sort by

400 publications mentioning hsa-mir-223 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-223. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 432
Other miRNAs from this paper: hsa-mir-155, hsa-mir-3178
To further explore whether NF-κB was involved in H. pylori -mediated upregulation of miR-223-3p, we used a specific NF-κB signal inhibitor BAY 11-7082 to treat the cells and found that NF-κB inhibitor treatment reversed H. pylori (CagA [+]) infection or CagA expression vector transfection -mediated upregulation of miR-223-3p. [score:13]
Fig. 2 a miR-223-3p expression was analyzed by qRT-PCR in AGS, BGC-823 and SGC-7901 cells treated with H. pylori (CagA [+]) alone or together with NF-κB inhibitor BAY 11-7082. b qRT-PCR analysis of the expression of miR-223-3p in AGS, BGC-823 and SGC-7901 cells transfected with CagA expression vector (pcDNA3.1-CagA) alone or together with NF-κB inhibitor BAY 11-7082. c of NF-κB protein level in AGS, BGC-823 and SGC-7901 cells transfected with control siRNA or NF-κB siRNAs. [score:11]
a miR-223-3p expression was analyzed by qRT-PCR in AGS, BGC-823 and SGC-7901 cells treated with H. pylori (CagA [+]) alone or together with NF-κB inhibitor BAY 11-7082. b qRT-PCR analysis of the expression of miR-223-3p in AGS, BGC-823 and SGC-7901 cells transfected with CagA expression vector (pcDNA3.1-CagA) alone or together with NF-κB inhibitor BAY 11-7082. c of NF-κB protein level in AGS, BGC-823 and SGC-7901 cells transfected with control siRNA or NF-κB siRNAs. [score:11]
f (1 and 2) The wild-type (WT) or mutant (Mut) reporter constructs was co -transfected with control or miR-223-3p mimics into BGC-823 and SGC-7901 cells, and the dual luciferase activity was determined at 48 h after transfection Furthermore, to ascertain whether miR-223-3p could directly target the 3′-untranslated region (UTR) of ARID1A in gastric cancer cells, we constructed a wild-type luciferase reporter vector (WT) containing the targeting sequences of ARID1A 3′-UTR and a mutant luciferase reporter vector (Mut) in which the targeting sequences were mutated (Fig.   4e). [score:10]
f (1 and 2) The wild-type (WT) or mutant (Mut) reporter constructs was co -transfected with control or miR-223-3p mimics into BGC-823 and SGC-7901 cells, and the dual luciferase activity was determined at 48 h after transfectionFurthermore, to ascertain whether miR-223-3p could directly target the 3′-untranslated region (UTR) of ARID1A in gastric cancer cells, we constructed a wild-type luciferase reporter vector (WT) containing the targeting sequences of ARID1A 3′-UTR and a mutant luciferase reporter vector (Mut) in which the targeting sequences were mutated (Fig.   4e). [score:10]
We upregulated ARID1A expression in the cells transfected with miR-223-3p mimics and found that the increase in cell proliferation and migration mediated by the miR-223-3p mimics was abrogated by the ARID1A overexpression (Fig.   5f–i). [score:8]
miR-223-3p downregulated ARID1A expression by directly binding to the 3’-UTR of ARID1A. [score:7]
Fig. 1 H. pylori induces miR-223-3p expression depending on CagA in gastric cancer cells a The expression of CagA was analyzed by western blot in AGS, BGC-823 and SGC-7901 cells infected with H. pylori (CagA [+] or CagA [-]) at MOI (multiplicity of infection) of 100:1 for 6 or 24 h. b (1–3) qRT-PCR analysis of the expression of miR-223-3p in the gastric cancer cells infected with H. pylori (CagA [+]) or H. pylori (CagA [-]). [score:7]
The expression of miR-223-3p is upregulated in human gastric cancer tissues and associated with H. pylori infectionFinally, we determined whether the results from the cell level had any clinical significance. [score:6]
The expression of miR-223-3p is upregulated in human gastric cancer tissues and associated with H. pylori infection. [score:6]
These results suggested that NF-κB was involved in CagA -mediated miR-223-3p upregulation via binding to the promoter of primary miR-223-3p and increasing its expression. [score:6]
H. pylori induces miR-223-3p expression depending on CagA in gastric cancer cellsTo investigate the regulatory role of H. pylori infection on miR-223-3p expression, we infected the gastric cancer cells AGS, BGC-823 and SGC-7901 with H. pylori 26695 (CagA [+]) for 6 and 24 h 3, 23 and determined the expression of miR-223-3p with quantitative real-time PCR (qRT-PCR). [score:6]
miR-223-3p directly targets ARID1A 3’-UTR and decreases ARID1A expression. [score:6]
The expression of ARID1A is downregulated in human gastric cancer tissues and negatively associated with miR-223-3p. [score:6]
Western blot results showed that the downregulation of p21 and E-cadherin mediated by miR-223-3p mimics can be partially reversed by the ARID1A overexpression (Fig.   5j). [score:6]
Furthermore, the overexpression of ARID1A deprived the miR-223-3p -mediated promotion of gastric cancer cell proliferation and migration, suggesting that the miR-223-3p played the oncogenic role in gastric cancer by directly targeting ARID1A. [score:6]
The upregulation of miR-223-3p expression in H. pylori-infected gastric mucosa was detected by miRNA microarrays [21]. [score:6]
We determined the expression of NF-κB in miR-223 mimics -transfected gastric cancer cells and found that miR-223 has no effect on the expression of NF-кB in the gastric cancer cells. [score:5]
Data are the means±SD of three independent experimentsTo further determine whether H. pylori CagA was responsible for the increased expression of miR-223-3p, we used a isogenic 26695 CagA mutant strain (CagA [−]) to infect the cells and found that the isogenic 26695 CagA mutant strain infection had no effect on the expression of miR-223-3p (Fig.   1a, b). [score:5]
The results showed that H. pylori CagA overexpression increased the cell proliferation and migration and the miR-223-3p inhibitor partially abrogated CagA -mediated biological effects (Fig.   3e–h). [score:5]
Since it has been reported that miR-223 targets NF-κB and IRAK1 in macrophages [34],we want to know whether miR-223 can target NF-κB in gastric cancer cells and form a feedback loop with NF-κB. [score:5]
Wang J Wu J Cheng Y Jiang Y Li GOver -expression of microrna-223 inhibited the proinflammatory responses in Helicobacter pylori-infection macrophages by down -regulating IRAK-1Am. [score:5]
As shown in Fig.   4f, miR-223-3p overexpression suppressed the wild-type luciferase activity of ARID1A 3′-UTR reporter, while it had no effect on the Mut luciferase reporter activities. [score:5]
The results showed that the H. pylori CagA was expressed in H. pylori (CagA [+])-infected cells (Fig. 1a) and miR-223-3p expression level was significantly increased with H. pylori (CagA [+]) infection in all the three cells (Fig.   1b). [score:5]
Data are the means±SD of three independent experiments To further determine whether H. pylori CagA was responsible for the increased expression of miR-223-3p, we used a isogenic 26695 CagA mutant strain (CagA [−]) to infect the cells and found that the isogenic 26695 CagA mutant strain infection had no effect on the expression of miR-223-3p (Fig.   1a, b). [score:5]
g of the migration ability in SGC-7901 cells transfected with CagA expression vector (pcDNA3.1-CagA) alone or together with miR-223-3p inhibitor. [score:5]
Fang G MicroRNA-223-3p Regulates Ovarian Cancer Cell Proliferation and Invasion by Targeting SOX11 ExpressionInt. [score:5]
a The expression of CagA was analyzed by western blot in AGS, BGC-823 and SGC-7901 cells infected with H. pylori (CagA [+] or CagA [-]) at MOI (multiplicity of infection) of 100:1 for 6 or 24 h. b (1–3) qRT-PCR analysis of the expression of miR-223-3p in the gastric cancer cells infected with H. pylori (CagA [+]) or H. pylori (CagA [-]). [score:5]
In this study, we first confirmed that H. pylori (CagA [+]) infection increased the expression of miR-223-3p in gastric cancer cells, while CagA- deleted H. pylori mutant strain (CagA [-]) infection has no effect on miR-223-3p expression. [score:5]
Furthermore, CagA expression vector (pcDNA3.1-CagA) transfection increased the expression of miR-223-3p in the gastric cancer cells. [score:5]
We used the NF-κB pathway inhibitor BAY 11-7082 to treat the gastric cancer cells and then determined the expression of miR-223-3p. [score:5]
Therefore, we transfected the miR-223-3p mimics or inhibitor into gastric cancer cells and used qRT-PCR and western blot to determine the effect of miR-223-3p on the expression of ARID1A. [score:5]
e EdU analysis of the cell proliferation ability in SGC-7901 transfected with CagA expression vector (pcDNA3.1-CagA) alone or together with miR-223-3p inhibitor. [score:5]
In the clinical setting, miR-223-3p was downregulated in gastric cancer tissues compared with the corresponding noncancerous tissues and the expression level of miR-223-3p was significantly higher in H. pylori -positive gastric cancer tissues than that in H. pylori -negative tissues. [score:5]
Furthermore, we used CagA expression vector (pcDNA3.1-CagA) to transfect the gastric cancer cells and found that miR-223-3p expression was significantly increased with pcDNA3.1-CagA transfection (Fig.   1c). [score:5]
c qRT-PCR analysis of the expression of miR-223-3p in AGS, BGC-823 and SGC-7901 cells transfected with control vector (pcDNA3.1) or CagA expression vector (pcDNA3.1-CagA). [score:5]
Data are the means±SD of three independent experiments To further investigate the underlying mechanism of miR-223-3p in gastric cancer cell proliferation and migration, we used different databases such as TargetScan, Mirnada and miRBase to predict the targets of miR-223-3p and found that ARID1A (a member of the SWI/SNF family) might be targeted by miR-223-3p. [score:5]
In this study, we identified ARID1A as a novel direct target of miR-223-3p in gastric cancer. [score:4]
In addition, knockdown of NF-κB with specific NF-κB siRNA decreased the expression of miR-223-3p and the promoter activity of miR-223-3p. [score:4]
Liang H MicroRNA-223 delivered by platelet-derived microvesicles promotes lung cancer cell invasion via targeting tumor suppressor EPB41L3Mol. [score:4]
To investigate the regulatory role of H. pylori infection on miR-223-3p expression, we infected the gastric cancer cells AGS, BGC-823 and SGC-7901 with H. pylori 26695 (CagA [+]) for 6 and 24 h 3, 23 and determined the expression of miR-223-3p with quantitative real-time PCR (qRT-PCR). [score:4]
Wild-type (WT) or the mutant (Mut) pGL3-miR-223-3p promoter construct was co -transfected with control siRNA or NF-κB siRNAs into AGS, BGC-823 and SGC-7901, and the dual luciferase activity was determined at 48 h after transfection As a transcription factor, NF-κB has been demonstrated to bind to the binding sites on the promoters of target genes and regulate their transcription. [score:4]
We used qRT-PCR to detect the expression of miR-223-3p in 42 paired gastric cancer and corresponding noncancerous tissues and found that 22/42 (52.38%) of the clinical gastric cancer specimens showed significantly increased expression of miR-223-3p as compared with corresponding noncancerous tissues (Fig.   S3, Table  S2). [score:4]
NF-κB binds to the miR-223-3p promoter and is involved in CagA -induced upregulation of miR-223-3p. [score:4]
However, the potential mechanism of H. pylori -mediated miR-223-3p upregulation remains undefined. [score:4]
The luciferase assay showed that inhibition of NF-κB expression reduced the luciferase activity driven by the wild-type pGL3-miR-223-3p promoter, whereas NF-κB siRNA has no significant effect on the mutant miR-223-3p promoter activity (Fig.   2g). [score:4]
Wild-type (WT) or the mutant (Mut) pGL3-miR-223-3p promoter construct was co -transfected with control siRNA or NF-κB siRNAs into AGS, BGC-823 and SGC-7901, and the dual luciferase activity was determined at 48 h after transfectionAs a transcription factor, NF-κB has been demonstrated to bind to the binding sites on the promoters of target genes and regulate their transcription. [score:4]
Similarly, BAY 11-7082 treatment also abrogated the upregulation of miR-223-3p mediated by pcDNA3.1-CagA transfection in AGS, BGC-823 and SGC-7901 cells (Fig.   2b). [score:4]
Therefore, we next determined whether NF-κB was involved in CagA -mediated miR-223-3p upregulation. [score:4]
These results suggested that ARID1A was a direct target of miR-223-3p in gastric cancer cells. [score:4]
On the contrary, knockdown of miR-223-3p with miR-223-3p inhibitor increased the mRNA and protein levels of ARID1A (Fig.   4c, d, Fig.   S2). [score:4]
d Regression analysis showed that ARID1A is negatively associated with miR-223-3p in GC tissues We also determined the expression of ARID1A in the paired gastric cancer and corresponding noncancerous tissues and found that 28/42 (66.7%) of the gastric cancer specimens showed significantly decreased expression of ARID1A as compared with corresponding noncancerous tissues (Fig.   S4, Table  S2). [score:4]
As shown in Fig.   2a, pretreatment of gastric cancer cells with BAY 11-7082 abrogated the upregulation of miR-223-3p induced by H. pylori (CagA [+]) infection. [score:4]
Therefore, we assume that NF-κB binds to the promoter of the primary miR-223-3p and regulates its transcription directly. [score:3]
Moreover, Ma et al. [33] found that the overexpression of miR-223 was related with H. pylori -positive infection in gastric cancer. [score:3]
d qRT-PCR analysis of the ARID1A mRNA level in BGC-823 and SGC-7901 cells transfected with control or miR-223-3p inhibitor. [score:3]
Therefore, these data demonstrated that miR-223-3p promoted cell proliferation and migration by targeting ARID1A partially. [score:3]
showed that the average expression level of miR-223-3p in tumor tissues was significantly higher than that in surrounding noncancerous tissues (Fig.   6a). [score:3]
H. pylori induces miR-223-3p expression depending on CagA in gastric cancer cells. [score:3]
Fig. 6Clinical relevance of miR-223-3p and expression of ARID1A in human GC tissues. [score:3]
f EdU analysis of the cell proliferation ability in SGC-7901 cells transfected with miR-223-3p mimics alone or together with ARID1A expression vector (pcDNA6.0-ARID1A). [score:3]
Therefore, our findings suggest that NF-κB/miR-223-3p/ARID1A axis may link the process of H. pylori -induced chronic inflammation to gastric cancer and miR-223-3p may serve as a novel target for the intervention of the malignance. [score:3]
b of miR-223-3p expression in H. pylori -positive and H. pylori -negative gastric cancer tissues. [score:3]
ARID1A is functionally important for the biological effects of miR-223-3p by targeting p21 and E-cadherin. [score:3]
In this study, we find that H. pylori CagA induces miR-223-3p expression through NF-κB pathway. [score:3]
j of the expression of p21 and E-cadherin in SGC-7901 cells with different transfectionsThen, we sought to explore the potential role of ARID1A in miR-223-3p -mediated biological functions. [score:3]
c of the ARID1A protein level in BGC-823 and SGC-7901 cells transfected with control or miR-223-3p inhibitor. [score:3]
In our study, we verified the oncogenic role of miR-223-3p in gastric cancer, which is consistent with the results from Ma et al. [33] Importantly, we found that the miR-223-3p inhibitor reversed CagA -mediated promotion of cell proliferation and migration. [score:3]
Taken together, these results suggested that H. pylori infection induced miR-223-3p expression in CagA -dependent manner. [score:3]
e qRT-PCR analysis of the expression of miR-223-3p in the gastric cancer cells transfected with control siRNA or NF-κB siRNAs. [score:3]
The results showed that the mRNA and protein levels of ARID1A were decreased after the ectopic expression of miR-223-3p in BGC-823 and SGC-7901 cells (Fig.   4a, b, Fig.   S2). [score:3]
These results suggested that H. pylori induced miR-223-3p expression in a CagA -dependent manner. [score:3]
Of these miRNAs, only has-miR-223-3p showed increased expression in H. pylori -positive mucosa, but the potential mechanism is not clear. [score:3]
h of the migration ability in SGC-7901 cells transfected with miR-223-3p mimics alone or together with ARID1A expression vector (pcDNA6.0-ARID1A). [score:3]
Moreover, we validate the oncogenic role of miR-223-3p by repressing ARID1A (AT-rich interacting domain containing protein 1A) expression. [score:3]
j of the expression of p21 and E-cadherin in SGC-7901 cells with different transfections Then, we sought to explore the potential role of ARID1A in miR-223-3p -mediated biological functions. [score:3]
a of miR-223-3p expression in GC tissues and adjacent normal gastric mucosa (n = 42, P = 0.0077). [score:3]
Correlation analysis between ARID1A and miR-223-3p expression in GC samples were made using linear regression. [score:3]
Human miR-223-3p mimics, miR-223-3p inhibitor and corresponding controls were synthesized from RiboBio (Guangzhou, China). [score:3]
Therefore, these results suggested that H. pylori CagA increased miR-223-3p expression via NF-κB -dependent pathway and miR-223-3p might act as a 'bridge' to link H. pylori -induced chronic inflammation and carcinogenesis. [score:3]
Therefore, we wonder whether miR-223-3p is involved in CagA -mediated inflammation to gastric cancer by serving as a downstream target of NF-κB. [score:3]
qRT-PCR results showed that NF-κB siRNA reduced miR-223-3p expression level in the three cells (Fig.   2e). [score:3]
miR-223-3p promotes cell proliferation and migration by targeting ARID1A. [score:3]
The mutations were generated at the predicted miR-223-3p binding sites located in the ARID1A 3′-UTR. [score:2]
One assumed RELA binding site was mutated using the QuickChange Site-Directed Mutagenesis Kit and the wild-type pGL3-miR-223-3p as the template. [score:2]
We knocked down miR-223-3p in CagA overexpressed gastric cancer cells and used EdU ands to investigate the cell proliferation and migration ability. [score:2]
Wei Y MiR-223-3p targeting SEPT6 promotes the biological behavior of prostate cancerSci. [score:2]
Furthermore, compared with H. pylori -negative gastric cancer tissues, miR-223-3p expression was significantly higher in H. pylori -positive tissues (Fig.   6b). [score:2]
Fig. 7Schematic representation of the NF-κB/miR-223-3p/ARID1A regulatory mechanism in H. pylori-infected gastric cells Human gastric cancer cell lines AGS, BGC-823 and SGC-7901 were purchased from the Cell Resource Center, Institute of Biochemistry and Cell Biology at the Chinese Academy of Science (Shanghai, China). [score:2]
In summary, we determined the role and regulatory mechanism of miR-223-3p in H. pylori CagA -induced gastric carcinogenesis and progression. [score:2]
Fig. 4 a of the ARID1A protein level in BGC-823 and SGC-7901 cells transfected with control or miR-223-3p mimics. [score:1]
miR-223-3p promotes the proliferation and migration of gastric cancer cells and is involved in CagA -mediated biological effects. [score:1]
The pGL3-miR-223-3p luciferase reporter plasmid was constructed by inserting the promoter sequences of miR-223-3p into the pGL3-basic vector (Promega) between the KpnI and XhoI sites. [score:1]
c of the migration ability in BGC-823 and SGC-7901 cells transfected with the control or miR-223-3p mimics. [score:1]
5-Ethynyl-2'-deoxyuridine (EdU) ands were used to detect the effects of the miR-223-3p mimics on gastric cancer cells proliferation and migration, respectively. [score:1]
b qRT-PCR analysis of the ARID1A mRNA level in BGC-823 and SGC-7901 cells transfected with control or miR-223-3p mimics. [score:1]
a of the ARID1A protein level in BGC-823 and SGC-7901 cells transfected with control or miR-223-3p mimics. [score:1]
It has been reported that there is a putative NF-κB binding site in the promoter of miR-223-3p [22]. [score:1]
Fig. 3 a EdU analysis of the cell proliferation ability in BGC-823 and SGC-7901 cells transfected with the control or miR-223-3p mimics. [score:1]
We found that the NF-κB/ miR-223-3p/ARID1A signaling cascade may be a 'bridge' for H. pylori -induced chronic inflammation to gastric cancer, thereby providing a new mechanism for the pathogenicity of H. pylori (Fig.   7). [score:1]
Collectively, these results demonstrate that miR-223-3p plays an important role in promoting the gastric carcinogenesis and progression and is a key mediator for the biological effects of H. pylori CagA. [score:1]
These results suggest that miR-223-3p is involved in the CagA -mediated biological function in gastric cancer. [score:1]
Wild-type (WT) or the mutant (Mut) pGL3-miR-223-3p promoter construct was co -transfected with control siRNA or NF-κB siRNAs into AGS, BGC-823 and SGC-7901, and the dual luciferase activity was determined at 48 h after transfection Next, we sought to elucidate the biological role of miR-223-3p in gastric carcinogenesis and progression. [score:1]
Since a conserved putative NF-κB binding site in the promoter region of miR-223-3p is found [22], we wonder whether miR-223-3p is involved in H. pylori CagA -mediated transformation from chronic inflammation to gastric cancer via NF-κB -dependent pathway. [score:1]
NF-κB is required for the induction of miR-223-3p upon H. pylori stimulation. [score:1]
Data are the means±SD of three independent experiments a EdU analysis of the cell proliferation ability in BGC-823 and SGC-7901 cells transfected with the control or miR-223-3p mimics. [score:1]
Moreover, a highly significant negative correlation between miR-223-3p and ARID1A transcripts was observed in these samples (Fig.   6d). [score:1]
In a previous study, the promoter region of miR-223-3p was reported to contain putative NF-κB binding site [22]. [score:1]
The 3′-UTR fragments of ARID1A containing putative miR-223-3p binding sites were amplified and cloned into the pMIR-REPORT luciferase vector between HindIII and SpeI sites (Ambion, Austin, TX, USA). [score:1]
e Upper: the predicted complementary sequences of miR-223-3p in the 3′-UTR of ARID1A. [score:1]
f Schema of the putative NF-κB binding sites in the miR-223-3p promoter region. [score:1]
miR-223-3p has been characterized as a oncogene in multiple tumors, such as pancreatic cancer, prostate cancer, ovarian cancer, lung cancer and gastric cancer, by targeting different genes, such as FBXW7, SEPT6, SOX11, EPB41L3 35– 38. [score:1]
Next, we wondered whether miR-223-3p was involved in CagA -mediated biological role in gastric cancer. [score:1]
Next, we sought to elucidate the biological role of miR-223-3p in gastric carcinogenesis and progression. [score:1]
Ma L Chen Y Zhang B Liu GIncreased microRNA-223 in Helicobacter pylori -associated gastric cancer contributed to cancer cell proliferation and migrationBiosci. [score:1]
b of the EdU -positive cell ratio in the cells transfected with the control or miR-223-3p mimics. [score:1]
We then examined whether miR-223-3p was involved in CagA -mediated biological effects. [score:1]
As shown in Fig.   3a–d, miR-223-3p mimics promoted the proliferation and migration significantly in BGC-823 and SGC-7901 cells. [score:1]
The miR-223-3p complementary sequences AACUGAC in the 3′-UTR of ARID1A were mutated to remove the complementarity. [score:1]
NF-κB is required for the induction of miR-223-3p upon H. pylori stimulationIt has been demonstrated that the H. pylori CagA -mediated malignant transformation of gastric epithelial cells are closely related to NF-κB activity, which is a key molecular link between inflammation and oncogenesis initiation and progression [24]. [score:1]
miR-223-3p promotes the proliferation and migration of gastric cancer cells and participates in CagA -mediated biological effects. [score:1]
We found that miR-223-3p bound to the complementary sites of the 3′-UTR of ARID1A and decreased its mRNA and protein levels. [score:1]
BGC-823 and SGC-7901 cells were co -transfected with WT or Mut luciferase reporters and miR-223-3p mimics. [score:1]
[1 to 20 of 123 sentences]
2
[+] score: 400
First, miR-223 inhibitor significantly up-regulates the expression of FBXW7 mRNA and protein in 7901/DDP cells, whereas miR-223 mimic significantly down-regulates the expression of FBXW7 mRNA and protein in 7901 cells. [score:13]
The expression of CDK2, CDK4, CDK6, CCND1, CCND2 and CCND3 was significantly down-regulated in miR-223 inhibitor or pcDNA/FBXW7 -transfected 7901/DDP cells compared with control cells, while p14, p16, p21 and p27 were significantly up-regulated. [score:10]
Thus, up-regulation of FBXW7 could mimic the effect of miR-223 down-regulation on the chemo sensitivity of 7901/DDP cells and rescue the effect of miR-223 overexpression on the chemo sensitivity of 7901 cells. [score:9]
Overexpression of FBXW7 could mimic the effect of miR-223 down-regulation and silencing of FBXW7 could partially reverse the effect of miR-223 down-regulation on DDP resistance of DDP-resistant GC cells. [score:9]
These data suggest that miR-223 targets FBXW7 and down-regulates its expression in GC. [score:8]
Fourth, down-regulation of FBXW7 could mimic the effect of miR-223 mimic in 7901 cells, whereas up-regulation of FBXW7 could partially reverse the effect of miR-223 mimic in 7901/DDP cells. [score:7]
SiRNA -mediated down-regulation of FBXW7 could rescue the effect of miR-223 downregulation on the sensitivity of 7901/DDP cells to DDP. [score:7]
Thus, miR-223 can perform its resistance promoting function by inhibiting tumor suppressor targets. [score:7]
We further determined whether FBXW7 down-regulation could rescue the effects of miR-223 down-regulation on the chemo sensitivity of 7901/DDP cells. [score:7]
We also detected miR-223 expression in tumor and control tissues and found that miR-223 expression was significantly higher in tumors (Figure  1E, p < 0.05) and it expressed especially higher in stage III/IV patients (Figure  1F, p < 0.05). [score:7]
Third, overexpression of FBXW7 could mimic the effect of miR-223 inhibitor in 7901/DDP cells, whereas silencing of FBXW7 could partially reverse the effect of miR-223 inhibitor in 7901 cells. [score:7]
Figure 6 siRNA -mediated down-regulation of FBXW7 could mimic effect of miR-223 up-regulation on sensitivity of 7901 cells. [score:7]
Therefore, miR-223 could negatively regulate the expression of FBXW7 by directly targeting FBXW7 3’UTR transcript. [score:7]
Meantime, the IC [50] value in miR-223 inhibitor transfected 7901/DDP or BGC-823/DDP cells still showed higher levels than that in respective sensitive cells, suggesting that inhibiting miR-223 expression could only partially reverse the DDP-resistant GC cells to DDP-sensitive phenotype (Figure  2C). [score:7]
The targets of miR-223 were predicted through three publicly available algorithms (TargetScan, PicTar and miRanda), and FBXW7 was selected as a putative target in all three software. [score:7]
Thus, down-regulation of FBXW7 could mimic the effect of miR-223 mimic on the chemo sensitivity of 7901 cells and rescue the effect of miR-223 inhibitor on the chemo sensitivity of 7901/DDP cells. [score:6]
Over -expression of FBXW7 could rescue the effect of miR-223 up-regulation on the sensitivity of 7901 cells to DDP. [score:6]
In addition, up-regulation of FBXW7 could reverse the effects of miR-223 overexpression on the G1/S transition (Additional file 3: Figure S2C) and DDP -induced apoptosis (Additional file 3: Figure S2D) of 7901 cells. [score:6]
Further, we determined whether the up-regulation of FBXW7 could rescue the effects of miR-223 over -expression on the chemosensitivity of GC cells. [score:6]
Also, up-regulation of FBXW7 could rescue the increased IC [50] value of DDP to 7901 cells induced by miR-223 over -expression (Additional file 3: Figure S2B). [score:6]
Also, siRNA/FBXW7 could decrease the increased IC [50] value of DDP to 7901/DDP cells induced by miR-223 inhibitor (Additional file 4: Figure S3B), and siRNA/FBXW7 could abrogate the effects of miR-223 inhibitor on the G1/S transition (Additional file 4: Figure S3C) and DDP -induced apoptosis (Additional file 4: Figure S3D) of 7901/DDP cells. [score:5]
GAPDH was used as an internal control; (D) Western blot detection of FBXW7 protein expression in cells transfected with miR-223 mimic or inhibitor. [score:5]
All experimental data were expressed as the Mean ± S. D. The significance of differences of clinical data according to miR-223 expression was determined by Student’s t-test. [score:5]
U6 was used as an internal control; (B) 7901/DDP cells transfected with miR-223 inhibitor show more DDP sensitivity than cells transfected with inhibitor NC. [score:5]
Figure 5 Over -expression of FBXW7 could mimic the effect miR-223 inhibitor on the sensitivity of 7901/DDP cells. [score:5]
Expression of miR-223 was negatively correlated with FBXW7 expression in cells and tissues. [score:5]
Taken together, these data suggested that up-regulation of miR-223 might have important roles in the development of GC and DDP resistance in GC cells, especially under H. pylori infection state. [score:5]
The histogram shows the mean ± S. D. of the normalized luciferase activity from three independent experiments; (C) qRT-PCR detection of FBXW7 mRNA expression in 7901 cells transfected with miR-223 mimic or inhibitor. [score:5]
Analyses using the TargetScan, PicTar and miRanda algorithms’ databases revealed that more than 100 genes were predicted to be the potential targets of miR-223. [score:5]
Furthermore, miR-223 was found to be significantly up-regulated in H. pylori infected tissues and cells, suggesting that H. pylori infection may lead to GC development and DDP resistance. [score:5]
Indicated miR-223 inhibitor or inhibitor NC -transfected 7901/DDP cells were plated in triplicate and exposed to DDP (0.0 and 4.0ug/ml). [score:5]
Forty-eight hours after transfection, qRT-PCR assay was performed and indicated that miR-223 expression was significantly decreased after inhibitor transfection (p < 0.05) (Figure  2A). [score:4]
Figure 2 Down-regulation of miR-223 significantly increases the sensitivity of 7901/DDP cells to DDP. [score:4]
FBXW7 was identified as the direct and functional target gene of miR-223. [score:4]
Likewise, we also found that up-regulation of miR-223 could affect G1/S transition and reduce the DDP -induced apoptosis in parental GC cells. [score:4]
Additionally, miR-223 was reported to be significantly up-regulated in H. pylori infected gastric tissues through miRNA array profiling. [score:4]
Then, qRT-PCR and western blot assays were performed to analyze the effects of miR-223 expression change on FBXW7 mRNA and protein expression. [score:4]
By loss-of-function studies, down-regulation of miR-223 could reverse the in vitro DDP resistance of DDP-resistant GC cells by affecting G1/S cell cycle transition and inducing apoptosis enhancement. [score:4]
MicroRNAs (miRNAs) including miR-27 [34], miR-25 [35] and miR-223 [36] have been reported to be involved in regulating the expression of FBXW7. [score:4]
Figure 3 Up-regulation of miR-223 significantly reduces the sensitivity of 7901 cells to DDP. [score:4]
Our data clearly suggest that miR-223 promotes the DDP resistance of GC cells by directly targeting FBXW7. [score:4]
The results showed that FBXW7 expressed significantly lower when transfecting with miR-223 mimic and higher when transfecting with miR-223 inhibitor, compared with respective controls (Figure  4C). [score:4]
To determine whether the 3’UTR region of FBXW7 mRNA is a direct functional target of miR-223, we cloned FBXW7 3’UTR containing the potential binding site into the pGL3 vector to generate the pGL3-FBXW7-wt vector (Figure  4A). [score:4]
To further investigate the roles of FBXW7 in the miR-223-regulated cell cycle in DDP-resistant 7901 cells, we analyzed the expression of G1/S checkpoint related proteins in miR-223 inhibitor or pcDNA/FBXW7 transfected 7901/DDP cells, including CCND1, CCND2, CCND3, CCNE1, CCNE2, CDK2, CDK4, CDK6, p14, p16, p21, p27, c-myc (Figure  7). [score:4]
The site-directed mutagenesis of the miR-223 target-site was carried out using Invitrogen (Californlia, USA). [score:4]
In the present study, we demonstrated that miR-223 could promote DDP resistance of GC cells via regulating G1/S cell cycle transition and apoptosis by targeting FBXW7. [score:4]
Thus, up-regulation of miR-223 could increase the in vitro resistance of 7901 or BGC-823 cells to DDP. [score:4]
Therefore, down-regulation of miR-223 could reverse the DDP resistance of resistant GC cells by inducing cell arrest in G0/G1 phase and enhanced apoptosis when exposed to DDP treatment. [score:4]
qRT-PCR assay confirmed the up-regulated expression level of miR-223 in 7901/miR-223 and BGC-823/miR-223 cells, compared with that in 7901/NC or BGC-823/NC cells (Figure  3A). [score:4]
Next, we analyzed the effects of miR-223 up-regulation on cell cycle and apoptosis of parental GC cells when exposed to DDP treatment by flow cytometry. [score:4]
We showed that up-regulation of miR-223 could reduce the sensitivity of parental GC cells to DDP in vitro. [score:4]
In summary, our data establish a functional link that miR-223 and FBXW7 in GC, and show that miR-223 could promote DDP resistance in GC cells via regulating cell cycle and apoptosis by targeting FBXW7. [score:4]
Forty-eight hours after siRNA/FBXW7 and miR-223 inhibitor were co -transfected into 7901/DDP cells, qRT-PCR and western blot assays showed that siRNA/FBXW7 could recover the expression of FBXW7 mRNA and protein (Additional file 4: Figure S3A). [score:4]
Figure 1 miR-223 expression in cells and tissues. [score:3]
MiR-223 has been known to be up-regulated in many human cancers, including colorectal cancer [25], lung cancer [26] and GC [27]. [score:3]
MiR-223 is up-regulated in tumor tissues and DDP-resistant GC cells. [score:3]
The IC [50] value of DDP in miR-223 inhibitor transfected 7901/DDP or BGC-823/DDP cells was also significantly reduced substantially (p < 0.05). [score:3]
Next, we analyzed the effects of miR-223 inhibitor on cell cycle and apoptosis of 7901/DDP cells when exposed to DDP treatment by flow cytometry. [score:3]
MiR-223 and FBXW7 regulate the expression of G1/S transition in DDP-resistant GC cells. [score:3]
To investigate the roles of miR-223 in the DDP resistance, miR-223 inhibitor or inhibitor NC (iNC) was transiently transfected into 7901/DDP and BGC-823/DDP cells. [score:3]
The forci formation was indicated; (C) MTT analysis of the IC [50] values of DDP in 7901/miR-224 or 7901/NC cells; (D) Flow cytometric analysis of cell cycle in 7901/miR-223 or 7901/NC cells combined with DDP (0 and 2.0 ug/ml); (E) Flow cytometric analysis of apoptosis in 7901/miR-223 or 7901/NC cells combined with DDP (0 and 2.0 ug/ml); Data are expressed as the mean ± S. D. of three individual experiments. [score:3]
Thus, in the future, miR-223/FBXW7 signature might predict the responses of GC patients to DDP -based chemotherapy and represent potential targets for therapeutic intervention. [score:3]
FBXW7 was a functional target of miR-223. [score:3]
We found in the present study that H. pylori positive patients had a significantly higher proportion of miR-223 over -expression. [score:3]
Then, we correlated FBXW7 with miR-223 expression in the same GC cells and specimens. [score:3]
Our findings revealed the roles of miR-223/FBXW7 signaling in the DDP resistance of GC cells and targeting it will be a potential strategic approach for reversing the DDP resistance in human GC. [score:3]
Forty-eight hours after 7901/DDP cells were transfected with miR-223 inhibitor or pcDNA/FBXW7, cells were collected. [score:3]
A significant inverse correlation was observed (2-tailed Spearman's correlation, r = −0.915; P = 0.000) when FBXW7 mRNA levels were plotted against miR-223 expression (Figure  8D). [score:3]
The luciferase activity was determined after co-transfecting pGL3-FBXW7-wt vector and miR-223 mimic or NC and the result showed that the luciferase activity was decreased by miR-223 mimics transfection (P < 0.05) when the wild type 3’UTR of FBXW7 was present, and the activity was increased significantly (P < 0.05) when miR-223 was inhibited. [score:3]
We found that miR-223 was most significantly up-regulated miRNA in DDP-resistant GC cells compared with parental GC cells. [score:3]
Effect of miR-223 expression on sensitivity of GC cells to cisplatin in vitro. [score:3]
Then, we determined the effect of miR-223 inhibitor on colony formation of 7901/DDP cells when exposed to DDP treatment (0 and 4 ug/ml). [score:3]
Figure 8 Expression of miR-223 was negatively correlated with FBXW7 in cells and tissues. [score:3]
Importantly, to further explore the molecular mechanisms by which miR-223 exerts its function, the determination of its functional target gene is essential. [score:3]
We co-cultured 7901 and BGC-823 cells with different MOIs of H. pylori and found that miR-223 expression increased with MOIs of H. pylori infection (Additional file 2: Figure S1A). [score:3]
A FBXW7 3’UTR fragment containing wild-type or mutant miR-223 -binding sequence was cloned downstream of the luciferase reporter gene in pGL3-luc vector; (B) Relative luciferase activity was analyzed after wild-type or mutant 3’UTR reporter plasmids were co -transfected with miR-224 mimic or inhibitor in 7901 cells. [score:3]
For ectopic expression of miR-223, miR-223 mimic or miR-NC vectors were purchased from GenePharm. [score:3]
Correlation between miR-223 expression and clinicopathological features of GC patients. [score:3]
Besides, miR-223 and FBXW7 could affect the G1/S transition of cell cycle by altering some certain cell cycle regulators. [score:2]
Compared with iNC transfected cells, the percent of 7901/DDP or BGC-823/DDP cells in G0/G1 phase after miR-223 inhibitor transfected increased, while cells in S phase was decreased with different doses of DDP (Figure  2D). [score:2]
As shown in Figure  2B and Additional file 2: Figure S1C, the capacity of colony formation in miR-223 inhibitor transfected 7901/DDP and BGC-823/DDP cells was significantly decreased compared with iNC transfected cells (p < 0.05). [score:2]
Mutation was generated on the FBXW7 3’UTR sequence in the complementary site for the seed region of miR-223. [score:2]
Eto K, Iwatsuki M, Watanabe M, Ishimoto T, Ida S, Imamura Y, et al. : The sensitivity of gastric cancer to trastuzumab is regulated by the miR-223/FBXW7 pathway. [score:2]
For reporter assays, SGC-7901 cells were cultured in 24-well plates and each transfected with 100 ng of pGL3-luc-FBXW7/3’UTR-wt or pGL3-luc-FBXW7/3’UTR-mut and miR-223 mimics or inhibitor using Lipofectamine 2000 (Invitrogen, USA). [score:2]
MiR-223 mimic or inhibitor or siRNA-FBXW7 and their negative controls were obtained from GenePharma (Shanghai, China). [score:2]
In this study, we chose miR-223 by qRT-PCR analysis, the most significantly up-regulated miRNA in GC, to investigate its formation of DDP-resistant phenotype of GC cells and possible molecular mechanisms. [score:2]
We transient transfected miR-223 mimic or NC into 7901 or BGC-823 cells. [score:1]
We further divided the patients into H. pylori infected and non-infected groups and found that miR-223 was significantly higher in H. pylori infected tumor and control adjacent tissues (Additional file 2: Figure S1B). [score:1]
When exposed to DDP treatment (0 or 2 ug/ml), the capacity of colony formation in 7901/miR-223 or BGC-823/miR-223 cell was increased (p < 0.05) (Figure  3B and Additional file 2: Figure S1D). [score:1]
We further investigated the role of miR-223 over -expression on sensitive cells. [score:1]
U6 was used as an internal control; (B) 7901/miR-223 cells show less DDP sensitivity than 7901/NC cells. [score:1]
Briefly, the 3’UTR sequence of FBXW7 predicted to interact with miR-223 was amplified and cloned into the EcoRI and XhoI sites of pGL3-luc vector (Promega, Madison, WI, USA). [score:1]
The apoptosis of 7901/miR-223 or BGC-823/miR-223 cells was significantly decreased (Figure  3E). [score:1]
Finally, FBXW7 was negatively correlated with miR-223 in GC tissues. [score:1]
Among the 10 miRNAs, miR-223 was found to be most significantly changed in 7901/DDP cells (P < 0.01) (Figure  1C). [score:1]
miR-223 FBXW7 Cisplatin resistance Gastric cancer Gastric cancer (GC) is the second leading cause of cancer-related deaths worldwide [1]. [score:1]
Indicated 7901/miR-223 or 7901/NC cells were plated in triplicate and exposed to DDP (0 and 2.0 ug/ml). [score:1]
These experimental data, taken together, support an important role of altered miR-223 during tumor progression and metastasis. [score:1]
Specially, miR-223 was reported to be involved in trastuzumab induced resistance of GC [13]; however, it is still unclear whether miR-223 play a role in DDP induced resistance. [score:1]
Also, miR-223 could significantly increase DDP -induced apoptosis of resistant cells (Figure  2E). [score:1]
According to the functions of these genes and the effect of miR-223 on GC cells, FBXW7 was chosen as the interesting gene in further study. [score:1]
Our results indicated that miR-223 and FBXW7 might affect the G1/S transition of cell cycle. [score:1]
Meanwhile, parental GC cell line transfecting with miR-223 mimic was established for gain-of-function studies. [score:1]
[1 to 20 of 103 sentences]
3
[+] score: 371
Given our observation of significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in cells treated with 3.5 mM Pi, we used RT-qPCR to determine the expression levels of representative VSMC phenotypic marker genes - most of which are targeted by these miRNAs [8], [10]. [score:11]
Elevated Pi significantly downregulates expression of miR-143 and miR-145 and upregulates miR-223. [score:9]
miR-223 upregulation modulates the expression of target proteins mef2c and Rhob. [score:8]
To complement these in vitro findings, we also observed significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in aorta samples collected from ApoE knock-out mice, which display vascular calcification. [score:8]
We also found that NFIA, an experimentally validated miR-223 specific target known to be expressed in VSMCs [33] was significantly downregulated at both messenger and protein levels in the presence of high Pi concentrations. [score:8]
On the other hand, we show in our study that miR-223 upregulation affects the expression of two other recently described miR-223 targets, Mef2C [19]– [20] and RhoB [21]. [score:8]
To upregulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR-223 and anti-miR-223, respectively. [score:7]
0047807.g004 Figure 4 To upregulate and knock-down the expression of miR-223, VSMCs were transfected using pre-miR-223 and anti-miR-223, respectively. [score:7]
To up-regulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR223 and anti-miR-223, respectively. [score:7]
We also show that modulating the expression of miR-223 affects the expression of its reported targets Mef2c and RhoB in our in vitro mo del. [score:7]
Evidence from our studies suggests that Pi alters cell proliferation and migration, reduces the amount of the actin cytoskeleton, downregulates miR-143 and miR-145 and upregulates miR-223. [score:7]
0047807.g005 Figure 5To up-regulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR223 and anti-miR-223, respectively. [score:7]
0047807.g003 Figure 3 To upregulate and knock-down the expression of miR-223, VSMCs were transfected for 48 h with pre-miR-223 and anti-miR-223, respectively. [score:7]
There was significant downregulation of miR-143 and miR-145 and concomitant upregulation of miR-223 in 20-week-old ApoE- KO mice. [score:7]
To upregulate and knock-down the expression of miR-223, VSMCs were transfected using pre-miR-223 and anti-miR-223, respectively. [score:7]
Interestingly, miR-223 upregulation induced a significant downregulation of SMαA mRNA and a mild increase in Serum Response Factor (SRF) mRNA but did not significantly affect other marker genes. [score:7]
miR-143 and miR-145 are downregulated and miR-223 is upregulated in ApoE- KO mice. [score:7]
Our in vivo results in a well-established murine mo del thus reflected our in vitro findings, i. e. downregulation of miR-143 and miR-145 and upregulation of miR-223 in the presence of calcium-Pi deposits. [score:7]
Additionally, we found that the expression of two of the known miR-223 targets, Mef2c and RhoB, was highly reduced in Pi treated as well as miR-223 over -expressing VSMCs. [score:7]
Effect of miR-223 up- and downregulation on VSMC proliferation, cytoskeleton size and marker gene expression. [score:6]
Two independent studies have validated that miR-223 directly targets and inhibits Mef2c mRNA [19]– [20]. [score:6]
Accelerated migration, a less structured and decreased actin cytoskeleton in the presence of high Pi, and a modulation of target genes Mef2c and RhoB could be linked (at least in part) to upregulation of miR-223. [score:6]
A key finding of our study was that miR-223 (which is conventionally associated with carcinogenesis [25]– [26]but is also a newly described marker of skeletal and cardiac muscle damage [11]– [12] is expressed in VSMCs and is strongly upregulated in calcifying VSMCs and in calcified aortas from ApoE- KO mice. [score:6]
Interestingly, we also found that miR-223 (a marker of muscle damage and a key factor in osteoclast differentiation) is expressed in VSMCs and is significantly upregulated in Pi -treated cells. [score:6]
Lastly, we detected the upregulation of miR-223 expression in vivo, in aorta collected from ApoE- KO mice (a well-established mo del of atherosclerosis and vascular calcification, displaying Ca*Pi [3]). [score:6]
Here, we found that miR-223 was expressed in smooth muscle and that its upregulation is a potential marker of VSMC damage. [score:6]
Cells were collected and processed for further analysis after 48 h. Figure S7 shows that VSMCs transfected with pre-mir-223 or anti-mir-223 significantly up-regulated or reduced the expression of miR-223, respectively. [score:6]
Furthermore, we detected downregulation of SMαA at both the mRNA and protein levels during overexpression of miR-223. [score:6]
Surprisingly, up- or downregulating miR-223 in VSMCs did not alter NFIA expression (data not shown). [score:6]
Nuclear factor IA (NFIA, an experimentally validated miR-223 target [13]) appeared to be downregulated in cells treated with 3.5 mM Pi, as expected (given the increase in miR-223). [score:6]
Similarly, we saw significant downregulation of MYO (which is involved in cell migration and proliferation [8]– [10] when miR-223 was over-expressed. [score:6]
However, impressively, in Pi treated cells, the expression of miR-223 increased dramatically and the relative expression increased up to 700% fold. [score:5]
Additionally, we normalized the expression of miR-223 to the expression of the VSMC-specific miR-143 (Figure S3). [score:5]
Finally, we show strong reduction in the expression of two of miR-223 targets, Mef2c and RhoB, which have established roles in VSMC biology. [score:5]
In Figure S6, we show that, as previously described in Figure 3, mir-223 overexpression increases VSMC migration, mir-223 inhibition decreases VSMC migration, and high Pi treatment (3.5 mM) increases VSMC migration. [score:5]
Figure S2 miR-223 is expressed in VSMCs, and its expression is increased by high Pi. [score:5]
Moreover, quantitative real-time PCR evidenced strong (4-fold) upregulation of miR-223 in Pi -treated cells (Figure 1E); this finding was confirmed by in situ Hybridization (ISH) (Figure S2). [score:4]
