sort by

100 publications mentioning hsa-mir-217

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-217. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 390
Further, overexpression of circ-TTBK2 increased HNF1β expression via impairing miR-217 expression which negatively regulated HNF1β by targeting its 3′-UTR. [score:10]
Also, we found that overexpression or downregulation of miR-217 did not affect the expression of TTBK2 (Additional file 2: Figure S2c). [score:8]
Derlin-1 (−)-NC group) The above results showed that circ-TTBK2 modulated HNF1β expression via regulating miR-217 expression, and HNF1β increased Derlin-1 expression by activating the promoter of Derlin-1. To clarify whether HNF1β reversed miR-217 -induced impairment of malignant progression of glioma cells, we measured the biological behavior of glioma cells that stably expressed miR-217+HNF1β (non-3′UTR). [score:8]
Fig. 4HNF1β was upregulated in glioma tissues and cell lines and was a target of miR-217; both circ-TTBK2 and miR-217 could modulate HNF1β expression. [score:8]
Additionally, miR-217 expression is downregulated and exerts a tumor-suppressive function in gastric cancer [20]. [score:8]
Moreover, qRT-PCR and western blot were used to determine the expressions of HNF1β mRNA and protein in glioma cells treated with circ-TTBK2 inhibition and/or miR-217 overexpression. [score:7]
Meanwhile, overexpressed miR-217 obviously inhibited cell proliferation, colony formation, and invasion, while promoted apoptosis of colorectal cancer cell via targeting AEG-1 3′-UTR [38]. [score:7]
Further, miR-217 expression was significantly lower in lung cancer tissues than in noncancerous tissues, and enhanced miR-217 inhibited cell proliferation, migration, and invasion, while induced apoptosis of SPC-A-1 and A549 cells via targeting KRAS [40]. [score:7]
circ-TTBK2 (−)+miR-217 (−) group) Having confirmed that HNF1β was upregulated in glioma tissues and cells, effects of HNF1β overexpression or downregulation on glioma cells were investigated. [score:7]
In summary, our study revealed that circ-TTBK2 inhibition restrained malignant progression of glioma cells by upregulating miR-217. [score:6]
Overexpressed miR-217 impaired HNF1β -induced promotion of glioma cell progression and regulated signaling pathways by targeting 3′-UTR of HNF1β. [score:6]
In addition, upregulated circ-TTBK2 decreased miR-217 expression and there was a reciprocal negative feedback between them in an Argonaute2 -dependent manner. [score:6]
As previously reported, miR-217 is robustly downregulated in human epithelial ovarian cancer (EOC) and inhibits cell growth and metastasis [19]. [score:6]
The in vivo experiment showed downregulated circ-TTBK2 or overexpressed miR-217 (Fig.   8b). [score:6]
Moreover, mRNA and protein expressions of HNF1β were obviously upregulated in the circ-TTBK2 (+)+miR-217 (−) group than those in the circ-TTBK2 (+)+miR-217 (+) group (Fig.   4g). [score:6]
Using bioinformatics databases (TargetScan, miRanda, and RNAhybrid), HNF1β was identified as a direct target of miR-217. [score:6]
Knockdown of circ-TTBK2 combined with overexpression of miR-217 inhibited tumor growth and led to higher survival in nude mice. [score:6]
More importantly, inhibition of circ-TTBK2/miR-217/HNF1β/Derlin-1 axis may be a potential therapeutic target for human gliomas. [score:5]
Additionally, overexpressed miR-217 reversed circ-TTBK2 -induced promotion of HNF1β expression. [score:5]
MiR-217 was downregulated in glioma tissues and cell lines and exerted tumor-suppressive function in glioma cells. [score:5]
Moreover, reintroduction of miR-217 decreased HNF1β mRNA and protein expressions by targeting its 3′-UTR. [score:5]
And circ-TTBK2 inhibition combined with miR-217 overexpression produced the longest survival period (Fig.   8b). [score:5]
First, we found that overexpression of HNF1β (without 3′-UTR) reversed inhibition on glioma cell malignant biological behavior induced by miR-217. [score:5]
Fig. 3Overexpression of circ-TTBK2 promoted malignant biological behavior of glioma cells via decreasing miR-217 expression. [score:5]
MiR-217 exerted tumor-suppressive function through downregulating HNF1β. [score:5]
c The schematic cartoon of the mechanism of circ-TTBK2 as an oncogene negative regulation of miR-217 in glioma cells In this study, we demonstrated that circ-TTBK2 was upregulated in glioma tissues and cell lines. [score:5]
Expression profiling analysis has depicted a possible tumor-suppressive function of miR-217 in various cancers. [score:5]
MiR-217 expression was significantly decreased in the circ-TTBK2 (+) group, while miR-217 expression was significantly increased in the circ-TTBK2 (-) group (Fig.   3c). [score:5]
Notoriously, miR-217 was downregulated in various tumors such as EOC and gastric cancer. [score:4]
c qRT-PCR analysis for circ-TTBK2 regulated miR-217 expression in U87 and U251 cells (data are presented as the mean  + SD (n = 5, each group). [score:4]
Stable knockdown of circ-TTBK2 or overexpression of miR-217 glioma cell lines (U87 and U251) were established to explore the function of circ-TTBK2 and miR-217 in glioma cells. [score:4]
g qRT-PCR and western blot analysis for circ-TTBK2 combined with miR-217 regulated HNF1β expression in U87 and U251. [score:4]
f qRT-PCR and western blot analysis for miR-217 regulated HNF1β expression in U87 and U251. [score:4]
HNF1β was a direct target of miR-217, and played oncogenic role in glioma cells. [score:4]
Remarkably, circ-TTBK2 knockdown combined with miR-217 overexpression led to tumor regression in vivo. [score:4]
Remarkably, knockdown of circ-TTBK2 combined with miR-217 overexpression resulted in the smallest tumor volume (Fig.   8b). [score:4]
Having confirmed that miR-217 expression was negatively regulated by circ-TTBK2 expression, we further investigated whether miR-217 reversed circ-TTBK2 -mediated promotion of glioma cells progression. [score:4]
In contrary, miR-217 was downregulated in glioma tissues and cell lines. [score:4]
b Quantification of migration and invasion cells with the expression of miR-217 and HNF1β changed. [score:3]
Also, overexpression of miR-217 impeded glioma cells malignancy in vitro and reduced tumor growth in vivo. [score:3]
c Flow cytometry analysis of U87 and U251 with the expression of miR-217 and HNF1β changed (data are presented as the mean  + SD (n = 5, each group). [score:3]
We further ascertained that miR-217 targeted circ-TTBK2-Wt. [score:3]
In summary, these results indicated that circ-TTBK2 reduced miR-217 expression in RISC manner, and there might be a reciprocal repression feedback loop between circ-TTBK2 and miR-217. [score:3]
HNF1β was a target of miR-217, and was involved in circ-TTBK2- and miR-217 -mediated modulation of glioma cells malignant progression. [score:3]
MiR-217 expression was negatively correlated with the pathological grades of glioma, and similarly with circ-TTBK2, miR-217 was also located in the cytoplasm (Fig.   2a, b). [score:3]
Fluorescence in situ hybridization and quantitative real-time PCR were conducted to profile the cell distribution and expression of circ-TTBK2 and microRNA-217 (miR-217) in glioma tissues and cells. [score:3]
These results clarified that circ-TTBK2 promoted glioma cells malignant progression via reducing miR-217 expression. [score:3]
This inferred that miR-217 might function as a tumor-suppressor in glioma cells. [score:3]
Similarly, the expression of circ-TTBK2 was significantly restored in anti-miR-217 group (Fig.   3d). [score:3]
c Expression level of TTBK2 in cells treated with pre-miR-217 and anti-miR-217 (n = 5, each group). [score:3]
k Flow cytometry analysis of U87 and U251 with the expression of circ-TTBK2 and miR-217 changed (data are presented as the mean  + SD (n = 5, each group). [score:3]
e Quantification number of migration and invasion cells with different expression levels of miR-217. [score:3]
Remarkably, the in vivo study demonstrated that the inhibition of circ-TTBK2 and restoration of miR-217 exhibited the lowest tumor volume and the longest survival tumor-bearing nude mice. [score:3]
Fig. 2miR-217 expression in glioma tissues and cell lines: restoration of miR-217 restrained the malignant progression of glioma cells. [score:3]
Derlin-1, p-PI3K, p-AKT, p-ERK, and p-MEK1/2 expression levels were significantly restored in the miR-217+HNF1β (non-3′UTR) group than those in the miR-217+HNF1β group (Fig.   7d). [score:3]
These results demonstrated that miR-217 could target circ-TTBK2 in a sequence-specific manner, and there was a reciprocal repression process between circ-TTBK2 and miR-217. [score:3]
Furthermore, miR-217 targeted circ-TTBK2 in a sequence-specific manner, miR-217 and circ-TTBK2 formed a negative feedback loop possibly mediated by RNA -induced silencing complex (RISC). [score:3]
b qRT-PCR was conducted to detect expression levels of miR-217 in glioma tissues of different grades and NBTs (data are presented as the mean  + SD (n = 11, NBTs group; n = 19, each glioma tissue group). [score:3]
Our data showed that miR-217 targeted TTBK2-Wt1, this binding site was the same sequence as circ-TTBK2 harbored. [score:3]
In addition, pre-miR-217 did not change the linear TTBK2 expression. [score:3]
These findings indicated that miR-217 exerted tumor-suppressive function in glioma cells. [score:3]
miR-217+HNF1β-NC group) As previously reported, Derlin-1 exerted oncogenic function by activating PI3K/AKT and ERK pathways; we next examined the expression of proteins involved in these signaling pathways. [score:3]
miR-217+HNF1β-NC group) As previously reported, Derlin-1 exerted oncogenic function by activating PI3K/AKT and ERK pathways; we next examined the expression of proteins involved in these signaling pathways. [score:3]
More importantly, using bioinformatics softwares (Targetscan, miRanda, and RNAhybrid), a binding site was identified between miR-217 and HNF1β. [score:3]
This might partially explain why the expression of circ-TTBK2 and miR-217 were negatively correlated. [score:3]
The survival analysis demonstrated that in circ-TTBK2 inhibition, miR-217 reintroduction led to longer survival than the control group. [score:3]
MiR-217 was downregulated in glioma tissues and cell lines. [score:3]
Meanwhile, the expression of miR-217 was lower in U87 and U251 glioma cells than that in normal human astrocytes (Fig.   2c). [score:3]
d qRT-PCR analysis for miR-217 attenuated circ-TTBK2 expression in U87 and U251 cells (data are presented as the mean  + SD (n = 5, each group). [score:3]
a FISH was used to determine expression and location of miR-217 in glioma tissues and normal brain tissues (NBTs) (red, miR-217; blue, DAPI nuclear staining). [score:3]
Similarly, miR-217 was negatively correlated with malignant profiling and exerted tumor-suppressive function by restraining malignant biological behavior of human osteosarcoma cells [39]. [score:3]
Our data demonstrated that miR-217 expression was reduced in glioma tissues and cells. [score:3]
f Flow cytometry analysis of U87 and U251 cells with the expression of miR-217 changed (data are presented as the mean  + SD (n = 5, each group). [score:3]
j Quantification number of migration and invasion cells with the expression of circ-TTBK2 and miR-217 changed. [score:3]
c Expression levels of miR-217 in human normal astrocytes and glioma cell lines (data are presented as the mean  + SD (n = 5, each group). [score:3]
Due to the oncogenetic role of HNF1β in various tumors, and the putative binding site between miR-217 and HNF1β predicted with bioinformatics databases, we hypothesized that HNF1β might be involved in circ-TTBK2/miR-217 regulation network. [score:2]
MiR-217 functional targeted circ-TTBK2, but not TTBK2, and reversed the circ-TTBK2 -mediated promotion of glioma cell progression. [score:2]
Also, overexpressed miR-217 decreased migrating and invading cell numbers compared with that in the pre-NC group (Fig.   2e). [score:2]
Scale bars represent 40 μm) MiR-217 expression levels in glioma tissues and cells were analyzed by FISH and qRT-PCR. [score:2]
Restoration of miR-217 significantly inhibited glioma cell proliferation compared with the pre-NC group (Fig.   2d). [score:2]
c The schematic cartoon of the mechanism of circ-TTBK2 as an oncogene negative regulation of miR-217 in glioma cells By scanning TTBK2 genome and circBase, we found that circ-TTBK2 contained only exons and was generated from exon 3, exon 4, exon 5, and exon 6 from TTBK2 gene (Fig.   1d). [score:2]
These corroborated the hypothesis that HNF1β was involved in circ-TTBK2/miR-217 regulation network. [score:2]
While mRNA and protein expressions of HNF1β were significantly decreased in the pre-miR-217 group compared with those in the pre-NC group (Fig.   4f). [score:2]
d analysis of p-PI3K, PI3K, p-AKT, AKT, p-ERK, ERK, p-MEK1/2, and MEK1/2 regulated by miR-217 and HNF1β in U87 and U251 cells, they are shown using GAPDH as endogenous control (data are presented as the mean  + SD (n = 5, each group). [score:2]
Luciferase assay result confirmed that HNF1β was a target of miR-217. [score:2]
Further, circ-TTBK2 introduction combined with miR-217 inhibition led to an increased cell number compared with circ-TTBK2 (+)+miR-217 (+) (Fig.   3j). [score:2]
Moreover, glioma cells treated with miR-217+HNF1β (non-3′UTR) showed a lower apoptosis ratio than cells treated with miR-217+HNF1β (Fig.   7c). [score:1]
The luciferase activity in the HNF1β-Wt+miR-217 group was significantly attenuated than that in the HNF1β-Wt+miR-217-NC group, while the luciferase activity in the HNF1β-Mut+miR-217 group was not affected (Fig.   4b). [score:1]
We also found that circ-TTBK2, but not linear TTBK2, acted as miR-217 sponge in a sequence-specific manner. [score:1]
a The predicted miR-217 binding site in HNF1β (HNF1β-Wt) or and the designed mutant sequence (HNF1β-Mut) were indicated. [score:1]
a The predicted miR-217 binding site in circ-TTBK2 (circ-TTBK2-Wt) or and the designed mutant sequence (circ-TTBK2-Mut) were indicated. [score:1]
HNF1β-Wt+miR-217-NC group). [score:1]
The relative enrichment levels of circ-TTBK2 and miR-217 were both increased in the anti-Ago2 group than those in the anti-normal group. [score:1]
Given that Derlin-1 could be activated by HNF1β, and miR-217 modulated glioma cell progression via targeting 3′-UTR of HNF1β, we next sought to investigate whether Derlin-1 and the downstream pathways were involved in miR-217 -induced blunting effect on glioma cells. [score:1]
Moreover, miR-217 bound to circ-TTBK2 in a sequence -dependent manner and there was a reciprocal negative feedback between circ-TTBK2 and miR-217. [score:1]
circ-TTBK2 (+)+miR-217 (+) group; [#] P < 0.05 vs. [score:1]
