double -negative feedback loop between Zeb1/2 and the miR-200 family members in a quite early stage of EMT. [score:4]
To test whether our observations that the EMT induced by miR-200 suppression is highly reversible could be extended to another cell line, we tested the mammary tumor cell line, SUM149PT, as it has been reported to show phenotypic equilibrium in monolayer culture 27. [score:3]
Other miR-200 family targets, including FHOD1, PPMIF and FN1 mRNAs, were induced in a lesser extent with distinct kinetics for each gene (Fig. 3a). [score:3]
An miR-200 target, FHOD1 (formin homologue domain-containing protein 1) (Fig. 3a), as a member of the formins, is expected to contribute to actin polymerization (F-actin formation) during EMT. [score:3]
Kinetics of the multiple molecular events involved in the EMT induced by inhibition of the miR-200 family. [score:3]
Reversion of the observed multiple molecular events after the release from miR-200 -family inhibition. [score:3]
Importantly in culture C (ESA(−) cells originated from ESA(+) cells after the TuD-141/200c induction), Zeb1 and Zeb2 were drastically elevated among the miR-200 family targets. [score:3]
How to cite this article: Haraguchi, T. et al. Dynamics and plasticity of the epithelial to mesenchymal transition induced by miR-200 family inhibition. [score:3]
As early as 12–16 hours after Dox addition, representative miR-200 family targets, Zeb1 and Zeb2 began to increase their levels by more than 5-fold, indicating that their mRNAs are extremely sensitive to a reduction in miR-200 activity (Fig. 3a and Supplementary Figure S9). [score:3]
Importantly, all of the major mRNAs shown to be involved in miR-200 -mediated EMT in HCT116 cells had similar changes in SUM149PT cells upon induction of and release from TuD-141/200c expression, indicating that cascade of molecular events represented in Supplementary Figure S10 can be induced by modulation of the functional miR-200 family activity in different cell types. [score:3]
EMT and MET are also regulated by the activities of miR-200 family members in the SUM149PT triple -negative breast cancer cell line. [score:2]
Using our system described above for regulating miR-200 family activity, we performed time course analysis of the key molecular events that have been previously reported to be involved in the EMT. [score:2]
The cumulative evidence to date indicates that the miR-200 family members are among the key regulators of the EMT. [score:2]
12) is much higher than that of the other miR-200 members (which are transcribed from chr. [score:1]
Even with this limitation, we were still able to detect the reversibility of miR-200 -mediated EMT in this cell line. [score:1]
The asterisk indicates the nucleotides that differ between miR-200a/141 and miR-200b/c/429. [score:1]
Sequences of miR-200 family members as well as their seed sequences (grey box) are shown in the lower panel. [score:1]
The observed cascade of molecular events induced by modulation of the functional miR-200 family activity is schematically represented in Supplementary Figure S10. [score:1]
Considering that the core sequence of miR-200c is shared by miR-200b and -429, whereas that of miR-200a is identical to miR-141 (Fig. 1a), we designed a hybrid type TuD molecule with 2 miRNA binding sites (MBS) that are complementary to miR-200c and miR-141, respectively. [score:1]
Our current results highlight the molecular basis of epithelial plasticity supported by the miR-200 family. [score:1]
MiRNA microarray analysis of HCT116 cells indicated that two miR-200 loci are transcribed at basal levels, whereas production of miR-200c/-141 (transcribed from chr. [score:1]
Hence, the major cascade of molecular events associated with miR-200 -dependent EMT that we observed in HCT116 cell system can be basically recapitulated in SUM149PT cells. [score:1]
This is mechanistically supported by the transcriptional reversibility of key genes downstream of the miR-200 family examined here including Zeb1, Zeb2, FHOD1, PPM1F, E-Cad, ESRP1, ESA, and CTGF. [score:1]
Overall these observations support that miR-200 -mediated EMT is reversible in this cell line. [score:1]
[1 to 20 of 34 sentences]
36
[+] score: 86
Other miRNAs from this paper: hsa-mir-21, hsa-mir-200c, hsa-mir-200a
In contrast, we found that the CDF treatment with or without gemcitabine combination showed increased expression of both miR-200b, and miR-200c, but the effect with curcumin or its combination was minimal, suggesting the superiority of CDF in suppressing the expression of miR-21, resulting in the re -expression of PTEN, and re -expression of miR-200 which could be responsible for the reversal of EMT phenotype in cells treated with CDF. [score:11]
We also showed anti-tumor activity of CDF alone and in-combination with gemcitabine, which was consistent with inactivation of miR-21, and consequently increased expression of PTEN, attenuation of the DNA binding activity of NF-κB inhibition in the expression of COX-2, and activation in the expression of miR-200 in tumor remnants of a xenograft mouse mo del of human PC, all of which provide convincing in vivo activity of CDF which is consistent with in vitro findings. [score:9]
In contrast to miR-21, miR-200 family is known as tumor suppressor and they are usually down-regulated in some tumors including PC and the loss of expression of miR-200 family contribute to the acquisition of EMT phenotype and drug resistance. [score:8]
In a xenograft mouse mo del of human PC, CDF treatment significantly inhibited tumor growth, which was associated with decreased NF-κB DNA binding activity, COX-2, and miR-21 expression, and increased PTEN and miR-200 expression in tumor remnants. [score:7]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while re -expression of miR-200 can result in the reversal of EMT phenotype [29], [30]. [score:6]
Here we showed, for the first time, that CDF can up-regulate miR-200b and miR-200c in tumor remnants in vivo, consistent with significantly greater inhibition of tumor growth in the xenograft mouse mo del when CDF was used in combination with gemcitabine. [score:6]
CDF exhibited anti-tumor activity in MIAPaCa-2 cells induced tumors in a xenograft mouse mo del, which was consistent with inhibition of NF-κB DNA binding, COX-2, miR-21, and caused re -expression of miR200 in tumor remnants. [score:5]
Modulation in the expression of miR-21 and miR-200 family in vivo We determined the expression levels of miR-21, miR-200b and miR-200c in MIAPaCa-2 tumors by real time RT-PCR. [score:5]
We further determined the expression levels of miRNA-200b and miR-200c in tumor tissues which are known regulators of EMT and found to be significantly low in MIAPaCa-2 cells (Figure 7D). [score:4]
These results suggest that the anti-tumor activity of CDF is mediated via re -expression of miR-200 which may potentially results in the reversal of EMT phenotype and could also lead to overcome drug resistance in PC. [score:3]
Western blots analysis of COX-2, PTEN and β-actin expression in tumor remnants (C); miR-21, miR-200b and miR-200c expression in tumor remnants as measured by real-time RT-PCR (D). [score:3]
In our previous publication [12], we demonstrated that CDF treatment could re-express miR-200 in PC cells. [score:3]
Modulation in the expression of miR-21 and miR-200 family in vivo. [score:3]
We determined the expression levels of miR-21, miR-200b and miR-200c in MIAPaCa-2 tumors by real time RT-PCR. [score:3]
Recently, we have developed a novel synthetic analogue of curcumin, 3,4-difluoro-benzo-curcumin [we named it as Difluorinated-Curcumin or in short CDF [10], [11]], which showed greater bioavailability in pancreatic tissues, and also inhibited cell growth, DNA -binding activity of NF-κB, Akt, COX-2, and the production of PGE [2] and VEGF, and caused induction of miR-200 and inactivation of miR-21 in PC cells [12]. [score:3]
In the current study we showed, for the first time, that CDF could significantly inhibit the sphere-forming ability (pancreatospheres) of PC cells consistent with increased disintegration of pancreatospheres, which was associated with attenuation of CSC markers (CD44 and EpCAM), especially in gemcitabine-resistant (MIAPaCa-2) PC cells containing high proportion of CSCs consistent with increased miR-21 and decreased miR-200. [score:3]
To determine the expression of miRNAs (miRNA-200b, miR-200c, and miR-21) in MIAPaCa-2 tumors, we used TaqMan MicroRNA Assay kit (Applied Biosystems) following manufacturer's protocol. [score:2]
In xenograft mouse mo del of human PC tumors induced by MIAPaCa-2 cells, CDF exhibits anti-tumor activity by regulating COX-2, PTEN, miR-21, miR-200, and NF-κB in vivo. [score:2]
[1 to 20 of 18 sentences]
37
[+] score: 78
Other miRNAs from this paper: hsa-mir-200c, hsa-mir-200a
Members of the miR-200 family are downregulated in human cancer cells and tumors due to aberrant epigenetic gene silencing and play a critical role in the suppression of EMT, tumor cell adhesion, migration, invasion and metastasis, by targeting and repressing the expression of key mRNAs that are involved in EMT (ZEB1 and ZEB2), and participates in a signalling network with the E-cadherin transcriptional repressors ZEB1/ deltaEF1 and ZEB2/SIP1, and TGF-β2 that is postulated to facilitate maintenance of stable epithelial or mesenchymal states but also allow reversible switching between these states in response to EMT effectors (such as TGF-β) [15, 16]. [score:10]
Among many miRNAs, miR-200 family is known as tumor suppressor and they are usually down-regulated in some tumors including prostate cancer and the loss of expression of miR-200 family contributes to the acquisition of EMT phenotype and drug resistance. [score:8]
Members of miR-200 family are known to be tumor suppressors, which are usually downregulated in some tumors. [score:6]
Real time-PCR result showed that miR-200a were significantly downregulated in CSCs (Figure  2A), while miR-200b and miR-200c expressions were similar with PANC-1 cell line (data was not shown). [score:6]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while reexpression of miR-200 can result in the reversal of EMT phenotype. [score:6]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while overexpression of miR-200a can result in the reversal of EMT phenotype [22]. [score:6]
MiR-200 family is known as tumor suppressor and they are usually down-regulated in EMT in some cancer stem cells, such as in prostate cancer and breast cancer [22, 23]. [score:5]
Interestingly, recent studies have also shown that miR-200 family could regulate the processes of EMT by targeting E-box binding protein ZEB1 and ZEB2 [36]. [score:4]
We determined the expression levels of miR-200a, miR-200b and miR-200c in PANC-1 cell line and CSCs by real time-PCR. [score:3]
Then, we analysed the miR-200 family and transcription factors Oct4 and Nanog expression in CSCs of pancreatic cancer cell line PANC-1, and determined their relationships with EMT markers and repressors of E-cadherin transcription. [score:3]
We determined the expression levels of miR-200a, miR-200b and miR-200c in CSCs of PANC-1 by real time RT-PCR. [score:3]
In ovarian and breast cancer, low expression of miRNA-200 plays important roles in cancer metastasis [14, 17, 18]. [score:3]
These findings hypothesizes that the expression of miR-200 in pancreatic cancer cell is correlated with stemness, EMT and metastasis. [score:3]
Among the family of miR-200, only miR-200a expression was dramatically decreased. [score:3]
And miR-200 has been identified as a powerful regulator of EMT. [score:2]
MiR-200 changed the tumor environment, inhibiting the process of EMT and metastasis [19, 20]. [score:2]