Like with Mef2c, miR-223 upregulation significantly decreased the amount of mRNA (of approximately 90%, Figure 5A) with a concomitant decrease of the RhoB protein (of approximately 40%, Figure 5B and C). [score:4]
Accordingly, in our mo del, miR-223 upregulation induced a strong and significant decrease of Mef2c mRNA (of approximately 80%, Figure 5A) and a concomitant decrease of the protein product, as evidenced by immunofluorescence protein staining (of approximately 35%, Figure 5B and C). [score:4]
On the other hand, miR-223 knock-down had no effect on the expression of these markers. [score:4]
Despite consulting several databases, we did not find any binding sites for miR-223 on SMαA, MYO or SRF mRNAs; this argues in favour of an indirect effect of miR-223 on expression of these species. [score:4]
Effect of miR-223 up- and down regulation and Pi on miR-223 specific targets Mef2c and RhoB. [score:4]
Up-regulation of miR-223 further enhances VSMC migration and reduces the amount of actin cytoskeleton. [score:4]
We found that upregulating miR-223 in VSMCs induces a significant increase in cell proliferation and migration and reduces the amount of the actin cytoskeleton. [score:4]
We also looked at the effect of miR-223 regulation on another recently described miR-223 target, RhoB [21]. [score:4]
One of our study's most important findings was the upregulation of miR-223 in VSMCs treated with high levels of Pi and in ApoE- KO mice displaying vascular calcification. [score:4]
Over -expressing miR-223 in VSMCs increased proliferation and markedly enhanced VSMC migration. [score:3]
RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
Our results suggest that (i) high levels of Pi increase VSMC migration and calcification, (ii) altered expression levels of miR-223 could play a part in this process and (iii) miR-223 is a potential new biomarker of VSMC damage. [score:3]
Figure S3 Expression of miR-223 relative to miR-143 in control or Pi treated VSMCs. [score:3]
In contrast, significantly greater expression of miR-223 (1.6-fold) was observed in older, 20-week-old ApoE- KO mice (which displayed vascular calcification), relative to WT mice (Figure 5B). [score:3]
This strongly argues against a direct regulation of NFIA mRNA by miR-223 in our mo del. [score:3]
We also determined the effect of Pi on expression levels of the osteogenesis marker miR-223 [13], which is also a newly described marker of muscle damage [11], [12]. [score:3]
We attempted to determine miR-223′s role in VSMC biology and showed that overexpressing this species increased VSMC proliferation. [score:3]
Figure S7 Effect of pre-miR-223 and anti-miR-223 on expression of miR-143 and miR-223 in VSMCs. [score:3]
Interestingly, high Pi attenuates the effect of miR-223 inhibition on migration, and the levels of the combination of both treatments are comparable to control levels, ie high Pi neutralizes the effect of anti-miR-223. [score:3]
In the present study, we used two independent techniques to show that miR-223 over -expression had a significant impact on VSMC migration. [score:3]
This was further confirmed by immunofluorescence protein staining, which clearly showed a very low level of SMαA and MYO and a high level of SRF when miR-223 was over-expressed in VSMCs (Figure 4D-E). [score:3]
Vascular smooth muscle cells transfected with pre-miR (over -expression) and anti-miR (knock-down) specific for miR-143 and miR-223 were compared with a scrambled RNA control (Figure 3A). [score:3]
0047807.g006 Figure 6 RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
To the best of our knowledge, this is the first report of expression of miR-223 in VSMCs (Figure 1E and Figure S2). [score:3]
This indicates that anti-miR-223 and high Pi neutralize each other's effect on both VSMC migration and SMαA expression (data not shown). [score:3]
Over -expression of miR-223 enhances VSMC migration. [score:3]
Figure S6 Effect of a combination of over -expression of miR-223 and high Pi on VSMC migration. [score:3]
Expression of miR-143, miR-145 and miR-223 in wild-type and ApoE- KO mice. [score:3]
Again, this agrees with studies correlating miR-223 over -expression with increased tumour cell migration [20], [26]. [score:3]
The relative expression of miR-223 compared to miR-143 at basal level, i. e. in control cells is approximately 1000 times lower than the VSMC specific miR-143. [score:2]
We next looked at the effect of miR-223 regulation on several VSMC marker genes (Figure 4C). [score:2]
We next investigated the effect of miR-223 regulation on reported targets Mef2c and RhoB. [score:2]
Relative to control experiments, over -expression of miR-223 significantly increased the metabolic activity of VSMCs (by 17%, according to the WST-1 assay). [score:2]
However, miR-223 knock-down had no effect (Figure 4A). [score:2]
We found similar results (a 25% increase) for miR-223 upregulation in the BrdU assay, which measures DNA synthesis and thus VSMC proliferation. [score:1]
Pre-miR-223 induced a highly significant 64% increase in cell migration. [score:1]
Cells were transfected for 48 h with pre-miR-223/anti-miR-223 or treated with Pi for 10 days. [score:1]
To the best of our knowledge, ours is the first report of an effect of miR-223 on migration in normal (i. e. non-tumor) cells. [score:1]
Accordingly, anti-miR-223 treatment was associated with significantly (28%) lower migration (Figure 3A). [score:1]
Our results suggest that miR-143, miR-145 and miR-223 are potential biomarkers of vascular calcification. [score:1]
We thus evidenced a significant impact of miR-223 on VSMC migration. [score:1]
Lastly, we sought to study the fate of miR-143, miR-145 and miR-223 under in vivo vascular calcification conditions. [score:1]
The resulting increase in miR-223 could be a compensatory mechanism for alleviating (at least in part) the cellular damage. [score:1]
miR-223 was first described as a myeloid-specific miRNA [12] and as a biological marker for several tumoral processes [25]– [26]. [score:1]
miR-223 increases VSMC migration and proliferation and decreases the amount of actin cytoskeleton. [score:1]
This independent and complementary technique yielded similar results after 5 h of migration: pre-miR-223 was associated with significantly greater (75%) cell migration, vs. [score:1]
First, VSMCs were seeded in 6-well culture plates (Corning) and transfected with irrelevant scramble, anti-miR-223/143 or pre-miR-223/143 ((Applied Biosystems). [score:1]
Indeed, increased levels of miR-223 have been reported in damaged skeletal muscle (in Duchenne muscular dystrophy [11]) and in cardiomyocytes [12]). [score:1]
Furthermore, anti-miR-223 treatment was associated with a VSMC migration rate that was 33% lower than for controls (Figure 3B). [score:1]
We also highlighted (for the first time) a potential role for miR-223 in these conditions. [score:1]
As in the Mef2c experiments, anti-miR-223 treatment had no detectable effect. [score:1]
This is suggestive of the role of miR-223 in VSMC calcification. [score:1]
– an observation that fits well with miR-223′s known involvement in many tumoral processes [25]– [26]. [score:1]
Furthermore, miR-223 has been linked to osteogenesis and calcium-phosphate deposits(Ca*Pi) [13]. [score:1]
Our results thus suggest that miR-223 has a role in the VSMCs' complex response to Pi. [score:1]
[1 to 20 of 92 sentences]
4
[+] score: 351
We selected Il17rd as a candidate target gene of miR-223-3p by analysis of post-transcriptional miRNA-mRNA interaction networks using miRNA prediction algorithms and demonstrated that miRNA-223-3p downregulated Il17rd mRNA expression and IL-17RD protein levels and upregulated Il6 mRNA expression in both mouse and human synovial cells. [score:13]
We additionally report that miR-223-3p targets molecules involved in IL-17RD expression, thereby downregulating IL-17RD levels and that miR-223-3p upregulates IL-6 induction in the IL-17RD expressed synovial cells. [score:13]
The transfection of plasmid vectors overexpressing miR-223-3p into NIH3T3 and MH7A cells resulted in the downregulation of Il17rd expression and upregulation of Il6 expression. [score:13]
This study is the first to demonstrate that miR-223-3p downregulates IL-17RD in both mouse and human cells; miR-223-3p may contribute to the pathogenesis of RA by downregulating the expression of IL-17RD and upregulating that of IL-6 in synovial cells. [score:12]
We also observed miR-223-3p downregulated IL-17RD but upregulated Il6 expression in human MH7A cell, and that TNF-α stimulation increased miR-223-3p and Il6 mRNA levels but decreased Il17rd mRNA expression in MH7A cells. [score:11]
In order to predict the target genes of upregulated miR-223-3p in SKG mice treated with ß-glucan, we used five different miRNA target prediction algorithms (miRWalk, DIANA-microT, PITA, RNAhybrid, Targetscan) and cross-evaluated the output from these algorithms to identify target mRNAs with greater accuracy. [score:10]
Expression of miR-223-3p and Il6 mRNA in MH7A cells was upregulated; however, that of Il17rd mRNA was downregulated following TNF-α stimulation. [score:9]
We observed that plasma levels of miR-223-3p are elevated in RA mo del of SKG mice, and that miR-223-3p downregulated IL-17RD but upregulated Il6 expression in mouse NIH3T3 cells. [score:9]
In contrast, transfection with miR-223-3p -expressing clone#7 upregulated Il6 mRNA expression in these cells (Fig 5G). [score:8]
We performed inhibition assay using chemically modified single stranded RNA molecules designated to specifically bind to and inhibit endogenous miRNA molecules (miR-223-3p inhibitor) or scrambles as anti-miRNA inhibitors negative control (Life Technologies, Madrid, Spain). [score:8]
As shown Fig 7, miR-223-3p transiently upregulated at 3h but downregulated at 6, 12, and 24h after TNF-α stimulation. [score:7]
0169702.g007 Fig 7MH7A cells were stimulated with TNF-α (100 ng/ml) and the expression levels of miR-223-3p (A), Il6 (B) and Il17rd mRNA (C) in MH7A cells were analyzed after 3, 6, 12 and 24 h. were expressed as the relative fold change in the expression levels of these RNAs in the untreated control. [score:7]
Transfection with miR-223-3p -expressing clone#7 resulted in increased miR-223-3p mRNA expression (Fig 5C) but decreased Il17rd mRNA expression (Fig 5D) in MH7A cells. [score:7]
miR-223-3p was shown to be overexpressed in synovial tissue of patients with RA [19], and silencing of miR-223-3p expression was found to reduce disease severity in experimental arthritis [48]. [score:7]
In order to confirm the functional role of miR-223-3p in post-transcriptional miRNA-mRNA interaction in human synovial cells, we transfected IL-17RD -expressing human synovial cells (MH7A) with miR-223-3p plasmids, and showed that transfection with these plasmids resulted in decreased Il17rd expression and increased Il6 mRNA expression in MH7A cells. [score:7]
To determine the functional role of miR-223-3p in the expression of Il17rd, we transduced miR-223-3p overexpression vector into NIH3T3 cells that constitutively expressed IL17RD (Fig 1A). [score:7]
MH7A cells were stimulated with TNF-α (100 ng/ml) and the expression levels of miR-223-3p (A), Il6 (B) and Il17rd mRNA (C) in MH7A cells were analyzed after 3, 6, 12 and 24 h. were expressed as the relative fold change in the expression levels of these RNAs in the untreated control. [score:7]
High expression level of miR-223-3p is seen in myeloid cells and upregulation of miR-223-3p is an important element of myeloid cell differentiation [16– 18]. [score:6]
miR-223-3p may contribute the pathogenesis of RA, representing a novel target for the development of therapies against this disease. [score:6]
These results indicate that miR-223-3p interacts with Il17rd mRNA, downregulating Il-17RD protein expression in NIH3T3 cells. [score:6]
In order to determine whether miR-223-3p mediates IL-17RD expression in humans via direct interaction with its 3’UTR, we used bioinformatics software TargetScan to predict the potential binding sequences in the 3’UTR of hIl17rd. [score:6]
MiR-223-3p downregulates IL-17rd expression. [score:5]
The activity of miR-223-3p was analyzed by transfection of plasmid vectors overexpressing miR-223-3p into IL-17RD -expressing NIH3T3 and MH7A cell lines. [score:5]
Il17rd was identified as the candidate target gene of miR-223-3p using five miRNA target prediction algorithms. [score:5]
Next, we examined the effect of miR-223-3p inhibitor on Il17rd mRNA expression in MH7A clone#7. [score:5]
We observed an increase in Il6 mRNA expression, but a decrease in that of Il17rd, following transfection of mouse NIH3T3 cell line with the miR-223-3p expression vector. [score:5]
List of target gene for miR-223-3p from five miRNA target prediction algorithms. [score:5]
As shown in Fig 5H, Il17rd mRNA expression was increased by the treatment of miR223-3p inhibitor (Fig 5H). [score:5]
analysis of the plasma showed upregulation of miR-223-3p and miR-709 in the plasma of SKG mice treated with ß-glucan relative to untreated SKG mice. [score:4]
The top five upregulated miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p) were selected for subsequent analysis, which was performed via quantitative real-time PCR analysis of the plasma from individual mice in each group. [score:4]
Upregulation of miR-223-3p, but not of miR-709, was statistically significant. [score:4]
MH7A cells were stimulated with various concentrations of TNF-α and the expression levels of miR-223-3p (A, D) Il17rd (B, E), and Il6 mRNA (C, F) were analyzed after 3 h (A, B, C) and 24 h (D, E, F). [score:3]
We additionally observed that TNF-α stimulation increased miR-223-3p and Il6 mRNA levels but decreased Il17rd mRNA expression in MH7A cells. [score:3]
The expression of miR-223-3p was significantly augmented at 3 h, but not at 24 h, after TNF-α stimulation (Fig 6A and 6D). [score:3]
To confirm the relationship between miR-223-3p and IL17-RD expression in the synovial cells, we transfected miR-223-3p into the human synovial cell line MH7A (Fig 1B). [score:3]
Among the 5 clones selected using puromycin, high expression levels of miR-223-3p miRNA were detected in several clones, such as #1, #2, and #7, using real-time PCR (Fig 1B). [score:3]
The next day, 20 ng of reporter plasmid, pmG/ mIl17rd or pmG/ hIl17rd (both pmG/ hIl17rd wild type or deleted for the miR-223-3p seed site), was co -transfected with 80 ng of either miR-223-3p overexpression vector (pBA/miR-223-3p) or negative control vector (pBA/NC). [score:3]
miR-223-3p is overexpressed in the synovium and peripheral T cells of patients with RA [12, 19– 21]. [score:3]
Among the 23 clones selected using neomycin, high levels of expression of miR-223-3p miRNA were detected in several clones, such as #1, #3, #6, #13, and #15, using real-time PCR (Fig 1A). [score:3]
Next, we examined the effect of miR223-3p on IL-17RD expression at the protein level. [score:3]
Reporter plasmid and mouse pmG/mIl17rd were transfected into HeLa cells with either miR-223-3p overexpression vector (pBA/miR-223-3p) or negative control vector (pBA/NC). [score:3]
By contrast, the inhibitory effect of miR-223-3p on luciferase activity was partially restored by the deletions of binding sequences in the 3’UTR of hIl17rd (Fig 5B). [score:3]
Although the correlations between IL17RD and IL-6 expression are still not known, our observations support these previous findings, confirming that miR-223-3p contributes to functional interplay between IL-17RD, inflammatory cytokines, and TLR families. [score:3]
As shown in Fig 4A, transfection with pBA/miR-223-3p significantly inhibited luciferase activity relative to transfection with pBA/NC (Fig 4A). [score:3]
Effects of miR-223-3p overexpression on the human cells. [score:3]
IL-17rd is a target gene of miR-223-3p. [score:3]
Effect of TNF-α on the expression of miR-223-3p, Il17rd, and Il6 mRNA in MH7A cells. [score:3]
The bioinformatics approach identified 1,115 mRNAs as commonly predicted target genes from miR-223-3p by all the algorisms (S2 Table). [score:3]
Kinetics of the expression of Il17rd, and Il6 mRNA and miR-223-3p after TNF-α stimulation. [score:3]
Expression of miR-223-3p in stable transfected cells. [score:3]
miRNA-223-3p was also reported to be a biomarker of disease activity in RA [49]. [score:3]
TNF-α induces miR-223-3p and IL-6 expression in the human synovial cell line. [score:3]
In order to examine the effect of different diose of TNF-α on miR-223-3p expression in synovial cells, we stimulated MH7A cells with TNF-α. [score:3]
This result indicates that Il17rd is a target gene of miR-223-3p. [score:3]
This study aimed to analyze the functional role of miR-223-3p in the pathogenesis of RA by overexpressing miR-223-3p in synovial cell lines. [score:3]
In order to construct the miR-223-3p overexpression vector (pBA/miR-223-3p), the following oligonucleotides were annealed and inserted into the BamHI/HindIII site of pBAsi-hU6 Neo or Puro vector (TaKaRa Bio): 5’- GATCCGTGTCAGTTTGTCAAATACCCCAGTGTGCTGTCCTGGGGTATTTGACAAACTGACACTTTTTTA-3’ and 5’- AGCTTAAAAAAGTGTCAGTTTGTCAAATACCCCAGGACAGCACACTGGGGTATTTGACAAACTGACACG-3’ (the sequence of miR-223-3p is underlined). [score:3]
Effects of miR-223-3p overexpression on the mouse cells. [score:3]
Elevated plasma levels of microRNA-223-3p (miR-223-3p) in patients with RA are implicated in the pathogenesis of the disease. [score:3]
IL-17rd is a target gene of miR-223-3p in humans. [score:3]
The expression of miR-223-3p was significantly increased in NIH3T3 clone#13 transfected with pBA/miR-223-3p (Fig 4B). [score:3]
This reporter plasmid vector was transfected into HeLa cells, together with either the miR-223-3p overexpression plasmid vector (pBA/miR-223-3p) or the negative control vector (pBA/NC), to compare the effects of transfection with pBA/miR-223-3p and pBA/NC on luciferase activity. [score:3]
We next examined the effect of miR-223-3p on IL-6 expression in NIH3T3 cells. [score:3]
We next examined the kinetics of miR-223-3p, Il6, and Il17rd mRNA expression after TNF-α (100 ng/ml) stimulation. [score:3]
Either pmG/ hIl17rd WT or pmG /hIl17rd del was transfected into HeLa cells with either miR-223-3p overexpression vector (pBA/miR-223-3p) or negative control vector (pBA/NC). [score:3]
Our results indicated that expression of miR-223-3p was inversely correlated to that of IL-17RD in synovial cells. [score:3]
0169702.g006 Fig 6MH7A cells were stimulated with various concentrations of TNF-α and the expression levels of miR-223-3p (A, D) Il17rd (B, E), and Il6 mRNA (C, F) were analyzed after 3 h (A, B, C) and 24 h (D, E, F). [score:3]
MiR-223-3p augments IL-6 expression. [score:2]
Pools of 5 clones with pBA/miR-223-3p vectors or 4 pBA/NC control vectors were isolated as stable transfectants. [score:1]
0169702.g001 Fig 1 NIH3T3 cells (A) or MH7A cells (B) were transfected with pBA/miR-223-3p or pBA/NC and the resulting cells were individually picked for expansion using conventional cloning techniques. [score:1]
Five miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p), whose levels were found to be significantly elevated in the pooled plasma of ß-glucan -injected SKG mice by panel real-time PCR, were analyzed. [score:1]
As shown in Fig 5B, co-transfection with pmG/ hIl17rd WT and pBA/miR-223-3p showed a significant decrease of the luciferase activity relative to transfection with pBA/NC. [score:1]
We transfected the luciferase reporter plasmid into HeLa cells, together with either pBA/miR-223-3p or pBA/NC. [score:1]
The sequence of human miR-223-3p is the same as that of mouse miR-223-3p. [score:1]
miR-223-3p miRNA was determined using real-time PCR. [score:1]
NIH3T3 cells (A) or MH7A cells (B) were transfected with pBA/miR-223-3p or pBA/NC and the resulting cells were individually picked for expansion using conventional cloning techniques. [score:1]
However, the precise role of miR-223-3p in the pathogenesis of RA is still unknown. [score:1]
Then we designed pmirGLO luciferase reporter constructs containing either the wild-type (pmG/ hIl17rd WT) or deleted (del) miR-223-3p binding sequences in the 3’UTR of hIl17rd (pmG/ hIl17rd del) (Fig 5A). [score:1]
in humansThe sequence of human miR-223-3p is the same as that of mouse miR-223-3p. [score:1]
Our observations support previous reports demonstrating that miR-223-3p is involved in the pathogenesis of RA in humans as well as in animal mo dels [48, 49]. [score:1]
In order to perform the luciferase assay, the 3’UTR of mouse IL17rd (mIl17rd) and human IL17rd (hIl17rd) genes containing miR-223-3p target sequences were amplified from mouse or human genomic DNA by PCR, using the following primers, mIl17rd-3’UTR F: 5’-GGACTCGGAAGAGTCTAAGCA-3’, mIl17rd-3’UTR R: 5’-TTACAAGAAAACATTTTATTTGATGTAGAA-3’, hIl17rd-3’UTR F: 5’-CAAAACGAAAGAGTCTAAGCATTG-3’, and hIl17rd-3’UTR R: 5’-TTAAAACAAAACATTTTATTTAATGCAGA-3’. [score:1]
In order to confirm whether miR-223-3p interacts with Il17rd mRNA, we used luciferase reporter plasmid vector driven by pmG/mIl17rd. [score:1]
was performed using stable NIH3T3 and MH7A transfectant cells harboring pBA/miR-223-3p or pBA/NC vectors. [score:1]
0169702.g005 Fig 5(A) Schematic diagram of the luciferase reporter plasmids including IL-17RD3’UTR wild type (WT) or deleted (del) miR-223-3p binding sequences in the 3’UTR in which six nucleotide forming the seed region of miR-223-3p were deleted. [score:1]
For transfection, NIH3T3 cells were grown to 90% confluence and transfected with pBA/miR-223-3p or pBA/NC using Lipofectamine 3000. [score:1]
Pools of 23 clones with pBA/miR-223-3p vectors or 9 pBA/NC control vectors were isolated as stable transfectants. [score:1]
[1 to 20 of 85 sentences]
5
[+] score: 302
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-1-1
p27 was considerably upregulated by contact inhibition only in fibroadenoma-derived MCF10A cells (a mo del of semi-normal mammary gland epithelial cells) (Figure 6A) and this was paralleled by upregulation of miR-223. [score:9]
Conversely, in S phase WT MEFs, when miR-223 levels dropped and E2F1 expression raised (Figure 3D), miR-223 overexpression resulted in a significant downregulation of E2F1 protein (Supplementary Figure 2B, right panels). [score:8]
Among the different p27-regulated miRs during G1 arrest, we focused our studies on the regulation of miR-223 and demonstrated that sustained expression of miR-223 represents an important event in the regulation of contact inhibition, both in normal and in K-Ras transformed cells. [score:8]
We discovered an auto regulatory feedback loop between E2F1 and miR-223, in which E2F1 repressed the miR-223 promoter and miR-223 downregulated E2F1 expression. [score:7]
Altogether, these data suggested that p27 contributes to regulation of miR-223 transcription via a CDK -dependent nuclear activity, likely via E2F1 inhibition and that p27 could also regulate mature miR-223 expression with a CDK-independent cytoplasmic activity. [score:7]
Data represent the 2 [-ΔCT] values obtained by normalizing miR-223 with U6 expression (D) or pri-miR-223 expression normalized by the expression of the housekeeping gene GusB (E). [score:7]
To understand if the regulation of miR-223 by p27 played a role during transformation, we looked at miR-223 expression in p27WT and p27 KO 3T3 fibroblasts transformed with the oncogenic form of K-Ras4B (K-Ras [V12]) (Supplementary Figure 4A), since p27 expression is maintained and has a particular relevance in K-Ras [V12] transformed cells [29]. [score:6]
p27 regulates miR-223 expression following contact inhibition. [score:6]
These data implied that in primary MEFs contact inhibition directly signaled on the miR-223 promoter, in a manner at least partially independent from p27 expression. [score:6]
Cytoplasmic p27 directly binds and stabilizes miR-223, while nuclear p27, by inhibiting E2F1 expression and activity, induces miR-223 transcription. [score:6]
In contrast, in tumor-derived cells, miR-223 expression was not modified by contact inhibition (Figure 6B), suggesting that p27 could affect miR-223 regulation in mammary epithelial cells and that it could contribute to loss of miR-223 in breast cancer. [score:6]
Western blot and qRT-PCR analyses proved that in HC WT MEFs miR-223 knock-down resulted in upregulation of E2F1 (2.9 folds) (Supplementary Figure 2B, left and middle panels). [score:5]
In WT cells, miR-223 knock-down partially rescued the G1 arrest imposed by contact inhibition (Figure 4A) and miR-223 overexpression delayed of about 3 hours the S phase entrance of serum starved MEF following serum stimulation, as demonstrated by BrdU incorporation assay (Figure 4B) and FACS analyses of cell cycle distribution (Figure 4C). [score:5]
Only when contact inhibition and serum deprivation were used together a modest increase in miR-223 expression was appreciated, although it did not reach statistical significance (Figure 1B and Supplementary Table 5). [score:5]
Contact inhibition stimulates miR-223 promoter activity by decreasing E2F1 expression. [score:5]
p27 is a critical mediator of miR-223 expression after contact inhibition. [score:5]
α-amanitin completely blocked pri-miR-223 expression both in WT and p27 KO MEFs (Figure 2C), but only in p27 KO MEFs mature miR-223 levels dropped after treatment (Figure 2D), suggesting that the expression of p27 was necessary for the stability of mature miR-223. [score:5]
All exogenously expressed p27 proteins were able to significantly increase the levels of endogenous miR-223 in p27 KO cells (Figure 4D), demonstrating that the extent of miR-223 increase was not influenced by the loss of nuclear localization or by the loss of cyclin/CDK binding ability and suggesting that p27 stabilized miR-223 expression via a cytoplasmic and CDK-independent activity. [score:5]
G1 arrest, induced either by serum deprivation or by contact inhibition, elicited a marked increase of miR-223 levels in WT MEFs (Figure 1B), although only contact inhibition caused statistically significant differences (Figure 1B and Supplementary Table 5). [score:5]
In summary, we show that contact inhibition induces the nuclear and cytoplasmic accumulation of p27, both impinging on miR-223 expression. [score:5]
The overexpression of miR-223 in p27 KO growing cells (Supplementary Figure 4C) strongly reduced the S phase population in p27 KO K-Ras [V12] cells exponentially growing (from 25% to 16%), therefore mimicking the achievement of contact inhibition (Supplementary Figure 4D), while it had only minor effects on cells after achievement of confluence (Supplementary Figure 4D). [score:5]
Our data convincingly establish that p27 regulates miR-223 expression in two ways. [score:4]
Our results indicated that E2F1 expression was regulated by cell-cell contact in WT cells and its levels inversely correlated with those of miR-223 (Figure 3D). [score:4]
A miR-223/E2F1 regulation loop controls cell cycle exit after contact inhibition. [score:4]
The second way by which p27 regulates miR-223 is related to the ability to inhibit pRB phosphorylation by CDKs, thus eventually blocking E2F1 activity. [score:4]
To dissect the mechanism whereby p27 regulated miR-223 expression following contact inhibition we blocked RNA transcription with Actinomycin D (Act-D) and measured the levels of miR-223. [score:4]
p27 contributes to the regulation of miR-223 expression in G1 arrested cells. [score:4]
Contact inhibition regulates miR-223 transcription. [score:4]
To get more insights in the regulation of miR-223 stability by p27, we overexpressed p27 wild type (p27 [WT]) or p27 [CK-] and p27 [KR] mutants in p27 KO 3T3 fibroblasts (Supplementary Figure 3A and B). [score:4]
These data suggested that in the context of cell transformation the regulation of miR-223 expression by p27 played a functional role. [score:4]
Data are expressed as fold increase of pri-miR-223/miR-223 levels respect to the T0 (HC harvested cells). [score:3]
Data represent the 2 [-ΔCT] values obtained by normalizing miR-223 with snoRNA234 expression. [score:3]
miR-223 high levels then target E2F1 mRNA, thereby promoting cell cycle arrest. [score:3]
Interestingly, phosphorylation on T157, but not on T198, significantly correlated with miR-223 expression in TNBC (Figure 6D). [score:3]
Figure 2(A) miR-223 expression in 3 independent WT or p27 KO MEF preparations cultured in HC condition and then treated with EGTA for 1 hour. [score:3]
Future investigation will address if and how post-translational modifications of p27 following contact inhibition can modulate its ability to bind and stabilize miR-223. [score:3]
Conversely, by splitting cells from HC culture into low or high confluence conditions (Figure 1D) or by treating HC cells with EGTA to disrupt the cell-cell contacts (Figure 2A), we observed that cell-cell contact was necessary in WT, but not in p27 KO, MEFs to sustain the expression of miR-223. [score:3]
D/E, miR-223 (D) and pri-miR-223 (E) expression in p27 KO 3T3 fibroblasts transduced with retroviruses encoding for p27 [WT], p27 [CK-] and p27 [KR], as indicated. [score:3]
On the right, expression of miR-223 (upper panel) and p27 protein (lower panel) is reported. [score:3]
However, overexpression of miR-223 had only a partial effect on p27 KO MEFs cell cycle entry (Supplementary Figure 2C), suggesting that other mechanisms were also implicated or that compensatory mechanisms existed in p27 null cells. [score:3]
Figure 3(A) miR-223 expression in WT and p27 KO MEFs transduced with lentiviruses encoding for pre-miR-223 under the control of a CMV promoter, cultured in HC condition and then treated with EGTA for 1 hour. [score:3]
miR-223 levels paralleled the expression of p27 protein, as demonstrated by immunofluorescence (Supplementary Figure 1) or western blot analyses (Figure 3D). [score:3]
Expression of miR-223, miR-1, control miR and p27 protein after 0, 90 and 120 minutes of incubation with lysate from p27 KO cells is reported. [score:3]
The above data suggested that cell-cell contact triggered miR-223 transcription, which was eventually stabilized by p27 expression. [score:3]
Data represent the 2 [-ΔCT] values obtained by normalizing miR-223 with U6 expression. [score:3]
By exposing WT MEFs to conditioned medium harvested from WT MEFs under EG or highly confluent (HC) conditions, we excluded that secreted/diffusible factors produced in HC could induce miR-223 expression (Figure 1C). [score:3]
Our results indicated that only cells expressing the p27 [WT] protein displayed higher levels of pri-miR-223 (Figure 4E). [score:3]
No significant difference in cell cycle distribution was observed in WT cells when miR-223 was overexpressed (not shown). [score:3]
The observation that only p27 [WT] but not the p27 [CK-] mutant is able to stimulate the activity of miR-223 promoter and increase the levels of pri-miR-223 (Figure 4) strongly suggests that p27 participates in the control of miR-223 transcription via the inhibition of E2F1 activity through the CDK/RB pathway. [score:3]
Accordingly, when pre-miR-223 was ectopically expressed under the control of an exogenous CMV promoter and cell-cell contacts were disrupted by EGTA treatment, levels of miR-223 remained stable in WT but not in p27 KO MEFs (Figure 3A). [score:3]
Data are expressed as fold increase of miR-223 levels respect to the T0 (HC harvested cells). [score:3]
In the graph, qRT-PCR validation of miR-223 expression in the same MEF population used for the array is reported. [score:3]
The combined use of serum deprivation and contact inhibition further increased the levels of miR-223 in WT cells (Figure 1B and Supplementary Table 5). [score:3]
Data are expressed as fold increase of miR-223 respect to the T0 (HC harvested cells). [score:3]
More intriguingly, two frame shifts mutations (K134fs and P137fs) found in luminal A breast cancer [28, 31] completely disrupt the 2 [nd] RNA-BM reinforcing the potential significance of the regulation of miR-223 stability by p27 in breast cancer onset and/or progression. [score:3]
In the lower graph, miR-223 expression levels in the same culture conditions are reported. [score:3]
Data are expressed as fold increase of miR-223 levels in HC respect to EG. [score:3]
It has been proved that the transcription factor E2F1 binds and represses miR-223 promoter in human acute myeloid leukemia (AML) [18] and that miR-223 promoter regulation is conserved among human and mouse [19, 20]. [score:2]
p27-miR-223 axis is deregulated in breast cancer. [score:2]
Next, we investigated in more detail the regulation of miR-223 by p27 in G1 arrested cells following contact inhibition. [score:2]
T198 phosphorylation has been linked to p27 degradation [24] while T157 phosphorylation has been linked to p27 displacement in the cytoplasm [33], suggesting that the latter could participate in the regulation of miR-223 binding. [score:2]
Given the established role of E2F1 in cell cycle progression [21], we tested whether cell-cell contact regulated miR-223 promoter activity via E2F1. [score:2]
These data prompted us to directly test whether p27 affected miR-223 stability. [score:2]
Bioinformatic analyses highlighted the presence of a conserved site for miR-223 binding in the mouse E2F1 3'UTR (not shown), as previously demonstrated in human AML [18], supporting the possibility that also in mice a feedback regulation loop may exist. [score:2]
Three miRs, mmu-miR-223, mmu-miR-712 and mmu-miR-719, were regulated by both G1 arrest and the presence of p27 (Figure 1A and Supplementary Table 4). [score:2]
Regulation of miR-223 by p27 in breast cancer. [score:2]
The first is the direct binding of p27 to mature miR-223 that protected miR-223 from degradation. [score:2]
Interestingly, p27WT K-Ras [V12] displayed 3- to 4-folds higher levels of miR-223 compared to p27 KO K-Ras [V12] cells (Supplementary Figure 4B) and a drop of S phase cells from 12% to 7%, following contact inhibition (Supplementary Figure 4D). [score:2]
p27 is a RNA binding protein and directly stabilizes miR-223. [score:2]
Cytoplasmic p27 directly binds mature miR-223 increasing its stability (Figure 7). [score:2]
Next, we tested the levels of pri-miR-223 in the same cells to verify if p27 could act as a transcriptional regulator, independently on its cyclin/CDK binding, as recently suggested [27]. [score:2]
Our data are in accord with the phenotypes of p27 [22] and miR-223 [35] knock-out animals, both presenting features of hyper proliferation. [score:2]
Still, it is possible that p27 contributes to the regulation of miR-223 transcription also via E2F1 unrelated mechanisms, as recently demonstrated for other protein coding genes [27]. [score:2]
Data collected so far could not fully explain the differences observed in the stability of the mature miR-223 between WT and p27 KO cells. [score:1]
These data suggested that miR-223 could primarily bind the region between aa 90 and 103 that it is highly conserved among species, and that the region between aa 134 and 142 could participate in the binding (Supplementary Figure 3F). [score:1]
In contrast, deletion of E2F1 sites mildly increased miR-223 promoter activity in p27 KO cells both in EG and HC, although differences did not reach statistical significance (Figure 3C). [score:1]
miR-223 stability is affected by transcriptional and post-transcriptional mechanisms. [score:1]
When the two RNA -binding site where concomitantly destroyed (p27 [dMUT] mutant) (Figure 5E and Supplementary Figure 3F) we observed no binding between p27 and miR-223. [score:1]
Our results showed that p27 ability to bind miR-223 paralleled the levels of T157 phosphorylation, with the p27 [T157D] mutant displaying the greatest ability (Figure 6E and F), thus providing an explanation for the positive correlation observed in breast cancers (Figure 6D). [score:1]
When p27 KO MEFs were analyzed under the same culture conditions no significant fluctuation in miR-223 levels was observed. [score:1]
This assay demonstrated that recombinant p27 protein was able to significantly lengthen the half-life of miR-223, but not of control-miR or of the un-related miR-1 (Figure 5A and B), suggesting that p27 directly bound and protected from degradation miR-223. [score:1]
Then, a RIP performed on endogenous p27 immunoprecipitated from HC or EG WT and p27 KO MEFs proved the physiological significance of this interaction showing that miR-223 was readily recovered only in WT HC cells (Figure 5F). [score:1]
Thus, we evaluated the expression of p27 and miR-223 in a panel of breast cancer derived cell lines, grown in EG or HC. [score:1]
miR-223 reduces cell proliferation in K-RasV12 transformed cells. [score:1]
In HC WT MEFs miR-223 remained stable over time, even in the presence of Act-D, while its levels significantly decreased in p27 KO cells (Figure 2B). [score:1]
Accordingly, when p27 [WT] or p27 [CK-] were transfected with the miR-223 promoter in 293-T17 cells we observed that only the WT protein was able to significantly increase its transcriptional activity (Figure 4F). [score:1]
It is conceivable that one of these modifications might be the phosphorylation of p27 on T157 that correlates with miR-223 levels in TNBC and significantly increases the binding of p27 to miR-223 in vitro. [score:1]
p27 binds and stabilizes mature miR-223. [score:1]
Nuclear p27 likely counteracts E2F1 activity by impairing RB phosphorylation, thereby increasing miR-223 transcription. [score:1]
miR-223 controls cell cycle exit in WT MEFs. [score:1]
Transition from G1 to S phase led to progressive decrease of miR-223 levels, similarly to what observed in EG cells (Figure 1B and Supplementary Table 5). [score:1]
In the lower graph qRT-PCR analyses, evaluating miR-223 binding to p27 [WT] or mutant proteins expressed as fold enrichment respect to miR-223 binding to EGFP transfected cells. [score:1]
The deletion of two putative E2F1 binding sites in the miR-223 promoter (E2F1Del in Figure 3C) significantly increased its activity in WT cells, only when cultured in EG condition. [score:1]
Next, we tested the possibility that also the region between aa 134 and 142 could bind miR-223. [score:1]
We identified two possible miR-223 binding motifs (RNA-BM) in human p27: the first (1 [st] RNA-BM) between aa 90-103 and the second (2 [nd] RNA-BM) between aa 134-142. [score:1]
Among them, mmu-miR-223 (hereafter miR-223) was the only one with an identified human homolog and was therefore chosen for further analyses. [score:1]
Schematic representation of the proposed mechanism, linking p27 to miR-223 in the control of cell proliferation. [score:1]
In the inset, miR-223 promoter constructs used are depicted. [score:1]
The K96Q substitution, predicted to alter the miR-223 binding motif in p27 (BindN analysis) is also associated with the presence of breast cancer in MEN patients [34]. [score:1]
miR-223 levels were generally reduced in the different types of breast cancers, with the exception of TNBC (Figure 6C and Supplementary Figure 5A). [score:1]
[1 to 20 of 100 sentences]
6
[+] score: 282
Other miRNAs from this paper: hsa-mir-21, hsa-mir-224
We found that NF-κB inhibitor could induce miR-223, while mTOR inhibitor down-regulated miR-223 (Fig.   4a). [score:8]
Moreover, the observed facts that miR-223 over -expression or down-regulation, when compared with their mock transfections, could reduce or further increase viable cell loss in celastrol -treated samples, were understandable: up- or down -regulating miR-223 could ameliorate or increase celastrol-caused NF-κB and mTOR inhibition, respectively. [score:8]
NF-κB inhibitor, like celastrol, could induce miR-223; the induction of miR-223 by NF-κB inhibitor or celastrol was reduced by the use of mTOR inhibitor. [score:7]
Up -regulating miR-223 ameliorated celastrol-caused NF-κB and mTOR inhibition (Fig.   5b), a finding consistent with the result that miR-223 overexpression reduced the loss of living cells in celastrol -treated samples (Fig.   2b). [score:6]
In this work, we found that both non-toxic and toxic doses of celastrol could induce miR-223 expression in human cancer cell lines MCF-7 and PC3, and that miR-223 down-regulation further reduced the number of living cells in these two cancer lines treated by celastrol. [score:6]
Interestingly and strangely, the above data showed that miR-223 down-regulation could activate NF-κB in cells not treated with celastrol, however, when celastrol was used, cells with knocked-down miR-223 showed lower NF-κB and mTOR activity than cells with mock transfection. [score:5]
Down -regulating miR-223 could increase the number of viable cells, yet it further reduced viable cells in samples that were treated by celastrol; up-regulation of miR-223 displayed opposite effects. [score:5]
As such, NF-κB dominance explains why overexpression of miR-223 alone reduced viable cells, even when mTOR activity and HSP70 levels were increased (because such a manipulation inhibited NF-κB activity). [score:5]
To address this issue, we inhibited or over-expressed miR-223 and observed the effects of such manipulation on celastrol’s action. [score:5]
b Effects of mTOR inhibitor on celastrol -induced miR-223 expression. [score:5]
MCF-7 or PC3 cells were treated with NF-κB inhibitor (PDTC) and/or mTOR inhibitor Ku-0063794 (abbreviated as Ku) for 1 or 6 h, then, the RNA (6 h samples) was extracted and miR-223 determined by quantitative reverse-transcription PCR. [score:5]
Over -expression of miR-223 had the opposite effect on viable cell numbers when compared to miR-223 down-regulation, either when used alone or when in combination with celastrol. [score:5]
Three: mTOR inhibitor could reduce celastrol- or NF-κB inhibitor -induced miR-223 elevation. [score:5]
a Effects of NF-κB inhibitor and/or mTOR inhibitor on miR-223. [score:5]
When the two inhibitors were used together, miR-223 elevation was inhibited (Fig.   4a). [score:5]
One: NF-κB inhibition and mTOR activation (both observable at 5 min after celastrol treatment, though mTOR was inhibited by 1 h) preceded miR-223 elevation (at 6 h). [score:5]
Down -regulating or overexpressing miR-223 increased or decreased the loss of viable cells in celastrol -treated samples, respectively. [score:4]
Since celastrol is a strong NF-κB regulator [19– 21], and NF-κB reportedly regulates miR-223 [22], we thought that regulating NF-κB might be involved in miR-223 induction. [score:4]
This provides an explanation for the finding that miR-223 down-regulation increased loss of living cells in celastrol -treated samples (Fig.   2b), rather than promoting survival, as when celastrol was not used (Fig.   2b). [score:4]
These effects are contrary, but perhaps the effects of NF-κB alteration are dominant (a hypothesis adjusted in the section), making the final outcome of miR-223 down-regulation an increase in viable cells (as presented in above Fig.   2b). [score:4]
Our work discloses that celastrol, in a NF-κB inhibition/mTOR activation-related way, induces miR-223 in MCF-7 and PC3, and that down -regulating miR-223 could further reduce living cancer cells in samples treated with celastrol. [score:4]
That miR-223 down-regulation increased viable cell can also be explained in this way, since it showed the opposite effect on NF-κB, mTOR, and HSP70. [score:4]
Since celastrol could induce miR-223 expression, and this small RNA is reported to affect the viability of cancer cells, including MCF-7 and PC3 [13– 16], we were interested in whether regulating miR-223 levels affected celastrol’s anti-cancer ability. [score:4]
We confirmed that when miR-223 was inhibited in MCF-7 and PC3 cells treated by celastrol, the numbers of living cells could be further reduced, while down -regulating miR-223 alone increased the number of living cells. [score:4]
This indicates that down -regulating miR-223 enhanced celastrol-caused NF-κB and mTOR activity inhibition (both prone to reducing survival) (Fig.   5b). [score:4]
The observed decrease in viable cells from up -regulating miR-223 (Fig.   2b) is also explainable through NF-κB dominance: this manipulation inhibits NF-κB while activating mTOR and HSF-1 and elevating HSP70 (Fig.   5b). [score:4]
As shown in Fig.   5b, down -regulating miR-223 alone could activate NF-κB (in favor of survival), yet inhibited mTOR and HSF-1 activity and decreased HSP70 level (prone to reducing survival). [score:4]
7-AAD 7-amino-actinomycin D CFSE Carboxyfluorescein diacetate succinimidyle ester DMSO Dimethyl sulfoxide FCM Flow cytometry HSF-1 Heat shock factor-1 HSP Heat shock response HRP Horseradish peroxidase mTOR Mammalian target of rapamycin miR-223 microRNA-223 NF-κB Nuclear factor-kappaB PVDF Polyvinylidenedifluoride qRT-PCR Quantitative real-time PCR This work is supported by the following grants: Shanghai Gongli Hospital Youth Project (No. [score:3]
Different binding sites used by NF-κB in different cells might cause varying effects on miR-223 expression. [score:3]
Inducing miR-223 by celastrol was related to NF-κB inhibition and mTOR activation. [score:3]
The effects of miR-223 on breast cancer are harder to explain due to inconsistent research data, with some studies showing promoting effects and others showing suppression [14, 15]. [score:3]
For the first time, we disclose that celastrol could induce miR-223 in breast and prostate cancer cells, and that inhibiting miR-223 could further reduce the living cells in celastrol -treated cancer cell lines. [score:3]
Data is presented as mean ± SD; statistics were determined between the celastrol -treated group and DMSO, * indicates P < 0.05, while ** indicates P < 0.01 We found that after 6 h treatment, celastrol could significantly induce miR-223 expression in the two cell lines. [score:3]
Indeed, celastrol is a toxic agent, and our results showed that in presence of celastrol, miR-223 overexpression promoted survival. [score:3]
mTOR inhibitor also reduced celastrol-caused miR-223 elevation (Fig.   4b). [score:3]
These findings suggest that celastrol’s miR-223 induction was related to NF-κB inhibition and transient mTOR activation (as shown in Fig.   3a). [score:3]
Down -regulating HSP70 reduced miR-223 (data not shown), indicating that celastrol -induced HSP70 elevation might play a role in maintaining miR-223 level, through in the later stage after celastrol treatment, as HSP70 elevation needed 6 h. Finally and interestingly, in addition to miR-223 being affected by NF-κB and mTOR activity and HSP70 levels, miR-223 could regulate these three molecules, providing a clue to understanding the effects of miR-223 on cellular viability. [score:3]
Two: like celastrol, NF-κB inhibitor PDTC could induce miR-223. [score:3]
After 24 h transfection with miR-223-Down antagomir or miR-223 mimics, miR-223 was inhibited or elevated, respectively (Fig.   2a). [score:3]
Celastrol’s miR-223 induction might be due to NF-κB inhibition and transient mTOR activation: these two events occurred prior to miR-223 elevation in celastrol -treated cells. [score:3]
Then, we observed the effects of altering NF-κB or mTOR activity on miR-223 expression. [score:3]
The experiments were repeated three times The above data shows that, NF-κB inhibition and transient mTOR activation, but not HSP70 elevation, occurred before miR-223 elevation and thus might be the cause of miR-223 elevation in celastrol -treated cells. [score:3]
Kumar et al. reported that in combination with Notch, NF-κB activation, rather than inhibition, elevated miR-223 [22]. [score:3]
Nevertheless, our work suggests that simultaneous inhibition of miR-223 induction could be a novel way to increase celastrol’s anti-cancer ability, at least in breast or prostate cancer. [score:3]