The proliferation of glioma cells in the circ-TTBK2 (+)+miR-217 (−) group was significantly increased than that in the circ-TTBK2 (+)+miR-217 (+) group (Fig.   3i). [score:1]
We assumed that circ-TTBK2 might harbor a binding site of miR-217 using bioinformatics database (Starbase). [score:1]
For determination of circ-TTBK2 and miR-217, clinical specimens were divided into five group: NBTs (normal brain tissues) (n = 11), grade I (n = 19), grade II (n = 19), grade III (n = 19), and grade IV (n = 19). [score:1]
This demonstrated that the binding site between TTBK2 and miR-217 was not functional. [score:1]
miR-217+HNF1β-NC group. [score:1]
circ-TTBK2-Wt+miR-217-NC group). [score:1]
Bioinformatics database (Starbase) showed that a putative binding site exists between circ-TTBK2 and miR-217. [score:1]
Further, we found that there was a reciprocal negative feedback between circ-TTBK2 and miR-217. [score:1]
d The predicted two miR-217 binding sites in TTBK2 (TTBK2-Wt and TTBK2-Wt1) and the designed mutant sequences (TTBK2-Mut and TTBK2-Mut1) were indicated. [score:1]
In the anti-miR-217 group, the relative enrichment levels of circ-TTBK2 and miR-217 immunoprecipitated with Ago2 were lower than those in the control group, respectively (Fig.   3e–h). [score:1]
Moreover, reintroduction of miR-217 significantly reversed circ-TTBK2 -mediated promotion of glioma progression. [score:1]
The hybridization mix was prepared with circ-TTBK2 probe or miR-217 probe in hybridization solution. [score:1]
Restoration of miR-217 restrained glioma cells malignant progression. [score:1]
miR-217 (+) group; [▲] P < 0.05 vs. [score:1]
Proliferation of glioma cells in the miR-217+HNF1β (non-3′UTR) group was significantly restored than that in the miR-217+HNF1β group (Fig.   7a). [score:1]
These data provided a novel insight into the molecular mechanism of circ-TTBK2 and miR-217. [score:1]
The luciferase activity in the circ-TTBK2-Wt+miR-217 group was significantly decreased than that in the circ-TTBK2-Wt+miR-217-NC group (Fig.   3b), while the luciferase activity in the circ-TTBK2-Mut+miR-217 group was not changed. [score:1]
Circular RNAs circ-TTBK2 MicroRNAs miR-217 Glioma Human malignant gliomas are the most common and lethal primary brain tumor in adults [1, 2], and glioma cells are featured as carrying heterogeneous genetic molecular aberrations [3– 5]. [score:1]
circ-TTBK2 (−)+miR-217(−) group; [▲] P < 0.05 vs. [score:1]
P < 0.05 (miR-217 (+) or circ-TTBK2 (−) vs. [score:1]
miR-217+HNF1β group; [#] P < 0.05 vs. [score:1]
This indicated that circ-TTBK2 might sponge to miR-217 to modulate its function in glioma cell. [score:1]
Then, our results demonstrated that Derlin-1, p-PI3K, p-AKT, p-ERK, and p-MEK1/2 were distinctly restored when glioma cells were co -transfected with miR-217 and HNF1β (without 3′-UTR). [score:1]
Correlation between miR-217 and TTBK2. [score:1]
In the present study, we investigated the expression and functions of circ-TTBK2, miR-217, HNF1β, and Derlin-1 in glioma tissues and cells. [score:1]
Further, we measured miR-217 expression in the circ-TTBK2 (+) and circ-TTBK2 (−) groups by qRT-PCR. [score:1]
Furthermore, numbers of migrating and invading cells in the miR-217+HNF1β (non-3′UTR) group were increased versus those in the miR-217+HNF1β group (Fig.   7b). [score:1]
However, the function of miR-217 in glioma and circ-TTBK2/miR-217 functional network in modulating glioma malignant behavior remains unknown. [score:1]
Bioinformatics software (Starbase) revealed that circ-TTBK2 harbor a binding site of miR-217. [score:1]
For details, see Additional file 3. For identification of circ-TTBK2 and miR-217 rearrangement in glioma tissues, circ-TTBK2 probe (green-labeled, Biosense, Guangzhou, China) (5′ CAATCTTTCTCAATGGTCTGACGTCA 3′) and miR-217 probe (red-labeled, Exiqon, Copenhagen, Denmark) were used. [score:1]
miR-217+HNF1β-NC group). [score:1]
control group); P < 0.01 (circ-TTBK2 (−)+miR-217 (+) group vs. [score:1]
e– h miR-217 was identified in circ-TTBK2-RISC complex. [score:1]
MiR-217 overexpression promoted apoptosis of glioma cells compared with the pre-NC group (Fig.   2f). [score:1]
[1 to 20 of 130 sentences]
2
[+] score: 291
Other miRNAs from this paper: hsa-mir-152, hsa-mir-126, hsa-mir-185, hsa-mir-148b
We found that DNMT1 expression was significantly downregulated after transduction with an hsa-miR-217 lentivirus in young HSFs, while DNMT1 levels increased in old HSFs transduced with a lentivirus expressing an hsa-miR-217 inhibitors, as assessed by reverse-transcriptase quantitative PCR (RT-qPCR) and western blot analysis (Figure 2E–2H and Supplementary Figure 1). [score:10]
DNMT1 levels were upregulated after transducing HSFs with a lentivirus expressing an hsa-miR-217 inhibitors (n = 3, *p < 0.05). [score:8]
As mentioned above, miR-217 can influence Sirt1 expression, and Sirt1 inhibition can decrease p53 acetylation [32] and induce the expression of senescent -associated secretory phenotype (SASP) [33], indicating that miR-217 might induce senescence via a Sirt1 or SASP -mediated pathway. [score:7]
DNMT1 is a target of miR-217 and regulation of DNMT1 expression by miR-217 in HSFs. [score:6]
DNMT1 levels were significantly downregulated after transducing HSFs with a lentivirus expressing hsa-miR-217 (n = 3, *p < 0.05). [score:6]
The p16 and pRb mRNA and protein levels increased after miR-217 overexpression and decreased after miR-217 inhibition, compared with their expression levels in control cells. [score:6]
The results confirmed that miR-217 expression was significantly upregulated in skin tissues and HSFs from old individuals (Figure 6A, 6B). [score:6]
The DNMT1 shRNA lentivirus partially reversed DNMT1 upregulation caused by the miR-217 inhibitors (*p < 0.05). [score:6]
Moreover, the changes in p16 and pRb expression levels mediated by miR-217 were partially reversed by regulating DNMT1 expression (Figure 5C–5H). [score:6]
To determine whether miR-217 -dependent DNMT1 down-regulation could affect DNA methylation levels of the promoters of senescent -associated genes, we studied the effects of miR-217 expression on DNA methylation in the promoters of 24 senescent -associated genes, using microfluidic PCR and next-generation bisulfite sequencing (Supplementary Table 1). [score:6]
miR-217 expression was significantly upregulated in old-aged HSFs compared with that observed in young-aged HSFs (n = 10, *p < 0.05). [score:5]
Figure 4Abbreviations: c-i: control inhibitors; miR-i: miR-217 inhibitors; c-sh: control shRNA; DNMT1-sh: DNMT1 shRNA lentivirus; c-m: control mimics; miR-m: miR-217 mimics; con: control adenovirus; DNMT1: DNMT1 adenovirus. [score:5]
miR-217 expression was significantly upregulated in passage-aged HSFs, compared with that observed in young HSFs (n = 3, *p < 0.05). [score:5]
Abbreviations: c-i: control inhibitors; miR-i: miR-217 inhibitors; c-sh: control shRNA; DNMT1-sh: DNMT1 shRNA lentivirus; c-m: control mimics; miR-m: miR-217 mimics; con: control adenovirus; DNMT1: DNMT1 adenovirus. [score:5]
Two microliters of hsa-miR-217, hsa-miR-217 inhibitors, DNMT1-shRNA, a negative-control lentivirus, or a DNMT1 adenovirus (20 nM, GeneChem Company, China) were added to the culture medium, and the cells were incubated at 37°C for 48 h. HSFs and 293T cells were transfected with an miR-217 mimics, an miR-217 inhibitors, or a scrambled miRNA control at a final concentration of 20 mM using Lipofectamine (Thermo Scientific), according to the manufacturer's instructions. [score:5]
miR-217 consists of 23 nucleotides, is located in Chromosome 2, and has been demonstrated to function as a potential tumor suppressor in several types of carcinoma cells by targeting KRAS, WASF3, and Sirt1 mRNAs [23, 24]. [score:5]
The DNMT1 shRNA lentivirus partially reversed the decreased p16 or pRb expression levels caused by the miR-217 inhibitors (*p < 0.05). [score:5]
Collectively, these findings indicated that miR-217 promoted HSF senescence by suppressing DNMT1 expression. [score:5]
While searching for an upstream miRNA that could down-modulate DNMT1 expression, we found homology between miR-217 and a region in the 3′-UTR of human DNMT1 RNA, based on computational miRNA target analysis with miRNA databases (www. [score:5]
These data suggested that miR-217 induced a hypomethylation -dependent increase in p16 and pRb expression, likely due to its effect on DNMT1 translation, leading to HSF senescence. [score:5]
The DNMT1 shRNA lentivirus partially reversed the decreased p16 or pRb expression caused by the miR-217 inhibitors (*p < 0.05). [score:5]
Dachshund homolog 1, another known target gene of miR-217, can repress cyclin D1 expression to influence the cell cycle [34]. [score:5]
As DNMT1 was identified as an miR-217 target, we next sought to determine whether miR-217 could surpress DNMT1 expression in HSFs. [score:5]
miR-217 expression was significantly upregulated in old skin tissues compared with that observed in young skin tissues (n = 10, *p < 0.05). [score:5]
miR-217 suppresses DNMT1 expression during HSF senescence. [score:5]
PTEN can also be targeted by miR-217 to dysregulate PI3K/Akt/PTEN signaling -induced, oxidative -associated senescence [35, 36], implying miR-217 may influence HSF senescence by regulating the cell cycle or the PI3K/Akt/PTEN pathway. [score:5]
Figure 5Abbreviations: c-i: control inhibitors; miR-i: miR-217 inhibitors; c-sh: control shRNA; DNMT1-sh: DNMT1 shRNA lentivirus; c-m: control mimics; miR-m: miR-217 mimics; con: control adenovirus; DNMT1: DNMT1 adenovirus. [score:5]
Similar results were observed in HSFs transfected with an miR-217 inhibitors versus a control inhibitors (Figure 2C, 2D). [score:5]
To examine whether miR-217 induces senescence in HSFs through DNMT1, we increased or silenced DNMT1 expression in HSFs with overexpressed or down-modulated miR-217 (Figure 4A, 4B). [score:5]
Regulation of DNMT1 expression by miR-217 in HSFs. [score:4]
The DNMT1 adenovirus partially reversed DNMT1 downregulation caused by the miR-217 mimics (*p < 0.05). [score:4]
We found that DNMT1 knockdown could induce HSF senescence and that miR-217 can target the 3′-UTR sequence of DNMT1 and induce senescence in HSFs. [score:4]
MiR-217 promotes senescence by suppressing DNMT1 expression in HSFs. [score:4]
These results confirmed that miR-217 could directly target the 3′-UTR of DNMT1. [score:4]
To determine whether miR-217 directly targeted DNMT1, we generated a WT DNMT1 3′UTR luciferase reporter vector and a mutant (Mut) DNMT1 3′-UTR luciferase reporter vector. [score:4]
Finally, we demonstrated a negative correlation between miR-217 and DNMT1 expression during skin aging in vivo, implying that miR-217 -dependent regulation of DNMT1 may occur in vivo and contribute to the pathogenesis of skin aging. [score:4]
Moreover, the effect of miR-217 in promoting senescence was associated with decreased p16 and phosphorylated retinoblastoma (pRb) gene methylation levels, resulting from DNMT1 downregulation. [score:4]
In summary, our study showed that miR-217 plays an important role in the HSF senescence through a mechanism involving the regulation of p16 and pRb methylation levels via targeting DNMT1. [score:4]
Therefore, to investigate the expression of miR-217 and DNMT1 in vivo, we examined their expression levels in normal skin tissues and HSFs from skin tissues of patients of different ages who had undergone plastic surgery. [score:3]
The DNMT1 adenovirus did significantly inhibit the increased SA-β-gal -positive ratio caused by the miR-217 mimics (*p < 0.05; left panel). [score:3]
The DNMT1 adenovirus partially reversed the heightened p16 or pRb expression caused by the miR-217 mimics (*p < 0.05). [score:3]
This finding represents the first demonstration that DNMT1 is a target of miR-217. [score:3]
The DNMT1 adenovirus partially reversed the enhanced p16 or pRb expression caused by the miR-217 mimics (*p < 0.05). [score:3]
The DNMT1-shRNA lentivirus partially reversed the increased proliferation rate caused by the miR-217 inhibitors (n = 3 for each time point, *p < 0.05). [score:3]
Though bioinformatics analysis, we found that miR-217 potentially targets DNMT1 mRNA. [score:3]
The classical senescence markers (p16 and pRb) were chosen for further study, and we confirmed that miR-217 induced hypermethylation of the p16 and pRb promoters and influenced p16 and pRb expression though DNMT1. [score:3]
Next, we studied the miR-217 level in senescent HSFs and found that miR-217 was significantly upregulated in passage-aged HSFs, compared with those from the younger cohort (Figure 2B). [score:3]
Finally, we demonstrated an inverse correlation between DNMT1 and miR-217 expression in skin tissues and HSFs from patients of different ages, implying that miR-217 and DNMT1 contribute to the pathogenesis of skin aging. [score:3]
Taken together, our findings revealed that miR-217 improves senescence in HSFs by targeting DNMT1. [score:3]
Conversely, silencing DNMT1 partially reversed the decreased SA-β-gal activity and increased proliferation rate caused by miR-217 inhibition in passage-aged HSFs (Figure 4E, 4F). [score:3]
Figure 6miR-217 and DNMT1 expression in vivo (A) miR-217 levels were detected by RT-qPCR. [score:3]
The results showed an inverse correlation of the DNMT1 protein and miR-217 expression in HSFs passaged different numbers of times in culture (R [2] = 0.736, P < 0.05; Figure 2I). [score:3]
Based on the targeting relationship between miR-217 and DNMT1, we assessed the promoter-methylation levels of 24 senescence -associated genes using microfluidic PCR and next-generation bisulfite sequencing, finding 6 senescence -associated genes with altered promoter-methylation levels in HSFs. [score:3]
Transduction with the DNMT1 shRNA lentivirus partially reversed the decreased SA-β-gal -positive ratio caused by the miR-217 inhibitors (*p < 0.05; left panel). [score:3]
This study provides the first demonstration that miR-217 can induce senescence by targeting DNMT1 in relation to skin aging. [score:3]
miR-217 and DNMT1 expression in vivo. [score:3]
miR-217 and DNMT1 expression in skin tissues and HSFs collected from individuals of different ages. [score:3]
Though bioinformatics analysis and dual-luciferase reporter assays, we confirmed that DNMT1 could be targeted by miR-217. [score:2]
MiR-217 was identified as an endogenous inhibitors of Sirt1, which promoted endothelial cell senescence [25]. [score:2]
Regulation of cellular senescence in HSFs by miR-217. [score:2]
The cellular growth rate was significantly increased in passage-aged HSFs transduced with the hsa-miR-217 inhibitors lentivirus compared with the control lentivirus (n = 3 for each time point, *p < 0.05). [score:2]
The SA-β-gal -positive rate was obviously decreased in HSFs transduced with the hsa-miR-217 inhibitors lentivirus, compared with the control lentivirus (right panel). [score:2]
