sort by

334 publications mentioning hsa-mir-210 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-210. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 411
Other miRNAs from this paper: hsa-mir-145, hsa-mir-150
d Overexpression of miR-210-3p decreased E-cadherin expression and increased Vimentin and Fibronectin expression in VCaP and C4-2B cells; while silencing miR-210-3p increased E-cadherin expression and decreased Vimentin and Fibronectin expression in VCaP and C4-2B cells. [score:11]
Western blot analysis revealed that upregulating miR-210-3p reduced the expression of epithelial marker E-cadherin and enhanced the expression of mesenchymal marker vimentin and fibronectin in VCaP and C4-2B cells (Fig. 3d); conversely, silencing yielded an opposite effect on these EMT markers (Fig. 3d and Fig. 2j). [score:8]
Real-time PCR analysis showed that upregulating miR-210-3p increased the expression levels of multiple NF-κB signaling downstream metastasis-related target genes including TWIST1, MMP13 and IL11 in PCa cells. [score:8]
Several studies have indicated that miR-210-3p was upregulated in multiple human cancers and that high expression of miR-210-3p promoted cancer cell invasion and metastasis via different mechanisms and predicted poor survival [40, 41, 66– 68]. [score:6]
Furthermore, NF-κB signaling activity repressed by the specific inhibitors attenuated the stimulatory role of upregulating miR-210-3p on invasion and migration of PCa cells. [score:6]
In this study, our results demonstrated that high expression of miR-210-3p constitutively activated NF-κB signaling via simultaneously suppressing negative regulators of NF-κB signaling TNIP1 and SOCS1, resulting in the bone metastasis of PCa. [score:6]
Furthermore, upregulating miR-210-3p enhances, while silencing miR-210-3p suppresses the EMT, invasion and migration of PCa cells in vitro. [score:6]
Using the publicly available algorithms TargetScan, miRanda and miRDB, we found that multiple negative regulators of NF-κB signaling, including TNIP1, SOCS1, PIAS4 and PDLIM7, may be potential targets of miR-210-3p (Fig. 5a and Additional file 8: Figure S4a). [score:6]
To further investigate the clinical significance of miR-210-3p -induced TNIP1 and SOCS1 downregulation and the subsequent activation of NF-κB signaling in PCa tissues, miR-210-3p expression and the protein expression levels of TNIP1, SOCS1 and nuclear p65 were examined. [score:6]
miR-210-3p expression is upregulated in bone metastatic PCa tissues and cells. [score:6]
Furthermore, our results demonstrate that miR-210-3p promotes EMT, invasion and migration of PCa cells via targeting negative regulators of NF-κB signaling (TNF-α Induced Protein 3 Interacting Protein 1) TNIP1 and (Suppressor Of Cytokine Signaling 1) SOCS1, resulting in constitutive activation of NF-κB signaling pathway. [score:6]
Our results further demonstrate that miR-210-3p maintains the sustained activation of NF-κB signaling via targeting negative regulators of NF-κB signaling (TNF-α Induced Protein 3 Interacting Protein 1) TNIP1 and (Suppressor Of Cytokine Signaling 1) SOCS1, resulting in EMT, invasion, migration and bone metastasis of PCa cells. [score:6]
a Predictive target genes of miR-210-3p from TargetScan, miRanda and miRDB. [score:5]
Moreover, inhibition of NF-κB signaling by LY2409881 and JSH-23 impaired the stimulatory effect of miR-210-3p overexpression on migration and invasion in PCa cells (Fig. 4f and g). [score:5]
The median of miR-210-3p expression in PCa tissues was used to stratify high and low expression of miR-210-3p. [score:5]
Therefore, we further examined miR-210-3p expression in PCa cells under hypoxic conditions and found that miR-210-3p expression steadily increased with a gradient increase of the COCl2 concentration in PCa cells (Fig. 6h). [score:5]
e and f Overexpression of miR-210-3p enhanced, while silencing miR-210-3p suppressed invasion (e) and migration (f} abilities in VCaP and C4-2B cells. [score:5]
Here, we report that miR-210-3p activated NF-κB signaling through directly targeting SOCS1 and TNIP1 in PCa cells, which promoted the development of bone metastasis of PCa. [score:5]
Here, we reported that miR-210-3p expression was elevated in bone metastatic PCa tissues, which was caused by recurrent gains, and high expression of miR-210-3p correlated with PSA levels, Gleason grade and bone metastasis status in PCa patients. [score:5]
Consistently, the analysis of the publicly available PCa datasets revealed that miR-210-3p expression in metastatic bone tissues was upregulated compared with that in primary PCa tissues (Additional file 9: Figure S5). [score:5]
miR-210-3p expression levels were normalized to that miR-210-3p expression of sample one. [score:5]
In this study, our results demonstrated that overexpression of miR-210-3p augmented the NF-κB signaling activity via targeting TNIP1 and SOCS1 in PCa cells. [score:5]
Indeed, our results revealed that miR-210-3p expression in metastatic bone tissues was upregulated compared with primary PCa tissues. [score:5]
RT-PCR and western blotting analysis revealed that miR-210-3p overexpression reduced the expression levels of SOCS1 and TNIP1, but not of PIAS4 and PDLIM7 in PCa cells. [score:5]
Taken together, our results indicate that overexpression of miR-210-3p activates NF-κB signaling by inhibiting TNIP1 and SOCS1, resulting in the bone metastasis of PCa (Fig. 7b). [score:5]
j Silencing miR-210-3p increased E-cadherin expression and decreased Vimentin and Fibronectin expression in PC-3 cells. [score:5]
Our results further indicate that miR-210-3p activates NF-κB signaling in PCa cells via directly targeting SOCS1 and TNIP1, resulting in the development of PCa bone metastasis. [score:5]
Consistent with the miR-210-3p expression in PCa tissues, miR-210-3p expression was elevated in PCa cells compared with normal prostate epithelial cells RWPE-1 (Fig. 1e and Additional file 4: Figure S1b). [score:4]
We further knocked down miR-210-3p expression in the TGF-β -treated VCaP and C4-2B cells and found that silencing miR-210-3p reversed the cell phenotypes in VCaP and C4-2B cells (Fig. 3c). [score:4]
Taken together, our results suggest that miR-210-3p directly targets SOCS1 and TNIP1, resulting in constitutive activation of NF-κB signaling in PCa cells. [score:4]
Upregulating miR-210-3p enhances, while silencing miR-210-3p represses the EMT, invasion and migration of PCa cells in vitro. [score:4]
It’s worth noting that miR-210-3p has been broadly demonstrated to be a direct target of HIF-1α in a variety of tumor cells [40, 41]. [score:4]
Therefore, these findings suggest that a hypoxic bone microenvironment promotes bone colonization of cancer cells to bone via activation of miR-210-3p/ NF-κB signaling axis, which contributes to the development of bone metastatic disease in PCa. [score:4]
In contrast, silencing miR-210-3p increased the expression levels of SOCS1 and TNIP1 (Fig. 5b-d and Additional file 8: Fig. S4b and c), indicating that miR-210-3p negatively regulated SOCS1 and TNIP1 in PCa cells. [score:4]
miR-210-3p targets multiple negative regulators of NF-κB signaling. [score:4]
Taken together, these finding indicate that high expression of miR-210-3p may be involved in the whole process of bone metastasis in PCa, from escaping from primary PCa tissues to the development of secondary metastatic bone tumors. [score:4]
We further examined the expression levels of miR-210-3p in our 149 PCa tissues and found that the miR-210-3p expression level in bone metastatic PCa tissues was robustly elevated compared with non-bone metastatic PCa tissues (Fig. 1d). [score:4]
In summary, our results demonstrate that upregulation of miR-210-3p caused by recurrent gains activates NF-κB signaling pathway, which further promotes bone metastasis in PCa. [score:4]
a Gene set enrichment analysis (GSEA) revealed that miR-210-3p expression significantly and positively correlated with the EMT signatures. [score:3]
Moreover, our results further indicate that recurrent gains (amplification) contribute to miR-210-3p overexpression in a small number of PCa patients. [score:3]
Consequently, these finding demonstrate that silencing miR-210-3p inhibits the bone metastasis of PCa in vivo. [score:3]
High expression of miR-210-3p correlated with serum PSA level, Gleason grade and distant bone metastasis status in PCa patients. [score:3]
Furthermore, the percentage of high expression of miR-210-3p was higher in bone metastatic PCa tissues than in non-bone metastatic PCa tissues (Additional file 4: Fig. S1a). [score:3]
Taken together, our results indicate that high expression of miR-210-3p constitutively activates NF-κB signaling, which is essential for bone metastasis of PCa. [score:3]
miR-210-3p expression is elevated in PCa, particularly in bone-metastatic PCa. [score:3]
To further explore the underpinning mechanism of miR-210-3p overexpression in PCa tissues, we analyzed the PCa dataset from TCGA and found that recurrent gains (amplification) appeared in 5.1% of PCa tissues (Fig. 6a). [score:3]
Interestingly, the expression levels of miR-210-3p increases steadily from non-bone metastatic PCa tissues, bone metastatic PCa tissues to metastatic bone tissues and high expression of miR-210-3p positively correlates with the clinicopathological characteristics and bone metastasis status of PCa patients. [score:3]
Then, we further exogenously overexpressed miR-210-3p and endogenously silenced miR-210-3p via viral transduction in VCaP and C4-2B cells (Fig. 3b). [score:3]
As shown in Fig. 4a and Additional file 7: Figure S3b, we found that miR-210-3p overexpression significantly enhanced, while silencing miR-210-3p reduced NF-κB -dependent luciferase activity in PCa cells. [score:3]
P < 0.001. e The average expression level of miR-210-3p in PCa tissues with gains was higher than those without gains in our PCa samples. [score:3]
Importantly, gains were observed in 2/10 bone metastatic PCa tissues, but were not observed in non-bone metastatic PCa tissues (Fig. 6b), indicating that miR-210-3p overexpression caused by gains may be implicated in the bone metastasis of PCa. [score:3]
Moreover, luciferase assay revealed that upregulating miR-210-3p repressed, while silencing miR-210-3p elevated the reporter activity driven by the 3’UTRs of SOCS1 and TNIP1, but not by the mutant 3’UTR of SOCS1 and TNIP1 within the miR-210-3p–binding seed regions in PCa cells (Fig. 5e and f and Additional file 8: Fig. S4d). [score:3]
Collectively, these results indicate that overexpression of miR-210-3p is involved the bone metastasis of PCa. [score:3]
Interestingly, miR-210-3p expression was further higher in bone metastatic PCa tissues than in non-bone metastatic PCa tissues (Fig. 1c). [score:3]
The relative expressions of miR-210-3p and these proteins were used to perform the correlation analysis. [score:3]
Silencing miR-210-3p inhibits bone metastasis of PC-3 cells in vivo. [score:3]
Recurrent gains are the underlying mechanism responsible for miR-210-3p overexpression in a small portion of PCa patients. [score:3]
Moreover, our results revealed that miR-210-3p activated NF-κB signaling via targeting TNIP1 and SOCS1, which further promoted the EMT, invasion, migration and bone metastasis of PCa cells in vitro and in vivo. [score:3]
Taken together, these findings uncover a plausible mechanism responsible for constitutive activation of NF-κB signaling in bone metastasis of PCa, suggesting that miR-210-3p may serve as a novel target for clinical intervention in PCa. [score:3]
These results indicate that recurrent gains are implicated in miR-210-3p overexpression in a small portion of PCa patients. [score:3]
We further explored the functional significance of NF-κB signaling in the pro-metastasis role of miR-210-3p in PCa cells using NF-κB signaling inhibitors LY2409881 and JSH-23. [score:3]
g Kaplan-Meier analysis of mouse bone metastasis-free survival in the vector and miR-210-3p-downexpression groups. [score:3]
of PCa tissue samples revealed that miR-210-3p overexpression strongly correlated with serum PSA levels, Gleason grade and bone metastasis status in PCa (Additional file 3: Table S3 and Additional file 5: Table S4). [score:3]
RT-PCR was performed to identify the underlying mechanism of miR-210-3p overexpression in bone metastasis of PCa. [score:3]
Therefore, these findings indicate that hypoxic bone marrow microenvironment contributes to higher expression of miR-210-3p in metastatic bone tissues. [score:3]
Silencing miR-210-3p inhibits NF-κB signaling activity in PC-3 cells. [score:3]
Fig. 2Silencing miR-210-3p inhibits bone metastasis of PC-3 cells in vivo. [score:3]
​ * P < 0.05. e Quantification of the BLI signaling in the vector and miR-210-3p-downexpression groups at 45, 52 and 59 day respectively. [score:3]
Overexpression of miR-210-3p positively correlates with serum PSA levels, Gleason grade and bone metastasis status in PCa patients. [score:3]
Clinical correlation of miR-210-3p with its targets was examined in human PCa and metastatic bone tissues. [score:3]
Furthermore, the expression level of miR-210-3p in PCa tissues with the gains was robustly higher than in those without gains (Fig. 6e). [score:3]
Importantly, the miR-210-3p expression levels in bone metastatic PCa cell lines (PC-3, C4-2B and VCaP) were differentially higher than in primary PCa cell 22RV1 and brain metastatic cell line DU145 and lymph node metastatic cell line LNCaP (Fig. 1e). [score:3]
k Silencing miR-210-3p suppressed invasion and migration abilities in PC-3 cells. [score:3]
Pearson analysis revealed that miR-210-3p expression inversely correlated with SOCS1 (Additional file 10: Figure S6a. [score:3]
Furthermore, our finding demonstrated that recurrent gains are the underlying mechanism contributing to miR-210-3p overexpression in bone metastatic PCa tissues. [score:3]
Our results further indicate that recurrent gains are responsible for miR-210-3p overexpression in a small number of PCa patients. [score:3]
Furthermore, invasion and migration assays were performed and the result indicated that upregulating miR-210-3p increased, while silencing miR-210-3p decreased the invasion and migration ability of PCa cells (Fig. 3e and f and Fig. 2k). [score:3]
Moreover, cellular fractionation and western blotting analysis revealed that overexpression of miR-210-3p enhanced, while silencing of miR-210-3p reduced nuclear accumulation of NF-κB/p65 (Fig. 4b and Additional file 7: Figure S3c). [score:3]
a Analysis of miR-210-3p expression with SOCS1, TNIP1 and nuclear p65 in 3 bone metastatic PCa tissues, 3 non-bone metastatic PCa tissues and 3 metastatic bone tissues. [score:3]
Fig. 6Recurrent gains are involved in miR-210-3p overexpression in PCa. [score:3]
Hypoxic bone marrow microenvironment contributes to higher expression of miR-210-3p in metastatic bone tissues. [score:3]
To assess the mechanism underlying the higher expression of miR-210-3p in metastatic bone tissues compared with bone metastatic PCa tissues, numerous studies have reported that miR-210-3p is a direct target of hypoxia-inducible factor (HIF) [40, 41], and that the bone marrow microenvironment harbors extensive hypoxic regions characterized by abundant HIF [42– 44]. [score:3]
Bioinformatics analysis, real-time PCR, western blot and luciferase reporter analysis were applied to discern and examine the relationship between miR-210-3p and its potential targets. [score:3]
Importantly, silencing miR-210-3p significantly inhibits bone metastasis of PC-3 cells in vivo. [score:3]
P < 0.001. f miR-210-3p expression levels was markedly elevated in metastatic bone tissues compared with that in primary PCa tissues with bone metastasis (PCa/BM, n = 68; Bone, n = 9). [score:2]
b Real-time PCR analysis of miR-210-3p expression inVCaP and C4-2B cells transduced with miR-210-3p or transfected with anti-miR-210-3p compared to controls. [score:2]
miR-210-3p expression levels was markedly elevated in metastatic bone tissues compared with that in primary PCa tissues with bone metastasis (BM, n = 6; Bone, n = 7). [score:2]
miR-210-3p expression is elevated in bone metastatic PCa tissues compared with non-bone metastatic PCa tissues. [score:2]
These results suggest that miR-210-3p may regulate the NF-κB signaling pathways, which have been reported to promote bone metastasis in various types of cancers [18, 19]. [score:2]
Real-time PCR analysis of miR-210-3p expression in PC-3 cells transduced with antagomiR-210-3p compared to controls. [score:2]
As shown in Fig. 7a, miR-210-3p and nuclear p65 expression in bone metastatic PCa tissues (T4–6) was elevated compared with that in non-bone metastatic PCa tissues (T1–3)and further increased in metastatic bone tissues (T7–9). [score:2]
Furthermore, the expression of miR-210-3p was measured in 5 paired PCa/bone tissues and we found that miR-210-3p expression was elevated in metastatic bone tissues compared with the matched primary PCa tissues (Fig. 6g). [score:2]
b Hypothetical mo del illustrating that constitutive activation of the NF-κB pathway by miR-210-3p epigenetic disruption of multiple negative feedback loops leads to bone metastasis of PCa To determine the clinical significance of miR-210-3p in PCa, we first analyzed the miRNA sequencing dataset of PCa from The Cancer Genome Atlas (TCGA) and found that miR-210-3p expression was elevated in PCa tissues compared with the adjacent normal tissues (ANT) (Fig. 1a and b). [score:2]
To determine the clinical significance of miR-210-3p in PCa, we first analyzed the miRNA sequencing dataset of PCa from The Cancer Genome Atlas (TCGA) and found that miR-210-3p expression was elevated in PCa tissues compared with the adjacent normal tissues (ANT) (Fig. 1a and b). [score:2]
Moreover, microribonucleoprotein (miRNP) immunoprecipitation (IP) assay showed a direct association of miR-210-3p with SOCS1 and TNIP1 transcripts (Fig. 5g and h), which further demonstrated the direct repressive effects of miR-210-3p on SOCS1 and TNIP1. [score:2]
In this study, we report that miR-210-3p expression is elevated in PCa tissues compared with the adjacent prostate epithelial tissues (ANT). [score:2]
Therefore, it’s conceivable that miR-210-3p expression in bone tissues will be elevated compared with primary PCa tissues due to the inducible effects of abundant HIF within the hypoxic bone marrow microenvironment. [score:2]
miR-210-3p is a well-documented oncogenic miRNA implicated in various aspects of cancer development, progression and metastasis. [score:2]
a miR-210-3p expression levels was markedly elevated in PCa tissues compared with that in adjacent normal tissues (ANT) as assessed by analyzing the TCGA PCa miRNA sequencing dataset (ANT, n = 52; PCa, n = 498). [score:2]
P < 0.001. g miR-210-3p expression levels was differentially increased in metastatic bone tissues compared with that in corresponding paired priamy PCa tissues (n = 5). [score:2]
Thus, the findings of this current study improve our understanding of the molecular mechanisms underlying constitutive activation of NF-κB in bone metastasis of PCa, and provide novel insights into the development of anti-bone metastasis therapeutic strategies for PCa via silencing miR-210-3p. [score:2]
Real-time PCR analysis indicated that miR-210-3p expression in 9 individual metastatic bone tissues was significantly enhanced compared with that in 68 bone metastatic PCa tissues (Fig. 6f). [score:2]
miR-210-3p EMT Bone metastasis NF-κB signaling and prostate cancer Prostate cancer (PCa) is the most common malignant cancer and the second leading cause of cancer-related death in men worldwide [1]. [score:1]
c The percentage of miR-210-3p with gains in our PCa samples. [score:1]
In this study, our results revealed that miR-210-3p was elevated in human bone metastatic PCa tissues and cells. [score:1]
Therefore, our results uncover a novel mechanism by which miR-210-3p sustains constitutive activation of NF-κB signaling, elucidating the oncogenic function of miR-210-3p in bone metastasis of PCa. [score:1]
These results suggest that NF-κB signaling activation is essential for the pro-metastasis role of miR-210-3p in PCa cells. [score:1]
miR-210-3p activates NF-kB signaling pathway in PCa cells. [score:1]
Individual silencing of SOCS1 and TNIP1 rescued the repression of the invasive ability in miR-210-3p- silenced PCa cells (Additional file 8: Figure S4f). [score:1]
However, the clinical significance and biological roles of miR-210-3p in PCa bone metastasis remain obscure. [score:1]
Clinical correlation of miR-210-3p with TNIP1, SOCS1 and NF-κB activation in human PCa tissues. [score:1]
The analysis of clinical correlation reveals that miR-210-3p inversely correlates with SOCS1 and TNIP1, but positively correlates with NF-κB signaling activity in human PCa and metastatic bone tissues. [score:1]
Notably, the stimulatory effect of miR-210-3p on NF-κB activity was attenuated by LY2409881 and JSH-23 (Fig. 4e). [score:1]
d Percentages and number of miR-210-3p samples with gains in PCa patients with different bone metastasis statues in our PCa samples. [score:1]
However, the biological roles and clinical significance of miR-210-3p in bone metastasis of PCa remains largely unknown. [score:1]
Clinical correaltion of miR-210-3p with SOCS1, TNIP1 and nuclear p65 in human PCa and bone tissues. [score:1]
The chi-square test was used to analyze the relationship between miR-210-3p expression and clinicopathological characteristics. [score:1]
The clinical correlation of miR-210-3p with SOCS1, TNIP1 and NF-κB signaling activity is verified in PCa tissues. [score:1]
Furthermore, recent literatures have identified miR-210-3p as a serum marker in many types of cancer, which will facilitate the early detection of metastatic tumors [68, 69]. [score:1]
Silencing miR-210-3p repressed EMT, invasion and migration in PC-3 cells in vitro. [score:1]
Moreover, a study by Taddei showed that hypoxia -induced miR-210 in fibroblasts enhanced the senescence -associated features, which promoted PCa aggressiveness by inducing EMT and by secreting energy-rich compounds to support PCa cell growth [70]. [score:1]