RT-qPCR was performed using the miScript PCR Kit to assay the expression of miR-200 family. [score:2]
MiR-200a, miR-200b, miR-200c and U6 kits were purchased from Biomics biotech (NanTong). [score:1]
Thus, the discovery of molecular knowledge of drug resistance and metastasis in relation to miR-200 family, CSCs and EMT in pancreatic cancer are becoming an important area of research, and such knowledge is likely to be helpful in the discovery of newer drugs as well as designing novel therapeutic strategies for the treatment and/or prevention of pancreatic cancer with better outcome. [score:1]
Figure 5 miR-200 reduces invasion and migration in human pancreatic cancer. [score:1]
[1 to 20 of 20 sentences]
38
[+] score: 76
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a, hsa-mir-200c, mmu-mir-200c, hsa-mir-200a
It is of note that further down-regulation of Zeb1 in Zeb1 null MEF cells had little effects on miR-200 expression (Figure  4B), possibly due to [1] the level of Zeb1 protein in het MEF cells is low enough to relieve the repression on miR-200 family, further decrease in Zeb1 expression in null cells will not increase in miR-200 expression accordingly or/and [2] it is also possible that Zeb1 might down-regulate other unknown factor(s) that positively regulates expression of miR-200 family at the same time and thereby makes the regulation network more complex. [score:17]
Our results suggest that E2F-Rb1 binds constitutively to the Ets1 promoter and limits the level of expression, but a second major impact of Rb1 on Ets1 expression is mediated through Rb1 repression of Zeb1 [40] and in turn induction of miR-200, which targets Ets1. [score:7]
miR-200b targets Ets-1 and is down-regulated by hypoxia to induce angiogenic response of endothelial cells. [score:6]
Knockdown of Zeb1 in the T KO MEFs using shRNA lenvirirus, as described previously [17], eliminated much of the induction of Ets1 (Figure  4D), suggesting that induction of Zeb1 and repression of miR-200 as Rb1 family members are mutated is contributing significantly to the upregulation of Ets1. [score:5]
Because miR-200 has been shown to target Ets1 [19], we wondered if Zeb1 might also affect expression of Ets1. [score:5]
We link the effect of Zeb1 to its regulation of miR-200, which in turn target Ets1. [score:4]
Such findings raised the possibility that Zeb1 might feedback to induce Ets1 via its repression of miR-200, and that Rb1 might also influence Ets1 expression via its regulation of Zeb1. [score:4]
Rrm2, ribonucleotide reductase, Ntf3, neurotrophin 3. Zeb1 is a target of the miR-200 family, but in a negative loop Zeb1 feeds back to repress transcription of miR-200 family members [20, 21]. [score:3]
We link Rb1 repression of Zeb1 to induction of miR-200 family members, which in turn target Ets1 mRNA. [score:3]
miR-200 also represses Zeb1, but in a double negative loop Zeb1 binds the promoters of miR-200 family members and represses their expression [20, 21]. [score:3]
These results suggest that Rb1-E2F binds the Ets1 promoter to limit its level of expression, but it is induction of Zeb1 and in turn repression of miR-200 when the Rb1 family activity is lost that is responsible for most of the induction of Ets1. [score:3]
Taken together, our results provide evidence of an amplification loop consisting of Ets1 and Zeb1, which is mediated by miR-200 and regulated by Rb1. [score:2]
Figure 8 Mo del depicting an Ets1-Zeb1 amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
These results imply that CtBP -dependent transcription repression of miR-200 family members by Zeb1 is important for regulation of Ets1 and for thymocyte differentiation. [score:2]
We propose that Ets1 and Zeb1 form an amplification loop that is dependent upon Zeb1 repression of miR-200 and regulated by the Rb1 family (Figure  8). [score:2]
These findings suggest that Ets1 and Zeb1 comprise an amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
As we demonstrated previously [16], mutation of Rb1 family members led to induction of Zeb1 and this induction of Zeb1 was accompanied by repression of miR-200 (Figure  4C) and, as shown above, Ets1 (Figure  1). [score:2]
Zeb1 repression of the miR-200 family is linked to induction of Ets1. [score:1]
Ets1 Zeb1 miR-200 Thymocyte differentiation Lung adenocarcinoma c-Ets1 was identified as a proto-oncogene based on v-ets in the genome of the avian leukemia retrovirus E26, and is the founding member of the Ets family of transcription factors [1]. [score:1]
Recent studies have found that Ets is repressed by miR-200 family members [19]. [score:1]
Taken together, these results suggest an amplification loop between Ets1 and Zeb1, where Ets1 increases transcription of Zeb1, and Zeb1 in turn represses miR-200 to further elevate Ets1. [score:1]
[1 to 20 of 21 sentences]
39
[+] score: 72
B, shown is a time series qRT-PCR data of miR-141 and miR-200b expression in zeb1b -overexpressing embryos (left side; injected with 100 pg zeb1b mRNA and 30 pg gfp mRNA) or zeb1a/b double morphants (right side; injected with 4 ng zeb1a/b TBMO) relative to control embryos (left side; injected with 130 pg gfp mRNA; right side; injected with 4 ng SCMO). [score:5]
We measured the expression of miR-141 and miR-200b, located in the two different miR-200 family clusters, in zeb1b -overexpressing embryos and zeb1a/b morphants by qRT-PCR. [score:3]
Values are the mean ± S. E. F, shown are qRT-PCR data of zeb1a, zeb1b, and cdh1 mRNA expression in miR-200 family -deficient embryos relative to SCMO -injected control embryos at 2- and 6-somite stage (n = 5 per condition). [score:3]
miR-141 and miR-200b expression in control embryos was set to 1 (n = 4 per condition; values represent the mean ± S. E. ). [score:3]
Zebrafish miR-200a and miR-200b have similar but not identical seed sequences and are together sufficient to post-transcriptionally repress Zeb1b expression by binding to their miR response elements (MREs) in the zeb1b 3′-UTR (23) (Fig. 7 A). [score:3]
zeb1a, zeb1b, and cdh1 expression in control embryos was set to 1. Values are mean ± S. E. We also performed in silico analyses of the zebrafish miR-200 clusters and the 3′-UTRs of zeb1a and zeb1b (Fig. 7 A). [score:3]
To investigate their functional relevance, we generated miR-200 morphants by injection of a triple anti-miR-200 MO mix (miR-141 MO, miR-200b MO, and miR-429 MO) that was shown to efficiently knockdown all five members of the miR-200 family (23) and controlled our knockdown experiment for the absence of expression of these by whole-mount ISH of 2-day-old embryos (data not shown). [score:3]
Shin J. O. Nakagawa E. Kim E. J. Cho K. W. Lee J. M. Cho S. W. Jung H. S. (2012) miR-200b regulates cell migration via Zeb family during mouse palate development. [score:3]
zeb1a, zeb1b, and cdh1 expression in control embryos was set to 1. Values are mean ± S. E. We also performed in silico analyses of the zebrafish miR-200 clusters and the 3′-UTRs of zeb1a and zeb1b (Fig. 7 A). [score:3]
Finally, our results show that zebrafish Zeb1 proteins control miR-200 family member expression. [score:3]
A recent study revealed the importance of Zeb1/miR-200 regulation for the development of the mouse palate, which requires coordinated cellular rearrangements driven by EMT (60). [score:3]
To verify the efficacy of anti-miR-200 family MOs, one-cell stage embryos were injected with an anti-miR-200 MO mix (miR-141, -200b, -429) or SCMO, fixed at 48 h post fertilization (hpf), and assayed for miR-141, 200a/b/c, and -429 expression by whole-mount ISH. [score:2]
The Regulatory Feedback Loop of Zeb1 and miR-200 Is Functional but Has Only Minor Impact on Zebrafish Gastrulation. [score:2]
D, shown are live control and miR-200 family knockdown embryos at the indicated stages. [score:2]
Choi P. S. Zakhary L. Choi W. Y. Caron S. Alvarez-Saavedra E. Miska E. A. McManus M. Harfe B. Giraldez A. J. Horvitz H. R. Schier A. F. Dulac C. (2008) Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Bracken C. P. Gregory P. A. Kolesnikoff N. Bert A. G. Wang J. Shannon M. F. Goodall G. J. (2008) A double -negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. [score:2]
Interestingly, our data show that the miR-200 family -based feedback loop controlling Zeb1 activity is functional but does not effectively contribute to control of the Zeb1-E-cadherin regulatory system during zebrafish gastrulation and segmentation stages (Fig. 8). [score:2]
Together with previously published data (23) showing miR-200 regulation of zeb1b, this reveals that the double -negative feedback loop is conserved in evolution from zebrafish to mammals. [score:2]
An additional level of adhesion regulation is established by the ZEB1/miR-200 feedback loop that controls cellular plasticity in cancer cells (14). [score:2]
In the triple anti-miR-200 MO injection, 4 ng of each MO were co -injected into the yolk at the one-cell stage. [score:1]
The miR-200b-a-429 cluster is located on zebrafish chromosome 23. [score:1]
We analyzed the 3′-UTRs of zeb1a and zeb1b for potential MREs for the miR-200 family (Fig. 7 A, left side). [score:1]
E, shown is quantification of epiboly progress in SCMO -injected embryos and miR-200 family -deficient embryos shown in D (shield, n = 25 embryos each; 75%-epiboly, n = 34 embryos each; 90% epiboly, n = 33 embryos each). [score:1]
Left side, shown is a scheme of the genomic organization of the zeb1b 3′UTR and the putative zeb1a 3′-UTR with their miR-200 family MREs. [score:1]
The stem-loop sequences of miR-200b and miR-200a are separated only by a 49-base pair spacer sequence, whereas the spacer between miR-200a and miR-429 comprises 1569 base pairs. [score:1]
This finding and previously published data by Choi et al. (23) together reveal that the reciprocal ZEB1/miR-200 feedback loop, which plays an essential role in defining the EMT status and cellular plasticity of human cancer cell lines, is also conserved in teleosts. [score:1]
Recently we and others have shown that this morphological plasticity of cancer cells is mediated by a double -negative feedback loop between ZEB1 and the miR-200 family members (13, 14). [score:1]
Right side, shown is a scheme of the genomic organization of the miR-200c-141 and miR-200b-a-429 clusters on zebrafish chromosome 6 and 23, respectively. [score:1]
The zeb1a 3′UTR contains 4, and the zeb1b 3′UTR 10 miR-200 family MREs. [score:1]
C, a comparative genomic analysis of the miR-200 family members in human (hsa) and zebrafish (dre) indicates extensive conservation with respect to the mature miR and the seed sequences. [score:1]
Studies in human cancer cell lines revealed that ZEB1 and the miR-200 family are linked in a reciprocal negative feedback loop (13, 14). [score:1]
A, shown is a schematic representation of the reciprocal Zeb1a/b-miR-200 feedback loop. [score:1]
So far little is known about Zeb1/miR-200 feedback loop functions during gastrulation. [score:1]
In summary, our in vivo and in silico data in combination with the data by Choi et al. (23) indicate that the reciprocal negative feedback loop between ZEB1 and the members of the miR-200 family is conserved through evolution. [score:1]
miR-200 morphant gastrulae displayed only a small delay of epiboly progression (Fig. 7, D and E), whereas deep cell layer thinning appeared unaffected (data not shown). [score:1]
Our results together with previously published data (23) demonstrate that the Zeb1/miR-200 double -negative feedback loop is conserved in teleosts. [score:1]
Finally, we show that Zeb1b represses transcription of miR-141 and -200b, two members of the miR-200 family. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. (2008) A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