Conversely, in passage-aged HSFs, miR-217 inhibition significantly decreased the percentage of SA-β-gal -positive cells and increased the proliferation rate, compared with the control group (Figure 3C, 3D). [score:2]
In young HSFs, miR-217 overexpression increased the percentage of SA-β-gal -positive cells and decreased the cell proliferation rate, compared with that observed in the control group (Figure 3A, 3B). [score:2]
Adaptive regulation of miR-217 and DNMT1 merits further in vivo research in the field of skin aging. [score:2]
To date, there were not further study demonstrating an association between miR-217 and cellular senescence. [score:1]
Quantitative real-time PCR (qRT-PCR) was performed according to an miRNA protocol from Thermo Scientific using miR-217- or U6-specific primers (RiboBio Company, Guangzhou, China), inventoried real-time miRNA expression assays, and a RT-qPCR machine from Thermo Scientific. [score:1]
We found that DNMT1 could partially reverse both the miR-217 -mediated increase in SA-β-gal activity and decreased proliferation rate in young HSFs (Figure 4C, 4D). [score:1]
Our data indicated that the miR-217/DNMT1/p16/pRb axis contributed to HSF senescence. [score:1]
These findings raise the possibility that medical strategies aimed at protecting against the effects of miRNAs that promote skin aging, such as miR-217, could be effective in preventing aging. [score:1]
Figure 3 (A) HSFs senescence was detected by evaluating the number of SA-β-gal positive cells at 48 h post-transduction with a lentivirus expressing hsa-miR-217 in young HSFs (left panel). [score:1]
Thus, our results indicated that miR-217 could improve senescence in HSFs. [score:1]
The DNMT1 adenovirus could partially reverse the decreased proliferation rate caused by the miR-217 mimics (n = 3 at each time point, *p < 0.05). [score:1]
This finding is in agreement with previous data that miR-217 induces senescence in endothelial cells [25]. [score:1]
Role of miR-217 in modulating promoter methylation levels of senescent -associated genes in HSFs. [score:1]
However, the mechanisms whereby miR-217 induces HSF senescence by targeting DNMT1 have not been investigated. [score:1]
In contrast, a negative correlation was observed between miR-217 and DNMT1 levels in skin tissues (R [2] = 0.532, P < 0.05) and HSFs (R [2] = 0.700, P < 0.05) from individuals of different ages (Figure 6E, 6F). [score:1]
Only 6 detected genes had significantly alteration, and DNA-methylation analysis showed that miR-217 variation altered the promoter methylation levels of 6 senescence -associated genes (Figure 5A, 5B). [score:1]
miR-217 could induce senescence in HSFs. [score:1]
Role of miR-217 in modulating the promoter-methylation levels of p16 and pRb in HSFs. [score:1]
To determine the role of miR-217 in HSF senescence, we examined senescence-related indexes after modulating the miR-217 level. [score:1]
Each vector, along with 50 nM miR217, was transfected into HEK293 cells using the Lipofectamine 2000 reagent (Invitrogen), according to the manufacturer's instructions. [score:1]
Figure 2 (A) Bioinformatics analysis was used to predict an miR-217 -binding site in the 3′-UTR of DNMT1, as shown in the upper site. [score:1]
Moreover, we analyzed the correlation between miR-217 and DNMT1 levels in 10 couples of HSFs with differing passage numbers. [score:1]
We cotransfected HEK293T cells with an miR-217 mimics or a control mimics along with either reporter vector. [score:1]
[1 to 20 of 85 sentences]
3
[+] score: 205
The Silent Information Regulator 1 (SIRT1), a histone deacetylase known to be involved in stress-responsive pathways as inflammation [70, 71, 72], was a miR-217 target that did not show significant differential expression relative to uninfected cells 12 h post infection but presented a significant down-regulation at 24 h post infection (3.45 fold down-regulated), what reinforces that different target genes of the same miRNA have different dynamics of regulation. [score:15]
However, at later stages of infection, miR-217 expression was already closer to uninfected expression levels (up-regulated only 1.7 at 12 h post-infection), whereas miR-576-3p was still up-regulated 2.83 times in infected cells, indicating a slightly different kinetics for those miRNAs. [score:11]
To accomplish that, HuH-7 cells were transfected with non-human negative control miRNA inhibitor, miR-217 inhibitor, miR-576-3p inhibitor or both miRNA inhibitors and infected with OROV 3h post-transfection. [score:9]
We demonstrated that miR-217 and miR-576-3p were up-regulated during infection and that their cognate targets were down-regulated. [score:9]
Although not proved as a miRNA target yet, we included DCP2, the only selected miR-217 target already significantly down-regulated at 12 h post infection, because of its relevance as a restriction factor for other bunyavirus [73]. [score:8]
The kinetics of expression of miR-217 suggests an early induction during infection compared to miR-576-3p, since miR-217 was up-regulated 2.26 times as early as 3 h post-infection while miR-576-3p was only up-regulated 1.44 at the same point. [score:8]
0006508.g008 Fig 8HuH-7 cells were transfected with 75 nM negative control inhibitor, miR-217 inhibitor, miR-576-3p inhibitor or both. [score:7]
HuH-7 cells were transfected with 75 nM negative control inhibitor, miR-217 inhibitor, miR-576-3p inhibitor or both. [score:7]
Negative control inhibitor, miR-217 inhibitor and miR-576-3p inhibitor (Integrated DNA Technologies) were transfected at a final concentration of 75 nM using 2 μl of Lipofectamine 2000 (Thermo Fisher Scientific) per replica. [score:7]
In order to validate the miRNAs that were significantly deregulated in the array (miR-26a-1-3p and miR-576-3p) and to verify the expression of the miRNAs only detected in infected cells in the expression profile array (miR-217, miR-26a-2-3p and miR-92a-1-5p), we designed specific primers for each miRNA and checked its expression by RT-qPCR (Fig 3). [score:7]
To investigate possible pathways regulated by miR-217 and miR-576-3p during OROV infection, we performed target prediction using TargetScan, miRTarget2, PicTar, miRBase, TarBase and miRanda databases. [score:6]
As most of those miRNAs are previously annotated as star miRNAs (as example of miR-26a-1-3p previously annotated as miR-26a-1*) and some prediction database algorithms use proved interaction as criteria for prediction, we only selected miR-217 and miR-576-3p, both mature strand miRNAs, for further target prediction analysis (one detected only in infected cells and the other one up-regulated significantly upon infection in the array, respectively, and both validated). [score:6]
In order to evaluate if target regulation could present a higher effect in a later point of the infection, we selected two predicted and published targets for miR-217 and three for miR-576-3p to assess their expression 24 h post infection (Fig 6B). [score:6]
As it was demonstrated that apoptosis is regulated by OROV replication [67], we selected the Mitogen-Activated Protein Kinase 1 (MAPK1) for being a known miR-217 target that regulates apoptosis [68]. [score:5]
Nonetheless, the predicted target genes for miR-217 and miR-576-3p, DCP2 and STING, respectively, recovered to similar levels to non-infected cells in the presence of miRNA inhibitors 18 h post-infection (Fig 8B). [score:5]
Relative expression levels of selected target mRNAs predicted for miR-217 and miR-576-3p. [score:5]
Furthermore, the inhibition of miR-217 and miR-576-3p partially restricted viral replication, as demonstrated by a decreasing in both viral RNA and titer in the presence of miRNA inhibitors (Fig 8). [score:5]
Black columns represent predicted targets for miR-576-3p and gray columns represent predicted targets for miR-217, respectively. [score:5]
We further assessed the expression in a later point of infection (24 h) of three targets of miR-217 during OROV infection: DCP2, MAPK1 and SIRT1 (Fig 6B). [score:5]
Our validation experiments showed the same tendency of the miRNAs panel with an increasing expression of both miR-217 (Fig 3A) and miR-576-3p (Fig 3B) during infection, reaching a peak of expression at 6 h post-infection (about 5.5 fold increase for both miRNAs). [score:5]
Inhibition of miR-217 led to a 2.3 fold decrease in viral RNA replication, while inhibition of miR-576-3p led to a 7.7 fold decrease. [score:5]
Ontology enrichment analysis [56] was performed for the predicted targets of the differentially expressed miR-217 and miR-576-3p. [score:5]
Our results suggested that the down-regulation of DCP2 by miR-217 could explain OROV sustained replication. [score:4]
We demonstrated that miRNAs miR-217 and miR-576-3p, differentially expressed during infection, could be regulating crucial pathways, like innate immunity response, mainly in upstream proteins of interferon-β induction pathway (adaptor and kinase proteins, as well as transcription factors), protein shutoff and apoptosis. [score:4]
Cellular target genes regulated by miR-217 and miR-576-3p. [score:4]
Black columns represent miR-217 expression levels and gray columns represent miR-576-3p levels. [score:3]
The data suggest that both miR-217 and miR-576-3p could act synergistically to inhibit IFN-β antiviral response. [score:3]
Mean fold change of expression levels in OROV infected cells relative to uninfected cells for (A) miR-217 and (B) miR-576-3p. [score:3]
Inhibition of miR-217 and miR-576-3p affects OROV replication. [score:3]
Altogether, those data demonstrate that inhibition of miR-217 and miR-576-3p is a prospective approach to restrict OROV replication in HuH-7 cells. [score:3]
Enrichment pathway analysis of predicted targets for miR-217 and miR-576-3p. [score:3]
The miR-576-3p expression peaked at 6 h post-infection and presented a kinetic similar to miR-217 (Fig 3B). [score:3]
Finally, reduced viral titers confirmed the diminished replication, as a 3-fold decrease was observed in the same time point using miR-217 and miR-576-3p inhibitors (Fig 8D). [score:3]
Network depicting the relation among miR-217, miR-576-3p and 92 selected target mRNAs found in at least 3 out 6 databases. [score:3]
0006508.g005 Fig 5 Network depicting the relation among miR-217, miR-576-3p and 92 selected target mRNAs found in at least 3 out 6 databases. [score:3]
Inhibition of miR-217 and miR-576-3p impairs OROV replication. [score:3]
MiR-217 was already described in cancer cells involved in tumor migration suppression [75, 76]. [score:2]
com/science/article/pii/S0167488912000547 71 Deng S, Zhu S, Wang B, Li X, Liu Y, Qin Q, et al Chronic pancreatitis and pancreatic cancer demonstrate active epithelial-mesenchymal transition profile, regulated by miR-217-SIRT1 pathway. [score:2]
We predicted 195 cellular genes to interact with miR-217, miR-576-3p, or both, using that criterion (S2 Table). [score:1]
For the purpose of display in the heatmap, k-nearest neighbors method (k = 5) was performed to predict the missing values in uninfected cells for miR-217, miR-26a-2-3p and miR-92a-5p. [score:1]
For the purpose of display, missing values of uninfected cells for miR-217, miR-26a-2-3p and miR-92a-5p were predicted by k-nearest neighbors method and imputed after normalization as described in section. [score:1]
The induction of miR-26a-2-3p and miR-217 were inconsistent and observed only in three out of five infected replicas. [score:1]
We focused our analysis on miR-217 and miR-576-3p given the aforementioned reasons; nonetheless, we cannot exclude the possibility that the other miRNAs identified could be playing a role in OROV infection, as we could validated some of them (Fig 3C). [score:1]
[1 to 20 of 43 sentences]
4
[+] score: 189
The results showed that the expression of miR-217 was significantly downregulated and TNFSF11 was significantly upregulated with miR-217 inhibitor, and miR-217 was significantly upregulated and TNFSF11 was significantly downregulated with miR-217 mimics (Figures 5(a), 5(b), and 5(c)). [score:17]
In this study, firstly, we showed that the expression of miR-217 was consistent in the pathological renal tissues and plasma in MN; abnormal expression of renal tissue miR-217 possibly contributed to abnormal expression of plasma miR-217 (relative expression of fold change = −6.95 in renal tissue, relative expression of fold change = −4.12 in plasma, and absolute expression of fold change = −2.02 in plasma). [score:13]
A previous study showed that there were 20 upregulated and downregulated microRNAs with the highest fold changes in the peripheral blood from patients with MN, and miR-217 was most significantly downregulated, with more than 10-fold reduction in the peripheral blood [21]. [score:10]
Finally, in in vitro experiments, the upregulation of miR-217 could decrease the expression of TNFSF11 and not induce human podocyte cells apoptosis; however, the downregulation of miR-217 could bring about an opposite change. [score:9]
The results showed that the miR-217 regulated TNFSF11 in human podocyte cells; the upregulation of miR-217 could not induce human podocyte cells apoptosis; however, the downregulation of miR-217 could induce human podocyte cells apoptosis. [score:8]
The results showed that, compared with control patients, the expression of miR-217 was not statistically different in renal tissue and plasma from FSGS, was significantly upregulated in those from the DN (fold change = 4.27 in renal tissue, fold change = 3.25 in plasma), and was significantly downregulated in those from MN (fold change = −6.95 in renal tissue, fold change = −4.12 in plasma) (Figures 1(a)– 1(f)). [score:8]
The upregulation of miR-217 could not induce human podocyte cells apoptosis; however, the downregulation of miR-217 could induce human podocyte cells apoptosis (Figure 5(d)). [score:7]
Synthetic microRNAs were transfected into human podocyte cells to induce upregulation and downregulation of miR-217 with Lipofectamine 2000™ (Invitrogen, MA, USA), according to the manufacturer's protocol. [score:7]
Compared with control patients, miR-217 was significantly downregulated and TNFSF11 was significantly upregulated in MN. [score:6]
Databases of miRanda, TargetScan, and PicTar were used to predict the potential target genes of miR-217. [score:5]
The results showed that, compared with control patients, the absolute expression of plasma miR-217 was also significantly downregulated in MN (fold change = −2.02 in plasma) (Figure 2(b)). [score:5]
According to target gene prediction analysis, TNFSF11 had a putative binding site in the 3′UTR of miR-217 and might be the target gene of miR-217 (Figure 3(a)). [score:5]