Therefore, our finding uncover a novel mechanism by which miR-210-3p disrupts the negative feedback loops of NF-κB signaling in PCa cells, which results in constitutive activation of NF-κB signaling, supporting the notion that NF-κB signaling contributes to the bone metastasis of PCa. [score:1]
NF-κB activation mediates the pro-metastasis role of miR-210-3p in PCa cells. [score:1]
Collectively, our findings indicate that miR-210-3p plays an important role in the bone metastasis of PCa. [score:1]
d The sum of bone metastasis scores for each mouse in tumor-bearing mice inoculated with vector (n = 9) or anti-miR-210-3p (n = 8) cells. [score:1]
Thus, these results demonstrate that miR-210-3p activates NF-κB signaling pathway in PCa cells. [score:1]
Furthermore, individual silencing of SOCS1 and TNIP1 reversed the repression of NF-κB activity by miR-210-3p silencing in PCa cells (Additional file 8: Figure S4e). [score:1]
H&E staining of the tumor sections from the tibias of injected mice demonstrated that silencing miR-210-3p dramatically reduecd the tumor burden in bone (Fige. [score:1]
The human miR-210-3p gene was PCR-amplified from genomic DNA and cloned into a pMSCV-puro retroviral vector (Clontech, Japan). [score:1]
a The percentage of miR-210-3p with gains in the PCa samples from TCGA. [score:1]
i Silencing miR-210-3p converted a stick-like or long spindleshaped mesenchymal profile to a cobblestone-like or a short spindle-shaped epithelial morphology in PC-3 cells. [score:1]
Fig. 7Clinical relevance of miR-210-3p with SOCS1, TNIP1 and NF-kB signaling activity in human PCa and bone tissues. [score:1]
To establish a rapid mouse mo del of bone metastasis, the luciferase-labeled vector or miR-210-3p-silencing PC-3 cells were inoculated perspectively into the left cardiac ventricle of male nude mice to monitor the progression of bone metastasis by bioluminescence imaging (BLI). [score:1]
These results indicate that miR-210-3p promotes the EMT, invasion and migration in PCa cells in vitro. [score:1]
miR-210-3p expression was evaluated by real-time PCR in 68 bone metastatic and 81 non-bone metastatic PCa tissues. [score:1]
miR-210-3p promotes EMT, migration and invasion in PCa cells. [score:1]
b Hypothetical mo del illustrating that constitutive activation of the NF-κB pathway by miR-210-3p epigenetic disruption of multiple negative feedback loops leads to bone metastasis of PCa The key findings of the current study present novel insights into the critical role of miR-210-3p in the sustained activation of NF-κB signaling, which further promotes bone metastasis of PCa. [score:1]
b Percentages and number of miR-210-3p samples with gains in PCa patients with different bone metastasis statues in TCGA dataset (n. s. = no significance). [score:1]
By contrast, silencing miR-210-3p repressed these downstream genes in PCa cells (Fig. 4c and d and Additional file 7: Figure S3d). [score:1]
[1 to 20 of 139 sentences]
2
[+] score: 408
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21a, mmu-mir-210, mmu-mir-21b, mmu-mir-21c
Similar to the previously reported context-specific target gene predilection for miR-21 in PH (Parikh et al, 2012), the apparent favoring of ISCU1/2 as a target of miR-210 in the hypoxic pulmonary endothelium is not an uncommon scenario in miRNA biology where, with increased specific miRNA expression, only a subset of its validated gene targets may display a net down-regulation. [score:12]
Supporting the role of the miR-210-ISCU1/2 axis in such Fe-S down-regulation, Fe-S -dependent GRX2 sensor fluorescence was also decreased in the absence of hypoxia by small interfering RNA (siRNA) knockdown of ISCU1/2 (Fig 2B, efficiency of knockdown as demonstrated in Supplementary Fig S8A) or separately, by forced miR-210 expression [Fig 2C, expression as we previously reported (Chan et al, 2009)]. [score:10]
M, N Pharmacologic inhibition of miR-210 (N = 7/group) down-regulated pulmonary expression of miR-210, *** P < 0.0001 (M), and preserved ISCU1/2 expression in < 100-μm pulmonary vessels, ** P = 0.0015 (N). [score:10]
We present evidence in mice and humans whereby the hypoxia-inducible microRNA-210 down-regulates its target ISCU1/2 in order to regulate the pulmonary vascular and endothelial expression of Fe-S clusters both through acquired injury (e. g. hypoxia) and genetic mutations. [score:10]
Conversely, the direct miR-210 targets ISCU1/2, detected specifically by immunohistochemical stain (Supplementary Fig S3B), were down-regulated in diseased pulmonary vasculature of mice and humans (Fig 1F and G) suffering from PH, but not in unaffected peripheral vasculature (Supplementary Fig S4B– D). [score:9]
A regimen to prevent PH development (“prevention study”; Fig 5A) down-regulated miR-210 expression in lungs of mice exposed to hypoxia + SU5416, as assessed by RT–qPCR of whole lung (Fig 5B), by RT–qPCR of PECAM [+] pulmonary vascular cells from diseased lungs (Fig 5C), and by in situ pulmonary vascular staining (Fig 5D). [score:9]
Alternatively, indirect regulatory pathways may exist in hypoxia that ultimately may be more powerful stimuli on certain target genes than any direct miR-210 engagement of the target transcripts themselves. [score:8]
MiR-210 expression was also up-regulated in the small diseased pulmonary arterioles (< 200 μm external diameter) in human PAH lung tissues compared with those arterioles observed in non-diseased human lung tissue (Fig 1D; patient demographics in Supplementary Table S1). [score:8]
These PECAM [+] cells (> 95% purity, Supplementary Fig S5) displayed an up-regulation of miR-210 by RT–PCR (Fig 1H, Supplementary Fig S6A) and a down-regulation of ISCU1/2 (by antibody staining and flow cytometry, Fig 1I, Supplementary Fig S6B). [score:7]
In contrast, the expression of other reported targets of miR-210, such as SDHD, COX10, E2F3, and Ephrin A3, was unchanged or even increased in diseased PECAM [+] cells from hypoxic mice as assessed by flow cytometry (Supplementary Fig S6C– F) or immunohistochemical stain of remo deled pulmonary vessels (Supplementary Fig S7A and B). [score:7]
Guided by the intimal expression of miR-210, we wanted to quantify specifically the expression of miR-210 and ISCU1/2 in diseased pulmonary vascular endothelial cells. [score:7]
F, G From animals in (C) and humans in (D), immunohistochemistry (IHC) revealed that the miR-210 targets ISCU1/2 were reciprocally down-regulated in miR-210-enriched remo deled pulmonary vessels—namely in PH mice exposed to Hyp + SU5416 (F, *** P = 0.0002) and in human PAH patients (G, *** P = 0.0008). [score:6]
Thus, by delineating a consistent reliance on mitochondrial metabolism in miR-210 [−/−] mice even under PH disease conditions, these findings demonstrated that miR-210 is necessary, at least in part, for the metabolic dysregulation observed in diseased pulmonary vasculature in vivo. [score:6]
By interrogating that mo del further in both acquired injury (e. g. hypoxia) and genetic human disease (ISCU mut/mut), we now define the miR-210-ISCU1/2 regulatory axis as a crucial pathogenic lynchpin of pulmonary vascular disease in vivo. [score:6]
B–D Intravenous delivery of anti-miR-210 down-regulated miR-210 expression in whole lung tissue (N = 7/group), *** P < 0.0001 (B), the pulmonary vasculature as assessed by in situ staining (N = 7/group), *** P = 0.0003 (C), and PECAM [+] vascular endothelial cells derived from whole lung tissue (N = 4/group), ** P = 0.0013 (D). [score:6]
Such staining revealed that miR-210 expression was induced within the diseased pulmonary vasculature of mice (< 100 μm external diameter vessels) (Fig 1B and C), as compared with non-diseased tissue and miR-scrambled control probe (Supplementary Fig S3A). [score:6]
Corresponding with the link between inflammatory cytokine stimulation and up-regulated HIF activity, miR-210 was also induced in inflammatory mouse mo dels of PH driven by transgenic pulmonary interleukin-6 (IL-6) expression [elevated right ventricular systolic pressures reported in Steiner et al (2009)] and by chronic S.  mansoni infection (Fig 1A, Supplementary Fig S2A). [score:6]
B, C Pharmacologic inhibition of ISCU (N = 8/group) did not influence miR-210 expression in the lungs either after Norm + SU5415, NS P = 0.8634 (B) or Hyp + SU5416, NS P = 0.9786 (C). [score:5]
Fe-S integrity is decreased in hypoxic pulmonary vascular cells and in hypoxic PH in vivoPreviously, we postulated that the down-regulation of Fe-S levels in PAECs is directly mediated by miR-210 and ISCU1/2 (Chan et al, 2009). [score:5]
Thus, similar to both hypoxia and forced miR-210 expression, knockdown of ISCU1/2 promoted PH, thereby confirming the direct importance of Fe-S biogenesis in pulmonary vascular homeostasis and PH manifestation in vivo. [score:5]
Previously, we postulated that the down-regulation of Fe-S levels in PAECs is directly mediated by miR-210 and ISCU1/2 (Chan et al, 2009). [score:5]
Based on our prior studies of the regulation of miR-210 in pulmonary arterial endothelial cells (PAECs) (Chan et al, 2009) and the up-regulation of both HIF-1α and HIF-2α in vascular endothelial cells in hypoxia-relevant PH in mice (Supplementary Fig S1), we hypothesized that the miR-210-ISCU1/2 axis is active in various forms of PH stemming from hypoxia -dependent or HIF -dependent activity. [score:5]
However, in contrast to decreased ISCU1/2 in diseased pulmonary vessels of WT mice exposed to hypoxia + SU5416, miR-210 [−/−] mice displayed preserved ISCU1/2 expression in small pulmonary vessels (< 100 μm) under those same conditions (Fig 3B). [score:5]
Figure 5Antisense inhibition of miR-210 protects against and improves existing manifestations of PH in vivo A Schema of the strategy to determine whether antisense inhibition of miR-210 (anti-miR-210) prevents PH secondary to Hyp + SU5416 exposure (“prevention protocol”). [score:5]
Correspondingly, despite increased pulmonary vascular expression of the HIF-responsive glucose transporter-1 (GLUT1) in diseased WT mice (Fig 3D), GLUT1 in miR-210 [−/−] pulmonary vessels was unchanged. [score:5]
Thus, diseased pulmonary vasculature may even rely upon circulating miR-210 as a molecular messenger to communicate with other recipient tissues during disease progression. [score:5]
In that vein, the concept of miR-210, ISCU1/2, and Fe-S deficiency as pathogenic determinants in PH has even further translational significance for improving both diagnosis and therapeutic management of this disease. [score:5]
Studying cultured cells, we previously reported that hypoxia up-regulated the HIF-α -dependent microRNA-210 (miR-210), leading to specific mitochondrial and metabolic alterations (Chan et al, 2009). [score:4]
Moreover, we have recently shown that extracellular miR-210 can be taken up by recipient tissue to induce ISCU1/2 down-regulation and metabolic effects beyond the source tissue (Hale et al, 2014). [score:4]
Furthermore, taken together, we can conclude that, in both mouse mo dels and human examples of PH in vivo, the miR-210-ISCU1/2 regulatory axis is activated in small diseased pulmonary vessels, particularly in endothelial cells. [score:4]
Consistent with the activation of the miR-210-ISCU1/2 axis in vascular endothelial cells, based on flow cytometric analysis, such PCNA up-regulation corresponded specifically to PECAM [+] pulmonary vascular endothelial cells (Fig 3H). [score:4]
Anti-miR-210 prevented endothelin-1 up-regulation (Supplementary Fig S12B), and, as in miR-210 [−/−] mice, anti-miR-210 also reduced the number of proliferating PCNA -positive vascular cells (Fig 5H). [score:4]
H, I miR-210 expression (H) was increased (*** P = 0.0003), and ISCU1/2 expression (I) was decreased (*** P < 0.0001) in PECAM [+] pulmonary vascular endothelial cells isolated from PH mice (Hyp + SU5416) as compared with control (Norm + SU5416) (N = 4/group, left bars). [score:4]
Our findings offer an alternative paradigm of pathogenesis whereby mitochondrial respiratory activity is dysregulated, independent of respiratory complex protein expression but critically dependent on miR-210, ISCU1/2, and Fe-S integrity. [score:4]
Our findings also emphasize the direct relevance of the miR-210-ISCU1/2-Fe-S regulatory axis and mitochondrial metabolic dysfunction in pulmonary arterial endothelial cells for overall PH development. [score:4]
Delivery resulted in miR-210 up-regulation in whole lung tissue (Fig 4B) and in small pulmonary vessels (Fig 4C) but not the heart or other organs (Supplementary Fig S14). [score:4]
Consistent with findings in cultured PAECs (Supplementary Fig S12A), endothelin-1 in pulmonary tissue was also up-regulated by miR-210 (Fig 4E). [score:4]
Therefore, activation of miR-210 and down-regulation of ISCU1/2 are sufficient for repressing Fe-S levels in endothelial cells throughout the human pulmonary vascular tree and are necessary to do so during hypoxia. [score:4]
miR-210 was also up-regulated in lungs of mice suffering from PH stemming from chronic hypoxia (10% O [2]) (Supplementary Fig S2B) and in mouse lungs with more severe PH (Supplementary Fig S2A) stemming from chronic hypoxia accompanied by serial administration of the VEGF-receptor antagonist SU5416 (Fig 1A). [score:4]
Demonstrating the essential role of miR-210 in this hypoxic response, antisense inhibition of miR-210 partially rescued GRX2 fluorescence in the presence of hypoxia (Fig 2C). [score:3]
Gain-of-function and loss-of-function experiments were also performed to manipulate miR-210 and ISCU1/2 expression in the pulmonary vasculature of mice, followed by molecular and physiologic analyses relevant to Fe-S -dependent functions. [score:3]
So, while the miR-210-ISCU1/2 axis indeed appears active at least to a certain degree in diseased PASMCs (Fig 1C and F, Supplementary Fig S16), our results demonstrate the particularly robust actions of miR-210 in PAECs (Chan et al, 2009). [score:3]
Thus, the elucidation of the miR-210-ISCU1/2-Fe-S axis expands the pervasive relevance of mitochondrial dysfunction in additional vascular cell types beyond muscle tissue in PH and emphasizes the therapeutic potential of targeting this metabolic pathway in vascular endothelium. [score:3]
First, in the presence of SU5416 but in the absence of hypoxia, chronic pulmonary expression of miR-210 in WT mice was achieved by serial intrapharyngeal injections of liposomally encapsulated miR-210 oligonucleotide mimics, as adapted from prior protocols (Bertero et al, 2014) (Fig 4A). [score:3]
This decrease of miR-210 was accompanied by de-repression of ISCU1/2 expression as assessed by in situ staining (Fig 5E) and flow cytometric assessment of PECAM [+] endothelial cells (Fig 5F). [score:3]
C, D Consistent with specific delivery to the vascular endothelium after intravenous administration (Dahlman et al, 2014), 7C1 -mediated delivery of anti-miR-210 (N = 6/group) decreased miR-210 expression in PECAM [+] pulmonary vascular endothelial cells, ** P = 0.0013, (D) but not PECAM -negative pulmonary cells, NS P = 0.3775 (C). [score:3]
Finally, this work could serve as a foundation for discovery of the actions of miR-210, ISCU1/2, and Fe-S biology in additional diseases beyond PH that may share similar hypoxic, genetic, and metabolic underpinnings. [score:3]
E Correspondingly, endothelial-specific anti-miR-210 (N = 6/group) increased ISCU1/2 expression in PECAM [+] cells even in the presence of chronic hypoxia, *** P = 0.0003. [score:3]
For example, while iron content in whole-cell lysates of miR-210 -expressing PAECs was unchanged compared with control PAECs (consistent with the findings of unchanged total pulmonary iron content in hypoxic mice, Supplementary Fig S10F), mitochondrial iron levels were greater with miR-210 expression as compared with control (Supplementary Fig S15). [score:3]
First, using a fluorescent GRX2 transgene sensor system, Fe-S clusters were quantified in diseased PECAM [+] endothelial cells from PH mice and in cultured cells in hypoxia or after manipulation of either miR-210 or ISCU1/2. [score:3]
Therefore, our results not only provide a mechanistic explanation linking Fe-S biogenesis and mitochondrial respiratory activity to PH but also establish PH as the first of perhaps many mammalian “iron–sulfur” diseases driven by miR-210, ISCU1/2, and deficiencies in Fe-S clusters. [score:3]
Additionally, given the number of potential Fe-S biogenesis targets (Rouault & Tong, 2008; Rouault, 2012) beyond ISCU1/2, it is plausible that unidentified miRNAs act in concert with miR-210 to control further Fe-S biogenesis and other PH manifestations. [score:3]
Consistent with previous descriptions of alternative gene targets of miR-210 important in iron transport (Yoshioka et al, 2012; Qiao et al, 2013), it is possible that miR-210 may exert additional control over iron homeostasis in vivo. [score:3]
Corresponding with such endothelial-specific delivery, miR-210 level was decreased and ISCU1/2 expression was increased in those same PECAM [+] cells (Fig 6D and E). [score:3]
Despite absent expression of miR-210 (Supplementary Fig S11), mice were viable at baseline and displayed no grossly abnormal phenotype. [score:3]
Interestingly, levels of other reported miR-210 targets such E2F3 and Ephrin A3 (Supplementary Fig S7C and D) were unchanged, again indicating the importance of ISCU1/2 in the specific actions of miR-210 in this context. [score:3]
Nonetheless, other gene targets of miR-210 may still influence PH via processes beyond mitochondrial function and in cell types other than the pulmonary endothelium (Chan & Loscalzo, 2010; Gou et al, 2012). [score:3]
Thus, we conclude that chronic induction of miR-210 in vivo represses ISCU1/2 as a primary target, leading to disruption of Fe-S biogenesis, mitochondrial metabolism, and pathologic alteration of the proliferative and oxidative states of the pulmonary vasculature. [score:3]
Under the same conditions, expression of the potent vasoconstrictor endothelin-1 was also decreased in miR-210 [−/−] pulmonary tissue (Fig 3F), consistent with alterations of endothelin-1 in cultured PAECs by miR-210 (Supplementary Fig S12). [score:3]
Such findings emphasize the unique importance of ISCU1/2 as a canonical miR-210 target gene in this context. [score:3]
However, the effects in health or disease of chronic activation of the miR-210-ISCU1/2 axis with consequent repression of Fe-S clusters in vivo are not known. [score:3]
Taken together, these data demonstrate that deficiencies in Fe-S integrity, mediated in large part by hypoxia and the miR-210-ISCU1/2 axis, are prevalent in PH and may play a fundamental role in controlling pulmonary vascular homeostasis and disease. [score:3]
To establish more definitively the causative actions of miR-210 and ISCU1/2 in PH, we next employed a variety of protocols for pharmacologic administration of miR-210 oligonucleotide mimics or inhibitors as well as a siRNA specific for ISCU1/2 in the pulmonary vasculature of mice. [score:3]
Similarly, when administered to ameliorate already existing PH [using a “reversal study” protocol which we previously described (Bertero et al, 2014)] (Fig 5L), anti-miR-210 similarly decreased pulmonary vascular miR-210 (Fig 5M), increased ISCU1/2 expression (Fig 5N), and significantly ameliorated elevations of RVSP and vessel remo deling (Fig 5O– Q). [score:3]
F Similarly, ISCU1/2 expression was preserved in PECAM [+] endothelial cells derived from mice treated with anti-miR-210 (N = 4/group), ** P = 0.0016. [score:3]
Separately, endogenous miR-210 in WT mice was pharmacologically inhibited by serial weekly intravenous injections of 2′-F- and 2′-O-methoxyethyl (2′MOE) -modified anti-miR-210 oligonucleotides, as we previously described (Bertero et al, 2014). [score:3]
Diseased pulmonary tissue from mice and separate cohorts of human patients was subjected to quantitative analysis by RT–PCR and in situ histology to measure expression of miR-210 and ISCU1/2. [score:3]
Pharmacologic inhibition of miR-210 (Figs 5 and 6) also could be promising in humans, especially with the advent of specific anti-miR delivery methods to the pulmonary vasculature and endothelium (Figs 6 and 7). [score:3]
Comparison of the roles of miR-210 in different cellular and disease contexts may further highlight these differences. [score:3]
Figure 4MiR-210 is sufficient to induce pulmonary vascular dysfunction in mice A Schema for forced miR-210 expression in vivo (N = 8/group). [score:3]
J Compared with WT controls (N = 9), miR-210 [−/−] mice (N = 8) displayed a blunted increase of the Fulton index (RV/LV + S) under PH versus baseline conditions (expressed as a ratio of RV/LV + S under Hyp + SU5416 versus Norm + SU5416, * P = 0.031). [score:2]
First, delivery of siISCU did not alter miR-210 expression either under normoxia or hypoxia compared to the siControl mice (Fig 7B and C). [score:2]
In contrast, PCNA expression was reduced in the miR-210 [−/−] pulmonary vascular wall compared with WT controls (Fig 3G). [score:2]
E Correspondingly, anti-miR-210 delivery resulted in preservation of ISCU1/2 expression in < 100-μm pulmonary vessels as compared to anti-miR-Control (N = 5/group), ** P = 0.0011. [score:2]
Consistent with the role for ISCU1/2 and Fe-S biogenesis in mitochondrial electron transport in cultured cells (Chan et al, 2009), mitochondrial respiratory complex activity (Complex I) was also preserved in pulmonary tissue harvested from miR-210 [−/−] mice as compared with decreased activity in diseased WT mice exposed to hypoxia + SU5416 (Fig 3C). [score:2]
In turn, chronic miR-210 expression led to elevated right ventricular systolic pressure (RVSP) compared with WT littermates treated with miR-Control (Fig 4F). [score:2]
Furthermore, distal pulmonary vessel remo deling was significantly alleviated in miR-210 [−/−] mice compared with diseased WT littermates (Fig 3K– M). [score:2]
Moreover, together with our cellular and rodent studies, these results confirm the direct causative relationship of the miR-210-ISCU axis with PH, as driven by either acquired (hypoxia driven) or human genetic (ISCU mut/mut) alterations. [score:2]