To evidence this notion, we found that the NF-κB inhibitor that elevated miR-223 could also increase mTOR activation (Fig.   4a). [score:3]
The results of culture -transfected cells after 60 h showed that down -regulating or overexpressing miR-223 alone could increase or decrease viable cells in MCF-7 and PC3 when compared to controls (mock transfection) (Fig.   2b, c). [score:3]
Celastrol reduced viable cells and induced miR-223 expression in MCF-7 and PC3 in time- and dose -dependent ways. [score:3]
Inhibiting miR-223 induction, in addition to blocking heat shock response [11, 12], is novel way to increase celastrol’s anti-cancer ability. [score:3]
Cells were treated with celastrol and/or mTOR inhibitor for 6 h, then the miR-223 was detected. [score:3]
Based on the following facts, we thought that celastrol -induced miR-223 might be related to NF-κB inhibition and rely on transient mTOR activation. [score:3]
Then, we investigated the possible reason for celastrol’s miR-223 induction by focusing on how altering NF-κB affects miR-223 expression, since celastrol is a known NF-κB regulator [19– 21], and NF-κB reportedly regulates miR-223 [22]. [score:3]
The experiments were repeated three times The above data shows that, NF-κB inhibition and transient mTOR activation, but not HSP70 elevation, occurred before miR-223 elevation and thus might be the cause of miR-223 elevation in celastrol -treated cells. [score:3]
Data is presented as mean ± SD; statistics were determined between the celastrol -treated group and DMSO, * indicates P < 0.05, while ** indicates P < 0.01We found that after 6 h treatment, celastrol could significantly induce miR-223 expression in the two cell lines. [score:3]
Fig. 4Effects of NF-κB and/or mTOR acidity on miR-223 expression. [score:3]
Yang et al. found that miR-223 promoted the invasion of breast cancer cells via the Mef2c-β-catenin pathway [14], while Pinatel et al. reported that overexpressing miR-223 decreased migration, increased cell death in anoikis conditions and augmented sensitivity to chemotherapy, but had no effect on adhesion and proliferation [15]. [score:3]
Importantly, miR-223 could regulate NF-κB [27], mTOR [28, 29], and members of the heat shock protein family [28]. [score:2]
If a molecular alteration is in fact the basis for miR-223’s effects on celastrol’s ability to reduce viable cells, this molecular alteration should affect cellular viability in cells treated with celastrol in addition to being regulated by miR-223 alterations. [score:2]
Third, we found that NF-κB, mTOR, or HSP70 could regulate miR-223. [score:2]
Celastrol’s induction of miR-223 helps to explain the mechanisms behind some of celastrol’s other known actions, such as celastrol’s newly identified potential in anti-obesity applications, since miR-223 is not only a major regulator of cholesterol (miR-223 can reduce cholesterol) [35], but also an insulin sensitivity enhancer [36]. [score:2]
That is to say, we looked into the possible effects of miR-223 on these molecules, since these molecules, as mentioned above, reportedly affect celastrol’s anti-tumor ability, and also because miR-223 has been confirmed as regulating these molecules [27– 29]. [score:2]
a Regulating miR-223 by transfection. [score:2]
Data are presented as mean ± SD; * indicates P < 0.05, while ** indicates P < 0.01 We also used siRNA transfection to knock down HSP70 and found that the cells with lowered HSP70 had decreased miR-223 (data not shown), suggesting that celastrol -induced HSP70 elevation might contribute to miR-223 maintenance, though this effect would occur at a later stage, such as more than 6 h after celastrol treatment. [score:2]
miR-223 could regulate HSP70 level, yet the effects were inconsistent in two cell lines as well as in situation with and not with celastrol, thus making us difficult to relate miR-223’s effects to its altering HSP70. [score:2]
Data are presented as mean ± SD; * indicates P < 0.05, while ** indicates P < 0.01 We also used siRNA transfection to knock down HSP70 and found that the cells with lowered HSP70 had decreased miR-223 (data not shown), suggesting that celastrol -induced HSP70 elevation might contribute to miR-223 maintenance, though this effect would occur at a later stage, such as more than 6 h after celastrol treatment. [score:2]
Fig. 2Effects of regulating miR-223 on viable cell numbers. [score:2]
Nevertheless, if a molecular alteration is the cause behind celastrol’s miR-223 induction, it should meet two requirements, (1) following celastrol treatment, this alteration must happen before miR-223 induction and (2) this alteration itself could regulate miR-223 in our system. [score:2]
These two molecules might also play roles in celastrol’s miR-223 regulation. [score:2]
Fig. 5Effects of on multiple molecules on cellular viability and miR-223 regulation of these molecules. [score:2]
Data in A panel are presented as mean ± SD, statistics were determined between different treatments (without celastrol) and DMSO control, or between different treatments (plus celastrol) and celastrol alone * indicates P < 0.05, while ** indicates P < 0.01 We then observed the effects of miR-223 on NF-κB, mTOR and HSP70 in cells treated or not by celastrol. [score:1]
In agreement with such findings, HSP70 elevation was observed at 6 h after celastrol addition (Fig.   3b), a time-point coinciding with miR-223 elevation (Fig.   1b). [score:1]
Finally, we tried to find the possible molecular basis by which miR-223 alterations affected cellular viability in cells treated or not treated with celastrol. [score:1]
This suggests that mTOR activation was necessary for miR-223 induction. [score:1]
Data in A panel are presented as mean ± SD, statistics were determined between different treatments (without celastrol) and DMSO control, or between different treatments (plus celastrol) and celastrol alone * indicates P < 0.05, while ** indicates P < 0.01We then observed the effects of miR-223 on NF-κB, mTOR and HSP70 in cells treated or not by celastrol. [score:1]
Finally and interestingly, miR-223 also could affect NF-κB and mTOR and the effects were different between cells treated or not treated with celastrol, thus providing an explanation for differing effects of miR-223 alteration on cellular viability in the presence of celastrol or not. [score:1]
* indicates P < 0.05, while ** and *** indicate P < 0.01 and P < 0.001, respectively We were then interested in why celastrol could induce miR-223. [score:1]
To support this notion, our bioinformatics work with ChIPBase software [39] identified multiple NF-κB binding sites up- and down-stream of the miR-223 loci in the human X chromosome. [score:1]
Therefore, the effects of altering mTOR and HSP70 on miR-223 expression were also investigated. [score:1]
This offers a possible explanation for celastrol’s miR-223 induction. [score:1]
MiR-223-Down antagomir, miR-223 mimics, or siRNA for HSP70 gene or their controls were transfected into cells by siRNA-mate (GenePharma Shanghai, China), according to the manufacturer recommendations. [score:1]
miR-223 Celastrol Anti-cancer MCF-7 PC3 NF-κB mTOR HSP70 Celastrol is a natural compound extracted from the plant triperygium wilfordii Hook F, which has been used in anti-inflammation and anti-cancer treatments in Chinese folk medicine for many years. [score:1]
b Effects of miR-223 alteration on multiple molecules. [score:1]
Celastrol-caused induction still existed at 24 h. miR-223 induction was dose -dependent in that higher dosages resulted in higher miR-223 levels (Fig.   1b). [score:1]
Here, we report that celastrol treatment can elevate miR-223 in human breast cancer cell line MCF-7 and prostate cancer PC3. [score:1]
Cells were transfected with miR-223-Down antagomir (shortened to anti-miR-223) or miR-223 mimics or corresponding mock agent (mock transfection) for 24 h, then the cells were washed to stop transfections. [score:1]
miR-223 is also reported to promote the biological behavior of prostate cancer [16], contribute to gastric cancer cell proliferation and migration [17], and function as an oncogene in human colorectal cancer cells [18]. [score:1]
Recently, we found that celastrol could induce miR-223 in human hepatoma cells (unpublished). [score:1]
This difference may be attributed to MCF-7’s higher miR-223 levels induced by celastrol. [score:1]
miR-223 affected cellular viability-related NF-κB, mTOR activity, and HSP70 level. [score:1]
Celastrol affected mTOR, NF-κB, and HSF-1 activation before inducing miR-223. [score:1]
Again, we focused on the relationship between miR-223 and NF-κB, mTOR, and HSP70, but in reverse. [score:1]
Wei et al. recently reported that miR-223 promoted prostate cancer behavior [16], yet this was different from our results. [score:1]
Therefore, we first observed whether celastrol-caused alterations in NF-κB, mTOR and HSP70 occurred, and if they preceded miR-223 elevation (which were obvious at 6 h after celastrol treatment). [score:1]
Therefore, whether or not celastrol-caused miR-223 elevation affects celastrol’s anti-cancer action, and if so, why, are questions worth addressing. [score:1]
miR-223 induction is also consistent with celastrol’s efficacy in anti-inflammation applications [37, 38]. [score:1]
Altering miR-223, however, showed inconsistent effects on celastrol -induced HSP70 elevation in the two cell lines (Fig.   5b). [score:1]
These results indicate that blocking miR-223 elevation could further reduce living cells in samples treated with celastrol. [score:1]
The final step in this work was to try to find the possible molecular basis for miR-223’s effects on cellular viability in samples treated or not treated with celastrol. [score:1]
Cells were transfected with miR-223-Down antagomir (shortened to anti-miR-223) or miR-223 mimics or corresponding mock agent (mock transfection) for 24 h, then the miR-223 levels were determined by PCR to confirm if transfection was successful. [score:1]
Fig. 1Effects of celastrol on number of living cells and miR-223 in two cell lines. [score:1]
Another finding is that miR-223 affected celastrol’s ability to reduce numbers of viable cancer cells. [score:1]
b Inducing miR-223 with celastrol. [score:1]
To do so, we first observed miR-223 alterations caused by celastrol in human breast cancer line MCF-7 and prostate cancer line PC3 (two of the most common types of cancer and the two cancer types most often used in celastrol studies), as well as the effects of manipulating miR-223 on celastrol’s ability to reduce the number of living cells. [score:1]
It has been reported that miR-223 influences the survival ability of various cancer cells [13]. [score:1]
One interesting finding of our work is that celastrol could induce miR-223 in MCF-1 and PC3. [score:1]
After cells were transfected with anti-miR-223 (b) or miR-223 mimics (c) for 24 h, the cells were washed with PBS and then cultured with celastrol at different doses or with DMSO for 60 h. Cell numbers were determined by flow cytometry. [score:1]
b and c miR-223’s effects on viable cell numbers. [score:1]
[1 to 20 of 106 sentences]
7
[+] score: 264
It seems contradictory that miR-223 can suppress tumor invasion and metastasis through targeting Artemin [10], but may promote tumor by inhibiting the expression of EPB41L3, a tumor suppressor in human NPC [10]. [score:11]
These findings demonstrated that miR-223 regulates the NPC development by targeting MAFB expression, and implicates miR-223 as a candidate target for NPC diagnosis and treatment. [score:9]
MiR-223 up-regulation in Hela cells inhibits cell proliferation by targeting IGF-1R [9]. [score:7]
d. RT-qPCR confirmed that the gene expression of MAFB was inhibited by miR-223 overexpression. [score:7]
The expression level of miR-223 was also down-regulated in another two NPC cell lines HONE-1 and SUNE-1 (data no shown). [score:6]
In Hela cells, overexpression of MiR-223 suppresses cell proliferation by targeting IGF-1R [9]. [score:6]
The microarray results for miR-223 down-regulated MAFB gene expression were verified through RT-qPCR and. [score:6]
And MAFB expression was decreased accompanied with miR-223 overexpression. [score:5]
These results indicated that miR-223 inhibits the growth and migration of NPC cells through reducing MAFB gene expression. [score:5]
We obtained the consistent result that miR-223 suppressed MAFB gene expression in CNE-2 cells (Fig.   5d). [score:5]
The results are consistent with the discovery in hepatic carcinoma that the inhibition of miR-223 accompanies the enhancement of Stathmin1 expression [24]. [score:5]
Exogenous expression of miR-223 in CNE-2 cells could inhibit cell proliferation both in vitro and in vivo. [score:5]
In addition, both of miR-223 -mimic administration and reduction of MAFB expression all lead to the inhibition of cell growth and migration. [score:5]
The inhibition of MAFB gene expression on protein level through miR-223 mimic administration was confirmed by. [score:5]
On the other hand, there has been another report suggesting that miR-223 functions as a potent tumor suppressor of the Lewis lung carcinoma cell line by targeting insulin-like growth factor-1 [29]. [score:5]
MiR-223 negatively regulates the growth and migration of NPC cells via reducing MAFB expression, and this finding provides a novel insight into understanding miR-223 regulation mechanism in nasopharyngeal carcinoma tumorigenesis. [score:5]
MAFB is identified as a direct target of miR-223. [score:4]
However, in the gastric cancer development, miR-223 acts as an oncogene to promote cell invasion and migration via affecting expressions of EPB41L3 and FBXW7/hCdc4 genes [10, 26, 27]. [score:4]
MiR-223 -mimic administration could lead to the suppression of MAFB expression both in RNA and protein levels. [score:4]
In addition, miR-223 has been report to regulate the proliferation and invasion of human breast cancer cells for targeting Caprin-1 [28]. [score:4]
Exogenously up -regulating miR-223 could suppress cell proliferation and colony formation, increase tumor formation in nude mice (Fig.   2 and 4). [score:4]
Based on miRNA microarray we found that miR-223 was down-regulated in NPC cell line CNE-1 and CNE-2, and further verified the role of miR-223 in NPC pathogenesis. [score:4]
The discrepant results of miR-223 role seemed to indicate that miR-223 regulates different gene expression to play different role in various cancers. [score:4]
Fig. 5MAFB is a direct target gene of miR-223. [score:4]
In hematopoietic cells, miR-223 can negatively post-transcript regulate the expression of LMO2 and CEBP-β to reduce cell proliferation [25]. [score:4]
Exogenous miR-223 inhibits cell proliferation and colony formation in vitro. [score:3]
In our study, we demonstrated that exogenous miR-223 inhibits CNE-2 cell migration and invasion (Fig.   3). [score:3]
This observation suggested that miR-223 may inhibit the proliferation of NPC cells. [score:3]
After miR-223 mimic and negative control microRNA transfected, we found that 39 transcripts were differentially expressed between two groups. [score:3]
As miR-223 maybe also targets other genes in nasopharyngeal carcinoma, further analyses are needed to elucidate the full spectrum of miR-223 functions. [score:3]
Real-time quantitative PCR and were used to confirm miR-223 and MAFB expression levels. [score:3]
a. The RT-qPCR confirmed that the miR-223 expression was significantly lower in CNE-1 and CNE-2 than that in NP69 (*P < 0.05). [score:3]
These results demonstrated that miR-223 inhibits the migration and invasion of NPC cells in vitro. [score:3]
To fully realize its effect, we observed that miR-223 inhibited NPC cell growth, migration and invasion both in vitro and in vivo. [score:3]
Here, we identified miR-223 as down-regulated in undifferentiated nasopharyngeal carcinoma cell line CNE-2, compared with immortalized nasopharyngeal epithelial cell line NP69. [score:3]
To investigate the mechanism of miR-223 inhibition NPC cells, we performed a cDNA expression microarray analysis. [score:3]
Fig. 3Exogenous miR-223 suppresses cell migration and invasion in vitro. [score:3]
c. The cDNA microarray analysis revealed that there were 39 differentially expressed genes between the CNE-2 transfected with miR-223 mimics and the CNE-2 transfected with negative control. [score:3]
MAFB, a transcription factor of Maf family members, was identified as a target gene of miR-223. [score:3]
Those transcripts have not been reported as targets for miR-223. [score:3]
These results indicated that exogenous miR-223 suppresses tumor growth in vivo. [score:3]
In this study, we found the reduction of miR-223 expression both in NPC cells and in NPC patients’ plasma. [score:3]
These results encouraged us to check the expression level of miR-223 in clinical specimens. [score:3]
org [13], were used to predict the interaction probability between miR-223 and MAFB, including binding sites for miR-223 in MAFB and the targeting efficiency. [score:3]
The findings implicated that miR-223 could be a potential target for intervention and diagnosis to NPC. [score:3]
As shown in Fig.   2c and d, both plate and soft agar colony formation abilities were suppressed by exogenous miR-223 in CNE-2 cells. [score:3]
The mutated MAFB 3’UTR containing mutations of the miR-223 binding sit was obtained using GeneTailor Site-Directed Mutagenesis System (Invitrogen), namely mutated 3’UTR (mt-UTR). [score:3]
The miR-223 expression was analyzed with U6 as a normalizer. [score:3]
Fig. 2Exogenous miR-223 suppresses cell proliferation and colony formation in vitro. [score:3]
c. The miR-223 expression was significantly decreased in NPC patients’ plasma. [score:3]
b. RT-qPCR confirmed that the miR-223 expression was significantly lower in CNE-1 and CNE-2 than that in NP69 (*P < 0.05). [score:3]
The data were showed as means ± SD (n = 10) In vitro, the cells transfected with miR-223 mimics showed a higher miR-223 expression level (Fig.   2a). [score:3]
MAFB was identified as a miR-223 target gene. [score:3]
MiR-223, which was recently identified to be related with migration and invasion of malignant tumors, was lower expressed in NPC cell lines CNE-1 and CNE-2. We employed RT-qPCR to validate the microarray results and a consistent result was observed (P < 0.05; Fig.   1b). [score:2]
MiR-223 expression is significantly lower in CNE samples than control samples. [score:2]
MiR-223 suppresses tumor growth in vivo. [score:2]
By wound healing assay, we found that exogenous miR-223 inhibited CNE-2 cell migration (Fig.   3a). [score:2]
Compared with NP69, miR-223 expression was significantly lower in NPC cell line CNE-1 and CNE-2 (Fig.   5a) that was consistent with the miRNA microarray results (Fig.   1a). [score:2]
Our results illuminate the role of miR-223 in NPC development and provide valuable information for clinical implications. [score:2]
a. RT-qPCR result confirmed that the miR-223 expression was significantly higher as compared with untreated and control group after exogenous miR-223 transfection in CNE-2 (*P < 0.05). [score:2]
Consistently, the results of in vitro transwell migration and Matrigel invasion assay showed that exogenous miR-223 inhibited CNE-2 cells migration and invasion (Fig.   3b and c). [score:2]
* indicates P < 0.05 compared with control group The proliferation inhibition of miR-223 in CNE-2 cells prompted us to examine the effect of miR-223 on the migration and invasion of NPC cells. [score:2]
Li J, Guo Y, Liang X, Sun M, Wang G, De W, Wu W: MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. [score:2]
The targeting relationship between miR-223 and MAFB was verified using dual luciferase reporter assay. [score:2]
MiR-223 inhibits NPC cell migration and invasion. [score:2]
* indicates P < 0.05 compared with control group As exogenous miR-223 suppresses cell proliferation of NPC cells in vitro, we examined the effect of miR-223 in vivo. [score:2]
We found that the average miR-223 level was significantly lower in the plasma of 10 NPC patients than that from 10 normal healthy subjects. [score:1]
Extrogenous miR-223 in CNE-2 cells would decrease the ability of colony formation and migration. [score:1]
The plasma miR-223 levels in NPC patients were detected by TaqMan analysis. [score:1]
a. The appearance of xenograft subcutaneous NPC in miR-223 mimics transfection and control groups. [score:1]
As a result, the growth rate was significantly decreased in CNE-2 cells due to exogenous miR-223 (Fig.   2b). [score:1]
MiR-223 was firstly reported to be involved in the regulation of human granulopoiesis [6, 7]. [score:1]
CNE-2 cells transfected with miR-223 mimic and control microRNA (2 × 10 [6]) or MAFB specific siRNA and negative control siRNA in 100 μl no serum medium were injected respectively into particular side of each mouse. [score:1]
The expression of miR-223 was measured by real-time quantitative PCR (RT-qPCR) by using One Step SYBR® PrimeScript® RT-PCR Kit II (Takara) and following the manufacturer’s protocol on ABI 7500 HT real-time PCR detection system as normalized to the housekeeping gene U6. [score:1]
MiR-223/Ect2/p21 signaling regulates osteosarcoma cell cycle progression and proliferation [35]. [score:1]
These findings suggest that miR-223 is associated with migration and invasion of malignant tumor. [score:1]
After 24 h transfection of miR-223 mimic and negative control in CNE-2, total RNA was isolated and hybridized to an Affymetrix GeneChip Human Genome U133 Plus 2.0 Array. [score:1]
The potential role of miR-223 mimic in cell proliferation and colony formation was observed. [score:1]
The total tumor size for negative control and miR-223 mimic transfected groups was 995.37 ± 674.63 and 598.38 ± 613.23 mm [3] respectively (Fig.   4c). [score:1]
However, to our knowledge, the role of miR-223 in nasopharyngeal carcinogenesis remains undefined. [score:1]
After injected with CNE-2 cells that were transfected with miR-223 mimic or control microRNA respectively, we found that tumors grew at a slower rate and had smaller sizes (Fig.   4a- b). [score:1]
Fig. 4Exogenous miR-223 attenuates nasopharyngeal tumor growth in mouse xenograft mo dels. [score:1]
c. Total tumor weight of miR-223 mimic transfection and control groups. [score:1]
a. The function of exogenous miR-223 on CNE-2 cells migration. [score:1]
org software to predict the potential targets for miR-223 and combined the results to select MAFB for further investigation. [score:1]
The miR-223 expression was decreased in CNE-1, CNE-2 cells as compared with NP69 cells, an immortalized human nasopharyngeal epithelial cell line, and its level also reduced in NPC patients’ plasma as compared with healthy controls. [score:1]
The above-mentioned reports with our study indicate that miR-223 could be a serum biomarker of NPC patients to give early diagnosis for optimal treatment. [score:1]
[1 to 20 of 87 sentences]
8
[+] score: 231
Other miRNAs from this paper: hsa-mir-122, hsa-mir-146a
Given that miR-223 functions as an oncogene in human gastric cancer by targeting FBXW7 [16], and that genistein treatment significantly inhibited miR-223 expression but up-regulated FBXW7 in PDAC cells [7], we further examine the involvement of FBXW7 in the effect of miR-223 in human patients with pancreatic cancer. [score:10]
Overexpression of FBXW7 also up-regulated the epithelial marker E-cadherin and down-regulated the mesenchymal markers N-cadherin and vimentin, and reversed the miR-223 -mediated induction of EMT in Panc-1 and BxPC-3 cells (Figure 4G). [score:9]
Given that hnRNPK has been shown to transactivate the CT element in vivo and mediate the activity of the CT element in vitro [15], we hypothesized that hnRNPK transcriptionally upregulates the expression of miR-223 in PDAC. [score:6]
In the current study, we demonstrate that up-regulation of miR-223 is potentially responsible for aberrant expression of hnRNPK in PDAC tumor cells. [score:6]
Although we and other groups found that miR-223 expression was significantly enhanced in different types of tumor tissues including PDAC [7, 13], very little is known about the mechanisms underlying the transcriptional upregulation of miR-223 in PDAC. [score:6]
HnRNPK associates with miR-223 promoter and transcriptionally upregulates its expression. [score:6]
In conclusion, our results suggest selective expression of hnRNPK in a subset of PDAC cells may confer disease progression via enhancing transcription and activation of miR-223 in FBXW7 -dependent manner. [score:5]
Kaplan–Meier analysis demonstrated that the median survival time of PDAC patients with low and high expression of miR-223 was 31.4 and 14.6 months, respectively (Figure 1D), which is consistent with analysis about the relationship between miR-223 expression and clinicopathologic parameters in 60 PDAC patients (Table 1). [score:5]
MiR-223 expression is up-regulated in PDAC tissues and cell lines, whichcorrelates with the poor prognosis of PDAC. [score:5]
Panc-1 and BXPC-3 cells overexpressing miR-223, FBXW7, or both was determined using the MTT assay D and E. and migration was assessed using the Transwell assay (P <0.05, N=5) F., G. The expression of EMT markers was assessed by western blotting in miR-223 or FBXW7 expressing cells. [score:5]
Increased miR-223 expression is correlated with decreased FBXW7 and enhanced hnRNPK expression in human PDAC specimens. [score:5]
Importantly, high-level hnRNPK expression was found to be correlated with poor prognosis and increased expression of miR-223 in PDAC patients. [score:5]
HnRNPK directly binds to miR-223 promoter and transcriptionally stimulates its expression. [score:4]
We further tested whether hnRNPK can regulate the level of miR-223 expression. [score:4]
Taken together, our data suggest that the impact of miR-223 on cell proliferation, migration and EMT is mediated by the down -regulation of its target FBXW7 in PDAC cells. [score:4]
F. Knockdown of hnRNPK reduces miR-223 expression while increases the level of FBXW7. [score:4]
G. Knockdown of miR-223 inhibited the growth of PDAC cells-engrafted tumors. [score:4]
To examine the effect of miR-223 expression on cell viability, PDAC cells were transfected with miR-control, miR-223 mimics or miR-223 inhibitor, and analyzed using the MTT and Transwell migration assays. [score:4]
HnRNPK in turn promotes PDAC tumorigenesis by regulating miR-223 transcription and decreasing FBXW7 expression, which requires phosphorylation of hnRNPK at threonine 1695 by GSK3. [score:4]
The site-directed mutagenesis of the miR-223 target-site was carried out using Invitrogen (Californlia, USA). [score:4]
Together, these results suggest that hnRNPK transcriptionally promotes miR-223 expression. [score:3]
E. miR-223 suppresses cell apoptosis (n = 5). [score:3]
Representative tumors were photographed at 15 days after the first treatment with miR-223 inhibitor or control (left panel). [score:3]
Importantly, over -expression of FBXW7 decreased the viability and migratory ability of Panc-1 and BxPC-3 cells in a time dependent manner, and reversed the miR-223 -induced increase of cell viability and migration (Figure 4D, 4E, and 4F). [score:3]
D. Kaplan–Meier survival analysis of PDAC patients grouped by the expression levels of miR-223. [score:3]
D and E. Enforced expression of hnRNPK induces an elevation of pre-miR-223 and miR-223 levels. [score:3]
Conversely, inhibition of miR-223 significantly caused the opposite phenotypes (Figure 3C and 3D). [score:3]
Targeted disruption of the hnRNPK/miR-223/FBXW7 feedback loop may have therapeutic implications to improve clinical outcomes in patients with advanced PDAC. [score:3]
We found miR-223 expression was significantly increased in PDAC specimens (0.89±0.28) compared with non-PDAC control specimens (0.25±0.41; P=8.9e−7), whereas FBXW7 was found to be decreased, and hnRNPK expression was subsequently increased compared with non-PDAC specimens. [score:3]
FBXW7 overexpression rescues the effect of miR-223 on PDAC cell proliferation and migration. [score:3]
miR-223 promotes PDAC cell growth and migration, while inhibits apoptosis and enhances S phase of PDAC cells. [score:3]
Graph representing tumor volumes (middle panel) and tumor weight averages (right panel) between control and miR-223 inhibitor -treated mice groups (n=8 per group) at the end of the experiment were presented. [score:3]
C. Correlation between miR-223 and FBXW7 protein expression in tumor samples. [score:3]
The relationship between miR-223 expression and clinicopathologic parameters in 60 PDACs. [score:3]
Enforced expression of hnRNPK was found to elevate both pre-miR-223 (Figure 2D) and mature miR-223 levels (Figure 2E). [score:3]
We identified FBXW7 not only as a major downstream target of hnRNPK-miR-223 complex driving the tumorigenicity of poorly differentiated PDAC, but also is a E3 ligase of hnRNPK. [score:3]
As expected, ratio of cell apoptosis significantly increased in FBS-free medium, whereas it was inhibited with the transfection of miR-223 mimics (Figure 3E). [score:3]
To decide the functional role of miR-223 in PDAC, we utilized ISH to study the expression pattern of miR-223 in cancer and corresponding non-cancer tissues. [score:3]
Importantly, an in vivo tumor formation assay demonstrated that miR-223 inhibitor inhibited the growth of PDAC cells-engrafted tumors compared to control oligonucleotides -treated tumors (Figure 3G). [score:3]
Figure 4C shows an inverse correlation between FBXW7 and miR-223 expression in pancreatic tumors. [score:3]
To confirm the ISH results, miR-223 expression in 31 pairs of PDAC tissues and adjacent normal tissues was examined by qRT-PCR analysis. [score:3]
C. Expression levels of FBXW7 and hnRNPK, and miR-223 were scored in PDAC (n=60) and normal pancreatic tissue tissues (n=20). [score:3]
Expression and diagnostic significance of miR-223 in PDAC. [score:3]
Consistent with these findings, in the current study, we show a new function for hnRNPK in miR-223 transcriptional activation, although miR-223 had not been previously reported as hnRNPK targets. [score:3]
As shown in Figure 1B, compared to adjacent normal tissues, miR-223 expression was significantly enhanced in PDAC tissues. [score:2]
For reporter assays, PADC cells were cultured in 24-well plates and each transfected with 100 ng of pGL3-luc-FBXW7/3′UTR-wt or pGL3-luc-FBXW7/3′UTR-mut and miR-223 mimics or inhibitor using Lipofectamine 2000 (Invitrogen, USA). [score:2]
E. MiR-223 expression in seven PDAC cell lines versus normal ductal cell. [score:2]
The effect of miR-223 on pancreatic cancer cell viability and invasion is mediated by the down regulation of FBXW7. [score:2]
Conversely, knockdown of hnRNPK reduced miR-223 levels in PDAC cells (Figure 2F). [score:2]
As expected, the expression levels of miR-223 and hnRNPK were significantly increased in PDAC specimens compared with those in controls, which were consistent with the data from the xenograft mouse mo del. [score:2]
Ectopic expression of miR-223 in the Panc-1 and BxPC-3 cell lines significantly increased cell viability in a time -dependent manner (Figure 3A) and increased migratory ability (Figure 3B) compared to miR-control transfected cells. [score:2]
Compared with miR-control, miR-223 mimics resulted in an enhanced percentage of S phase in PDAC cells, whereas miR-223 inhibitors caused a G1 cell-cycle arrest, which was evidenced by the reduced percentage of S and the increased percentage of G1 (Figure 3F). [score:2]
Although large numbers of miRNAs such as miR-223 have been found to be associated with human PDAC [7], less is known about their regulatory mechanisms. [score:2]
In addition, qRT-PCR analysis revealed that PDAC patients had > 1.5-fold greater concentrations of serum miR-223 than duodenal adenocarcinoma patients or healthy controls (P <0.05 for each comparison), whereas no significant difference in the serum miR-223 level was observed between duodenal adenocarcinoma patients and healthy controls (Figure 1C). [score:1]
B. qRT-PCR analysis of miR-223 levels in 31 pairs of PDAC tissues and adjacent non-cancer tissues. [score:1]
Relative levles of miR-223 were confirmed by qRT-PCR (Supplementary Figure 1). [score:1]
In addition, we examined the effect of miR-223 on cell cycle progression. [score:1]
To search for novel transcription factor of miR-223, we analyzed the promoter region of miR-223, and observed that miR-223 promoter region contains three CT-rich DNA sequences, which is termed the CT element [14] (Figure 2A). [score:1]
B. Representative slides of IHC staining of FBXW7 and hnRNPK, and in situ hybridization (ISH) probing of miR-223 in PDAC and normal pancreatic tissue tissues (left panel). [score:1]
Therefore, more studies are needed to elucidate the role of miR-223 in other cancers. [score:1]
Figure 2B demonstrated an association of hnRNPK with miR-223 promoter using ChIP analysis. [score:1]
B. ChIP analysis of hnRNPK binding to the promoter of miR-223 in PDAC cells. [score:1]
However, in breast cancer, miR-223 has a negative correlation with the survival of patients [29]. [score:1]
A total of 60 PDAC specimens along with 20 controls (Figure 6A) were analyzed for FBXW7 and hnRNPK levels by IHC and miR-223 levels by ISH (Figure 6B). [score:1]
Confident with the in vitro data, we further studied the correlation of miR-223, FBXW7 and hnRNPK in human PDAC samples. [score:1]
Collectively, these data clearly demonstrate that miR-223 has a growth-promotive function in PDAC. [score:1]
A. Positive staining for miR-223 was found in human PDAC tissues but not in adjacent normal pancreatic tissues by ISH. [score:1]
miR-223 antagomir sequences: 5′-GGGGTATTTTAGAACTGACA- 3′. [score:1]
Briefly, the 3′UTR sequence of FBXW7 predicted to interact with miR-223 was amplified and cloned into the EcoRI and XhoI sites of pGL3-luc vector (Promega, USA). [score:1]
Together, these data suggest that miR-223 might be an oncogenic miRNA in PDAC. [score:1]
These clinical data further support mechanism postulating that miR-223/FBXW7/hnRNPK feedback loop promotes PDAC growth and metastasis (Figure 6D). [score:1]
pre-miR-223 (D) and miR-223 (E), were detected by qRT-PCR. [score:1]
ISH was performed using antisense oligonucleotide probes for miR-223 (Exiqon, USA), with scrambled-miR (5′-GTGTAACACGTCTATACGCCCA-3′) serving as a negative control. [score:1]
For the first time, this provides a mechanistic explanation for the correlation between miR-223/FBXW7 and hnRNPK in pancreatic cancer. [score:1]
C. qRT-PCR analysis of serum miR-223 levels in PDAC patients (n=60), 40 age-matched normal (N) controls, and 17 duodenal adenocarcinoma (DA). [score:1]
E. Schematic diagram of the hnRNPK/miR-223/FBXW7 feedback loop. [score:1]
In situ hybridization ISH was performed using antisense oligonucleotide probes for miR-223 (Exiqon, USA), with scrambled-miR (5′-GTGTAACACGTCTATACGCCCA-3′) serving as a negative control. [score:1]
Consistent with this view, patients with higher miR-223 results in a worse survival, whereas lower level shows the opposite. [score:1]
This raises the question of whether hnRNPK could also interact with miR-223 in a manner similar to that of protein-coding genes. [score:1]
24 hours after infection, miR-223 was detected by qRT-PCR. [score:1]
Moreover, induction of miR-223 by hnRNPK decreases the level of FBXW7 in PDAC cells. [score:1]
Positive cytoplasmic staining for miR-223 was evident in cancer cells, whereas no miR-223 positivity was found in the adjacent normal pancreatic tissues (Figure 1A). [score:1]
Our findings collectively show an important new miR-223/FBXW7/HnRNPK feedback loop. [score:1]
C. Firefly reporter activity measured from Panc-1 cells infected with adenoviruses expressing hnRNPK, or β-galactosidase (β-gal), or empty vector (pGL4), or with constructs containing the wild-type (WT) miR-223 promoter, or the miR-223 promoter mutated at putative hnRNPK binding sites (Mut). [score:1]
A scrambled probe for miR-223 was used as a negative control that did not stain any tissue sections. [score:1]
Low FBXW7 is tightly correlated with higher miR-223 and hnRNPK levels in human PDAC tissues. [score:1]
The sequences were then mutated to disrupt hnRNPK binding to the miR-223 promoter sequences as indicated. [score:1]
Figure 1 A. Positive staining for miR-223 was found in human PDAC tissues but not in adjacent normal pancreatic tissues by ISH. [score:1]
We next investigated whether miR-223 expression correlated with the prognosis of PDAC. [score:1]
[1 to 20 of 89 sentences]
9
[+] score: 192
In addition to our findings that miR-223 and miR-93 regulate IR in AT by targeting GLUT4, these two miRNAs have also been found to suppress proinflammatory activation of macrophages by targeting IRAK4 (for miR-93) [24] and Pknox1 (for miR-223) [25]. [score:8]
Both miRNAs act as antiangiogenesis regulators, but miR-93 directly targets vascular endothelial growth factor A (VEGF-A) [39], while miR-223 targets β1 Integrin [40]. [score:7]
miR-223 is overexpressed in insulin resistant myocardial cells and, paradoxically, overexpression of miR-223 by transfection has been reported to increase GLUT4 protein expression but not mRNA, thereby improving glucose uptake in cardiomyocytes [12]. [score:7]
As we previously noted that PCOS women with IR had the lowest expression of GLUT4 [11], it is possible that miR-93 and miR-223 may have additive effects on the regulation of GLUT4 expression. [score:6]
To determine the role of and mechanism by which miR-223 induced IR in adipocytes, we overexpressed miR-223 in human differentiated adipocytes in vitro to achieve an approximately twofold increase in expression compared to empty plasmid controls (P < 0.01; Figure 2(a)), similar to the level of miR-223 overexpression in human AT (Figure 1(a)). [score:6]
Consistent with the hypothesis that TNF- α increases IR in adipocytes, at least in part, via the modulation of miR-223 expression, we observed that treatment of human differentiated adipocytes with TNF- α (10 ng/mL) for 24 hours significantly increased miR-223 expression (Figure 3). [score:5]
To gauge the possible effects of these differences on miR-223 expression we first determined whether an association existed between miR-223 expression and age or BMI for the entire group combined. [score:5]
Although in silico analysis (algorithms miRanda, PicTar, and TargetScan) indicated that GLUT4 was not a predicted target of miR-223, we found one potential binding site in the 3′UTR sequence of GLUT4 by using the free energy -based miRNA prediction program PITA. [score:5]
However, miR-223 does appear to be overexpressed in AT and the myocardium of IR subjects and suggests that miR-223 may serve as a therapeutic target for IR. [score:5]
In addition, our data indicated that the induced overexpression of miR-223 was associated with a decrease in GLUT4 protein content (Figure 2(c)), but not GLUT4 gene expression (Figure 2(d)). [score:5]
Overexpression of miR-223 decreased GLUT4 protein content and inhibited insulin-stimulated glucose uptake in cultured human adipocytes. [score:5]
Similar to cardiomyocytes [12], overexpression of miR-223 in adipocytes did not alter GLUT4 mRNA expression. [score:5]
In a previous study, we examined the expression of miR-223 in AT from a total of 25 subjects, and our findings indicated that miR-223 tended to be overexpressed in PCOS and non-PCOS women with IR [11]. [score:5]
In conclusion, our data indicates that miR-223 is overexpressed in the subcutaneous AT of subjects with IR, regardless of PCOS status, and that miR-223 expression is positively associated with IR in vivo. [score:5]
We found overexpression of miR-223 inhibited glucose uptake stimulated by insulin in human differentiated adipocytes in vitro (Figure 2(b)). [score:5]
In addition TNF- α induced miR-223 expression in vitro, suggesting that TNF- α exerts its negative effect on insulin action at least in part through its modulation of the expression of this miRNA. [score:5]
These data suggest GLUT4 could be a direct target of miR-223. [score:4]
In the present study, we examined the regulation of GLUT4 expression by miR-223. [score:4]
As tumor necrosis factor- α (TNF- α) induces IR in adipocytes [19], the role of TNF- α in the regulation of miR-223 expression in human differentiated adipocytes was also examined. [score:4]
Furthermore, by the GLUT4 3′UTR reporter assay, we demonstrated that miR-223 regulates GLUT4 expression by direct binding to its 3′UTR site. [score:4]
That miR-223 decreased GLUT4 protein, but not mRNA, in adipocytes which suggests that miR-223 may regulate GLUT4 expression by binding to its 3′UTR. [score:4]
Transient cotransfection of miR-223 and luciferase expression plasmids in human differentiated adipocytes demonstrated direct binding of miR-223 to the GLUT4 3′UTR site, resulting in a significant reduction in luciferase (Figure 2(f)). [score:4]
To address whether direct binding of miR-223 to the GLUT4 3′UTR is responsible for the observed suppression of GLUT4, we performed a luciferase assay in which direct binding of miR-223 to the vector GLUT4 3′UTR gene transcript would repress a luciferase reporter. [score:4]
Together, these data suggest that miR-93 expression is associated with both IR and PCOS, whereas miR-223 is not involved in PCOS per se but is related to IR. [score:3]
Our results indicate that miR-223 expression did not vary according to age (r = −0.11, P = 0.288) but was positively correlated with BMI (r = 0.46, P = 0.01). [score:3]
The expression of miR-223 was significantly increased among all women with IR (P = 0.0004; Figure 1(a)). [score:3]
However, to promote cancer activity, they also target different genes including C/EBP β, FOXO1, NFI-A, STAT5A, ARTN, FBXW7, and SEPT6 (for miR-223) [29– 33] and FUS1, RhoC, PTEN, CDKN1A, TGF βR2, and NRF2 (for miR-93) [34– 38]. [score:3]
However, unlike cardiomyocytes, miR-223 overexpression was associated with a decrease in GLUT4 protein content and glucose uptake in AT. [score:3]
In cardiomyocytes, overexpression of miR-223 stimulates glucose uptake and increases GLUT4 protein content but not the level of mRNA [12]. [score:3]
We hypothesized that abnormal expression of miR-223 plays a role in the metabolic dysfunction of PCOS and IR. [score:3]
These trends were confirmed in the present study, analyzing a larger number of subjects, such that miR-223 was significantly overexpressed in women with IR, regardless of PCOS status. [score:3]
This suggests that reduced insulin-stimulated glucose uptake in miR-223 overexpressed human differentiated adipocytes could be due to decreased levels of GLUT4, not by altering GLUT4 translocation. [score:3]
However, no difference in miR-223 expression was detected (Figure 1(b)) with regard to PCOS status. [score:3]
The 3′UTR luciferase plasmid (1  μg) with either miR-223 overexpression or empty plasmid (2  μg) was transfected in each well of a 12-well plate. [score:3]
In addition we also observed that miR-223 was abnormally expressed in PCOS women with IR. [score:3]
In cardiomyocytes, overexpression of miR-223 enhances insulin-stimulated glucose uptake by increasing GLUT4 but not by altering insulin signaling and AMPK activity (baseline and phosphorylation) [12]. [score:3]
Macrophage activation is associated with IR [26]; therefore, these data suggest that miR-223 and miR-93 could also regulate IR by regulating inflammation. [score:3]
Together these data suggest the possibility that miR-223 could be a potential therapeutic target for IR. [score:3]
miR-223 and miR-93 have been found to have similar functions yet they may or may not target the same genes. [score:3]
Insulin signaling components and AMPK are not targets of miR-223. [score:3]
miR-223 overexpression plasmid (Cat# SC400292), noninsert empty plasmid control (Cat# PCMVMIR), and transfection reagent MegaTran 1.0 (Cat# TT200002) were purchased from OriGene (Rockville, MD). [score:3]
Our results indicated that miR-223 expression was positively correlated with HOMA-IR (r = 0.64, P < 0.01; Figure 1(d)) Subjects with IR (regardless of the presence of PCOS) tended to have a greater mean body mass index (BMI) than subjects without IR (Table 1), a difference that reached significance only in women without PCOS, between those with IR and those without IR. [score:3]
Analysis of GLUT4 3′UTR sequence using the free energy -based miRNA prediction program PITA [18] revealed one potential target site for miR-223 in GLUT4 (Figure 2(e)). [score:3]
The adjustment did not change our results, with the difference in miR-223 expression between women with and without IR (P = 0.0193) and the absence of a difference between women with and without PCOS (P = 0.1178) (Table 2) remaining. [score:3]
Comparing all four subgroups (7 subjects without PCOS and without IR, 8 without PCOS but with IR, 8 with PCOS but without IR, and 10 with both PCOS and IR), miR-223 was only significantly overexpressed in the two groups of women with IR, compared to subjects without PCOS and without IR (P < 0.01; Figure 1(c)). [score:2]
It is unclear whether miR-223 may also regulate IR in adipocytes. [score:2]
Both miR-93 and miR-223 regulated GLUT4 protein content in adipocytes [11]. [score:2]
Consequently, we compared miR-223 expression values adjusted for BMI for subjects with and without PCOS and with and without IR. [score:2]
These data suggest that miR-223 and miR-93 may also have additive effects on these functions. [score:1]
Alternatively, miR-223 was increased in women with IR, regardless of PCOS status. [score:1]
In the present study, we examined the role of miR-223 in the AT of four groups of women: those without PCOS or IR; those without PCOS, but with IR; those with PCOS, but without IR; and women with PCOS and IR. [score:1]
Next, we examined the association of miR-223 expression with measures of IR, including HOMA-IR. [score:1]
[1 to 20 of 52 sentences]
10
[+] score: 190
To further investigate whether miR-223 can induce the differentiation of hESCs, H9 cells were transfected with lentiviruses expressing a mature miR-223 sequence or a miR-223 inhibitor, then were cultured with or without bFGF for 12, 72, and 120 h. When expression of Oct-4 and Nanog were assayed by qRT-PCR, mRNA levels of both transcription factors were observed to significantly decrease in cells expressing exogenous miR-223 following bFGF withdrawal compared to the levels of Oct-4 and Nanog detected in cells containing exogenous miR-223, cells expressing miR-223 inhibitor in the absence of bFGF, and in control cells (Fig. 2, A,B). [score:9]
However, after 120 h, levels of p-Akt in both the control extracts and the extracts of cells expressing miR-223 -inhibitor were significantly higher than those of cells expressing exogenous miR-223 (Fig. 3C). [score:7]
To confirm these observations, cell extracts were collected from control cells, cells expressing exogenous miR-223 with and without withdrawal of bFGF, and cells expressing a miR-223 inhibitor that underwent bFGF withdrawal. [score:7]
Using qRT-PCR and western blotting, both mRNA and protein levels of Nanog and Oct-4 were found to be significantly upregulated following lentiviral expression of an miR-223 inhibitor and withdrawal of bFGF for 120 h, compared with withdrawal of bFGF in the absence of lentiviral infection (Fig. 2D, E). [score:7]
To test this hypothesis, lentiviral transduction was performed to achieve overexpression of miR-223 and miR-223 -targeted inhibition. [score:7]
Western blotting detected a significant increase in levels of IGF-1R following expression of the miR-223 inhibitor compared to expression of exogenous miR-223 (Fig. 3B). [score:6]