The results showed that, compared with control patients, the absolute expression of plasma miR-217 was also significantly downregulated in MN (fold change = −2.02 in plasma). [score:5]
Whether miR-217 regulated the expression of TNFSF11 and whether this relation between miR-217 and TNFSF11 contributed to the pathological mechanism of MN remain unclear. [score:4]
Synthetic miR-217 mimics, miR-217 inhibitor, and the relative controls were transfected into human podocyte cells. [score:3]
In summary, our study identifies that miR-217 is a useful diagnostic biomarker and is involved in human podocyte cells apoptosis via targeting TNFSF11 in membranous nephropathy and provides a new diagnostic strategy for membranous nephropathy. [score:3]
The Relative Expression of miR-217 in Tissue and Plasma of Membranous Nephropathy. [score:3]
The relative expression of miR-217 was detected by the qRT-PCR method. [score:3]
The absolute expression of plasma miR-217 was enrolled in the ROC curve analysis. [score:3]
According to the absolute expression of plasma miR-217, plasma miR-217 reflected obvious separation between MN and control patients, with an AUC of 0.942 (95% confidence interval = 0.904 to 0.979), a cutoff value < 750 copies/ul, and sensitivity and specificity of 88.9% and 75.9%. [score:3]
miR-217 is a useful diagnostic biomarker and is involved in human podocyte cells apoptosis via targeting TNFSF11 in membranous nephropathy. [score:3]
In addition, miR-217 did not inhibit luciferase activity under 3′UTR of mutated (Mut) TNFSF11 (Figure 3(c)). [score:3]
The expression of miR-217 in pathological tissues is a useful diagnostic biomarker on MN and its possible pathological mechanism still remains unclear. [score:3]
Among those target genes, the gene of TNFSF11 had a binding site in the 3′UTR of miR-217. [score:3]
The results showed that miR-217 inhibited luciferase activity under 3′UTR of wild-type (WT) TNFSF11 (Figure 3(b)). [score:3]
The miR-217 inhibitor and mimics were transfected into human podocyte cells to investigate the pathological mechanism of miR-217 in this disease. [score:3]
In addition, the TNFSF11 was confirmed to be the target gene of miR-217. [score:3]
In order to verify this hypothesis, synthetic miR-217 mimics and miR-217 inhibitor were transfected into human podocyte cells. [score:3]
The absolute expression of miR-217 was detected by the qRT-PCR method. [score:3]
When the human podocyte cells grew to about 80% confluence, they were exposed to 100 nmol/L Angiotensin II (Sigma, Germany) for 24 h. Synthetic miR-217 mimics, miR-217 inhibitor, and the relative controls (empty vector) were purchased from BioVectra (Shanghai, China). [score:3]
Therefore, miR-217 is involved in human podocyte cells apoptosis via targeting TNFSF11 and contributed to the pathological mechanism of MN. [score:3]
Therefore, miR-217 possibly contributed to the pathological mechanism of MN via targeting TNFSF11. [score:3]
The Absolute Expression of miR-217 in Plasma of Membranous Nephropathy. [score:3]
TNFSF11 Was the Target Gene of miR-217. [score:3]
Expression miR-217 plasmid and TNFSF11 wild-type and mutated 3′UTR luciferase reporter were cotransfected into HEK293T cells. [score:3]
In this study, the dual-luciferase reporter assay confirmed that TNFSF11 was the target gene of miR-217. [score:2]
The expression of miR-217 was evaluated based on the threshold cycle (Ct) as n = 2 − ΔΔCt, where ΔCt = Ct related microRNA−Ct U6 and ΔΔCt =  ΔCt experimental−ΔCt control. [score:1]
The Effects of miR-217 on the Apoptosis in Human Podocyte Cells. [score:1]
Synthetic single-stranded RNA oligonucleotide miR-217 (miRBase release v. 19.0) was purchased from Shanghai GenePharma, China. [score:1]
In this study, for the first time, we demonstrated that absolute quantification of plasma miR-217 was able to be a useful diagnostic biomarker in MN, and we discussed the possible mechanism of miR-217 in MN and provided a new diagnostic strategy for MN. [score:1]
The dual-luciferase reporter assay method was used to further investigate whether miR-217 directly targeted TNFSF11. [score:1]
The results showed that plasma miR-217 reflected obvious separation between MN (n = 84) and control patients (n = 72), with an AUC of 0.942 (95% confidence interval = 0.904 to 0.979), a cutoff value < 750.0 copies/ul, and sensitivity and specificity of 88.9% and 75.9% (Figure 2(c)). [score:1]
Therefore, plasma miR-217 was a useful diagnostic biomarker in MN. [score:1]
Whether miR-217 in tissue was released in the peripheral blood in MN remains unclear. [score:1]
In this study, we investigated whether miR-217 is a useful diagnostic biomarker and the possible pathological mechanism of miR-217 in this disease. [score:1]
Therefore, in this study, we investigated the expression of miR-217 in pathological tissues and peripheral blood from MN and whether this microRNA is a diagnostic biomarker for MN. [score:1]
Then, miR-217 had obvious separation between patients with MN and control patients, with an AUC of 0.941, a cutoff value of <750.0 copies/ul, and sensitivity and specificity of 88.9% and 75.9%. [score:1]
The standard curves for miR-217 were plotted by Ct values versus copy number of the synthetic miRNAs. [score:1]
The Standard Curves for Absolute Quantification of Plasma miR-217. [score:1]
The standard curves of miR-217 were analyzed by Ct values and copy number of the synthetic microRNAs (Figure 2(a)). [score:1]
Therefore, in this study, we detected the absolute quantification of plasma miR-217. [score:1]
[1 to 20 of 51 sentences]
5
[+] score: 166
Other miRNAs from this paper: hsa-mir-494
We conclude that miR-217 appears to be a novel tumor suppressor in GC and that downregulated miR-217 may contribute to tumor development and progression in GC patients. [score:7]
When miR-217 inhibitor and shGPC5 were cotransfected into HGC-27 cells, miR-217 inhibitor promoted the shGPC5 -inhibited cell proliferation and invasion (Fig 5B and 5D). [score:7]
miR-217 posttranscriptional reduces GPC5 expression by directly targeting its 3’UTR. [score:6]
The expression of miR-217 is downregulated in GC cell lines. [score:6]
The expression of miR-217 in HGC-27 cells transfected with miR-217 mimics was up-regulated. [score:6]
Furthermore, qRT-PCR and western blot assay showed that overexpression of miR-217 inhibited GPC expression. [score:6]
Further experiments indicated that overexpression of miR-217 can suppress GC cell migration and invasion. [score:5]
The miR-217 mimic, mimic control (scramble), miR-217 inhibitor, inhibitor control, pEZ-GPC5 and control vector were purchased from RiboBio (Guangzhou, China). [score:5]
The expression of miR-217 was defined based on the threshold cycle (Ct), and relative expression levels were calculated as22 [-[(Ct of miR-217)-(Ct of U6)]] after normalization with reference to expression of U6 small nuclear RNA[20, 21] (S2 Table). [score:5]
Overexpression of miR-217 suppressed GC cell invasion and proliferation. [score:5]
The expression of miR-217was increased in transfected HGC-27 cells using miR-217 mimics (Fig 3A) and decreased using miR-217 inhibitor (Fig 3B). [score:5]
Further studies demonstrated that overexpression of miR-217 suppressed GC cell invasion and proliferation. [score:5]
Intriguingly, patients with lower expression of miR-217 tended to have more advanced TNM stage, suggesting that low expression ofmiR-217was associated with GC progression. [score:5]
In this study, miR-217 was frequently downregulated in GC. [score:4]
In this study, miR-217 was frequently downregulated in human GC cell lines and tissues and the lower level of miR-217 was associated with pTNM stage of GC. [score:4]
Downregulation of miR-217 is a frequent event in various cancers, suggesting its important role in tumorigenesis[17– 19]. [score:4]
Consistent with this result, the ability of miR-217 to regulate the expression of the GPC5 protein was verified by western blotting (Fig 4D). [score:4]
Ectopic of miR-217 reduced luciferase activity in the GPC5 wild-type reporter gene but not the mutant GPC5 3’UTR, indicating that miR-217 directly targeted the GPC5 3’UTR (Fig 4B). [score:4]
GPC5 was identified as a direct and functional target of miR-217. [score:4]
Low levels of miR-217 expression were associated with pTNM stage of patients. [score:3]
To confirm the direct regulation of GPC5 by miR-217, we used GPC 3’ UTR reporter vector bearing the potential miR-217 binding site in the fluorescent reporter. [score:3]
Li and his colleagues showed that miR-217 was down-regulated in clear cell renal cell carcinoma (ccRCC) compared to paired normal tissue[29]. [score:3]
Lower miR-217 expression level was associated with higher tumor grade and stage. [score:3]
0125474.g001 Fig 1. (A) The expression level of miR-217 in four human GC cell lines (SGC-7901, HGC-27, MGC-803, MKN-45) and GES-1 was quantified using. [score:3]
When miR-217 mimic and pEZ-GPC5 were cotransfected into HGC-27 cells, miR-217 expression reduced the GPC5 -induced GC cell proliferation and invasion (Fig 5A and 5C). [score:3]
Analysis using available algorithms indicated that GPC5 was a theoretical target gene of miR-217 (Fig 4A) [24]. [score:3]
MiR-217 is downregulated in GC tissues. [score:3]
miR-217 inhibits GC cell proliferation and invasion. [score:3]
The expression of miR-217 was normalized to U6 snRNA. [score:3]
The mRNA level of GPC5 was decreased after transfection with miR-217 mimics and increased after transfection with miR-217 inhibitor using qRT-PCR (Fig 4C). [score:3]
To prove that miR-217 directly targeted the GPC53’UTR, we performed luciferase reporter gene assays. [score:3]
Restoration of miR-217 inhibits GPC5 -mediated GC cell proliferation and invasion. [score:3]
Restoration of miR-217 inhibited GPC5 -mediated GC cell proliferation and invasion. [score:3]
In this study, the expression of miR-217 was decreased in GC cell lines and tissues. [score:3]
We firstly quantified the expression level of miR-217 in four human GC cell lines (SGC-7901, HGC-27, MGC-803, MKN-45) and GES-1 using northern blot (Fig 1A). [score:3]
The expression level of miR-217 wasdecreased in GC cell lines compared with GES-1. QuantitativeRT-PCR also showed that the expression of miR-217 was decreased in GC cell lines (SGC-7901, HGC-27, MGC-803, MKN-45) compared with GES-1, a normal gastric epithelial cell line(Fig 1B). [score:3]
The expression of miR-217 was lower in GC tissues than in adjacent noncancerous tissues (Fig 2C). [score:3]
Quantitative RT-PCR was used to examine miR-217 expression in 50 GC tissues and their paired adjacent noncancerous tissues. [score:3]
Moreover, lower levels of miR-217 expression associated with the pTNM stage of GC patients (Fig 2D). [score:3]
To investigate the molecular mechanism of the tumor suppressor role of miR-217 in GC, we used luciferase reporter assay and western blot to confirm that GPC5 was a target of miR-217 in GC cells. [score:2]
Among 50 tumor tissues, 44 cases exhibited decreased miR-217 expression compared with the adjacent normal tissues (88%, 44 of 50, Fig 2B). [score:2]
The invasiveness of cells transfected with miR-217 mimics was decreased compared with the scramble group or control group cells and miR-217 inhibitor increased cell invasion compared with the scramble group or control group cells (Fig 3E). [score:1]
The association between miR-217 and GPC5 was analyzed using Spearman’s correlation test. [score:1]
0125474.g003 Fig 3. (A) Real-time RT-PCR analysis of miR-217 in HGC-27 cells upon transfection ofmiR-217 mimic. [score:1]
However, little is known about the potential role of miR-217 in GC. [score:1]
0125474.g004 Fig 4. (A) The 3'-UTR of GPC5 mRNA contains the binding sequences of miR-217. [score:1]
[1 to 20 of 46 sentences]
6
[+] score: 96
Our in silico analysis revealed that miR-216 and miR-217 potentially target many important genes that play critical roles during the pathogenesis of PC (Table 1); and the downregulation of miR-217 [45] and miR-216 [44] suggests their potential as tumor suppressors in PC by targeting downstream targets, particularly the Kras oncogene [43] and Janus kinase 2 [44]. [score:12]
At 30 weeks of age, the expression of miR-216 (p-value = 0.016), miR-217 (p-value = 0.0078), miR-150 (p-value =0.023), Let-7b (p-value = 0.031,) and miR-96 were significantly downregulated, whereas the expression of miR-146b (p-value = 0.0078), miR-205, (p-value - 0.0078), miR-21, miR-195 (p-value = 0.031), and miR-34c (p-value = 0.063) were significantly upregulated in KC animals compared to control animals (Figure 2B). [score:10]
The expression of miR-223, miR-483-3p (p-value = 0.01), 146b, 205 (p-value = 0.001), 221, 21 (p-value = 0.023), 195, 34c and miR-26a (p-value = 0.0078) were significantly upregulated, whereas the expression of miR-216, miR-141, miR-217, Let-7b (p-value = 0.001), and Let-150 (p-value = 0.01) were significantly downregulated in human PC tissues as compared to the cancer-adjacent normal tissues (Figure 3E). [score:10]
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
In addition to KC mice, we also observed a significant downregulation of miR-216 and miR-217 in human PC tissue (Figure 3E); these results are in agreement with earlier studies on human PC [38– 43] that show downregulation of miR-217 in 76.2% (16/21) of PC tissue as well as cell lines [43]. [score:7]
The panel of differentially expressed miRNAs were validated by real-time PCR using TaqMan assays, and the results were consistent with the data that showed up-regulation of miR-21, miR-221, miR-100 and miR-26a and down-regulation of miR-26b, miR-141, miR-96, miR483-3p, miR-216, and miR-217 in the KC compared to control mice (Figure 1A). [score:7]
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
Further, at 50 weeks of age, the expression of miR-216, miR-217, miR-345, miR-141, miR-483-3p, miR-26b, miR-96, Let-7b (p-value = 0.01), miR-100, miR-26a and miR-150 (p-value = 0.094) were further downregulated in KC animals compared to control mice (Figure 2D). [score:5]
Several studies have shown the abnormal expression of miRNAs including miR-21, Let-7b, miR-100, miR-217, and miR-216 in PC and have proposed them as candidates for early diagnosis and potential molecular targets [23, 24]. [score:5]
Both miR-216 and miR-217 act as potential tumor suppressors for PC by targeting the Kras oncogene [43]. [score:5]
The expression of pancreas-specific tumor suppressors miR-217 and miR-216 were unaltered at 10 weeks of age (presence of PanIN-Ia and Ib), but progressively decreased from 25 – 50 weeks of age as PanIN lesions progressed to PDAC. [score:5]
The expressions of miR-216 and miR-217 were also progressively reduced in KC mice, but the expressions of miR-21, miR-205, miR-146b, miR-34c, and miR-223 progressively increased (Figure 1A, 2A– 2D). [score:5]