Furthermore, using genetic and pharmacologic methods to perform gain-of-function and loss-of-function analyses in the rodent pulmonary vasculature in vivo coupled with the first-known observation of pulmonary vasculopathy in a human harboring a loss-of-function mutation of ISCU, we define the microRNA-210-ISCU1/2 axis as an overarching upstream pathogenic mechanism, central to the vascular and endothelial metabolic alterations that promote PH. [score:2]
During hypoxic exposure, GRX2, but not GCN4, sensor fluorescence was increased after transfection of an antisense miR-210 inhibitor (AS210) as compared with control (ASC) (N = 3, ** P = 0.003 for GRX2; N = 3, NS P = 0.1194 for GCN4). [score:2]
Such alterations of Fe-S levels were also not dependent upon reduction of total mitochondrial content in cultured pulmonary vascular cell types exposed to hypoxia (Supplementary Fig S10A and B), in mice exposed to hypoxia + SU5416 (Supplementary Fig S10C), or in mice where miR-210/ISCU1/2 were directly manipulated (Supplementary Fig S10D and E). [score:2]
Figure 3miR-210 regulates Fe-S biogenesis, mitochondrial function, and downstream PH pathways in vivo and is necessary to induce hypoxic PH in mice A Schema of comparing miR-210 [−/−] and WT mice after hypoxia + SU5416 (PH) versus normoxia + SU5416 (control). [score:2]
I Unlike WT mice (black bars) demonstrating increased right ventricular systolic pressure (RVSP) after Hyp + SU5416 (N = 10) versus Norm + SU5416 (N = 11), hemodynamic dysregulation was significantly alleviated in miR-210 [−/−] mice (white bars, N = 11) (*** P < 0.0001, * P = 0.0258, ** P = 0.0059). [score:2]
Expression levels of 3-nitrotyrosine, a marker of oxidative stress in the pulmonary vasculature, were significantly reduced in the pulmonary vessels of miR-210 [−/−] mice as compared with WT controls following hypoxia + SU5416 (Fig 3E). [score:2]
In that context, to determine whether endothelial-specific actions of the miR-210-ISCU1/2 axis are necessary for hypoxia -induced PH development, serial delivery in vivo of anti-miR-210 to the pulmonary vascular endothelium was achieved using the recently described 7C1 nanoparticle delivery system (Dahlman et al, 2014). [score:2]
Importantly, the miR-210-ISCU1/2 axis similarly regulated Fe-S levels in endothelial cells derived throughout the pulmonary vascular tree (Supplementary Fig S9). [score:2]
Figure 6Antisense inhibition of miR-210 specifically in vascular endothelium improves existing manifestations of PH in vivo A Following the schema of Fig 5A in the presence of hypoxia but the absence of SU5416, intravenous delivery of anti-miR-210 ameliorated the elevation of RVSP compared with anti-miR-Control (N = 6/group, *** P = 0.001). [score:2]
Knockdown of ISCU1/2 independent of miR-210 in the pulmonary vasculature promotes PH. [score:2]
The miR-210-ISCU1/2 regulatory axis is activated in PH related to hypoxia and HIF activity. [score:2]
Yet, compared with WT controls, miR-210 [−/−] mice displayed a blunted increase of RV/LV + S (Fulton index) under disease versus baseline conditions, thus indicating at least partial protection from the RV hypertrophic response and consistent with the hemodynamic improvement (Fig 3J). [score:2]
Data information: In (A, B), mean expression of miR-210 in control groups was assigned a fold change of 1, to which all samples were compared. [score:2]
O–Q In contrast to anti-miR-Control (N = 8), anti-miR-210 ameliorated the elevation of RVSP (N = 10/group, *** P < 0.0001) (O) and pulmonary vascular remo deling (N = 7/group, ** P = 0.0022, * P = 0.0167) (P–Q). [score:1]
Thus, using both genetic and pharmacologic methods, we conclude that chronic induction of endogenous miR-210, particularly in endothelial cells, is necessary and sufficient to promote hypoxia -induced PH in vivo. [score:1]
Beyond hypoxic activation of miR-210, other triggers, independent of hypoxia and HIF, may reduce ISCU1/2 and thus provoke pulmonary vascular dysfunction. [score:1]
G Endothelin-1 was decreased in lung tissue from mice treated with anti-miR-210 during Hyp + SU5416 exposure (N = 6/group), * P = 0.0181. [score:1]
G PCNA was increased in WT PH pulmonary vessels but was decreased in miR-210 [−/−] tissue exposed to either condition (N = 5/group) (** P = 0.0096, * P = 0.0124, * P = 0.0263 for miR-210 [−/−] ). [score:1]
Thus, miR-210 is necessary for the hypoxic induction of PH in vivo. [score:1]
B Schema of the strategy to determine whether delivery of anti-miR-210 specifically to the vascular endothelium via packaging with 7C1 nanoparticles improves hypoxia -induced PH (“7C1 reversal protocol”). [score:1]
The finding of increased levels of plasma -based miR-210 in a small cohort of PH patients (Fig 1E) could serve as the basis for the future study of miR-210 as a specific biomarker for PH. [score:1]
By RT–PCR, we found that miR-210 was induced in the lungs of mice deficient in the von Hippel–Lindau gene (VHL [−/−]), a genetic mo del of PH driven by constitutive HIF-α activation (Fig 1A, Supplementary Fig S2A). [score:1]
As a result, in contrast to anti-miR-Control (N = 8), endothelial-specific anti-miR-210 ameliorated the elevation of RVSP (N = 6), ** P = 0.0024 (G), and pulmonary vascular remo deling (N = 6/group), ** P = 0.0021, * P = 0.0117 (H–I). [score:1]
Yet, considering our results demonstrating PH manifestation after repressing ISCU1/2 alone (Fig 7), we conclude that the actions of miR-210 in the pulmonary vasculature in large part are concentrated on Fe-S biogenesis and downstream mitochondrial dysfunction. [score:1]
When intravenously administered to ameliorate already existing PH induced by hypoxia alone without SU5416 (“reversal study”; Fig 6B), endothelial delivery of 7C1-encapsulated anti-miR-210 led to a decrease in miR-210 specifically in PECAM [+] pulmonary vascular endothelial cells but not in other PECAM -negative pulmonary cells (Fig 6C). [score:1]
To delineate the metabolic actions of miR-210 in vivo (Fig 3A), we analyzed mice carrying homozygous deletions of the mmu-miR-210 gene (miR-210 [−/−]) as described (Prosser et al, 2011; Mok et al, 2013). [score:1]
BNC co-designed the experiments and provided reagents utilizing anti-miR-210. [score:1]
Hypoxic induction of miR-210 induces oxidative stress and pulmonary vascular proliferation via repression of Fe-S biogenesis and mitochondrial metabolism. [score:1]
K–M Under PH (black bars, N = 8/group) versus baseline conditions (white bars, N = 6/group), pulmonary vascular remo deling was alleviated in miR-210 [−/−] mice, as visualized via histology (L), and confirmed by decreased % arteriolar muscularization (K, ** P = 0.001, ** P = 0.0045 for miR-210 [−/−], * P = 0.0158) and decreased vessel wall thickness (M, *** P < 0.0001, ** P = 0.0086). [score:1]
To demonstrate definitively the importance of ISCU1/2 and Fe-S biogenesis in the actions of miR-210 and hypoxia in PH, we assessed the consequences of repressing ISCU1/2 in the pulmonary vasculature independent of hypoxia or miR-210 manipulation. [score:1]
Thus, even in the absence of hypoxia, miR-210 induction is sufficient to induce pulmonary vascular dysfunction in vivo. [score:1]
Moreover, such endothelial-specific miR-210 repression significantly ameliorated elevations of RVSP (Fig 6G) and vessel remo deling (Fig 6H and I). [score:1]
Given the altered metabolic and cellular phenotypes driven by miR-210, we wanted to determine whether chronic induction of this miRNA is necessary and sufficient to promote PH. [score:1]
Furthermore, using genetic and pharmacologic methods to perform gain-of-function and loss-of-function analyses in the rodent pulmonary vasculature in vivo coupled with the first-known observation of pulmonary vasculopathy in an ISCU mut/mut human, we define the miR-210-ISCU1/2 axis as an overarching upstream pathogenic mechanism, central to the vascular and endothelial metabolic alterations that promote PH (Fig 7J). [score:1]
HMP constructed the mmu-miR-210 [−/−] mice and aided in their care during experimental study. [score:1]
I–K Anti-miR-210 delivery (N = 10/group) ameliorated the elevation of RVSP, ** P = 0.0031 (i) and vascular remo deling, as reflected by increased percent of muscularized arterioles (N = 8/group, ** P = 0.0091) (J) and increased medial thickness relative to vessel diameter in < 100-μm pulmonary vessels (N = 6/group, ** P = 0.0021) (K). [score:1]
Pulmonary vascular induction of miR-210, particularly in the endothelium, promotes PH. [score:1]
D miR-210 mimic also repressed ISCU1/2 levels in those same caliber vessels (N = 6/group), ** P = 0.0022. [score:1]
F–I Delivery of anti-miR-210 (N = 5/group) decreased endothelin-1 in hypoxic mouse lung tissue, * P = 0.0198 (F). [score:1]
E 3-nitrotyrosine (3-NT) was increased in pulmonary vessels of WT PH mice but was reduced in miR-210 [−/−] mice in either condition (N = 6/group) (*** P < 0.0001, NS P = 0.4087). [score:1]
B By immunohistochemistry (IHC), ISCU1/2 was unchanged in < 100 μm pulmonary vessels of miR-210 [−/−] mice exposed to Hyp + SU5416 (N = 6) versus Norm + SU5416 (N = 7), NS P = 0.2833. [score:1]
The distinct HIF and hypoxia dependence of miR-210 coupled with the hypoxia-independent genetic (ISCU mut/mut) predisposition to PH demonstrates the wide spectrum of human PH subtypes where control of Fe-S integrity controls pathogenesis, encompassing at least Group 1 PAH (HIF dependent), Group 3 PH (hypoxia dependent), and likely Group 5 PH (“metabolic” dysfunction) (Simonneau et al, 2013). [score:1]
Next, we wanted to determine whether this miR-210 -dependent metabolic shift is associated with phenotypes consistent with the cellular manifestations of PH. [score:1]
B From animal subjects in (A), in situ hybridization (ISH, purple stain) revealed increased miR-210 in < 100-μm pulmonary vessels of mice suffering from PH, * P = 0.0493 for first graph, ** P = 0.0015 for second graph, * P = 0.0391 for third graph. [score:1]
H As assessed by in situ immunofluorescence, PCNA was decreased in pulmonary vessels (< 100 μm) after anti-miR-210 delivery, ** P = 0.001. [score:1]
E Endothelin-1 was increased in mouse lung tissue after delivery of miR-210 mimic (N = 6/group), * P = 0.0368. [score:1]
Figure 2Impaired Fe-S cluster integrity in diseased pulmonary vasculature is driven by the miR-210-ISCU1/2 axis After lentiviral delivery of GCN4 or GRX2 sensor genes to human PAECs, cellular fluorescence was measured by flow cytometry. [score:1]
Upstream of ISCU1/2, our work highlights miR-210 as one of the several miRNAs known to modulate pulmonary vascular function and PH in vivo. [score:1]
B, C Intrapharyngeal delivery of miR-210 mimic increased miR-210 in whole lung (*** P = 0.0002) (B) and in < 100-μm pulmonary vessels (** P = 0.007) (C). [score:1]
Among other vascular cell types, staining for miR-210 was also evident in the intimal layer of remo deled vessels, consistent with prior studies implicating the robust actions of miR-210 in PAECs (Chan et al, 2009). [score:1]
With hypoxia + SU5416, miR-210 [−/−] mice were substantially protected against the development of PH, exhibiting only slight increases in RVSP as compared with more substantial elevations in WT control mice (Fig 3I). [score:1]
Induction of miR-210 was observed in remo deled pulmonary vessels (Fig 1B) but not in other peripheral vascular tissue (Supplementary Fig S4A). [score:1]
To ensure that SU5416 was not confounding the actions of anti-miR-210, mice were exposed to anti-miR-210 and hypoxia alone with significant prevention of hemodynamic manifestations of PH (Fig 6A). [score:1]
D IHC demonstrated that pulmonary vascular GLUT1 was increased in WT PH mice (left bars, *** P = 0.0006), but GLUT1 was unchanged in miR-210 [−/−] mice in either condition (right bars, NS P = 0.9967). [score:1]
L Schema of the strategy to determine whether anti-miR-210 improves existing PH (“reversal protocol”). [score:1]
[1 to 20 of 133 sentences]
3
[+] score: 297
In respect to the involvement on erythroid functions, the major conclusions of the present study are the following: (a) microRNA-210 expression is increased in ErPCs from a β-thalassemia patients expressing high levels of HbF (Fig 2A, 2D and 2F); (b) microRNA-210 expression increases following MTH-treatment of K562 cells and human ErPCs from β-thalassemia patients (Fig 2B and 2E, Figs 7 and 8); (c) this increase in microRNA-210 is associated with erythroid induction and elevated expression of γ-globin genes (Fig 2E and 2F, Figs 6B and 12A); (d) anti-microRNA-210 interferes with the MTH -induced changes of gene expression in MTH -treated K562 cells (Figs 3, 4 and 12E). [score:11]
From this gene expression profile, 358 genes among 748 mRNAs were found down-regulated by MTH and selectively induced by microRNA-210 inhibition with anti-microRNA-210. [score:8]
In respect to the identification of possible targets of microRNA-210, our study allowed us to identify raptor mRNA as (a) a sequence containing a 3’-UTR region with several microRNA -binding sites including two binding sites for microRNA-210 (Fig 5B); (b) expressed at low levels in ErPCs from a β-thalassemia patients producing high levels of HbF (Fig 5A); (c) down-regulated during MTH-induction of K562 cells and ErPCs from β-thalassemia patients (Figs 3A, 6B, 7B and 7D, Figs 8B and 11). [score:8]
Representation of the intersections of microRNA-210 targets whose expression is down-regulated in ErPCs from Th17 (high HbF) vs. [score:8]
Altogether, these results strongly suggest raptor mRNA as a microRNA-210 target, despite the fact that we can not exclude that other molecular microRNA-210 targets might be involved in erythroid differentiation and γ-globin gene expression. [score:7]
Up-regulation of microRNA-210 and down-regulation of raptor mRNA during MTH erythroid induction of ErPCs from β-thalassemia patients. [score:7]
Despite the fact that silencing of raptor is not sufficient to induce up regulation of the expression of γ-globin genes, but needs the activation of other MTH -induced pathways (Fig 13), the data reported in the present study allow us to propose a link between microRNA-210, raptor, mTOR-C1, erythroid differentiation and preferential expression of the γ-globin genes in erythroid cells. [score:6]
The down-regulated expression of raptor gene during MTH -induced erythroid differentiation of K562 cells is modulated by anti-microRNA-210. [score:6]
MicroRNA profile in ErPCs and K562 cells: microRNA-210 is up-regulated in ErPCs from β-thalassemia patients expressing high HbF levels and in K562 cells induced to erythroid differentiation by MTH. [score:6]
The protocol reported from Promega Corporation (WI, USA) was used for the cloning of raptor microRNA-210 target sites (site1: 5’-AAA CTA GCG GCC GCT CAC TGA GCA GGA AGC GCA CAG TCT AG-3’; site2: 5’-AAA CTA GCG GCC GCG AAG CCC AGC TCC ACC CGC ACA CTC TAG-3’) and mutated target sites (5’-AAA CTA GCG GCC GCT CAC TGA GCA GGC AGA TCA ACG TCT AG-3’; 5’-AAA CTA GCG GCC GCG AAT CGC AGA TCC TCC CTC GCA CTC TAG-3’). [score:5]
The results demonstrate that microRNA-210 expression is inhibited following treatment with the anti-microRNA-210 of MTH -treated and untreated K562 cells, but not when anti-microRNA-588 was used (Fig 3B). [score:5]
Th1 (low HbF) and down-regulated in MTH -induced K562 cells, but resulting up regulated by anti-microRNA-210. [score:5]
The results obtained confirmed that anti-miR-210 treatment leads to a sharp increase of raptor protein expression; conversely, raptor expression decreases following premiR-210 treatment. [score:5]
The expression of other putative microRNA-210 target genes, such as FANK1 and CYB5R2, resulted unchanged or undetectable (data not shown). [score:5]
The data shown in Table 1 and depicted in Fig 4 support the concept that treatment with anti-microRNA-210, but not with anti-microRNA-588, suppresses MTH -induced increases of the expression of these genes. [score:5]
The data obtained are shown in Fig 8A and confirm that microRNA-210 is up-regulated following MTH treatment. [score:4]
Altogether, these data support the concept that the microRNA-210 binding sites present within the 3’-UTR sequence of the raptor mRNA are direct targets of microRNA-210. [score:4]
These data strongly support the concept that microRNA-210 is involved in erythropoiesis and possibly in up regulation of the expression of γ-globin genes. [score:4]
Most importantly, this homology is similar or even higher than the homology between microRNA-210 and other validated target mRNAs (Fig 5C), such as PLK1 (polo-like kinase 1), ROD1 (Regulator of Differentiation 1) and E2F3 (E2F transcription factor 3) [42– 44]. [score:4]
Since our first interest was to identify sequences modulated by microRNA-210, we compared this list with a list of transcripts which were found to be both down-regulated in MTH -induced K562 cells (excluding the transcripts modulated in MTH -induced K562 cells plus anti-microRNA-588) and up regulated in MTH -induced K562 cells treated with anti-microRNA-210. [score:4]
Following these studies, microRNA-210 is a master regulator of gene expression in hypoxic conditions. [score:4]
We and others have reported that microRNA-210 is involved in erythroid differentiation and, possibly, in γ-globin gene up-regulation [23, 27, 72]. [score:4]
Among the genes which were found to be expressed at low levels when Th17 was compared to Th1 (using as threshold a 4.00 fold change value), 227 were found to be possible target genes of microRNA-210. [score:4]
The data obtained suggest that the raptor microRNA-210 binding sites are direct targets of microR-210. [score:4]
In parallel, while a strong MTH -mediated down-regulation of raptor mRNA was found, as expected, raptor mRNA increased when anti-microRNA-210 was added to MTH -treated cells (Fig 8B, p<0.05). [score:4]
Taken together, our data suggest that MTH -induced erythroid differentiation, HbF induction and hypoxic conditions might display common molecular biology features, one of which is represented by microRNA-210 up-regulation. [score:4]
Fig 2D shows the validation by RT-qPCR of microRNA-210 expression data obtained by the microRNA-profiling. [score:3]
Among these microRNAs, microRNA-210 on one hand is the most expressed in high-HbF samples and, on the other, exhibits a high absolute fold change value. [score:3]
Accordingly, we can speculate that among the two microRNA-210 sites the most critical for raptor expression is microRNA-210-1654. [score:3]
Anti-microRNA against microRNA-210 prevents MTH -mediated gene expression changes. [score:3]
Anti-microRNA-210 reverses MTH -mediated inhibition of raptor mRNA content. [score:3]
In a second set of experiments, the effects of anti-microRNA-210 on expression of microRNA-210, raptor and globin transcripts in MTH -induced K562 cells were analyzed. [score:3]
Modulation of gene expression by anti-microRNA-210 in K562 cells induced to erythroid differentiation by MTH. [score:3]
Raptor gene as a putative target of microRNA-210. [score:3]
Arrowed three putative microRNA-210 target genes. [score:3]
In agreement with the microarray data, β-thalassemia ErPCs expressing elevated HbF levels exhibit an even higher content of microRNA-210. [score:3]
Expression of microRNA-210 and raptor mRNA in K562 cells. [score:3]
Fig 3B reports the expression of microRNA-210 validated by RT-qPCR in samples treated with anti-microRNA-210. [score:3]
0121567.g005 Fig 5(A) Genes putatively modulated in gene expression analysis by microRNA-210 in human erythroid induced cells. [score:3]
Altogether, the data shown in Fig 2 (panels A, E and F) encouraged us to follow the hypothesis of a possible link between expression of microRNA-210 and HbF levels in our experimental mo del systems. [score:3]
In addition, microRNA-210 is suppressed when anti-microRNA-210 was transfected to the cells. [score:3]
In order to conclusively analyze the effects of anti-miR-210 and premiR-210 on raptor gene expression, experiments were conducted and the results shown in Fig 12 (12C and 12D). [score:3]
All the three genes, as expected, contain binding sites for microRNA-210, as found employing miRGator, as well as inspection of the previously published paper by Fasanaro et al. [41], describing an integrated approach to identify microRNA-210 target mRNA sequences. [score:3]
The arrowed nucleotides indicate the base substitution introduced in raptor target microRNA-210 mutated sites 1 and 2. (B) Luc2/hRluc ratios obtained in extracts of K562 cells treated with the pmirGLO vector or with the raptor-210-site1-pmiRGLO, MUT-raptor-210-site1-pmiRGLO, raptor-210-site2-pmiRGLO, MUT-raptor-210-site2-pmiRGLO vectors. [score:3]
Expression of microRNA-210 and raptor mRNA in erythroid precursor cells. [score:3]
Targets of microRNA-210 were identified by available databases (Union of DIANA-microT; MiRanda microma. [score:3]
These data are fully in agreement with the hypothesis of an involvement of microRNA-210 with γ-globin gene expression. [score:3]
In this study, we have firstly analyzed the expression of microRNA-210 in K562 cells induced to erythroid differentiation by the HbF inducer mithramycin (MTH), and found that microRNA-210 content increases following MTH-induction. [score:3]
These experiments were performed to verify whether raptor 3’-UTR mRNA sequences carrying the microRNA-210 binding sites might be a target site of microRNA-210. [score:3]
Furthermore, the increase of microRNA-210 and γ-globin mRNA content in MTH -treated K562 cells (Fig 2E) was confirmed in five independent experiments, in agreement with data elsewhere reported (Paired t test, p = 0.0123) [27] and microarray results (Fig 2B and S2 Table), suggesting that the increase of microRNA-210 is a reproducible feature and could be associated to γ-globin gene expression. [score:3]
Expression of microRNA-210 and raptor gene in K562 cells and erythroid precursors. [score:3]
In this context, we first analyzed the effects of anti-microRNA-210 and premicroRNA-210 on the expression of microRNA-210, raptor and globin transcripts in uninduced K562 cells. [score:3]