Using qRT-PCR, Nanog (A) and Oct-4 (B) mRNA levels were assayed in control cells, cells expressing exogenous miR-223 with and without bFGF withdrawal, and cells expressing a miR-223 inhibitor that underwent withdrawal of bFGF for 12, 72, and 120 h (* p<0.05, ** p<0.01; n = 6). [score:6]
Third, IGF-1R was significantly downregulated following overexpression of miR-223. [score:6]
0078769.g002 Figure 2Using qRT-PCR, Nanog (A) and Oct-4 (B) mRNA levels were assayed in control cells, cells expressing exogenous miR-223 with and without bFGF withdrawal, and cells expressing a miR-223 inhibitor that underwent withdrawal of bFGF for 12, 72, and 120 h (* p<0.05, ** p<0.01; n = 6). [score:6]
Notably, however, neither overexpression, nor inhibition, of miR-223 exerted significant effects on cell proliferation and apoptosis. [score:5]
FACS analysis shows that exogenous expression of miR-223, or an inhibitor of miR-223, does not affect cell apoptosis. [score:5]
Furthermore, in SW480 cells and rat aortic smooth muscle cells, Wang et al. previously reported that miR-223 suppressed cell proliferation by targeting IGF-1R [21]. [score:5]
FACS analysis demonstrated that expression of exogenous miR-223, or an inhibitor of miR-223, does not affect cell cycle progression. [score:5]
In the present study, an increase in levels of p-Akt were detected in hESCs in the presence of a miR-223 inhibitor, thereby suggesting that miR-223 regulates the differentiation of hESCs via the IGF/Akt pathway. [score:4]
In addition, two markers of pluripotency, Oct-4 and Nanog, were assayed in hESCs using lentiviral expression of miR-223 and a miR-223 inhibitor, in order to better understand the role and mechanistic details of miR-223 in the proliferation, apoptosis, and differentiation of hESCs. [score:4]
Based on the results of the present study, it appears that miR-223 regulates the differentiation of hESCs by targeting IGF-1R and its downstream Akt signaling pathway. [score:4]
Expression levels of miR-223 were found to significantly increase in differentiated H9 cells. [score:3]
MiR-223 Regulates hESCs Differentiation likely by Targeting IGF-1R/Akt Signaling. [score:3]
Thus, miR-223 promotes hESCs differentiation likely via suppressing the IGF/Akt pathway. [score:3]
Lentiviral -based vectors containing pre-miR-223 or miR-223 inhibitor sequences were transformed into competent Escherichia coli cells and antibiotic-resistant colonies were selected on LB-ampicillin agar plates. [score:3]
Virus Transduction and Detection of miR-223 Expression. [score:3]
Recombinant viral vectors encoding miR-223, the miR-223 inhibitor, and the two packaging plasmids were prepared using a plasmid extraction kit (Invitrogen). [score:3]
Combined with aforementioned evidence from previous reports, our data suggested that miR-223 promotes hESCs differentiation likely via suppressing the IGF/Akt pathway. [score:3]
Second, cells expressing a mutant version of IGF-1R did not respond to miR-223. [score:3]
Based on these data, we hypothesize that miR-223 acts as a local regulator of IGF-1R, thereby modulating development of hESCs. [score:3]
In contrast, differentiated hESCs expressed high levels of miR-223. [score:3]
Our current study revealed that miR-223 behaves as a Akt inhibitor during hESCs differentiation. [score:3]
Collectively, these results suggest that miR-223 enhances the differentiation of hESCs without affecting the processes of proliferation and apoptosis, and this is in contrast with the role of miR-223 in osteoclasts where miR-223 has been shown to inhibit both cell differentiation and proliferation [12], [20]. [score:3]
These results suggest that IGF-1R may be a target of miR-223 (Fig. 3A). [score:3]
Taken together, these data indicate that miR-223 accelerates the differentiation of hESCs, while inhibition of miR-223 maintains the pluripotency of hESCs. [score:3]
Construction of pLV-THM-miR-223 and pLV-THM-miR-223 -inhibitor Vectors. [score:3]
The mature sequence of the miR-223 inhibitor used was: 5′-UGGGGUAUUUGACAAACUCACA-3′, and it was chemically synthesized by Sangon Biotech Co. [score:3]
Cells (1 × 10 [5]/well) were plated in 24-well plates, then incubated with 100 ng pmirGLO- IGF1R -3′UTR vector and 30 nM exogenous miR-223 or miR-223 inhibitor. [score:3]
After 24 h, cells were transduced with each lentivirus stock (5.0 × 10 [5] titer units), then were incubated for an additional 48–72 h prior to detection of miR-223 expression by quantitative real-time polymerase chain reaction (qRT-PCR). [score:3]
0078769.g003 Figure 3(A) hESCs were infected with lentiviruses expressing miR-223 and wild type IGF-1R-3′UTR or a mutant IGF-1R-3′UTR construct. [score:3]
Correspondingly, overexpression of miR-223 resulted in a significant decrease in luciferase activity for the IGF-1R- 3′UTR reporter. [score:3]
In the present study, IGF-1R was found to be a target gene of miR-223 based on several lines of evidence. [score:3]
Levels of mRNA and protein were also assayed for Oct-4 (D) and Nanog (E) in the presence or absence of an miR-223 inhibitor 12, 72, and 120 h after withdrawal of bFGF (* p<0.05, ** p<0.01; n = 6). [score:2]
Small RNAs were isolated using a mirVana miRNA Isolation Kit (Ambion), and expression of miR-223 was detected using quantitative RT-PCR and Taqman miRNA assays (Applied Biosystems). [score:2]
However, the mechanisms by which miR-223 regulates the proliferation, apoptosis, and differentiation of hESCs remains unclear. [score:2]
A dual luciferase assay was used to detect expression of IGF1R following the lentiviral infection of hESCs with miR-223 and the 3′UTR region of IGF-1R fused to a luciferase reporter. [score:2]
A decrease in luciferase activity was detected, indicating that IGF-1R can be regulated by miR-223. [score:2]
Based on these data, it appears that the differentiation of hESCs is regulated by miR-223 via IGF-1R. [score:2]
In combination, these data suggest that miR-223 regulates hESCs differentiation. [score:2]
Currently, miR-223 has been shown to have an essential role in the proliferation of granulocytes, gastric cancer cells, venous smooth muscle cells, and hematopoietic cells [11]. [score:1]
Moreover, although the miR-223 gene is located on the X chromosome, similar results were obtained for both H9 and H1 cell lines, which were originally isolated from female and male individuals, respectively. [score:1]
MiR-223 regulates hESCs differentiation likely via IGF-1R/Akt. [score:1]
Taken together, these results suggest that miR-223 is not required for the proliferation of hESCs, and this is inconsistent with the proproliferative role that miR-223 has exhibited in other cell types [17]. [score:1]
A, Detection of miR-223 (A), Oct-4, (B), and Nanog (C) in hESCs and spontaneously differentiated cells 12, 72, and 120 h after withdrawal of bFGF (* p<0.05; ** p<0.01; n = 6). [score:1]
Potential interactions between miRNA-223 and the 3′UTR of IGF-1R. [score:1]
Based on these results, it is hypothesized that miR-223 plays a key role in the differentiation of hESCs. [score:1]
In undifferentiated hESCs, low levels of miR-223 were detected. [score:1]
Levels of miR-223 detected in hESCs and spontaneously differentiated cells. [score:1]
Furthermore, recent evidence suggests that miR-223, an evolutionarily conserved miRNA, may represent a potential biomarker for recurrent ovarian cancer and sepsis [19]. [score:1]
In contrast with miR-223, levels of Oct-4 and Nanog decreased in differentiated H9 cells (Fig. 1, B,C). [score:1]
Effects of exogenous miR-223 on cell apoptosis. [score:1]
In contrast, the reporter activity of a construct containing a mutated version of IGF-1R-3′UTR was not affected by the presence of exogenous miR-223. [score:1]
Using qRT-PCR, levels of miR-223 were detected in undifferentiated hESCs and spontaneously differentiated hESCs using H9 cells cultured in the presence and absence of bFGF, respectively (Fig. 1A). [score:1]
0078769.g001 Figure 1 A, Detection of miR-223 (A), Oct-4, (B), and Nanog (C) in hESCs and spontaneously differentiated cells 12, 72, and 120 h after withdrawal of bFGF (* p<0.05; ** p<0.01; n = 6). [score:1]
Effect of miR-223 on Cell-cycle Distribution and Apoptosis. [score:1]
To further investigate this hypothesis, expression of miR-223 was monitored during hESC differentiation. [score:1]
Effect of exogenous miR-223 on cell cycle progression. [score:1]
These results suggest that miR-223 plays an important role in the differentiation of hESCs. [score:1]
Using bioinformatics predictions, complementary binding sites have been identified in both miR-223 and the 3′-UTR of IGF-1R mRNA. [score:1]
[1 to 20 of 64 sentences]
11
[+] score: 189
Other miRNAs from this paper: mmu-mir-223
miR-223 overexpression down-regulates interleukin-6 (IL-6) and IL-1β expression in TLR-activated macrophages [16]. [score:8]
In the study, miR-223 expression of the stroke patients with LA or SA showed similar up-regulation. [score:6]
miR-223 expression was up-regulated in the 1 day and 3 days groups following stroke occurrence compared to the control [Figure  2A, 1 day vs. [score:5]
During differentiation or tumor progression, miR-223 suppresses cell proliferation by targeting insulin-like growth factor-1 receptor (IGF1R) [17]. [score:5]
B. miR-223 was significantly up-regulated in patients with LA and SA strokes. [score:4]
microRNA-223, which were negatively correlated with NIHSS scores (r = −0.531, p < 0.01) and infarct volume (r = −0.265, p = 0.039), was significantly up-regulated in large artery and small artery strokes. [score:4]
Moreover, microRNA-223 in blood and brain were positively correlated (r = 0.834, p < 0.05), and they were up-regulated significantly in mice that underwent middle cerebral artery occlusion (p < 0.05). [score:4]
Some known transcriptional factors including NFI-A and C/EBPα regulate miR-223 expression [14]. [score:4]
In vitro studies have demonstrated that miR-223 could specifically regulate IGF1R expression [17]. [score:4]
In hepatic ischemia/reperfusion injury, miR-223 is greatly up-regulated and positively correlates with serum markers of ischemic injury [18]. [score:4]
The expression levels and the time course of blood miR-223 in acute ischemic stroke patients. [score:3]
IGF-1 levels changed with miR-223 levels in the 1 day, 2 days and 3 days groups after ischemia (Figure  4A) and miR-223 expression was positively associated with IGF-1 levels (Figure  4C, r = 0.205, p = 0.022). [score:3]
We did not find the significant difference of the expression levels of miR-223 (data not shown here). [score:3]
Besides, to obtain a temporal expression profile of miR-223 in patients, it is perfect for the extraction of basal samples from the same patients at 24, 48 and 72 hours. [score:3]
We believe that miR-223 has great potential as a novel therapeutic target for ischemic stroke. [score:3]
miR-223 was significantly up-regulated in both brain and blood samples compared to that of the sham in MCAO mice (Figure  3A, brain, MCAO vs. [score:3]
Another study of miR-223 expression proved that miR-223 was greatly increased in the blood of young stroke patients aged 18–49 years [23]. [score:3]
There was no significant correlation between miR-223 expression and IGF1R (Figure  4B, r = −0.023, p = 0.795) and IL-6 (Figure  4D, r = −0.058, p = 0.522). [score:3]
Figure 2 The time course of miR-223 expression and the correlation analysis between miR-223 and clinical information. [score:3]
The Y axis showed the miR-223 expression levels by log2 change. [score:3]
r = −0.265, p = 0.039. miR-223 expression levels of LA or SA stroke patients were significantly increased [Figure  2B, LA vs. [score:3]
A. Bar graphs showed the expression of miR-223 in brain tissue and blood of MCAO mice at 1 day. [score:3]
NIHSS scores had a negative correlation with miR-223 expression in our study, implying the potential neuroprotective role of miR-223 in stroke. [score:3]
Our findings suggested IGF-1 might be a new target of miR-223. [score:3]
Box plots exhibited the time course of miR-223 expression in stroke patients. [score:3]
In our study, we found the similar changes of miR-223 expression in the blood of acute ischemic stroke patients and that the brain miR-223 level positively correlated with blood miR-223 level in ischemic mice. [score:3]
The correlation between miR-223 and potential target genes. [score:3]
In the study, IGF-1 level changed with miR-223 levels in the 1 day, 2 days and 3 days groups after ischemia, suggesting the modulation of miR-223 on IGF-1 expression. [score:3]
miR-223 expression levels were negatively associated with NIHSS scores (Figure  2C, r = −0.531, p < 0.01) and infarct volume (Figure  2D, r = −0.265, p = 0.039). [score:3]
A. miR-223 was highly expressed in 1 day and 3 days stroke patients. [score:3]
The severity of stroke and the infarct volume of stroke patients were negatively associated with miR-223 expression. [score:3]
miR-223 relative expression was normalized to the endogenous control U6 expression in triplicate and was calculated by the 2 [-Δct] method. [score:3]
Studies demonstrated that miR-223 is mainly expressed in bone marrow and plays an important role in granulopoiesis [15]. [score:3]
IL-6 could induce the decrease of miR-223 expression after lipopolysaccharide stimulation in macrophages [16]. [score:3]
To eliminate unmatched factor impaction (hypertension, diabetes and hyperlipidemia) on miR-223 expression levels between two groups, a logistic regression was performed. [score:3]
The Y axis indicated miR-223 expression levels by log2 change. [score:3]
In this study, we demonstrated that miR-223 was hyper-expressed in the circulating blood of acute ischemic stroke patients. [score:3]
Maybe this is a relative broad time range for the expression of miR-223. [score:3]
In the central nervous system miR-223 is also highly present and is neuroprotective by targeting GluR2 and NR2B subunits of the glutamate receptor [19]. [score:3]
However, miR-223 showed opposite expression patterns in LA or SA stroke within 6–18 months [23]. [score:3]
Box plots showed the expression of blood miR-223 in patients and control. [score:3]
Box plots exhibited the miR-223 expression level among different subtypes. [score:3]
Great attention has been paid to miR-223 because it can regulate cell cycle, tumor invasiveness, haematopoietic differentiation and immune cell function [13]. [score:2]
To explore the regulatory mechanism of miR-223 in the ischemic pathological process, we also studied the down-stream insulin-like growth factor-1 (IGF-1), IGF1R and IL-6 changes in stroke patients. [score:2]
Our results suggest that microRNA-223 is associated with acute ischemic stroke and possibly plays a role in stroke through up -regulating growth factor such as insulin-like growth factor-1 gene. [score:2]
The study reported circulating miR-223 based markers for acute ischemic stroke occurrence, subtypes and infarct volume. [score:1]
Figure 3 Blood and brain miR-223 levels were elevated and they have a positive correlation in mice. [score:1]
Brain and blood miR-223 in ischemic mice. [score:1]
Previous animals’ experiments demonstrated that miR-223 level was significantly elevated at 24 and 72 hour reperfusion in rat transient MCAO [25] and at 3 and 24 hours in ischemic preconditioning [26]. [score:1]
D. The scatterplot showed miR-223 levels have a negative correlation with infarct volume of stroke patients. [score:1]
It was plausible to assume that miR-223 takes part in the early inflammatory reaction after stoke through other pathways. [score:1]
Further studies with larger sample sizes are needed to assess the clinical application of miR-223 signatures. [score:1]
Brain miR-223 and blood miR-223 level were significantly elevated and have a positive correlation in MCAO mice. [score:1]
The relationship between the microRNA-223 level and NIHSS scores, TOAST subtypes, and infarct volume was analyzed respectively. [score:1]
However, we did not find a similar correlation between miR-223 and IGF1R in the blood of patients with acute ischemia. [score:1]
D. The scatterplot showed miR-223 was not associated with IL-6 after ischemia. [score:1]
Here we investigated the roles and possible targets of circulating microRNA-223 in human ischemic stroke within the first 72 hours. [score:1]
miR-223 is located in the X chromosome. [score:1]
A positive correlation between the blood miR-223 and the brain miR-223 levels was analyzed by Spearman’s correlation analysis (Figure  3B, r = 0.834, p < 0.05). [score:1]
Whether miR-223 associated with the severe stroke needs to be further studied. [score:1]
The influence of miR-223 levels on a categorical variable was assessed by logistic regression analysis using forward stepwise selection procedures after adjusting for those variables with a proven biological relevance for stoke mobidity to avoid the possibility of finding some spurious associations. [score:1]
The mean NIHSS in our studies is relative low, suggesting miR-223 is sensitive for mild stroke. [score:1]
The plasma level of IGF-1 has a positive correlation to miR-223 level. [score:1]
The plasma level of insulin-like growth factor-1 was positively associated with that of microRNA-223 (r = 0.205, p = 0.022). [score:1]
The results of logistic regression suggested that the level of blood miR-223 was a stroke risk factor (p = 0.011, adjusted odd ratio = 1.002, 95% CI: 1.000-1.004). [score:1]
Figure 1 Blood miR-223 levels were significantly increased in acute ischemic stroke. [score:1]
The relationship between circulating microRNA-223 and pathogenesis of acute ischemic stroke is unknown. [score:1]
We then assessed the relationship between the alteration of circulating miR-223 levels and the NIHSS scores, subtypes and infarct volume of acute stroke patients. [score:1]
ECA: External carotid artery; IGF-1: Insulin-like growth factor-1; IGF1R: Insulin-like growth factor-1 receptor; IL-1β: interlukin-1β; IL-6: Interlukin-6; ICA: Internal carotid artery; MCAO: middle cerebral artery occlusion; miR-223: microRNA-223; NIHSS: National Institutes of Health Stroke Scale; TOAST: Trial of Org 10172 in acute stroke treatment criteria. [score:1]
The result suggested that miR-223 is involved in the process of ischemia and hypoxia and implied that blood miR-223 represents the changes of miR-223 in brain response to ischemic stroke. [score:1]
C. The scatterplot showed miR-223 levels were negatively associated with NIHSS scores. [score:1]
Here, we analyzed changes of miR-223 levels in acute ischemic stroke patients and animal ischemia mo del. [score:1]
B. The scatter plot demonstrated the positive correlation between blood miR-223 and brain miR-223 at 1 day after ischemia. [score:1]
The changes of miR-223 levels for stroke diagnosis and their relationship with clinical confound factors need to be explored. [score:1]
Figure 4 The relationship between miR-223 and IGF1R, IGF-1 and IL-6. A. Line chart exhibited the changes of miR-223, IGF-1, IGF1R and IL-6 within 72 hours. [score:1]
To develop a novel technique quickly detect the changes of miR-223 will greatly help to the diagnosis of stroke. [score:1]
miR-223 levels were greatly increased in patients with LA and SA stroke. [score:1]
But we did not find a correlation between miR-223 and IL-6 levels in vivo. [score:1]
microRNA-223 was detected by real-time polymerase chain reactions. [score:1]
Increasing evidences suggest miR-223 plays a vital role in modulating inflammatory reactions [15]. [score:1]
The relationship between miR-223 and TOAST subtypes, NIHSS scores and infarct volume. [score:1]
B. The scatterplot showed miR-223 was not associated with IGF1R after ischemia. [score:1]
C. The scatterplot demonstrated miR-223 was positively correlated to IGF-1. r = 0.205, p = 0.022. [score:1]
However, the function of miR-223 associated with acute ischemic brain injury (less than 72 hours) remains unknown. [score:1]
[1 to 20 of 84 sentences]
12
[+] score: 182
To support the role of miR-223 -targeting EPB41L3 to promote A549 cells invasion, direct silencing of EPB41L3 expression by EPB41L3 siRNA showed an increased A549 cells invasion and overexpressing of EPB41L3 expression by miR-223-resistant EPB41L3-overexpress plasmid showed a suppressed A549 cell invasion (Additional file 1: Figure S3). [score:14]
Although our data indicate that upregulation of miR-223 in anucleate platelets is not derived from de novo miR-223 synthetic pathway but from the direct maturation of pre-miR-223, the mechanism by which the upregulation of miRNAs in platelets is governed remains to be further explored. [score:8]
To overexpress EPB41L3, an expression plasmid designed to specifically express the full-length open reading frame (ORF) of EPB41L3 without the miR-223-responsive 3′-UTR was also constructed and transfected into A549 cells. [score:7]
It has been also reported that miR-223 directly target the 3′UTR of erythrocyte membrane protein band 4.1-like 3 (EPB41L3) [35] and is the most upregulated miRNA in recurrent tumors [36]. [score:7]
The role of EPB41L3 in inhibiting A549 cell invasion was further validated by directly downregulating EPB41L3 via transfecting cells with EPB41L3 siRNA or miR-223 mimic. [score:7]
In conclusion, our results demonstrated that miR-223 directly binds to the 3′-UTR of the EPB41L3 mRNA transcript and inhibits EPB41L3 translation. [score:6]
The promotion of A549 cells invasion by P-MVs was largely abolished by depleting miR-223 using anti-miR-223 ASO and overexpressing EPB41L3 via miR-223-resistant EPB41L3 -expressing plasmid (Figure  6A and B). [score:5]
Figure 4 Direct regulation of EPB41L3 expression by miR-223. [score:5]
To determine whether exogenous miR-223 delivered by P-MVs has a biological function in A549 cells, we analyzed the potential target genes of miR-223 using three computer-aided algorithms, TargetScan, miRanda, and PicTar. [score:5]
Our study demonstrates for the first time that platelet-secreted miR-223 via P-MVs can promote lung cancer cell invasion via targeting tumor suppressor EPB41L3. [score:5]
Moreover, compared with cells transfected with pre-miR-223 alone, those transfected with both pre-miR-223 and the EPB41L3 -expressing plasmid lack of the miR-223-responsive 3′-UTR, exhibited higher EPB41L3 protein levels (Figure  4F and G), suggesting that miR-223-resistant EPB41L3 is sufficient to rescue the suppression of EPB41L3 by miR-223. [score:4]
As a hematopoietic-specific miRNA with crucial functions in myeloid lineage development [53, 54], miR-223 has been shown to target a transcription factor Mef2c [53], CEBP-beta [55], glutamate receptors (GluR2 and NR2B) [56], IGF-1R [57] and EPB41L3 [34] in other cell types. [score:4]
Transfection with pre-miR-control, pre-miR-223, small interference RNAs (siRNAs) and miR-223-resistant EPB41L3 -expressing plasmid. [score:3]
This mutated luciferase reporter was unaffected by overexpression miR-223 (Figure  4C). [score:3]
As shown in Figure  1B, the levels of pre-miR-223 in the platelets of NSCLC patients were rapidly increased compared to platelets of healthy volunteers, which is inversely correlated to the up-regulation of miR-223 in platelets of NSCLC patients. [score:3]
We determined the possible role of miR-223 delivered by P-MVs targeting EPB41L3 in modulating the A549 cells invasion process. [score:3]
The effect of P-MVs on reducing target cell EPB41L3 and promoting tumor cell invasion is in proportion to the level of miR-223 in P-MVs. [score:3]
As the previous study [34], overexpression of miR-223 in A549 cells via transfection of miR-223 mimic (Figure  4B) clearly showed that miR-223 strongly reduced protein level (Figure  4D and E). [score:3]
Furthermore, as depletion of miR-223 by anti-miR-223 ASO and miR-223-resistant EPB41L3-overexpress plasmid treatment can effectively decreased A549 cells invasion, our study also provides a potential miRNA -based therapeutic strategy for lung cancers. [score:3]
Platelet miR-223 promotes A549 cells invasion via targeting EPB41L3. [score:3]
Figure 5 Exogenous miR-223 delivered by P-MVs reduced EPB41L3 protein expression in A549 cells. [score:3]
Recently, we reported that P-MVs could effectively deliver miR-223 into human umbilical vein endothelial cells (HUVECs), in which platelet miR-223 targeted IGF-1R and promoted HUVEC apoptosis induced by advanced glycation end products (AGEs) [31]. [score:3]
Li et al. [34] examined miRNAs in several human gastric cell lines and showed that miR-223 is specifically overexpressed in metastatic gastric cells and stimulates tumor cell invasion. [score:3]
To test the direct binding of miR-223 to the target gene EPB41L3, a luciferase reporter assay was performed. [score:3]
As shown in Figure  4A, we predicted EPB41L3 as a target gene of miR-223. [score:3]
First, we found that the levels of miR-223 in both platelets and P-MVs were significantly upregulated in lung cancer patients compared to those in cancer-free controls. [score:3]
Given that miR-223 is the most abundant miRNA in the platelets and P-MVs [31, 32] and its expression is deregulated in many types of cancer [33- 36], it is considered as a member of an emerging family of tumor-promoting miRNAs called oncomiRs. [score:3]
Third, exogenous miR-223 derived from platelets reduced the protein level of tumor suppressor EPB41L3 and thus promoted the lung cancer cells invasion. [score:3]
These results collectively showed that platelet-secreted miR-223 via P-MVs could be effectively delivered into A549 cells, in which it targets EPB41L3, and thus promotes cell invasion. [score:3]
Furthermore, we showed that P-MVs could effectively deliver miR-223 into human lung cancer cells A549, in which platelet miR-223 targeted EPB41L3 and thus promoted A549 invasion. [score:3]
Incubation of human lung cancer A549 cells with P-MVs resulted in rapid delivery of miR-223 into A549 cells, in which platelet miR-223 targeted EPB41L3 and thus promoted A549 cell invasion. [score:3]
For miR-223 overexpression, 100 pM pre-miR-223 or scrambled control miRNA (pre-miR control) was used (Invitrogen). [score:3]
It has been reported that miR-223 could promote breast cancer invasiveness by suppressing Mef2c (Myocyte enhancer factor 2c) [33]. [score:3]
Furthermore, we introduced point mutations into the corresponding complementary sites in the 3′-UTR of EPB41L3 to eliminate the predicted miR-223 binding sites. [score:2]
Moreover, compared with cells transfected with pre-miR-223 alone, those transfected with both pre-miR-223 and the EPB41L3-overexpression plasmid exhibited significantly lower invasion rates (Figure  6A and B), suggesting that miR-223-resistant EPB41L3 sufficiently attenuated the promotion effect of invasion of miR-223 on lung cancer cells. [score:2]
For luciferase reporter assays, A549 cells were cultured in 24-well plates, and each well was transfected with 1 μg of firefly luciferase reporter plasmid, 1 μg of a β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (100 pmol) of pre-miR-223 or the scrambled negative control RNA using Lipofectamine 2000 (Invitrogen). [score:2]
By the luciferase reporter assay and experimental validation, we confirmed EPB41L3 as a target of miR-223 in lung cancer A549 cells. [score:2]
In summary, our results demonstrate the miR-223 level in the platelet and P-MVs were significantly increased during lung cancers patients, and that through release of miR-223-containing P-MVs, platelets of lung cancers patients can remotely modulate the invasion of lung cancer cells. [score:1]
Figure 1 The levels of miR-223 and pre-miR-223 in platelets isolated from NSCLC patients or Lewis lung carcinoma mice. [score:1]
Because P-MVs generally account for two-thirds of circulating MVs in peripheral bloodstream, this result suggests that P-MVs from Lewis lung carcinoma mice contain a higher level of miR-223 than normal mice. [score:1]
To test the binding specificity, the sequences that interacted with the miR-223 seed sequence were mutated (from AACUGAC to UUGACUG), and the mutant EPB41L3 3′-UTR was inserted into an equivalent luciferase reporter. [score:1]
Figure 3 Effective delivery of platelet miR-223 into A549 cells by P-MVs. [score:1]
Figure 6 Platelet miR-223 delivered by P-MVs promotes A549 cells migration. [score:1]
The level of miR-223 was assessed by qRT-PCR and normalized against the amount of total RNA. [score:1]
Figure 2 The level of miR-223 in P-MVs isolated from NSCLC patients and Lewis lung carcinoma mice. [score:1]
As expected, luciferase activity was also markedly reduced in the cells transfected with pre-miR-223 (Figure  4C). [score:1]
The levels of miR-223 and pre-miR-223 were assessed by qRT-PCR and normalized against blood volume. [score:1]
In contrast, the pre-miR-223 level in the recipient A549 cells was not altered by incubation with P-MVs (Figure  3F), suggesting that the elevation of miR-223 level in A549 cells is not due to de novo miRNA biosynthesis but derived from P-MV delivery. [score:1]
To determine the potential biological functions of the miRNA-containing P-MVs, we studied the delivery of miR-223 into A549 cells via P-MVs. [score:1]
In agreement with this observation, incubation of A549 cells with P-MVs at 37°C strongly increased miR-223 level, and this elevation could be largely abolished by co-transfecting A549 cells with anti-miR-223 antisense oligonucleotide (ASO) (Figure  3E). [score:1]
As can be seen in Figure  6, treatment with the P-MVs from NSCLC patients, which contain higher level of miR-223 than the P-MVs from cancer-free donors, resulted in the largest invasion of tumor cells. [score:1]
Our results demonstrated that platelets from NSCLC patients contain higher level of miR-223 than that from healthy subjects. [score:1]
Interestingly, we found that, under tumor condition, the level of miR-223 in both platelets and P-MVs were increased. [score:1]
Diehl et al. [28] reported that miRNAs, including miR-19, miR-21, miR-126, miR-133, miR-146 and miR-223, could be detected in P-MVs, suggesting that platelets can secrete their miRNAs through P-MVs. [score:1]
Although the effect of factors other than platelet miR-223 on the reduction of EPB41L3 and promotion of A549 cells invasion cannot be excluded at this stage, depleting miR-223 in A549 cells by anti-miR-223 ASO largely reversed the enhancement of A549 cell invasion by P-MVs, implicating that miR-223 in P-MVs plays a key role in modulating A549 cell invasion by P-MVs. [score:1]
We found that the miR-223 level increased from 3.86 × 10 [−8] fM of healthy volunteers to 1.80 × 10 [−6] fM of NSCLC patients per platelet (Additional file 1: Figure S1). [score:1]
In the present study, we explored the role of microRNA-223 (miR-223) derived from platelets in modulating lung cancer cell invasion. [score:1]
Synthetic oligonucleotides, including pre-miR-223, anti-miR-223, and scrambled negative control (pre-miR-control and anti-miR-control), were purchased from Ambion (Austin, TX). [score:1]
In the present study, we explored the role of miR-223 derived from anucleate platelets in modulating lung cancer cell invasion. [score:1]
This finding suggested that the binding site strongly contribute to the interaction between miR-223 and EPB41L3 mRNA. [score:1]
These results confirmed the role of miR-223 delivered by P-MVs in reducing EPB41L3 levels in the A549 cells. [score:1]
P-MVs effectively deliver miR-223 into the recipient A549 cells. [score:1]
As shown in Figure  1A, miR-223 in the platelet of per milliliter blood from NSCLC patients increased about 10-fold than healthy volunteers. [score:1]
The effect of P-MVs on EPB41L3 reduction and enhancement of tumor cell invasion was largely abolished by depleting miR-223, suggesting that miR-223 play a key role in these processes. [score:1]
EPB41L3 Band 4.1-like protein 3 miR-223 microRNA-223 NSCLC Non-small cell lung cancer P-MVs Platelet-secreted microvesicles MVs Microvesicles PLT Platelet numbers PCT Platelet hematocrit MPV The mean platelet volume PDW Platelet distribution width This work was supported by grants from the National Basic Research Program of China (973 Program, 2012CB517603 and 2011CB504803), the National Natural Science Foundation of China (No. [score:1]
More interestingly, although the incubation with P-MVs of healthy volunteers could increase the miR-223 level in the A549 cells more than 20-fold, incubation with the P-MVs of NSCLC patients further increased the miR-223 level in the A549 cells more than 200-fold (Figure  3E). [score:1]
The effect of P-MVs on reducing EPB41L3 in A549 cells but promoting tumor cell invasion could be largely abolished by depletion of miR-223 via transfection with miR-223 antagomir. [score:1]
We next determined whether the exogenous miR-223 delivered by P-MVs could affect the level of EPB41L3 in the recipient A549 cells. [score:1]
Western blot analysis demonstrated that incubation of A549 cells with P-MVs significantly decreased the levels of cellular EPB41L3 protein, and this reduction of EPB41L3 protein levels by P-MVs was largely abolished by co-transfection with the anti-miR-223 ASO (Figure  5A and B). [score:1]
In the present study, we reported that P-MVs contain various miRNAs, particularly miR-223, which displays the highest level in platelets, and these platelet miRNAs can be delivered into recipient tumor cells via P-MVs. [score:1]
As the previous study [34], A549 cells transfected with pre-miR-223 showed an increased invasion (Figure  6A and B). [score:1]
[1 to 20 of 71 sentences]
13
[+] score: 172
Other miRNAs from this paper: hsa-mir-105-1, hsa-mir-105-2, hsa-mir-760
Overexpression of miR-223 decreased expression of ARTN in KYSE150 cells while silencing miR-223 increased expression of ARTN in EC9706 cells. [score:7]
MMP-2 and MMP-9 levels were decreased following up-regulation of miR-223, whereas MMP-2 and MMP-9 levels were increased by inhibition of miR-223 (Figure 4I, G). [score:6]
Mutation of the binding site abolished the ability of miR-223 to inhibit the expression of the luciferase reporter (Figure 3B). [score:6]
Regulation of miR-223 expression affected the expression of ARTN as well as cell migration and invasion in esophageal carcinoma cells. [score:6]
Future studies should examine how miR-223 is regulated in human cancer and other human diseases and whether both ARTN and miR-223 are targets for therapy. [score:6]
These results reveal that ARTN, a known tumor metastasis-related gene, is a direct target of miR-223 and that miR-223 may have a tumor suppressor function in esophageal carcinoma and could be used in anticancer therapies. [score:6]
Down-regulation of miR-223 has in vivo significance in chronic lymphocytic leukemia and improves disease risk stratification [19]. [score:6]
Consistent with the migration results, overexpression of miR-223 significantly inhibited invasion of KYSE150 cells (Figure 4E, F). [score:5]
Interestingly, ARTN expression levels were higher in KYSE150 and KYSE510 than in EC9706 and TE13 cell lines, suggesting that expression of miR-223 was inversely related to ARTN protein level in esophageal carcinoma. [score:5]
The overexpression of mir-223 did not inhibit proliferation of KYSE150 cells. [score:5]
High expression of miR-223 was detected in KYSE150 and KYST510 cell lines, while low expression of miR-223 was detected in EC9706 and TE13 cell lines (Figure 3D). [score:5]
Finally, we validated that ARTN is a direct target of miR-223 in the context of human esophageal carcinoma. [score:4]
Furthermore, down-regulation of miR-223 was associated with poor prognosis in chronic lymphocytic leukemia [18, 19]. [score:4]
Furthermore, ARTN mRNA was a direct and functional target of miR-223. [score:4]
To verify whether ARTN expression is regulated by miRNAs, miR-105, miR-223 and miR-760 were chosen for further study according to the results of a bioinformatic search. [score:4]
Co-transfection of a mir-223 expression vector with pMIR-ARTN led to the reduced activity of luciferase in a dual-luciferase reporter gene assay, suggesting that ARTN is a target gene of miR-223. [score:4]
miR-223 interacts with the ARTN 3'UTR and regulates endogenous ARTN protein expression. [score:4]
In EC9706 cells, the morphology and proliferation did not change when the cells were transfected with a mir-223 inhibitor or Scr-miR-223. [score:3]
To further study the potential relationship between miR-223 and ARTN, we analyzed miR-223 and ARTN expression level in esophageal cancer tissues. [score:3]
Figure 3. (A) The miR-223 expression vector pcDNA3.1 (+)-miR-223 reduced the activity of firefly luciferase. [score:3]
We also analyzed miR-223 expression level in four esophageal squamous cell lines (KYSE150, KYSE510, TE13 and EC9706). [score:3]
Meanwhile, EC9706 cells transfected with either an miR-223 inhibitor or Scr-miR-223 closed the scratch-wounds more quickly than cells that were untreated or transfected with pcDNA3.1(+) (Figure 4C, D). [score:3]
Consistent with this result, silencing of miR-223 using an miR-223 inhibitor resulted in an increase of ARTN protein level in EC9706 cells (Figure 3F). [score:3]
miR-223 was found to be downregulated in breast and ovarian cancer specimens compared to normal ovarian tissues [23]. [score:3]
The EC9706 cells transfected with the miR-223 inhibitor could effectively penetrate the chamber and travel to the other side of the membrane (Figure 4G, H). [score:3]
To develop potential therapy targeting ARTN, we studied the roles of miR-223 in the migration and invasion of human esophageal carcinoma. [score:3]
The negative correlation of miR-223 and ARTN expression was found (Figure 3C). [score:3]
Finally, we revealed that miR-223 overexpression repressed cell migration and invasion in human esophageal carcinoma cell lines. [score:3]
miR-105, miR-223 and miR-760 including a 200 bp flanking sequence were cloned from human genomic DNA and inserted into pcDNA3.1 (+) multiple cloning sites to construct the miRNAs expression vectors. [score:3]
To explore the potential role of miR-223 in the migration of esophageal carcinoma cell lines, we first examined the effect of the overexpression of miR-223 in KYSE150 cells, which have very low levels of endogenous miR-223, on cell migration. [score:3]
Furthermore, ARTN is a target gene of miR-223. [score:3]
In the present study, overexpression of miR-223 leads to a decrease in ARTN function and represses cellular migration and invasion in KYSE150 cells. [score:3]
Figure 4 Effect of miR-223 expression on migration in esophageal carcinoma cells. [score:3]
On the contrary, silencing of miR-223 increases ARTN expression and promotes cellular migration and invasion in EC9706 cells. [score:3]
Mutations of miR-223 binding sites were introduced by site-directed mutagenesis; four nucleotides within the core binding sites of ARTN 3'UTR were changed. [score:3]
These observations indicate that miR-223 can inhibit invasion in human esophageal carcinoma cell lines. [score:3]
For transfection, cells were grown to 80% confluency and transfected with RNAi vector, recombined eukaryotic vector, a chemically synthesized miRNA-223 inhibitor or a negative control using Lipofectamine 2000 (Invitrogen, CA, USA), according to the manufacturer's recommendation. [score:3]
The miR-223 expression vector pcDNA3.1 (+)-miR-223 reduced the firefly luciferase activity (Figure 3A). [score:3]
Furthermore, overexpression of miR-223 in KYSE150 cells decreased cell migration and invasion. [score:3]
EC9706 cells, which have a high level of endogenous miR-223, were transfected with an miR-223 inhibitor or a negative control. [score:3]
There is emerging evidence that suggests that miR-223 plays an important role in cell proliferation, hematopoietic development and differentiation [20- 22]. [score:2]
These results indicate that ARTN is post-transcriptionally regulated by miR-223. [score:2]
We transfected pcDNA3.1 (+)-miR-223 and pcDNA3.1 (+) empty vector into KYSE150 cells and observed a decrease of ARTN protein level in the presence if miR-223 (Figure 3E). [score:1]
To examine invasion, KYSE150 cells were transfected with either pcDNA3.1 (+)-miR-223 or pcDNA3.1 (+) and reseeded on top of the insert. [score:1]
ARTN mRNA contains a binding site for miR-223 in the 3'UTR. [score:1]
miR-223 has no effect on the proliferation of esophageal carcinoma cells. [score:1]
The demonstrates that miR-223 does not significantly influence the proliferation of esophageal carcinoma cells. [score:1]
KYSE150 cells transfected with pcDNA3.1 (+)-miR-223 closed the scratch-wounds more slowly than cells that were untreated or transfected with pcDNA3.1 (+) (Figure 4A, B). [score:1]
Subsequently, transfections were carried out in HEK293 cells with pMIR-ARTN and pcDNA3.1(+)-miR-223 or pMIR-ARTN-Mut and pcDNA3.1(+)-miR-223. [score:1]
Silencing of miR-223 in EC9706 cells increased cell migration and invasiveness. [score:1]
The genomic sequences, including 200 bp flanking sequences, of the human miR-105, miR-223 and miR-760 genes were cloned from HEK293 cells. [score:1]
KYSE150 cells were transfected with pcDNA3.1 (+) or pcDNA3.1 (+)-miR-223 prior to the proliferation assy. [score:1]
Effect of mir-223 on the migration of esophageal carcinoma cells. [score:1]
As a result, the three miRNAs with the highest free energy (hsa-mir-105, hsa-mir-223 and hsa-mir-760) were chosen. [score:1]
[1 to 20 of 54 sentences]
14
[+] score: 167
We believe it is likely that upregulation of miR-223 in human obesity has a net suppressive effect on the inflammatory cascade in visceral adipose tissue macrophages representing a compensatory adaptation to the inflammatory disease. [score:8]
TLR4 signaling is known to be involved in the etiology of meta-flammation and LPS stimulation of TLR4 is known to downregulate miR-223 expression during macrophage polarization [5]. [score:6]
We hypothesized a link between macrophage miR-223 expression and TLR4 signaling -mediated changes in FBXW7 expression, which have not been previously reported. [score:5]
However, we believe that the miR-223 levels we report are largely due to the VAT macrophage population because it has been clearly shown that miR-223 is most abundantly expressed in myeloid-derived cells, though other cell and tissue types do express miR-223 at lower levels [13, 14]. [score:5]
Interestingly, Haneklaus et al. found that overexpression of miR-223 prevented the accumulation of NLRP3 protein and inhibited IL-1β production by the inflammosome. [score:5]
We found that co-transfection of a miR-223 mimic with the hFBXW7 3’-URT (WT UTR) plasmid decreased luciferase expression / function to a significant degree, demonstrating that miR-223 mimics can repress a surrogate of human FBXW7 expression. [score:5]
We found that miR-223 was significantly upregulated in the liver and adipose of obese mice compared to lean wild type C57BL/6 control mice; expression was normalized to snoRNA234 in murine samples (Fig 4A). [score:5]
Our data suggests a miR-223-FBXW7-TLR4 regulatory axis, with macrophage miR-223 levels likely modulating the inflammatory response to LPS via effects on FBXW7 and TLR4 expression. [score:4]
Based on these findings and bioinformatics predictions we hypothesized that miR-223 expression in VAT macrophages regulated both pro- and anti-inflammatory pathways including the E3 ubiquitin ligase FBXW7. [score:4]
The authors attributed their result to miR-223 -mediated suppression of Pknox1 function, a positive regulator of macrophage activation. [score:4]
However, our study demonstrates that miR-223 levels potently regulating macrophage FBXW7, a key suppressor of TLR4. [score:4]
Further, we showed that miR-223 upregulation in the VAT was specific to the SVF. [score:4]
These data suggest that miR-223 plays a significant role in both pro and anti-inflammatory pathways in mature macrophages and that further elucidation of the intricacies of this regulation is important to inflammatory diseases. [score:4]
We found that miR-15b, -451, -486, and -223 were significantly upregulated in the SVF, with miR-223 being the most dramatically increased in the obese group (Fig 2A). [score:4]
Our data showing miR-223 -mediated repression of FBXW7 in macrophages as well as the downregulation of miR-223 upon LPS stimulation strongly support a role for miR-223 in the interplay between FBXW7 and TLR4. [score:4]
miR-223 was significantly upregulated in whole adipose in cohort 2 (Fig 2B). [score:4]
Expression of miR-223 is regulated by several transcription factors, including transcription factor PU. [score:4]
miR-223 targets the protein ubiquitination pathway. [score:3]
miR-223 mimic reduces TLR4 expression in macrophages stimulated with LPS. [score:3]
MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7. J Biol Chem. [score:3]
0165962.g003 Fig 3Pathway analysis of miR-223 gene targets using IPA [®] software by Ingenuity Systems (Qiagen). [score:3]
In order to identify an appropriate gene target for miR-223, we utilized 11 separate tools for maximal predictive power (DIANA-microT (http://www. [score:3]
To our knowledge, this is the first study to report that miR-223 affects NOS2 levels and provides an additional mechanism by which miR-223 expression in macrophages modulates an activated phenotype. [score:3]
Ablation of miR-223 resulted in enhanced IFNγ/LPS -induced NOS2 expression. [score:3]
Ingenuity pathway analysis (IPA) was used to sort potential targets of miR-223 by canonical pathways potentially relevant to diabetes, cellular energy utilization, and inflammation (Fig 3). [score:3]
Pathway analysis of miR-223 gene targets using IPA [®] software by Ingenuity Systems (Qiagen). [score:3]
miR-223 suppresses macrophage activation via inducible nitric oxide synthase. [score:3]
Murine obesity demonstrated increased miR-223 expression and repressed FBXW7 levels. [score:3]
NO also functions in vasodilation, thus miR-223 expression in obesity may have implication in cardiovascular changes associated with macrophage inflammation (foam cells, atherogenesis) [25]. [score:3]
Our data, combined with these previous reports, suggest that miR-223 expression changes in the liver may further modulate an FBXW7-SREBP1 connection. [score:3]
FBXW7 has previously been shown to be a target of miR-223 [11], however the FBXW7-miR-223 axis in macrophage inflammation has not been reported. [score:3]
Our data shows that miR-223 null macrophages express significantly higher levels of inducible nitric oxide synthase (NOS2) (Fig 5C). [score:3]
miR-223 mimic reduces TLR4 expression in LPS-stimulated macrophages. [score:3]
We see that removal of miR-223 increases both TLR4 and FBXW7 levels, though unstimulated knockout macrophages have a higher normalized TLR4/FBXW7 ratio, indicating an enhanced ability to respond to LPS. [score:2]
0165962.g006 Fig 6 (A) WT BMM have about 21,000-fold greater expression of miR-223 by TaqMan probe -based qPCR compared to miR223 KO BMMs. [score:2]
Zhuang et al. showed that miR-223 whole body knockout mice developed worsened insulin resistance with high fat diet feeding and diet -induced obesity [23]. [score:2]
The pMIR-REPORT-hFBXW7-WT construct was mutated at 4 miR-223 seed / binding sites using the Stratagene Quikchange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) according to manufacturer instructions. [score:2]
Our study suggests that a miR-223-FBXW7-TLR4 axis plays a strong role in the macrophage inflammatory phenotype, with ablation of miR-223 regulating multiple pathways including Toll-like receptor 4 (TLR4), STAT3, and inducible nitric oxide synthase (NOS2) signaling. [score:2]