MOs against the miR-200 family are as published (23): anti-miR-141 (5′-GCA TCG TTA CCA GAC AGT GTT A-3′), anti-miR-200b (5′-GTC ATC ATT ACC AGG CAG TAT TA-3′), and anti-miR-429 (5′-ACGGCATTACCAGACAGTATTA-3′). [score:1]
FIGURE 7. Analysis of the potential reciprocal Zeb1a/b-miR-200 negative feedback loop. [score:1]
[1 to 20 of 40 sentences]
40
[+] score: 71
To further explore the potential significance of the deletion overlap involving the miR-200 family, we examined gene expression in patients and found that a number of TargetScan-predicted targets of either miR-200a or miR-200b were collectively upregulated in the tumor compared to unaffected pair-matched myometrium (∼180 genes ranging from 1.25–10.3 fold upregulation). [score:12]
These findings indicated that alteration (loss) of two overlapping genomic regions (7.09 Mb of Chr1 1p36.33-p36.23 and 24.56 Mb of Chr3 3q26.1-q27.2 harboring cancer related miRNAs may be related to the tumorigenesis of a subset of ULMs via deregulation of the miR200a/b and miR-15/16 gene targets and in part this process may be due to the loss of convergent inhibitory action of the miR-200 family and miR-15 and miR-16 on a small group of the same downstream target genes. [score:8]
B analysis of expression of five miR-200 predicted target genes in ULMs cell line UtLM with stable miR-200a expression (see Methods) and control (vector PGIPZ only). [score:7]
Collectively, these findings suggest that the loss of miR-200 family, identified by miRNA profiling and a CGH analysis, together with upregulation of its target genes may contribute to the tumor growth and underlie the mesenchymal character of ULMs. [score:6]
Conversely, loss of miR-200 shown to modulate growth as well as the UtLM morphology (Figure 4C,D), may lead to upregulation of genes (some of them convergent targets of lost miR-15/16) that contribute to the progression of ULM tumorigenesis. [score:6]
As shown above, downregulation of miR-200 family members appears a candidate event in leiomyomas in select patients due to loss of corresponding genomic DNA loci and broader reduction of miR-200 expression in ULMs (Table 3 and Figure S2). [score:6]
A Scatter plot analysis of relative mRNA expression in five miR-200 predicted target genes in 10 ULMs and matched myometria (our data and GSE593). [score:5]
Focused pathway analysis (using GO, KEGG, Biocarta and Panther databases) of the predicted miR-200 family targets that are consistently upmodulated in ULMs including patient B4 (Table S3) implicates categories of regulation of transcription proliferation and cell cycle control, actin cytoskeleton and adherens, tight, gap and focal adhesion junction remo deling, as well as cancer related signaling pathways (MAPK, RAS, WNT, NOTCH, TGF-β, VEGF). [score:4]
Importantly and as predicted by pathway analysis (Table S3), overexpression of miR-200a in UtLM cells led to growth inhibition compared to mock infected controls (Figure 3C), and reverted the fibroblastoid morphology towards more pronounced epithelial phenotype (Figure 3D), consistent with the established role of miR-200 family in epithelial-mesenchymal transition [33]. [score:4]
Interestingly, members of cancer -inhibitory miRNA family miR-200a, miR-200b, miR-429 and miR-551a are located in the region of loss at 1p36 while the 3q26-27 region harbors miR-15b, miR-16-2 and other microRNAs including miR-1263, miR-720, miR-551b, miR-569, miR-1224. [score:3]
MiR-200 predicted target gene analysis in uterine ULMs. [score:2]
We observed that miR-200a and miR-200b were significantly down regulated in 51 ULMs (net loss of −0.36±0.11 and −0.45±0.06, respectively). [score:2]
0012362.g003 Figure 3 MiR-200 predicted target gene analysis in uterine ULMs. [score:2]
Primers for 11 let-7 and 5 miR-200 predicted target genes are summarized in Table S1. [score:2]
Candidate role of the loss of miR-200 family and miR-15 and miR16 in ULMs. [score:1]
Loss of miR-200 family is associated with epithelial and mesenchymal transition (EMT) and aggressive tumor phenotypes of ovarian cancer [30], [31]. [score:1]
[1 to 20 of 16 sentences]
41
[+] score: 70
Cumulative multigenerational stress upregulated miR-200b and downregulated miR-429 expression levels in the uterus of F1-SS and F2-SSS generations (Figures  5A, B). [score:9]
miR-200 family members, including the downregulated miR-200a, are predicted to target genes that regulate synaptic function, neurodevelopment and neuronal survival [50]. [score:8]
When upregulated, miR-200b may act to suppress Stat5b, Zeb1 and Zeb2 mRNA levels in the F1-SS and F2-SSS generations (Figures  5D-F), while reduced Zeb2 expression in particular was transmitted to the F2-SSS generation (Figure  5F). [score:8]
Main miR-200 family target genes in the uterus, Stat5b, Zeb1 and Zeb2, were downregulated by multigenerational stress in the F1 generation. [score:6]
The upregulation of uterine miR-200b may be causative for the suppression of Stat5b and ZEB1 and ZEB2; however, they may also reflect low postpartum progesterone levels due to timing of tissue sampling in the present study. [score:6]
Furthermore, ZEB1 serves as transcription factor to inhibit the miR-200 family, thus enhancing Stat5b expression [19]. [score:5]
Interestingly, miR-200b/200c/429 are induced at term labour in mice and humans and miR-200b/200c/429 are upregulated in mouse mo dels of preterm labour [18]. [score:4]
Including the downregulated miR-200b, the miR-200 family may exert peripheral effects to control uterine quiescence and contractility during pregnancy and labour [18]. [score:4]
The qRT-PCR confirmed changes of the selected miRNAs (Figure  4B), decreased expression of miR-96, miR-141, miR-182, miR-183, miR-200a, miR-200b, miR-429 and miR-451 in F2-SSS compared to F0-S animals, whereas miR-23b and miR-200c showed increased expression levels. [score:4]
Furthermore, stress altered miRNA expression patterns in the brain and uterus of F2 mothers, including the miR-200 family, which regulates pathways related to brain plasticity and parturition, respectively. [score:4]
Multigenerational stress in the F1-SS and the F2-SSS generations elevated miR-200b expression levels. [score:3]
Both miR-200b and miR-429 are known to modulate gestational length through interaction with their target genes Stat5b, Zeb1 and Zeb2 [18]. [score:3]
Target genes of the miR-200 family include three particular genes, Stat5b, Zeb1 and Zeb2, all involved in pregnancy maintenance [18]. [score:3]
In order to validate miRNAs, we performed quantitative real time PCR (qRT-PCR) analysis of these differentially regulated miRNAs (n = 3 per group for F0, F1 and F2 generations, three replicates per sample): miR-23b, miR-96, miR-141, miR-181a, miR-182, miR-183, miR-200a, miR-200b, miR-200c, miR429 and miR-451. [score:2]
Ancestral programming by stress particularly involved the miR-200 family. [score:1]
[1 to 20 of 15 sentences]
42
[+] score: 69
Also inhibits metastasisClape 2009 [67], Xu 2011 [4], Friedman 2009 [73] miR-145 Tumor suppressor Inhibits migration, invasion and metastasisFriedman 2009 [73] miR-200 s Tumor suppressor Inhibit cell migration and invasion by reversing EMTKong 2009 and 2010 [69, 70] miR-221 Onco-miRNA Stimulates cell growth and influences cell cycle progressionZheng 2011 [78], Galardi 2007 [77], Sun 2009 [76], Pang 2010 [23]. [score:11]
It was also proved that significant down-regulation of the miR-200 family in PC3 PDGF-D cells and in PC3 cells exposed to purified active PDGF-D protein, resulting in the up-regulation of ZEB1, ZEB2, and Snail2 expression (a transcription factor which belongs to the snail protein family and plays critical roles in the formation of tissues during embryonic development) [69]. [score:10]
Interestingly, re -expression of miR-200b in PC3 PDGF-D cells led to reversal of the EMT phenotype accompanied with the down-regulation of ZEB1, ZEB2, and Snail2 expression, and all of these events were associated with greater expression levels of epithelial markers [69]. [score:10]
It is well known that NF-κB plays an essential role in facilitating the processes of EMT induced by different factors through up-regulation of ZEB1 and ZEB2, which in turn suppress the expression of miR-200 family members by binding to the E-box sequence of the miR-200 promoter [69]. [score:8]
Moreover, it was proved that transfection of PC3 PDGF-D cells with miR-200b considerably decreased the expression of ZEB1, ZEB2, and Snail2 at both the mRNA and protein levels, with simultaneous greater expression levels of epithelial markers such as E-cadherin, stratifin, CRB3, EpCAM, F11R, and connexin 26, all of these events collectively led to the inhibition of cell migration and invasion [69]. [score:7]
From these facts, we can conclude that PDGF-D-stimulated attainment of the EMT phenotype in PC3 cells is, partly, an outcome of suppression of miR-200 and that new strategies in which miR-200 would be up-regulated will become an auspicious approach for the treatment of invasive prostate cancer [69]. [score:6]
Whereas miR-200 can down-regulate the expression of ZEB1 and ZEB2 by interacting with the 3'-UTR of ZEB1 and ZEB2 mRNA [69]. [score:6]
All of these findings suggest a double -negative feedback loop between miR-200 and ZEB1/ZEB2 that permits the preservation of the EMT phenotype, even after withdrawal of the initial inducing signal, which might become a critical target for the reversal of EMT [63]. [score:3]
Studies from our laboratory have shown that the miR-200 family controls epithelial-mesenchymal transition (EMT) by targeting zinc-finger E-box binding homebox 1 (ZEB1) and ZEB2 [63, 69, 74]. [score:3]
The role of miR-141 and miR-200b (both belong to the same family of miRNAs) were reported to be the two largely over regulated miRNAs in prostate epithelial cells in comparison with prostate stromal cells [71]. [score:2]
The role of miRNA-200. [score:1]
In a breast cancer mo del, our studies have shown that in vivo manipulation of miR-200b leads to significantly reduced pulmonary metastases of breast cancer cells [74] which further supports the role of miR-200 family in metastases of human cancers. [score:1]
Because the miRNAs are part of the cellular signaling circuit that controls EMT [60], it has been suggested that many miRNAs families, including miR-200 family and miR-205, play important roles in controlling EMT [61- 63]. [score:1]
[1 to 20 of 13 sentences]
43
[+] score: 69
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-200c, hsa-mir-200a, hsa-mir-429, hsa-mir-203b
Conversely, miRNA expression analysis in endometrial carcinosarcomas, a bona fide example of EMT in vivo, revealed a marked downregulation of miR-203 and miR-200 family members in the mesenchymal areas, concomitant to the upregulation of EMT inducers, including SNAI1 [25]. [score:9]
MiR-200b (A), miR-200a (B), miR-429 (C) expression levels were determined by qRT-PCR and normalized to U44 expression and expression levels in non -induced MCF7-SNAI1 cells. [score:7]
Further expression profiling in human primary and metastatic cancers showed that miR-203 and miR-200 family members were significantly suppressed in the latter, suggesting a direct involvement in cancer metastasis [26]. [score:6]
Altogether these data suggest that SNAI1 regulates expression of miR-203 and both miR-200 clusters in a coordinated manner, and that these miRNAs co-act in SNAI1-regulated programs. [score:5]
Co-regulated overexpression of miR-203 and miR-200 family members has been reported during early stages of human stem cell differentiation into epidermal cells suggesting their participation to this process [24]. [score:4]