However, no significant difference was observed in the expression of pancreas-specific miR-217 (Figure 2A). [score:3]
[1 to 20 of 14 sentences]
7
[+] score: 88
An miR-217 mimic, an miR-217 inhibitor, an miRNA negative control mimic (con mimic), an miRNA negative control inhibitor (con inhibitor), a circRNA_10084 siRNA and a control siRNA were synthesized by RiBoBio (Guangzhou, China). [score:7]
Overexpression of miR-217 attenuated the upregulation of EZH2 and cyclin-D1 induced by exosomes derived from arsenite-transformed L-02 cells (Figs.   5b,c). [score:6]
Moreover, exosomes derived from cells transfected with circRNA_100284 siRNA inhibited proliferation of normal L-02 cells at multiple time points (24, 48, 72, and 96 h), but this effect was reversed by an miR-217 inhibitor (Fig.   5g). [score:5]
An miR-217 inhibitor reversed the effects, including the decreased levels of EZH2 and cyclin-D1, and inhibited the cell cycle and proliferation caused by exosomes from arsenite-transformed L-02 cells transfected with circRNA_100284 siRNA. [score:5]
After normal L-02 cells were transfected with control inhibitor or miR-217 inhibitor for 24 h, they were treated with T-CM-exo, circRNA_100284-T-CM-exo, or con siRNA-T-CM-exo for 24 h. d were performed, and relative protein levels (means ± SD, n = 3) of EZH2 and cyclin-D1 were determined. [score:5]
L-02 cells were treated with culture medium or exosomes isolated from arsenite-transformed L-02 cells that were transfected with circRNA_100284 siRNA or control siRNA, and an miR-217 inhibitor or control inhibitor for 24 h, and the cells were harvested after 24 h. After washing twice with cold PBS, cells were fixed with 75% ethanol at 4 °C overnight and again washed twice with cold PBS. [score:5]
In addition, flow cytometry showed that the inhibited G1/S transition induced in normal L-02 cells by exosomes from arsenite-transformed L-02 cells transfected with circRNA_100284 siRNA was also restored by an miR-217 inhibitor (Figs.   5e,f). [score:5]
Zhang M miR-217 suppresses proliferation, migration, and invasion promoting apoptosis via targeting MTDH in hepatocellular carcinomaOncol. [score:5]
We previously reported that, for arsenite-transformed HaCat cells, circRNA_100284 regulates the cell cycle by acting as a sponge of miR-217 [15], a tumor suppressor that regulates cell proliferation in various cancers, including HCCs [51]. [score:5]
The present results showed that overexpression of miR-217 in normal cells reduced the increased levels of EZH2 and cyclin-D1 induced by exosomes from arsenite-transformed L-02 cells. [score:3]
Wang X Silencing of long noncoding RNA MALAT1 by miR-101 and miR-217 inhibits proliferation, migration, and invasion of esophageal squamous cell carcinoma cellsJ. [score:3]
In cancers, miR-217 targets EZH2 (refs. [score:3]
miR-217 inhibits cell proliferation through inducing arrest in the G2/M phase of the cell cycle [52]. [score:3]
Lu L Posttranscriptional silencing of the lncRNA MALAT1 by miR-217 inhibits the epithelial-mesenchymal transition via enhancer of zeste homolog 2 in the malignant transformation of HBE cells induced by cigarette smoke extractToxicol. [score:3]
Next, normal L-02 cells were transfected with a control or an miR-217 inhibitor and then exposed to exosomes derived from arsenite-transformed L-02 cells transfected with or without circRNA_100284 siRNA. [score:3]
Western blot analyses revealed that the miR-217 inhibitor reversed the effects of exosomes from arsenite-transformed L-02 cells transfected with circRNA_100284 siRNA on the levels of EZH2 and cyclin-D1 in normal L-02 cells (Fig.   5d). [score:3]
circRNA_100284 was contained in exosomes released by transformed cells and could be transferred into normal cells, and exosomal circRNA_100284 regulated the cell cycle and stimulated cell proliferation of normal liver cells by interacting with miRNA-217 (miR-217). [score:2]
Xue J Circ100284, via miR-217 regulation of EZH2, is involved in the arsenite-accelerated cell cycle of human keratinocytes in carcinogenesisBiochim. [score:2]
These results show that exosomal circRNA_100284 regulates the cell cycle and cell proliferation via miR-217. [score:2]
However, the mechanism for regulation of EZH2 by miR-217 in L-02 cells and how it affects malignant transformation remain to be determined. [score:2]
Since, in a previous study, we found that, in HaCaT cells, circRNA_100284 is involved in the arsenite-promoted cell cycle via miR-217 [15], we predicted that the pathway was also involved in the abnormal cell cycle of L-02 cells induced by exosomes from arsenite-transformed L-02 cells. [score:1]
Binding sites between circRNA_100284 and miR-217 (Fig.   5a) were analyzed by the bioinformatics methods, circBase (http://circrna. [score:1]
Normal L-02 cells were transfected with a control or an miR-217 mimic and then exposed to exosomes derived from arsenite-transformed L-02 cells. [score:1]
a A schematic graph illustrating binding sites between circRNA_100284 and miR-217. [score:1]
In normal cells, exosomal circRNA_100284 induced an accelerated cell cycle and promoted proliferation via acting with miR-217 (Fig.   8). [score:1]
circRNA_100284 from arsenite-transformed cells transferred into normal L-02 cells via exosomes induce acceleration of the cell cycle and promotes proliferation via miR-217 Chronic exposure to arsenite elevates circRNA_100284 levels, which is involved in the malignant transformation of normal L-02 cells. [score:1]
Exosomal circRNA_100284 derived from arsenite-transformed L-02 cells induces acceleration of the cell cycle and promotes proliferation via miR-217 in normal L-02 cells. [score:1]
After normal L-02 cells were transfected with control mimic or miR-217 mimic for 24 h, they were treated with CM-exo or T-CM-exo for 24 h. b were performed, and c relative protein levels (means ± SD, n = 3) of EZH2 and cyclin-D1 were determined. [score:1]
circRNA_100284 from arsenite-transformed cells transferred into normal L-02 cells via exosomes induce acceleration of the cell cycle and promotes proliferation via miR-217 SUPPLEMENTAL MATERIAL We thank Donald L. Hill (University of Alabama at Birmingham, USA), an experienced, English-speaking scientific editor for editing. [score:1]
Exosomal circRNA_100284 derived from arsenite-transformed L-02 cells induces the acceleration of the cell cycle and promoted proliferation via miR-217 in normal L-02 cells. [score:1]
To conclude, in normal liver cells, exosomal cicrRNA_100284 accelerates the cell cycle and promotes cell proliferation via miR-217. [score:1]
[1 to 20 of 31 sentences]
8
[+] score: 53
Previous studies have also demonstrated that increased expression of hsa-miR-217 is associated with suppression of Ras/MAPK and PI3K-AKT [21, 22], indicating that these pathways may be up-regulated by the suppressed expression of this miRNA. [score:12]
Both hsa-miR-217 and hsa-miR-125b, are associated with the regulation of the expression of the CDKN2 locus which has a proven regulatory role in biological ageing and renal function post-transplant [5, 6, 7]. [score:5]
The incidence of DGF was associated with higher donor age (p<0.001), increased CDKN2a/p16 expression (p = 0.01) and decreased expression of hsa-miR-217 (p<0.0001) and hsa-miR-125b (p = 0.035) in allografts showing DGF post-transplant compared to these without the occurrence of DGF (Fig 1). [score:4]
Two miRNAs, hsa-mir-217 and hsa-mir-125b, involved in cellular stress and damages responses are of particular interest in this context, as they help regulate biological ageing processes common across taxa and as mediators of CDKN2 loci transcript expression. [score:4]
When DGF-related microRNAs were analysed for their correlation with renal allograft function at post-operative day 3 (POD3), post-operative day 5 (POD5) and post-operative day 7 (POD7), the expression of hsa-miR-125b was positively correlated with MDRD4 at all time-points while hsa-miR-217 was associated with renal function on POD5 and POD7 (Table 3). [score:3]
Delayed graft function is related to donor age, CDKN2A/p16 and the expression of hsa-miR-217 and hsa-miR-125b. [score:3]
Differential expression between good and poor performers (minimum of two-fold difference) was observed for hsa-miR-505, hsa-miR-34a, hsa-miR-1275, hsa-miR-125a-5p, hsa-miR-449a, hsa-miR-155, hsa-miR-101#, hsa-miR-375, hsa-miR-96, hsa-miR-217 and hsa-miR-125b. [score:3]
Interestingly, a negative correlation between hsa-miR-217 and CDKN2A/p16 expression was also noted (cc = -0.392, p = 0.001). [score:3]
hsa-miR-217 (002337) and hsa-miR-125b (000449) expression was normalised against the following endogenous controls: RNU44 (001094), RNU48 (001006) and U6snoRNA (001973) for each sample. [score:3]
The expression of hsa-miR-217 was positively correlated with MDRD4 at 12 months (cc = 0.300, p = 0.007; Table 2) 10.1371/journal. [score:3]
This was applied to analyses for hsa-mir-217 and hsa-mir-125b expression levels relative to clinical parameters, to determine their predictive ability for individual performance criteria in the primary allograft cohort (n = 94). [score:3]
The expression of hsa-miR-217 was positively correlated with MDRD4 at 12 months (cc = 0.300, p = 0.007; Table 2) 10.1371/journal. [score:3]
In particular, hsa-miR-125b and hsa-miR-217 are involved in the regulation of a broad range of cellular/biological processes that intersect on the MAPK signalling and the PI3K-AKT pathways. [score:2]
Further analysis of the CDKN2 locus revealed that hsa-miR-217 is positively correlated with ANRIL (CDKN2B-AS1, cc = 0.289, p = 0.029). [score:1]
In this instance, we have demonstrated that the levels of two such rapid response elements (hsa-miR-217 and hsa-miR-125b) are significantly altered in organs which experience DGF post-transplantation Our data provides clear evidence that pre-transplant analysis of miRNA related to cellular bio-ageing, cell stress and damage responses is useful in determining post-transplant function of renal allografts. [score:1]
[1 to 20 of 15 sentences]
9
[+] score: 43
Up-regulation of miR-217 could decrease the expression of KRAS protein, thereby inhibiting tumour cell growth [39]. [score:8]
To further determine that the up-regulation of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p was specific response to T. gondii infection, we compared the expression of these three miRNAs in mice infected with T. gondii to mice infected with P. berghei, P. yoelii, P. chabaudi, C. parvum, MHV, or S. aureus. [score:5]
The levels of the three miRNAs, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p miRNAs, were found specifically up-regulated in plasma of mice after T. gondii infection. [score:4]
We report the evidence that three miRNAs, including mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p, are significantly up-regulated in the plasma of mice after T. gondii infection, which may lead to the discovery of novel biomarkers for T. gondii infection. [score:4]
Another over-expressed miRNA from the plasma of mice with T. gondii infection is mmu-miR-217-5p, which is known to be encoded by a gene located on chromosome 11. [score:3]
Figure 3 ROC curve analysis of the expression of plasma levels of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p. [score:3]
Previous studies indicated that miR-217 may act as a tumour suppressor, as suggested from a study on renal cell carcinoma and pancreatic ductal adenocarcinoma [38, 39]. [score:3]
Three of those miRNAs (mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p) were prominently expressed in mice infected by both the RH and ME49 strains of T. gondii. [score:3]
The expression of the three miRNAs mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p were further assessed in a large number of mice infected with either RH or ME49 strain of T. gondii. [score:3]
The elevated expression of miRNAs was specific to T. gondiiinfectionWe further investigated if the three elevated circulating miRNAs in plasma, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p, were host specific responses to T. gondii infection. [score:1]
Quantitative analysis of these miRNAs in a large set of plasma samples from mice showed that mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p were potentially useful for early stage diagnosis, with a satisfactory degree of sensitivity and specificity. [score:1]
Of these miRNAs, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p were detected with the highest abundance (the average Ct values were 17.43, 27.45 and 26.08, respectively). [score:1]
We focused on the analysis of three miRNAs, mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p, which were detected abundantly in mice infected with the RH (Type I) and ME49 (Type II) strains of T. gondii. [score:1]
Scatter plots of plasma levels of mmu-miR-712-3p (A), mmu-miR-511-5p (B), and mmu-miR-217-5p (C) in mice infected with RH and ME49 strains of T. gondii (n = 20 each) and in healthy subjects (n = 20). [score:1]
Thus, the data collectively suggest that the elevated responses of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p in T. gondii infected mice were parasite-specific. [score:1]
Figure 2 Validation of mmu-miR-712-3p, mmu-miR-511-5p and mmu-miR-217-5p in plasma samples (n = 60). [score:1]
[1 to 20 of 16 sentences]
10
[+] score: 35
Recent data suggests that miR-217 is an oncogene that is overexpressed in aggressive human B cell lymphomas [30] and contradictarorily functions as a potential tumor suppressor in hepatocellular carcinoma through direct suppression of E2F3 [31]. [score:8]
RT-PCR validated three significantly upregulated miRNAs and three significantly downregulated miRNAs namely miR-217, miR-216a, miR-216b, miR-146a, miR-509-3p and miR-211. [score:7]
Further studies are needed to determine whether higher expression of miR-217 in intraocular medulloepithelioma represents an oncogenic effect or the dysregulation functions as a potential tumor suppressor that might explain its low metastatic potential. [score:6]
For validation using RT-PCR, we chose three miRNAs (miR-217, miR-216a, and miR-216b) that were upregulated and three miRNAs (miR-146a, miR-509-3p, miR-211) that were downregulated by at least 6 standard deviations in tumor compared to control arrays. [score:6]
On the other hand, levels of miR-217 are downregulated in pancreatic intraepithelial neoplasm and pancreatic ductal adenocarcinomas [32] and in clear cell renal carcinomas [33]. [score:4]
As for miR-217, there is no specific pathway identified linked to this microRNA, but is indirectly associated with cancer and pancreatitis. [score:2]
In this discussion we will focus on a few of the MiR-217 was highly overexpressed in medulloepitheliomas. [score:2]
[1 to 20 of 7 sentences]
11
[+] score: 34