As previously described, microRNA-210 is up regulated after MTH-treatment, while microRNA-588 is expressed at very low levels in K562 cells without major changes during MTH-treatment (data not shown) and was considered as an internal negative control of the experiment. [score:3]
Furthermore, microRNA-210 is known as firmly associated to hypoxia; this is in our opinion of interest, since hypoxia has been demonstrated to be associated to activation of the erythroid program leading to selective expression of fetal globin genes and HbF production in erythroid cells [37– 40]. [score:3]
In addition, in agreement with the data shown in the microarray and RT-qPCR analyses depicted in Fig 2, we would underline that the majority of β-thalassemia ErPCs express higher starting microRNA-210 levels than healthy ErPCs exhibiting at the same time lower raptor mRNA content. [score:3]
In order to further verify this hypothesis we forced microRNA-210 expression in K562 cells by transfection of premicroRNA-210 (Fig 9C), and co-transfection was performed with the vectors reported in Fig 9A. [score:3]
Cloning of raptor microRNA-210 target sites in the pmiRGLO vector and luciferase assay. [score:2]
These results are compatible with a direct effect of the endogenous microRNA-210 on the microRNA-210 binding sites of the raptor 3’-UTR sequence. [score:2]
No major effects of RAPA, well in agreement with its peculiar mechanism of action, were found on microRNA-210 and raptor mRNA content (Fig 6C); in fact, RAPA binds directly to mTORC1 by associating with its intracellular receptor FKBP12, without causing a reduction of raptor protein level [48]. [score:2]
Therefore, in addition of the already reported mechanisms of action of MTH (which for instance is known to directly bind to the γ-globin gene promoter [24], MTH might exert its effects through microRNA-210 activation. [score:2]
In order to determine whether MTH affects globin gene expression together with microRNA-210 and raptor alteration in other erythroid cell mo del systems, we have considered ErPCs from peripheral blood of the β-thalassemia patients reported in Fig 7 and Table 2. Fig 11A shows the RT-qPCR analysis demonstrating an increase of microRNA-210 associated to reduction of raptor mRNA in MTH -treated ErPCs with respect to uninduced ErPCs employed as reference control, in agreement with the results obtained in MTH -induced K562 cells (see Fig 8). [score:2]
In this respect it is interesting to note that microRNA-210 is among the microRNAs which are clearly up regulated in hypoxic conditions [39, 72] as recently published by Noman et at. [score:2]
These genes were considered as putative targets of microRNA-210 in erythroid cells in association with increase of HbF production. [score:2]
These results strongly sustain the hypothesis that microRNA-210 (and its up regulation) is deeply involved in erythroid differentiation. [score:2]
RT-qPCR analysis of microRNA-210, raptor and γ-globin transcripts was performed using untreated cells as reference and microRNA-let-7c and 18S as internal control gene sequences. [score:1]
Samples from uninduced cells are presented as circles, from 30 nM MTH -treated cells as squares and from cells treated with MTH + anti-microRNA-210 as triangles. [score:1]
Quantification by RT-qPCR of microRNA-210 (A, C) and raptor mRNA (B, D) in 9 healthy donors (US) (A, B) and 9 β-thalassemia patients (Th) (C, D). [score:1]
In the presence of anti-microRNA-210 the following effects in MTH -treated K562 cells were observed: (a) a decrease of microRNA-210 content (it should be underlined that the effects of anti-microRNA might be based on binding to mature microRNA-210, but also to primicroRNA or premicroRNA) (Figs 3B, 8A and 12); (b) an increase of raptor mRNA (Figs 5A, 8B and 12) and (c) a decrease of functions associated with differentiation processes (i. e. proportion of benzidine -positive cells, Hb, γ-globin mRNA accumulation) (Figs 3, 4 and 12E). [score:1]
In addition, administration of anti-microRNA-210 (but not of anti-microRNA-588) prevents MTH -mediated γ-globin mRNA accumulation (Fig 3C). [score:1]
The results indicate a slight increase of microRNA-210 in ErPCs from β-thalassemia patients, in comparison to ErPCs from healthy donors. [score:1]
This is in agreement with the data shown in Fig 3D, indicating that the proportion of benzidine -positive cells (which is about 80% in MTH -treated K562 cells) decreases to about 5% in K562 cells treated with MTH plus anti-microRNA-210. [score:1]
As expected, the effects of premicroRNA-210 administration were found to be opposite (a sharp increase of microRNA-210 was associated with a decrease of raptor mRNA in uninduced K562 cells). [score:1]
Studies were also performed on K562 cells with the aim of quantifying raptor mRNA and raptor protein content following treatment with anti-microRNA-210 and premicroRNA-210. [score:1]
represent the fold changes with respect to untreated K562 cells at time = 0. (B) qPCR analysis of microRNA-210 (white histogram), raptor mRNA (black histogram), α- and γ-globin transcripts (grey histograms) in MTH -induced K562 cells after five days of erythroid differentiation (mean±S. [score:1]
The results reported in Fig 12A demonstrate that anti-microRNA-210 strongly reduces microRNA-210 content, in association with an increase of raptor mRNA. [score:1]
This finding supports the hypothesis of an involvement of microRNA-210 in determining the raptor mRNA content. [score:1]
However, in most of the analyzed ErPC populations analyzed MTH induced, as expected, a significant increase of microRNA-210 (Fig 7, 7A and 7C). [score:1]
K562 cells were transfected with 400 nM anti-microRNA-210 and premicroRNA-210, cytoplasmic protein extracts were prepared after 2 days of cell culture and analysis performed, using β-actin as reference internal control. [score:1]
Phenotype and genotype of the ErPCs from thalassemia patients employed in microRNA-210 and raptor analyses. [score:1]
Finally, we observed a significant correlation between microRNA-210 content and HbF in ErPCs from β-thalassemia patients (α = 0.05%, two-tailed = 0.0176 and R [2] = 0.7082) (data elaborated with GraphPad program) (Fig 2F). [score:1]
Despite few differences in the heat map profile (Fig 3A), we found evidence suggesting that in the presence of anti-microRNA-210 the MTH -mediated erythroid induction is not fully operating. [score:1]
In order to obtain information about a possible functional role of raptor microRNA-210 binding sites, the 640-microRNA-210 and 1645-microRNA-210 binding sites (see Fig 5B and 5C), and the related mutated sequences (Fig 9) were cloned in the pmirGLO vector, carring the firelyfly luciferase gene (luc2) under the control of the PGK promoter and the internal control renilla luciferase (hRluc) under the control of the SV40 promoter. [score:1]
Three independent experiments were performed treating K562 cells with MTH and with MTH plus anti-microRNA-210. [score:1]
0121567.g012 Fig 12 (A) Effects of anti-microRNA-210 and premicroRNA-210 administration at the concentration of 200 nM with the siPort NeoFX transfection reagent (Ambion). [score:1]
0121567.g008 Fig 8 Quantification by RT-qPCR of microRNA-210 (A) and raptor mRNA (B) in K562 cell line was performed. [score:1]
0121567.g011 Fig 11 (A) Modulation of microRNA-210, raptor, α- and γ-globin mRNAs in ErPCs from β-thalassemia patients by MTH. [score:1]
High levels of microRNA-210 were also found by other research groups [40, 41, 72– 76]. [score:1]
To further investigate the role of microRNAs in MTH-treatment, the gene expression profiles of K562 cells treated with 30 nM MTH and MTH plus anti-microRNA-210 or anti-microRNA-588 were examined. [score:1]
Quantification by RT-qPCR of microRNA-210 (A) and raptor mRNA (B) in K562 cell line was performed. [score:1]
Effects of anti-microRNA-210 and premicroRNA-210 on K562 cells. [score:1]
Effects of premicroRNA-210 on pmirGLO luciferase vectors incorporating the raptor microRNA-210 binding sites. [score:1]
Significant pathways enriched in the list of 748 modulated mRNAs in K562 cells induced by MTH and up-regutaled by anti-miR-210. [score:1]
0121567.g009 Fig 9 (A) Scheme of the pmirGLO vector, location and sequences of the cloned normal and mutated microRNA-210 sites in the raptor 3’-UTR. [score:1]
It should be underlined that two putative sites for microRNA-210 are present with the 3’-UTR of the human raptor mRNA (Fig 5B). [score:1]
Their conclusion was that microRNA-210 is involved in erythroid differentiation and maturation. [score:1]
Interestingly, in MTH -treated cells a reduction of γ-globin mRNAs is observed together with the microRNA-210 decrease and raptor mRNA increase (Fig 12E). [score:1]
In this case, an increase of raptor mRNA was found associated to a sharp decrease of microRNA-210 content (Fig 12E). [score:1]
Raptor, FANK1 and CYB5R2 mRNAs contain microRNA-210 binding sites. [score:1]
After five days of treatment, RNA was extracted and the levels of microRNA-210 and raptor mRNA determined. [score:1]
The results on raptor mRNA were in agreement with the analysis reported in Fig 12B, showing a higher content of raptor protein following treatment of K562 cells with anti-microRNA-210 (1.41±0.12, fold increase with respect to the untreated controls). [score:1]
The samples analyzed were obtained respectively from untreated K562 cells (a) or K562 cells treated with MTH (30 nM) + anti-microRNA-210 (b), MTH (c), or MTH + anti-microRNA-588 (d) (p<0.05). [score:1]
We found only minor changes after treatment of K562 cells with MTH plus anti-microRNA-588, while treatment with MTH plus anti-microRNA-210 displays a microarray profile that is more similar to control cells than MTH -induced cells (Fig 3A). [score:1]
0121567.g007 Fig 7 Quantification by RT-qPCR of microRNA-210 (A, C) and raptor mRNA (B, D) in 9 healthy donors (US) (A, B) and 9 β-thalassemia patients (Th) (C, D). [score:1]
0121567.g004 Fig 4 The samples analyzed were obtained respectively from untreated K562 cells (a) or K562 cells treated with MTH (30 nM) + anti-microRNA-210 (b), MTH (c), or MTH + anti-microRNA-588 (d) (p<0.05). [score:1]
Modulated genes following anti-microRNA-210 treatment analyzed by gene-profiling and involved in heme biosynthetic process and hemoglobin pathway. [score:1]
Anti-microRNA-210 and premicroRNA-210 were administered daily at the concentration of 200 nM with the siPort NeoFX transfection reagent (Ambion, Applied Biosystems, Foster City, CA, USA). [score:1]
In this vector we cloned the two microRNA-210 raptor sequences (Fig 9A) and two mutated sequences carrying nucleotide substitution in evolutionary conserved positions. [score:1]
Therefore, we pointed our attention on microRNA-210. [score:1]
The samples analyzed were obtained from untreated K562 cells and K562 cells treated with MTH (30 nM) + anti-microRNA-210, MTH, or MTH + anti-microRNA-588 (taken as anti-microRNA-control). [score:1]
The extent of complementarity between these sequences with mature microRNA-210 is 36.4% for microRNA-210-640 site and 72.7% for microRNA-210-1654 site (evaluated using TargetScanS 4.2, http://www. [score:1]
In order to obtain further information supporting an effect of anti-microRNA-210 on the erythroid pattern and other erythroid-related genes, a computer -based analysis was performed on the pathways enriched in our list of modulated genes, showing that the hemoglobins chaperone is the most significant (S3 Table). [score:1]
The raptor microRNA-210 sites modulate luciferase activity in a reporter gene construct. [score:1]
Quantification of microRNA-210, raptor, α- and γ-globin transcripts in MTH -induced K562 cells. [score:1]
Fig 6B shows a summary of three independent experiments performed in MTH -treated K562 cells after five days of MTH treatment, demonstrating that the increase of microRNA-210 was reproducibly associated with a decrease of raptor mRNA, and a parallel increase of α- and γ-globin mRNA accumulation. [score:1]
[1 to 20 of 114 sentences]
4
[+] score: 271
Other miRNAs from this paper: mmu-mir-210
Given that the data obtained in murine and cellular mo dels support that SDH loss of function do not directly activate the HIF-1α pathway, that HIF-1α nuclear accumulation is only observed in about 38% of tumor cells in SDHx [m]-PGLs, and that these tumors show mild miR-210 over -expression, we postulate that HIF-1α up-regulation in these tumors is a late event that it is favored by SDHx mutations but is triggered by still undefined biochemical or genetic event/s. [score:8]
Importantly, VHL-PGLs, in addition to accumulate HIF-1α, express low levels of SDHB likely as a result of miR-210 up-regulation which also represses expression of other genes essential for mitochondrial metabolism [17]. [score:8]
By contrast, tissues (such as adrenal gland) derived from conditional homozygous SdhD −/− mice do not over-express HIF-1α nor its targets [20] and therefore they were not expected to over-express miR-210. [score:7]
Given that most tumors carrying VHL inactivating mutations are not necessarily accompanied by loss of heterozygosity, we also analyzed the impact of a VHL cancer -associated mutation, F76 del VHL, on miR-210 expression by using SCC40 cells which, endogenously, express wild type VHL [18, 19]. [score:7]
Only a few of those studies have focused on correlation analysis between miR-210 expression and SDHx-mutations showing that overexpression of miR-210 was associated with SDHx mutations of PCCs, PGLs, and gastrointestinal stromal tumours [26, 27]. [score:7]
This result was not replicated in 786-O[+] cells that express wild type VHL and the HIF-2α rather than HIF-1α subunit thus suggesting that HIF-1α is the predominant HIF-α subunit involved in the pseudohypoxic up-regulation of miR-210. [score:6]
In vivo roles of VHL and HIF-1α on the expression of miR-210We first addressed whether the expression of miR-210 in the paraganglionic system is regulated by VHL and/or HIF-1α activity in vivo. [score:6]
Roles of SDHD and SDHB on the expression of miR-210To determine whether SDH loss of function exert any effect on miR-210 expression, we used previously reported established cell lines (MEF and BMK) obtained from a tamoxifen-inducible SdhD knockout mutant mouse [20]. [score:6]
Thus, in contrast to the data obtained in the SDHD knock-out mouse mo del or in the cell -based assays, cells carrying SDHC or SDHD mutations express higher levels of HIF-1α protein and its targets, miR-210, CA9 and EGLN3 than their normal counterparts. [score:6]
VHL mutations are associated with a strong HIF-1α -dependent miR-210 over -expression and accumulation of HIF-1α in most tumor cells whereas SDHx mutations are associated with mild increase of miR-210 and the presence of a heterogeneous, HIF-1α -positive and HIF-1α -negative, tumor cell population. [score:5]
By using RNA interference as well as conditional knock-out of SDHD via the Cre-Lox system, we demonstrate that absence of SDHD does not induce HIF-1α dependent miR-210 up-regulation. [score:5]
Figure 2B shows that inhibition of the succinate:ubiquinone oxidoreductase activity by 0.5 mM TTFA did not induce miR-210 over -expression in VHL -deficient (786-O[−]) or VHL-proficient (786-O[+]) cells. [score:5]
We demonstrated that ablation of VHL or HIF1A genes in neural crest-derived cells, from which the paraganglia originates, increases the basal levels of miR-210 (VHL knockout) or blunt the inducing effect of hypoxia (HIF1A knockout) on miR-210 indicating that these proteins are essential for the in vivo expression of miR-210 under hypoxic/pseudohypoxic conditions in paraganglia. [score:5]
The role of the SDH complex on miR-210 expression was further explored in cultured cell lines by using siRNAs targeting the SDHD or SDHB genes. [score:5]
By contrast, the mitochondrial SDH complex activity, related with tumorigenesis and supposedly involved in HIF-1α regulation [5], does not appear to have a direct effect on HIF-1α -dependent miR-210 over -expression but it favors it via a mechanism which has not been clearly defined as yet. [score:5]
Thus, the question remained whether mutant VHLs are also defective for HIF-1α regulation and able to up-regulate miR-210 in the presence of wild type VHL. [score:5]
Analysis of miR-210 in MEF and BMK cells revealed that ablation of the two (homozygous SdhD −/−) or one (heterozygous SdhD +/-) SdhD alleles failed to induce miR-210 over -expression in BMK-cells and even caused a reduction of miR-210 expression levels in MEF cells (Figure 2A). [score:5]
Previous association studies had shown that mutations of VHL in tumors correlate with miR-210 over -expression [11, 23, 26, 27]. [score:4]
In the present report, we addressed the functional role of the SDH mitochondrial complex II components on the hypoxic/pseudohypoxic miR-210 up-regulation. [score:4]
To analyze the impact of SDHx cancer -associated homozygous mutations on the expression of HIF-1α and miR-210, we used two PGL-derived cell lines, one composed of tumor cells which had been obtained from a tympanic PGL with homozygous SDHC exon 2 deletion (SDHC-PGL) [16] and other composed of tumor -associated fibroblasts which were derived from a SDHD-mutated (c. 88_314+247 del, p. His30Asn fs*11) jugular PGL (SDHD-TAFs). [score:4]
To determine whether SDH loss of function exert any effect on miR-210 expression, we used previously reported established cell lines (MEF and BMK) obtained from a tamoxifen-inducible SdhD knockout mutant mouse [20]. [score:4]
In this report we have used cellular- and knockout murine-mo dels and neuroendocrine PGLs to determine whether the HIF-1α and VHL proteins, implicated in the miR-210 -mediated hypoxia/pseudohypoxia response in vitro, and the mitochondrial SDH complex, involved in HIF-1α stabilization, are essential for miR-210 expression in vivo. [score:4]
These premises encouraged us to carry out an in-depth analysis of the role of HIF-1α, SDH, and VHL on miR-210 expression by using knockout murine mo dels and analyses of human tumor material. [score:4]
To further analyze the role of HIF-1α on miR-210 expression, wild type HIF1A +/+ and knockout HIF1A −/− mice were exposed to hypoxia (10% O [2]) for 30 days prior to organ isolation to allow for HIF-1α accumulation in tissues. [score:4]
Thus, other than association studies, direct evidences for a role of F76 del on miR-210 expression was lacking and it was not known whether loss of the wild type allele was required for the activation of the pro-tumorigenic HIF pathway by the mutant VHL. [score:4]
We first addressed whether the expression of miR-210 in the paraganglionic system is regulated by VHL and/or HIF-1α activity in vivo. [score:4]
The relative contribution of HIF-2α isoform in the development of PGL and miR-210 expression has not been explored in this report. [score:4]
Therefore, although several lines of evidence suggest a predominant role for HIF-1α in miR-210 expression [11], the relative contribution of HIF-2α isoform in PGL development remains to be fully determined. [score:4]
Absence of miR-210 up-regulation by siRNA -mediated silencing of SDHB or SDHD. [score:4]
miR-210 quantifications revealed that, as previously described, VHL [m]-PGLs expressed higher levels of miR-210 than SDHx [m]- or SDHx [wt]/VHL [wt]-PGLs (Figure 7A). [score:3]
Studies in VHL-related PGLs (VHL-PGLs) revealed that the HIF-pathway involves, among other cues, the HIF-1α-microRNA target, miR-210 [11, 16]. [score:3]
Finally, loss of SDHD or decreased SDHB or SDHD expression levels does not induce the HIF-1α/miR-210 pathway. [score:3]
Figure 5B shows that both types of cells, SDHC-PGLs and SDHD-TAFs, have slightly but significant higher levels of miR-210 expression in normoxia than human paraganglia (normal carotid body) or non-tumoral fibroblasts, respectively. [score:3]
In vitro and in vivo analysis of the role of VHL and HIF-1α on miR-210 expression. [score:3]
However, increased miR-210 levels were not found in any of the transfected cells (Figure 3), thus suggesting that full SDH function is not required for HIF-α-independent miR-210 expression. [score:3]
Analysis of the role of SDHD on miR-210 expression. [score:3]
Role of SDH on HIF-1α/miR-210 expression. [score:3]
These data contrasted with the reported link between SDHD deficiency and HIF-1α accumulation what prompted us to use another cell-system to clarify the role of decreased mitochondrial complex II activity on miR-210 expression. [score:3]
Role of VHL on HIF-1α/miR-210 expression. [score:3]
As shown in Figure 1G, a significant increase of miR-210 and CA9 was detected upon expression of the F76 del-VHL mutant in RCC4[+] cells. [score:3]
Roles of SDHD and SDHB on the expression of miR-210. [score:3]
We also provide experimental evidences supporting that a mutant VHL protein, F76 del, acts as a dominant -negative inhibitor of the wild-type VHL by inducing the pro-tumorigenic HIF/miR-210 pathway even in the presence of wild type VHL. [score:3]
As shown in Figure 2C, TTFA treatment did not induce miR-210 expression but slightly, although significantly, reduced it in SCC40 cells. [score:3]
In accord with these findings, miR-210 over -expression was not detected in the adrenal medulla from heterozygous VHL +/- mice. [score:3]
The same experimental strategy was then applied but using cells that were incubated under hypoxic conditions (1% O [2] for 48 h) after siRNA transfection to allow for HIF-α -dependent miR-210 over -expression (Figure 3). [score:3]
Further biochemical studies will be required to unravel the specific mechanisms involved in regulation of the HIF-1α/miR-210 axis by pathogenic mutations on SDHx genes. [score:3]
Under these conditions, the functional inactivation of HIF-1α significantly reduced hypoxic expression of miR-210 as well as EGLN3 in the adrenal medulla (Figure 1C). [score:3]
HIF-1α/miR-210 expression in SDHx- and VHL-mutant PGLs. [score:3]
Collectively, the data indicates that the constitutive expression of miR-210 requires a functional wild type VHL protein but it is not influenced by partial VHL losses. [score:3]