SNAI1 represses the transcription of both miR-200 clusters (our data) [7], [27], [28] and indirectly activates expression of the ZEB factors (our unpublished observation) [9]– [11]. [score:4]
SNAI1 represses miR-203 and miR-200b expression. [score:3]
Therefore, we decided exploring the regulation of miR-203 and miR-200 family members through SNAI1, and their integration into regulatory networks governing epithelial cell plasticity. [score:3]
The miR-200s regulate EMT through a double negative feedback loop with the ZEB factors, which, depending on the relative levels of miR-200 and ZEB, can direct the switch from epithelial- to mesenchymal-like states and back [5]– [8]. [score:3]
We combined these experimental results with miRNA expression signature analyses of four published datasets of epithelial and mesenchymal NCI60 cancer cell lines (Fig. 1A, Table S2) [20]– [23], and calculated expression correlations with the miR-200 epithelial marker family (Table S3). [score:3]
Figure S1 Expression profiles of miR-200b cluster members upon SNAI1-induction in the MCF7-SNAI1 EMT cell mo del. [score:3]
MiRNAs recently emerged as important regulators in EMT, the most prominent being the two clusters of the miR-200 epithelial marker family: miR-200b/200a/429 (miR-200b) and miR-200c/141 (miR-200c) [3], [4]. [score:2]
By a large-scale analysis on epithelial plasticity, we highlighted miR-203 and its molecular link with SNAI1 and the miR-200 family, key regulators of epithelial homeostasis. [score:2]
A) The top panel corresponds to the core network integrating described interactions between miR-203, miR-200s (miR-200), SNAI1, ZEB1, ZEB2 and E-cadherin (CDH1). [score:1]
We integrated the novel miR203/SNAI1 feedback loop together with the known miR200/ZEB feedback loops [5] into an a priori SNAI1-centered EMT core network (Fig. 3A), based on our present and published data. [score:1]
By combining computational biology and experimental approaches, we propose a novel EMT core network integrating two fundamental negative feedback loops, miR203/SNAI1 and miR200/ZEB. [score:1]
Also, SNAI1 has been shown to repress miR-200 family members during murine embryonic stem cell differentiation [28]. [score:1]
C) Relative luciferase activity of miR-203 and miR-200b promoter constructs in non -induced (NI) and SNAI1 -induced cells. [score:1]
We further showed that miR-203 and miR-200b promoter activity significantly decreased upon 12 h of SNAI1 induction (Fig. 1C). [score:1]
Here, we performed a large-scale analysis highlighting miR-203 as consistently associated with epithelial plasticity and correlated to the miR-200 family which plays a key role in epithelial homeostasis. [score:1]
MiR-203 was continuously repressed upon SNAI1 induction, similarly to the miR-200b cluster (Fig. 1B; Fig. S1). [score:1]
During SNAI1 -induced EMT in MCF7 breast cancer cells, miR-203 and miR-200 family members were repressed in a timely correlated manner. [score:1]
EMT core network integrating the miR203/SNAI1 and miR200/ZEB double negative feedback loops. [score:1]
We integrated this novel miR203/SNAI1 with the known miR200/ZEB feedback loops to construct an a priori EMT core network. [score:1]
In silico analysis predicted two binding sites for miR-203, but none for miR-200 family members, within the 3′UTR of the SNAI1 mRNA (Fig. 2E) (microRNA. [score:1]
Further, in agreement with in silico predictions, miR-200a and miR-200c (miR-200a/c), representing both seed sequences found within the miR-200 family, did not repress wild type SNAI1-3′UTR reporter activity (Fig. 2G). [score:1]
0035440.g003 Figure 3A) The top panel corresponds to the core network integrating described interactions between miR-203, miR-200s (miR-200), SNAI1, ZEB1, ZEB2 and E-cadherin (CDH1). [score:1]
Mir-200b promoter construct, pGL3miR200b/200a/429 (−321/+120) has been previously described [6]. [score:1]
[1 to 20 of 28 sentences]
44
[+] score: 68
The choice of miRNAs for validation with real-time RT-PCR was based on their differential expression among the groups as well as their putative biological significance: miR-542-5p is predicted to target estrogen receptor alpha mRNA; miR-200a and miR-429 are both members of the miR-200 family; and miR-503 is the most down-regulated miRNA in both types of carcinoma and the precursor lesion. [score:8]
While most tumours have shown a down-regulation of the miR-200 family, the up-regulation observed in endometrial carcinoma is shared with a few other tumours including melanoma, ovarian carcinoma, and colorectal carcinoma. [score:7]
Recently, Castilla et al [38] have demonstrated differential miRNA expression levels between the epithelial and mesenchymal elements in uterine carcinosarcoma, with up-regulation of the miR-200 family in the epithelial part. [score:6]
In the studies of miRNA expression in endometrial carcinomas, the up-regulation of the miR-200 family may be influenced by estradiol and ERα and this possibility deserves further study. [score:6]
The most striking similarity among studies of miRNA expression in EEC is the up-regulation of the miR-200 family. [score:6]
Insights into the up-regulation of the miR-200 family in certain tumour types, including endometrial carcinoma, may be gained by examining the role of steroid receptors in the regulation of miRNAs. [score:5]
However, there are some tumour types in which an up-regulation of the miR-200 family has been observed. [score:4]
It may be that the less aggressive nature of ERα -positive endometrial carcinomas relates to the up-regulation of the miR-200 family, which, in turn, maintains an epithelial phenotype and resists the EMT transition. [score:4]
The entire miR-200 family (miR-200a/b/c, miR-141, and miR-429) was up-regulated in cases of EEC. [score:4]
Our data share some important similarities with previously published reports [22]– [26]; Table 4. The most striking similarity is the up-regulation of the miR-200 family (miR-141, 200a, 200b, 200c, 429) in EEC relative to normal controls. [score:4]
MicroRNAs which have similar expression changes in other studies of EEC are italicized and the miR-200 family miRNAs are bolded. [score:3]
Examination of miRNAs that are consistently dysregulated in various studies of EEC, like the miR-200 family, will aid in the understanding of the role that miRNAs play in tumorigenesis in this tumour type. [score:2]
A recent review by Cochrane et al [39] describes the regulation of the miR-200 family by estrogen receptor-α and estradiol. [score:2]
Studies have shown an association with low miR-200 family levels and an aggressive tumour phenotype [31], [32] consistent with the regulation of the EMT switch as described. [score:2]
Efforts to elucidate the role that miRNAs play in endometrial carcinoma should focus on the miR-200 family as well as the other miRNAs that are consistently dysregulated in the multiple studies of endometrial carcinoma to date. [score:2]
Conversely, if ZEB1 and ZEB2 levels are low, as would be expected with high miR-205 and miR-200 family members, E-cadherin levels increase and an epithelial phenotype should be maintained. [score:1]
The miR-200 family has been implicated in the epithelial-to-mesenchymal transition (EMT) that occurs as a part of tumour invasion and metastasis [28]– [30]. [score:1]
The miR-200 family consists of five members localized on two genomic clusters (miR-200a/b, miR-429 on chromosome 1, and miR-200c, miR-141 on chromosome 12) [27]. [score:1]
[1 to 20 of 18 sentences]
45
[+] score: 67
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 MiRNAs are small, 19–23 nucleotide non-coding RNAs that function as post-transcriptional repressors of gene expression, either through messenger RNA (mRNA) degradation or translational repression (Bartel, 2009). [score:14]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 Using microarray analysis, the expression profile of murine miRNAs in the developing lip and PS were analyzed from E10 to E14 (Mukhopadhyay et al., 2010; Warner et al., 2014). [score:12]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 CS, CC, JV: Conception of the work, drafting of the manuscipt, revision of the manuscript, final approval of the manuscript. [score:10]
MiR-200b belongs to the miR-200 family and together with other family members miR-200a and miR-429, it is clustered in an intergenic region on human chromosome 1. MiR-200b is expressed in the epithelium during palatogenesis in the mouse, including in the midline epithelial seam (MES), and its expression gradually decreases as fusion proceeds (Shin et al., 2012a, b). [score:5]
MiR-200b belongs to the miR-200 family and together with other family members miR-200a and miR-429, it is clustered in an intergenic region on human chromosome 1. MiR-200b is expressed in the epithelium during palatogenesis in the mouse, including in the midline epithelial seam (MES), and its expression gradually decreases as fusion proceeds (Shin et al., 2012a, b). [score:5]
In summary, miR-140 regulates the migration of neural crest cells, miR-200b regulates palatal fusion and the miR-17-92b cluster regulates palatal shelf growth. [score:4]
In keeping with this, overexpression of miR-200b results in a failure of fusion due to persistence of the MES (Shin et al., 2012a, b). [score:3]
miR-200b regulates cell migration via Zeb family during mouse palate development. [score:3]
In this respect, miR-200b was shown to target Smad2, Snail, Zeb1, and Zeb2, all genes encoding transcription factors that function as mediators of the Tgf-β signaling pathway. [score:3]
Overexpression of miR-200b also leads to maintenance of the MES by repressing TGF-β during the final stages of palatogenesis and hence results in a failure of the PS to fuse. [score:3]
MiR-200b is involved in Tgf-beta signaling to regulate mammalian palate development. [score:2]
miR-200b as regulator of palatal fusion. [score:2]
Apart from miR-140, the miR-17-92 cluster, and miR-200b (see below), most of the miRNAs have an as yet unknown role in palatogenesis. [score:1]
[1 to 20 of 13 sentences]
46
[+] score: 67
Second, our studies past and present, have showed the mesenchymal-specific downregulation of miR-200 expression in a panel of OSCC [35] and pancreatic cancer cell lines, respectively, but not miR-205 and miR-655 expression. [score:8]
Our findings strongly suggest that the TGF-b -induced EMT can be suppressed by miR-655, independently of miR-200 family members, through translational inhibition of ZEB1 and TGFBR2 in cancer cells (Fig. 4E). [score:7]
In a Western blot analysis in the parental Panc1 cells 96 hours after transient transfection with these miRNAs, miR-520d-3p and miR-655, as well as miR-200b-3p, were confirmed to upregulate expression of the E-cadherin protein markedly, whereas only slight effects of other miRNAs were observed (Fig. 1D). [score:6]
Recently, the miR-200 family (miR-141, -200a, -200b, -200c, and -429) and miR-205 have been demonstrated as EMT-suppressive miRNAs directly targeting ZEB1 and ZEB2 [17]. [score:6]
The miR-200 family members are typical EMT-suppressive miRNAs targeting several components of TGF-b signaling pathways, including the miR-200-ZEB1-E-cadherin axis, which is crucial in EMT and was described to be deregulated in mesenchymal-like cancer cells [17], [18], [20]. [score:6]
On the other hand, overexpression of miR-655, as well as the miR-200 family, induced significant morphologic changes and inhibited cell migration and invasion in 3 pancreatic cancer cell lines and a breast cancer cell line, MDA-MB-231. [score:5]