Further, the upregulation of miR-217 and inflammatory cytokines in Kupffer cells of mice on administration of ethanol reduces SIRT1, and increases NF-κB expression. [score:6]
Xi and colleagues (2015) [69] elegantly demonstrated that miR-217 is downregulated and that its target gene, kallikrein 7 (KLK7), increases in esophageal adenocarcinoma cell lines and esophageal tumors that have been exposed to cigarette smoke condensate (CSC). [score:6]
Notably, the reduction in miR-217 expression and the upregulation of KLK7 effected greater methylation levels in patients with a history of smoking compared which those who had never smoked [69]. [score:5]
Downregulation of miR-217 increases MALAT1 levels to induce EZH2/histone H3 lysine 27 trimethylation (H3K27ME3), and this pathway modifies the EMT and causes malignant transformation in HBE cells [110]. [score:4]
Lu L. Luo F. Liu Y. Liu X. Shi L. Lu X. Liu Q. Posttranscriptional silencing of the lncRNA MALAT1 by miR-217 inhibits the epithelial-mesenchymal transition via enhancer of zeste homolog 2 in the malignant transformation of HBE cells induced by cigarette smoke extract Toxicol. [score:3]
Thus, the inhibition of hepatic miR-217 is an interesting approach toward mitigating the inflammatory response in alcoholic steatosis [105]. [score:3]
Further, the suppression of miRNA in the cell mo del and esophageal tumor samples correlated with hypermethylation of CpG islands in the coding region of miR-217. [score:3]
Yin H. Liang X. Jogasuria A. Davidson N. O. You M. miR-217 regulates ethanol -induced hepatic inflammation by disrupting sirtuin 1-lipin-1 signaling Am. [score:2]
Similarly, MALAT1 participates in the CSE -induced EMT in HBE cells and is regulated by miR-217. [score:2]
[1 to 20 of 9 sentences]
12
[+] score: 29
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
MiR-217 was up-regulated by TGF-β and was able to activate Akt through the down-regulation of PTEN to increase glomerular mesangial cell survival and hypertrophy [52]. [score:6]
Ssc-miR-216 and ssc-miR-217 were also located in the same genome loci in chromosome 3. Overexpression of has-miR-216a/217 activates the PI3K/Akt and TGF-β signaling pathways by targeting PTEN and SMAD7 in human hepatocellular carcinoma cells [54]. [score:5]
Ssc-miR-182, ssc-miR-187, ssc-miR-136, ssc-miR-210, ssc-miR-217 and ssc-miR-10b participate in regulation Neurotrophin signaling pathway by targeting corresponding genes, including BNDF, SHC4, KRAS and FOXO3. [score:4]
NR4A2 was also targeted by has-miR-302d and has-miR-371, which indicates that miR-217 has some regulatory functions in common with other pluripotency -associated miRNAs in hESCs [53]. [score:4]
We also assessed another three selected miRNAs, ssc-miR-136, ssc-miR-217 and ssc-miR-182, which were found to be more highly expressed in mpiPSCs (Fig 3C). [score:3]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
However, miR-217 was found to target NR4A2 in hESCs to block differentiation. [score:3]
Interestingly, the mpiPSCs were characterized by high expression of miR-217. [score:1]
[1 to 20 of 8 sentences]
13
[+] score: 27
When we compared the mRNA and miRNA profiles, differentially regulated in PKD, with Argonaute (a comprehensive database on miRNAs; [45, 71]), there were few genes reported as miRNA target like tropomyosin 1, alpha (TPM1) as a target of miR-21, the beta polypeptide of tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (YWHAB), regulatory subunit 9B of protein phosphatase 1 (PPP1R9B), early growth response 3 (EGR3) and dynamin 1-like (DNM1L) as targets of miR-31, plysia ras-related homolog A2 (RHOA) as targets of miR-217, etc. [score:10]
miRNA Target Genes Pathways miR-128 ABCB9, BTG1, DSCR1, RASD1 ABC transporters General miR-136 GRN, PPP1R9B miR-147 HOXA1, PTGFRN miR-148 EGR3, SCN3A miR-181b IGF1R, NKX6-1 Adherens junction, Maturity onset diabetes of the, Focal adhesion, **Long term depression miR-196a ABCB9, CPB2, IRS1, MAPK10 ABC transporters General, Complement and coagulation cas, Adipocytokine signaling pathwa, Insulin signaling pathway, Type II diabetes mellitus, Fc epsilon RI signaling pathwa, Focal adhesion, **GnRH signaling pathway, **MAPK signaling pathway, Toll like receptor signaling p, Wnt signaling pathway miR-203 SARA1 miR-20 BTG1, SARA1, YWHAB Cell cycle miR-21 TPM1 mir-216 GNAZ **Long term depression miR-217 RHOA Adherens junction, Axon guidance, Focal adhesion, Leukocyte transendothelial mig, Regulation of actin cytoskelet, TGF beta signaling pathway, T cell receptor signaling path, Tight junction, Wnt signaling pathway miR-31 ATP2B2, DNM1L, EGR3, PPP1R9B, YWHAB **Calcium signaling pathway, Cell cycle miR-7 SLC23A2 miR-7b HRH3, NCDN, SLC23A2 **Neuroactive ligand receptor in b: miRNAs and their targets (from TargetScan and miRanda). [score:8]
We predict that several of the differentially regulated genes are miRNA targets and miR-21, miR-31, miR-128, miR-147 and miR-217 may be the important players in such interaction. [score:4]
Interestingly, the expressions of miR-31 and miR-217 have not been previously reported in kidney. [score:3]
Furthermore, we describe some newly detected miRNAs, miR-31 and miR-217, in the kidney which have not been reported previously. [score:1]
It is interesting to note that miR-31 and miR-217 have not been previously reported in kidney. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Additionally, lipin-1, a phosphatidic acid phosphohydrolase, which converts phosphatic acid into diacyl glycerol was also found to be down-regulated by miR-217 [76]. [score:4]
Chronic alcohol feeding of mice showed upregulation of miR-33, miR-34a, and miR-217 in the liver and these microRNAs were also elevated in ethanol-exposed mouse AML-12 hepatocytes. [score:4]
Ethanol treatment decreased the expression of SIRT1 and a similar decrease in SIRT1 was observed in hepatocytes transfected with miR-217 mimic [74]. [score:3]
Further, SIRT1 was identified as a target gene for miR-217 in the liver. [score:3]
This represents a second SIRT1 -targeting microRNA that is elevated with ethanol feeding in rodents (miR-34a and miR-217). [score:3]
Alcohol dehydrogenase, but not aldehyde dehydrogenase was found to be critical for the increased expression of miR-217. [score:3]
Yin H. Hu M. Zhang R. Shen Z. Flatow L. You M. microRNA-217 promotes ethanol -induced fat accumulation in hepatocytes by down -regulating sirt1 J. Biol. [score:2]
Yin H. Liang X. Jogasuria A. Davidson N. O. You M. miR-217 regulates ethanol -induced hepatic inflammation by disrupting sirtuin 1-lipin-1 signaling Am. [score:2]
Ethanol treatment of miR-217 -transfected hepatocytes exacerbated the decrease in the levels of SIRT1 protein [74, 75]. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 25
As demonstrated, miR-217 expression was negatively regulated by circ-TTBK2 expression in an AGO2 -dependent manner and there was a reciprocal repression feedback loop between circ-TTBK2 and miR-217 [121]. [score:6]
By sequestering miR-217 activity, circ-TTBK2 enabled higher expression of oncogenic proteins HNF1 β and Derlin-1, which promoted cell proliferation, migration, and invasion, while inhibiting apoptosis of glioma cells [121]. [score:5]
CircRNA circ-TTBK2 was significantly upregulated in glioma tissues and cell lines and acted as a miR-217 sponge. [score:4]
In addition, circ-TTBK2 knockdown in combination with miR-217 overexpression led to tumor regression in vivo [121]. [score:4]
miR-217 is a tumor-suppressive miRNA, associated with various cancer types, including epithelial ovarian cancer [119] and gastric cancer [120]. [score:3]
In glioma, miR-217 negatively correlated with the pathological grades of tumors and exerted tumor-suppressive activity in glioma cells [121]. [score:3]
[1 to 20 of 6 sentences]
16
[+] score: 25
KRAS was identified as a direct target of miR-217 and, concordantly, up-regulation of miR-217 decreased KRAS protein expression and subsequently reduced the constitutive phosphorylation of downstream Akt. [score:9]
[52] miR-217 PDCA KRASXenograft tumors of PDAC cells were directly injected with miR217 -expressing plasmids or a control vector using in vivo-jet PEI. [score:4]
To confirm the function of miR-217 in vivo, xenograft tumors of PDAC cells were directly injected with miR217 -expressing plasmids or a control vector using in vivo-jet PEI (Polyplus Transfection, Illkirch, France). [score:4]
Therefore, miR-217 may serve as a therapeutic target for miRNA -based PDAC therapy [53]. [score:3]
They investigated the biological role of miR-217 in PDAC cells in vitro and in vivo since miR-217 is frequently down-regulated in pancreatic ductal adenocarcinoma (PDCA) [59, 60]. [score:2]
The results from these assays indicated that miR-217 suppresses tumor cell growth in vivo. [score:2]
miR-217 in pancreatic cancer cells. [score:1]
[1 to 20 of 7 sentences]
17
[+] score: 24
Our data showed that ectopic expression of miR-217 significantly inhibited cancer cell aggressiveness in PDAC cells by targeting focal adhesion pathways (data not shown). [score:7]
Downregulation of miR-217, miR-141, miR-148a and miR-375 in PDAC tissues was commonly observed in PDAC tissues [12]. [score:4]
Other study showed that significantly downregulation of miR-216a and miR-217 was detected in Kras [G12d];Pdx1-Cre mouse at 25 weeks [36]. [score:4]
In that study, 3 miRNAs (miR-216a, miR-216b, and miR-217) were reduced in expression in the Kras [G12D] pancreas. [score:3]
Past studies pointed to the anti-tumour function of miR-217 in several cancers, including the targeting of the KRAS oncogene in PDAC [49]. [score:3]
The miR-216 family members and miR-217 are located on human chromosome 2q16.1. [score:1]
We found that miR-217, miR-216a-5p/-3p and miR216b-5p/-3p were close together and were defined as clustered miRNAs. [score:1]
Our miRNA signature showed that miR-217 was also markedly reduced in PDAC tissues. [score:1]
[1 to 20 of 8 sentences]
18
[+] score: 20
Mir-99a, mir-181a* and mir-23a were down-regulated in NRs whereas mir-217 was accumulated in NRs compared to SVRs. [score:3]
The levels of expression of mir-217 and mir-181a* were too low to be detected efficiently (Fig. 3A). [score:3]
Only few putative mRNAs targets of mir-23a, mir-217, mir-99a and mir-181a* have been described, so far. [score:3]
Interestingly, Mir-217 has been described as an oncogene [35] and a reduction of mir-99a expression has been reported in HCC tissues [31]. [score:3]
The major novelty of our work consists in the identification of 4 miRNAs (mir-23a, mir-99a, mir-181a*, and mir-217) differentially expressed between NRs and SVRs. [score:3]
The expression of mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 was investigated, in 68 serum samples available (NR = 26, RR = 10, RR = 32) (Fig. 3). [score:1]
0121395.g003 Fig 33A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
Mir-217 and mir-181a* were not detected efficiently in our serum samples (Fig. 3). [score:1]
3A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
To our knowledge, there are no study that reported efficient detection of serum mir-217 and mir-181a* in human serum samples. [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 20
Interestingly, tumor suppressor miR-101 and miR-217 acted as post-transcriptional regulators of MALAT1, whose silencing induced cell cycle arrest by p21 and p27 upregulation, and b-MYB inhibition. [score:9]
miR-101 and miR-217 overexpression or MALAT1 knockdown via miRNA mimics and siRNAs respectively, inhibited migration and invasion capabilities of ESCC cells, and were accompanied by deregulation of MALAT1 downstream metastasis -associated genes MIA2, HNF4G, ROBO1, CCT4, and CTHRC1 [88]. [score:7]
Furthermore, Ago2 -dependent post-transcriptional regulation of MALAT1 by miR-101 and miR-217 significantly impaired proliferation, migration, and invasion of Esophageal Squamous Cell Carcinoma Cells (ESCC) cells, highlighting the MALAT1 -dependent tumor suppressor role of these miRNAs [88]. [score:4]
[1 to 20 of 3 sentences]
20
[+] score: 19
As mentioned above, these miRNAs such as miR-203, miR-204, miR-205 and miR-217 negatively regulate RUNX2 expression, raising a possibility that miRNA -induced down-regulation of RUNX2 contributes to the suppression of malignant properties of pancreatic cancer cells such as drug resistance (Fig. 4). [score:9]
Zhao WG Yu SN Lu ZH Ma YH Gu YM Chen J The miR-217 microRNA functions as a potential tumor suppressor in pancreatic ductal adenocarcinoma by targeting KRASCarcinogenesis. [score:5]
It has been shown that the additional miRNAs (miR-23a, miR-34c, miR-133a, miR-135a, miR-205 and miR-217) also attenuate osteogenesis by targeting RUNX2 [162, 163]. [score:3]
Zhao et al. found that the expression level of miR-217 is significantly lower in pancreatic cancer tissues as compared to that in normal ones, and exogenous miR-217 reduces tumor growth in mouse xenograft mo dels [171]. [score:2]
[1 to 20 of 4 sentences]
21
[+] score: 18
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
For example, circ_100284 could up-regulate the expression of target gene EZH2 by inhibiting miR-217, elevate the concentration of cyclin D1, promote the cell cycle and induce vicious transformation of cells [9]; circ-ITCH may lead to cell cycle arrest and malignant cells suppression by affecting the Wnt signal pathway [10]; circ-Foxo3 could inhibit tumor angiogenesis [11]; ciRS-7 is closely related to hepatic microvascular invasion (MVI) by modulating the expression of miR-7 as well as its target genes, PIK3CD and p70S6K [12]. [score:18]
[1 to 20 of 1 sentences]
22
[+] score: 18
For example, the mature miR-217-5p sequence is 5′TACTGCATCAGGAACTGACTGG-3′ and the isomiR-217-5p sequence 5′-TACTGCATCAGGAACTGACTGGAC-3′ are both highly enriched in the pancreas, but the miR-217-5p isomiR lacks expression in the stomach, intestine and ovary while other isomiRs of miR-217-5p are expressed in the stomach, intestine and ovary (see the last miR-217-5p isomiR in Additional file 10: Figure S2). [score:5]
Eli Lilly investigated the isomiR expression of pancreas tissue specific and enriched miRNAs and the analysis revealed that isomiRs generally mirror their parent miRNA expression (Additional file 10: Figure S2), but some isomiRs are more tissue specific than others as shown for miR-215 in the intestines (Additional file 11: Figure S3) and miR-217-5p in the pancreas (Additional file 10: Figure S2). [score:3]
IsomiRs of miR-217-5p display more expanded or restricted expression with respect to tissues. [score:3]