miR-223 is known to play a conserved role in the development and homeostasis of myeloid and granulocyte differentiation. [score:2]
miR-223 regulates the production of nucleotide -binding oligomerization domain-like receptor protein 3 (NLRP3) and IL-1β [21]. [score:2]
IFNγ and/or LPS activation of mBMMs and RAW264.7 cells resulted in a 50% decrease in miR-223 levels (Fig 5A & 5B), indicating that TLR4 signaling regulates miR-223 transcription or pri-miRNA maturation. [score:2]
We believe that the role of miR-223 in meta-flammation is multifactorial and involves regulation of FBXW7, TLR4, STAT signaling, and nitric oxide (NO) production in macrophages. [score:2]
Colonies were screened for quadruple miR-223 mutations and validated by sequencing. [score:2]
miR-223 null macrophages have enhanced inflammatory signaling and increased FBXW7 levels. [score:1]
Dual stimulation with IFNγ and LPS resulted in a significant, but modest decrease in miR-223 null macrophages, significantly contrasted by the dramatic decrease of FBXW7 in WT macrophages. [score:1]
miR223 KO BMMs electroporated with miR-223 mimic (500nM) had levels about 10-fold higher than WT BMMs (Fig 6A and 6B). [score:1]
Optimizing transfection in primary macrophages is challenging and our goal was to replete the miR223 KO BMMs to a level reasonably comparable to WT (within a physiologic range). [score:1]
10 [6] HeLa cells (ATCC) were co -transfected with pMIR-REPORT-hFBXW7-WT or pMIR-REPORT-hFBXW7-quadruple mutant (MUT), miR-223 mimic—50nM (mirVana [™] by Life Technologies), and β-gal transfection control plasmid using an Eppendorf Multiporator [™]. [score:1]
miR223 KO BMMs were grown until confluent (day 7), scraped in warm 1X PBS, before the appropriate number of cells were aliquoted, spun and resuspended in Eppendorf hypo-osmotic buffer at 10 [6] cells/ml. [score:1]
miR-223 was not altered in the adipocyte fraction or in PBMCs (Fig 2D). [score:1]
hsa-miR-223 levels in circulating human blood monocytes isolated with Ficoll-Paque Plus (GE Healthcare). [score:1]
“WT UTR” indicates a vector containing un-mutated hFBXW7 3’-UTR and “Mutated UTR” indicates a vector containing hFBXW7 3’-UTR that has been mutated at all four miR-223 seed sequences. [score:1]
In order to assess the significance of miR-223 as a broadly conserved pathophysiologic change, we isolated RNA from the adipose, liver and muscle of ob/ob mice at approximately 20 weeks of age. [score:1]
Peripheral human blood monocytes miR-223 levels were no different between lean and obese groups, supporting our interpretation that the obesity -associated miR-223 induction is specific to changes in tissue macrophage phenotype. [score:1]
miR-223 was the second most correlated with BMI. [score:1]
After 10 minutes in the hypo-osmotic buffer, cells were electroporated (Eppendorf Multiporator [™]) at 1200V, 50μs in the presence of 500nM of miR-223 mimic or mimic control oligo. [score:1]
Thus, we believe that the miR-223-FBXW7 axis in macrophage inflammation is an important mechanism in balancing TLR4 -mediated inflammation in macrophages and is relevant to metaflammation. [score:1]
“+miR-223” indicates co-transfection of miR-223 mimic. [score:1]
pSTAT3 and total STAT3 levels in miR-223 null macrophages were clearly elevated over WT, as were levels of NOS2, indicating an enhanced inflammatory response to LPS and IFNγ/LPS. [score:1]
0165962.g004 Fig 4(A) mmu-miR-223 levels were significantly increased in the whole adipose and liver tissues, but not in skeletal muscle. [score:1]
WT and miR-223 [-/-] mice were obtained from Jackson Laboratories. [score:1]
Primary mouse macrophage transfection with miR-223 mimic and oligo control. [score:1]
In order to better understand the interplay between miR-223, FBXW7 and macrophage inflammatory signaling, we compared primary bone marrow derived macrophages (mBMMs) from wild type and miR-223 whole body knockout mice. [score:1]
[1 to 20 of 63 sentences]
15
[+] score: 146
Other miRNAs from this paper: hsa-mir-21, hsa-mir-200b, hsa-mir-200c
To further examine whether miR-223 was required for the protective effects of antioxidants against apoptosis induced by AGE-HSA, cells were transfected with miR-223 mimics or inhibitors in the presence or absence of antioxidants and then treated with AGE-HSA (300 μg/ml) for 24 h. We found that the protection conferred by the antioxidants was diminished by upregulation of miR-223, but amplified by downregulation of miR-223 (Figs 3 and 4). [score:9]
In conclusion, the present study suggests that miR-223 transfection bypasses antioxidant suppression of AGE -induced apoptosis at least partially through upregulation of FGFR2 expression. [score:8]
How to cite this article: Wang, Z. et al. Antioxidants inhibit advanced glycosylation end-product -induced apoptosis by downregulation of miR-223 in human adipose tissue-derived stem cells. [score:6]
These results indicated that miR-223 may act as a positive modulator of AGE-BSA -induced apoptosis in ADCSs, and that antioxidants inhibit AGE-HSA -induced apoptosis by downregulation of miR-223 in ADSCs. [score:6]
As shown in Fig. 2B, antioxidant pretreatment significantly suppressed upregulation of miR-223 in ADSCs induced by AGE-HSA (P < 0.05). [score:6]
Antioxidants suppress upregulation of miR-223 in ADSCs induced by AGE-HSA. [score:6]
To determine whether antioxidants affect the expression of miR-223 in ADSCs induced by AGE-HSA, the cells were pretreated with antioxidants for 20 h and then treated with AGE-HSA (300 μg/ml) for 24 h. Expression of miR-223 was then determined by RT-PCR. [score:5]
The results showed a significant increase in the miR-223 expression of ADSCs treated with AGE-HSA, but a reduction of in miR-223 expression when cells were pretreated with antioxidants before treatment with AGE-HSA. [score:5]
To determine whether AGE-HSA affects the expression of miR-223 in ADSCs, the cells were treated with HSA (300 μg/ml) or AGE-HSA (50–500 μg/ml) for 24 h, and then the expression of miR-223 was determined by RT-PCR. [score:5]
FGFR2 is a direct target of miR-223 in ADSCs. [score:4]
Furthermore, transfection of miR-223 inhibitors negatively regulated the caspase 3 activity induced by AGE-HSA (P < 0.05) (Fig. 4B). [score:4]
Role of downregulation of miR-223 in the protective effects of antioxidants on AGE-HSA -induced apoptosis of ADSCs. [score:4]
FGFR2 is a direct target of miR-223. [score:4]
Effects of antioxidants on AGE-HSA -induced upregulation of miR-223 in ADSCs. [score:4]
In contrast, cells transfected with miR-223 inhibitors showed negative regulation of the apoptosis induced by AGE-HSA (P < 0.05) (Fig. 4A). [score:4]
Downregulation of miR-223, through its positive effects on ADSCs, might help to restore the ability to heal wounds in diabetic individuals. [score:4]
Transfection of miR-223 inhibitors also resulted in negatively regulation of the ROS generation induced by AGE-HSA (P < 0.05) (Fig. 4C,D). [score:4]
At 70% confluence, the cells were transfected with miR-223 mimics, miR-223 inhibitors, or a negative control. [score:3]
Next, we further examined whether the counteraction of miR-223 overexpression against the protective effect of antioxidants on AGE-HSA -induced apoptosis is mediated by FGFR2. [score:3]
Next, we identified the miR-223 target gene to gain a further insight into the molecular mechanisms of miR-223 in the protective effects of antioxidants against AGE-HSA -induced apoptosis. [score:3]
Reintroduction of miR-223 by transient transfection or siRNA silencing of the target gene (FGFR2) blocked the protective effects of antioxidants on AGE-HSA -induced apoptosis and increased the production of ROS, while increasing the level of apoptosis and activity of caspase-3 in ADSCs. [score:3]
Our results support the notion that protective effects of antioxidants on AGE-HSA -induced apoptosis in ADSCs are partially mediated by a reduction in miR-223 expression. [score:3]
Apoptosis of human umbilical vein endothelial cells exposed to AGEs also involves miR-223 via targeting IGFR1 33. [score:3]
These results showed that FGFR2 underwent direct negative regulation by miR-223 in ADSCs. [score:3]
Transfection of miR-223 mimics or inhibitors was carried out as described previously 11. [score:3]
As shown in Fig. 2A, cells treated with AGE-HSA showed an increase in the expression of miR-223. [score:3]
Role of overexpression of miR-223 in the protective effects of antioxidants on AGE-HSA -induced apoptosis of ADSCs. [score:3]
org) was used to predict the potential target of miR-223. [score:3]
These results demonstrated that miR-223 may target FGFR2 in ADSCs. [score:3]
To assess the role of miR-223 in response to AGE-HSA and antioxidant treatments, apoptosis and ROS generation were examined in ADSCs in the presence or absence of miR-223 mimics or inhibitors. [score:3]
Moreover, the results of caspase-3 activity analysis showed that transfection of miR-223 mimics positively regulated the caspase 3 activity induced by AGE-HSA (P < 0.05) (Fig. 3B). [score:2]
The results of apoptosis analysis showed that transfection of miR-223 mimics positively regulated the apoptosis induced by AGE-HSA (P < 0.05) (Fig. 3A). [score:2]
Here, we aimed to clarify the biological role of miR-223 in ADSC apoptosis regulation by AGE-HSA and antioxidants. [score:2]
The luciferase activity of the pGL3-FGFR2-30-UTR reporter was significantly suppressed in miR-223 -transfected ADSCs compared with Negative Control (NC) -transfected cells normalized to a control vector containing Renilla luciferase, pRL-TK. [score:2]
MiR-223 expression was confirmed by RT-PCR. [score:2]
Overexpression of IGFR protein was also found in anti-miR-223 -transfected cells compared with anti-NC -transfected and parental cells (Fig. 5F). [score:2]
To analyze miR-223 expression, RT- PCR was performed using specific stem-loop RT primers from a Hairpin-in miRNA qPCR Quantitation Kit (GenePharma, Shanghai, China). [score:2]
Cells were transfected with miR-223 inhibitors and/or pretreated with antioxidants and subsequently treated with AGE-HSA (300 μg/ml) for 24 h. The levels of apoptosis (A) and caspase-3 activity (B) were measured by ELISA. [score:1]
In support of these results, we examined FGFR2 protein and mRNA levels in miR-223- or anti-miR-223 -transfected cells, and their respective NC and parental cells by RT-PCR and western blotting, respectively. [score:1]
Briefly, cells were seeded in 96-well plates and co -transfected with the pMir-Report luciferase vector, pRL-TK Renilla luciferase vector, and miR-223 mimics as reported previously. [score:1]
Despite the effect of miR-223 on FGFR2 protein levels, no effect on FGFR2 mRNA levels was detected (Fig. 5C). [score:1]
Role of miR-223 in the protective effects of antioxidants against AGE-HSA -induced apoptosis, caspase-3 activity, and oxidative stress levels in ADSCs. [score:1]
[1 to 20 of 42 sentences]
16
[+] score: 138
Target mRNAs (TargetScan, negatively correlated) Cell Type specificity HSA-MIR-223 82 Monocytes; Eosinophils; Neutrophils HSA-MIR-143 60 Neutrophils HSA-MIR-150 27 B cells; T cells; NK cells HSA-MIR-500 25 Monocytes; pDCs HSA-MIR-652 11 Monocytes; Eosinophils; Neutrophils HSA-MIR-125A 9 T cells; Neutrophils To further support our observations, we searched for studies in which cell-type specific miRNA expression levels were altered by either over -expression or knock-out, and asked if the genes we had identified as miRNA targets were correspondingly up- or down-regulated in response. [score:15]
However, genes negatively correlated with miR-223 expression in our dataset were significantly more correlated (fold change >1.3) than similar sized groups of genes randomly selected from the set of TargetScan predictions (FDR p<0.01, 1000 permutations) (Figure 3B), suggesting that additional filtering for negative correlation between miRNA and mRNA expression in our dataset yields an enriched set of miR-223 targets that has higher probability of being regulated by miR-223 in vivo. [score:11]
Target mRNAs (TargetScan, negatively correlated) Cell Type specificity HSA-MIR-223 82 Monocytes; Eosinophils; Neutrophils HSA-MIR-143 60 Neutrophils HSA-MIR-150 27 B cells; T cells; NK cells HSA-MIR-500 25 Monocytes; pDCs HSA-MIR-652 11 Monocytes; Eosinophils; Neutrophils HSA-MIR-125A 9 T cells; Neutrophils 696 genes were specifically up or down-regulated in one, two or three different cell-types, with the majority of genes (542) uniquely up or down-regulated in a single cell-type. [score:11]
0029979.g003 Figure 3A) miR-223 expression across the profiled cell types (bars) is plotted against the relative expression profile (lines) of 82 genes identified as potential miR-223 targets (TargetScan, significant negative correlation). [score:9]
A) miR-223 expression across the profiled cell types (bars) is plotted against the relative expression profile (lines) of 82 genes identified as potential miR-223 targets (TargetScan, significant negative correlation). [score:9]
Genes identified as miR-223 targets using TargetScan were mildly up-regulated in response to miR-223 knockout, compared to all other genes. [score:8]
Since miR-223 levels were depleted in the knockout, we asked if the 82 genes identified as miR-223 targets from our current dataset would correspondingly be up-regulated in absence of negative regulation by miR-223. [score:8]
Since we observed that several miRNAs were expressed in the same cell type, e. g. miR-143, miR-145 and miR-223 are specifically expressed in neutrophils, we asked if miRNAs specific to the same cell type would target an overlapping set of genes. [score:7]
One of these miRNAs was miR-223, for which we were able to show that the target genes identified were correspondingly up-regulated in neutrophils of a miR-223 gene knockout mouse [25], serving as additional support that these genes may indeed be modulated by miR-223 in vivo. [score:7]
Ranking genes in the myeloid cluster by their connectivity, we found ABL2, a gene which regulates cytoskeleton remo deling during cell differentiation, cell division and cell adhesion was found to be targeted by the largest number of miRNAs (N = 5: miR-223, miR-143, miR-25, miR-27, miR-17), followed by EIF4A2, EPC1 and INO80D, which were targeted by four miRNAs each. [score:6]
Of interest, miR-223, miR-143, miR-150 and miR-652 replicated as significant in both Roche and HUG datasets, strengthening the case that these miRNAs may indeed regulate expression of their respective predicted target mRNAs. [score:6]
We used the data from a previously published miR-223 −/− system [25] to see if those targets would correspondingly be de-repressed when miR-223 is knocked-out. [score:4]
The organization of myeloid miRNAs in the regulatory network placed miR-223, miR-143 and miR-145 in a central position, since they targeted several genes in common with other miRNAs. [score:4]
Indeed, miR-223, miR-143 and miR-145 have been shown to be overexpressed in myeloid cells from polycythemia vera patients in which enhanced erythropoiesis is observed [28], suggesting that these 3 miRNAs are usually decreased during erythropoiesis. [score:3]
In samples from single donors, miR-150 and miR-223 were confirmed to be specifically expressed in lymphoid and myeloid lineage cells respectively (Figure S2). [score:3]
miR-223 was an example of a miRNA expressed in myeloid cells, which agreed with previous studies showing that miR-223 was involved in the differentiation of myeloid precursors into granulocytes. [score:3]
B) 82 genes were identified in our study as being significant miR-223 targets. [score:3]
For the myeloid lineage, we observed miR-223 to be expressed only in monocytes and granulocytes (fold change = 8.1 between monocytes and mDCs; p* = 0.02). [score:3]
Expression levels for miR-31, miR-143, miR-223 and miR-150 (Log2, mean ± SEM) are plotted across a panel of immune cell subsets, for samples obtained from single donors (dark shaded bars) and pooled donors (light shaded bars). [score:3]
Like miR-223, miR-652 was also only expressed in myeloid lineage cells (monocytes and granulocytes, fold change = 3.2; p* = 0.04). [score:3]
Potential miR-223 targets are repressed in a miR-223 −/− system. [score:3]
For miR-223, we found one study by Baek et al. [25], where the authors investigated the role of miR-223 in granulopoiesis by performing gene expression and proteomic profiling of mouse neutrophils obtained from a miR-223 knockout mouse vs a wild type control. [score:2]
The final network consisted of two clusters, a large cluster consisting of 9 miRNAs specific to neutrophils, monocytes and myeloid lineage cells (miR-223, miR-143, miR-145, miR-25, miR-27, miR-425, miR-17, miR-652 and miR-191) and a much smaller cluster specific to lymphoid lineage cells (B, T and NK cells), consisting of miR-150 and miR-29 co -regulating TET3, ERP44 and VEGFA. [score:2]
Figure S2 miR-31, miR-143, miR-223 and miR-150 are confirmed to be cell type specific, using data from single donor samples. [score:1]
Six of these miRNAs (miR-223, miR-143, miR-150, miR-500, miR-652 and miR-125) were cell-type specific based on our previous analysis. [score:1]
C) miR-223 was specific to myeloid lineage cells (neutrophils, eosinophils and monocytes), whereas miR-155 was specific to lymphoid lineage cells (pDCs, T cells, B cells and NK cells). [score:1]
This study also showed that mRNAs of most of the highly responsive proteins were de-repressed already at the myeloid progenitor stage, suggesting that miR-223 is important already early in neutrophil differentiation. [score:1]
miR-223 mutant mice also have higher numbers of granulocyte progenitors in the bone marrow and hypermature neutrophils in the circulation [31]. [score:1]
[1 to 20 of 28 sentences]
17
[+] score: 136
Thus, upregulation of oncogenic miR-223, -31, and -21 is accompanied by down-regulation of their respective tumor suppressor target Fbxw7, Stk40 and Pdcd4. [score:11]
miR-223, -31, -21 upregulation correlates with down-regulation of their tumor-suppressor targets. [score:11]
We then determined whether upregulation of oncogenic miR-223, -31, and -21 in ZD3T, ZD6T, and ZD12T esophagus is accompanied by down-regulation of their respective tumor suppressor targets, FXBW7 [25, 61], STK40 [60, 62, 63], and PDCD4 [64], by using qPCR (n = 7-10 rats/group). [score:11]
That the tumor suppressor genes Fxbw7, Pdcd4, and Stk40 were downregulated at the mRNA and protein level in marked-ZD tumor group (Figure 6) and that they were predicted to interact to alter network of target proteins [65, 66, 77] (Figure 7) provide support that miR-223, miR-21, and miR-31 have an important role in ESCC and may be useful prognostic biomarkers and therapeutic targets for ESCC. [score:10]
Analysis of esophageal expression of Fbxw7, Stk40, and Pdcd4 (respective tumor suppressor targets of miR-223, miR-31, and -21) in Zn-modulated rats at tumor endpoint. [score:7]
That the three tumor suppressor targets are predicted to interact to alter network of cancer-related proteins [65, 66, 77] provide support that miR-223, miR-21, and miR-31 have an important role in ESCC and may be useful therapeutic targets in ESCC. [score:7]
We selected 8 miRNAs in ZD3T esophageal tissue (miR-223, -21, -31, -146a, -146b, -221, -194, and -106b) and two miRNAs (miR-31, -223) in ZD6T and ZD12T esophageal tissues, Figure 4B shows that the Taqman data confirmed the upregulation of all 8 selected miRNAs in ZD3T vs ZST samples, and the upregulation of miR-223 and miR-31 in ZD6T and ZD12T samples. [score:7]
In ESCC, patients with high miR-223 expression have a significantly poorer prognosis, presumably because of repression of the function of its tumor suppressor target FBXW7 [25]. [score:7]
miR-223, miR-21, and miR-31 can target many important tumor suppressor genes, including FXBW7 [25, 61], STK40 [60, 62, 63], and PDCD4 [64]. [score:5]
Figure 7 A. The displayed esophagus-specific nine-gene network shows predicted functional relationships among the genes that are most functionally related to Stk40, Pdcd4 and Fbxw7 (tumor-suppressor targets of miR-31, mir-21 and miR-223, respectively). [score:5]
To explore the esophagus-specific functional relationships for Fbxw7, Stk40, and Pdcd4 (tumor-suppressor targets of miR-223, -31, -21), we employed FNTM for the rat. [score:5]
A. The displayed esophagus-specific nine-gene network shows predicted functional relationships among the genes that are most functionally related to Stk40, Pdcd4 and Fbxw7 (tumor-suppressor targets of miR-31, mir-21 and miR-223, respectively). [score:5]
miR-223, miR-21, and miR-31 are the top -upregulated species in the high ESCC-burden, marked-ZD esophagus. [score:4]
This 15-miRNA signature (Figure 3B, marked by asterisks) was defined by strong to modest upregulation of oncogenic miR-223, -21, -31, -146a, -146b, -27a, -221, -27b, -194, -24, -203, -183, -130b, -106b, and -22 (up 3.6 to 1.4 fold). [score:4]
Importantly, the high ESCC-burden, marked-ZD esophagus showed a 15-miRNA signature (with miR-223, -21, and -31 as the top-up-regulated species), thus differentiating it from the low ESCC-burden, mild-ZD esophagus with a 2-miRNA signature (miR-223, -31). [score:4]
By contrast, low ESCC-burden, ZD6T and ZD12T esophagus displayed, respectively, a 3-miRNA signature (miR-223, -31, -27b) and a 2-miRNA signature (miR-223, -31; up 2.9 and 1.5 fold) with modest upregulation (Figure 3B). [score:4]
The mechanism(s) by which miR-223 and miR-21 are upregulated by ZD remains to be elucidated. [score:4]
Thus, moderate and mild-ZD induces alterations in miRNA expression, including miR-31 and miR-223. [score:3]
Cellular localization of miR-223, miR-31 and miR-21 expression in human ESCC tissue. [score:3]
Our study suggests that miR-223, miR-31 and miR-21 alone or in combination could be used as therapeutic targets for treatment of ESCC. [score:3]
In addition, miR-223 and miR-31 dysregulation is common to marked-ZD and moderate/mild-ZD tumor groups (Figure 4A). [score:2]
Whether miR-223 and miR-21 co-localize in the same ESCC tissue is not known. [score:1]
miRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, rno-miR-21, rno-miR-31, rno-miR-223, hsa-miR-31, hsa-miR-223, negative controls (rno-miR-31) with mismatches at two position, were purchased from Exiqon (Vedbaek, Denmark). [score:1]
Figure 4 A. Venn diagram showing miR-223 and miR-31 are common to ZD3T, ZD6T, and ZD12T esophagi (cutoff point of P < 0.05 and fold difference >1.3), and scatterplot showing their fold change vs ZST. [score:1]
A limitation of this study is the fact that the underlying biological mechanisms of the key dysregulated miRNAs in ESCC development, namely, miR-223, miR-21, and miR-31, were not investigated. [score:1]
In situ hybridizationmiRCURY locked nucleic acid (LNA)™ microRNA detection probes, namely, rno-miR-21, rno-miR-31, rno-miR-223, hsa-miR-31, hsa-miR-223, negative controls (rno-miR-31) with mismatches at two position, were purchased from Exiqon (Vedbaek, Denmark). [score:1]
A. Venn diagram showing miR-223 and miR-31 are common to ZD3T, ZD6T, and ZD12T esophagi (cutoff point of P < 0.05 and fold difference >1.3), and scatterplot showing their fold change vs ZST. [score:1]
miR-223 acts as an oncomiR in several solid tumors, including ESCC, gastric, ovarian, and bladder cancers [25, 80– 82]. [score:1]
Localization of miR-223, miR-31, and miR-21 in human esophageal squamous cell carcinoma (ESCC) tissue by in situ hybridization (ISH). [score:1]
B. Validation of eight representative miRNAs in ZD3T esophagus; and miR-223 and miR-31 in ZD6T and ZD12T esophagi. [score:1]
Following deparaffinization, rehydration in graded alcohol and proteinase K treatment, tissue sections were hybridized with miR-31 probe (20 nM), miR-223 or miR-21 probe (50 nM) in hybridization buffer (Exiqon) at 50°C - 57°C for 14 h in a hybridizer (Dako, Glostrup, Denmark). [score:1]
These results represent the first simultaneous in situ detection of miR-223, -21, and -31 in human ESCC. [score:1]
Among which, miR-31 [15, 16, 30, 60] and miR-223 [25, 26, 34] are oncomiRs for human ESCC. [score:1]
miR-223, -31, and -21 ISH signal (blue, 4-nitro-blue tetrazolium and 5-brom-4-chloro-3′-indolylphosphate; counterstain, nuclear fast red) was moderate to intense and abundant in near serial formalin-fixed, paraffin-embedded sections of ESCC tumor tissue. [score:1]
All 12 cases showed intense to moderate miR-31, miR-223, and miR-21 ISH signal in near serial sections of moderately to poorly differentiated ESCC tumor samples (Figure 5). [score:1]
[1 to 20 of 35 sentences]
18
[+] score: 130
In contrast, the miRNA panel from lung specimens of MCT rats overexpressing hPGIS exhibited restoration of dysregulated miRNA levels to levels of naïve control rats, with downregulation of miRNAs that had been increased by MCT (miR-17, miR-21, and miR-223), and upregulation of miRNAs that had been decreased by MCT (miRs 424 and 503), Fig 5C]. [score:10]
The upregulation of miR-21 and miR-223 for all tissues examined indicates the possibility they are ubiquitously upregulated in all tissues affected by PAH, while other miRNAs may have a more tissue-specific dysregulation, for example miR-124 which is predominantly dysregulated in adventitial fibroblasts. [score:9]
Consistent with upregulation of miR-223, levels of IGF1R mRNA were downregulated in PA of MCT PAH rats, whereas the decreased miR-328 expression would have been expected to increase IGF1R mRNA levels. [score:9]
We also report downregulation of miR-223 in MCT PAH with specific inhibition of miR-223 that failed to attenuate MCT PAH, whereas overexpression of hPGIS reversed dysregulation of multiple miRNAs in lung specimens and attenuated MCT PAH [33]. [score:9]
Overexpression of miR-223 has been shown to downregulate expression of IGFR1 in HeLa, leukemia, hepatoma, and human embryonic stem cells [46– 48]. [score:8]
Since miRs 17, 21, and 223 were significantly upregulated in the PA of MCT PAH rats, we performed qPCR for BMPR2 and IGF1R mRNA, as these miRNAs have been associated with downregulation of BMPR2 (miR 17, 21 and 145) and IGF1R (miR-223 and 328). [score:7]
In the current study, miR-328 expression was modestly reduced in lung, but not PA, of MCT PAH rats, whereas miR-223 was consistently upregulated in all tissues and plasma. [score:6]
Inhibition of miR-223 did not attenuate MCT PAH, whereas human prostacyclin synthase overexpression restored miRNA levels in MCT PAH to levels detected in naïve rats. [score:5]
We do not know the much about miR-223 dysregulation in humans with PAH, but data showing upregulation of miR-223 by 1.5-fold in miRNA microarray heat maps of buffy coat blood specimens of human subjects with PAH are encouraging [36]. [score:5]
To evaluate a potential pathogenic relationship between miR-223 upregulation and PAH, we performed specific inhibition of this miRNA by injecting MCT PAH rats with A223 or a nonspecific control oligonucleotide, A-control. [score:4]
To explore whether findings from miR-223 dysregulation in cardiovascular disease could be extended to PAH [31, 32], we measured expression of miR-223 in MCT PAH rats. [score:4]
As shown in Fig 1, miR-223 was upregulated in lung, PA, RV, and plasma of MCT PAH rats. [score:4]
As shown in Fig 1, miR-223 was upregulated in lung, PA, and RV of MCT PAH rats. [score:4]
A223 inhibition of miR-223 did not attenuate MCT PAH, whereas hPGIS through modulation of multiple miRNAs did. [score:3]
These observations led us to evaluate the expression and function of miR-223 in MCT PAH by administering a specific inhibitor of miR-223 (A223) to MCT PAH rats. [score:3]
Based on TargetScan predictions, miR-223 binds to the seed region of IGF1R at position 234–241. [score:3]
0147827.g003 Fig 3Expression levels of miR-223 relative to saline-saline (naïve) control animals. [score:3]
In this study, we examined the expression of a panel of miRNAs in the monocrotaline (MCT) PAH rat mo del, evaluated the functional role of a specific miR-223 inhibitor on attenuation of PAH, and determined the results of human prostacyclin synthase (hPGIS) -mediated attenuation of MCT PAH on this miRNA panel. [score:3]
Finally, we evaluated the effects of these interventions on BMPR2 mRNA levels and also on IGF1R mRNA levels, which TargetScan predictions identify as a target for miR-223. [score:3]
Specific inhibition of miR-223 in MCT PAH rats. [score:3]
Subsequently, MCT PAH rats were injected with a specific inhibitor (antagomiR) for miR-223 (A223) or a nonspecific control oligonucleotide (A-control) 4 days after MCT administration, then weekly. [score:3]
Preliminary results with a limited number of human PAH lung specimens in our laboratory have shown a more modest increase (~1.25 fold) in miR-223 expression (data not shown). [score:3]
However, since hemodynamically and clinically, right ventricular systolic pressure is equivalent to pulmonary artery systolic pressure, it is highly unlikely that the reduction in miR-223 expression in lung and PA specimens induced by A-223 to naïve rat levels reduced PASP since no changes in RV mass or RVSP were detected (Fig 4). [score:3]
Expression levels of miR-223 relative to saline-saline (naïve) control animals. [score:3]
MiRNA-223 inhibitor (antagomiR-223, designated below as A223) was synthesized and purchased from Exiqon, Inc. [score:3]
Subsequently, dysregulation of miR-223 has been demonstrated in animal mo dels and humans with acute myocardial infarction and heart failure [31, 32]. [score:2]
The A223 -mediated reduction in levels of miR-223 in MCT PAH rats was specific, as levels of the remaining miRNAs in our panel were unchanged (Fig 3E). [score:1]
A223 significantly decreased miR-223 expression in the lung and PA, but not RV, of MCT PAH rats to levels measured in vehicle controls (Fig 3A–3D), whereas A-control did not. [score:1]
Because A223 administration to MCT PAH rats reduced miR-223 levels to levels in naïve rats, but did not attenuate MCT PAH, we hypothesized that restoration of BMPR2 signaling was a requirement for attenuation of MCT PAH. [score:1]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
Our data showed a reduction in miR-223 expression by A223 administration in PA and lung in MCT PAH to levels measured in naïve rats, whereas, A-control administration did not. [score:1]
MiR-223 has previously been considered a myeloid specific miRNA, but has been shown to be dysregulated in cardiovascular medicine with a potential role as a biomarker of acute myocardial infarction and heart failure [9, 10]. [score:1]
Its sequence (5’-ATTTGACAAACTGAC-3’) is complimentary to miR-223-3p. [score:1]
The functional effects of specific inhibition of miR-223 by A223 on MCT PAH were also evaluated. [score:1]
[1 to 20 of 34 sentences]
19
[+] score: 117
In addition, our results showed that miR-223 was primarily located in the Kupffer cells, but its expression levels were significantly up-regulated in hepatocytes, hepatic stellate cells and Kupffer cells after infection. [score:6]
We found miR-223 was primarily located in the Kupffer cells, and the expression level of miR-223 was significantly up-regulated in all these three types of resident liver cells post-infection, which suggests that the elevated serum miR-223 is derived from the infected liver. [score:6]
Relative miR-223 expression in comparison with uninfected hepatocytes was determined by qPCR (A), and the miR-223 expression levels of hepatocytes, HSCs and Kupffer cells after infection were analyzed (B). [score:5]
Bioinformatics analyses (TargetScan analysis [28] and Gene ontology analysis [29]) revealed a potential role of miR-223 in transcription regulator activity, transcription factor activity and DNA binding (Figure  4C). [score:4]
To identify miRNAs that reflected the schistosome infections and PZQ chemotherapy, six miRNA candidates (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) were selected for analysis in serum that were commonly deregulated in human liver diseases. [score:4]
However, a significant elevated expression level of miR-223 was detected in not only the Kuppfer cells, but also hepatocytes and HSCs after infection (Figure  4B). [score:3]
Therefore, we analyzed the expression level of miR-223 in serum of other hosts of schistosomes, including rabbits, buffalos and humans. [score:3]
Using a mouse mo del of schistosomiasis japonica, we found that the expression level of serum miR-223 was significantly elevated after infection, yet returned to near normal levels after treatment with the anti-helminth drug PZQ. [score:3]
We also conducted a separate experiment to determine the expression level of serum miR-223 in the progression of mouse schistosomiasis. [score:3]
All the rabbits were sacrificed at 56 days after infection to quantify the miR-223 expression level in the sera. [score:3]
We isolated the primary resident livers cells, including hepatocytes, hepatic stellate cells (HSCs) and Kupffer cells, to quantify the expression level of miR-223. [score:3]
Using a mouse mo del of Schistosoma japonicum infection, we found that the expression level of serum miR-223 was significantly elevated after infection, but returned to near normal levels after the treatment with praziquantel (PZQ). [score:3]
Therefore, we analyzed the expression level of miR-223 in serum of other host species of schistosome, including rabbits, buffalos and humans. [score:3]
Figure 4 Expression level of miR-223 in resident liver cells. [score:3]
Expression level of circulating miR-223 in the progression of schistosomiasis. [score:3]
Hydroxyproline content of liver samples (A) and miR-223 expression level of serum samples (B) from the four groups were determined, respectively. [score:3]
Next, we analyzed the expression level of serum miR-223 in the progression of mouse schistosomiasis. [score:3]
Expression levels of serum miR-223 (B), miR-122 (C), miR-34a (D), miR-199a-5p (E) miR-199a-3p (F), and miR-146b (G) were detected in the three groups of mice. [score:3]
Expression level of circulating miR-223 in human and other animal mo dels with schistosomiasis. [score:3]
The expression levels of miR-34a, miR-223, miR-122, miR-146b, miR-199a-5p, miR-199a-3p were determined using the SYBR Green Master Mix kit (TaKaRa, Dalian, China). [score:3]
Figure 2 Correlation between serum miR-223 expression level and liver hydroxyproline content in the infected mice. [score:3]
Considering the Kupffer cells are essential for the development of schistosomiasis -induced inflammation and fibrosis [38], our data implied that miR-223 could play an important role in the pathogenesis and progression of schistosomiasis japonica via regulating the function of Kupffer cells. [score:3]
As shown in Figure  3, the miR-223 expression level was obviously elevated in the serum of infected rabbit, buffalo and human, which validated the results of the miR-223 obtained from the mouse mo del of human schistosomiasis. [score:3]
In this study, we isolated the primary hepatocytes, HSCs and Kupffer cells from the infected and uninfected livers to quantify the expression level of miR-223. [score:3]
It is true that the elevated level of the serum miR-223 was associated with schistosomiasis, but it may not be specifically associated with the disease because the elevated level of the miR-223 was also observed in chronic hepatitis [18]. [score:3]
Figure 3 Expression level of the serum miR-223 in rabbit, buffalo and human with schistosomiasis. [score:3]
Expression level of miR-223 in resident liver cells and its potential function. [score:3]
Importantly, bioinformatics analyses showed that miR-223 potentially functions in transcription regulator activity, transcription factor activity and DNA binding. [score:2]
This suggested that miR-223 could regulate the transcription of some important genes in the Kupffer cells to modulate their function. [score:2]
Bioinformatics analyses revealed a potential functional role of miR-223 in transcription regulator activity, transcription factor activity and DNA binding. [score:2]
Previous studies have also shown that circulating miRNA-146a and miR-223 were significantly reduced in septic patients [19], while serum miRNA-122 and miRNA-192 were elevated in a mouse mo del of drug -induced liver injury [20]. [score:1]
For example, serum miR-21, miR-122 and miR-223 are elevated in patients with hepatocellular carcinoma and chronic hepatitis and thus, have the potential to serve as novel biomarkers for liver injury [18]. [score:1]
In mouse hosts, quantitative PCR result revealed that circulating miR-223, miR-122 and miR-34a were significantly elevated after infection (Figure  1B-D). [score:1]
Only one serum miRNA in infected mice, however, decreased significantly after the PZQ treatment (miR-223, Figure  1B). [score:1]
We validated the elevated level of the circulating miR-223 in serum samples of other host species including rabbits, buffalos and humans. [score:1]
Importantly, the level of serum miR-223 reflected the extent of liver pathology post-infection. [score:1]
In addition, we observed that circulating miR-223 was also significantly elevated in other hosts infected with S. japonicum, including rabbits, buffalos and humans, validating the results of the murine mo del. [score:1]
These results indicate that miR-233 was a schistosomiasis -associated miRNA, and thus circulating miR-223 may serve as a new potential biomarker for the detection of schistosome infection and the assessment of the response to chemotherapy. [score:1]
Bioinformatics analyses were also conducted to assess the potential function of miR-223. [score:1]
Importantly, the level of serum miR-223 was significantly correlated with the hydroxyproline content in the liver tissue (r = 0.808, P < 0.001), which suggests that the level of serum miR-223 could reflect the extent of liver pathology after infection (Figure  2C). [score:1]
This study suggested that the circulating miR-223 could serve as a potential new biomarker for the detection of schistosome infection and the assessment of the response to chemotherapy. [score:1]
As expected, the level of circulating miR-223 increased significantly during the course of infection (Figure  2B). [score:1]
We analyzed the serum levels of six selected candidate miRNA molecules (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) from mice, rabbits, buffalos and humans infected with Schistosoma japonicum using qPCR. [score:1]
Moreover, the serum miR-223 level was significantly correlated with the liver egg burden (r = 0.603, P = 0.008, Figure  2F). [score:1]
For examples, serum miR-155 is the potential biomarker for B-cell lymphoma [30] but also for other cancers such as breast cancer [31], ovarian cancer [32], and pancreatic cancer [33]; Serum miR-92 is the potential biomarker for colon cancer [34], but also leukemia [35], and ovarian cancer [32]; Circulating miR-223 is the potential biomarker for chronic hepatitis [18], but also for schistosomiasis observed in this study. [score:1]
To test this hypothesis, we selected six candidate serum miRNAs for analysis (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) in the murine mo del of human schistosomiasis and then performed validation in other host species including rabbits, buffalos and human patients infected with S. japonicum. [score:1]
Importantly, we found that the level of serum miR-223 reflected the extent of liver pathology post-infection. [score:1]
We found that miR-223 was primarily located in the Kuppfer cells of both infected and uninfected livers (Figure  4A). [score:1]
In addition to the association of the serum miR-223 with schistosomiasis, we also showed that the levels of the circulating miR-223 were significantly declined and returned to normality after treatment of the host with the anti-helminth drug, praziquantel. [score:1]
The potential role of miR-223 was analyzed by bioinformatics analyses (C). [score:1]
[1 to 20 of 50 sentences]
20
[+] score: 108
Indeed, it has been demonstrated that a natural dietary agent genistein inhibited miR-223 expression and subsequently up-regulated FBW7, leading to cell growth inhibition and apoptosis in pancreatic cancer cells [203]. [score:10]
Interestingly, in a separate report, down-regulation of miR-223 was identified in hepatocellular carcinoma, while re -expression of miR-223 caused an inhibitory effect on cell viability in hepatocellular carcinoma cell lines [180]. [score:8]
Interestingly, miR-223 was found to have a tumor suppressor function by inhibiting migration and invasion through targeting Artemin, a tumor metastasis-related gene, in human esophageal carcinoma [178]. [score:7]
Xu et al. found that the over -expression of miR-223 suppressed FBW7 expression, resulting in increased Cyclin E protein levels and activities, and subsequently causing genomic instability [24]. [score:7]
Conversely, reduced miR-223 expression resulted in increased FBW7 expression and decreased Cyclin E activity, indicating that FBW7 can be modulated directly by miR-223 [24]. [score:6]
Recently, Mavrakis et al. found that Mcl-1 levels are increased in mouse leukemias expressing miR-223 through down-regulation of FBW7 [181]. [score:6]
Re-introduction of miR-223 suppressed FBW7 expression at the post-transcriptional level in gastric cancer cell lines [25]. [score:5]
In line with this notion, it has been shown that miR-223 is overexpressed in the multiple step progression of Barrett's esophagus and modulates drug resistance via targeting PARR1 [179]. [score:5]
Moreover, overexpression of miR-223 has been found in patients with lymph node metastasis and metastatic disease at an advanced pathological stage in gastric carcinoma [25]. [score:5]
Furthermore, miR-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3 [177]. [score:5]
A growing body of evidence has recently demonstrated that miR-223 regulates FBW7 expression. [score:4]
To this end, emerging evidence has demonstrated that several molecules such as p53, Pin1 (Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1), C/EBP-δ (CCAAT/enhancer -binding protein-δ), Hes-5 (Hairy and Enhancer-of-split homologues 5), Numb, as well as microRNAs (miRNAs) including miR-27a and miR-223 have been found to regulate the expression of FBW7 [88- 91]. [score:4]
In addition, multiple microRNAs (miRNAs) such as miR-27a, miR-25, miR-129-5p, and miR-223 have also been demonstrated to regulate the expression of FBW7. [score:4]
Moreover, microRNAs (miRNAs) including miR-27, miR-25 and miR-223 have been reported to be involved in regulating the expression of FBW7 [24- 27]. [score:4]
Moreover, miRNAs including miR-223, miR-27a, miR-25, and miR-129-59p can also regulate the expression of FBW7. [score:4]
Accumulated evidence has also shown that multiple miRNAs including miR-27 and miR-223 could regulate FBW7 expression [24, 91]. [score:4]
Numerous studies have found overexpression of miR-223 in various types of human cancers including hepatocellular carcinoma [172], T-ALL [173], ovarian cancer [174], gastric cancer [25], esophageal squamous cell carcinoma [175], and bladder cancer [176]. [score:3]
Li et al. also reported that FBW7 protein levels were inversely correlated with miR-223 expression in gastric tumor tissues [25]. [score:3]
High expression of miR-223 was also found to be associated with poor survival in gastric carcinomas [177], ovarian cancer [174], and esophageal squamous cell carcinoma [175]. [score:3]
This group also identified FBW7 as a functional downstream target of miR-223 in esophageal cancers [175]. [score:3]
Regulation of FBW7 by miR-223. [score:2]
However, further in-depth research is needed in order to fully understand how miRNA-223 regulates FBW7 in human carcinogenesis. [score:2]
Giray BG Emekdas G Tezcan S Ulger M Serin MS Sezgin O Altintas E Tiftik EN Profiles of serum microRNAs; miR-125b-5p and miR223-3p serve as novel biomarkers for HBV -positive hepatocellular carcinomaMol Biol Rep 2014 171. [score:1]
Consistent with this finding, Kurashige and colleague reported similar inverse relationship between miR-223 and FBW7 in esophageal squamous cell carcinoma [175]. [score:1]
Recent evidence has suggested that miR-223 may play a key role in human cancers [169- 171]. [score:1]
3.7.2 by miR-223Recent evidence has suggested that miR-223 may play a key role in human cancers [169- 171]. [score:1]
[1 to 20 of 26 sentences]
21
[+] score: 98
In addition, pair-wise analyses revealed 42 common targets for miR-182 and miR-142-3p, 34 common targets for miR-182 and miR-223, and 7 common targets for miR-142-3p and miR-223 (Table S1, Fig. 2A). [score:7]
Consequently, MCF-7 cells were transfected with pCMV-MIR182, pCMV-MIR223, and pCMV-MIR (=empty or scrumble vectors) to induce their overexpression and to analyze the protein expression of their targets, that is, IGF-1R, FOXO3A, and FOXO1A. [score:7]
In line with this, transfection -induced over -expression of mature miR-223 significantly inhibited IGF-1R and FOXO3A protein levels (P < 0.05), while milder effects on FOXO1A protein expression were observed (Fig. 4C and D). [score:7]
Estradiol regulates miR-182 and miR-223 expression and their identified targets leading to activation of insulin/IGF-1 signaling pathway in MCF-7 cells. [score:6]
The most noteworthy novel finding was that in skeletal muscle, HRT use associates with down-regulation of miR-182, miR-223, and miR-142-3p, which modulate the expression of central players in the insulin/IGF-1 pathway, namely IGF-1R and FOXO3A. [score:6]
First, the down-regulation of miR-182 and miR-223 in the HRT users accorded with the higher mRNA and protein expression of IGF-1R, which in all likelihood leads to higher activity of the following PI3K/Akt-pathway in HRT users compared to nonusers. [score:5]
Figure 6The effects of estrogen stimulation on the expression of miR-182, miR-223, and miR-142-3p and their targets in infant female quadriceps femoris-derived myoblasts. [score:5]
Figure 4The effects of miR-182 and miR-223 over -expression on protein expression of IGF-1R, FOXO3A, and FOXO1A in MCF-7 cells. [score:5]
Identification of common pathways targeted by miR-182, miR-223, and miR-142-3p was obtained using the DIANA-microT 3.0 target prediction program (http://diana. [score:5]
Figure 5MiR-182, miR-223, and miR-142-3p expression and their target mRNA and protein levels under estrogen stimulation in MCF-7 cells. [score:5]
We found out that diaphragm muscle cells of young male mouse showed down-regulation of both miR-182 and miR-223 under exposure to 100 n m estradiol for 24 h (Fig. 7A) concomitantly with increased AKT phosphorylation (P < 0.05) (Fig. 7B). [score:4]
Both miR-223 and miR-142-3p were down-regulated by 100 n m E [2], the difference being highly significant for miR-142-3p (Fig. 6A). [score:4]
We also demonstrated here that IGF-1R, FOXO1A, and FOXO3A are direct targets for miR-223 (Fig. 3B, C, D). [score:4]
Putative pathways affected by miR-182, miR-223, and miR-142-3p are reported in Table 2. Among the putative target pathways, we found the insulin/IGF1 pathway (Fig. 2B). [score:3]
In addition, the loss-of-function of miR-223 resulted in an evident increase in the protein expression of IGF-1R (Fig. 4E). [score:3]
The next day, the cells were transfected with pCMV-MIR182/223 and pCMV-MIR (OriGene) or mirVana™ miRNA inhibitors (Ambion, USA) hsa-miR-223 ID:MH12301 (miR-223 antagomir), anti-miR negative control #1 (Mock) (Fig 3). [score:3]
Table S1 Common targets for hsa-miR-142-3p (250 elements), hsa-miR-182 (841 elements) and hsa-miR-223 (202 elements). [score:3]