Thus, understanding of the in vivo mechanisms of miR-210 expression should increase our knowledge on cancer pathogenesis and allow the identification of cancer-specific vulnerabilities that could be exploited therapeutically. [score:3]
In vivo roles of VHL and HIF-1α on the expression of miR-210. [score:3]
In contrast to VHL, absence of HIF-1α did not alter the constitutive expression of miR-210. [score:3]
Because SCC40 cells endogenously express wild type VHL, these data show that a mutant non-functional F76 del-VHL may abolish ubiquitination of HIF-1α by wild type VHL thus exerting a dominant negative effect that lead to the activation of the HIF-1/miR-210 pathway. [score:3]
However, we also discovered that partial loss of VHL in tumors is not accompanied by HIF-1α activation or miR-210 over -expression. [score:3]
These data suggest that the HIF-1α protein levels reached under these circumstances, if any, are not sufficient for induction of miR-210 expression but they are possibly enough to induce other HIF-1α-related genes. [score:3]
HIF-1α, in turn, is involved in the hypoxic-induction of miR-210 but do not participate in its constitutive expression. [score:3]
However, VHL [del]-PGLs expressed low levels of miR-210 which were similar to those detected in SDHx [wt]/VHL [wt]-PGLs. [score:3]
In line with the miR-210 expression data, differences in HIF-1α immunostainings were statistically significant between VHL [del]-PGLs and VHL [m]- PGLs (p<0.0001) or SDHx-PGLs (p=0.03), but not between VHL [del]-PGLs and SDHx [wt]/VHL [wt]-PGLs. [score:3]
Conversely, PGL-derived cells carrying SDHC or SDHB mutations do show mild activation of HIF-1α and miR-210. [score:2]
Individual TaqMan assay (Applied Biosystems) was used to analyze the expression of the mature human miR-210. [score:2]
Mild heterogeneous activation of HIF-1α/miR-210 signaling axis in PGL-derived cells carrying SDHx mutations. [score:2]
As shown in Figure 1B, miR-210 levels in the adrenal gland of normoxic knockout HIF1A −/− or HIF1A +/- mice were similar to those of wild type HIF1A +/+. [score:2]
Instead, mutations of SDHx genes may exert subtle inductive effects on the HIF-1α/miR-210 pathway. [score:2]
In addition, SDHx [m]-PGLs expressed slightly higher, statistically significant, levels of miR-210 compared to SDHx [wt]/VHL [wt]-PGLs (p=0.045). [score:2]
Consistent with our previously reported findings in PGL tissues carrying mutant F76 del-pVHL [11], a ~ 3- and ~ 90-fold increase of miR-210 and CA9 RNA levels, respectively, was detected upon ectopic expression of F76 del-VHL under normoxic conditions as compared with wild type VHL or mock -transfected cells (Figure 1E and 1F). [score:2]
As stated above, we definitively demonstrated that PGLs carrying VHL [m] are grossly defective with respect to HIF regulation and induce a strong activation of miR-210. [score:2]
We next analyzed the relative HIF-1α and miR-210 levels in tumors with specific genetic backgrounds: SDHx [wt]/VHL [wt], VHL [m], VHL [del], and SDHx [m] (SDHB or SDHD) [m]. [score:1]
E, F, G. miR-210 and CA9 RNA relative levels in SCC40 (E, F) and RCC4[+] or 786-O[+] cells (G) treated as indicated in (D). [score:1]
However, miR-210 levels did not change in heterozygous tissues obtained from VHL +/- thus indicating that a single functional copy of VHL produce enough functional VHL. [score:1]
A, B, C. miR-210, CA9 and EGLN3 RNA levels were quantified by in adrenal gland obtained from the indicated mice genotypes. [score:1]
miR-210, CA9 and EGLN3 RNA levels were analyzed in the indicated cells following treatment with SDHD (siSDHD), SDHB (siSDHB) or control (siCtrl) siRNAs. [score:1]
Figure 1 A, B, C. miR-210, CA9 and EGLN3 RNA levels were quantified by in adrenal gland obtained from the indicated mice genotypes. [score:1]
However, siSDHD or siSDHB did not further increase the hypoxic effect on miR-210 levels. [score:1]
On the contrary, TTFA significantly reduced miR-210 levels in VHL -deficient cells. [score:1]
As expected, increased levels of miR-210 were detected in hypoxic versus normoxic conditions. [score:1]
A functional link between defects of the VHL gene and activation of the miR-210 signaling pathway has also been demonstrated in other tumors such as PCCs, ccRCC and ovarian cancer [11, 23, 24]. [score:1]
The genotype-phenotype association studies revealed that the HIF-1α/miR-210 pathway is strongly activated in VHL [m]-PGLs, weakly activated in SDHx [m]-PGLs, and not activated in VHL [del]- and SDHx [wt]/VHL [wt]-PGLs. [score:1]
A. was performed for miR-210 in the indicated tumor types. [score:1]
However, the role of miR-210 in the pathogenesis of SDH-related tumors remains an unmet challenge. [score:1]
B, C, D. VHL-proficient (786-O[+]) and VHL -deficient (786-O[-]) (B, D) or SCC40 cells (C, D) were incubated with 0.5 mM TTFA (TTFA(+)) or solvent (TTFA(-)) for 16 hours prior to miR-210 (B, C) or EGLN3 (G) quantification by. [score:1]
Figure 7 A. was performed for miR-210 in the indicated tumor types. [score:1]
Figure 1A shows a significant 13-fold increase of miR-210 levels in the adrenal gland of VHL -null mice in comparison with wild type mice. [score:1]
To this end, we analyzed miR-210 levels in tissues isolated from mice with either VHL or HIF1A conditionally deleted in the neural crest derived cells. [score:1]
NF1/2 refers to the miR-210 data (mean ± SD value) obtained in NF1 and NF2 cells. [score:1]
This suggests that miR-210 is a potential oncomiR in VHL -deficient tumors which impact on mitochondria metabolism [16]. [score:1]
[1 to 20 of 85 sentences]
5
[+] score: 269
These results indicated that miR-210 directly downregulated the expression of VMP1 and consequently inhibited metastasis of CRC cells. [score:9]
Moreover, HIF1α expression in CRC tissues was up-regulated (P<0.001; Figure 1D) and positively correlated with miR-210 expression in CRC tissues (r = 0.402, P<0.01; Fig. 1E). [score:8]
Here, we detected a marked upregulation of miR-210 expression in CRC tissues, and miR-210 overexpression was significantly correlated with aggressive clinicopathological features, such as a large tumor size, positive regional lymph node metastasis, local tumor invasion, and an advanced clinical stage. [score:8]
These data strongly suggest that miR-210 negatively regulates VMP1 expression by directly targeting its 3′-UTR sequences. [score:7]
Using the median of the miR-210 expression levels as a cutoff, we divided the 116 CRC patients into two groups: a high miR-210 expression group and a low miR-210 expression group. [score:7]
Furthermore, overexpression of miR-210 significantly inhibited VMP1 mRNA and protein levels in HT-29 and SW480 cells (Fig. 6C, 6D) and VMP1 level was inversely correlated with miR-210 expression in primary CRC tissues (r = −0.318, P<0.01; Fig. 6E). [score:7]
The results indicated that miR-210 expression in the CRC tissues was significantly up-regulated in comparison to that in the adjacent normal tissues (P<0.001, Fig. 1A). [score:6]
Recently, Ying et al. showed that hypoxia -induced miR-210 could enhance the migration and invasion of hepatocellular carcinoma (HCC) [21], and Redova and colleagues found that the downregulation of miR-210 inhibited the migratory and invasive potential of renal cell carcinoma (RCC) [22], Rothé reported similar results in breast cancer [23]. [score:6]
0090952.g001 Figure 1(A) MiR-210 expression was tested using qRT-PCR in 193 pairs of human CRC tissues (CRC) and adjacent non-tumorous tissues (NT), and its expression was normalized to the level of U6 small nuclear RNA (U6) expression in each sample. [score:6]
Although it has been reported that miR-210 is expressed and greatly up-regulated in response to hypoxia in CRC cell lines (HCT-116 and HT-29), the function of miR-210 in colorectal cancer has not been elucidated to date, and its role in colorectal cancer progression remains unclear. [score:6]
However, Tsuchiya [32] reported that miR-210 expression was markedly downregulated in patients with poorly differentiated esophageal squamous cell carcinoma. [score:6]
Consistent results have shown that the up-regulated expression of miR-210 is involved in the hypoxia/VEGF signaling pathway in breast cancer [34]. [score:6]
The patients with high miR-210 expression had a significantly poorer 5-year overall survival rate than those with low miR-210 expression (P<0.001). [score:5]
MiR-210 suppresses VMP1 expression by directly binding to its 3′-UTR. [score:5]
As the most consistently and robustly up-regulated miRNA under hypoxic conditions, miR-210 regulates many aspects of hypoxia pathways, such as the angiogenic response of endothelial cells to hypoxia [38]. [score:5]
In addition, 58% (111 of 193) of the samples displayed more than 2-fold upregulation of miR-210 compared to the non-cancerous tissue samples, implying that the overexpression of miR-210 is a common event in CRC. [score:5]
However, a few studies have indicated that miR-210 expression is lost during tumorigenesis and that the miRNA exerts a tumor-suppressor effect on human epithelial ovarian and esophageal squamous cell carcinoma [27], [28]. [score:5]
The results showed that the patients with high miR-210 expression had a significantly poorer prognosis than those with low miR-210 expression (P<0.001, Fig. 1F). [score:5]
Moreover, we found that the “master” microRNA in hypoxia control, miR-210, is frequently up-regulated in CRC cells and is involved in hypoxia -induced CRC metastasis. [score:4]
Among the miRNAs induced by HIF1α, miRNA-210 is the most prominent and consistently up-regulated miRNA during the hypoxic response in different types of tumor cells and normal cells [19], [20]. [score:4]
VMP1 is a direct target of miR-210. [score:4]
Transwell experiments with or without Matrigel were performed to test the effect of miR-210 on CRC cell migration and invasion, and we found that the upregulation of miR-210 by the miR-210 mimics enhanced the migration and invasion ability of CRC cells (Fig. 4A, 4C). [score:4]
The dysregulated expression of miR-210 has been irrefutably demonstrated in different human malignancies. [score:4]
MiR-210 is frequently up-regulated in colorectal cancer tissues and involved in CRC development. [score:4]
We also confirmed previous findings that showed that miR-210 was up-regulated in CRC cells in response to hypoxia and that miR-210 was induced in a time -dependent manner. [score:4]
We found that miR-210 upregulation was correlated with aggressive tumor progression in CRC and that it could be used in the prognostic screening of patients with this malignancy. [score:4]
Overexpression of VMP1 partially reverses the migration and invasion of CRC cells induced by miR-210. [score:3]
The expression levels of miR-210 in 193 pairs of human CRC tissues and corresponding non-cancerous tissues were examined using qRT-PCR. [score:3]
We also found that miR-210 level was positively correlated with HIF1α expression that was related to metastasis and unfavorable prognosis of CRC [12], [13]. [score:3]
However, there were no significant associations between miR-210 expression and the patient's gender, age, tumor location, or histology grade (all P>0.05). [score:3]
However, overexpression of VMP1 partially reversed the migration and invasion of CRC cells induced by miR-210. [score:3]
To measure the biological properties of miR-210 in CRC cells, we transiently modulated the miR-210 expression level by transfection with miR-210 mimics or inhibitor. [score:3]
In the multivariate analysis, the Cox proportional hazards mo del involving the five significant prognostic factors identified miR-210 expression as an independent prognostic factor for patients with CRC (P = 0.008). [score:3]
Furthermore, concomitant overexpression of miR-210 and VMP1 could partially abrogate miR-210 -induced metastatic potential in CRC cells. [score:3]
These results demonstrate that miR-210 can promote CRC cell migration and invasion by targeting VMP1. [score:3]
Cai et al. showed that miR-210 expression was significantly higher in pediatric osteosarcoma patients and was significantly associated with aggressive clinicopathological features and a poor prognosis [31]. [score:3]
The results showed that overall survival was significantly related to the miR-210 expression level (RR = 2.621; 95% CI, 1.457–4.712; P = 0.001) and other four parameters (tumor size, local invasion, regional lymph node metastasis, and TNM stage; all P<0.05). [score:3]
In epithelial ovarian cancer, however, miR-210 is often deleted and may inhibit cell cycle progression [27]. [score:3]
0090952.g003 Figure 3(A, C) MiR-210 expression in HT-29 (A) and SW480 (C) cells was significantly increased after transfection with the miR-210 mimics. [score:3]
These results add to the accumulating evidence that miR-210 plays a critical role in promoting cancer development and may assist in the development of new therapeutic regimens against hypoxic tumors. [score:3]
Our results provide the first evidence that miR-210 is overexpressed in CRC tissues and functions as a key factor in the progression of CRC. [score:3]
We further summarized the association of miR-210 expression levels with various clinicopathological characteristics in CRC tissues and found that miR-210 expression was significantly correlated with large tumor size (P = 0.014), local invasion (P = 0.047), positive regional lymph node metastasis (P = 0.001), and TNM stage (P = 0.005). [score:3]
And in HCC, VMP1 is identified as a downstream target of miR-210 and the reduced VMP1 correlates with tumor metastases [21]. [score:3]
Moreover, transfection with the miR-210 inhibitor dramatically diminished the migration and invasion ability of the hypoxic CRC cells, whereas transfection with the miR-210 mimics further enhanced the migration and invasion ability of the CRC cells (Fig. 5). [score:3]
Moreover, the expression of miR-210 greatly increased with prolonged exposure to hypoxia, indicating that miR-210 was indeed induced by hypoxia in CRC cell lines. [score:3]
In contrast, Greither et al. [33] reported that there were no statistically significant correlations between miR-210 expression and any aggressive clinicopathological features in soft-tissue sarcoma. [score:3]
In the present study, we found that the overexpression of miR-210 markedly promoted the migration and invasion of CRC cells. [score:3]
TargetScan identifies that 3′-UTR of VMP1 contains predicted binding site for miR-210 (Fig. 6A). [score:3]
Further studies are needed to reveal the network between miR-210 and other targeted genes, which will provide a more detailed insight to understand the molecular mechanism of the function of miR-210. [score:3]
The statistical values of miR-210 expression and the other clinicopathological parameters derived from the Cox proportional hazards regression mo del are listed in Table 2. 10.1371/journal. [score:3]
The statistical values of miR-210 expression and the other clinicopathological parameters derived from the Cox proportional hazards regression mo del are listed in Table 2. 10.1371/journal. [score:3]
The median miR-210 expression level in the tumor samples was chosen as the cut-off point. [score:3]
0090952.g002 Figure 2(A) MiR-210 expression in CRC cell lines. [score:2]
0090952.g007 Figure 7. (A, B) Transwell migration and invasion assays were performed in VMP1 -overexpressing HT-29 cells cotransfected with miR-210 mimics or negative control. [score:2]
MiR-210 expression is increased in CRC tissues and associated with a poor prognosis. [score:2]
These findings indicated that miR-210 may play important roles in the development of the progressive phenotype of CRC. [score:2]
In accordance with these results, transfection with the miR-210 inhibitor led to a significant decrease in the migration and invasion ability of CRC cells compared to the cells transfected with the miR negative control (Fig. 4B, 4D). [score:2]
MiR-210 is expressed in CRC cell lines and is induced by hypoxia in CRC cells. [score:2]
0090952.g004 Figure 4 (A, B) Transwell migration assays of HT-29 and SW480 cells were performed after transfection with the miR-210 mimics (A) or inhibitor (B). [score:2]
Accordingly, it is important to explore the potential roles of miR-210 in solid tumor progression, as this miRNA has been proven to play a key role in the development of cancer under hypoxic conditions [21], [30]. [score:2]
Luciferase activity assay showed that miR-210 significantly inhibited the luciferase activity of the WT 3′-UTR but not the Mut 3′-UTR of VMP1 in HEK293T cells (Fig. 6B). [score:2]
MiR-210 expression and clinicaopathological feature in CRC patients. [score:2]
As shown in Figure 7, miR-210 mimics could augment the metastatic ability of CRC cells and decreased metastatic potential was observed in VMP1 -overexpressing cells compared with control cells. [score:2]
These data indicate that miR-210 may play crucial roles during tumorigenesis and cancer progression and may exert various effects on different cancers. [score:1]
To evaluate whether miR-210 expression was an independent indicator of overall survival for CRC patients, we first applied a univariate Cox proportional hazards regression mo del to estimate the individual hazard ratio for all of the clinicopathological parameters. [score:1]
The correlation between miR-210 and HIF1α (or VMP1) was determined by Pearson's correlation analysis. [score:1]
These results indicate that miR-210 is also a hypoxic marker in CRC patients, as it is in other cancers, such as head and neck cancer [35]. [score:1]
HEK293T cells were transiently cotransfected with miR-210 mimics/miR -negative control and WT-VMP1 3′-UTR vector/MUT VMP1 3′-UTR vector. [score:1]
Because we demonstrated miR-210 could increase the migration and invasion potential of CRC cells, we hypothesized that miR-210 could also mediate the hypoxia -induced migration and invasion of CRC cells. [score:1]
Thus, in addition to its roles in the adaption of tumor cells to low-oxygen stress and as a marker for tumor hypoxia, we suggest that elevated levels of miR-210 may have biological functions associated with the malignancy and metastasis of tumors, potentially explaining why miR-210 is associated with a poor prognosis in cancer patients. [score:1]
0090952.g006 Figure 6 (A) The putative miR-210 binding sequences in VMP1 3′-UTR. [score:1]
Further investigation revealed that VMP1 was the functional down-stream target of miR-210 in CRC. [score:1]
The detailed results of the statistical tests between miR-210 expression and the clinicopathological characteristics are listed in Table 1. 10.1371/journal. [score:1]
Our data imply that miR-210 acts as an oncogenic miRNA in human colorectal cancer to promote metastasis, which is consistent with the findings of earlier studies [21]- [23]. [score:1]
These discordant findings may be explained by the various roles that miR-210 might play in the pathogenesis of different cancers. [score:1]
With regard to survival, univariate and multivariate analyses were performed to explore the potential prognostic value of miR-210 in CRC. [score:1]
In the current study, we focused on miR-210, the hypoxia -induced miRNA, and examined its expression in human CRC tissues, analyzed its correlation with clinicopathological characteristics and prognosis, and then uncovered the role of miR-210 in hypoxia -induced metastasis during colorectal cancer progression. [score:1]
The results of the univariate analysis showed that patients with higher miR-210 levels had a poorer prognosis than those with a lower miR-210 level. [score:1]
The above results demonstrate that miR-210 plays an important role in the hypoxia -induced migration and invasion of CRC cells. [score:1]
Most studies have shown that miR-210 may act as an oncogenic miRNA and is associated with a poor prognosis in some human epithelial cancers [21], [24]– [26]. [score:1]
The functional exploration of miR-210 indicated that miR-210 plays key roles in many cellular processes involved in physiological and malignant conditions. [score:1]
Furthermore, we found that miR-210 mediated the hypoxia -induced migration and invasion of CRC cells. [score:1]
Furthermore, the results of the multivariate analysis of the Cox proportional hazards regression mo del showed that miR-210 was an independent prognostic factor for overall patient survival after surgery. [score:1]
Taken together, our observations indicate that miR-210 could promote the migration and invasion ability of CRC cells. [score:1]
As presented in Figure 2D and 2E, we found that the miR-210 levels increased in response to hypoxia in these cells. [score:1]
Together with our results, these findings indicate that miR-210 could be a promising prognostic marker to identify patients with a poor prognosis. [score:1]
The detailed results of the statistical tests between miR-210 expression and the clinicopathological characteristics are listed in Table 1. 10.1371/journal. [score:1]
We then used the Kaplan-Meier survival curve analysis to assess the prognostic value of miR-210 in colorectal cancer. [score:1]
[1 to 20 of 88 sentences]
6
[+] score: 249
Of the several immune related targets, we demonstrate using overexpression and inhibition studies that STAT6 is a bona-fide target of miR-210. [score:9]
We further demonstrate that STAT6 is a novel target of miR-210 using overexpression and inhibition studies in human CTBs and that STAT6 in turn modulates IL-4. Additionally, poly I:C -treated pregnant TLR3 KO mice do not exhibit changes in HIF-1α, NF-κBp50, miR-210, STAT6, and IL-4 levels and do not develop PE. [score:7]
Moreover, overexpression of miR-210 in CTBs decreased IL-4 expression and vice-versa suggesting that decreased levels of STAT6 contribute to the decrease in IL-4 expression. [score:7]
Taken together our data suggests that both of these transcription factors are up-regulated following TLR3 activation and that their interplay contributes to miR-210 transcriptional up-regulation. [score:7]
HIF-1α induced under normoxic conditions may in turn bind to the miR-210 promoter and up-regulate its expression. [score:6]
miR-210 Overexpression and Inhibition. [score:5]