Although no correlation between the expression pattern of miR-655 and that of any of these marker genes was found in this panel, these cell lines all showed lower expression of miR-655 than the miR-200 family and miR-205, as compared with a normal pancreas. [score:4]
By using the system for the first time we identified miR-655 as a novel EMT-suppressive miRNA, the biological meaning of which was different from that of the miR-200 family. [score:3]
Although the miR-200 family and miR-205, like miR-655, target ZEB1, their biological functions were found to differ from those of miR-655. [score:3]
These differences between miR-655 and miR-200 family members indicate the biological function of each EMT-suppressive miRNA in physiological and pathophysiological processes, including EMT/MET. [score:3]
The present study is the first to show clearly that miR-655 targets ZEB1 and TGFBR2 inducing inactivation of the TGF-b signaling pathway, involving the miR-200-ZEB1-E-cadherin axis, strongly suggesting a potential role for miR-655 as a prognostic marker and therapeutic agent in human cancers. [score:3]
Because miR-200b has already been confirmed to induce expression of the CDH1/E-cadherin transcript and protein in this study (Fig. 1B) and multiple previous studies, ds- miR-200b was used as a positive control in this analysis. [score:3]
These EMT-suppressive effects of miR- 655 were observed in a miR-200 family-independent manner (data not shown). [score:3]
We noticed a consistent positive correlation among expression profiles of miR-200 family members and a slight correlation between CDH1/E-cadherin and miR-200 family members. [score:3]
First, besides ZEB1, TGFBR2 was characterized as a direct target of miR-655 in our study, but not the miR-200 family and miR-205. [score:2]
The miR-200-ZEB1-E-cadherin axis has been clarified to be a crucial pathway downstream of TGF-b in EMT while reciprocal repression between ZEB1 and the miR-200 family has recently been reported to promote EMT and invasion in cancer cells [18]– [22]. [score:1]
During the acquisition of EMT characteristics, cancer cells lose the expression of genes that promote cell-cell contact, such as E-cadherin and the miR-200 family, and gain the expression of mesenchymal markers, such as vimentin, fibronectin, and N-cadherin, leading to enhanced cancer cell migration and invasion [6]– [8] and to confer drug resistance characteristics on cancer cells [9]. [score:1]
[1 to 20 of 17 sentences]
47
[+] score: 63
miR200 expression inhibits Suz12 action; silencing of miR200 leads to significantly increased Suz12 transcript and protein expression in the CSC population. [score:7]
For instance, downregulation of miR200b, -194 and -212 and upregulation of miR192, -424 and -98 are associated with docetaxel resistance in non small cell lung carcinoma [80]. [score:7]
The authors of this study note that while downregulation of miRNAs such as let7 occurs in both neoplastic transformation and CSC formation, expression of the miR200 family members is specifically altered in CSCs, suggesting a central role for miR200 in formation of this population. [score:6]
Korpal M. Lee E. S. Hu G. Kang Y. The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J. [score:6]
Re -expression of miR200 family members or miR205 only partially reverses the stem cell phenotype, an observation that highlights the complex deregulation that occurs in carcinogenesis. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
In a mo del of Src oncogene-transformed breast epithelial cells, CSC formation is dependent upon downregulation of miR200 family members [24]. [score:4]
Overexpression of one miR200 family member, miR429, has been shown to reverse EMT in ovarian cancer cell lines [89]. [score:3]
Iliopoulos D. Lindahl-Allen M. Polytarchou C. Hirsch H. A. Tsichlis P. N. Struhl K. Loss of miR200 inhibition of Suz12 leads to polycomb -mediated repression required for the formation and maintenance of cancer stem cellsMol. [score:3]
Ali S. Ahmad A. Banerjee S. Padhye S. Dominiak K. Schaffert J. M. Wang Z. Philip P. A. Sarkar F. H. Gemcitabine sensitivity can be induced in pancreatic cancer cells through modulation of miR200 and miR21 expression by curcumin or its analogue CDFCancer Res. [score:3]
Overexpression of miR200 leads to CSC death, raising the possibility that miRNAs may be useful therapeutics, especially in combination with chemotherapeutic drugs better suited to kill the non-CSC tumor population. [score:3]
miR200 family members regulate the epithelial-mesenchymal transition (EMT), via mediation of growth factor signaling pathways including transforming growth factor-beta and platelet-derived growth factor D [88]. [score:2]
The miR200 family of miRNAs appears to play a central role in tumor invasion and metastasis via their negative regulation of ZEB1 and ZEB2, zinc finger proteins that act as transcriptional repressors of e-cadherin [86, 87]. [score:2]
The mechanism of action of miR200 in regulating CSC formation appears to be epigenetic. [score:2]
Given the feasibility of miRNA adenoviral delivery, these observations raise the possibility that miR200 “replacement”, could serve as a novel metastasis-directed therapy. [score:2]
Namely, miR200 interacts with Suz12, a component of the PRC2 polycomb complex. [score:1]
Tellez C. S. Juri D. E. Do K. Bernauer A. M. Thomas C. L. Damiani L. A. Tessema M. Leng S. Belinsky S. A. EMT and stem cell-like properties associated with miR205 and miR200 epigenetic silencing are early manifestations during carcinogen -induced transformation of human lung epithelial cellsCancer Res. [score:1]
Exposure of lung epithelial cell cultures to tobacco carcinogens leads to epigenetic silencing of miR200b, miR200c and miR205 and phenotypic epithelial to mesenchymal transition (EMT) [69]. [score:1]
miR200 Family and Breast Carcinoma. [score:1]
The effects of Suz12 on e-cadherin in particular may contribute to the invasive and metastatic potential of breast carcinoma, with high miR200, low Suz12 and high e-cadherin levels associated with primary tumors and low miR200, high Suz12, and low e-cadherin observed in metastatic tumors [24]. [score:1]
[1 to 20 of 20 sentences]
48
[+] score: 63
This process may be reversible, since an increase in miR-200 family miRNAs expression initiates MET, restoring E-cadherin expression and promoting an epithelial phenotype [77]. [score:5]
Histograms showing relative expression (RQ) of mesenchymal markers (A), epithelial markers (B) and miRNA predictive target genes (C) in MSCs, after one week of transfection with miR-200 mimics (black bars), or with a control miRNA (scramble, white bars), in respect to control cells (CTR, grey bars). [score:5]
0159163.g008 Fig 8Histograms showing relative expression (RQ) of mesenchymal markers (A), epithelial markers (B) and miRNA predictive target genes (C) in MSCs, after one week of transfection with miR-200 mimics (black bars), or with a control miRNA (scramble, white bars), in respect to control cells (CTR, grey bars). [score:5]
Moreover, MSCs transfection with miR-200 mimics reduced the expression of two miRNA targets from our predictive analysis, CCND1 and IGF-1R (Fig 8C). [score:5]
In fact, mature miR-200 family miRNAs promote E-cadherin expression with the acquisition of an epithelial cell phenotype via post-transcriptional repression of zinc finger E-box binding transcription factor 1 and 2 (ZEB1 and ZEB2) [77]. [score:3]
We showed that both EVs and miR-200 family miRNAs can effectively reduce CCND1 and IGF1R expression in MSCs. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
In particular, we detected the expression of some miRNAs belonging to miR-200 family. [score:3]
Moreover, we observed an increased expression of ENPEP, indicating that the miR-200 miRNAs can induce the epithelial commitment of MSCs. [score:3]
After one week of transfection of bone marrow derived-MSCs with 5 synthetic miR-200 mimics, we observed a reduction in the expression of VIM and FN1, which is another mesenchymal marker involved in cell adhesion, cell migration, cell growth and cell differentiation [78]. [score:3]
Taken together, these results suggest that the miR-200 family carried by EVs can induce MET in MSCs by binding to the 3’UTR sequences of predicted target genes, like CCND1 and IGF1R (Fig 8D). [score:3]
We employed qRT-PCR to validate the expression levels of the five miRNAs belonging to miR-200 family, selected from the miRNA array. [score:3]
A mixture of mimics was used to increase the expression of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in MSCs. [score:3]
Luciferase-3’UTR reporter constructs (0.8 μg) or the empty expression vector (negative control) were co -transfected with miR-200a, miR-200b, miR-200c, miR-141 and miR-429 mimics (0.5 μg, MiScript miRNA mimics, Qiagen) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
Analysis of mesenchymal and epithelial markers expression in MSCs transfected with miR-200 mimics. [score:3]
To assess whether miR-200 family can effectively repress translation through binding to CCND1 and IGF1R 3’UTR, we performed luciferase reporter assay. [score:2]
MSCs were transiently transfected with miR-200a, miR-200b, miR-200c, miR-141 and miR-429 mimics (20 μM, MiScript miRNA mimics, Qiagen) using the HiPerFect Transfection Reagent (Qiagen), according to the manufacturer’s protocol. [score:1]
Among them, we found a subset of five miRNAs (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) that belong to miR-200 family, known to be involved in EMT [40, 41]. [score:1]
These data suggest that EVs may contribute to the epithelial commitment of MSCs by transferring a small subset of miRNAs that belong to the miR-200 family. [score:1]
The role of the miR-200 family in epithelial-mesenchymal transition. [score:1]
As a result, miR-200 family induced a 90% reduction of luciferase activity in transfected cells. [score:1]
Role of the miR-200 family in the epithelial commitment of MSCs. [score:1]
Recent studies on tumor cells [73– 76] have demonstrated that miR-200 family miRNAs (miR-200a, miR-200b, miR-200c, miR-141, miR-429) are involved in EMT. [score:1]
We evaluated the expression of CCND1 and IGF1R in MSCs after incubation with EVs or TOT-CM and after cell transfection with miR-200 mimics. [score:1]
[1 to 20 of 24 sentences]
49
[+] score: 61
However, it has been shown that ZEB1 triggers a double negative feedforward loop, by downregulating its own inhibitors (i. e., the mir-200 family members) [47, 48]. [score:6]
As a case study, we propose two prototypes of pure sponge (Figure  5A) and mixed TF-sponge (Figure  6A) modules, extracted from the normal breast analysis: the first employs PTENP1, a growth-suppressive lncRNA already identified as ceRNA [22, 25]; the second engages PVT1 as a competitor of CDH1 for binding to the mir-200 family and ZEB1 as both a transcriptional repressor of CDH1 and a target of the mir-200 family. [score:5]
However, this mo del may be undermined by the evidence that PVT1 - the main sponge regulator of the mir-200 family in the normal network - also results upregulated (∼ 2-fold) in cancer. [score:5]
Specifically, ZEB1 results downregulated in our breast cancer dataset compared to normal samples, while both the mir-200 family members and CDH1 are overexpressed. [score:5]
This is suggestive of an epithelial-like phenotype maintained by high levels of the mir-200 family members, which inhibit ZEB1 and, hence, increases the expression of ZEB-repressed epithelial genes, such as CDH1 (also known as E-cadherin) [33, 47]. [score:5]
Interestingly, the mir-200 family members are well-known to be involved in cancer metastasis and are believed to play an essential role in tumor suppression by inhibiting epithelial-to-mesenchymal transition (EMT), the initiating step of metastasis [32- 34]. [score:5]