Validation by quantitative PCR (qPCR) confirmed that the expression levels of miR-182, miR-223, and miR-142-3p in the HRT users were approximately one-third of that of nonusers (P = 0.05, 0.001 and 0.003, respectively; Fig. 1C), while miR-142-5p and miR-451 were not significantly different between HRT users and their nonuser co-twins. [score:3]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
In the present study, we confirmed that estrogen-regulated miRNAs, that is, miR-182, miR-223 and miR-142-3p, exist in skeletal muscle of postmenopausal women. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
MiR array data showed miR-142-3p, miR-142-5p, miR-223, miR-182, and miR-451 to be hypo-expressed in the HRT users compared to nonusers (Fig. 1B). [score:2]
P-CMV-MIR182, p-CMV-MIR223, and p-CMV-MIR (empty vector) plasmids were shipped from OriGene (OriGene Technologies Inc. [score:1]
Each pLUC vector was co -transfected into the HEK293T cells with a plasmid-encoding Renilla luciferase along with a plasmid-encoding miR-182 or miR-223 or the empty vector. [score:1]
MiR-223 and miR-182 modulate IGF-1R, FOXO1A, and FOXO3A protein levels. [score:1]
Specifically, miR-182 and miR-223 participate in the modulation of the insulin/IGF-1 pathway signaling. [score:1]
Furthermore, we confirmed that miR-223 also represses both IGF-1R and FOXO3A. [score:1]
[1 to 20 of 27 sentences]
22
[+] score: 81
In our microarray study, seven miRNAs were found to be differentially expressed, four (hsa-miR-196b, hsa-miR-30a, hsa-miR-873, and hsa-miR-337-3p) were downregulated and three (hsa-miR-1288, hsa-miR-451, and hsa-miR-223) were upregulated in EP pregnancy-derived tissues compared to VTOP samples. [score:8]
In vitro over -expression of these miRNAs triggered a clear downregulation of some predicted genes such as ITGA2 in the case of hsa-mi-196b and GALNT1 in the case of hsa-miR-223, but the expression of other predicted genes remains unaltered. [score:8]
An additional statistically significant pathway found in our study was extracellular matrix (ECM) receptor interactions, with hsa-miR-196b and hsa-miR-223 able to interact with two targeted genes (COL1A2, and ITGA2); we also confirmed that integrin A2 (ITGA2) was significantly downregulated in EP samples. [score:6]
Four miRNAs (hsa-miR-196b, hsa-miR-30a, hsa-miR-873, and hsa-miR-337-3p) were found to be downregulated in EP versus healthy pregnancy tissues, and three miRNAs (hsa-miR-1288, hsa-miR-451, and hsa-miR-223) were upregulated in EP compared to control pregnancy tissue samples (Figure 1A). [score:6]
To functionally prove that these miRNAs could have a direct effect on the repression of target genes, we transfected the human trophoblastic cell line JEG3 with miR-196b and miR-223 mimics and measured the gene expression of the predicted target genes (GALNT7, GALNT13 and ITGA2 for miR-196b; GALNT1, COL1A2 and MUC-1 for miR-223). [score:6]
When we transfected JEG 3 line with miR-223 a significant downregulation of GALNT1 expression was observed with time. [score:6]
Then, miR-196b and miR-223 could be targeting other unexpected/undescribed genes, being some of them responsible of regulating genes implicated in these reported pathways, finally balancing the gene expression of our selected genes. [score:6]
0102185.g004 Figure 4JEG3 cell line was used to check the inhibition effects of miR-196b and miR-223 mimics over predicted gene targets. [score:5]
JEG3 cell line was used to check the inhibition effects of miR-196b and miR-223 mimics over predicted gene targets. [score:5]
We observed a very significant increase (p<0.001) in the EP tissue samples compared to VTOP samples for hsa-miR-451(A) and hsa-miR-223 (B) expression, while hsa-miR-196b (D) showed a significant (p<0.05) downregulation compared to VTOP controls. [score:4]
The miRNA downregulated by the highest amount was hsa-miR-196b, with a 5.94-fold change compared to VTOP tissue, and the miRNA with the most increased expression was hsa-miR-223 with a 9.56-fold change compared to VTOP controls. [score:4]
Two miRNAs (hsa-miR196b and hsa-miR223) are able to target three important genes in the mucin biosynthesis pathway: GALNT7, GALNT1, and GALNT13. [score:3]
As an initial approach to functionally studying the differential profile of the statistically different miRNAs identified in the EP and VTOP embryonic samples, we performed a computational analysis to identify the genes and pathways which might be modulated by the three differentially expressed miRNAs we had found: miR-196b, miR-223, and miR-451. [score:3]
A significant ITGA2 expression was observed GALNT1 in JEG3 cells after 48 and 72 hours of miR-223 transfection (C). [score:3]
We confirmed a significant (p<0.001) increase in hsa-mir-451 (Figure 2A) and hsa-mir-223 (Figure 2B) miRNA expression (p<0.05) in EP samples compared to VTOP control samples, which was an even higher increase than in our microarray study. [score:2]
Trophoblast cell lines transfection with miR-196 and miR223. [score:1]
Of these seven miRNAs, three of them (hsa-miR-196b, hsa-miR-223, and hsa-miR-451) were validated by real time PCR in a larger sample of EP and control tissues. [score:1]
We first validated the miRNAs found in the microarray analysis by performing real time PCR on hsa-miR-196 and hsa-miR-223 in the same samples used for the microarray experiments (Figure S1). [score:1]
In vitro transfection of miR-196b and miR-223 in trophoblastic JEG3 cell line. [score:1]
In vitro cultured trophoblast cell line JEG3 at 50% of confluency was transiently transfected with 50 nM of either miR-196b and miR-223 mimic or scramble miRNA using HiPerfect, following the manufacturer's instructions (Qiagen, Valencia, CA, USA); after 24, 48 and 72 h RNA was extracted from the cells. [score:1]
We observed a very significant decrease (p<0.001) in the EP tissue samples compared to VTOP samples for hsa-miR-196b (A) expression, while hsa-miR-223 (B) showed a significant (p<0.05) increase compared to VTOP controls. [score:1]
[1 to 20 of 21 sentences]
23
[+] score: 76
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-15b
In our previous study, we showed that expression levels of miR-223, miR-23a and miR-15b were downregulated in the sera of MS patients versus healthy controls [15]. [score:6]
Moreover, stratifying according to the disease subtype, the downregulation of miR-223 and miR-23a still remained significant in RRMS patients vs. [score:6]
Moreover, based on the fact that genetic alterations could influence miRNA expression and possibly play a role in disease susceptibility, we genotyped three SNPs, mapping in the genomic regions of miR-223, miR-23a and miR-15b genes. [score:5]
2.1. miR-223 and miR-23a Expression Levels Are Altered in MS Patients versus ControlsIn the past few years, the identification of miRNAs differently expressed in blood and lesions of MS patients versus controls led miRNAs to be considered the new potential prognostic biomarkers for MS [4]. [score:4]
In this study, we found different expression levels of miR-223 and miR-23a in PBMCs of MS patients compared to controls, suggesting a possible involvement of these two miRNAs in the pathogenic mechanisms of the disease. [score:4]
In particular, we observed a significant upregulation of miR-223 and miR-23a levels in RRMS, but not in PPMS patients, though this could be due to the small number of PPMS cases. [score:4]
miR-223 is mainly expressed in myeloid cells and its function was originally described in the regulation of granulopoiesis. [score:4]
In particular, we determined the expression levels of these miRNAs both in PBMCs and sera from MS patients in order to establish a possible correlation between the levels of miR-223, miR-23a and miR-15b inside and outside the blood cells. [score:3]
In the present study, expression levels of miR-223, miR-23a and miR-15b were determined in PBMCs and serum from 15 MS patients and 12 controls (Table 1), as an independent replication. [score:3]
2.1. miR-223 and miR-23a Expression Levels Are Altered in MS Patients versus Controls. [score:3]
Based on these findings, a possible explanation of our results could be that the uptake of circulating miR-223 and miR-23a is increased in PBMCs of MS patients, where they exert their function on targeting genes, possibly involved in MS pathogenesis. [score:3]
Interestingly, target genes of miR-223, miR-23a and miR-15b seem to play a role in MS pathogenesis [15]. [score:3]
Interestingly, miR-223 has already been found upregulated in blood [10, 17], and in T regulatory cells [18] from MS compared to healthy subjects and in active MS lesions compared to normal CNS areas in controls subjects [11]. [score:3]
org websites, we found predicted target genes of miR-223 and miR-23a involved in immunity and possibly relevant to MS pathology. [score:3]
On the contrary, a significant downregulation of miR-223, miR-23a, and miR-15b levels was found in the serum of the same MS population when compared with controls (miR-223: 0.31 ± 0.07 vs. [score:3]
Expression levels of miR-223, miR-23a and miR-15b were analyzed using the One-Way Anova test. [score:3]
Interestingly, we found that the miR-223 gene is in LD with the VISG4 gene, a B7 family-related protein V-set and Ig domain-containing 4. VISG4 is a negative regulator of T cell activation. [score:2]
A significantly increased miR-223 relative expression level was observed in PBMCs from MS patients as compared with controls (0.94 ± 0.14 vs. [score:2]
edu/mpg/haploview/) to identify the tagging SNPs of miR-223, miR-23a and miR-15b genes (rs1044165, rs3745453 and rs1451761, respectively). [score:1]
Interestingly, exosomes secreted from IL-4 activated macrophages shuttle miR-223 into breast cancer cells and miR-223 promotes breast cancer cell invasion [20]. [score:1]
Genetic Analysis of miR-223, miR-23a and miR-15b in MS Patients. [score:1]
In order to test the genes coding for the studied miRNAs as susceptibility factors for MS, we also decided to perform genetic analyses of miR-223, miR23a and miR-15b. [score:1]
Thus, an association with variants in VISG4 gene in LD with miR-223 locus would be responsible for the association found with rs1044165 in our MS population. [score:1]
In particular, miR-223, miR-23a and miR-15b levels were significantly reduced [15]. [score:1]
3.4. miR-223, miR-23a and miR-15b Extraction from PBMCs and Serum and Quantitative Analysis by Real-Time PCR. [score:1]
The ease with which blood can be obtained in a manner that is minimally invasive to the patient encouraged us to go further in the analyses of miR-223, miR-23a and miR-15b in the cells of this tissue. [score:1]
The analysis of the three tagging SNPs revealed that the miR-223 rs1044165T allele likely acts as protective factor, whereas the miR-23a rs3745453C allele seems to exert a risk factor for MS pathogenesis. [score:1]
html) to determine the position of miR-223, miR-23a and miR-15b genes and Haploview software (http://www. [score:1]
The genetic analysis showed miR-223 SNP as a protective factor, and miR-23a variant as a risk factor for MS. [score:1]
Allele and genotype frequencies of miR-223, miR-23a and miR-15b SNPs in MS patients and controls were reported in Table 2. A significantly decreased genotypic frequency of miR-223 rs1044165 T/T genotype was observed in MS patients versus controls (OR = 0.29, CI: 0.17–0.50; p < 0.001). [score:1]
[1 to 20 of 30 sentences]
24
[+] score: 64
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Several studies have reported deregulated microRNAs in ATL patient samples and HTLV-1-transformed cells, among them miR-155, miR-146a, miR-150, and miR-223 were found up-regulated and miR-31 and miR124a down-regulated [146– 149]. [score:8]
Down-regulation of miR-223 was correlated with the up-regulation of HSP90B1, which was independently predictive of shorter time to the first therapy in CLL patients with unmutated IGHV [33]. [score:7]
AML patients present down-regulation of let-7b and miRNA-223 and overexpression of miRNA-128a and -128b compared to ALL. [score:5]
Finally, miR-223 was found to inhibit cellular growth in leukemia cells by targeting Insulin-Like Growth Factor 2 (IGF2) [120]. [score:5]
Lower expression of miR-181b, miR-29c and miR-223 was associated with disease progression in CLL patients and this correlates with unfavorable prognosis, such as shorter progression-free survival and overall survival [23, 30– 33]. [score:5]
The expression of miR-223 is known to affect T lymphopoiesis and granulocytosis with up to 20 % of acute ATL patients being diagnosed with the latter, which may be linked to high miR-223 expression [146]. [score:5]
Higher expression of miR-128b and lower expression of miR-223 has independently been reported for human ALL cell lines and ALL cells isolated from pediatric patients [61]. [score:5]
Jia CY, et al. MiR-223 suppresses cell proliferation by targeting IGF-1R. [score:4]
In addition, overexpression of miR-708, miR-223 and miR-27a has been associated with lower relapse-free survival in patients [77], possibly through regulation of FOXO3, BMI1 and E2F1. [score:4]
Deregulation of miR-146a, miR-155, miR-150 and miR-223 was reported to affect cellular proliferation [151– 153] and alteration of miR-31, miR-130b and miR-93 were involved in apoptosis resistance [154], suggesting a possible role of miRNA expression in ATL progression and pathogenesis. [score:4]
Plasma miR-511, miR-222, and miR-34a were up-regulated in B-ALL patients compared with normal controls, whereas plasma miR-199a-3p, miR-223, miR-221, and miR-26a were lower in B-ALL patients [167]. [score:3]
High miR-130b and low miR-145 and miR-223 expression in aggressive-type ATL were associated with shorter overall survival. [score:3]
The expression of miR-223 and the miR-15/16 family was increased in ALL patients treated with systemic glucocorticoid monotherapy [61, 78]. [score:3]
Analyses of over 430 miRNAs in 50 clinical T-ALL samples revealed a common signature: miR-223, miR-19b, miR-20a, miR-92, miR-142-3p, miR-150, miR-93, miR-26a, miR-16 and miR-342 [59]. [score:1]
De Leeuw et al. identified miRNA-23a, miRNA-27a, miRNA-199b, miRNA-221, and miRNA-223 as the most lineage-discriminative miRNAs between AML and ALL [63, 64]. [score:1]
Among miR-130b, miR-145 and miR-223, only miR-145 can act as an independent risk factor for ATL prognosis by a multivariate prognostic analysis. [score:1]
[1 to 20 of 16 sentences]
25
[+] score: 64
These miRNAs had overlapping and cooperative effects on tumor suppressor genes with miR-19b directly targeting PTEN and BIM; miR-20a directly targeting PTEN, BIM and PHF6; miR-92 directly targeting IKAROS/ IKZF1, PTEN, BIM, NF1 and FBXW7, and miR-223 directly targeting FBXW7, respectively. [score:15]
Moreover, it was confirmed that miR-223 mediated overexpression of TAL1 -induced growth of T-ALL cells through the direct inhibition of the expression of tumor suppressor, FBXW7. [score:10]
It was also shown that the expression of TAL1 and miR-223 was closely correlated during normal T-cell development as well as T-ALL, with high expression in early thymocytes and marked downregulation after the double -negative-2 stage of maturation. [score:9]
In this study, miR-223 was identified as the most upregulated miRNA by TAL1, and ChIP-sequence revealed that miR-223 was a direct target of TAL1. [score:7]
MiR-223 has been found to be overexpressed in a subset of T-ALLs and directly targeted FBXW7, a known tumor suppressor gene in T-ALL [31, 46]. [score:7]
Mavrakis et al. [46] further identified five miRNAs (miR-19b, miR-20a, miR-26a, miR-92 and miR-223) that contributed to leukemogenesis and acted as multi -targeted regulators of several tumor suppressor genes (IKAROS/ IKZF1, PTEN, BIM, PHF6, NF1 and FBXW7). [score:6]
Furthermore, another study of TAL1-regulated miRNAs in T-ALLs also showed the direct activation of miR-223, and inversely, the direct repression of miR-146b-5p by TAL1 [63]. [score:4]
MiR-223 was found overexpressed in a subset of myeloid-like adult T-ALLs which appeared to have an unfavorable clinical outcome [31]. [score:2]
Moreover, it also confirmed the negative regulation of FBXW7 by miR-223 [48]. [score:2]
Further studies by putative promoter analysis, luciferase and chromatin immunoprecipitation (ChIP) assays revealed that both NOTCH and NF-κB signal could directly and cooperatively activate the transcriptional activity of miR-223 promoter. [score:1]
Furthermore, miR-223 was transcriptionally activated by NF-κB signaling pathway [48]. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 56
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-16-2, hsa-mir-222, hsa-mir-126
Indeed, miR-223 regulates glucose metabolism and GLUT4 expression in neonatal rat cardiomyocytes[16], is up-regulated in insulin-resistant human hearts[16] and down-regulated in plasma from patients with type 2 diabetes[18]. [score:10]
Further studies targeting the role of HDL -associated miR-223 will also provide insight into the effect of dysregulated HDL-miRNAs in obesity -associated diseases and the metabolic changes associated with weight loss. [score:6]
MicroRNA-223 regulates Glut4 expression and cardiomyocyte glucose metabolism. [score:3]
Indeed, we have previously shown that miR-223 transfers from HDL to human coronary artery endothelial cells, where it inhibits inflammation by reducing mRNA and protein levels of intercellular adhesion molecule-1[7]. [score:3]
In obese mice, miR-223 is overexpressed in adipocytes[17]. [score:3]
In fact, Milagro et al. showed that baseline expression of several miRNAs including miR-223, in peripheral blood mononuclear cells of obese women can predict the response to a hypocaloric diet[12]. [score:3]
Changes in miR-223 levels were not associated to changes in HDL composition or size. [score:1]
As there are no reports of changes in HDL -associated miRNA levels with diet -induced weight loss in the literature, we have examined the effects of weight loss on HDL levels of miR-16, miR-17, miR-126, miR-222 and miR-223, all of which have a known association with obesity and are HDL -associated[6]. [score:1]
Additional evidence that miR-223 is sensitive to metabolic change comes from a recent study showing that serum miR-223 levels are increased after one-hour of acute anaerobic exercise[19] and immediately after completing a marathon race[20]. [score:1]
Circulating miR-223 levels have previously been associated with diet -induced weight loss[12]. [score:1]
These results are consistent with the fact that miR-223 has previously been associated with metabolic disorders such as obesity and diabetes[16– 18]. [score:1]
This suggests that basal levels of miRNAs, including miR-223, could potentially be used as prognostic biomarkers and may forecast the response to a hypocaloric diet. [score:1]
We aim to determine if HDL -associated miR-16, miR-17, miR-126, miR-222 and miR-223 levels are altered by diet -induced weight loss in overweight and obese males. [score:1]
It has recently been demonstrated that HDL transport multiple miRNAs, including miR-16, miR-17, miR-126, miR-222 and miR-223[6]. [score:1]
After multiple testing corrections, we found that only the level of HDL -associated miR-223 was significantly decreased in overweight and obese male subjects after 12 weeks of high protein diet -induced weight loss. [score:1]
Indeed, Milagro et al. have shown that peripheral blood mononuclear cells (PBMCs) miR-223 levels predict the response to diet -induced weight loss with basal levels of miR-223 being lower in people that did not respond to the weight loss intervention[12]. [score:1]
The association of miR-223 with metabolic disorders has been demonstrated both in vitro and in vivo. [score:1]
This raises the possibility that HDL -associated miR-223 may play a role in the metabolic changes associated with diet -induced weight loss through its involvement in intercellular communication[16]. [score:1]
We also found that changes in HDL-miR-223 levels are not related to HDL composition or size as 12 weeks of HP diet was accompanied by a decrease in the level of HDL -associated miR-223, while the composition and size of the HDL particles did not change. [score:1]
The HP diet induced a significant decrease in HDL -associated miR-223 levels (p = 0.015), which positively correlated with changes in body weight (r = 0.488, p = 0.032). [score:1]
These results indicate that changes in HDL -associated miR-223 levels are independent of changes in HDL size. [score:1]
HDL -associated miR-223 levels are significantly decreased after HP diet -induced weight loss in overweight and obese males. [score:1]
Indeed, we and others have reported that miR-223 in particular is transferred between cells by HDL in a novel cell-to-cell communication network[6, 7]. [score:1]
These include miR-16, miR-17, miR-126, miR-222 and miR-223[8– 11]. [score:1]
Changes of HDL -associated miR-16, miR-17, miR-126, miR-222 and miR-223 levels over 12 weeks of weight loss diet (n = 47). [score:1]
Fig 1 and Table 2 show the fold changes of HDL -associated miR-16, miR-17, miR-126, miR-222 and miR-223 from overweight and obese subjects over 12 weeks of HP or NP weight loss diet. [score:1]
The results in the present study show that after 12 weeks of HP diet -induced weight loss, the levels of HDL -associated miR-223 are significantly decreased in obese and overweight individuals. [score:1]
Our results suggest that, among all the HDL -associated miRNAs that were studied in this project, HDL -associated miR-223 is the most sensitive to metabolic changes after 12 weeks of diet -induced weight loss. [score:1]
Non-normally distributed variables (fold changes of miR-222 and miR-223) were normalised prior to analysis using natural logarithmic (ln) transformation. [score:1]
miR-16, miR-17, miR-126, miR-222 and miR-223 were present on HDL from overweight and obese subjects at baseline and after 12 weeks of the HP and NP weight loss diets. [score:1]
For miR-223, a significant decrease was found in the HP group (p = 0.015), but not in the NP group. [score:1]
In fact, obesity is associated with decreased levels of miR-17 in the blood, subcutaneous and omental adipose tissue from obese subjects[8], decreased levels of miR-126 in both white adipose tissue from obese women and isolated fat cells[9] and decreased levels of serum miR-223[10]. [score:1]
These results indicate that changes in HDL-miR-223 levels are not associated with changes in HDL composition (Fig 2). [score:1]
In the HP diet group, changes in the level of HDL -associated miR-223 were positively correlated with changes in body weight over 12 weeks of diet (Table 3). [score:1]
[1 to 20 of 34 sentences]
27
[+] score: 55
The transcription factor Mef2c has been identified as a crucial target of miR-223 in mouse myeloid precursors [35] and, indeed, conditional knock-out of Mef2c within the miR-223 knock-out mouse rescued the proliferation abnormality but not the differentiation defect and the functionality of granulocytes [35], suggesting that additional miR-223 targets might be responsible for these phenotypes. [score:7]
As C/EBP α  inhibits cell-cycle progression by interfering with E2F1 activity [37], these data suggest that downregulation of E2F1 by miR-223 (see above) could be important for the granulocytic maturation process. [score:6]
Low levels of miR-223 have been reported in AML patients with the t(8; 21) chromosome translocation, which is responsible for the production of the fusion protein AML1-ETO (also known as RUNX1-ETO) and it has been shown that the AML1-ETO protein inhibits miR-223 expression through its binding to the promoter region and the recruitment of chromatin remo delling enzymes [33]. [score:5]
Importantly, treatment of cells carrying the AML1-ETO translocation with hypomethylating agents, AML1/ETO inhibitors, or ectopic expression of miR-223 was able to arrest proliferation and stimulate myeloid differentiation [26, 31, 33]. [score:5]
Among the deregulated miRNAs in AML, these studies identified miRNAs already known to be hematopoietic specific (e. g., miR-142-5p, miR-223, and miR-181) or reported to be highly expressed in other hematological malignancies and solid tumours (e. g., miR-221, miR-222, miR-17-92 cluster and miR-155) [6, 18, 20, 21, 69]. [score:4]
Fazi et al. observed a down-regulation of miR-223 in t(8; 21) AML samples [33] and showed that this was due to epigenetic silencing by the AML1-ETO oncoprotein (see above). [score:4]
Conversely, miR-223 expression is negatively regulated by NFI-A and E2F1 [26, 30]. [score:4]
miR-223 is preferentially expressed in myeloid cells [27] and is induced by ATRA treatment of APL cells through the transcription factors CCAAT/enhancer binding protein α (C/EBP α) and PU. [score:3]
This is mediated, at least in part, by the translational repression of NFIA and LMO2 by miR-223 [31, 34]. [score:3]
Ectopic expression for some of these miRNAs, such as miR-26a, miR-29a, miR-142-3p and miR-342, has been produced and, similarly to miR-223, it stimulated granulocytic differentiation of AML cells [38, 41, 43, 44]. [score:3]
Notably, these two genes are posttranscriptionally regulated by miR-223, thus generating a negative feedback loop [26, 30]. [score:2]
Altogether these data indicated that the deregulation of miR-223 might contribute to the differentiation block underlying myeloid leukemia pathogenesis. [score:2]
A miR-223 knock-out mouse has been produced [35]. [score:2]
The decline of miR-223 is a critical event for the expansion of erythroblast cells. [score:1]
Following miR-223, additional studies have identified different miRNAs activated by ATRA treatment in APL cell lines and primary APL blasts [19, 29, 38– 43]. [score:1]
The presence of miR-223 is dispensable for granulocyte cell fate specification and its absence produced an increase of granulocyte progenitors and altered granulocyte immunological function. [score:1]
The first miRNA found to play a critical role in APL differentiation was miR-223 [26]. [score:1]
Consistently with the data obtained in malignant myelopoiesis, in normal myeloid differentiation of human cord blood CD34 [+] hematopoietic progenitor cells (HPSs), miR-223 levels increased during granulocytic differentiation and decreased during erythroid maturation [34]. [score:1]
[1 to 20 of 18 sentences]
28
[+] score: 52
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
The deregulation of miR-155, the miR-17-92 cluster and miR-223, miRNAs involved in lung development and homeostasis, resulted in the uncontrolled lung inflammation in murine mo dels [70, 77, 82]. [score:3]
In addition, another miRNA, miR-223, has been shown to be crucial for normal granulocyte development and function in the lung [82]. [score:2]
Several miRNAs such as miR-155, miR-26a, let-7, miR-29, miR-15/miR-16, miR-223, miR-146a/b and the miR-17-92 cluster have been shown to be involved in homeostasis and in the lung development (Table 4). [score:2]
MiR-200a and miR-223 were detected in lethal influenza virus infection presumably contributing to the extreme virulence of the r1918 influenza virus [85]. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 52
Even under hypocholesterolemic conditions, treatment with miR-223 suppressed HMGCoA-S1 and SC4MOL expression, suggesting that perhaps its expression is sensitive to cellular cholesterol concentrations. [score:7]
Lastly, miR-96, miR-185, and miR-223 have all been shown to suppress SRB1 expression in vitro and, therefore, regulate macrophage cholesterol uptake [32, 33]. [score:6]
However, expression of 3-hydroxy-3-methylglutaryl-coA reductase (HMGCoA-R) was increased with miR-223 overexpression, indicating a more complicated pathway of miR-223 -mediated regulation of cholesterol biosynthesis [33]. [score:6]
That miR-223 is the main miRNA found on HDL is particularly interesting because, as discussed in more detail below, miR-223 is also capable of regulating SRB1 expression [32, 33]. [score:4]
Conversely, miR-223 treatment increased ABCA1 expression and cholesterol efflux to ApoA1, though by an indirect mechanism [33]. [score:4]
MiR-223 overexpression in vitro repressed mRNA expression of 3-hydroxy-3-methylglutaryl-coA-synthase 1 (HMGCoA-S1) and methylsterol monoxygenase 1 (SC4MOL), two genes in the cholesterol biosynthetic pathway [33]. [score:4]
Along with miR-223, miR-96 and miR-185 were also identified as regulators of SRB1 expression [32]. [score:4]
MiR-223 also suppresses hepatic SRB1 expression, leading to a reduction in hepatic HDL uptake [33]. [score:4]
MiR-185 and miR-223 are activated by hypercholesterolemic conditions, therefore their ability to inhibit further cholesterol uptake is unsurprising. [score:3]
Therefore, miR-223 may be able to regulate its own cellular uptake. [score:2]
Along with miR-33-5p, miR-223 is involved in the regulation of numerous genes that maintain cholesterol homeostasis. [score:2]
For example, miR-223 [−/−] mice have a nearly four-fold increase in CYP7A1 mRNA [33]. [score:1]
MiR-223 was previously discussed for its ability to regulate numerous genes, including macrophage SRB1. [score:1]
Sp3 is an Sp1 antagonist [52]; indeed, in vitro, miR-223 antagonized Sp3, derepressing Sp1 and allowing for induction of ABCA1 [33]. [score:1]
One such miRNA is miR-223 [33]. [score:1]
Lastly, recent evidence suggests that miR-223 may also modulate CYP7A1. [score:1]
HDL is the primary lipoprotein involved in miRNA transport, with miR-223 being the most abundant miRNA [31]. [score:1]
[1 to 20 of 17 sentences]
30
[+] score: 48
In conclusion, a more sensible and specific quantification of miRNAs by absolute Q-PCR analysis highlighted common up-regulation of miR-206, miR-223, miR-199a-5p, miR-199b*, miR-27a, miR-128a, miR-31 and miR-142-5p, and down-regulation of miR-17 in dystrophic fibres isolated from TA, DIA and VA of the adult mdx mouse (Figure S1). [score:7]
Absolute quantification confirmed common up-regulation of miR-206, miR-199a-5p, miR-223 and miR-199b* in all mdx single fibres tested (Figure S1). [score:4]
MiR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223 were significantly up-regulated afterwards muscle damage respect damaged muscle. [score:4]
In the case of the FRG1 over -expressing mice, only 4 of the tested miRNAs were found over-expressed in all muscle analyzed (miR-206, miR-223, miR-199a-5p and miR-199b), while the remaining 10 miRNAs showed a heterogeneous behaviour depending on the muscle considered. [score:4]
We identify fourteen miRNAs associated to dystrophic fibres (miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) that may mediate muscle regeneration and remo delling in animal mo dels of MDs and acute muscle damage, and confirm over -expression of the previously identified regeneration -associated myomiR-206. [score:3]
Moreover expression of miR-223 and miR-142-5p in single muscle fibres might reflect the common mesodermic origin of muscle and hematopoietic tissues. [score:3]
In this study we have also shown the expression of non-muscle enriched miRNAs, such as the granulocytes -associated miR-223 and haematopoietic miR-142-5p, in single muscle fibres. [score:3]
In agreement with our finding, previously published data demonstrated expression of miR-223 and miR-142-5p not limited to granulocytes or haematopoietic lineage. [score:3]
Dystrophic muscle fibres isolated from different animal mo del of MDs were commonly characterized by the over -expression of several miRNAs (miR-15b, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) with an expression profile strictly dependent on muscle impairment and damage accumulation (Figure 7). [score:3]
Data obtained evidenced a group of miRNAs whose expression does not change during muscle repair afterwards acute damage (miR-15b, miR-17, miR-128a, miR-221, miR-199a-5p miR-199b and miR-199b*) (Table 1), and a group of miRNAs that are triggered afterwards CTX delivery (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) (Table 1), suggesting major involvement of the latter in muscle regeneration. [score:3]
Fourteen miRNAs were found dysregulated in dystrophic muscle fibres of the mdx mouse with differences linked to the originating muscle (miR-206, miR-199a-5p, miR-223, miR-199b, miR-199b*, miR-21, miR-221, miR-17, miR-15b, miR-31, miR-128a, miR-142-5p, miR-335-5p and miR-27a). [score:2]
The expression levels of miR-21, miR-142-5p, miR-199a-5p, miR-199b*, miR-206, miR-223 and miR-335-5p were instead strictly related to the type of muscle considered, underling a relationship with muscle-type dependent impairment (Figure 2B). [score:2]
Otherwise, single muscle fibres isolated from lower affected TA and VA of the mdx mouse were respectively associated to 7 (miR-206, miR-199a-5p, mir-223, mir-199b, miR-199b*, miR-21 and miR-221) and 5 (miR-206, miR-199a-5p, mir-223, mir-199b and miR-199b*) dysregulated miRNAs (Figure 1). [score:2]
This study demonstrated a common signature of DMD and ischemic muscle, outlining three different families of DMD-signature miRNAs: inflammatory (miR-222 and miR-223), degenerative (miR-1, miR-29c, and miR-135a) and regenerative (miR-31, miR-34c, myomiR-206, miR-335, miR-449, and miR-494). [score:1]
In particular, miR-223 was localized in cardiomyocytes, with prominent peri-nuclear staining, and in non-myocytes by in situ hybridization on cryosection of heart [48]; and miR-142-5p was detected in embryonic stem cells (ESC) where it is involved in cardiac differentiation [49]. [score:1]
Only 7 of the 14 miRNAs associated to dystrophic fibres (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) were triggered by CTX injury. [score:1]
The array analysis evidenced a dystrophic miRNA-signature not dependent to the muscle type of origin which include the regeneration -associated miR-206; miR-199a-5p, miR-199b, miR-199b* and miR-223. [score:1]
In agreement with data already published characterizing the miRNome of mdx and DMD muscle [15], [16], [17], the over -expression of several miRNAs (miR-21, miR-31, miR-199a-5p, miR-199b, miR-142-5p, miR-221, miR-223 and miR-335-5p) was confirmed in murine dystrophic single muscle fibres. [score:1]
[1 to 20 of 18 sentences]
31
[+] score: 47
For instance, miR-449-5p exerts anti-IAV activities by inhibiting histone deacetylase and, therefore, inducing IFNβ expression (18), and inhibition of miR-223-3p (which was more highly expressed in the DBA/2J strain in our study) reduced mortality and delayed death of H5N2-infected mice (64). [score:9]
miR-223-3p dampens NLRP3 inflammasome activity (70) and can inhibit inflammation by targeting STAT3 (71). [score:5]
Expression of 75 miRNAs, including miRNAs of the miR-21, miR-223, miR-34, and miR-449 correlated with both HA mRNA expression and any of the hematological parameters. [score:5]
These are comprised of miRNAs with a lower (miR-34b-5p and miR-92b-3p) or higher (miR-467e-5p) expression in DBA/2J vs C57BL/6J mice throughout the time course and those that are more highly expressed at 48 or 120 hpi only (miR-223-3p and miR-21a-3p). [score:5]
Of note, one of these miRNAs (miR-18a-5p) (as well as miR-223-3p, whose expression in addition differed between the two mouse strains) is among three miRNAs that were recently identified as being commonly regulated in the response to IAV infection in all four species screened, i. e., humans, pig, chicken, and mouse (63). [score:4]
The RT-qPCR analysis confirmed the higher expression of miR-223-3p, miR-21a-3p, and miR-467e-5p in DBA/2J and the lower expression of miR-34b-5p and miR-92b-3p after infection, compared to C57BL/6J (Figure 8B). [score:4]
Of these, miR-223-3p (whose expression correlated the most strongly with granulocyte numbers) is known to play important roles in the differentiation of myeloid cells, including neutrophils (56). [score:3]
Absolute granulocyte numbers and miRNA expression correlated most significantly in both mouse strains (23 miRNAs with significant correlations; violet circles in Figure 3), with miR-223-3p, miR-142-3p, and miR-20b-5p correlating the most positively in both mouse strains ([ρ [DBA/2J] + ρ [C57BL/6J]]/2 > 0.7). [score:3]
When FC values were used, RT-qPCR detected changes in miR-21a-3p, miR-223-3p, and miR-34b-5p expression in the same direction as measured by RNAseq, whereas no significant regulation was observed for miR-467e-5p and miR-92b-3p (Figure 8A). [score:3]
Expression of subsets of miRNAs correlated significantly with peripheral blood granulocyte and monocyte numbers, particularly in DBA/2J mice; miR-223-3p, miR-142-3p, and miR-20b-5p correlated most positively with these cell types in both mouse strains. [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
[1 to 20 of 11 sentences]
32
[+] score: 45
While some researchers found that the overexpression of miR-223 suppressed osteoclastogenesis, others have recently demonstrated that this overexpression could impair the production of IL-10 (a potent anti-inflammatory cytokine in RA synovial tissue) in activated T cells through targeting IGF-1R [40]. [score:9]
One putative target of miR-223 is repression of NF-1a, which is responsible for osteoclast differentiation and function, by upregulating the expression of the M-CSF receptor [15]. [score:8]
Human neutrophils express 148 different miRNAs; one of the most important is miR-223, since results from several studies indicate that this miRNA is preferably expressed in the myeloid cell lineage and its level of expression positively correlates with the progression of granulopoiesis. [score:7]
Furthermore, authors confirmed, in vitro, the capability of miR-223 to suppress osteoclastogenesis in PBMC when it was overexpressed. [score:5]
In a study performed in Japan, the expression of miR-223 in RA synovium was found to be highly expressed in RA synovium when compared to OA. [score:4]
Fulci et al. identified an overexpression of miR-223 in T cells and plasma from RA patients; however, results are debatable [39]. [score:3]
This evidence suggests that administration of miR-223 could prevent joint destruction by inhibiting osteoclastogenesis [66]. [score:3]
This suppression might be induced via RANKL or TNF- α; in theory, miR-223 might exert its effect in a common molecule downstream their signaling pathways. [score:3]
Additionally, after performing ROC curve analysis, two miRNAs were identified to have the highest area under the curve (miR-23 and miR-223) and furthermore, when analyzed in combination, demonstrated a higher sensitivity and specificity to identify responders to treatment, in relation to the identification made with other miRNAs alone. [score:1]
Ismail et al. along with the work of other researchers found that miR-223 is a central mediator of an intercellular crosstalk between immune cells, as it packs itself with HDLs (high-density lipoproteins) and is transported into endothelial cells which do not transcribe miR-223 [38]. [score:1]
From these, only six (miR-16-5p, miR-23-3p, miR-125b-5p, miR-126-3p, miR-146a-5p, and miR-223-3p) reached significance with high confidence levels, and all of them were elevated exclusively in responders to treatment. [score:1]
[1 to 20 of 11 sentences]
33
[+] score: 44
Given the fact that miR-124 negatively regulates the expression of miR-223 as shown by us previously [15], there is a possibility that inhibition of miR-124 in the IL-4 treated macrophages results in a further upregulation of miR-223 and further increase in the Arg1 expression. [score:11]
It was recently demonstrated that miR-223 is up-regulated by IL-4 resulting in the upregulation of Arg1 [14]. [score:7]
One of the possible candidates that may cause the upregulation of Arg1 is miR-223, which is expressed in macrophages in the periphery but not in the CNS [15]. [score:6]
We have previously demonstrated that in contrast to the mouse macrophages in the periphery, microglia expressed high levels of miR-124, but not miR-223 [15], and this microRNA contributed to the M2 phenotype in these cells, suggesting the role of miR-124 in polarization of CNS-resident macrophages [13], [15]. [score:3]
Thus there is a possibility that miR-223 can substitute for miR-124 in macrophages treated with miR-124 inhibitor. [score:3]
However, miR-223 is prominently expressed in granulocytes and is not fully M2-specific [33]. [score:3]
We have previously shown that microglia in the normal CNS exhibited properties of the M2-type macrophages [8] and expressed high levels of miR-124 but not the M1 phenotype associated miR-155 or another reported M2 -associated miR-223 [15]. [score:3]
As for miR-124 it was also shown that another M2 -associated microRNA, miR-223, was capable of inhibiting the STAT3 pathway [26]. [score:3]
Recent study suggests that miR-223 contributes to the development of the M2 phenotype in macrophages residing in the adipose tissue [7], [14]. [score:2]
Finally, besides miR-124 and miR-223, other microRNAs may also contribute to M2 phenotype of macrophages further suggesting redundant mechanisms in the regulation of M2 polarization by several microRNAs [27]. [score:2]
miR-146 and miR-21, which are involved in the macrophage activation and the resolution of inflammation, respectively [13], were shown to be associated with allergic responses [31], [32], so as was miR-223 which was recently shown to contribute to the M2 phenotype acquisition [14]. [score:1]
[1 to 20 of 11 sentences]
34
[+] score: 43
Downregulation of HNF1B in HepG2 cells resulted in significant reduction of all analysed miRNAs, with the highest impact on miR-223 whose level was reduced by almost 99%. [score:4]
Five of them differed between HNF1A-MODY and HNF1B-MODY, and, amongst those, four (miR-24, miR-27b, miR-223 and miR-199a) showed HNF1B-MODY-specific expression levels in the replication group. [score:3]
Among the 11 differentially expressed miRNAs (significant in ANOVA), eight differed significantly between HNF1B-MODY and at least one of the other groups (miR-32, miR-223, miR-23a, miR-199a, miR-27b, miR-24, miR-145 and miR-423; ESM Table 3). [score:3]
Expression levels of: (c) miR-24 ΔC [t]; (d) miR-223 ΔC [t]; (e) miR-27b ΔC [t]; (f) miR-199a ΔC [t]; (g) miR-32 ΔC [t]; (h) miR-23a ΔC [t]; (i) miR-423 ΔC [t]; (j) miR-145 ΔC [t]. [score:3]
Apart from miR-223, which correlated negatively with BMI in the type 1 diabetic and HNF1A-MODY groups, no significant correlations were noted for the clinical covariates with miRNA expression levels (ESM Table 5). [score:3]
In conclusion, we have shown that expression of the circulating miRNAs miR-24, miR-223, miR-27b and miR-199a depends on HNF1β function, making them potentially applicable in the diagnosis of HNF1B-MODY. [score:3]
The miRNAs with the most significant differences in expression levels mirrored those observed in the primary group: miR-24, miR-223, miR-27b and miR-199a (Fig.   2). [score:3]
The most striking differences were found between the HNF1B-MODY and HNF1A-MODY groups, evidenced by lower expression levels of miR-223, miR-24, miR-27b and miR-199a in the former. [score:3]
Linking miRNA and effector pathways in our study was based on bioinformatic predictions; however, a recent study on chromatin immunoprecipitation (ChIP) of HNF1β published by Hajarnis et al (deposited as GSE71250 in the Gene Expression Omnibus database) showed that miR-223 indeed has a strong HNF1β -binding site in its promoter region, while the intragenic miR-199a has an HNF1β -binding site in the promoter of the dmm-2 gene [33]. [score:3]
HNF1β binding sites were the most prevalent in the case of miR-223, which correlated with its having the greatest reduction in expression in the cell line experiments. [score:3]
Significant differences in covariate-adjusted expression levels were noted for miR-24 (p = 0.0072), miR-223 (p = 0.0184), miR-27b (p = 0.0107) and miR-199a (p = 0.0435; ESM Fig.   1). [score:3]
Brackets are used to connect the groups with significant (p < 0.05) pairwise differences; [†] p = 0.07; exact p values are shown in ESM Table  4 Afterwards, we measured the impact of siRNA -induced knockdowns of HNF1α and HNF1β on the expression levels of miR-24, miR-223, miR-27b and miR-199a in human hepatocytes (HepG2). [score:2]
miR-24, miR-223, miR-23 and miR-199a show 100% conservation of seed region sequences between humans and mice [23]. [score:1]
The silencing of HNF1A significantly decreased levels of miR-24, miR-27b and miR-199a, and had no effect on the miR-223 content in HepG2 cells (Fig.   3d). [score:1]
Significance criterion was met by 11 distinct miRNAs: miR-223, miR-24, miR-99b, miR-423, miR-92a, miR-27b, miR-23a, miR-199a, miR-101, miR-145 and miR-32; these are presented on a hierarchical cluster heatmap in Fig.   1b. [score:1]
AU, arbitrary units These data suggest that serum levels of miR-24, miR-223, miR-27b and miR-199a associated with HNF1B dysfunction might reflect changes in intracellular miRNA profile in the liver. [score:1]
Interestingly, another study also showed that miR-223 and miR-199a are dependent on liver function [32], supporting our assumption that the most significant impact of an HNF1A or HNF1B defect would be manifested predominantly via hepatic function disruption rather than by beta cell -associated effects. [score:1]
Silencing of HNF1B in human hepatocytes significantly decreased intracellular levels of miR-24, miR-27b, miR-199a and miR-223. [score:1]
Fig. 2Comparisons of serum miRNA levels in the UK group: (a) miR-24; (b) miR-223; (c) miR-27b; (d) miR-199a. [score:1]
[1 to 20 of 19 sentences]
35
[+] score: 43
resistant cellsmiRNA microarray RT-qPCR Western blottingLi, 2009 [124] G2535 (equivalent to 25 μM GEN) 2 daysColo357, Panc-1, HPDE↑ miR-146a expression ↓ EGFR, IRAK-1, NF-κB and MTA-2 expression ↓ cell invasionmiRNA microarray RT-qPCR Western blottingLi, 2010 [125] GEN 60 μM 16 h, 3 days, 7 days AsPC-1, MiaPaCa-2↑ miR-34a expression ↓ Notch-1 expression ↓ cell growth ↑ apoptosisRT-qPCR Western blottingXia, 2012 [126] GEN 60 μM 3 daysAsPC-1, BxPC-3↓ miR-223 expression ↑ Fbw7 protein expression ↓ cell growth ↑ apoptosis ↓ migration and invasionMTT assay FACS for apoptosis detection RT-qPCR Western blottingMa, 2013 [127] GEN n. a. n. a. ↓ miR-27a ↓ cell growth ↑ apoptosis ↓ invasionMTT assay RT-qPCR Western blottingXia, 2014 [128] (abstract only) Equol 10, 100 μg PND 1–10 Sprague-Dawley rats ↑ methylation at the c-Ha-Ras gene methylation sensitive restriction digestion, Southern blottingLyn-Cook, 1995 [80]Abbreviations: SPI: soy protein isolate; AOM: Azoxymethane; G2535: contains 70.5% GEN, 26.3% DAI, 0.3% GLY); HPDE: Human pancreatic duct epithelial cells; also see footnotes Table 1. In 2012, stomach cancer had a global incidence of 952000 cases and resulted in 724000 cancer deaths [1, 11]. [score:11]
resistant cellsmiRNA microarray RT-qPCR Western blottingLi, 2009 [124] G2535 (equivalent to 25 μM GEN) 2 daysColo357, Panc-1, HPDE↑ miR-146a expression ↓ EGFR, IRAK-1, NF-κB and MTA-2 expression ↓ cell invasionmiRNA microarray RT-qPCR Western blottingLi, 2010 [125] GEN 60 μM 16 h, 3 days, 7 days AsPC-1, MiaPaCa-2↑ miR-34a expression ↓ Notch-1 expression ↓ cell growth ↑ apoptosisRT-qPCR Western blottingXia, 2012 [126] GEN 60 μM 3 daysAsPC-1, BxPC-3↓ miR-223 expression ↑ Fbw7 protein expression ↓ cell growth ↑ apoptosis ↓ migration and invasionMTT assay FACS for apoptosis detection RT-qPCR Western blottingMa, 2013 [127] GEN n. a. n. a. ↓ miR-27a ↓ cell growth ↑ apoptosis ↓ invasionMTT assay RT-qPCR Western blottingXia, 2014 [128] (abstract only) Equol 10, 100 μg PND 1–10 Sprague-Dawley rats ↑ methylation at the c-Ha-Ras gene methylation sensitive restriction digestion, Southern blottingLyn-Cook, 1995 [80]Abbreviations: SPI: soy protein isolate; AOM: Azoxymethane; G2535: contains 70.5% GEN, 26.3% DAI, 0.3% GLY); HPDE: Human pancreatic duct epithelial cells; also see footnotes Table 1. In 2012, stomach cancer had a global incidence of 952000 cases and resulted in 724000 cancer deaths [1, 11]. [score:11]