After 48 hrs of transfection, a significant increase in STAT6 (Fig. 6B) and IL-4 (Fig. 6C) expression was observed after miR-210 inhibition. [score:5]
Our results demonstrate for the first time that TLR3 activation in human CTBs significantly increases miR-210 expression and in our TLR3 -induced mouse mo del of PE placental miR-210 expression is increased significantly. [score:5]
Here we demonstrate that TLR3 activation induces miR-210 expression via the transcription factors HIF-1α and NF-kBp50 and that STAT6 is a target of miR-210. [score:5]
Of these, 11 miRs were overexpressed and miR-210 expression was increased 3.6-fold in severe PE patients. [score:5]
Although placental miR-210 expression is increased in PE patients, very few miR-210 targets and their pathophysiological role in PE have been identified so far. [score:5]
P. In order to determine if TLR3 activation directly contributes to miR-210 up-regulation, we treated pregnant TLR3 KO mice with poly I:C (P-PIC TLR3 KO). [score:5]
Pineles et al. used miRBase to determine putative mRNA targets of miR-210 and miR-210 targets are enriched in genes related to immune responses [29]. [score:5]
P. TargetScan [22] and miRanda [40] algorithms suggested STAT6 as a target of miR-210 (Fig. 2A). [score:5]
Recently, another transcription factor, the NF-κBp50 subunit, was also shown to bind the miR-210 promoter and regulate its expression [36]. [score:4]
Whether the same transcription factors also regulate miR-210 expression during normoxia remains to be elucidated. [score:4]
These results indicate that the transcription factors may bind to the promoter at different time points and their interplay regulates the expression of miR-210. [score:4]
Recent studies indicate that miR-210 is also up-regulated in the plasma of PE women [44]. [score:4]
It has been previously shown that HIF-1α regulates the expression of miR-210 in a variety of tumor types through a hypoxia-responsive element [34]. [score:4]
TLR3 Induced miR-210 Up-regulation in Pregnant Mice. [score:4]
Target genes of miR-210 were predicted to regulate immune responses, apoptosis, and lipid metabolism. [score:4]
Several targets of miR-210 have been identified through a combination of target prediction algorithms and biochemical assays. [score:4]
TLR3 Induced miR-210 Up-regulation in Human CTBs. [score:4]
In summary, our work suggests that miR-210 expression is increased by TLR3 possibly via HIF-1α and NF-κB leading to decreased levels of STAT6 and IL-4 and may partly contribute to the development of PE. [score:4]
Inhibition of miR-210 was similar at either 100 or 200 nM thus we used 100 nM for all subsequent studies (Fig. 6A). [score:3]
P. A. Schematic of human STAT6 3′-UTR sequence targeted by miR-210. [score:3]
CTB cells were transfected with either scramble (negative control) or different concentrations of a miR-210 inhibitor (100 nM or 200 nM). [score:3]
These results indicate a direct role of endogenous miR-210 in the negative regulation of STAT6 and IL-4. 10.1371/journal. [score:3]
Total RNA (including small RNAs) was isolated from placentas of both P and P-PIC mice at gestational day 18. miR-210 expression was subsequently determined by. [score:3]
Down-regulation of miR-210 increased STAT6 levels compared to scramble (negative control). [score:3]
In the present study we hypothesized that TLR3 activation via poly I:C increases placental miR-210 via activation of HIF-1α and NF-κBp50 which suppresses the STAT6/IL-4 anti-inflammatory pathway leading to PE. [score:3]
0067760.g006 Figure 6CTB cells were transfected with either scramble (negative control) or different concentrations of a miR-210 inhibitor (100 nM or 200 nM). [score:3]
Targetscan predicts one site (P [ct] < 0.1) whereas miRanda suggests two putative binding sites for miR-210 in the 3′UTR of STAT6 and the miRSVR score for binding site 1 is −0.587 and for binding site 2 is −0.0257. [score:3]
These results indicate a direct role of endogenous miR-210 in the negative regulation of STAT6 and IL-4. 10.1371/journal. [score:3]
Whether or not miR-210 expression also increases in our TLR3 -induced PE mouse mo del is unknown. [score:3]
Schematic of human STAT6 3′-UTR sequence targeted by miR-210. [score:3]
Validation of STAT6 as a Target of miR-210 in CTBs. [score:3]
Consistent with the finding that neither of the transcriptional activators was increased, we did not observe any increase in placental miR-210 expression in P-PIC TLR3 KO mice (Fig. 3C). [score:3]
In support, several studies showed that the expression of miR-210 increases upon exposure to hypoxia, which implies that miR-210 may be a potential marker of hypoxia. [score:3]
PE pregnancies are associated with poor placentation that can cause focal regions of ischemia/hypoxia in the placenta which in turn may cause increased miR-210 expression. [score:3]
Here we demonstrate that TLR3 activation induced the expression of miR-210, HIF-1α, and NF-κBp50 in placentas of wild-type mice as well as human CTBs. [score:3]
STAT6 is a Target of miR-210. [score:3]
miR-210 Expression in TLR3 Deficient Pregnant Mice Treated with Poly I:C. No significant change in placental HIF-1α, NF-κB, miR-210, STAT6, and IL-4 levels in TLR3 KO P-PIC mice. [score:3]
miR-210 expression is increased in placentas of women with PE. [score:3]
P. A. Total RNA (including small RNAs) was isolated from placentas of both P and P-PIC mice at gestational day 18. miR-210 expression was subsequently determined by. [score:3]
Thus, increased miR-210 expression may serve as a potential biomarker for PE. [score:3]
Based on our results, miR-210 inhibition may ameliorate the symptoms of PE. [score:3]
HIF-1α and NF-κB induced miR-210 expression in hypertensive P-PIC mice. [score:3]
Transfection of miR-210 mimics (pre-miRs; Dharmacon) or miR-210 inhibitors (anti-miRs; Ambion) was performed in human CTBs using the reverse transfection technique recommended for use with the siPORT NeoFX transfection reagent (Life Technologies). [score:3]
miR-210 expression was increased significantly at 6, 24, and 48 hrs after poly I:C treatment (Fig. 4C). [score:3]
Thus there is a need to identify additional miR-210 targets and disseminate their role in the pathophysiology of PE. [score:3]
C. Under the same conditions as above, miR-210 expression increased following TLR3 activation with the peak induction seen at 48 hrs as determined by. [score:3]
We confirmed increased expression of miR-210 in CTBs transfected with a pre-miR mimetic of miR-210 by (Fig. 5A). [score:3]
Levels of miR-210 may be a more accurate predictor of PE as miR-210 expression in serum samples increases with the severity of PE [44], but this remains to be determined. [score:3]
Moreover, expression of miR-210 has been shown to be induced during hypoxia by hypoxia inducible factor-1α (HIF-1α) [32]– [35] and the nuclear factor-κB (NF-κB) p50 subunit [36]. [score:3]
NF-kBp50 levels in P-PIC placentas increased 2.7 fold compared to P placentas (p<0.05, Fig. 1D ) suggesting that NF-kBp50 also regulates miR-210 expression. [score:3]
The expression of miR-210 was normalized to mouse snoRNA 142 for mouse placentas and to human U6 for CTBs. [score:3]
A study by Enquobahrie et al. indicated a significant 1.5-fold increase in miR-210 expression in PE placentas [43]. [score:3]
Furthermore, P-PIC TLR3 KO mice, which exhibited no symptoms of PE, did not exhibit an increase in placental miR-210 expression compared to P TLR3 KO mice. [score:2]
The role of miR-210 in angiogenesis and iron metabolism are well established but the role of miR-210 in the regulation of genes related to immune responses are unknown. [score:2]
Compared to control P mice, miR-210 expression increased significantly in P-PIC placentas (4.9 fold, p<0.05, Fig. 1A) and this was associated with increased systolic blood pressure (P: 95±2 mm Hg vs. [score:2]
Overexpression of miR-210 decreased STAT6 levels compared to scramble (negative control). [score:2]
To determine if miR-210 expression is also induced in placentas from P-PIC mice compared to P mice at gestational day 18 we performed reactions. [score:2]
Previous studies have shown that miR-210 is induced during hypoxia and HIF-1α was identified as a transcription factor that binds to the promoter of miR-210 [32]– [34]. [score:1]
Moreover, the NF-kBp50 subunit also binds to the promoter of miR-210 under hypoxia [36]. [score:1]
Among them, miR-210 was found in several studies to be elevated significantly in PE women [29], [31]. [score:1]
The promoter of miR-210 has several putative transcription factor binding sites [34]. [score:1]
miR-210 was increased significantly in PE placentas and mostly localized in the syncytiotrophoblasts. [score:1]
CTBs were transfected with either scramble (negative control) or different concentrations of miR-210 mimic (30 nM or 100 nM). [score:1]
The induction of miR-210 by TLR3 decreases STAT6 and IL-4 which may contribute to the inflammatory state evident in PE. [score:1]
0067760.g005 Figure 5CTBs were transfected with either scramble (negative control) or different concentrations of miR-210 mimic (30 nM or 100 nM). [score:1]
C. Placental miR-210 levels in both P TLR3 KO and P-PIC TLR3 KO mice were determined by. [score:1]
A. After 48 hrs of treatment, RNA was isolated and was performed to determine miR-210 levels. [score:1]
To further investigate the role of miR-210 on STAT6/IL-4 expression, anti-miR-210 was transfected into human CTBs. [score:1]
Poly I:C increased HIF-1α and NF-κB which induced miR-210 leading to decreased STAT6 and IL-4 in human CTBs. [score:1]
Since the 3′UTR of STAT6 is a predicted target of miR-210, we measured protein levels of STAT6. [score:1]
Anti-miR-210 increased STAT6 and IL-4 levels in human CTBs. [score:1]
miR-210 mimic decreased STAT6 and IL-4 levels in human CTBs. [score:1]
P placentas, Fig. 1C) suggesting that HIF-1α likely binds to the promoter of miR-210 under normoxia. [score:1]
[1 to 20 of 79 sentences]
7
[+] score: 220
[34] We proved CTGF increases accumulation of HIF-1 α into nuclei as inhibited by miR-210 inhibitor, thus promoting HIF-1 α -dependent VEGF expression and angiogenesis by inhibiting GPD1L expression and PHD2 activity via miR-210 upregulation. [score:14]
CTGF promotes HIF-1 α -dependent VEGF expression and angiogenesis by inhibiting GPD1L expression and PHD2 activity via upregulating miR-210To identify mechanism of miR-210-involved VEGF -dependent angiogenesis, we searched for downstream genes using bioinformative screening analysis of miRNA target databank: TargetScan, MicroCosm, and miRanda. [score:14]
[35] CTGF -inhibited HIF-1 α hydroxylation was reversed by miR-210 inhibitor, leading to decrease the accumulation of HIF-1 α into nucleus (Figure 5c), indicating CTGF -mediated miR-210 upregulation inhibits PHD2 expression and subsequently increases HIF-1 α activation. [score:12]
These suggest CTGF boosting HIF-1 α -dependent VEGF expression and angiogenesis by inhibiting GPD1L expression and PHD2 activity through upregulation of miR-210. [score:10]
CTGF activates PI3K, AKT, ERK, and NF- κB/ELK1 pathway, leading to the upregulation of miR-210, contributing to inhibit the GPD1L expression and PHD2 activity, promoting the HIF-1 α -dependent VEGF expression and angiogenesis in human synovial fibroblasts (Figure 7). [score:10]
CTGF promotes HIF-1 α -dependent VEGF expression and angiogenesis by inhibiting GPD1L expression and PHD2 activity via upregulating miR-210. [score:10]
45, 46 We use miRNA target prediction (TargetScan, MicroCosm, and miRanda) to find GPD1L as most probable miR-210 target, whereas CTGF decreased GPDlL mRNA expression. [score:9]
To verify direct CTGF inducement of miR-210-mediating VEGF -dependent angiogenesis, we transfected miR-210 mimic or inhibitor into OASFs; miR-210 inhibitor but not mimic blocked CTGF -induced VEGF expression, EPC tube formation and migration (Figures 3b–d). [score:8]
We also indicated that miR-210 directly repressed GPD1L protein expression through binding to 3′UTR of human GPD1L gene, thereby negatively regulating GPD1L that is documented as promoting PHD activity and later impeding HIF-1 α expression. [score:7]
On the other hand, miR-210 inhibitor reversed CTGF -inhibited GPD1L mRNA and protein expression (Figure 5b). [score:7]
For serial experiments, cells were pretreated for 30 min with inhibitors, including Ly294002, Wortmannin, AKTi, U0126, PD98059, and HIF-1 α inhibitor or transfected with miR-210 mimic, miR-210 inhibitor, ELK1 siRNA, p65 siRNA, and CTGF shRNA for 24 h, followed by treatment with CTGF for 24 h to prevent signaling via CTGF pathway. [score:7]
Transfection of miR-210 inhibitor significantly reversed CTGF -inhibited GPD1L expression. [score:7]
With CTGF -mediated VEGF expression or EPC tube formation and migration reduced by transfection with ELK1 and p65 siRNA (Figures 4c–e), we postulate CTGF-increased miR-210 upregulation and angiogenesis as involving NF- κB and ELK1 transactivation. [score:6]
One mechanism underlying CTGF increased VEGF yield by activating PI3K, AKT, ERK, and NF- κB/ELK1 pathway, thus upregulating miR-210 expression. [score:6]
Pretreatment with PI3K (Ly294002 or Wortmannin), AKT (AKTi), and ERK inhibitors (U0126 or PD98059) for 30 min reduced CTGF -induced miR-210 expression (Figure 3f). [score:5]
These inhibitors antagonized CTGF-increased miR-210 expression, indicating CTGF-increased VEGF -dependent angiogenesis via PI3K, AKT, ERK, and miR-210 signaling pathways. [score:5]
To identify mechanism of miR-210-involved VEGF -dependent angiogenesis, we searched for downstream genes using bioinformative screening analysis of miRNA target databank: TargetScan, MicroCosm, and miRanda. [score:5]
Figure 4b shows all these inhibitors or siRNAs markedly reducing CTGF -induced miR-210 expression. [score:5]
From these three databanks overlapping between predicted targets of miR-210, GPD1L ranked as most probable target. [score:5]
We used luciferase reporter vectors harboring wild-type 3'-untranslated region (3′UTR) of GPD1L mRNA (wt-GPD1L-3′UTR) and vector containing mismatches in predicted miR-210 -binding site (full muntant-GPD1L-3′UTR) to learn if miR-210 regulates 3′UTR of GPD1L. [score:4]
Therefore, miR-210 directly represses GPD1L expression through binding to 3′UTR of human GPD1L gene. [score:4]
Among significantly regulated miRNAs, miR-210 was most upregulated in CTGF -treated OASFs compared with controls. [score:4]
Involvement of NF- κB and ELK1 in CTGF increases miR-210 upregulation. [score:4]
Involvement of NF- κB and ELK1 in CTGF increases miR-210 upregulationThe miR-210 promoter contains NF- κB- and ELK1 -binding sites. [score:4]
We screened 96 miRNAs from customized miRNA array to find miR-210 most upregulated in CTGF -treated OASFs. [score:4]
47, 48 On the other hand, PI3K, AKT, and ERK reportedly regulate miR-210 expression. [score:4]
We directly applied CTGF in OASFs to rate miR-210 expression, which miR-210 raised in a time -dependent manner (Figure 3a). [score:4]
PI3K, AKT, and ERK pathways are reported to regulate expression of miR-210 and VEGF. [score:4]
Figure 5a shows CTGF and miR-210 mimic inhibiting luciferase activity in wt-GPD1L-3′UTR plasmid but not in muntant-GPD1L-3′UTR plasmid. [score:3]
[44] We saw OASF transfection with miR-210 inhibitor reducing CTGF -induced VEGF production as well as EPC tube formation and migration, making it an angiogenic gene in human OASFs. [score:3]
[34] To determine which transcription factors are involved in CTGF -induced miR-210 expression, three different length miR-210 promoter constructs were generated. [score:3]
Also, qPCR confirmed expression of miR-210 in OASFs starkly higher than in normal SFs, indicating that miR-210 promotes angiogenesis. [score:3]
portend CTGF acting via PI3K, AKT, and ERK signaling pathways to promote miR-210 expression and VEGF -dependent angiogenesis in human synovial fibroblasts. [score:3]
31, 32, 33 We assessed their roles in CTGF -induced miR-210 and VEGF expression. [score:3]
CTGF thus increases VEGF -dependent angiogenesis by augmenting miR-210 expression through PI3K, AKT, ERK, and NF- κB/ELK1 signaling pathways in human synovial fibroblasts. [score:3]
We also found miR-210 expression in OASFs sharply higher than in normal SFs (Supplementary Figure 2). [score:3]
These suggest miR-210 as positive regulator of CTGF -mediated, VEGF -dependent angiogenesis in OASFs. [score:2]
The customized miRNA array primer was obtained from System Biology Ireland (Galway, Ireland); DMEM, α-MEM, fetal bovine serum (FBS), and all other cell culture reagents from Gibco-BRL Life Technologies (Grand Island, NY, USA); wild-type 3′UTR of GPD1L mRNA (wt-GPD1L- 3′UTR) and vector containing mismatches in predicted miR-210 -binding site (full muntant-GPD1L-3′UTR) from Addgene (Cambridge, MA); ON-TARGET plus siRNAs of ELK1, p65, GPD1L and control from Dharmacon Research (Lafayette, CO, USA); all other chemicals Sigma-Aldrich (St. [score:2]
The miR-210 promoter contains NF- κB- and ELK1 -binding sites. [score:1]
Plasmid pGL2-Basic (Promega, Madison, WI, USA) was used to generate constructs of the human miR-210 (hmiR-210) promoter. [score:1]
CTGF promotes VEGF production and angiogenesis by increasing miR-210 via PI3K, AKT, and ERK pathways. [score:1]
Pretreatment of cells with Ly294002, Wortmannin, AKTi, U0126, and PD98059 abolished CTGF-increased p-p65 and p-ELK1 accumulation into nuclei as well as p65 and ELK1 binding to NF- κB and ELK1 elements on miR-210 promoter (Figures 4f and g). [score:1]
[1 to 20 of 42 sentences]
8
[+] score: 211
Other miRNAs from this paper: mmu-mir-210
In preliminary studies we employed lentiviral -mediated anti-sense miR-210 gene transfer technique to downregulate miR-210 expression in human hepatoma cells and found that knockdown of miR-210 expression significantly suppressed cell viability, induced cell arrest, increased apoptotic rate and enhanced radiosensitivity in hypoxia [17]. [score:11]
Our preliminary studies showed that AIFM3 downregulation by siRNA attenuated radiation induced apoptosis in miR-210 downregulated hypoxic human hepatoma cells, which suggest miR-210 downregulation mediate enhanced radiation induced apoptosis in hypoxic human hepatoma cells through AIFM3 gene at least in part [17]. [score:10]
These results indicated that knockdown of miR-210 decreased HIF-1α protein and increased protein expression of miR-210 targeted MNT, EFNA3 and AIFM3 genes in human hepatoma xenograft, which might lead to cell proliferation and angiogenesis suppression and apoptosis enhancement. [score:8]
Our preliminary findings suggested that miR-210 might be a potential therapeutic target and specific inhibition of miR-210 expression in combination with radiotherapy showed an enhanced effect on hypoxic human hepatoma cells in vitro[17]. [score:7]
HIF-1α protein downregulation by knockdown of miR-210 might be due to destruction of a hypoxia -induced positive feedback loop, in which HIF-1α induce miR-210 expression in hypoxia, which represses glycerol-3-phosphate dehydrogenase 1-like (GPD1L), contributing to increase of HIF-1α protein stability [33]. [score:7]
Knockdown of miR-210 increased protein expression of miR-210 targeted genes, but decreased HIF-1α protein in hepatoma xenograft. [score:6]
We hypothesis that miR-210 might be a logical novel target to overcome hypoxia -induced radioresistance and knock-down of miR-210 might enhance radiosensitivity of hypoxic cells in hepatoma xenograft through inhibiting proliferation and angiogenesis and inducing apoptosis. [score:6]
Effect of knockdown of miR-210 on protein expression of HIF-1α and miR-210 targeted MNT, EFNA3 and AIFM3 genes in hepatoma xenograft. [score:6]
These findings suggest that specific inhibition of miR-210 expression may be a means to enhance the effectiveness of radiotherapy to human hepatoma. [score:5]
In summary, our studies demonstrated that knockdown of miR-210 inhibited proliferation and angiogenesis, induced apoptosis in human hepatoma SMMC-7721 xenograft and knockdown of miR-210 in combination with radiotherapy showed an enhanced anti-tumor effect on human hepatoma. [score:5]
Figure 2 Detection of protein expression of HIF-1α and miR-210 targeted genes in hepatoma xenograft by Western blot. [score:5]
It has been reported that high levels of miR-210 were associated with disease recurrence and short overall survival in head and neck squamous cell carcinoma [23] and display an inverse correlation with disease-free and overall patient survival in human breast cancer samples [24]. [score:5]
Protein expression of HIF-1α and miR-210 targeted genes in human hepatoma xenograft was assessed by Western blot. [score:5]
These data demonstrate that stable integration of anti-sense miR-210 significantly suppressed miR-210 expression in human hepatoma xenograft in nude mice. [score:5]
Fold changes in miR-210 expression between treatments and controls were determined by the 2 [-ΔΔCT] method, normalizing the results to U6 RNA expression level. [score:5]
Knockdown of miR-210 in combination with radiotherapy is more effective than radiotherapy alone or miR-210 knockdown therapy alone in suppressing tumor growth and extending survival duration. [score:5]
Our experiments demonstrated specific inhibition of miR-210 expression might be a means to enhance the effectiveness of radiotherapy to human hepatoma. [score:5]
AIFM3, a gene homologous to the apoptosis-inducing factor (AIF), is a direct target of miR-210 in human hepatoma cells [17, 31]. [score:4]
These results suggest that knockdown of miR-210 may lead to tumor growth delay by cell proliferation and angiogenesis suppression and apoptosis enhancement. [score:4]
These results suggest that knockdown of miR-210 in combination with radiotherapy is more effective than radiotherapy alone or anti-sense miR-210 therapy alone in suppressing tumor growth and extending survival duration. [score:4]
Among these hypoxia -induced miRNAs, miR-210 is unique in its wide distribution, HIF dependence and robust upregulation in response to hypoxia [11]. [score:4]
Tumor growth was delayed in miR-210 downregulated xenograft. [score:4]