Amylase and lipase increases were noted from 1–8 h in rats in both 15 and 50 μg/kg dose groups while pancreatic necrosis was noted at 8, 24 and 48 h. MiR-375-3p has been reported to be enriched in islets and the miRNA with the highest intra-islet expression [38] and in our study was increased from 4–24 h in the 15 and 50 μg/kg groups, returning to approximately vehicle level by 48 h. MiR-216a-5p and miR-217-5p remained elevated in the serum of rats longer than amylase or lipase and had a much greater dynamic range which could be advantageous if detection of pancreatic injury is not able to be examined at earlier time points. [score:3]
MiR-216b displayed similar kinetics to miR-216a-5p, but with a reduced dynamic range while miR-217-5p displayed increases similar to amylase. [score:1]
MiR-216a-5p, amylase and lipase were increased in the serum concurrently at 1 h, remained elevated until 8 h while miR-216a-5p remained elevated until 24 h. MiR-217-5p displayed similar kinetics to miR-216a-5p except miR-217-5p generally had a larger dynamic range and remained elevated until 48 h. Both miRs-216a-5p and 217-5p displayed much larger dynamic ranges than amylase or lipase and remained elevated longer. [score:1]
MiR-216b-5p was increased in 1 vehicle treated animal and miR-217-5p was increased in 2 vehicle treated animals with no histopathologic or clinical chemistry correlates (data not shown). [score:1]
Interestingly, miR-217-5p displayed very large increases for the longest amount of time in the rat and this result was not reflected in the dog. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 17
Four miRNAs (miR-144, miR-217, miR-424 and miR-214) were also reported to be down-regulated in HCC, and the supplement of their target gene E2F3a partially reversed the tumor suppressive effects of these miRNAs in HCC cells [50– 52]. [score:8]
Studies demonstrated the biological functions of miR-144, miR-141 and miR-217, with the ability to suppress migration and invasion of HCC cells by downregulating E2F3 [50, 51, 68]. [score:6]
Meanwhile, miR-217 was reported to function as a tumor suppressor in HCC progression and miR-217/E2F3 and miR-214/E2F3 axises may be potential candidates for developing rational therapeutic approaches [51, 83]. [score:3]
[1 to 20 of 3 sentences]
24
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Molecular mechanisms underlying these effects are partly explained by the fact that ectopic expression of miR-217, in tyrosine kinase inhibitor-resistant K562 cells, resulted in reduced expression of DNMT3A and increased the sensitivity of tumor cells to tyrosine kinase inhibitors [54]. [score:9]
Similarly, loss of miR-217 and miR-199b expression has been correlated with resistance to ABL tyrosine kinase inhibitors [53, 54]. [score:5]
[1 to 20 of 2 sentences]
25
[+] score: 14
miR-217 and miR-377 in combination were found to attenuate HMOX1 protein expression, whereas knockdown of miR-217 and miR-377 up-regulates HMOX1 protein, but exhibits no alteration in HMOX1 mRNA levels, suggesting that the regulation occurs at the translational level [42]. [score:10]
Beckman J. D. Chen C. Nguyen J. Thayanithy V. Subramanian S. Steer C. J. Vercellotti G. M. Regulation of heme oxygenase-1 protein expression by miR-377 in combination with miR-217 J. Biol. [score:4]
[1 to 20 of 2 sentences]
26
[+] score: 10
Similarly, miR-217 inhibits SIRT1 expression by binding to the 3’-UTR of SIRT1, leading to loss of SIRT1 function on its major endothelial targets including FOXO1 and eNOS, finally promoting endothelial senescence [125]. [score:7]
Cancer-related SIRT1 overexpression is owing to the evasion of related miRNAs including miR-34a, miR-146b, miR-132/212 and miR-217 (Figure 2H) [120]. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 10
As illustrated in Fig 3, 7 miRNAs including miR-29c, miR-217, miR-375, miR-215, miR-19b, miR-133a and let-7a had relatively low and stable expression levels (P < 0.05) in early period, and increased significantly (P < 0.01) from 12 to 13 weeks when the gonads entered into rapid development. [score:4]
Furthermore, miRNA-217, miRNA-155, miR-19b and miR-9 have target genes that are associated with puberty onset, such as FSHR, LEPR and circadian clock genes. [score:3]
Of the 9 members, miR-217 and miR-375 are regulators of chicken ovary maturity [29]. [score:2]
According to previous reports and our sequencing results, 9 miRNAs, including miR-29c-3p, miR-375, miR-215-5p, miR-9-5p, miR-19b-3p, miR-133a-3p, let-7a, miR-217-5p and miR-155 were determined as candidates. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 10
Among the microRNAs highly expressed in the kidney [14, 15], several key microRNAs (miR-192, miR-200b, miR-200c, miR-216a, and miR-217) were upregulated in glomerular mesangium of diabetic mouse mo dels (type I (streptozotocin (STZ) -induced) and type2 (db/db)) (vide infra). [score:6]
miR-216a and miR-217 are downstream targets of miR-192 through Zeb1/2 mediated mechanisms [17]. [score:3]
Akt activation by miR-216a and miR-217 led to glomerular mesangial cell expansion and hypertrophy, another hallmark of diabetic nephropathy (Figure 2A). [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 10
MiR-217 was down-regulated in 75% of PDAC and directly targeted KRAS mRNA [66]. [score:6]
MiR-126, miR-96, or miR-217 down-regulation could represent an additional epigenetic reinforcement of RAS-MAPK pathway activation in pancreatic tumors. [score:4]
[1 to 20 of 2 sentences]
30
[+] score: 9
Other miRNAs from this paper: hsa-mir-145, hsa-mir-136, hsa-mir-186, hsa-mir-384
For instance, Gao et al. discovered that a lncRNA, RoR, was capable of binding to miR-145 for competitive regulation of Nanog expression in pancreatic cancer [29], while the lncRNA HOTAIR was shown to act as a ceRNA for miR-217 to facilitate HIF-1α expression and upregulation of AXL in renal cell carcinoma [30]. [score:9]
[1 to 20 of 1 sentences]
31
[+] score: 9
Of the most up-expressed miRNA (miRNA-181a-3p) in HepG2/DOX, one target gene RBM22 supported by three softwares (Mireap, miRDB and PicTar), was expected to be the common targets of seven other significantly differentially expressed miRNAs including miR-21, miR-101, miR-217, miR-590-5p, miR-181b, miR-181c, and miR-181d. [score:9]
[1 to 20 of 1 sentences]
32
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In addition, miR-217 and miR-34a, which have been reported to be up-regulated by tat exposure, bind to the 3′ UTR of Sirtuin 1 (SIRT1) mRNA inhibiting its expression. [score:8]
[1 to 20 of 1 sentences]
33
[+] score: 8
SIRT-1 activity inhibition during senescence can also be induced by upregulation of miR-217, which targets SIRT-1 3′UTR and induces its posttranscriptional silencing in different endothelial systems, including HUVECs and human aortic and coronary artery endothelial cells [118]. [score:8]
[1 to 20 of 1 sentences]
34
[+] score: 8
The expression of miR-217 increases in aged endothelial cells and promotes senescence through inhibition of SirT1, which is known to promote longevity and mediates the beneficial effects of calorie restriction. [score:5]
Four of twelve reported miRNAs (miR-217, -34a, -369-5p, and -20a) were regulated in the same way in our study; absence of the others in our study may reflect differences in cell types and senescence mo dels. [score:2]
Furthermore, miR-217 has been reported to play a role in endothelial senescence and is implicated in the pathogenesis of atherosclerosis [52]. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
It was also reported that miR-217 inhibit Runx2 protein expression in osteoblasts and chondrocytes, it also significantly impeded osteoblast differentiation, and the effect could be reversed by the corresponding anti-miRNA 24 25. [score:5]
We found that circRNA-CER harbors miRNA -binding sites, including miR-636, miR-665, miR-217, miR-646 and miR-136. [score:1]
According to the network above, there were 5 miRNA binding sites for circRNA-CER, and they were miR-636, miR-665, miR-217, miR-646 and miR-136, respectively. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 7
Azam AT, Bahador R, Hesarikia H, Shakeri M, Yeganeh A. Downregulation of microRNA-217 and microRNA-646 acts as potential predictor biomarkers in progression, metastasis, and unfavorable prognosis of human osteosarcoma. [score:4]
Low miR-217 and miR-646 expression levels were unfavorable prognostic factors for overall survival of osteosarcoma patients [13]. [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
For example, miR-142-5p and miR-142-3p (hematopoietic system), miR-122 (liver), and miR-216 and miR-217 (pancreas) were highly expressed in these organs and less abundantly in HM [48, 177], suggesting that these HM microRNAs may originate from the maternal bloodstream to specifically target the development, growth and function of the corresponding organs in the HM fed infant. [score:6]
These include for example muscle miR-1 and miR-133 [173], brain miR-9 and miR-124a [178], pancreatic miR-216 and miR-217 [179], liver miR-122 [21, 173], blood cell miR-451 [180], and endothelial cell miR-126 [181]. [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 7
Predating the report by Chiang et al. [178], two cellular miRNAs- miR-34a and miR-217, were reported to bind the 3′UTR, and repress the translation, of the mRNA of silent mating type information regulation 2 homolog 1 (SIRT1) [186, 187]. [score:4]
Zhang H. S. Wu T. C. Sang W. W. Ruan Z. MiR-217 is involved in Tat -induced HIV-1 long terminal repeat (LTR) transactivation by down-regulation of SIRT1Biochim. [score:3]
[1 to 20 of 2 sentences]
39
[+] score: 7
Other miRNAs from this paper: hsa-mir-21
Because microRNAs (miR) are well known regulators of Pten we determined expression of miR-21 and miR-217. [score:4]
Expression of miR-21 and miR-217 was analysed with the Taqman microRNA reverse transcription kit and subsequent amplification with Taqman Universal PCR master mix and Taqman microRNA assays (all from Applied Biosystems). [score:2]
miR-217 was not detectable in neurofibroma derived Schwann cells and the majority of MPNST cell lines (data not shown). [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 7
We found that IFN-γ and TNF-α resulted in up-regulation of miR-155–5p, miR-4485–3p, miR-218–5p, and miR-146a–5p and down-regulation of miR-582–5p, miR-582–3p, miR-93–5p, miR-217 and miR-125b–5p (supplemental Tables S1 and S2). [score:7]
[1 to 20 of 1 sentences]
41
[+] score: 7
Importantly, miRNAs have been shown to mediate TGFB signaling in diabetic nephropathy, and several candidates, including miR-92, miR-192, miR-216a, miR-217, and miR-377 are upregulated in mesangial cells in response to either glucose or TGFB, and are also indirectly correlated with increased collagen and fibronectin expression [44], [45], [46], [47]. [score:7]
[1 to 20 of 1 sentences]
42
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
This mechanism is mediated by the inhibition of sirtuin 1 (SIRT1), a direct target of miR-34a and miR-217, inducing cellular senescence [73]. [score:6]
Furthermore, endothelial senescence is controlled by miR-217 and miR-34a. [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 6
Chen et al. [36] selected the following candidate miRNAs based on a report on EMT and kidney disease [46]: miR-15a, miR-17-92, miR-21, miR-30, miR-192, miR-216a, miR-217, and miR-377 [36]. [score:3]
miR-30 significantly correlated with GFR and no detectable expression of miR-216a and miR-217 was found in patient samples [36]. [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 6
In addition to tissue-specific ageing, it is increasingly evident that many miRNA regulate gene expressions in well-known ageing pathways, most notably in the p53 tumor suppressor pathway (miR-34, miR-29 and miR-217, etc. ) [score:6]
[1 to 20 of 1 sentences]
45
[+] score: 5
SIRT1 is also downregulated by miR-217, leading to the modulation of endothelial cell senescence via silent information regulator 1 (SIR1) [140]. [score:5]
[1 to 20 of 1 sentences]
46
[+] score: 5
Pten, the inhibitor of PI3K/AKT, was targeted by miR-216 and miR-217 and these miRNAs were also activated by Tgfb1 [46]. [score:5]
[1 to 20 of 1 sentences]
47
[+] score: 5
Lee et al reported that miR-122a is specifically expressed in liver tissue while miR-216 and miR-217 are preferentially expressed in the pancreas [38]. [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
For example, circ-GMPS and miR-217 might interact, and GMPS was also a potential target of miR-217 according to TargetScan [50]. [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
Studies from You and colleagues show that chronic ethanol exposure (in cells and liver) increases levels of miR-217, which dysregulates the function of lipin-1, a key player in lipid metabolism, by sequestering it into the cytosol [86]. [score:2]
Yin H. Hu M. Zhang R. Shen Z. Flatow L. You M. MicroRNA-217 promotes ethanol -induced fat accumulation in hepatocytes by down -regulating SIRT1 J. Biol. [score:1]
Yin H. Liang X. Jogasuria A. Davidson N. O. You M. Mir-217 regulates ethanol -induced hepatic inflammation by disrupting sirtuin 1-lipin-1 signaling Am. [score:1]
Alcohol also causes a miR-217 -dependent loss of function of sirt1 in hepatocytes [86] and Kupffer cells [122]; thus, supporting a link between miR-217 and alcohol -induced hepatic steatosis and inflammation. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
[1 to 20 of 1 sentences]
51
[+] score: 5
41, 42 Several miRNAs, including miR-21, miR-216a, miR-217 and miR-494, have been shown to confer sorafenib resistance in HCC by inhibiting autophagy through targeting phosphatase and tensin homolog (PTEN). [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 5
Elevated levels of miRNA-217 are associated with inhibited expression of SIRT1 in atherosclerosis [40]. [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
An interesting expression pattern is represented by miR-216a, miR-216b and miR-217 which were found to be exclusively expressed in the F100 cerebellum, implying that they are highly stage- and tissue-specific miRNAs. [score:5]
[1 to 20 of 1 sentences]
54
[+] score: 5
The miRNA signatures generated for ER status (miR-342, miR-299, miR-217, miR-190, miR-135b, miR-218), for PR status (miR-520g, miR-377, miR-527-518a, miR-520f-520c) and for HER2/ neu status (miR-520d, miR-181c, miR-302c, miR-376b, miR-30e) include miRNAs that have previously been identified as dysregulated in breast cancer and other cancers [7, 9, 37- 43] and involved in the regulation of cell functions such as growth, apoptosis, migration and invasion [38, 42, 43]. [score:3]
Stepwise ANN analysis identified predictive miRNA signatures corresponding with oestrogen (miR-342, miR-299, miR-217, miR-190, miR-135b, miR-218), progesterone (miR-520g, miR-377, miR-527-518a, miR-520f-520c) and HER2/ neu (miR-520d, miR-181c, miR-302c, miR-376b, miR-30e) receptor status. [score:1]