Along this line, the mir-200 family members appear highly upregulated in the cancer dataset that we analyzed (from 4- to 8-fold). [score:4]
Moreover, it reveals a net binding preference towards the mir-200 family (Figure  7A), which it antagonizes to regulate the expression of hundreds of mRNAs in the normal case. [score:4]
In particular, the switch to a mesenchymal state can be induced by the transforming growth factor TGF β, which increases ZEB1, while ectopic expression of the mir-200 family members, which reduces ZEB1, seems either to prevent TGF β -induced EMT or to initiate epithelial-like reversion in mesenchymal cells [33]. [score:3]
Moreover, the mir-200 family members have recently been associated to human breast cancer [35- 39] and their overexpression was shown to promote the mesenchymal-to-epithelial transition [40]. [score:3]
This marked pattern suggests the existence of specific miRNAs, particularly the mir-200 family, acting at global level as buffers of mRNA/lncRNA highly co-expressed pairs. [score:3]
We speculate that the withdrawal in cancer of the PVT1 ceRNA activity can be due to the preferential expression of the two isoforms missing the binding sites for the mir-200 family. [score:3]
In particular, members of the mir-200 family can be grouped in two clusters based on the seed sequence (i. e., the mir-200b/c/429 and mir-200a/141 clusters), differing by one nucleotide. [score:1]
Particularly, ceRNA mechanisms orchestrated by the mir-200 family, which is preponderant in the normal breast scenario, disappear in the BRCA network, where other sponges appear to be activated. [score:1]
It is connected to 753 different mRNAs (∼50% of total mRNAs in the network) and the mir-200 family members are mediating over 80% of these interactions (Additional file 5: Tables S5 and S10). [score:1]
Note that two isoforms (Iso 11 and 12) lack seed matches for the mir-200 family. [score:1]
In particular, we observed an outstanding prevalence of the mir-200 family in the whole normal-MMI-network. [score:1]
Interestingly, PVT1 revealed a net binding preference towards the mir-200 family as the bone of contention with its rival mRNAs. [score:1]
Despite most of the PVT1 alternative isoforms harboring seed matches for both clusters (Figure  7C), two isoforms lack the putative MREs for the mir-200 family. [score:1]
Colored boxes correspond to exons where the seed-complementary sites - for mir-200a/mir-141 (red), and for mir-200b/mir-200c (purple) - occur. [score:1]
In fact, the Pearson correlation between CDH1 and PVT1 is very high in normal breast (r=0.8), but strongly dependent on the miRNA, as witnessed by the drastic drop in the correlation after the computational removal of the miRNA (e. g. r=0.01 when subtracting mir-200b effect). [score:1]
Notably, the normal MMI-network (1738 nodes and 32375 edges) is marked by a clear segregation into two internally well connected components: a larger one (1354 nodes and 31417 edges) mainly dominated by the mir-200 family and a smaller one (378 nodes and 954 edges) mainly controlled by mir-452. [score:1]
[1 to 20 of 22 sentences]
50
[+] score: 60
As miR-1 and miR-200 target sequences identified in SNAI2 3′-UTR are well conserved, mutually repressive regulation for SNAI2 and miR-1/miR-200b-a-429 is likely to be a common regulatory mechanism operating in human and other species. [score:5]
Members of the miR-200 family (miR-200f) have been shown to be major regulators of EMT through the targeted silencing of the EMT-transcriptional inducers ZEB1 and ZEB2, which in turn transcriptionally repress miR-200f in a double -negative feedback loop [27], [28]. [score:4]
Additionally, we also detected elevated methylation at miR-200b-a-429 locus in basal B cell lines (>50%), that correlates with downregulation of miR-200b, miR-200a and miR-429 (Figures S5 and S1). [score:4]
Transcriptional repression of miR-200b-a-429 and miR-1 by SNAI2 occurs by direct interaction through E-box elements; and conversely, SNAI2 was functionally validated as target gene for miR-1 and miR-200b [43]. [score:4]
Indeed, in hepatocellular carcinoma, miR-200b-a-429 promoter sequences show decreased histone H3 acetylation, a permissive epigenetic mark that is in turn modulated by miR-200a through direct targeting of the histone deacetylase 4 (HDAC4) [48]. [score:4]
In fact, during the preparation of this manuscript a study has been published describing a mutually inhibitory regulatory loop for SNAI2 and miR-200b/miR-1 in a murine mo del of aggressive prostate cancer. [score:4]
Interestingly, the expression of miR-200c-141 and its DNA methylation levels showed a significant inverse correlation in breast tumors, but no such association was observed for miR-200b-a-429 cluster (Figure 2C ). [score:3]
Figure S4 Stable overexpression of SNAI2 represses transcriptional activation of miR-200b-a-429 promoter through E-box elements. [score:3]
0047709.g001 Figure 1The expression levels of miR-200 family members (A) and EMT-transcriptional inducers (B) were quantified by qRT-PCR in 70 breast cancer samples. [score:3]
Relative luciferase activity of the WT constructs was set to 1. A strong de-repressive effect was observed for miR-200b-a-429 E1E2 mutant promoter in the cell line overexpressing SNAI2. [score:3]
Consistent with this idea, we demonstrated that overexpression of SNAI2 in MDCK cells had a strong repressive effect in the transcriptional activation of miR-200b-a-429 promoter, and this effect was strictly dependent on E-box motifs (Figure S4). [score:3]
The expression levels of miR-200 family members (A) and EMT-transcriptional inducers (B) were quantified by qRT-PCR in 70 breast cancer samples. [score:3]
Wee et al [47] have also shown that methylation of both promoter regions is inversely associated with miR-200b expression levels in breast cancer cell lines as well as in clinical specimens. [score:3]
A recent study [47] has functionally defined an independent promoter region for miR-200b-a-429 cluster, capable of directing transcriptional activity at the same level as the promoter sequences formerly described [27] and studied here. [score:2]
To study further the association between modulation of miR-200f and induction of EMT in breast cancer and to validate the epigenetic regulation of miR200 during this process, we utilized our recently described mo del systems for spontaneous EMT in mammary cells [38]. [score:2]
Spontaneous EMT in Normal Basal Breast is Associated to Hypermethylation of miR-200c-141 LocusTo study further the association between modulation of miR-200f and induction of EMT in breast cancer and to validate the epigenetic regulation of miR200 during this process, we utilized our recently described mo del systems for spontaneous EMT in mammary cells [38]. [score:2]
The promoter sequences analyzed for miR-200b-a-429 cluster span 415 bp encompassing the transcription start site (TSS) functionally defined by Bracken and colleagues [27]. [score:1]
MDCK-CMV (control) and MDCK-SNAI2 cell lines were transfected with firefly luciferase reporter constructs containing the promoter sequences of mouse E-cadherin (−178/+92) or human miR-200b-a-429 (−321/+120). [score:1]
The authors describe that miR-200b-a-429 cluster is epigenetically repressed in mammary fibroblasts by the repressive histone mark H3K27me3, while DNA methylation is the major epigenetic mechanism repressing the transcriptional activation of miR-200c-141 cluster. [score:1]
Two overlapping amplicons were analyzed in the promoter region of each genomic locus (miR-200b-a-429 and miR-200c-141). [score:1]
Importantly, Fibros subpopulation from Myo1089 cells showed increased methylation level of miR-200c-141 locus but not of miR-200b-a-429 locus (Figure 3C ), which parallels the result observed in MBCs (Figure 2B ). [score:1]
Although the methylation levels of miR-200b-a-429 locus were slightly increased in MBCs, there were no significant differences among the different tumor types. [score:1]
Similarly, Vrba et al [33] described that normal human mammary cells exhibit differential methylation of the proximal and distal parts of the CpG island (Figure 2A ), where the respective miR-200b-a-429 promoter regions are located. [score:1]
The five members of the miR-200f are grouped in two independent transcriptional units: a) miR-200b, miR-200a and miR-429 are clustered in an intergenic region of chromosome 1; and b) miR-200c and miR-141 are located on chromosome 12, within the intron of a noncoding RNA. [score:1]
[1 to 20 of 24 sentences]
51
[+] score: 59
Other miRNAs from this paper: hsa-mir-141, hsa-mir-200c, hsa-mir-200a, hsa-mir-429
Expression of ZEB1 and ZEB2 was upregulated concomitant with downregulation of miR200b and miR200c in TGF-β -treated cell lines, MDCK cells and normal rat kidney epithelial (NRKE) cells [43], [44], [45]. [score:9]
A transient upregulation was detectable after 6 h, but was no longer observed after 24 or 72 h. Moreover, miRNAs of the miR200 family have not been analyzed in human tubular cells and therefore, we chose three members of the miR200 family to assess their abundance, namely 200b, 200c and 141. miR200b showed the highest miRNA expression with a comparable expression in hPTECs and HKC-8 cells (Fig. 4C). [score:8]
A transient upregulation was detectable after 6 h, but was no longer observed after 24 or 72 h. Moreover, miRNAs of the miR200 family have not been analyzed in human tubular cells and therefore, we chose three members of the miR200 family to assess their abundance, namely 200b, 200c and 141. miR200b showed the highest miRNA expression with a comparable expression in hPTECs and HKC-8 cells (Fig. 4C). [score:8]
Our data are thus in line with the hypothesis that high levels of miRNAs of the miR200 family and the missing regulation by TGF-β contribute to the stability of E-cadherin expression in distal tubular cells. [score:4]
Analysis of transcription factors and miRNAs possibly involved in E-cadherin regulation revealed high levels of miRNAs of the miR200 -family, which may contribute to the stability of E-cadherin expression in human distal tubular epithelial cells. [score:4]
We identify differences between primary cells and cell lines in expression and regulation of miRNAs of the miR200 family providing a molecular explanation for the stability of E-cadherin. [score:4]
Prolonged autocrine signaling of TGF-β was necessary to drive sustained ZEB upregulation and miR200 silencing for maintenance of the mesenchymal state. [score:4]
Compared to miR200b, which was used as reference in Fig. 5C, miR200c and miR141 were expressed less abundantly with a considerably higher expression in hPTECs compared to HKC-8 cells. [score:3]
Analysis of molecular mechanisms showed a role for Rho-kinases in hPTECs plasticity, and stable expression of ZEB transcription factors and miRNAs of the miR200 family as potential mediators of E-cadherin stability in distal cells. [score:3]
In each set of experiments, expression of miR200b was set to 1. Error bars reflect variability of duplicate determinations. [score:3]
Correspondingly, there was no significant regulation of miR200b, 200c or 141 in hPTECs. [score:2]
Given the selective regulation of miR141, a role of further members of the miR200 family, e. g. miR200a or miR429 cannot be excluded. [score:2]
It has been suggested that the interplay between transcription factors ZEB1 and ZEB2 and miRNAs of the miR200 family plays an essential role in TGF-β -mediated regulation of E-cadherin [34]. [score:2]