To investigate the mechanism underlying the knockdown of miR-210 mediated tumor growth delay, we analyzed protein expression of HIF-1α gene and miR-210 targeted MNT, EFNA3 and AIFM3 genes in human hepatoma xenograft by Western blot. [score:4]
The Western blot results indicated that knockdown of miR-210 decreased HIF-1α protein and increased protein expression of MNT, EFNA3 and AIFM3 genes in human hepatoma xenograft. [score:4]
The target human hepatocarcinoma SMMC-7721 cells were infected with both of the viruses (encoding either anti-sense miR-210 or scramble sequence) and selected using puromycin. [score:3]
Figure 1 Real-time Reverse transcription-Polymerase Chain Reaction (RT-PCR) analysis of miR-210 expression (fold change) in human hepatoma xenograft. [score:3]
MiR-210 could override hypoxia -induced cell cycle arrest by downregulating MNT [13]. [score:3]
Real-time reverse transcription-polymerase chain reaction (RT- PCR) analysis of miR-210 expression in tumor tissues. [score:3]
Over -expression of EFNA3 significantly blocked the angiogenesis effect of miR-210 [30]. [score:3]
In the present study, in order to investigate the effect of knockdown of miR-210 in tumorigenesis in vivo, we subcutaneously implanted miR-210 downregulated human hepatoma SMMC-7721 cells into nude mice. [score:3]
Several miR-210 targets which influence cell proliferation, apoptosis, metabolism, and angiogenesis have been identified such as E2F3, MYC antagonist (MNT), caspase-8 associated protein-2 (CASP8AP2), iron-sulfur cluster scaffold protein (ISCU) and the receptor tyrosine kinase ligand ephrin-A3 (EFNA3) [12- 16]. [score:3]
Huang et al. have demonstrated that stably expression of miR-210 in implanted tumor tissue could repress tumor growth in immunodeficient mice [26]. [score:3]
Figure 4 Effect of knockdown of miR-210 in combination with radiotherapy on survival of mice bearing human hepatoma. [score:2]
Figure 3 Effect of knockdown of miR-210 in combination with radiotherapy on human hepatoma xenograft growth. [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on survival of nude mice bearing human hepatoma. [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on cell proliferation in human hepatoma xenograft was examined by Ki-67 staining, which is a specific marker of proliferating cell. [score:2]
MiR-210 expression is elevated in a variety of human solid tumors [21, 22]. [score:2]
MiR-210 expression in hepatoma xenograft. [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on tumor angiogenesis was analyzed by CD31 staining, which is a specific marker of endothelial cells. [score:2]
Knockdown of miR-210 in combination with radiotherapy showed an enhanced anti-tumor effect on human hepatoma xenograft. [score:2]
MiR-210 expression in tumor tissues was assessed by real-time Reverse transcription-Polymerase Chain Reaction (RT-PCR). [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on apoptosis in human hepatoma xenograft. [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on angiogenesis in human hepatoma xenograft. [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on cell proliferation in human hepatoma xenograft. [score:2]
Effect of knockdown of miR-210 in combination with radiotherapy on human hepatoma xenograft growth in athymic nude mice. [score:2]
In contrast, no obvious change of miR-210 expression was observed in SMMC-7721/Lv-scr xenograft compared with that in SMMC-7721 xenograft (p > 0.05) (Figure  1). [score:2]
To investigate the mechanism underlying the knockdown of miR-210 mediated growth delay in SMMC-7721/Lv-anti-210 xenograft, we analyzed protein expression of HIF-1α, MNT, EFNA3 and AIFM3 genes in human hepatoma xenograft by Western blot. [score:2]
HIF-1α directly binds to a hypoxia responsive element (HRE) on the proximal miR-210 promoter, located 400 bp upstream of the structure [11]. [score:2]
SMMC-7721 Cells with stable integration of the anti-sense miR-210 were generated through lentiviral -mediated gene transfer and were subcutaneously implanted into nude mice. [score:1]
The average tumor volume reached 1772 mm [3] in mice of control group on day 30, while only 593 mm [3] (33.46% of control) in combined therapy group, 1295 mm [3] (73.10% of control) in anti-sense miR-210 therapy group, and 913 mm [3] (51.52% of control) in radiotherapy group. [score:1]
The mice implanted with SMMC/Lv-anti-210 cells were divided into two groups: Anti-sense miR-210 therapy group received no X-irradiation; Combined therapy group was subjected to 8 Gy X-ray irradiation. [score:1]
Thus, miR-210 functions as a micro-controller of a wide range of cellular responses to hypoxia. [score:1]
The quantification of IMVD showed 9.11 ± 2.67, 9.89 ± 2.09, 8.22 ± 2.22, 4.89 ± 1.76 and 4.78 ± 1.79 in control, negative control vector, radiotherapy, anti-sense miR-210 therapy and combined therapy group, respectively. [score:1]
A: control group; B: negative control vector group; C: radiotherapy group; D: anti-sense miR-210 therapy group; E: combined therapy group. [score:1]
In the present study, we investigated the effect of knockdown of miR-210 in tumorigenesis and the efficacy of knockdown of miR-210 in combination with radiotherapy in nude mice bearing human hepatoma SMMC-7721 cells and its mechanism. [score:1]
anti-sense miR-210 therapy group. [score:1]
SMMC-7721 Cells with stable integration of the anti-sense miR-210 (5′-TCAGCCGCTGTCACACGCACAG-3′) or scramble sequence (5′-TTCTCCGAACGTGTCACGTTTC-3′) were generated through lentiviral -mediated gene transfer [17]. [score:1]
However, genomic deletions of miR-210 in human epithelial ovarian cancer samples suggested these deletions as a possible trigger to tumorigenesis [12]. [score:1]
The median survival of control, negative control vector, radiotherapy, anti-sense miR-210 therapy and combined therapy group was 42.83 ± 4.75, 43.5 ± 6.06, 72.50 ± 5.58, 53.83 ± 6.85 and 84.33 ± 5.54 days, respectively. [score:1]
MiR-210 expression in SMMC-7721/Lv-anti-210 xenograft was significantly decreased compared with that in SMMC/Lv-scr xenograft (p < 0.001). [score:1]
MiR-210 is regulated by HIF-1α, HIF-2α and nuclear factor κB (NFκB) [11, 13, 20]. [score:1]
TUNEL staining was done to assess the apoptotic effect of knockdown of miR-210 in combination with radiotherapy in tumors, which showed an increased number of TUNEL -positive cells in treatment groups compared with control group. [score:1]
Clonal cell populations carrying anti-sense miR-210 or scramble sequence were obtained by limiting dilution of 100–300 cells in three 96-well plates. [score:1]
MiR-210 expression was assessed by real-time PCR according to the TaqMan MicroRNA Assay protocol (Applied Biosystems). [score:1]
The stem–loop of miR-210 is located in an intron of a noncoding RNA, which is transcribed from AK123483 on chromosome 11p15.5 [11]. [score:1]
NFκB p50 can physically interact with a conserved κB binding site and activate miR-210 promoter under hypoxia [20]. [score:1]
MiR-210 is the most consistently and robustly induced miRNA under hypoxia and functions as a micro-controller of a wide range of cellular responses to hypoxia. [score:1]
The quantification of TUNEL staining showed 3.44 ± 1.42%, 3.89 ± 1.05%, 18.89 ± 4.28%, 10.89 ± 2.42% and 27.67 ± 3.87% positive cells in control, negative control vector, radiotherapy, anti-sense miR-210 therapy and combined therapy group, respectively. [score:1]
In addition, miR-210 levels correlate with breast cancer aggressiveness and metastatic potential [25]. [score:1]
[1 to 20 of 69 sentences]
9
[+] score: 199
Table S4Full list of the predicted targets transcripts down-regulated following hsa-miR-210, hsa-miR-147a or hsa-miR-147b overexpression in A549 cells. [score:8]
Interestingly, some transcripts that were slightly repressed in microarrays experiments were significantly inhibited in luciferase experiments: ALDH5A, SDHD and SH3BGRL, identified initially as miR-210-only targets turned out to be also targeted by miR-147b while the opposite situation occurred with IER5. [score:7]
Interestingly, we found a co-enrichment of hsa-miR-147b and hsa-miR-210 predicted targets in several experiments performed in different hsa-miR-210 transfected cell types (data deposited in the NCBI Gene Expression Omnibus under serie GSE33247 and data not shown) using several algorithms including for instance TargetScan and microCosm. [score:7]
For instance, using TargetScan as prediction tool, we found an enrichment of more than 10 fold for miR-147b predicted targets in miR-210 -transfected cells and similar data were found in the opposite conditions (Figure 3A, list of predicted targets in Table S4). [score:7]
While it is well known that miR-210 expression is under the control of Hypoxia-Inducible Factor-1 alpha (HIF-1α) in virtually all cell lines tested, including A549 cells, the regulation of expression of hsa-miR-147a and hsa-miR-147b has not been well documented yet. [score:6]
B) Venn diagram summarizing the predicted common targets of miR-210 and miR-147 family members using the combination of transcriptomic data and different bioinformatics prediction tools: TargetScan and a search of a 6 nt complementary seed 2–7 sequences in 3′UTR. [score:5]
Multiple studies have consistently established that miR-210 induction is a feature of the hypoxic response in both normal and transformed cells and its overexpression has been detected in a variety of cardiovascular diseases and solid tumors (for review, [48]). [score:5]
Identification of miR-210, miR-147a and miR-147b Targets by mRNA Profiling of A549 Cells Overexpressing Pre-miRNAs. [score:5]
B) Venn diagram summarizing the predictive common targets of miR-210 and miR-147 family members using different bioinformatics prediction tools: TargetScan, microCosm and a search of a 7 nt complementary seed 2–8 sequences in 3′UTR using our laboratory-made tool “MicroCible” [25] (http://www. [score:5]
Taken together, these data indicated that mRNAs that are knocked down following transfection by miR-210 and miR-147b tend to overlap substantially (between 40 and 70% depending on the prediction tool) but are different from those down-regulated by miR-147a (Figure 3A and Figure S1B). [score:5]
Our more recent experiments using a lentiviral approach confirmed that expression of miR-210 within ∼2fold of physiological induction by hypoxia also resulted in a significant co-enrichment of miR-210 and miR-147b predicted targets (data not shown). [score:5]
0044919.g004 Figure 4A) Direct targeting of the 15 candidate transcripts by miR-210, miR-147a and miR-47b was analyzed in vitro. [score:4]
A) Direct targeting of the 15 candidate transcripts by miR-210, miR-147a and miR-47b was analyzed in vitro. [score:4]
A wide spectrum of miR-210 targets have been identified, with roles in mitochondrial metabolism, angiogenesis, DNA repair, and cell survival. [score:3]
Logarithm (base 2) of the average expression, logarithm (base 2) of the ratio of miR-210/miR-Neg and false discovery rate p-values using the Benjamini-Hochberg correction are represented. [score:3]
A) In silico evaluation of the common predicted targets between hsa-miR-210, hsa-miR-147a and hsa-miR-147b using TargetScan or microCosm. [score:3]
0044919.g001 Figure 1 In silico prediction of miR-210 and miR-147 family targets. [score:3]
Therefore, these experiments underlined the close proximity of miR-210 and miR-147b regarding apoptotic -mediated cellular effects while miR-147a appears as a potent inhibitor of cell proliferation and migration. [score:3]
Overall, these results underscore the highly similar impact on transcriptome of miR-210 and miR-147b overexpression. [score:3]
Figure S1Overlap between predicted targets of miR-210 and miR-147 family members. [score:3]
The constructs, corresponding to the 3′UTR of NDUFA4, SDHD and E2F3, 3 validated targets of miR-210 have been described elsewhere [26]. [score:3]
MiR-210 (A) and miR-147b (B) expression was monitored by qPCR on RNA from A549 cells stimulated with 10 µg/ml LPS or 10 ng/ml TNFα with or without exposure to 1% O2 for 48 hours. [score:3]
Indeed, hypoxia and TLR stimulation, which increase miR-210 and miR-147b, respectively, induce very large and different transcriptional programs that will likely interfere with an efficient comparison of the corresponding data sets and also mask the more subtle effects of these miRNAs on their mRNA targets. [score:3]
Figure S2 Graphs adapted from our webtool miRontop (Le Brigand et al. 2010, Bioinformatics) showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of hsa-miR-210, hsa-miR-147a and hsa-miR-147b. [score:3]
0044919.g003 Figure 3) Graphs adapted from our webtool miRontop [33] showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of miR-210, miR-147a and miR-147b. [score:3]
miR-147b and miR-210 expression in response to LPS, TNFα and hypoxia. [score:3]
In silico prediction of miR-210 and miR-147 family targets. [score:3]
Using our recently described application MiRonTop [33] and a large set of miRNA -overexpressed microarray experiments, we noticed indeed a close relationship between two miRNAs from distinct families, hsa-miR-147b and hsa-miR-210. [score:3]
Cellular Phenotypes Triggered by miR-147a, miR-147b and miR-210 Overexpression. [score:3]
Figure S3 Graphs adapted from our webtool miRontop (Le Brigand et al. 2010, Bioinformatics) showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of hsa-miR-210, hsa-miR-147a and hsa-miR-147b. [score:3]
A significant inhibition of cell proliferation by miR-147a was also observed in regular condition of growth on plastic (Figure 5B, left panel) while an opposite early transient stimulation by both miR-147b and miR-210 was noticed. [score:3]
Note that an important percentage of genes knocked down by miR-210 were also knocked down by miR-147b but not by miR-147a. [score:3]
Graphs adapted from our webtool miRontop [33] showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of miR-210, miR-147a and miR-147b. [score:3]
Importantly, we found a significant co-enrichment of miR-210 and miR-147b predicted targets using these tools in cells transfected by either of these 2 miRNAs while no significant link was found with miR-147a (Figure 3A and Figure S1B). [score:3]
Table S3 List of themes corresponding to “canonical pathways” annotations identified by Ingenuity Pathway Analysis in response to overexpression of hsa-miR-210, hsa-miR-147a or hsa-miR-147b. [score:3]
Table S2 List of themes corresponding to “Molecular Function” annotations identified by Ingenuity Pathway Analysis in response to overexpression of hsa-miR-210, hsa-mir-147a or hsa-miR-147b. [score:3]
Enrichment of miR-210 and miR-147 family members-predicted targets in the different subsets of modulated transcripts following transfection by each miRNA candidate. [score:3]
Biological consequences of miR-210, miR-147a and miR-147b overexpression on A549 cells proliferation and viability. [score:3]
Global effect of miR-210 and miR-147 family members over -expression on transcriptome in the A549 cell line. [score:3]
B) Venn diagram summarizing the predicted (using the microarray approach) and validated (after luciferase assay) common targets of miR-210 and miR-147 family members. [score:2]
Overall, the global picture summarizing the target specificity for these 15 transcripts appeared quite similar for microarray and luciferase assays and underscored the close relationships between miR-210 and miR-147b (Figure 4B). [score:2]
More specifically, our study is the first demonstration of the strong functional link existing between miR-147b, associated within inflammatory response, and miR-210 associated with hypoxia and cancer, i. e. two miRNAs previously associated to distinct regulatory pathways and cellular role. [score:2]
Our data interestingly connect the molecular pathways regulated by miR-210 and miR-147b, suggesting that they could drive a common stress-related response following either hypoxia or inflammation. [score:2]
Distinct Regulation of miR-210 and miR-147 Family Members in A549 Cells. [score:2]
Second, we could validate a significant number of common predicted targets of miR-210 and miR-147b using luciferase assay. [score:2]
Interestingly, the co-enrichment observed between miR-210 and miR-147b was also detected when we considered conserved or non-conserved targets (Figure S3). [score:2]
We found a close relationship between two miRNAs from distinct families, hsa-miR-147b and hsa-miR-210, but sharing the same “minimal” seed sequence (2–7): UGUGCG. [score:1]
0044919.g005 Figure 5A549 cells were transfected with 10 nM pre-miR-210, pre-miR-147a, pre-miR-147b or pre-miR-Neg and analyzed for several proliferation (A-E) and viability (F-G) parameters. [score:1]
As shown in Figure 2B and 2C, the similarity between miR-210 and miR-147b -mediated transcriptomic changes was particularly underlined while most of miR-147a -mediated changes were specific. [score:1]
The situation is different for miR-210 and miR-147b. [score:1]
Chemically synthesized miRNA duplexes pre-miR-210, pre-miR-147a and pre-miR-147b and control pre-miRNA (pre-miR-Neg # 1) were purchased from Ambion. [score:1]
Interestingly, all the pathways significantly modulated by miR-147b were also altered by miR-210. [score:1]
0044919.g002 Figure 2A549 cells were transfected with synthetic pre-miR-210/147a/147b (10 nM) or with negative pre-miRNA (n = 3). [score:1]
This suggests that these two different external stimuli could lead to a similar intracellular molecular adaptation regarding metabolic switch as suggested by several reports about miR-210 function [48]. [score:1]
A549 cells were transfected with 10 nM pre-miR-210, pre-miR-147a, pre-miR-147b or pre-miR-Neg and analyzed for several proliferation (A-E) and viability (F-G) parameters. [score:1]
A) Alignment of miR-210, miR-147a and miR-147b mature sequences. [score:1]
As previously shown for miR-210, we also found a close association of miR-147a and miR-147b signatures with “Oxidative phosphorylation”, “Mitochondrial dysfunction” and “Death Receptor signalling” [26]. [score:1]
We could first show the strong similarity between miR-210 and miR-147b at a whole genome transcriptome level while it appeared that miR-147a -mediated changes were highly specific. [score:1]
A strong wound closure delay was observed following pre-miR-147a transfection while no significant effect could be detected with pre-miR-210 and pre-miR-147b. [score:1]
Cell cycle analysis was then performed and indicated that miR-147a mediated cell cycle arrest in G1 phase while miR-210, and to a lesser extent miR-147b slightly increased the fraction of cells in the S/G2 phase (Figure 5C and 5D). [score:1]
As expected, miR-210 was significantly induced in A549 cells under hypoxic condition but was insensitive to LPS or TNFα treatment (Figure 6A). [score:1]
A549 cells were transfected with synthetic pre-miR-210/147a/147b (10 nM) or with negative pre-miRNA (n = 3). [score:1]
On each panel, miR-210, miR-147a and miR-147b are highlighted as blue, green and red dots, respectively. [score:1]
Figure S4 Dose-response effect of miR-210, miR-147a and miR-147b on A459 cells viability. [score:1]
B) Heatmap comparing normalized log2 of the ratio between miR-210 or miR-147 family members and miR-Neg. [score:1]
This validation set was based on different criteria, including the best p-values associated to transcripts modulation, the selection of transcripts that belong to the various categories visualized in the Venn diagram of Figure 3B and to annotations for gene ontology terms enriched in each experimental condition (provided by our bioinformatics tool miRontop): such as “mitochondria” and “apoptosis” for miR-210 and miR-147b and “cell cycle”for miR-147a. [score:1]
B) Effect of miR-210 and miR-147 family on A549 cell proliferation. [score:1]
On each panel, hsa-miR-210, hsa-miR-147a and hsa-miR-147b are highlighted as blue, green and red dots, respectively. [score:1]
By contrast, hsa-miR-210 and hsa-miR-147b possessed an identical seed corresponding to the hexamer UGUGCG but totally divergent sequences otherwise. [score:1]
Overall, this observation may indicate that multiple other miRNAs are indeed in the same situation as the one described here for miR-210 and miR-147b and would need to be further clarified in terms of putative functional redundancy. [score:1]
Overall, our data strongly support that a minimal 6 nt seed sequence only found in miR-210 and miR-147b represents the major functional component of these 2 miRNAs. [score:1]
Molecular Characteristics and in silico Target Identification of miR-210 and miR-147 Family. [score:1]
A549 cells were co -transfected with pre-miR-210, pre-miR-147a, pre-miR-147b or pre-miR-Neg and different pSI-Check-2™ constructs containing the 3′UTR of interest described in Table S5. [score:1]
While hsa-miR-210 is the unique member of its family, hsa-miR-147b sequence is closely related to hsa-miR-147a and differs only with a 1 nt substitution in the seed sequence (Figure 1A). [score:1]
A549 cells were transfected with 10 nM, 1nM, 0,1nM or 0,01nM of hsa-pre-miR-210, hsa-pre-miR-147a, hsa-pre-miR-147b or pre-miR-Neg and analyzed for several viability parameters. [score:1]
While the miR-210/miR-147b proximity shown in our study underscores this key molecular rule, it also provides several original findings. [score:1]
This is not the case here, since a concentration as low as 0.1 nM of miR-210 or miR-147b mimics was still able to induce a significant apoptotic effect (Figure S4). [score:1]
This effect was further confirmed by the specific detection of the cleaved forms of Poly ADP ribose polymerase (PARP) and caspase-3 as well as a decrease of pro-caspase-3 in cell lysates of miR-210 and miR-147b -transfected A549 cells (Figure 5G and S4C-D). [score:1]
We show that both these miRNAs induced a delayed apoptosis, as evidenced by trypan blue staining, caspase-3 activity and PARP cleavage (Figure 5), confirming the pro-apoptotic effect of miR-210 in A549 cells [26]. [score:1]