Ma J. Cheng L. Liu H. Zhang J. Shi Y. Zeng F. Miele L. Sarkar F. H. Xia J. Wang Z. Genistein down-regulates miR-223 expression in pancreatic cancer cells Curr. [score:6]
Ma et al. showed that GEN (60 μM) down-regulated miR-223 expression, reduced cell growth and invasion, and increased apoptosis in pancreatic cancer cell lines. [score:6]
GEN in combination with anti-miR-223 was even more effective in inducing Fbw7 levels, and consequently inhibiting cell growth, migration as well as invasion and inducing apoptosis, indicating that some of the effects of GEN might be through miR-223 repression and induction of its target Fbw7 [127]. [score:5]
miR-223 is up-regulated in various tumor types and plays an oncogenic role in pancreatic cancer. [score:4]
[1 to 20 of 6 sentences]
36
[+] score: 42
a Over -expression of miR-31 restores chemo-response by reducing stathmin expression; miR-101/stathmin pathway contributes to radioresistance in human NPC; down-regulation of miR-193b promotes migration and proliferation of tumor cells by targets stathmin; miR-223 regulates stathmin by JNK signaling pathway to regulate MPM cell motility; b up-regulation of miR193b reduces proliferation and migration by inhibiting stathmin and uPA; silencing of miR-210 promotes proliferation of cancerous cells; transfection of miR-142 and miR-223 decreases expression of stathmin and IGF-1R to inhibit proliferation of cancerous cells; c microrna-9 inhibits cell proliferation, vasculogenic mimicry and tumor growth through controlling stathmin expression; miR-101 suppresses autophagy via targets stathmin and down-regulation of miR-101 is linked to the increase of cellular proliferation and invasiveness. [score:32]
Specific transfection of miR-142 and miR-223 influences post-transcriptional regulation of proteins in hepatocellular carcinoma (HCCs), which has a suppressive effects on proliferation of hepatocellular carcinoma cells by regulating expressions of stathmin and insulin-like growth factor-1 receptor (IGF-1R) [74] (Fig.   5b). [score:7]
And study reveals that aberrant miR-223 contributes to aggressiveness of malignant pleural mesothelioma (MPM) by regulating stathmin and both are also in turn regulated by the JNK signally pathway [31] (Fig.   5a). [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 41
In that cohort of patients, etanercept significantly downregulated serum levels of hsa-miR-223-3p and hsa-miR-126-5p among others. [score:4]
Six out of ten miRNAs selected for validation were found significantly upregulated by anti-TNFα/DMARDs combination therapy (miR-16-5p, miR-23-3p, miR125b-5p, miR-126-3p, miRN-146a-5p, miR-223-3p). [score:4]
A second group of five miRNAs under 2-fold change but involved in processes such as inflammation, cardiovascular and autoimmune diseases, and RA were also selected (hsa-let-7a-5p, hsa-miR-16-5p, hsa-miR-124a-3p, hsa-miR-155-5p, hsa-miR-223-3p). [score:3]
In our cohort, IL-6 receptors alpha and beta were found to be putative targets for three of the six validated miRNAs (hsa-miR-23-3p, hsa-miR-125b-5p, and hsa-miR223-3p). [score:3]
Filková M Aradi B Senolt L Ospelt C Vettori S Mann H Association of circulating miR-223 and miR-16 with disease activity in patients with early rheumatoid arthritisAnn Rheum Dis. [score:3]
To validate the PCR array data, ten miRNAs differentially expressed were selected (hsa-miR-125b, hsa-miR-23a-3p, hsa-miR-21-5p, hsa-miR-126-3p, hsa-miR-146a-5p, hsa-let-7a-5p, hsa-miR-16-5p, hsa-miR-124a-3p, hsa-miR-155-5p, and hsa-miR-223). [score:3]
Consistent with our results, a recent study has shown the association of two of the miRNAs found significantly increased in response to anti-TNFα/DMARDs combination therapy in our study (hsa-miR-223-3p, and hsa-miR-16-5p) with disease activity in RA patients newly diagnosed [34]. [score:3]
To validate the PCR array data,10 miRNAs differentially expressed were selected (hsa-miR-125b, hsa-miR-23a-3p, hsa-miR-21-5p, hsa-miR-126-3p, hsa-miR-146a-5p, hsa-let-7a-5p, hsa-miR-16-5p, hsa-miR-124a-3p, hsa-miR-155-5p, and hsa-miR-223). [score:3]
The miRNAs validated by RT-PCR in our cohort of patients (miR146a-5p, miR-16-5p, miR-23-3p, miR-125b-5p, miR223-3p; miR126-3p) have been previously reported to act as relevant regulators of immune cells development, playing crucial roles in the inflammatory response, and acting as key players in the pathogenesis of various chronic and autoimmune disorders, including RA itself [24]. [score:3]
That data were further supported by ROC analyses, which showed that hsa-miR-23-3p and hsa-miR-223-3p levels at T1, with a cutoff value of 6.9 and 11.2 (relative expression at T1) respectively, were predictors of non-response to anti-TNFα/DMARD combination treatment (Figure  5B-C) with a sensitivity of 62.5% and 57.1%, and a specificity of 86.4% and 90.2% respectively. [score:3]
Taken together, these results suggest that serum hsa-miR-23a-3p and hsa-miR-223-3p can act both as predictors of therapy response and biomarkers of response to anti-TNFα/DMARDs combination therapy with high specificity. [score:1]
Furthermore, ROC analyses demonstrated that two of these six miRNAs (hsa-miR-23-3p and hsa-miR-223-3p) can act in RA patients as both predictors of therapy response (indicating those patients who would not benefit from anti-TNFα/DMARDs combination therapy), and as biomarkers of response to anti-TNFα/DMARDs combination therapy (so that their levels would be indicative of treatment efficacy and also of the degree of response). [score:1]
The changes observed in three miRNAs (hsa-miR-146a-5p, hsa-miR-223-3p and hsa-miR-16-5p) significantly correlated with the changes observed in clinical parameters (that is, DAS28), and five of them at least with changes in inflammatory parameters such as CRP or ESR (hsa-miR-146a-5p, hsa-miR-223-3p,hsa-miR-16-5p, hsa- miR-126-3p and hsa-miR-23-3p) (Figure  4). [score:1]
Further, we identified a specific plasma miRNA signature (miR-23 and miR-223) that may serve both as predictor and biomarker of response to anti-TNFα/DMARDs combination therapy. [score:1]
At a cutoff value of 3.03 for miR-223, the values were 57.1% and 84.3% respectively (Figure  6A-C). [score:1]
Serum miRNAs hsa-miR-23a-3p and hsa-miR-223-3p as predictors of therapy response in RA patients. [score:1]
To improve accuracy of the analysis, we performed the combination of ROC curve analyses of miR-23, and miR-223. [score:1]
In total population, six of the ten miRNAs clearly distinguished RA serum samples after anti-TNFα/DMARDs combination therapy with high confidence level (P <0.05): (hsa-miR-125b, hsa-miR-126-3p, hsa-miR146a-5p, hsa-miR-16-5p, hsa-miR-23-3p, and hsa-miR-223-3p) all of them being increased after treatment (Figure  2A; Tables S3 and S4 in Additional file 1). [score:1]
ROC analysis showed the highest AUC for miR-23 and miR-223. [score:1]
[1 to 20 of 19 sentences]
38
[+] score: 41
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
As DCs are important regulators for IBD, we examined miRNA expression specifically in intestinal DC subsets and found that the expression of miR-223 by intestinal DCs decreased continuously during the progression of colitis. [score:6]
Mechanistic study revealed that miR-223 play an important role in maintaining the homeostasis of intestinal macrophages and DCs by directly targeting C/EBPβ (Zhou et al., 2015). [score:4]
MiR-223 was found highly expressed in freshly isolated epidermal LCs, and lack of miR-223 significantly increased LCs -mediated antigen-specific CD8 [+] T cell proliferation in vivo and in vitro (Mi et al., 2013). [score:3]
Intestinal DCs in miR-223 deficient mice showed a more pro-inflammatory phenotype and a decreased number of CX3CR1 [+] regulatory macrophages was also observed in miR-223 deficient mice. [score:2]
By using the DSS -induced colitis mouse mo del, we demonstrated that miR-223 deficiency resulted in more severe symptoms. [score:1]
[1 to 20 of 6 sentences]
39
[+] score: 40
In serum samples, miR-20a, miR-223, miR-21, and miR-145 [12, 13] are upregulated and let-7i-3p and miR-154-5p are downregulated, suggesting that these miRNAs are potential biomarkers for early detection of lung cancer in smokers [58]. [score:7]
miR-223 and miR-1274a were upregulated in subjects with COPD versus smokers without obstruction, and miR-15b was increased in COPD patients compared with smokers without obstruction and was differentially expressed between disease severities. [score:7]
The targets of miR-223 are a tumor suppressor, tumor protein p53-inducible nuclear protein 1 (TP53INP1), and a microtubule regulator, stathmin 1 (STMN1) [115, 116]. [score:6]
Li X. Zhang Y. Zhang H. Liu X. Gong T. Li M. Sun L. Ji G. Shi Y. Han Z. miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3 Mol. [score:5]
The upregulation of miR-223 has been reported in two studies in smoking patients with lung cancer [12] and in gastric cancer after exposure to alcohol [70]. [score:4]
For example, miR-203, miR-205, and miR-223 are upregulated in patients with gastric cancer who consume alcohol regularly [70]. [score:4]
Thus, miR-34a and miR-223 are interesting molecules to be studied in conditions associated with the use of tobacco and alcohol for the development of new tools for diagnosis and therapy. [score:2]
Tobacco and alcohol seem to regulate miR-34c and miR-223 through the signaling pathways of apoptosis and the cell cycle [12, 30, 70]. [score:2]
Despite the interesting findings of the direct association of miR 210 and miR-375 with smoking and miR-223 with tobacco and alcohol use, the pathways involved between these miRNAs and the use of these risk factors have not been elucidated. [score:2]
According to the studies addressed in this review, the major miRNAs associated with tobacco and alcohol are miR-21, miR-34a, miR-34c [30, 97, 98, 109], miR-223 [12, 70], miR-375, and miR-210 [63, 64], which are involved in many signaling pathways, such as proliferation [52], transformation [9, 13], inflammation [9, 13], angiogenesis [13], apoptosis, and the cell cycle [12, 30, 70, 71, 98, 109]. [score:1]
[1 to 20 of 10 sentences]
40
[+] score: 40
Some miRNAs were upregulated 1, 3, and 14 days after infection (miR-15a); others were expressed late (miR-21, miR-206, and miR-451) or transiently upregulated (miR-223), whereas miR-146 was transiently downregulated (Table 1). [score:12]
Using a luciferase -based reporter assay, Haneklaus et al. showed that overexpression of miR-223 tends to reduce luciferase expression in the vector containing the 3′-UTR of NOD-like receptor P3 (NLRP3), implying that miR-223 can target NLRP3 with subsequent reduction in activity of the NLRP3-inflammasome (111). [score:6]
Among these, Li et al. observed an upregulation of miR-223 in mice infected with the lethal r1918 pandemic H1N1, but not the less virulent Tx/91 strain. [score:4]
In another study, miR-223 was shown to be upregulated in lung of mice experimentally infected with two IAV (H5N2) strains of differential virulence. [score:4]
The authors also reported that miR-223 can indirectly repress the transcription factor CREB, which is responsible for maintaining cell survival and growth (110), suggesting that the lethal IAVs may induce cellular apoptosis via increasing expression of miR-223 (103). [score:4]
As shown in Figure 3A, three miRNAs (miR-18a-5p, miR-223-3p, and miR-451-3p) were differentially regulated in all four species, suggesting a common IAV infection-related signature. [score:2]
Figure 3B shows the pathways regulated by two of these three miRNAs, i. e., miR-18a-5p and miR-223-3p (miR-451-3p is not included in the DIANA tool). [score:2]
In terms of sequence identity, the mature form of miR-223 was more closely related to the corresponding sequences in mice than in chicken and pig. [score:1]
miR-223: infection, inflammation and cancer. [score:1]
The more virulent strain induced miR-223 more strongly than the less virulent strain, and subsequent administration of anti-miR-223 to these mice reduced IAV titer and increased animal survival and weight gain at 1, 3, and 5 days after inoculation, suggesting a positive correlation between miR-223 levels and severity of IAV infection in this mo del (112). [score:1]
The role of miR-223 in infection, inflammation, and cancer has been reviewed extensively (109). [score:1]
An association between miR-223 and IAV virulence has been proposed in several studies. [score:1]
To gain further insight into the cross-species conservation of functionally related miRNAs, we then used the ClustalX version 2.0 software (123) to align the sequences of the stem-loop (premature) form of miR-223 in humans, mice, chicken, and pig (Figure 3C). [score:1]
[1 to 20 of 13 sentences]
41
[+] score: 40
Focusing on the conserved miRNAs presented in Table 1, we found that of the 14 miRNAs downregulated in our study relative to normal bone, six were published as upregulated in osteosarcoma relative to osteoblasts, namely the miRNAs miR-126, miR-142-3p, miR-195, miR-223, miR-451 and miR-497, while miR-31/miR-31* was upregulated compared to bone and downregulated compared to osteoblasts. [score:11]
The inverse deregulation of miRNAs compared to bone or osteoblasts is consistent with previous publications, Jones et al. [10] identified miR-126, miR-142-5p, miR-195, miR-223 and miR-451 to be downregulated in osteosarcoma versus bone while Lulla et al. [11] reported a subset of these, miR-126, miR-142-3p, miR-223 and miR-451, to be upregulated when compared to osteoblasts. [score:6]
All of the miRNAs that were confirmed downregulated in clinical samples compared to bone are known to act as tumor suppressors in other types of cancers, that is miR-1, miR-126/miR-126*, miR-133b, miR-144, miR-195, miR-223 and miR-497 [38], [39], [40], [41], [42], [43]. [score:5]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
To verify these findings, microarray expression data for osteoblasts were included for these miRNAs, and all, except for miR-223, showed the same expression pattern in our cell lines compared to osteoblasts as in the published clinical data (Figure 2). [score:4]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
Similar modes of regulation have been described for miR-126/miR-126*, miR-223 and miR-451 in erythroid differentiation (reviewed in [34], [35]. [score:2]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 40
In detail, the expression of miR-186, miR-215 and miR-223 resulted upregulated in ATRA differentiated cells, while the expression of miR-17-5p, miR-25, miR-193, miR-195, and let-7a resulted downregulated (the miRNAs bolded were already reported as deregulated by ATRA in differentiated NB4 cells in refs. [score:12]
We observed a ten-fold upregulation of miR-223 expression in our system, when the CD11 [+ ]positive cells are more than 90%, hence terminally differentiated [additional file 4]. [score:6]
As positive control we checked for the expression of miR-223, upregulated during myeloid differentiation [17]. [score:6]
Fazi and co-workers showed that upregulation of miR-223 lead to repression of NF1-A translation and this is relevant in the early stages of myeloid differentiation [17]. [score:6]
The relevance of miR-223 upregulation during the early stages of myeloid differentiation has been described [17]. [score:4]
As expected, miR-223 was found expressed 10 fold higher after ATRA induced differentiation (Figure 1D) in both NB4 and HL60 cells. [score:3]
Figure 1 Cluster analysis of treated and untreated NB4 cell lines using the 8 human miRNAs differentially expressed and Northern blot validation of miR-223, miR-17 and miR-25. [score:3]
[1 to 20 of 7 sentences]
43
[+] score: 39
Conversely, differential expression of several miRNAs such as miR-223 and miR-17–5p, and consequent regulation of their targets, is required for normal myelopoiesis 18, 31. [score:6]
miR-223 itself represses the expression of NFI-A and other transcription factors that are important in hematopoietic differentiation processes such as MEF2C, a transcription factor that promotes myeloid progenitor proliferation [48], LMO2, a key regulator of erythropoiesis [49], and E2F1, the master regulator of cell-cycle progression [27]. [score:5]
The authors further show that the lineage-specific expression levels of miR-223 are fine-tuned by the coordinated recruitment and function of different lineage-specific transcription factors to the miR-223 regulatory regions [31]. [score:4]
The upregulation of miR-223 we observed during monocytopoiesis and granulopoiesis, has also been recently shown [31], but with their additional observation of miR-223 being maintained at low levels during erythropoiesis. [score:4]
The latter two are themselves negative regulators of miR-223 expression and thus fine-tune miR-223 in a negative feedback loop (a). [score:4]
miR-223, miR-125b, miR-10a, miR-196b and miR-135a showed similar patterns of expression to that observed in the TLDA data. [score:3]
miR-223 expression was used as a positive control and showed an approximately three-fold increase by day 9 (Fig.   3c). [score:3]
Figure 6The miR-223, miR-125b and mir-10a regulatory circuits in human hematopoiesis. [score:2]
miR-223 regulates myeloid differentiation via the transcription factors LMO, MEF2C, NFI-A, and E2F1. [score:2]
An overview summarising the miR-223 regulatory circuitry in myeloid differentiation is illustrated in Fig.   6a. [score:2]
The functional role of miR-223 in granulopoiesis is realized through a regulatory circuit involving the transcription factors C/EBPβ, PU. [score:2]
The miRNAs that increase with differentiation in our study may indicate some that are required for a terminally differentiated phenotype (e. g. miR-223 for granulocytes and miR-15b for megakaryocytes) and the ones that decrease tend to be those that help to maintain the stem/progenitor cell phenotype (e. g. let-7c). [score:1]
miR-223 showed the greatest increase, with levels in granulocytes and monocytes 24- and 9-fold higher than in progenitors (Fig.   2d, top panel). [score:1]
[1 to 20 of 13 sentences]
44
[+] score: 38
The gene expression of the processing machinery components (Drosha, DGCR8 and Dicer) and the production of the selected miRNAs (miR-223, miR-92a, miR-486, miR-125a and miR-146a) are presented in Fig 4. The gene expression of Drosha, DGCR8 and Dicer was upregulated in cells incubated with either sera with added glucose compared to the NG sera (an average of 2 fold, p<0.05, Fig 4A). [score:7]
In turn, miR-223 upregulation reduces TLR4 signaling [32] and the activation of the signal transducer and activator of transcription 3 (STAT3) [33], thus suppressing the production of pro-inflammatory cytokines in macrophages [34]. [score:6]
Exposure of human macrophages to ACS sera compared to SA sera determines an increase of the production of miR-223, miR-92a, miR-486, miR-125a and miR-146a by the upregulation of Drosha, DGCR8 and Dicer expression, this effect being augmented by the increase of sera’s glucose concentration. [score:5]
Levels of miR-223 (A), miR-92a (B), miR-486 (C), miR-122 (D), miR-125a (E), miR-146a (F) in sera from Control subjects and coronary artery disease (CAD) patients with stable angina (SA) or acute coronary syndrome (ACS), with/without hyperglycemia. [score:3]
The gene expression of the processing machinery proteins (Drosha, DGCR8 and Dicer) and the selected miRNAs (miR-223, miR-92a, miR-486, miR-125a and miR-146a) levels are presented in Fig 3. 10.1371/journal. [score:3]
The gene expression of the processing machinery proteins (Drosha, DGCR8 and Dicer) and the selected miRNAs (miR-223, miR-92a, miR-486, miR-125a and miR-146a) levels are presented in Fig 3. 10.1371/journal. [score:3]
In this study, we evaluated the levels of a panel of six miRNAs (miR-223, miR-92a, miR-486, miR-122, miR-125a and miR-146a) in sera and HDL from stable angina (SA) and ACS patients, and the functional effects of ACS and SA patients’ sera, with or without hyperglycemia, on cultured human macrophages, namely on the gene expression of the processing machinery proteins (Dicer, Drosha, DGCR8) and analyzed miRNAs production. [score:1]
The serum and Lp levels of Homo sapiens (hsa)-miR-223-3p (ID002295), hsa-miR-92a-3p (ID000431), hsa-miR-486-5p (ID001278), hsa-miR-122-5p (ID002245), hsa-miR-125a-5p (ID002198), hsa-miR-146a-5p (ID000468) and cel-miR-39-5p (ID000200) were determined by employing the TaqMan technology. [score:1]
The addition of glucose to normoglycemic sera (to mimic the existing concentration in hyperglycemic ones) induces both an increase of the miRNAs (miR-125a, miR-486, miR-92a, miR-146a, and miR-223) levels and of their processing machinery proteins (Drosha, DGCR8 and Dicer). [score:1]
In conclusion, the hyperglycemia in serum is correlated with the increased levels of miR-223, miR-92a, miR-486 in sera and HDL, these miRNAs associated with HDL being able to discriminate between ACS and SA patients. [score:1]
The new data about the effect of hyperglycemia on miRNAs obtained in the present study are: (i) in hyperglycemic ACS sera, miR-223, miR-92a, miR-486, miR-122, miR-125a and miR-146a levels are increased compared to the normoglycemic ACS sera; (ii) in HDL from hyperglycemic ACS compared to normoglycemic sera, miR-223, miR-92a, miR-486 are increased and statistically different between ACS and SA patients; (iii) ACS sera induce an increase of Drosha, DGCR8 and Dicer expression and of miR-223, miR-92a, miR-486, miR-125a and miR-146a production in human macrophages; (iv) the hyperglycemic sera augments the effects observed in human macrophages exposed to normoglycemic sera, mainly in the case of ACS sera. [score:1]
In HDL from all CAD patients, miR-223, miR-92a, miR-486 and miR-122 had the highest levels, miR-223 and miR-486 being the most abundant in HDL [2] and miR-92a in HDL [3] (Fig 2). [score:1]
MiR-223 levels were positively correlated with apoE levels and negatively with HDL-C. All miRNAs levels, except for miR-223, were negatively correlated with PON1 activity. [score:1]
The serum levels of miR-223, miR-92a, miR-486 and miR-146a were correlated positively with the age and BMI of the patients and control subjects and negatively with LDL-C levels. [score:1]
The HG, ACS sera induced an increase of all analyzed miRNAs levels (p<0.05) compared to NG, ACS sera-incubated macrophages, while in cells incubated with SA sera, only miR-223 levels were higher in HG compared to NG sera (p<0.001, Fig 3B), in good correlation with the increased gene expression of Drosha, DGCR8 and Dicer. [score:1]
We report that the exposure of human macrophages to ACS sera induces the increase of the intracellular miR-223, miR-92a, miR-486, miR-125a and miR-146a levels in human macrophages, the highest levels being observed for miR-486 and miR-92a. [score:1]
It was reported that circulating miR-223 levels may predict cardiovascular death over a 4 years period in symptomatic CAD patients [26]. [score:1]
[1 to 20 of 17 sentences]
45
[+] score: 38
Consistently, in mouse myeloid 32D cells, stable expression of RUNX1-MTG8 also leads to downregulation of miR-221 and miR-223 (Figure  5A). [score:6]
In the presence of factors that impair RUNX1 function/level, this delaying effect likely reinforces the effects of direct deregulation of RUNX1-regulated target genes (e. g. miR-223) involved in myeloid differentiation (Figure  8). [score:6]
Consistently, the U937 [miR-17], U937 [RUNX1-MTG8] and U937 [CBFB-MYH11] clones also displayed significant downregulation of RUNX1-regulated miRNAs involved in myeloid differentiation, such as miR-223 (Figure  3C) and miR-27a (Additional file 1: Figure S2, right) [13, 26]. [score:5]
The integrated information gathered from the two myeloid cell mo dels shows that RUNX1 regulates myeloid differentiation not only by direct transcriptional regulation of coding and non-coding myeloid differentiation functions (e. g. miR-223), but also by modulating KIT -induced proliferation via non-coding miRNAs (e. g. miR-221). [score:4]
In the presence of factors that impair the RUNX1-miRNA mechanism (e. g. CBF fusion proteins or miRNAs targeting RUNX1-3′UTR), the effect of KIT -mediated proliferation reinforces the effects of deregulation of miRNAs controlled by RUNX1 and involved in differentiation (e. g. miR-223), thus resulting in complete block of myeloid differentiation (right). [score:4]
We found that the effects of ectopic miR-17 expression mimic the biological effects induced by the RUNX1-MTG8 and CBFB-MYH11 fusion proteins by affecting the same core mechanism: the RUNX1-miR-221-KIT axis and miR-223. [score:3]
The first described non-coding RUNX1-target was miR-223, which is critical for the establishment of both granulocyte and monocyte lineages [12- 15]. [score:3]
In the latter case, the delay of GCSF -induced differentiation due to KIT proliferation is reinforced by the repression of RUNX1-regulated coding and non-coding (e. g. miR-223) differentiation functions (Figure  8). [score:2]
Intrigued by this observation, we tested whether other factors, capable of interfering with RUNX1-CBFB regulatory function, can also negatively affect the RUNX1-miR-221-KIT axis and miR-223 transcription. [score:2]
RUNX1-MTG8 binding to RUNX1 consensus sequences in the miR-223 promoter region induces miR-223 transcriptional repression and block of myeloid differentiation in t(8;21) leukemia cells [12]. [score:1]
Previously we reported that the RUNX1 consensus sequences of the miR-221 and miR-223 promoters, as well as the miR-221 and miR-223 seed sequences, are conserved between human and mouse [17]. [score:1]
Thus, both CBF-AML fusion proteins negatively affect both the RUNX1-miR-221-KIT axis and RUNX1-miR-223 transcription, leading to increased KIT -induced proliferation of undifferentiated myeloid cells. [score:1]
[1 to 20 of 12 sentences]
46
[+] score: 38
To address whether dTuD vector is more effective in miRNA inhibition than the vector expressing a single TuD, we constructed dTuD-miR-223 against miR-223 and dTuD-Ctrl against scramble sequences. [score:5]
Sequence context outside the target region influences the effectiveness of miR-223 target sites in the RhoB 3'UTR. [score:5]
It has been reported that RhoB is the direct target of miR-223[19], therefore we generated a RhoB 3′UTR dual-luciferase reporter which contained a validated miR-223 binding sites (Fig 4A). [score:4]
H1-TuD-miR-223 and U6-TuD-miR-223 represent the modified dTuD vector harboring a single TuD-miR-223 expression cassette driven by H1 and U6 promoter, respectively. [score:3]
Two additional vectors, H1-TuD-miR-223 and U6-TuD-miR-223 expressing single TuD under control of H1 or U6 promoter were also constructed. [score:3]
We expected that the activity of luciferase could reflect the expression level of miR-223 in cells. [score:3]
The inhibitory effect on miR-223 activity by dTuD-miR-223. [score:3]
Transfection of antagomir, TuD and dTuD reduced 77%, 88% and 93% (p < 0.001) of miR-223, respectively (Fig 4C) and depressed 32%, 57% and 84% (p < 0.001) of RohB mRNA (Fig 4D), showing that dTuD-miR-223 has great inhibitory effect on miR-223. [score:3]
We transfected the 293A cells with three types of anti-miR-223 inhibitors. [score:3]
The co-transfection of H1-TuD-miR-223 or U6-TuD-miR-223 suppressed luciferase activity by ~20%. [score:3]
As expected, the co-transfection of miR-223 mimics in 293A cells along with RhoB 3′UTR reporter plasmid suppressed luciferase activity by ~40% compared to mimics-Ctrl. [score:2]
The luciferase activities were almost attenuated by the co -transfected dTuD-miR-223, but not dTuD-Ctrl (Fig 4B). [score:1]
[1 to 20 of 12 sentences]
47
[+] score: 38
[56] In addition, miR-223 played as an oncogene by inhibiting the expression of Fbxw7 in human GC [57] and T cell acute lymphoblastic leukemia. [score:5]
Mansour MR Sanda T Lawton LN The TAL1 complex targets the FBXW7 tumor suppressor by activating miR-223 in human T cell acute lymphoblastic leukemia. [score:5]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
Zhou et al [60] discovered that miR-223 promoted the cisplatin resistance of GC cell via regulating cell cycle by targeting Fbxw7. [score:4]
Kurashige J Watanabe M Iwatsuki M Overexpression of microRNA-223 regulates the ubiquitin ligase FBXW7 in oesophageal squamous cell carcinoma. [score:4]
Zhou X Jin W Jia H MiR-223 promotes the cisplatin resistance of human gastric cancer cells via regulating cell cycle by targeting FBXW7. [score:3]
[72] But recently, studies have shown that NF-kB signaling pathways regulate miR-223/FBXW7 axis in T-cell acute lymphoblastic leukemia. [score:2]
Kumar V Palermo R Talora C Notch and NF-kB signaling pathways regulate miR-223/FBXW7 axis in T-cell acute lymphoblastic leukemia. [score:2]
[58] Eto et al [59] also revealed that the miR-223/Fbxw7 pathway regulated the sensitivity of a human epidermal growth factor receptor 2 -positive GC cell line to trastuzumab through the modulation of apoptosis. [score:2]
Eto K Iwatsuki M Watanabe M The sensitivity of gastric cancer to trastuzumab is regulated by the miR-223/FBXW7 pathway. [score:2]
Li J Guo Y Liang X MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. [score:2]
Besides those, recently, accumulating evidence has shown that several molecules such as, miRNAs including miR-223, miR-25, miR-27a, miR-182, miR-503, and miR-129-5p, RITA, and FAM83D, as well as Pin1, CCAAT/enhancer -binding protein-δ, presenilin,,, EBP2, Numb4 and serum-and glucocorticoid-inducible protein kinase1 could regulate Fbxw7 (Figure 3). [score:2]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 13 sentences]
48
[+] score: 35
Among these 17 miRNAs, 7 miRNAs (hsa-miR-130b*, hsa-miR-21*, hsa-miR-223, hsa-miR-302a, hsa-miR-424, hsa-miR-451, hsa-miR-486-5p) were differentially expressed between active TB and latent TB, 6 miRNAs were up-regulated in active TB patients, and only hsa-miR-130b* showed reduced gene expression level. [score:8]
The rest 33 genes were regulated by multi-miRNAs: 14 genes were regulated by 2 miRNAs (e. g. CEP68 was targeted by hsa-miR-424 and hsa-miR-223), and 13 genes were regulated by 3 miRNAs. [score:6]
Interestingly, 5 of the miRNAs (hsa-miR-365, hsa-miR-223 and hsa-miR-144, hsa-miR-451, hsa-miR-424) were highly expressed in PBMCs and their expression in 3 groups was confirmed by qPCR. [score:5]
This difference between active and non-active TB groups was mainly due to the induced expression of hsa-miR-365, hsa-miR-223 and hsa-miR-302a, hsa-miR-486-5p, hsa-miR-144 and hsa-miR-451, hsa-miR-21* and hsa-miR-424 in active TB patients. [score:3]
Therefore, we hypothesize the depressed expression level of these 2 genes by multiple miRNAs such as hsa-miR-223 and hsa-miR-424 may lead to a disorder in the proportions of T cells and B cells in active TB patients, which may disturb the delicate balance of immune control in MTB infection. [score:3]
The expression profiles of the active TB and LTBI groups were statistically different for miRNAs from group 1: hsa-miR-144 (P<0.05), hsa-miR-424 (P<0.01), hsa-miR-451(P<0.05), hsa-miR-223 (P<0.05), and hsa-miR-365 (P<0.05). [score:3]
We analyzed the expression of 7 miRNAs (hsa-miR-223, hsa-miR-365 hsa-miR-424, and hsa-miR-451, hsa-miR-144, hsa-miR-500 and hsa-miR-21*) selected from the microarray data by qPCR. [score:3]
Among these miRNAs, hsa-miR-223, hsa-miR-424, and hsa-miR-451 and hsa-miR-144 were highly expressed in PBMCs compared to other miRNAs. [score:2]
Previous studies using a miR-223 -knockout mouse showed an increased proration of granulocytes, which are morphologically hypermature and hypersensitive to activating stimuli, and have more fungicidal activity [31]. [score:2]
[1 to 20 of 9 sentences]
49
[+] score: 35
For example, Sun et al. found that while microRNA-223 levels were significantly enriched in HIV-1-infected CD4(+)CD8(-) PBMCs, microRNA-29a/b, microRNA-155 and microRNA-21 levels were significantly reduced [36] and Terrier et al. that four miRNAs (miR-21, miR-29a, miR-29b and miR-452) were downregulated and only one (miR-146a) upregulated in lung A549 cells upon H1N1 and H3N2 infection [35]. [score:7]
Although this general feature could be a distinctive trait of FM patients we propose the use of the five validated miRNAs, which include hsa-miR223-3p, hsa-miR451a, hsa-miR338-3p, hsa-miR143-3p and hsa-miR145-5p for the diagnosis of the disease since the drastic differences detected in patients (at least 6-fold inhibited) should allow for the development of a more sensitive assay. [score:5]
We propose a signature of five strikingly downregulated miRNAs (hsa-miR223-3p, hsa-miR451a, hsa-miR338-3p, hsa-miR143-3p and hsa-miR145-5p) to be used as biomarkers of FM. [score:4]
Microarray analysis of FM patient PBMCs evidenced a marked downregulation of hsa-miR223-3p, hsa-miR451a, hsa-miR338-3p, hsa-miR143-3p, hsa-miR145-5p and hsa-miR-21-5p (4-fold or more). [score:4]
In addition to viral infections, hsa-miR-21 and hsa-miR-223 have been linked to inflammation and injury of the central nervous system [45– 48], hsa-miR-143-3p/hsa-miR-145-5p to muscle functioning [49, 50] and hsa-miR338/hsa-miR-451 downregulation to diabetes and inflammation [51, 52]. [score:4]
The fact that hsa-miR-223-3p and hsa-miRNA-145-5p have been associated to FM in more than one body fluid type strengthens our proposal of these miRNAs as biomarkers of the disease. [score:3]
Interestingly enough, two out of the five miRNAs we are proposing as biomarkers of FM, in particular hsa-miR223-3p and hsa-miRNA-145-5p, are inhibited in cerebrospinal fluid of FM patients [22]. [score:3]
GF: General Fatigue; PF: Physical and MF: Mental Fatigue, RA: reduced activity and RM: reduced motivation, are subscales of the MFI (Multidimensional Fatigue Inventory) (scale 0–20) [28]However, it is interesting to note that patient FM9 who had the lowest mental fatigue score (8) compared to an average of 14.3±2.8 in the FM group (n = 11), presented the highest levels for 4 of the 5 markedly inhibited miRNAs: hsa-miR-143, hsa-miR145, hsa-miR223 and hsa-miR451, with values for the two first miRNAs above lowest levels in control subjects and with a less than two-fold difference for the other two miRNAs (hsa-miR223 and hsa-miR451) with respect to its corresponding reference value in the control group (lowest control level, S4 Table, (a) values), suggesting a possible correlation between some of these miRNAs and mental fatigue severity. [score:2]
GF: General Fatigue; PF: Physical and MF: Mental Fatigue, RA: reduced activity and RM: reduced motivation, are subscales of the MFI (Multidimensional Fatigue Inventory) (scale 0–20) [28] However, it is interesting to note that patient FM9 who had the lowest mental fatigue score (8) compared to an average of 14.3±2.8 in the FM group (n = 11), presented the highest levels for 4 of the 5 markedly inhibited miRNAs: hsa-miR-143, hsa-miR145, hsa-miR223 and hsa-miR451, with values for the two first miRNAs above lowest levels in control subjects and with a less than two-fold difference for the other two miRNAs (hsa-miR223 and hsa-miR451) with respect to its corresponding reference value in the control group (lowest control level, S4 Table, (a) values), suggesting a possible correlation between some of these miRNAs and mental fatigue severity. [score:2]
These miRNAs corresponded to miRNAs hsa-miR-451a, hsa-miR-338-3p, hsa-miR-143-3p, hsa-miR-145-5p and hsa-miR-223-3p (Table 2). [score:1]
[1 to 20 of 10 sentences]
50
[+] score: 35
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
The comparison of the gene expressions of the exclusive targets and non-targets (mRNAs without target sites of the major miRNA or 5′-isomiR) before and after knocking out mmu-miR-223 showed that mmu-miR-223. [score:10]
Response of mRNAs after deleting mmu-miR-223 gene was determined by the fold change of mRNA expression between knockout (KO) and wild-type (WT) conditions (KO/WT). [score:4]
More interestingly, mmu-miR-223, in which 5′-isomiRs accumulate to a level comparable to the major form, is highly downregulated in tumor cells (17). [score:4]
The cumulative distributions of fold changes are plotted for the exclusive targets of mmu-miR-223. [score:3]
iso1 (77% versus 23%) and had a greater effect on target repression than mmu-miR-223. [score:3]
To investigate the functional impact of 5′-isomiRs on mRNA gene regulation, we first examined 5′ heterogeneity of miRNAs using sequencing data and then analysed data of microarray mRNA expression profiling with and without knocking out mmu-miR-223 in murine neutrophils (GSE22004) (21). [score:3]
iso1, reflected by a smaller P-value for the exclusive targets of miR-223 than that for miR-223. [score:3]
Microarray datasets of mmu-miR-223 and mmu-miR-142 knockout experiments (GSE22004, GSE42325, Supplementary Table S1B) were collected in recent studies (21, 46). [score:2]
mmu-miR-223 had a substantial amount of 5′-isomiRs (around 23%) from the 3p arm (Figure 4A), as determined by the sequencing data from murine neutrophils (GSM539851, GSM539852) (52). [score:1]
For instance, mmu-miR-223 was more abundant than mmu-miR-223. [score:1]
Figure 4. (A) The murine mmu-miR-223 hairpin and the most prominent 5′-isomiR. [score:1]
[1 to 20 of 11 sentences]
51
[+] score: 33
A) Upper panel, Ago2 expression level in HeLa cells induced by serum starvation and TNFα is detected by western bolting; Lower panel, relative levels of total miR-16, miR-30a, miR-223, miR-320b and miR-423-5p, as well as Ago2 complex -associated miR-16, miR-30a, miR-223, miR-320b and miR-423-5p in the HeLa cells with or without apoptotic reagent treatment. [score:3]
As shown in Figure 1A, miR-16, miR-223, miR-30a, miR-320b, let-7b, miR-92a, miR-423-5p and miR-21 were confirmed by qRT-PCR to have high expression levels in human plasma. [score:3]
B) Upper panel, Ago2 expression level in HL60 cells induced by ATRA is detected by western blotting; Lower panel, relative levels of total miR-16, miR-30a, miR-223 and miR-320b, as well as Ago2 complex -associated miR-16, miR-30a, miR-223 and miR-320b in the HL60 cells with or without ATRA treatment. [score:3]
To study whether the association of MV-encapsulated miRNAs with Ago2 complexes and their resistance to RNaseA degradation is dynamically regulated by cellular biological function, we assessed the relationship between the association of Ago2 complexes with miR-16 or miR-223 and the resistance of these miRNAs to RNaseA under cell apoptotic or differentiation conditions. [score:2]
The levels of total miR-16, miR-30a, miR-223, miR-320b and Ago2 complex -associated miR-16, miR-30a, miR-223, miR-320b in the MVs were assessed by qRT-PCR. [score:1]
In agreement with many previous studies [11], [16], [17], [37], [38], we found that the majority of the circulating miRNAs in human peripheral blood, such as miR-16, miR-223, miR-30a, miR-320, let-7b, miR-92a, miR-423-5p and miR-21 were located in the MV fraction. [score:1]
The sequences of the probes used were as follows: anti-miR-16 pull-down probe, ACGCCAATATTACGTGCTGCTAA; random probe, TGATGTCTAGCGCTTGGGCTTTG; anti-miR-223 pull-down probe, ATGGGGTATTTGACAAACTGACAA. [score:1]
We tested whether TPF treatment can decrease the stability of miRNAs, including miR-16, miR-30a, miR-223 and miR-320b, in secreted MVs by decreasing the miRNA-Ago2 association. [score:1]
We also observed an elevation of Ago2 complex -associated miR-223 but not total miR-223 in ATRA -treated HL60 cells (Figure S3B, lower panel). [score:1]
B) The levels of total miR-16, miR-30a, miR-223 and miR-320b, as well as Ago2 complex -associated miR-16, miR-30a, miR-223 and miR-320b in cells were assessed by qRT-PCR. [score:1]
Figure S1 A) A schematic illustration of the miR-223 pull-down strategy using a biotin-labeled probe complementary to human miR-223. [score:1]
B) Relative levels of total and Ago2 complex -associated miR-16, miR-30a, miR-223 and miR-320b in the MVs derived from HeLa cells with or without apoptotic reagent treatment. [score:1]
For instance, although miR-16 and miR-223 differ in their protein mediated stability by about 50% (Figure 1D), the difference in Ago2 association of these two miRNAs is far greater (∼85%) (Figure 2D). [score:1]
F) The resistance of miR-223 in HL60 cell-derived MVs to RNaseA. [score:1]
Note that, although the total miR-223 levels are not changed, the percentage of miR-223 associated with Ago2 complexes is increased during ATRA -induced differentiation. [score:1]
Through the disruption of the association of miRNAs, including miR-16, with Ago2 complexes by TPF treatment, we successfully decreased the resistance of miRNAs in the cell-derived exosomes to RNase A. In contrast, when we increased the percentage of Ago2 complex -associated miR-16 by inducing apoptosis or the percentage of Ago2 complex -associated miR-223 by inducing cell differentiation, we found that the resistance of miR-16 or miR-223 in the cell-derived exosomes to RNase A was significantly enhanced. [score:1]
B) The resistance of miR-16, miR-30a, miR-223 and miR-320b in MVs with/without TPF treatment against RNaseA. [score:1]
We also employed the same strategy to isolate potential miR-223 -associated proteins using the MV fractions derived from human plasma (Figure S1). [score:1]
As can be seen, Ago2 was also identified as a major protein band associated with miR-223 though the amount of Ago2 associated with miR-223 was slightly less than that associated with miR-16. [score:1]
D) The differentiation of HL60 cells induced by 20 µM ATRA for 48 h. E) Relative levels of total miR-16, miR-30a, miR-223, miR-320b and the levels of these miRNAs associated with Ago2 complexes in the MVs derived from HL60 cells with or without induced by ATRA. [score:1]
B) Silver staining and Western blotting (WB) of pull-down product from human plasma MVs by miR-223 probe. [score:1]
In agree with the conclusion that Ago2 complex protects its associated miRNA, the resistance of the miR-223 in the MVs to RNaseA was significantly enhanced following ATRA -induced cell differentiation (Figure 5F). [score:1]
During cell differentiation, the percentage of miR-223 associated with Ago2 complexes in the MVs was specifically increased, although the total amount of miR-223 was not altered (Figure 5E). [score:1]
Since protein digestion by PK dramatically enhances the sensitivity of miRNAs such as miR-223 and miR-320b to RNaseA although they are not associated with Ago2 at relatively high level, it is likely that these miRNAs in the cell-secreted MVs may be protected by other protein(s). [score:1]
It has been shown that miR-16 [31] and miR-223 [32], [33] are linked to cellular apoptosis and differentiation process, respectively. [score:1]
C) The relative levels of miR-16, miR-223, miR-30a, miR-320b, let-7b, miR-92a, miR-423-5p and miR-21 in the MV vs. [score:1]
[1 to 20 of 26 sentences]
52
[+] score: 33
Out of these miRNA, miR155, miR223 and miR146 are already known as suppressor of Toll-like receptor and cytokine signaling via a negative feedback regulation loop involving down-regulation of IL-1 receptor -associated kinase 1 (IRAK1) and TNF receptor -associated factor 6 (TRAF6) protein levels (Taganov et al., 2006). [score:7]
The first indication that miRNA might regulate the immune responses came from a report in 2004, showing selective expression of miR-142a, miR-181a, and miR-223 in immune cells (Chen et al., 2004). [score:4]
Cai et al. (2013b) also observed a significant upregulation of the mmu-miR-146b, mmu-miR-155, mmu-miR-223, mmu-miR-142-3p, mmu-miR-15b, and mmu-miR-126-5p after 30 dpi. [score:4]
miR-155 and miR-223 are differentially expressed in hematopoietic cell lineages and regulate myeloid progenitor cells (Gilicze et al., 2014). [score:4]
Similarly, higher expression of miR-155, miR-206, miR-223, and miR-511 had been co-related with higher inflammation in mice mo del of meningitis (Yu et al., 2014b). [score:3]
In a mice mo del study of infected liver cells, highly elevated expression of miR-34c, miR-199, miR-134, miR-223, and miR-214 at 45dpi had been noticed (Cai et al., 2013b). [score:3]
These studies had shown that the activation of TIRs and TNF-α receptor results in rapid expression of a host of miRNAs including let-7, miR-9, miR-99b, let-7e, miR-125a, miR-132, miR- 146a, miR-146b, miR-155, miR-187, and miR-223 (Taganov et al., 2006; Tili et al., 2007; Bazzoni et al., 2009; Ceppi et al., 2009). [score:3]
Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. [score:2]
Myeloid-derived microRNAs, miR-223, miR27a, and miR-652, are dominant players in myeloid regulation. [score:2]
Recent studies indicate that these miRNAs (miR-17–92 cluster, miR-150, miR-155, miR-181, miR-206, miR-223, and miR-511 etc. ) [score:1]
[1 to 20 of 10 sentences]
53
[+] score: 33
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
The expression of miR-223, miR-483-3p (p-value = 0.01), 146b, 205 (p-value = 0.001), 221, 21 (p-value = 0.023), 195, 34c and miR-26a (p-value = 0.0078) were significantly upregulated, whereas the expression of miR-216, miR-141, miR-217, Let-7b (p-value = 0.001), and Let-150 (p-value = 0.01) were significantly downregulated in human PC tissues as compared to the cancer-adjacent normal tissues (Figure 3E). [score:10]
The expressions of miR-216 and miR-217 were also progressively reduced in KC mice, but the expressions of miR-21, miR-205, miR-146b, miR-34c, and miR-223 progressively increased (Figure 1A, 2A– 2D). [score:5]
We observed downregulation of miR-146b, miR-34c, and miR-223 at 10 weeks of age; however, their expression increased with the progression of PC in KC animals compared to control animals (Figure 2A– 2D). [score:5]
On the other hand, miR-146b, miR-34c, miR-223, miR-195 (p-value = 0.031) and miR-216 (p-value = 0.063) were downregulated in KC mice compared to control littermates. [score:3]
[1 to 20 of 5 sentences]
54
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
MiRNA expression profiling in sputum of subjects exposed to ozone inhalation revealed significantly up-regulated expression of 10 miRNAs: miR-132, miR-143, miR-145, miR-199a-3p, miR-199b-5p, miR-222, miR-223, miR-25, miR-424 and miR-582-5p [94]. [score:8]
Several analyses provided evidence that miRNA genes (miR-101, miR-145, miR-223, miR-384, miR-494, miR-509-3p, and miR-1246) regulate CFTR expression, as well as anion transport, particularly in patients with F508 del mutation [58, 59, 60, 61, 62]. [score:5]
Studies analyzing miRNA expression profile in the sputum from mild-to-moderate asthmatic patients demonstrated elevated expression of miR-223-3p, miR-629-3p, miR-142-3p, miR-338, and miR-145 [35, 36]. [score:5]
Increased expression of miR-145, miR-223, and miR-494 was found in bronchial brushings from CF patients as compared to non-CF brushings [61, 62] and demonstrated the complexity in post-transcriptional regulation of CFTR. [score:3]
Furthermore, a strong association was found between increased expression of three miRNAs (miR-223-3p, miR-629-3p, and miR-142-3p), and severe asthma; these miRNAs were also negatively associated with spirometry results [36]. [score:3]
[1 to 20 of 6 sentences]
55
[+] score: 32
Previous studies have shown that miR-16 can suppress cell cycle progression by targeting multiple G1 cyclins (Bandi et al., 2009) and that miR-223 can indirectly regulate cyclin E (Xu et al., 2010). [score:7]
miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3. [score:5]
d. (B) Cell growth assay showing that ectopic expression of miRNAs does not affect cell proliferation in vitro with the exception of miR-223, which enhances the growth at days 2 and 3, and miR-146a, which suppresses cell growth at days 2 and 3. (C,D) Quantification of Matrigel assay demonstrating that miR-16, but not any of the other miRNAs, suppresses both migration and invasion, respectively. [score:5]
Similar analysis in mouse metastatic sarcomas revealed overlap for several downregulated miRNAs including miR-16, miR-103, miR-146a, miR-223, miR-342 and miR-511. [score:4]
By comparing the downregulated miRNAs in metastatic sarcomas from human and mouse, we found six miRNAs common to both: miR-16, miR-103, miR-146a, miR-223, miR-342 and miR-511 (Fig.  1D,E). [score:4]
Overexpression of these miRNAs had no significant effect on cell proliferation, with the exception of miR-223, which increased cell proliferation, and miR-146a, which decreased cell proliferation (Fig.  2B). [score:3]
MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7. J. Biol. [score:3]
Notably, some of these miRNAs, such as miR-146a and miR-223, have also been implicated in modulating metastasis in other tumor types (Hurst et al., 2009; Li et al., 2011). [score:1]
[1 to 20 of 8 sentences]
56
[+] score: 31
For top 10 downregulated microRNAs (hsa-miR-106b-5p, hsa-miR-26b-5p, hsa-miR-494, hsa-miR-425-5p, hsa-miR-363-3p, hsa-miR-15b-5p, hsa-miR-185-5p, hsa-miR-150-5p, hsa-miR-223-3p, hsa-miR-142-5p), we included those have been shown to be deregulated in cancer (having no controversial expression status; some of these microRNAs have been shown to be upregulated in some cancer types, whereas, downregulated in other cancer types), and have either expression data or functional studies in stem cells. [score:15]
Among those significantly differentially expressed miRNAs, five downregulated (miR-26b-5p, miR-200c-3p, miR-203a, miR-223-3p, miR-363-3p) and three upregulated (miR-328, miR-574-3p, miR-1825) miRNAs were selected as a result of detailed literature search for further confirmation with qRT-PCR. [score:9]
However, expression levels of miR-223-3p, miR-328, and miR-574-3p were not significantly different between CD133 [+] vs. [score:3]
To validate the differential expression of miR-26b, miR-200c, miR-203, miR-223, miR-328, miR-363-3p, 574-3p, and miR-1825, a total of 25 pairs of CD133 [+] and CD133 [−] cell populations collected from 25 tumor samples including those used in microarray experiments were studied. [score:3]
Only hsa-miR-26b-5p, hsa-miR-363-3p, and hsa-miR-223-3p met these criteria. [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 31
Prior to validating whether miR-583 and miR-143 contributed to targeted suppression of IL2Rγ expression, we analyzed the expression kinetics of miR-583 and miR-143, as well as the well-known miRNAs miR-223 and miR-150, during NK cell differentiation using real-time qPCR (Fig. 3b). [score:9]
Additionally, the downregulation of miR-223 in human mNK cells was previously reported to regulate GzmB translation [33]. [score:7]
Additionally, the downregulation of miR-223 in human mNK cells was previously reported to regulate GzmB translation during murine NK cell activation [33]. [score:7]
Our results were consistent with the microarray data presented in Fig. 2 showing that the expression of miR-583, miR-143 and miR-223 were decreased; however, the expression of miR-150 was increased during NK cell differentiation. [score:5]
The expression of miR-143, miR-223, miR-150 and miR-583 was analyzed by real-time qPCR. [score:3]
[1 to 20 of 5 sentences]
58
[+] score: 31
Our network analysis demonstrated that the increased expression of miR-223 and miR-451 could lead to upstream inhibition of G-protein GNA11, and in turn down-regulation of the ion channel regulator KCNMA1 and muscle contractile gene MYOM1 via a tyrosine-protein kinase SRC and NF-κB signaling (Fig 3). [score:9]
In SIP tissues, miR-223 and miR-451 were up-regulated and their potential target genes KCNMA1, GNA11, MYOM1 were down-regulated compared with Surg-CTL tissues (Table 3). [score:8]
In contrast, upregulation of miR-451 and miR-223 in SIP suggested modulation of G-protein -mediated muscle contraction. [score:4]
Although many IBD -associated miRNAs did not appear to be dysregulated in preterm NEC tissues, several miRNAs, including miR-223, miR-132, miR-146b-3p, miR-215, miR-375, miR-31 and miR-141, were regulated in both IBD and NEC. [score:3]
In SIP tissues, the regulation of miRNA/mRNA pairs, including miR-223/ KCNMA1, miR-451/ GNA11 and miR-451/ MYOM1 indicated involvement of these miRNAs in dysregulating the muscle contraction pathway, a major pathologic mechanism associated with SIP [4]. [score:3]
Our results showed that levels of miRNA/mRNA pairs: miR-451/ TLR4, miR-4793-3p/ TLR4, miR-132/ HBEGF, miR-1290/ THBS1, miR-132/ CD44, miR-223/ ICAM1, miR-132/ MMP9, miR-146-3p/ GNA11 and miR-146-3p/ MYLK were significantly correlated in an inverse manner in NEC tissues, whereas miR-410/ FLT-1 was directly correlated (Fig 2). [score:2]
miR-223 and miR-451 have known functions on proliferation and differentiation of vascular and skeleton muscles, [27, 28] but their novel involvement in neonatal gut muscle physiology and SIP pathophysiology has not been reported previously. [score:1]
Levels of 15 miRNAs: miR-223, miR-1290, miR-4725-3p, miR-4793-3p, miR-410, miR-187, miR-375, miR-203, miR-200b-5p, miR-194-3p, miR-200a, miR-215, miR-31, miR-192-3p and miR-141 were significantly different between NEC and SIP tissues (0.12–59.05 fold; Table 2). [score:1]
[1 to 20 of 8 sentences]
59
[+] score: 31
To confirm the time dependence of estrogen effect on miRNA expression in NZB/W [F1] mice, we analyzed the expression of miR-223 and miR-451, which were markedly upregulated by estrogen in wild-type B6 mice [42]. [score:8]
The expression of miR-223 and miR-451 in splenocytes was not increased with lupus manifestation in NZB/W [F1] mice (Figure S1) and the diversity in the expression level of select lupus -associated miRNAs in estrogen -treated mice with lymphoma development (Figure S2). [score:6]
Figure 5 Estrogen increased the expression of miR-223 and miR-451 expression in splenocytes from NZB/W [F1 ] mice. [score:5]
As expected, the expression levels of miR-223 and miR-451 were significantly upregulated in both 10-wk-old (Figure  5A) and 32-wk-old (Figure  5B) estrogen -treated mice when compared to age-matched intact or placebo -treated mice. [score:5]
Unlike lupus -associated miRNAs such as the miR-182 cluster that was highly increased in diseased, 36–40-wk-old NZB/W [F1] mice [34], miR-223 and miR-451 were not significantly increased in 36–40-wk-old female NZB/W [F1] mice when compared to pre-diseased NZB/W [F1] or NZW control (Additional file 1: Figure S1). [score:4]
The graphs show increased miR-223 and miR-451 expression in splenocytes from 10-wk-old (A) and 32-wk-old (B) estrogen -treated orchidectomized NZB/W [F1] mice when compared to either age-matched placebo control or intact control mice. [score:2]
This suggests that the remarkable increase of miR-223 and miR-451 in 32-wk-old estrogen -treated mice was attributable to estrogen effect, but not to lupus manifestation. [score:1]
[1 to 20 of 7 sentences]
60
[+] score: 31
Inhibition of the miR-223 target gene, E2F1, by CEBPA is pivotal to prevent leukemogenesis that results from E2F1 -mediated expression of the oncogene tribble (Trib) 2 gene [68, 69]. [score:7]
Remarkably, enforced expression of miR-181a led to a doubling of B cells while persistent expression of miR-223 or miR-142 increased the number of T cells by 30–40% [47]. [score:5]
As such both miR-223 and CEBPA regulate the expression of E2F1 in myeloid cells under normal physiological condition. [score:4]
miR-181a is preferentially expressed in the B-lineage, miR-223 in the myeloid lineage and mir-142 in both B and myeloid lineages [47]. [score:3]
Notably, miR-223 also targets seed sequences in the NF1A promoter to induce transcriptional gene silencing via recruitment of the polycomb repressive complex and a consequent increase in DNA methylation levels [42]. [score:3]
A decrease in miR-223 expression level is associated with CEBPA-mutated acute myeloid leukaemia [68]. [score:3]
In the cytoplasm of myeloid progenitors, miR-223 targets transcription factors MEF2C and NF1A that usually promote myeloid progenitor cell proliferation [54, 55]. [score:3]
As described in the previous section of this review, nuclear miR-223 has a key role in normal granulopoiesis. [score:1]
More than a decade ago, three miRNAs, miR-181a, miR-223 and miR-142 were recognized as key players in myeloid and lymphoid cell differentiation [47]. [score:1]
These data indicate that both nuclear and cytoplasmic miR-223 work synergistically to silence NF1A during granulopoiesis [42, 54]. [score:1]
[1 to 20 of 10 sentences]
61
[+] score: 31
Moreover, overexpression of miR-223 promotes gastric cancer invasion and metastasis by targeting tumour suppressor EPB41L3 expression. [score:9]
105) reported that miR-223 directly targeted STMN1 expression and repressed cell growth and metastasis. [score:6]
PLoS ONE 7, e33919 106 Li X. (2011) miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3. [score:5]
106) found that miR-223 up-regulated in gastric cancer, especially in patients with lymph node metastasis at an advanced pathological stage. [score:4]
124) analysed seven miRNAs expression profiles (miR-10b, miR-21, miR-223, miR-338, miR-30a-5p and miR-126) by real-time PCR in 100 gastric cancer patients and showed that seven-miRNA signatures could predict relapse-free and overall survival of patients with gastric cancer. [score:3]
Clinicopathological characteristic miRNAs Overall survival and recurrence: miR-10b, miR-21*, miR-214*, miR-335*, miR-375(78, 94, 121, 122, 123, 124, 125, 126, 127, 128) Tumor-suppressor-miRs: Let-7a*, Let-7 g*, miR-125a*, miR-126, miR-146a, miR-142-5p, miR-223, miR-338, miR-433 *miRNAs are also reported to be aberrantly expressed in human ovarian cancer. [score:3]
Several miRNAs circulating in blood of gastric cancer patients can be applied as diagnosis biomarkers, including let-7a, miR-1, miR-17-5p, miR-21, miR-20a, miR-27a, miR-34, miR-106a/b, miR-196a, miR-199a-3p, miR-218, miR-221, miR-223, miR-370, miR-376c, miR-378, miR-421, miR-423-5p, miR-451 and miR-486 (Refs 64, 76, 111, 112, 113, 114, 115, 116, 117). [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 31
Interestingly, miR-146b-5p, miR-223, miR-150, miR-16, and miR-191 among the down regulated miRNAs were found to be plentifully expressed in B and T-lymphocyte, confirming a positive disease status (Houzet et al., 2008). [score:6]
In HIV infection, increased expression of miRNA-223, miRNA-382, miRNA-125b, and miRNA-28 targets the 3′ UTR of HIV-1 mRNA, which may subsequently decrease HIV replication. [score:5]
In HIV infection, miRNA-223, miRNA-382, miRNA-125b, and miRNA-28, targets the 3′ untranslated region (UTR) of the HIV-1 messenger RNA, while miRNA-150 binds to Nef 3′ long terminal repeats (LTR) at 773 and 89 positions (Huang et al., 2007). [score:5]
However, the higher expression level of miRNA-21, miRNA-122 and lower expression level of miRNA-223 can be utilized to discriminate between HIV positive and HIV negative humans (Thapa et al., 2014). [score:5]
MiRNA-223 over expression represses the gastric cancer and inhibits the exosomes transfer of metastatic cells in another part of the body. [score:4]
Healthy person infected by malaria parasite has shown higher expression of miRNA-223 and miRNA-19b in normal RBC cells in blood (Goo et al., 2014). [score:3]
Current research analysis on miRNAs (miRNA-10b, miRNA-21, miRNA-223, miRNA-338, let-7a, miRNA-30a-5p and miRNA-126) in gastric cancer have been noted to show a positive correlation with the identification and diagnosis of early cancer stages (Li et al., 2012). [score:1]
Plasma microRNAs, miR-223, miR-21 and miR-218 as novel potential biomarkers for gastric cancer detection. [score:1]
MiRNA-223, miRNA-22, miRNA-218, and miRNA-25 has been found to be associated with metastasis and gastric cancer. [score:1]
[1 to 20 of 9 sentences]
63
[+] score: 31
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
There was temporary up-regulation of miR-223 in the housed cattle. [score:4]
Although the roles of miR-223 in human exercise or the grazing of animals remains unknown, our observation is similar to the result of down-regulated miR-223 level in circulation at 1 h post-exercise [43]. [score:4]
A high expression level of miR-223 is seen in cells of myeloid lineage, with granulocytes showing the highest levels. [score:3]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
In addition, miR-223 is also considered as an inflammatory miRNA due to its specific expression in the haematopoietic system [52]. [score:2]
In this overview, it was noted that the only miRNAs that were observed to increase in the grazing but not in the housed cattle were miR-144 and miR-451, whereas there were many more miRNAs with an increasing tendency in the housed but not in the grazing, such as miR-150 and miR-223. [score:1]
miR-223: infection, inflammation and cancer. [score:1]
The temporary lowering of circulating miR-223 in the grazing cattle might indicate haematopoiesis in those cattle. [score:1]
The miR-223 level in the housed cattle increased from time 0 to 1 or 2 mo (P < 0.008), while in the grazing cattle, it decreased from 0 to 4 and 7 mo (P < 0.006). [score:1]
Grazing -induced miRNAs: miR-19b, miR-150, miR-223, miR-320a, miR-361. [score:1]
At 2 mo, the levels of miR-19b, miR-150, miR-223, miR-320a, and miR-361 in the grazing cattle were lower than in the housed cattle (P = 0.015, 0.020, 0.026, 0.023, and 0.089, respectively). [score:1]
Meanwhile, in the present study, circulating levels of miR-19b, miR-150, miR-223, and miR-320a were temporarily lower in the grazing cattle than in the housed, suggesting that there might be some stress on the grazing cattle. [score:1]
[1 to 20 of 13 sentences]
64
[+] score: 30
In particular, the following target proteins were downregulated: PTEN which is known to be targeted by miR-21 [28], [29], cyclin D1 which is known to be targeted by miR-100, miR-99a and miR-223 [30] and Bcl-2 which is known to be targeted directly by miR-34, miR-181b and miR-16 [31], [32], [33] or indirectly modulated by miR-21 [34]. [score:14]
Interestingly, both MVs from MSCs and HLSCs showed the selective expression of miR-451 and miR-223, not detected in their cells of origin after the MV release. [score:3]
A recent report showed that miR-223 was the most highly expressed miRNA in peripheral blood mononuclear cells, platelets and their plasma microvesicles [16]. [score:3]
When the miRNA content of MSC-derived MVs was compared with that of the cells of origin, miR-223, miR-564 and miR-451 represented the three selectively expressed miRNAs in MVs. [score:2]
Moreover, miR-223 has been also involved as regulator of cell cycle in cancer with an inverse correlation with cancer progression [61]. [score:2]
When the miRNA content of HLSC MVs was compared with that of the cells of origin, miR-223, miR-142-3p and miR-451 represented the most highly differentially expressed miRNAs. [score:2]
Interestingly, also miR-223 was predicted to influence cell differentiation and development [59], in particular miR-223 appears to have a role in hematopoietic stem cell proliferation [60]. [score:2]
The abundance of some miRNAs (miR-21, miR-100, miR-99a and miR-223) increased progressively in mTEC concomitantly with the internalization of PKH26- labeled MVs (Figure 7A and B). [score:1]
The following miRNAs were tested: miR-221 (line1), miR-99a (line 2), miR-222 (line 3), miR-24 (line 4), miR-410 (line 5), miR-21 (line 6), miR-100 (line 7), miR-214 (line 8), miR-31 (line9), miR-223 (line 12), miR-122 (line 13) and miR-451 (line 14). [score:1]
[1 to 20 of 9 sentences]
65
[+] score: 30
CDK4, APPBP2, ZNF10, CDK13, and AKTIP are inhibited by let-7d, APPBP2 is inhibited by mir-200a, KLC1, FLNB, MYBL1, and GCN1L1 are inhibited by mir-223, FBXW7, ZNF274, and IRF8 are inhibited by mir-130a, and FUBP1 is inhibited by mir-25. [score:11]
In addition, FLNB is inhibited by mir-223 (c [il] = −0.21954), CDK4 is inhibited by miRNA let-7d (c [il] = −0.50305), and ZNF274 is inhibited by mir-130a (c [il] = −0.10597). [score:7]
Therefore, drugs designed to target these DNA methylated genes (BTG3, G0S2 and AP2B1) or genes inhibited by miRNAs, mir-223, let-7d, and mir-130a (FLNB, CDK4 and ZNF274) may delay aging. [score:5]
We found that in the specific core GEN of elderly individuals, FLNB, CDK4, and ZNF274 are inhibited by mir-223, let-7d, and mir-130a, respectively, and DNA methylation of FYN, CDK4, MAGED1 and ZNF274 in order to overcome dysregulation of the MAPK signaling, T-cell receptor signaling, and neurotrophin signaling pathways, as well as deregulated cell cycle and apoptosis processes. [score:5]
We observed that there are three core miRNAs, mir-223, let-7d and mir-130a, that regulate FLNB, CDK4, and ZNF274, respectively (Figure 10). [score:2]
[1 to 20 of 5 sentences]
66
[+] score: 29
Figure 3miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation Both gain- and loss-of-function in vivo studies of miR-126 in mouse mo dels demonstrated that either enforced expression or knockout of miR-126 substantially promoted development of t(8;21) AML in mice [75]. [score:10]
miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation. [score:6]
In the presence of factors that impair RUNX1 function/level this delay may act synergistically with deregulated of RUNX1-targets (e. g. miR-223) involved in differentiation of myeloid precursors. [score:4]
Further studies identified that transcription factor myocyte-specific enhancer factor 2C (MEF2C) gene is one of the targets of miR-223 in mediating its anti-proliferative effects in granulopoiesis, while miR-223 transcription is activated by RUNX1/RUNX1T1 -induced chromatin remo deling. [score:3]
miR-223, one RUNX1 target, is critical for the establishment of granulocyte and monocyte lineages [71, 72]. [score:3]
These results suggest that miR-223 loss is not sufficient to cause AML but it may be a contributing factor in leukemogenesis that requires further study. [score:1]
In support of this, the miR-223 mutant mouse was found to exhibit granulocytosis and hemizygous loss of the miR-223 gene has been identified in AML patients [28]. [score:1]
Recently, Maria et al, using the miR-223 [-/Y] and miR-223 [−/−] mice, found that loss of miR-223 alone results in a modest expansion of myeloid progenitors, but does not induce myeloproliferative disorder or alter HSC long-term repopulating and self-renewal capacity [29]. [score:1]
[1 to 20 of 8 sentences]
67
[+] score: 29
Other miRNAs from this paper: mmu-mir-223
Corroboration of gene expression profiles with predicted targets of miR-223, combined with molecular investigations, allowed us to identify chemokine (C-X-C motif) ligand 2 (CXCL2), chemokine (C-C motif) ligand 3 (CCL3), and interleukin 6 (IL-6) as novel targets of miR-223. [score:5]
Thus, in our mo del of experimental TB, the absence of miR-223 was responsible for uncontrolled expression of chemotactic mediators, CXCL2 and CCL3, and heightened neutrophil availability due to impaired granulopoiesis as a consequence of uncontrolled IL-6 expression. [score:5]
Lung gene expression profiling highlighted genes involved in neutrophil recruitment and the immune response as potential targets for miR-223. [score:5]
Additionally, miR-223 modulates cell activation by targeting NLR family pyrin (NLRP) containing domain 3 (NLRP3) inflammasome and I-kappa-B-kinase (IKK) alpha (IKK-α) (63, 64). [score:3]
Our biomarker analysis focusing on miR-223 in experimental TB of mice as well as reports by others reveal a profound correlation between disease susceptibility, TB pathology, and magnitude of the neutrophil responses. [score:3]
MiR-223 expression is induced during granulopoiesis (60), controlled by different myeloid transcription factors (61, 62), and reaches its highest level in mature neutrophils. [score:2]
These results add further knowledge to the role of miRs during TB and in particular suggest that miR-223 controls TB susceptibility by limiting neutrophil recruitment through regulation of pro-inflammatory chemokines. [score:2]
To address the biological role of miR-223 during TB, we employed the aerosol Mtb infection mo del of miR-223 mutant mice (60). [score:1]
Likewise, susceptible gene- deletion mutant strains, such as Card9 [−/−] and miR-223 [−/−] mice can be rescued by antibody -mediated neutrophil depletion (56, 72). [score:1]
miR-223 Fine-Tunes Inflammation in TB. [score:1]
We followed several candidate pathways and molecules that emerged from transcriptomics studies, including miR-223. [score:1]
[1 to 20 of 11 sentences]
68
[+] score: 28
According to the result, we found that although the population -based effects and inherent differences inevitably emerged as the previous report [33], the tendency of the expression patterns was consistent with the NGS findings, as miR-107 and miR-223-3p showed the upregulated expression levels in cancerous penile tissues, while miR-1247-5p and miR-509-3p showed the downregulated expression levels in cancerous penile tissues, which again verified the smRNA-seq sequencing data (S6 Fig). [score:13]
Of the upregulated miRNAs, miR-107, miR-223-3p, miR-340-5p, miR-424-5p and miR-944 were the top 5 most abundantly expressed miRNAs in the penile cancer tissues, among which, miR-107 had an expression level in PeCa exceeding 30,000 reads count. [score:8]
As expected, most majority of the miRNAs, either upregulated in the cancer tissues, such as miR-223-3p [61], miR-421 [62], miR-424-5p [63], miR-1260b [64] etc, or downregulated in the penile cancer, such as miR-205-5p [65], miR-211-5p [65– 66], miR-365-3p [67] and miR-1247 [68] etc, were entitled the similar roles in carcinogenesis of bladder cancer, retinoblastoma, breast cancer, nasopharyngeal cancer, pancreatic cancer and several other cancer types [61– 68]. [score:7]
[1 to 20 of 3 sentences]
69
[+] score: 26
Other miRNAs from this paper: hsa-mir-21, hsa-mir-100, hsa-mir-222, hsa-mir-126
As a matter of fact, over -expressing miR-222, but not miR-223 led to a STAT5A level that was almost undetectable, miR-21 that was down-regulated as well as TGFβ expression and collagen production that were barely discernible. [score:8]
It has been shown that the STAT5 protein level is modulated by both miRs in different cellular contexts and that STAT5 is a direct miR-222 and miR-223 target [18– 20]. [score:4]
It has been reported that both miR-223 and miR-222 post-transcriptionally regulate STAT5 [18– 20], which led us to evaluate their expression in HG-cultured, EV treated MCs. [score:2]
This highlighted a role that miR-222, miR-223 or both may play in the post-transcriptional regulation of STAT5A upon EV treatment. [score:2]
Gain-of function experiments were performed in MCs transfected with pre-miR-222 or pre-miR-223 and cultured in LG or HG conditions (S1A and S1B Fig), in order to evaluate which miR was able to regulate STAT5 expression. [score:2]
Whereas miR-222 is down regulated upon HG treatment and increased upon EV treatment (Fig 4A), miR-223 increased upon both HG and EV treatment (Fig 4B). [score:2]
On the other hand, STAT5 itself can be controlled by miRs, including miR-222 [18, 19], and miR-223 [20], which suggests that the overall scenario is extremely complex. [score:1]
An analysis of EV miR content in both cellular sources identified miR-222 and miR-223 [27]. [score:1]
miR-222 and miR-223 expression was evaluated by qRT-PCR and normalized to RNU6B (five experiment performed in triplicate, n = 5) (p = 0.04, pre-miR-222 vs pre miR neg c in LG; p = 0.001, pre-miR-222 vs pre miR neg in HG in A; p = 0.012, pre-miR-223 vs pre miR neg c in LG; p = 0.004, pre-miR-223 vs pre miR neg in HG in B). [score:1]
were performed in MCs cultured in LG or HG that had either been transfected with the pre-miR negative control or the pre-miR-222, pre-miR-223 or pre-miR-100 precursor oligonucleotides (Applied Biosystem), according to manufacturer’s instructions. [score:1]
0162417.g004 Fig 4 (A-B) miR‐222 (A) and miR-223 (B) expression was evaluated by qRT‐PCR on 48h LG- or HG-cultured MCs, that had either been treated with MSC-EVs or HLSC-EVs for 18h or otherwise left untreated. [score:1]
RNA from cells was then reverse-transcribed either using a TaqMan microRNA RT kit, that is specific for miR-222 and miR-223, or a Syber Green microRNA RT Kit specific for miR-21 and miR-100. [score:1]
[1 to 20 of 12 sentences]
70
[+] score: 24
In particular, the following target proteins, involved in cell proliferation, were downregulated: DHFR targeted by miR24 [33], Cyclin D1 targeted by miR223 [34], and E2F-2 targeted by miR31 [35]. [score:12]
Moreover, the use of miRNA inhibitors against miR451, miR223, miR24, miR125b, and miR31 on HepG2 reduced the proapoptotic activity induced by MV-HLSC. [score:3]
HepG2 transfection with miR451, miR31, and miR223 mimics, which reproduce mature endogenous miRNAs, inhibited proliferation of HepG2 (Fig. 5B). [score:3]
This was more significant for miR451, miR223, and miR31. [score:1]
Silencing Dicer in HLSC resulted in the modulation of different miRNAs, with a significant reduction of the antitumor miR223, miR24, miR31, and miR122 [55] in MVs. [score:1]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
To evaluate whether single miRNAs with antitumor activity (miR451, miR223, miR24, miR125b, and miR31) were relevant for the proapoptotic effect of MV-HLSC, we transfected HepG2 with selected miRNA inhibitors (Fig. 5A). [score:1]
MVs released from DCR-Kd HLSC (MV DCR−), but not from CTR-A HLSC (MV CTR-A), showed a significant reduction of miR223, miR24, miR31, miR122, and miR214 as detected by qRT-PCR (Fig. 4B). [score:1]
Among miRNAs present in MV-HLSC, we detected several miRNAs with potential antitumor activity including miR451, miR223, miR24, miR125b miR31, and miR122 (Fig. 3A). [score:1]
[1 to 20 of 9 sentences]
71
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
HCC cells showed highly deregulated miR-223 expression and a strong inverse relationship with its downstream target Stathmin 1 (Wong et al., 2008). [score:6]
Inhibition of caspases 3, 6, 7, and 8. Migration, invasionGramantieri et al., 2007; Meng et al., 2007; Ladeiro et al., 2008; Li et al., 2008; Wang et al., 2008, 2010; Wong et al., 2008, 2010; Garofalo et al., 2009; Huang et al., 2009; Liu et al., 2009; Pogribny et al., 2009; Su et al., 2009; Pineau et al., 2010; Karakatsanis et al., 2013 miR-223 Proliferation. [score:3]
Expression of microRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significance. [score:3]
MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin 1. Gastroenterology 135, 257– 269 10.1053/j. [score:2]
Circulating microRNAs, miR-21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitis. [score:1]
[1 to 20 of 6 sentences]
72
[+] score: 21
Interestingly, this upregulation of cyclin T1 was accompanied by a significant downregulation of a group of miRNAs that included miR-27b, miR-29b, miR-150, and miR-223 in activated CD4 [+] T-cells. [score:7]
However, only the miR-27b was shown to directly regulate the cyclin T1 expression, whereas miR-29b, miR-150, and miR-223 were all proposed to indirectly affect the cyclin T1 levels. [score:6]
Compared to the activated CD4 [+] T-cells, resting memory CD4 [+] T-cells displayed upregulation of five miRNAs—miR-28, miR-125b, miR-150, miR-223, and miR-382, which negatively targeted the 3′-ends of HIV-1 mRNAs [179]. [score:5]
Wang et al. [223] reported that monocytes expressed elevated levels of the cellular miRNAs miR-125b-5p, miR-28-5p, miR-150-5p, miR-223-3p, and miR-382-5p, all previously shown by Huang et al. [179] to impair HIV-1 replication in resting CD4 [+] T-cells. [score:3]
[1 to 20 of 4 sentences]
73
[+] score: 21
miR-125b is a member of anti-HIV-1 miRNA family (including miR-28, miR-125b, miR-150, miR-223, and miR-382) that targets the 3′UTR of HIV-1 transcripts and inhibit viral translation, a post entry step. [score:7]
miR-125b was consistently downregulated upon cocaine treatment, whereas expression of other miRNAs (miR-26, miR-150, miR-223, miR-122, and miR-296) were not significantly affected. [score:6]
Our microarray data revealed downregulation of an array of cellular miRNAs (data not shown) including anti-HIV-1 miRNAs (miR-125b, miR-150, miR-28-5p, miR-223, and miR-382) in cocaine treated cells (Fig. 3A). [score:4]
The table shows that cocaine treatment downregulated a family of anti-HIV-1 miRNAs including miR-125b, miR-150, miR-28p, miR-223, and miR-382 in CD4+ T cells. [score:4]
[1 to 20 of 4 sentences]
74
[+] score: 20
As shown in Figures 3, 4, 5, 6, miR-1798 and miR-1699 influence the expression of CCND1 and CCNE2, respectively, while miR-223 and miR-1744 regulate expression of CDK1 and CDK3, respectively. [score:6]
In addition, our results indicate that several microRNAs (miRs), specifically miR-222, miR-223, miR-1626, miR-1699, miR-1744, miR-1787, miR-1798 and miR-1812 interact with sites in the 3′-UTR of the cell cycle genes and regulatory factors affecting cell cycle genes including CCND1, CCNE2, CDK1, CDK3, CDKN1A and CDKN1B to influence post-transcriptional regulation of its expression in laying hens. [score:5]
In addition, as shown in Figures 5 and 6, in the presence of miR-223 and miR- 1744, the intensity and percentage of GFP-CDK1 -expressing cells (17.2% in control vs. [score:3]
1.3% in miR-223) and GFP-CDK3 -expressing cells (16.1% in control vs. [score:3]
This analysis revealed putative binding sites for several chicken miRNAs (miR-1798 for CCND1; miR-1699 for CCNE2; miR-223 for CDK1; miR-1744 for CDK3; miR-1626 for CDKN1A; and miR-222, miR-1787 and miR-1812 for CDKN1B), but not for the other four genes of interest. [score:1]
[C and D] After co-transfection of pcDNA-eGFP-3′UTR for the CDK1 transcript and pcDNA-DsRed-miRNA for the miR-223, the fluorescence signals of GFP and DsRed were detected using FACS [C] and fluorescent microscopy [D]. [score:1]
[A] Diagram of miR-223 binding sites in the 3′-UTR of the CDK1gene. [score:1]
[1 to 20 of 7 sentences]
75
[+] score: 20
Other miRNAs from this paper: hsa-mir-106a
In this study, miR223 was shown to target CXCL2, a chemokine involved in neutrophil recruitment. [score:3]
In mice aerosolized with LPS, a time -dependent increase of miR223 was correlated with a reduced expression of TNF-α, CXCL1, and CXCL2 (58). [score:3]
In human, miR223 was shown to be involved in the granulopoiesis (59) and patients suffering from sepsis exhibited a marked decrease of miR223 expression (60). [score:3]
Studies on miR-223 -deficient mice revealed higher numbers of granulocytes and hypermature neutrophils, indicating that miR-223 negatively regulates granulocyte generation and maturation (55, 56). [score:2]
It is, therefore, reasonable to speculate that a potent silencing escape affecting X-linked miRNAs like miR223 and miR106a could have a direct impact on the control of the fate lineage determination of hematopoietic progenitors, and consequently, could significantly impact the magnitude of the innate inflammatory response in males and females. [score:2]
X chromosome-linked miR223 and miR106a are potentially key miRNAs that may contribute to the contrasting outcome of the inflammatory response in males and females by regulating the innate immune signaling in PMNs and monocytes, respectively. [score:2]
All these data point toward the importance of X-linked miR223 in the control of the immune inflammatory response by regulating neutrophil recruitment. [score:2]
Furthermore, miR223 KO mice were shown to develop severe inflammatory symptoms upon LPS challenge and increased oxidative burst of neutrophils upon infection with Candida albicans (55). [score:1]
A higher susceptibility to Mycobacterium tuberculosis infection associated with excessive neutrophil accumulation within the lung and tissue damages was also observed in miR223 KO versus wild-type mice (57). [score:1]
For instance, number of reports described the crucial role of X-linked miR223 and miR106a in the differentiation of neutrophils and monocytes, the key cell players of the innate immunity at early stages of infection. [score:1]
[1 to 20 of 10 sentences]
76
[+] score: 20
This decrease resulted in increased STAT3 expression, as STAT3 is a direct target of miR-223. [score:6]
Downregulation of miR-223 expression in MΦ has also been reported to increase production (56). [score:6]
Interestingly, while this was achievable with a miR-223 cargo composed of either miR-223 duplexes or a miR-223 encoding plasmid, the duplexes resulted in the greatest miR-223 expression. [score:3]
For example, Tran et al. recently demonstrated an MΦ targeted approach that allowed for the delivery of miR-223. [score:3]
Let-7c and miR-24 favors M2 phenotype while miR-155 and miR-223 can repolarize M2 MΦ toward M1 phenotype. [score:1]
miR-223 is a multi-functional miRNA that has recently been shown to promote plasticity from the M1 to M2 phenotype, as evidenced by a decrease in M1 markers (such as iNOS-2), increase in M2 markers (such as Arg-1) and reduced production of pro-inflammatory cytokines (117). [score:1]
[1 to 20 of 6 sentences]
77
[+] score: 20
In addition to these roles, a recent study underscored the importance of miR-223 downregulation in the development of HCC [34], suggesting a potential role of this miRNA in liver disease. [score:7]
Similarly, miR-122 and miR-223 were found to be downregulated in HCC tissues but elevated in the serum of HCC patients. [score:4]
Seven miRNAs (miR-122, miR-192, miR-21, miR-223, miR-26a, miR-27a, and miR-801) that were differentially expressed between the HCC and control groups (healthy, CHB, and cirrhosis) were further tested in an additional 305 participants. [score:3]
Moreover, the level of serum miR-223 in HBV patients without HCC was higher than in HCC patients [24]. [score:1]
Hence, miR-223 may be a potential biomarker for liver diseases; however, its exact role in HCC needs to be fully investigated in the future. [score:1]
A subsequent study demonstrated that the elevation of serum miR-223 may arise from hepatic ischemia/reperfusion injury [35]. [score:1]
The damage to hepatocytes in patients with chronic hepatitis may be more serious than that in patients with HCC, and it is reasonable that the level of serum miR-223 in patients with chronic B hepatitis is much higher than in patients with HCC. [score:1]
3.2.2. miR-223. [score:1]
miR-223 (also called Mirn223) has drawn considerable attention in the literature. [score:1]
[1 to 20 of 9 sentences]
78
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
Gene target analysis of the up- and down-regulated milk microRNAs such as miR-223 and miR-15b, respectively, revealed several roles of these microRNAs in response to mastitis [154]. [score:6]
In this study, immune-related microRNAs (miR-30a, miR-223, miR-92a) were highly expressed in bovine milk-derived extracellular vesicles, which were uptaken in vitro by splenocytes and intestinal cells. [score:3]
In contrast, miR-223 negatively regulates neutrophil proliferation and activation [100]. [score:2]
These microRNAs include miR101 and miR150, which are known regulators of T cells [146, 147], and also miR-223 that has been reported to modulate innate immune cell (granulocytes and neutrophils) differentiation and activation [100, 119, 120]. [score:2]
Additionally, the expression levels of a selected bovine microRNA group, including miR-223, miR-106b, miR-15b, miR-155, and miR-34a, have been analyzed using qPCR and compared between colostrum and mature milk, where they were found to be present at significantly different levels [54]. [score:2]
[52, 55] miR-223 Neutrophil proliferation and activation. [score:1]
Bovine milk miR-15b, miR-27b, miR-34a, miR-106b, miR-130a, miR-155, and miR-223, which are all considered as immune- and development-related microRNAs, have been found in higher levels in colostrum than in mature milk [54]. [score:1]
Kosaka et al. [48] reported high quantities of microRNAs in HM with functions associated with the immune system during the first 6 months of lactation, including, but not limited to miR-181a, miR-17, miR-155, miR-150, and miR-223. [score:1]
miR-223, which is predicted to activate proliferation of granulocytes [119], is also found at high levels in HM [48]. [score:1]
miR-155 and miR-223 have been detected in bovine milk and are both involved in many immune functions [100], and potentially have anti-inflammatory effects especially in bovine colostrum. [score:1]
[1 to 20 of 10 sentences]
79
[+] score: 19
Evaluating the miRNA profile in a human vascular endothelial cell line (EAhy926) infected with DENV-2 (TR1751 strain) by microarray and qRT-PCR, 12 miRNA candidates were found to be up-regulated (miR-3178, miR-324-3p, miR-937, miR-3195, hsv1-miR-H6-3p, kshv-miR-K12-12*, let-7a-2*, miR-20b*) and down-regulated (miR-21*, miR-2116, miR-142-3p, miR-223). [score:5]
Concomitant with miR-223 down-regulation, there was a 63-fold increase in the level of STMN1 mRNA in infected cells. [score:4]
When miR-223 was inhibited, there was increase in viral titre in supernatants and lysates of infected EAhy926 cells. [score:3]
Among the down-regulated candidates, miR-223 showed a 30 % reduction when compared to uninfected cells. [score:3]
In conclusion, dengue infection was able to decrease miR-223 levels, which in turn increases STMN1 protein expression and improves virus replication, suggesting a potential antiviral role for this miRNA [127]. [score:3]
To investigate the involvement of miR-223 in DENV-2 replication, this miRNA was overexpressed or reduced using a plasmid transfection approach in cell culture. [score:1]
[1 to 20 of 6 sentences]
80
[+] score: 19
Moreover, recent studies show that several tumor suppressor miRNAs are directly regulated by C/EBPα, such as miR-223, miR-34a and miR-30C, and that transactivation of all miRNAs is inhibited along with the down-regulated expression of C/EBPα [21– 23]. [score:12]
Fazi et al. first identify miR-223 as a direct target of C/EBPα, and C/EBPα -induced up-regulation of miR-223 leads to granulopoiesis [19]. [score:7]
[1 to 20 of 2 sentences]
81
[+] score: 19
For example, miR-223 is preferentially expressed in the hematopoietic system with crucial functions in myeloid lineage development, and its expression is repressed in multiple tumors including hepatocellular cancer and acute myeloid leukemia (AML). [score:6]
These two transcription factors compete for binding to the miR-223 promoter: NFI-A maintains miR-223 at low levels, whereas the retinoic acid -induced C/EBPα replaces NFI-A to upregulate miR-223 expression. [score:6]
46, 47 For instance, Fazi et al. [48] has discovered that miR-223 expression was epigenetically silenced by AML1/ETO, a most common AML -associated fusion protein, through CpG methylation. [score:3]
[40–43] Fukao et al. [44] found that the expression of miR-223 gene is driven by the myeloid transcription factors PU. [score:3]
Fazi et al. [45] discovered that miR-223 and transcription factors NFI-A and C/EBPα form a minicircuitry to control human granulocytic differentiation. [score:1]
[1 to 20 of 5 sentences]
82
[+] score: 19
We find a low expression of miR-223 in MB/PMs and high expression levels at later stages of maturation (a cluster 6 profile) which fits this proposed function and regulation. [score:6]
hsa-miR-223 Both Targetscan and miRanda: CBFB, SP3, MYBL1, SP1, CUX1, Targetscan: TGFBR3, CDK17, E2F1. [score:5]
Pulikkan et al. demonstrate that miR-223 plays a crucial role in cell cycle regulation by down -regulating the cell cycle protein E2F1 and thereby aiding in promoting cell cycle arrest [19]. [score:3]
1 and C/EBP-β [35], [36], which both have an expression pattern resembling that of miR-223 [6]. [score:3]
The miRNAs were miR-130a and miR-155 (cluster 1), miR-146a (cluster 2), miR-34c-3p (cluster 3), miR-99b (cluster 4), miR-183 and miR-26a (cluster 5), and miR-27a and miR-223 (cluster 6). [score:1]
C/EBP-α is another key mediator of granulopoiesis [12] and has been shown to induce the transcription of miR-223 in concert with PU. [score:1]
[1 to 20 of 6 sentences]
83
[+] score: 19
Amongst the 13 miRNAs we selected, 6 miRNAs (miR-28-5p, miR-125b-5p, miR-150-5p, miR-155-5p, miR-223-3p, and miR-92a-3p) show up-regulated expression and 3 miRNAs (miR-29a-3p, miR-29b-3p, and miR-133b) show down-regulation of expression in patient samples, compared to uninfected counterparts. [score:10]
An interesting finding by Huang et al. suggested that a cluster of miRNAs (miR-28-5p, miR-125b-5p, miR-150-5p, miR-223-3p and miR-382-5p) have enriched expression in resting primary CD4+ T lymphocytes and have direct target sites on HIV-1 mRNA, thus leading to differential HIV-1 infectivity/resistance to different cells lying at varying developmental stages 11. [score:7]
MicroRNA-223-3p was also shown to be up regulated in HIV infection in an in vitro study, previously 34. [score:1]
In our study, there are 6 miRNAs (miR-28-5p, miR-125b-5p, miR-150-5p, miR-155-5p, miR-223-3p and miR-92a-3p) that are up regulated in patients (compared to uninfected controls). [score:1]
[1 to 20 of 4 sentences]
84
[+] score: 19
Among the down-regulated miRNAs, miR-223 expression decreased in hypoxia -treated mouse lungs and such a down-regulation contributed to the development of hypoxia -induced PH and right ventricular failure [48]. [score:10]
miR-210, miR-125a-5p, miR-424, miR-181a and miR-23b were most significantly up-regulated in hypoxia -treated HPASMC (Figure 5D), whereas miR-124, miR-888*, miR-541 and miR-223 were the most down-regulated miRNAs (Figure 5E). [score:7]
The amplification efficiency was 96% (miR-92a), 95% (miR-210), 91% (miR-16), 90% (miR-90), and 101% (miR-223), respectively, and the correlation coefficients (R [2]) for each miRNAs was >0.99. [score:1]
The LOD for miR-210 and miR-223 (a low abundant miRNA in HEK293 cells) in a qPCR reaction were 1.0 pg and 10.0 pg, respectively. [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 19
Using miR223 for normalization of miRNA expression levels, we confirmed significantly greater miR423-5p (p<0.05), miR30d (p<0.05), miR10b (p<0.05) and miR126 (p<0.001) expression in patients with low collateral capacity (Fig 3). [score:5]
Based on the data collected from the RT-PCR multiplex, three miRNAs were selected to be validated as stably expressed controls (mir15a, mir16, mir223). [score:3]
Based on the miRNA profiling data from the RT-PCR multiplex, three miRNAs were selected as potential reference miRNA candidates because of their stable expression in patients with low and high collateral capacity (miR15a, miR16 and miR223). [score:3]
We verified stable expression levels of miR15a, miR16 and miR223 by qPCR based on their cycle threshold (Ct) values and determined the lowest Cv in miR223 (S1 Fig). [score:3]
MiR223 demonstrates most stable expression between the two patient groups and healthy controls, with the lowest coefficient of variation (Cv) values. [score:2]
Cycle threshold values of three reference miRNA candidates (A: miR15a; B: miR16; C: miR223) in patients with low (CFI < 0.39) and high (CFI > 0.39) collateral capacity, as well as healthy individuals. [score:1]
Thus, miR223 was used as a reference miRNA. [score:1]
S1 Fig Cycle threshold values of three reference miRNA candidates (A: miR15a; B: miR16; C: miR223) in patients with low (CFI < 0.39) and high (CFI > 0.39) collateral capacity, as well as healthy individuals. [score:1]
[1 to 20 of 8 sentences]
86
[+] score: 18
Other miRNAs from this paper: rno-mir-223
miR-223, the mature form of Mir223, is a microRNA that is highly expressed in monocytes/macrophages and directly targets STAT3 to regulate its activation (Chen et al., 2012). [score:7]
Inducible microRNA-223 down-regulation promotes TLR-triggered IL-6 and IL-1β production in macrophages by targeting STAT3. [score:6]
When CAF-diet effects were compared to those of the STD diet, this translated into a moderate change in gene expression profile in circulating monocytes of the LEW rat, whereas a substantial set of genes was differentially modulated in WKY rats including microRNA 223 (Mir223) expression. [score:5]
[1 to 20 of 3 sentences]
87
[+] score: 18
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Venn diagrams depicting the distribution of miR-133, miR-193, miR-29a/b, miR-223 predicted targets (middle panel). [score:3]
[1 to 20 of 4 sentences]
88
[+] score: 17
let-7g-5p, miR-142-3p, miR-16-5p and miR-223-3p were expressed at high levels in all 5 lineages, while miR-134, miR-517c-3p/519a-3p, miR-518d-3p, miR-520d-5p/518a-5p/527 and miR-562 were expressed at low levels in all 5 lineages (Table S5B). [score:5]
It is well-accepted that miR-223 regulates granulocyte differentiation and function, although the exact molecular mechanism appears complex since ectopic expression of miR-223 in leukemic cells enhanced myeloid differentiation [59], whereas deletion of miR-223 in a murine mo del supported a negative regulatory effect on granulocyte differentiation [60]. [score:5]
We found miR-223 to be the most abundant granulocyte miRNA, consistent with another report using peripheral blood [58] and with the increased expression of miR-223 that occurs during granulocyte differentiation [59], [60]. [score:3]
miR-155 levels in B-cells strongly correlate with response to therapy [22] and levels of miR-223 and miR-191 vary with the extent of platelet inhibition by thienopyridines and aspirin [23]. [score:3]
Older literature refers to miR-223 as myeloid-specific, but the high level we observed in platelets is consistent with other reports [56], [57], and high levels were also found in Meg-01 cells that display megakaryocytic properties. [score:1]
[1 to 20 of 5 sentences]
89
[+] score: 17
We also observed that the mRNA potentially targeted by mmu-miR-223 (Arid4b, Lpin2, see Figure 5) and mmu-miR-146b (Zfp451, Klf13 and Tcfcp2l1) did undergo a downregulation at ST. [score:6]
The expression of mmu-miR-483 and -672 was downregulated at ST as compared to the PBS -treated mice while the levels of mmu-miR-223 and -146b were increased. [score:5]
Transient transfection analysis for luciferase reporter expression with Arid4b, Il-6 or Lpin2 3′UTR in the presence of miR-223; with Gmnn, Nola2 or Ube2c 3′UTR in the presence of miR-483; with Dera or Nusap1 3′UTR in the presence of miR-574-5p; with Cd3g or Phb2 3′UTR in the presence of miR-672; and with Fst, Ctse or Cdca8 3′UTR in the presence of miR-690. [score:3]
The second miRNA significantly regulated, mmu-miR-223, was previously shown to play a significant role in pulmonary function alteration by exposition to cigarette smoke [31] or to LPS [33]. [score:2]
Among the 17 others miRNA-mRNA pairs that were evaluated (Figure 4E-H and Figure 5), significant inhibition was observed in 10 experimental conditions (miR-29c and Ctsk; miR-146b and Scube2; miR-483 and Nola2 or Ube2c; miR-672 and Phb2; miR-223 and Il6 or Lpin2 or Arid4b; miR-690 Fst or Ctse). [score:1]
[1 to 20 of 5 sentences]
90
[+] score: 17
Other miRNAs from this paper: hsa-let-7e, hsa-mir-16-1,