Recently, several groups showed a mutual negative feedback loop between ZEB1/2 and miRNAs of the miR200 family regulating cellular plasticity in cancer cells but also in renal tubular cell lines [34]. [score:2]
miScript primer assays (Qiagen, Hilden, Germany) were used to detect miRNA expression following the manufacturer’s instructions Hs_miR-200c_1, Hs_miR-200b_3, Hs_miR-141_1 were used to detect members of the miR200 family and. [score:1]
[1 to 20 of 15 sentences]
52
[+] score: 58
In AsPC-1 pancreatic cancer cells, Notch-1 overexpression affected the expression of miRNAs: overexpression of Notch-1 led to increased expression of miR-21 and decreased expression of miR-200b. [score:11]
Re -expression of miR-200b led to inhibition of the EMT process by inducing decreased expression of ZEB1 and vimentin and increased expression of E-cadherin. [score:9]
Expression of the miR-200 family was increased or decreased in the process of metastasis: miR-200 was downregulated in the EMT process, while it was upregulated during the re-epithelialization of distal metastasis [82]. [score:9]
Li et al. also demonstrated that DIM could be effective against pancreatic cancer by reversing the EMT phenomenon by upregulating the expression of miR-200 and the let-7 family, which are typically lost in many other cancers [145]. [score:6]
Korpal M. Lee E. S. Hu G. Kang Y. The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2 J. Biol. [score:6]
According to a recent study by Li et al., DIM treatment decreased the expression of vimentin, ZEB1 and Slug as EMT markers with reversal of EMT in pancreatic cancer cells via the increased expression of miR-200 [145]. [score:5]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1 Nat. [score:4]
Li Y. VandenBoom T. G. 2nd Kong D. Wang Z. Ali S. Philip P. A. Sarkar F. H. Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells Cancer Res. [score:4]
Genistein treatment was found to attenuate the acquisition of EMT by AsPC-1 cells by promoting re -expression of miR-200b, which was repressed by Notch-1 signaling [90]. [score:3]
Specifically, the miR-200 family is significant for reducing the ZEB levels, cell migration and TGF-β -induced EMT [80, 81]. [score:1]
[1 to 20 of 10 sentences]
53
[+] score: 56
Dysregulated miRs in breast CAF included upregulation of miR-221, miR-31, and miR-221 with the downregulation of miR205, miR-200b, miR-200c, miR-141, miR-101, miR-342, let-7g and miR-26b affecting all aspects of cell differentiation and paracrine regulation (Zhao et al. 2012). [score:9]
Conversely, miR-200 expression down regulates known targets, including TGF-β2, that are particularly up regulated in many cancers (Benlhabib et al. 2015). [score:7]
CD-11-0219) 22585994 Benlhabib H Guo W Pierce BM Men delson CR 2015 The miR-200 family and its targets regulate type II cell differentiation in human fetal lung. [score:4]
However, the redundancy of miR-200 downregulation in both the epithelial and stromal compartments is highly supportive of using miR mimetic of this species. [score:4]
However, miR-200 family members have been reported to be both up- as well as downregulated in ovarian cancer (Park et al. 2008, Kan et al. 2012). [score:4]
Yet, in multiple independent studies miR-200 family was upregulated in metastatic breast and prostate cancers (Lin et al. 2014, Taylor et al. 2016). [score:4]
In the breast CAF, miR-200 family members seem to contributed to ECM remo deling through the expression of fibronectin and lysyl oxidase to potentiate cancer epithelial invasion (Tang et al. 2016). [score:3]
In a specific example, ectopic expression of miR-200 members significantly reduced anaplastic thyroid carcinoma cell invasion in a ZEB1/ZEB2 -dependent manner (Fig. 1) (Braun et al. 2010). [score:3]
Several miRs, such as miR-21, miR-34a, and the miR-200 family cluster target TGF-β signaling in prostate, breast and thyroid cancer for their functions during tumor progression and promotion (Braun et al. 2010, Shen et al. 2012, Chen et al. 2016) (Fig. 1). [score:3]
2013.405) 24096486 Park SM Gaur AB Lengyel E Peter ME 2008 The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Another target of miR-200 is Zeb1/Zeb2 in the maintenance of cellular plasticity, a major hallmark of tumor cell morphology (Brabletz & Brabletz 2010). [score:3]
CAN-15-2321) 26676753 Ahn SM Cha JY Kim J Kim D Trang HT Kim YM Cho YH Park D Hong S 2012 Smad3 regulates E-cadherin via miRNA-200 pathway. [score:2]
22283) 18506891 D’Ippolito E Plantamura I Bongiovanni L Casalini P Baroni S Piovan C Orlandi R Gualeni A Gloghini A Rossini A 2016 MiR-9 and miR-200 regulate PDGFR -mediated endothelial differentiation of tumor cells in triple negative breast cancer. [score:2]
1090922) 14764882 Brabletz S Brabletz T 2010 The ZEB/miR-200 feedback loop – a motor of cellular plasticity in development and cancer? [score:2]
It turned out that miR-21 helped distinguish between healthy and prostate cancer patients, but miR-141 (miR-200 family member) enabled distinction between localized and metastatic subjects. [score:1]
Importantly, miR-16 and miR-200 family members silences TGF-β signaling and blocks EMT (Brabletz & Brabletz 2010, Wang et al. 2014 b, Tang et al. 2016). [score:1]
Although in the epithelia miR-205 and miR-200 family members (miR-200c, miR-200b and miR-141) are associated with EMT progression, in fibroblastic cells they clearly have a different function. [score:1]
[1 to 20 of 17 sentences]
54
[+] score: 56
Other miRNAs from this paper: hsa-mir-205, hsa-mir-141, hsa-mir-200c, hsa-mir-200a, hsa-mir-429
High expression of either member of the indicated mir-200 cluster was associated with substantial expression of CDH1 mRNA (R = 0.22, p = 0.034), whereas ZEB1 and CDH1 mRNA were negatively correlated (R = –0.23, p = 0.027). [score:5]
The outcome of breast cancer disease in connection to mir-200 expression in primary tumors was highly dependent on the adjuvant therapy regimen used. [score:5]
Analysis of the expression of mir-200 family in primary colorectal tumors with known metastatic status showed that low levels of mir-200c were significantly associated with a metastatic disease (p = 0.041; Figure 1b). [score:5]
After stratifying for mir-200 expression, RT reduced the risk of local recurrences in the group of patients with tumors expressing high levels of mir-200s (b) but not in the group of tumors showing low mir-200 levels (c). [score:5]
We also show for the first time that the expression of the mir-200 family was associated with larger but fewer metastases, indicating a better prognosis for these patients. [score:3]
Our data support the theory that loss of expression of mir-200 family members activates the EMT system, and could thereby lead to migration and spreading of cells, as has been reported in various types of cancers [27, 28, 34]. [score:3]
To selectively analyze the expression of mir-200 in the epithelial compartment, matched normal, primary, and metastatic FFPE tissue samples from patients with metastatic colorectal cancer were microdissected (Figure 2a). [score:3]
Radiotherapy significantly decreased the risk of local recurrence in the patients with tumors expressing high levels of mir-200 but not in the patients whose tumors had low mir-200 levels (Figure 3a, b and c ). [score:3]
Metastatic tumors show altered mir-200 expression. [score:3]
Conversely, low mir-200 expression was associated with pronounced benefits of CMF, chiefly with regard to distant recurrence-free survival (Figure 3d, e and f). [score:3]
In summary, high ZEB1/low mir-200 expression was associated with activation of the PI3K–AKT pathway and with FGF signaling. [score:3]
For the survival analyses, a combination variable, mir-200, was created and defined as high expression (upper quartile) of mir-141 and/or mir-200c. [score:3]
There are five members of the mir-200 family, which are clustered together at two polycistronic sites: mir-200a, mir-200b, and mir-429 are located on chromosome 1p36 [13]; and mir-200c and mir-141 are located on chromosome 12p13. [score:1]
0084815.g003 Figure 3The treatment predictive value of mir-200 was analyzed in tumors from women who had been randomized to treatment with radiotherapy (RT) or systemic chemotherapy (CMF: cyclophosphamide, methotrexate, 5-FU) (a, d). [score:1]
Several microRNAs have been associated with EMT and metastasis, and the microRNA-200 (mir-200) family is described most frequently in this context [11]. [score:1]
The interaction between the treatment effect and miR-200 was clearly significant (CMF vs. [score:1]
radiotherapy: mir-200 high HR = 3.3 [CI 95% 1.3–9.42; p = 0.013] and mir-200 low HR = 0.49 [CI 95% 0.24–1.03; p = 0.059]; test for interaction p = 0.0035). [score:1]
The aim of the present study was to examine the potential of microRNAs as clinical markers and to elucidate the participation of the mir-200–ZEB–E-cadherin pathway in the progression of human cancers by using patient materials from metastatic colorectal and breast cancer. [score:1]
It is also plausible that additional microRNAs and signaling systems can play important roles in the metastatic process in vivo, perhaps in synergy with mir-200–ZEB. [score:1]
A trend towards shorter time to progression was seen in patients with low levels of CDH1 (p=0.11; Figure 1c) as well as members of the mir-200a/mir-200b/mir-429 cluster (p=0.22, p=0.08 and p=0.10, data not shown). [score:1]
The EMT-related mir-200 cluster has prognostic value in breast cancer patients. [score:1]
To summarize, we have shown that the EMT-related mir-200–ZEB–E-cadherin signaling pathway is of clinical relevance in predicting metastatic progression of primary tumors and the responses to different treatments. [score:1]
The treatment predictive value of mir-200 was analyzed in tumors from women who had been randomized to treatment with radiotherapy (RT) or systemic chemotherapy (CMF: cyclophosphamide, methotrexate, 5-FU) (a, d). [score:1]
Expression levels of all the five members of the mir-200 family, ZEB1, and CDH1 were measured by RT-qPCR in frozen tissue samples, and the results showed that the relationships between these factors in metastatic tissues were comparable those observed in primary tumors. [score:1]
[1 to 20 of 24 sentences]
55
[+] score: 55
Subsequently, we compared the expression levels of 410 co-expressed miRNAs between XY and YY testis (Table S5), and found a similar expression level for 93% co-expressed miRNAs, such as 5 dominantly expressed miRNAs, miR-26a, miR-7g, miR-200a, miR-200b and miR-103. [score:10]
Expression of five miR-200 family members (200a-3p, 200b-3p, 200c-3p, 141-3p, 429b-3p) was significantly up-regulated at 12 h, and were gradually rising to a higher value at 96 h after EE2 treatment compared to the expression of control group (Figure 6). [score:7]
The nine miRNAs includes four miRs (miR-16-5p, miR-21-3p, miR-462-5p, miR-731-3p) relatively high expressed in XX and five miRs (let-7g-5p, miR-26a-5p, miR-135c-5p, miR-193b-3p, miR-200b-3p) relatively high expressed in XY. [score:5]
Identification of potential targeting gene and further functional studies are needed to examine the role of miR-200 family members and other differently expressed miRNAs between XY and YY testes. [score:5]
The increased expression of miR-200 family members in male testis were observed after estrogen treatment, indicating that miR-200 family might play a role in inhibiting spermatogenesis. [score:5]
Hence, the relative low expression of miR-200 family members in YY testis may imply that their important function during testis development and spermatogenesis in yellow catfish. [score:4]
It was noticeable that miR-200 family members including miR-200a/b/c and their star sequences, miR-141 and miR-429/429a/429b all have a male-biased expression. [score:3]