The ER signature consisted of six miRNA transcripts (miR-342, miR-299, miR-217, miR-190, miR-135b, miR-218), and discriminated cases correctly with a median accuracy of 100% when classifying between ER -positive and ER -negative phenotypes. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 3 sentences]
56
[+] score: 5
Other miRNAs from this paper: hsa-mir-204, hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
Interestingly, miR-217 negatively regulates SIRT1 mRNA translation, thus suggesting dysregulation of the miR-217-SIRT1 axis in response to the inflammatory environment of pancreatic carcinoma [55]. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 5
Other miRNAs from this paper: hsa-mir-21, hsa-mir-122
For example, in Figure 5, we could observe that only the 5p-arm is expressed in miR-217 locus and this 5p-arm expression pattern is supported by the miR-217 annotation in miRBase [28]. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Cortex let-7c-1, miR-10a, miR-21, miR-124a-1, miR-128a, miR-135b, miR-150, miR-199a, miR-217, miR-329, miR-451. [score:1]
Hypothalamus miR-17, miR-29c, miR-124a-1, miR-128a, miR-150, miR-199a, miR-217, miR-223, miR-329, miR-429. [score:1]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
Spinal cord miR-28, miR-217, miR-218-1, miR-329, miR-331. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 4
Hong Q LncRNA HOTAIR regulates HIF-1alpha/AXL signaling through inhibition of miR-217 in renal cell carcinomaCell Death Dis. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
miR-217 and miR-34a are reported to favor Tat -induced HIV-1 LTR -driven transactivation by downregulating SIRT1 (sirtuin 1), a host-cell-encoded class II deacetylase [23], [24]. [score:4]
[1 to 20 of 1 sentences]
61
[+] score: 4
Moreover, a negative correlation between MIR101 or MIR217 and MALAT1 was previously observed in esophageal squamous cell carcinoma, while knockdown of MALAT1 inhibited cell growth, migration, and invasion [28]. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
Other miRNAs from this paper: hsa-mir-122, hsa-mir-155, hsa-mir-377
It has been reported that miRNAs, including miR-155, miR-377, miR-217 and miR-122, regulate HO-1 protein expression in cultured human cells (29– 31). [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 4
Azam AT Bahador R Hesarikia H Shakeri M Yeganeh A Downregulation of microRNA-217 and microRNA-646 acts as potential predictor biomarkers in progression, metastasis, and unfavorable prognosis of human osteosarcomaTumor Biol 2015 Bruland ØS Bauer H Alvegaard T Smeland S Jaffe N Bruland OS Bielack S Treatment of osteosarcoma. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
Other miRNAs from this paper: hsa-mir-22, hsa-mir-125b-1, hsa-mir-125b-2
Hong Q lncRNA HOTAIR regulates HIF-1alpha/AXL signaling through inhibition of miR-217 in renal cell carcinomaCell Death Dis. [score:4]
[1 to 20 of 1 sentences]
65
[+] score: 4
B. Relative expression of 8 microRNAs (miR-31, miR-98, miR-125, miR-139, miR-181a, miR-181b, miR-200b and miR-217) during hepatocytes differentiation from hPSC- iEZH2 cell line doxy induced the first 8 days of differentiation. [score:3]
miR-217 was the only EZH2 binding miRNA that could not be detected at any point during differentiation (S4 Fig). [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 4
For example, the miRNAs miR-21, miR-153, miR-216a, miR-217, miR-494 and miR-10a-5p have been shown to be upregulated in sorafenib-resistant cells and to participate in the mechanisms that are underlying sorafenib resistance [193]. [score:4]
[1 to 20 of 1 sentences]
67
[+] score: 4
The fold change value for the downregulated miRNAs ranged from −14.23 (hsa-miR-217) to −1.03 (hsa-miR-589-5p). [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 3
Other miRNAs from this paper: hsa-mir-21, hsa-mir-101-1, hsa-mir-205, hsa-mir-101-2
Wang X. Li M. Wang Z. Han S. Tang X. Ge Y. Zhou L. Zhou C. Yuan Q. Yang M. Silencing of long noncoding RNA MALAT1 by miR-101 and miR-217 inhibits proliferation, migration, and invasion of esophageal squamous cell carcinoma cells J. Biol. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
SAM analysis identified a group of five significantly up-regulated miRNAs, (FDR<1): hsa-mir-371, hsa-mir-369-5P, hsa-mir-29c, hsa-mir-499 and hsa-mir-217 (signal intensity of hsa-mir-217 was very low and thus not considered for subsequent analysis). [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
In recent years, several miRNAs, such as miR-155 [32], and miR-217 [33], related fat liver disease have been identified. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Wang et al. demonstrated that silencing of lncRNA MALAT1 by miR-101 and miR-217 would inhibit proliferation, migration, and invasion of esophageal squamous cell carcinoma cells [9]. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Other recent studies have reported that miR-9, miR-101 and miR-217 target MALAT1 for degradation in other human cancer cell lines. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
Other miRNAs from this paper: hsa-mir-31, hsa-mir-216a, hsa-mir-489
miR-216a and miR-217 -induced EMT-stimulated drug resistance via targeting PTEN in hepatocellular carcinoma [28]. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Other miRNAs such as mir-155, mir-181b, mir-15a, mir-16, mir-15b, mir-34a, mir-9, mir-30, let-7a, mir-125b, mir-217 and mir-185 modulate the expression of pivotal genes and functions which contribute to the final B-cell maturation [6]. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
A previous study showed that runx2 is a target of miR-30c, miR-135a, miR-204, miR-133a, miR-217, miR-205, miR-34, miR-23a and miR-338 [34]. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Much alike, the expression of senescence -associated miRNAs miR-217 and miR-34a increases in aging cells compared to young cells by 2.2- and 8.5-fold, respectively, but the actual numbers of the miRNAs are low (Fig.   2a and Supplementary Table  S1). [score:2]
In the data presented here, many of these miRNAs (e. g. miR-10a/b, miR-24/27, miR-125a, miR-126 and miR-221/222) are abundant, while others are present in relatively low amounts (e. g. miR-18a, miR-19a, miR-34a, miR-200a/b/c, miR-210 and miR-217), or not at all (e. g. miR-133a and miR-663) (Fig.   2a). [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 3
miR-217 and miR-196a expression profiles can be used in differentiating pancreatic cancer tissue from normal pancreas tissues and chronic pancreatitis [48]. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
The pancreatic HTE cfa-miR-217-3p had an annotated homolog in rat but not human (Additional file 5: Figure S4). [score:1]
This novel finding suggests that human miR-217 should in fact be two separate mature miRNA sequences: miR-217-5p and miR-217-3p. [score:1]
Conversely, information gathered from the dog miRNA atlas can be used to fill in gaps in the human annotation, as in the case with miR-217. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 3
miRNA Chromosome location Dysregulation References miR-122 18q21.3 Decreased/Increased 52, 103 miR-125b 11q24.1 Decreased 103 miR-126 9q34.3 Decreased 98 miR-155 21q21.3 Increased 31, 99 miR-181a 1q32.1 Decreased 52, 100 miR-199a 1q24.3 Decreased 99, 100 miR-200a 1p36.33 Decreased 100, 103 miR-21 17q23.2 Increased 52, 102 miR-217 2p16.1 Increased 91 miR-320 8p21.3 Increased 100, 103 miR-34a 1p36.22 Increased 52, 103 miR-375 2q35 Increased 101 miR-486 8p11.21 Increased 100 let-7b 22q13 Decreased 52 miRNA is a known regulator of Kupffer cell response to. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Previous studies have reported that miR-216a, miR-216b, and miR-217 are specifically expressed in the pancreas; these miRNAs were useful as biomarkers for pancreatic injury [30]. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
MiRNAs have been found to regulate cell proliferation, differentiation, and apoptosis [15- 17] and they have also been implicated in the regulation of senescence (miR-29, miR-30, miR-34a, miR-34b, miR-34c, miR122 miR-203, miR-205 and miR-217) [18- 23] mostly by interfering with either the p53 pathway or the retinoblastoma RB1/E2F function. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
The vascular impairment observed during ageing, in fact, is often combined with the altered expression of several micro -RNAs, such as miR-29 [39– 41], miR-34a [40– 42], miR-217 [40, 41] and miR-146 [41, 49, 50]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
miR-217 is progressively increased during ageing in the endothelial cells, and it can reduce SIRT1 expression through binding to a cognate response elements within SIRT1 3′ UTR of SIRT1 [77]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 2
By contrast, T- and B-cell regulatory miR-150 was not detected, and several tissue-specific miRNAs, such as miR-122 (liver), miR-216, miR-217 (pancreas) and miR-142-5p and miR-142-3p (hematopoietic cells), were barely detectable (Figure 1b). [score:2]
[1 to 20 of 1 sentences]
85
[+] score: 2
In human keratinocytes, circ100284 is involved in the arsenite-accelerated cell cycle via miR-217 EZH2 regulation [29]. [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
It is worth noting that these 10 miRNAs together (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-448, miR-93, miR-106b, miR-217, miR-539) could potentially be regulating 41% of the mRNAs significantly altered in PDAC. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
Previous study reported that miR-216 and miR-217 promoted TGF β -induced MC hypertrophy in vitro by regulating PTEN 32. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 2
Other miRNAs from this paper: mmu-mir-122, hsa-mir-122, mmu-mir-217, dre-mir-217, dre-mir-122
microRNAs (miR-217 and miR-122), tight junction protein claudin C, FAM136a, and zebrafish tetraspanin, are involved the process of gastrointestinal development. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-25, hsa-mir-33a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-141, mmu-mir-155, mmu-mir-10b, mmu-mir-129-1, mmu-mir-181a-2, mmu-mir-183, mmu-mir-184, hsa-mir-192, mmu-mir-200b, hsa-mir-129-1, mmu-mir-122, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-223, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-129-2, hsa-mir-184, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-96, mmu-mir-34a, mmu-mir-129-2, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-25, mmu-mir-210, mmu-mir-181a-1, mmu-mir-216a, mmu-mir-223, mmu-mir-33, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-217, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-375, mmu-mir-375, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-33b, mmu-mir-216b, hsa-mir-216b, mmu-mir-1b, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-129b, mmu-mir-216c, bbe-let-7a-1, bbe-let-7a-2, bbe-mir-10a, bbe-mir-10b, bbe-mir-10c, bbe-mir-125a, bbe-mir-125b, bbe-mir-129a, bbe-mir-129b, bbe-mir-133, bbe-mir-1, bbe-mir-183, bbe-mir-184, bbe-mir-200a, bbe-mir-200b, bbe-mir-210, bbe-mir-216, bbe-mir-217, bbe-mir-22, bbe-mir-252a, bbe-mir-252b, bbe-mir-278, bbe-mir-281, bbe-mir-33-1, bbe-mir-33-2, bbe-mir-34a, bbe-mir-34b, bbe-mir-34c, bbe-mir-34d, bbe-mir-34f, bbe-mir-375, bbe-mir-7, bbe-mir-71, bbe-mir-9, bbe-mir-96, bbe-mir-34g, bbe-mir-34h, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In contrast, many phylogenetically conserved miRNAs, as well as miRNAs present in both chordates and vertebrates (for example, miR-216, miR-217, miR-22, miR-25, and miR-96), could be reliably traced back to B. belcheri (Gray). [score:1]
Based on the available nematode, fruitfly, zebrafish, frog, chicken, mouse, rat and human miRNA information [18], 45 conserved amphioxus miRNAs could be classified into three distinct groups: 23 miRNAs (let-7a, miR-1, miR-7, miR-9, and so on) were conserved throughout the Bilateria; 5 miRNAs (miR-252a, miR-252b, miR-278, miR-281 and miR-71) were homologous to invertebrate miRNAs; and 17 miRNAs (miR-141, miR-200a, miR-200b, miR-183, miR-216, miR-217, miR-25, miR-22, miR-96, and so on) were present both in chordates and vertebrates (Table S9 in). [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 1
Among the cancer-related miRNAs, five miRNAs, namely, hsa-mir-217, hsa-mir-188, hsa-mir-125b-1, hsa-mir-100, and hsa-mir-181d, were reported to be associated with the acute myeloid leukemia. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Other miRNAs from this paper: hsa-mir-216a, mmu-mir-216a, mmu-mir-217, gga-mir-216a, gga-mir-217
The other variants with shorter 3′UTRs, however, loose between 16 and 36 potential miRNA binding sites, and among these are the experimentally validated binding sites of miR-216a and miR-217. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Furthermore, in the mouse mo del of T. gondii infection, miR-712, miR-511, and miR-217 have been indicated as a potential miRNA signature that can be useful for early detection of infection (49). [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Similarly, stepwise artificial neural networks analysis revealed predictive miRNA signatures (miR-342, miR-299, miR-217, miR-190, miR-135b, miR-218) corresponding to oestrogen receptor status in breast cancer [39]. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
For example, lncRNA RP23-298H6.1-001 hosts miR-216a and miR-217, all of which were induced by TGF-β1 in glomerular mesangial cells [110]. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
miR-101, miR-217 and MALAT1 siRNA have common downstream genes like MIA2, HNF4G, ROBO1, CCT4 and CTHRC1, and miR-101 or miR-217 and MALAT1 were negatively correlated in 42 pairs of esophageal cancer tissue samples and adjacent normal tissues [31]. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Vecchione et al. analyzed miR signatures associated with chemoresistance in 198 serous ovarian cancer samples along with clinical data and concluded that the presence miR-217, miR-484, and miR-617 was able to predict the chemoresistance of these tumors [78]. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
In glioma, circ-TTBK2 can bind and inactivate miR-217, leading to activation of the PI3K/AKT and ERK pathways via HNF-1β, which has a miR-217 binding site in its 3′ UTR. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
They determined that TGF- β activates Akt in glomerular mesangial cells by inducing miR-215a and miR-217, revealing a role for miRNAs in kidney disorders. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
To date only few lncRNAs have been reported as hosts for some miRNAs under diabetic conditions, for e. g., RP23-298H6.1-001 hosting miR-216a and miR-217 (refs 6, 11, 28, 29, 30). [score:1]
[1 to 20 of 1 sentences]