The expression of six miR-200 members (miR-200a, -b, -c and their star sequences) in XY testis and YY testis are all significantly higher than XX ovary. [score:3]
Intriguingly, we found that miR-200 family had a male-bias expression in yellow catfish. [score:3]
Expression of several miR-200 family members, such as miR-141 and miR-429 were lower in YY testis than in XY testis. [score:3]
Relative expression of miR-200 family members in testis after EE2 treatment. [score:3]
In order to investigate whether miRNAs play some roles in testis development, we checked the expression of miR-200 family members in testis treated with high dose of estrogen that would impair testis development and cell proliferation [33]. [score:3]
Most miR-200 family members in yellow catfish have more normalized reads in XY testis than YY testis. [score:1]
[1 to 20 of 13 sentences]
56
[+] score: 55
The miR-200 family directly targets the 3′ UTRs of Zeb1 and Zeb2 to inhibit their expression, and Zeb1 and Zeb2, on the other hand, bind the promoters of both miR-200 family clusters to reciprocally inhibit their transcription [49]. [score:10]
The miR-200 family is largely known as tumor suppressive because of its inhibition of the epithelial-mesenchymal transition (EMT) through direct targeting of Zeb1 and Zeb2 TFs [45], [46]. [score:8]
and its orthologs, miR-200b, miR-200c, and miR-141 were first found tumor suppressors as they inhibit EMT through targeting Zeb1 and Zeb2 [45], [47]. [score:7]
Among the 5 clusters that down-regulated -mediated luciferase expression is 200b∼429, one of two clusters that comprise the miR-200 family (Figure 5 and Table 1). [score:6]
Recently, however, new tumor-suppressor targets of the miR-200 family have been discovered, suggesting this miRNA family may have a pro-proliferative function [12], [51], [52]. [score:5]
Also striking was up-regulation of Myc -mediated transcription by the entire miR-200 family (Clusters 200c∼141 and 200b∼429). [score:4]
The most thoroughly studied function of the miR-200 family is inhibition of EMT. [score:3]
In miRNA clusters comprised of closely related family members, for example both clusters of the miR-200 family or many members of C19MC, similar or same seed sequences provide a clear mechanism for multiple cluster members to target identical sets of genes [13]. [score:3]
Our screen revealed a-suppressing role for cluster 200b∼429, which contains, miR-200b, and miR-429. [score:3]
Annotated as in Figure 2. Annotated as in Figure 2. The miR-200 family is comprised of two clusters. [score:1]
Bottom: constructs with the wild type binding site (WT) or a mutated miR-200 binding site (Mut) in the 3′ UTR. [score:1]
Annotated as in Figure 2. The miR-200 family is comprised of two clusters. [score:1]
Cluster 200b∼429 is located on chromosome 1 and contains, miR-200b, and miR-429. [score:1]
Our data support an oncogenic role for this miR-200 family and we performed ensuing studies to examine the role of in the pathway (see below). [score:1]
Ann Surg Oncol 51 Teleman AA (2010) miR-200 de-FOGs insulin signaling. [score:1]
[1 to 20 of 15 sentences]
57
[+] score: 55
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro DecidualizationInterestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:7]
Moreover, the transcription factor ZEB1, a validated target of the mir-200 family, is up-regulated during the secretory phase in the human endometrial stroma, and its misregulation has been implicated in endometrial cancer progression [51], [52]. [score:7]
Am J Obstet Gynecol 202: 466 e461–467 58 Snowdon J Zhang X Childs T Tron VA Feilotter H 2011 The microRNA-200 family is upregulated in endometrial carcinoma. [score:4]
Another miRNA family that is down-regulated during the decidualization process is the mir-200 family. [score:4]
Noteworthily, some of the differentially expressed miRNAs identified in our study during decidualization have been found to be misregulated in endometriosis (e. g., miR-9, miR-135b and miR-141) [56], [17], [43], preeclampsia (e. g., miR-155, miR-183 and miR-181b) [18], [19], [57] or endometrial cancer (e. g., the miR-200 family and miR-96) [54], [58], [59]. [score:4]
The molecular pathways potentially regulated by the mir-181, miR-200 and miR-183 families with the potential target genes are listed below the histograms. [score:4]
Interestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:4]
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro Decidualization. [score:4]
This family is located at two different loci (chromosomes 1 and 12) and includes the mir-141, mir-429, mir-200a, mir-200b and mir-200c, miRNAs that were significantly down-regulated in the decidualized hESCs (Figure 1C). [score:4]
We also analyzed the more enriched molecular pathways by the union of miRNAs targets for the 4 mir-200 family members. [score:3]
B, miR-181 C, miR-200 and D, miR-183 family members’ expression in the E+P decidualized hESCs for 9 days if compared to the non decidualized control hESCs. [score:2]
miR-181, miR-183 and miR-200 miRNAs families members are similarly regulated during in vitro decidualization. [score:2]
miRNA 200 b was not included in the 704 miRNAs of the PCR array; thus, we analyzed its expression in the same samples using specific miRNA-200 b primers (Qiagen). [score:2]
Another interesting finding is that all the members of three different miRNAs families (miR-181, miR-200 and miR-183) have been identified to be similarly regulated. [score:2]
The molecular pathways potentially regulated by the miR-200 family include renal cell carcinoma and ErbB signaling. [score:2]
[1 to 20 of 15 sentences]
58
[+] score: 54
ZEB1 suppresses the expression of all miR-200 family members, which in turn inhibits the translation of ZEB1 mRNA, resulting in the double -negative ZEB1/miR-200 feedback loop [79]. [score:9]
The miR-200 family miRNAs downregulate ZEB1 and ZEB2 expression, and effectively upregulate the cellular E-cadherin level to maintain a cell in a more epithelial-like state. [score:9]
Although the number of studies that analyzed the miRNA expression and/or functions in colorectal CSCs is still limited, miRNAs, such as miR-200 family miRNAs, miR-203, miR-137, miR-34a and miR-221, function as the regulator of stem cell properties in colorectal CSCs by targeting various genes involved in the regulation of CSC properties (Figure 2A). [score:7]
Functional validation in CRC cell lines has confirmed that miR-194, miR-200b, miR-203 and miR-429, which share target genes and pathways, have abilities to suppress the stem/serrated/mesenchymal subtype [77]. [score:5]
miR-200 family miRNAs function as a stem cell regulator through negative regulation of two key biological properties: EMT and self renewal [9, 79, 82]. [score:3]
We previously identified miRNAs, such as miR-200 families and miR-142, can target key elements of the self-renewal and multi-lineage differentiation pathways in human breast CSCs and normal mammary stem/progenitor cells by analysis of the surgical specimens of human breast cancer patients [9, 10]. [score:3]
The miR-200 cluster is an extensively studied tumor-suppressive miRNA cluster in the genome and composed of five miRNAs (miR-200a, miR-200b, miR-200c, miR-141 and miR-429). [score:3]
A large number of studies demonstrated that strong suppressive effects of miR-200 family on cell transformation, cancer cell proliferation, migration, invasion, tumor growth and metastasis [81]. [score:3]
Brabletz S. Brabletz T. The zeb/mir-200 feedback loop—A motor of cellular plasticity in development and cancer?EMBO Rep. [score:2]
In addition, super-enhancers, a new class of regulatory regions that consist of multiple enhancer-like elements, enhance both transcription and Drosha/DGCR8 -mediated processing of primary miRNAs, including miR-200 family miRNAs [80]. [score:2]
Coordinated Regulation of miR-200 and miR-203 in Colorectal CSCs. [score:2]
3.1. miR-200b/c and miR-203. [score:1]
The miR-200 family members are also divided into two subgroups based on their seed sequences that differ by only 1 nt between the subgroups: miR-200b, miR-200c, and miR-429 (AA UACUG) and miR-200a and miR-141 (AA CACUG). [score:1]
Recent paper reported that miR-221 and miR-200 family miRNAs play crucial opposing roles in inducing differentiation state in breast cancers [117]: miR-200 family miRNAs promote a well-differentiated epithelial phenotype, while miR-221/222 promote a poorly differentiated, mesenchymal-like phenotype. [score:1]
3.1.2. miR-200 Family miRNAs. [score:1]
Based on the chromosomal locations, the miR-200 family is divided into two clusters: the miR-200ab/429 cluster is located on chromosome 1p36, and the miR-200c/141 cluster is located on chromosome 12p13 [78]. [score:1]
Howe E. N. Cochrane D. R. Richer J. K. The mir-200 and mir-221/222 microRNA families: Opposing effects on epithelial identityJ. [score:1]
[1 to 20 of 17 sentences]
59
[+] score: 54
It was recently demonstrated that EZH2 is frequently upregulated in primary HCCs, and miRNA expression profiling in HCC cells with EZH2-knockdown revealed that a set of miRNAs, including miR-139-5p, miR-125b, let-7c, miR-101, and miR-200b, are epigenetically suppressed by EZH2 in HCC (Au et al., 2012). [score:9]
The miR-200 gene family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and miR-205 encode key regulators of EMT that act by directly targeting zinc finger E-box binding homeobox 1 (ZEB1) and ZEB2, which are transcriptional repressors that downregulate E-cadherin (CDH1; Gregory et al., 2008; Korpal et al., 2008; Park et al., 2008). [score:8]
The miR-200 family inhibits epithelial–mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. [score:6]
Interestingly, miR-200b reportedly targets another PRC2 subunit, SUZ12, in breast cancer stem cells (Iliopoulos et al., 2010), suggesting a possible feedback loop between EZH2 overexpression and miRNA silencing in cancer. [score:5]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
In normal mammary epithelial cells and fibroblasts, expression of miR-200 family and miR-205 genes is regulated by DNA methylation, histone modifications, or a combination of the two (Vrba et al., 2010), but aberrant DNA methylation leads to the silencing of these miRNAs in cancer (Ceppi et al., 2010; Neves et al., 2010; Wiklund et al., 2011). [score:4]
In addition, miR-200a and miR-200b are overexpressed in pancreatic cancer due to their hypomethylation, and their elevation in the serum of pancreatic cancer patients means they could potentially serve as diagnostic biomarkers (Li et al., 2010). [score:3]
Loss of miR-200 inhibition of Suz12 leads to polycomb -mediated repression required for the formation and maintenance of cancer stem cells. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Pancreatic cancers epigenetically silence SIP1 and hypomethylate and overexpress miR-200a/200b in association with elevated circulating miR-200a and miR-200b levels. [score:3]
In another study, Cao et al. (2011) demonstrated that in prostate and breast cancer cell lines, EZH2 represses a set of miRNAs (miR-181c, miR-181b, miR-200b, miR-200c, and miR-203), which in turn negatively regulate the PRC1 subcomponents BMI1 and RING2. [score:2]
Dynamic epigenetic regulation of the microRNA-200 family mediates epithelial and mesenchymal transitions in human tumorigenesis. [score:2]
Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer. [score:1]
Within the human genome, miR-200 family genes are grouped into two polycistronic units, miR-200b/200a/429 and miR-200c/141, located on chromosomes 1 and 12, respectively (Davalos et al., 2012). [score:1]
[1 to 20 of 14 sentences]
60
[+] score: 54 <