Molecular Characteristics and in silico Target Identification of miR-210 and miR-147 FamilyWhile hsa-miR-210 is the unique member of its family, hsa-miR-147b sequence is closely related to hsa-miR-147a and differs only with a 1 nt substitution in the seed sequence (Figure 1A). [score:1]
[1 to 20 of 80 sentences]
10
[+] score: 189
Furthermore, the expression of THSD7A in preeclamptic placentae was markedly downregulated, which was contrary to the changing expression pattern of miR-210. [score:8]
In summary, the results presented extend our knowledge of the function of miR-210 and THSD7A in the human placenta, and indicate that aberrantly expressed miR-210, partly through targeting THSD7A, plays an important role in the development of the pregnancy -associated disease, preeclampsia. [score:8]
Hypoxia increases miR-210 expression but down-regulates THSD7A. [score:6]
As miRNAs are post-transcriptional regulators that silence gene expression, placental miR-210 may be the effector of hypoxic stimulation, and may cause various changes in cell behaviour via its many target genes. [score:6]
Since THSD7A is one of the predicted miR-210 target genes, we validated the targeting of THSD7A by miR-210 in a human trophoblast cell line, HTR8/SVneo. [score:5]
A recent study by Vaiman and colleagues demonstrated a strong down-regulation of key hypoxia regulators including HIF-1α and HIF-1β, as well as the hypoxamir miR-210, by STOX1, a gene shown to be tightly associated with preeclampsia 54. [score:5]
As shown in Fig 3a,b, transfection of miR-210 mimics in HTR8/SVneo cells resulted in significant down-regulation of THSD7A expression at both the mRNA and protein levels, which decreased by approximately 40% and 60%, respectively, compared to the corresponding controls that were transfected with scrambled small RNA. [score:5]
Second, the expression of THSD7A was suppressed by miR-210 in HTR8/SVneo cells. [score:5]
On the other hand, silencing of THSD7A expression by specific siRNAs resulted in an inhibition of cell invasion (Fig. 4b,c) and abolished the invasion-promoting effect of anti-miR-210 (Fig. 4c,d). [score:5]
Fourth, the invasion-promoting effect of anti-miR-210 in HTR8/SVneo cells was attenuated when THSD7A expression was inhibited by siRNA. [score:5]
Consistent with previous reports that miR-210 inhibited trophoblast invasion 17 24, repression of miR-210 expression with specific anti-miR promoted cell invasiveness in HTR8/SVneo cells (Fig. 4a,c). [score:5]
The siRNA duplex against human THSD7A (si-THSD7A), the mature microRNA mimics for miR-210 (miR-210), the scramble control (NC), miR-210 inhibitor (anti-miR-210) and microRNA inhibitor NC (anti-NC) were purchased from Shanghai GenePharma, China. [score:5]
There has been no direct link between miR-210 and sFlt-1, however, they are all sensitively up-regulated by hypoxia. [score:5]
Further in vivo experiments using animal mo dels with placenta-specific gene manipulation of miR-210 or THSD7A are warranted to comprehensively understand the role of miR-210 and its target in placenta development and their association with pregnancy outcomes. [score:4]
To address whether or not THSD7A is a direct target of miR-210, we generated luciferase reporter constructs containing the wild type (BD-WT) or mutated (BD-MUT) THSD7A 3′UTR (Fig. 3c). [score:4]
Validation of THSD7A as a direct target of miR-210 in human trophoblast cells. [score:4]
Mouse strains with transgenic STOX1 exhibited preeclampsia-like symptoms 55, which substantiates the link between STOX1 and miR-210 with preeclamptic disease. [score:3]
The mutated pMIR-REPORT plasmid, which carries site mutations in the 3′UTR segments of human THSD7A mRNA being complementary to the seed sequence of miR-210, was generated based on BD-WT plasmids using Quick Change Lightning Site-Directed Mutagenesis Kit according to the manufacture’s instruction (Stratagene, La Jolla, California, USA). [score:3]
It is therefore likely that STOX1 overexpression mitigates an adaptive process mediated by miR-210. [score:3]
Upon incubation in low oxygen concentrations, miR-210 and THSD7A expression exhibited inverse responses. [score:3]
The inverse correlation between the miR-210 and THSD7A expression (both 186-KD and 260-KD) in the placental basal (e,g) and chorionic (f,h) plates of the studied individuals is shown. [score:3]
As shown in Fig. 5, we observed a time -dependent, and statistically significant induction of hsa-miR-210 and a simultaneous repression of THSD7A expression by the treatment of 2% oxygen. [score:3]
Considering the primary expression of miR-210 in placental trophoblasts, it is likely that miR-210 modulates trophoblast cell behaviour. [score:3]
Here we have validated a novel miR-210 target, THSD7A, which was also shown to be involved in modulating human trophoblast cell invasion. [score:3]
The reaction for each sample was carried out in duplicates with an initial denaturing at 94 °C for 2 min, followed by 40 cycles of 94 °C for 20 s, 60 °C for 30 s and 72 °C for 30 s. The detection of cDNA was carried out following the instructions of the SYBR® Premix Ex TaqTM kit (Takara, Dalian, China), and the reaction for each sample was carried out in duplicate at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 31 s. Relative expression level of THSD7A was normalized to the value of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and miR-210 was normalized to U6. [score:3]
Indeed, accumulating evidence suggest that miR-210 represses trophoblast invasion 17 24, and potassium channel modulatory factor 1 (KCMF1) is one of its targets in this respect 17. [score:3]
The data validated THSD7A as a target gene of miR-210 in human trophoblast cells, and indicated that the 5182-5189nt region of 3′UTR in THSD7A gene is a binding site for miR-210. [score:3]
In CD34 [+] endothelial cells, VEGF could dramatically increase miR-210 expression 50, and miR-210 mimics promoted the pro-angiogenic effect of VEGF. [score:3]
Several target genes of miR-210 are known to be involved in preeclampsia, such as ACVR1B 16, and studies have revealed that miR-210 could repress trophoblast cell invasion via modulating KCMF1 17, Ephrin-A3, Homeobox-A9 18, and THSD7A as shown in this study. [score:3]
THSD7A mediates the invasion -inhibitory effect of miR-210 in HTR8/SVneo cells. [score:3]
How to cite this article: Luo, R. et al. Hypoxia-inducible miR-210 contributes to preeclampsia via targeting thrombospondin type I domain containing 7A. [score:3]
The data revealed an inverse correlation between miR-210 and THSD7A expression (both186-KD and 260-KD) in the placental basal and chorionic plates of the studied individuals (Fig. 1e–h). [score:3]
Such a positive feedback interaction between miR-210 and VEGF signaling were observed in human synovial fibroblasts, rat osteoblast, rat kidney 51, and a related lower plasma levels of VEGF and miR-210 was recently found in Alzheimer’s disease patients 52. [score:3]
The data demonstrate that the invasion -inhibitory effect of miR-210 in human trophoblast cells is mediated, at least in part, by THSD7A. [score:3]
Such an injurious feed-back loop between oxygen tension, miR-210 expression and trophoblast cell invasion may play an important role in the pathogenesis of preeclampsia. [score:3]
Based on our previous report 23 and the findings presented here, miR-210 and THSD7A have a similar localization in trophoblast cells, and they exhibit an inversely related expression pattern in preeclamptic placenta. [score:3]
These targets mediate the effects of miR-210 in participating in oxidative stress and mitochondrial metabolism, angiogenesis 31, cell survival 35, DNA repair 36, and cell migration and invasion 18. [score:3]
Based on the data from miRWalk 28 29, a long list of genes are validated as targets for miR-210, including the receptor tyrosine kinase ligand ephrinA3 27, E2F transcription factor 3 30, the iron-sulfur cluster assembly proteins 1/2 31, the DNA repair protein RAD52 32, ACVR1B 33, iron-sulfur cluster scaffold homologue (ISCU) 10 34, KCMF1 17, Ephrin-A3 and Homeobox-A9 18, and so on. [score:3]
Therefore, further experimental studies are necessary to elucidate the way that miR-210 and its targets are involved in causing the placental dysfunction associated with preeclampsia. [score:3]
In addition, the impairment of trophoblast cell invasion by miR-210 targets, including THSD7A and KCMF1, may further aggravate the hypoxic condition at the feto-maternal interface. [score:3]
The THSD7A gene has been studied much less, and bioinformatic analysis of its links with the other miR-210 targets or the known preeclampsia -associated genes provides limited information (Supplementary Figure 2). [score:3]
Together, these findings support the hypothesis that THSD7A is one of the functional targets of miR-210 in placental trophoblast cells. [score:3]
The aberrant production of miR-210 and sFlt-1 in the aspect of preeclampsia may lead to damage in angiogenesis via dysregulation in VEGF pathway. [score:2]
One can therefore speculate that in the placenta, the oxygen tension regulated miR-210 and sFlt-1 act oppositely to keep VEGF signaling at a proper activation status. [score:2]
Regulation of miR-210 and THSD7A by hypoxia in HTR8/SVneo cells. [score:2]
The level of miR-210 was adjusted by the value of U6, and the relative value was presented as the mean ± SEM based on three independent experiments. [score:1]
Twenty-four hours following seeding, miR-210 mimics, anti-miR-210 and specific siRNA for THSD7A were transfected into the cells using Lipofectamine 2000 reagent according to the manufacturer’s instruction (Invitrogen, Carlsbad, CA). [score:1]
HTR8/SVneo cells were transfected with miR-210 mimics, NC, anti-miR-210 and /or specific siRNA for THSD7A. [score:1]
We kept the HTR8/SVneo cells under conditions of either normoxia (20% oxygen) or hypoxia (2% oxygen) for 48 hours, and measured miR-210 as well as THSD7A expression using qRT-PCR at various time points. [score:1]
Interestingly, studies are indicating the association between VEGF signaling and miR-210 in various cell types. [score:1]
First, the localization of THSD7A in human placenta was similar to that of miR-210 23. [score:1]
BD-WT contains the wild type seed sequence of miR-210 binding site in the human THSD7A 3′UTR, and BD-MUT possesses several mutated nucleotides in the seed sequence (denoted by asterisks). [score:1]
Third, the luciferase reporter assay demonstrated the direct binding of miR-210 to the 3′-UTR of THSD7A gene, with the binding site ranging from 5182nt to 5189nt. [score:1]
Anti-miR-210 decreased miR-210 levels. [score:1]
NM_015204.2) containing the putative miR-210 binding sequence were amplified and cloned into pMIR-REPORT Luciferase plasmid (Ambion, Austin, Texas, USA) at the Mlu1 and Spe1 sites. [score:1]
to show THSD7A protein levels in HTR8/SVneo cells transfected with NC and miR-210. [score:1]
THSD7A mRNA levels in HTR8/SVneo cells transfected with scramble control (NC) and miR-210 mimics (miR-210), as detected by qRT-PCR. [score:1]
HTR8/SVneo cells were transfected with 100 ng pMIR-REPORT construct that carries the wild type or the mutant THSD7A 3′UTR (BD-WT or BD-MUT), together with 10 ng pRL-TK control vector (encoding Renilla luciferase) and 40 nM miR-210 mimics or scramble control (NC). [score:1]
We previously measured miR-210 expression in these specimens 17 23, and a correlation analysis of miR-210 concentrations and THSD7A protein levels was performed accordingly. [score:1]
The level of miR-210 (a) and THSD7A (b) was determined by qRT-PCR and normalized to U6 and GAPDH, respectively. [score:1]
However, when the predicted miR-210 binding site was mutated, the miR-210 mimic did not affect the luciferase activity. [score:1]
The distribution pattern of THSD7A was very similar to that of miR-210, which we have previously reported 23. [score:1]
HTR8/SVneo cells were transfected with BD-WT or BD-MUT reporter construct, renilla luciferase vector (pRL-TK), together with miR-210 mimics or scrambled control. [score:1]
The sequences of miRNA and siRNA are: NC, 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense), and 5′-ACGUGACACGUUCGGAGAATT-3′ (anti-sense); si-THSD7A, 5′-GGGCAUUUGUGUUACUCAUTT-3′ (sense), and 5′-AUGAGUAACACAAAUGCCCTT-3′ (anti-sense); miR-210 mimics, 5′–CUGUGCGUGUGACAGCGGCUGA-3′ (sense), and 5′- AGCCGCUGUCACACGCACAGUU-3′(anti-sense); Anti-miR-210, 5′-UCAGCCGCUGUCACACGCACAG-3′ (sense); Anti-NC, 5′-CAGUACUUUUGUGUAGUACAA-3′ (sense). [score:1]
HTR8/SVneo cells were transfected with anti-miR-210 or its non -targeting control (anti-NC), and miR-210 levels were measured at 48 hours after transfection by qRT-PCR. [score:1]
[1 to 20 of 65 sentences]
11
[+] score: 188
Further, the regulation of miR-210 expression in Leishmania infection was found to be HIF-1α dependent as silencing of HIF-1α, downregulated the miR-210 expression. [score:9]
However, after silencing of HIF-1α (Figure 4A), the expression of miR-210 was significantly (p < 0.001) downregulated (Figure 4B), which confirmed that the upregulation of miR-210 was HIF-1α dependent. [score:9]
This study confirmed that L. donovani infection activates HIF-1α expression, which eventually alters the production of inflammatory cytokines in the favor of parasite survival through upregulation of miR-210 expression. [score:8]
In our present study, we found that during course of L. donovani infection, miR-210 expression was upregulated that helps in survival of parasites by suppression of host pro-inflammatory immune response. [score:8]
In a similar manner, before and after L. donovani infection, the expression of p50 and p65 subunit shows normal expression level in nuclear proteins (lane 1 and 2 of Figure 8B); however, after miR-210 silencing, the expression of p50 and p65 proteins was significantly (p < 0.001) higher in nuclear proteins (lane 3 of Figure 8B). [score:7]
We predicted the target of miR-210 by online software miRDB and Target Scan based on target rank and score. [score:7]
Herein, we provide a clue that HIF-1α controls the NF-κB mediated regulatory pathways of macrophages by upregulating miR-210 expression and helps in survival of parasites inside the host. [score:7]
Upregulation of miRNA-210 in Leishmania Infected Macrophage Was HIF-1α DependentTo find out the role of HIF-1α in regulation of miRNA-210 expression, we silenced HIF-1α gene in macrophages by HIF-1α specific siRNA (Supplementary Figure S2). [score:7]
Further, the upregulated miR-210 inhibits TNF-α receptor family leading to decreased synthesis of various pro-inflammatory cytokines, which helps the parasite survival inside the macrophages. [score:6]
In Leishmania infection, the manifestation of the disease occurs through impairment of host immune responses, and in our previous study, we found that miR-210 is greatly upregulated in macrophages during L. donovani infection (Tiwari et al., 2017). [score:6]
Up-regulation of microRNA210 induces immune dysfunction via targeting FOXP3 in CD4 [+] T cells of psoriasis vulgaris. [score:5]
In cytoplasm, before and after L. donovani infection, p50 and p65 showed normal level of expression (lanes 1 and 2 of Figure 8A); however, after miR-210 silencing, the p50 protein forms heterodimer with p65 and translocated to the nucleus and its expression was significantly (p < 0.001) lowered in cytoplasmic protein content (lane 3 of Figure 8A). [score:5]
Out of top 20 targeted genes (Supplementary Figure S3) of miRNA-210, we found that sixth rank of its targeted gene, i. e., tumor necrosis factor receptor super family plays an important role in activation of NF-κB (p50) subunit by gene ontology and KEGG (data not shown) since TNF-α is the main inducer of this signaling protein. [score:5]
microRNA-210 negatively regulates LPS induced production of proinflammatory cytokines by targeting NF-κB1 in murine macrophages. [score:4]
To conclude, the HIF-1α helps L. donovani survival through mir-210 upregulation. [score:4]
Emerging data have also proved the role of miR-210 in various human diseases (Zhang et al., 2012; Grosso et al., 2013) and also found to act as a regulator of immune responses (Qi et al., 2012; Zhang et al., 2012; Zhao et al., 2014). [score:4]
To find out the role of HIF-1α in regulation of miRNA-210 expression, we silenced HIF-1α gene in macrophages by HIF-1α specific siRNA (Supplementary Figure S2). [score:4]
These results indicated that miR-210 has an important role in IL-10 cytokine production during Leishmania infection and its control can upregulate the production of inflammatory cytokines. [score:4]
Upregulation of miRNA-210 in Leishmania Infected Macrophage Was HIF-1α Dependent. [score:4]
These findings clearly showed that miR-210 regulates the activation of NF-κB p50 and hypoxia induced miR-210 targets the TNF-α receptor super family gene. [score:4]
The miR-210 Regulates the Expression of NF-κB Transcription Factor p50. [score:4]
This study showed that HIF-1α induces miR-210 expression, which also controls respiratory burst activities of macrophages during Leishmania infection. [score:3]
Elevated levels of hypoxia-inducible microRNA-210 in pre-eclampsia: new insights into molecular mechanisms for the disease. [score:3]
The expression of miR-210 was silenced by antagomir according to the standard protocol described previously with required modification (Krützfeldt et al., 2005; Haftmann et al., 2015). [score:3]
miRNA-210 is one of the first hypoxamiR reported, which is targeted by HIF-1α (Kulshreshtha et al., 2007). [score:3]
FIGURE 4Expression of miR-210 and HIF-1α in infected macrophages. [score:3]
This study showed that inhibition of miR-210 by antagomir activates NF-κBp50 and augments the pro-inflammatory immune response. [score:3]
FIGURE 5Prediction and validation of TNF-α receptor as target gene of miRNA-210. [score:3]
The application of siHIF-1α decreased (p < 0.001) the level of miR-210 expression in infected macrophages (B). [score:3]
In the present study, we found that miR-210 targets many genes of inflammatory immune response that was observed by online software miRDB. [score:3]
Binding site of miR-210 and TNF receptor family was detected by Target Scan 6.0. [score:3]
The expression of miR-210 in L. donovani infected macrophages in the presence of siHIF-1α or scHIF-1α was estimated by qPCR (B). [score:3]
TNF receptor family is sixth rank target gene of miR-210 that was further validated by luciferase activity in our study and helps in NF-κB activation. [score:3]
We further hypothesized that the hypoxic conditions inside the host macrophages may regulate inflammatory cytokines production through HIF-1α induced miR-210/NF-κB mediated mechanisms. [score:2]
The miR-210 Regulates the NF-κB p50 for Pro-inflammatory Responses in L. donovani InfectionThe NF-κB p50 and p65 expression in cytoplasmic and nuclear protein extracts was evaluated by western blotting (Supplementary Figures S5, S6). [score:2]
These results confirmed the regulatory role of miR-210 in macrophage effector functions in terms of respiratory burst activity. [score:2]
The miR-210 Regulates the NF-κB p50 for Pro-inflammatory Responses in L. donovani Infection. [score:2]
For evaluating the role of HIF-1α in regulation of miR-210 expression in L. donovani infected macrophage, HIF-1α was silenced by HIF-1α specific siRNAs or scramble control (Santa Cruz Biotechnology, United States). [score:2]
TNF-α is one of the main inducers of NF-κB family and our results pointed its miR-210 mediated immune-regulation during VL that favors survival of parasites. [score:2]
Further, for validation of miR-210 target genes, we performed the luciferase reporter assay. [score:2]
The macrophages transfected with mimic of miR-210 significantly reduced the luciferase activities (p < 0.001) of genes fused to TNF-α receptor family 3′ UTR (B). [score:1]
After silencing of miR-210, the increased levels of NO [x] and ROS were observed that might be due to pro-inflammatory cytokines activation, which influenced the production of these free radicals and helped in the killing of parasites. [score:1]
The HIF-1α binds to highly conserved sequences, i. e., hypoxia responsive element (HRE) on the proximal miR-210 promoter, which is located 400 bp upstream on the chromosome 11p15.5 (Huang et al., 2010). [score:1]
Schematic representation of miRNA-210 sequence bound to TNF-α receptor (A). [score:1]
The miR-210 antagomir (designed in our laboratory and was synthesized by Integrated DNA Technologies, New Delhi) using sequence, CAGUGUGCGGUGGGCAGUGGCU with the following modification. [score:1]
Mutated 3′ UTR seed sequences of TNF-α receptor family did not show any significant luciferase activities treated with mimic of miR-210 (Figure 5). [score:1]
However, after silencing the miR-210 with antagomir, TNF-α stimulates NF-κB p50, which forms heterodimer with subunit of NF-κB and translocates into the nucleus where it binds to consensus sequences and promotes transcription of pro-inflammatory cytokines genes. [score:1]
MicroRNA-210 is the most important hypoxamiR, found in many cell types including macrophages. [score:1]
The role of HIF-1α and miR-210 was validated in the following four experiment groups, i. e., (1) uninfected Mφ, (2) Mφ infected with L. donovani, (3) antagomir treated Mφ infected with L. donovani, and (4) Antagomir scramble treated Mφ infected with L. donovani to validate the role of miR210 on parasitic infectivity and survival. [score:1]
Antagomir scramble (mismatched miR-210) was also obtained from the same company and used as negative control. [score:1]
Macrophages were transfected by constructed pGL3 vector with either controls or mimics of miR-210 using Lipofectamine 2000 (Invitrogen, United States). [score:1]
This study suggests that L. donovani exploits activation of HIF-1α and miR-210 in mammalian host for its survival and growth. [score:1]
miR-210: more than a silent player in hypoxia. [score:1]
HIF-1α and miR-210 Altered the Parasite Infectivity and Survival in the Macrophages. [score:1]
HypoxamiRs (miR-24-1, miR-26, miR-103, miR-181, miR-213, and miR-210) are a class of miRNAs, which are activated under low oxygen tension and induced by HIF-1α. [score:1]
This study adds a new insight that TNF-α production is NF-κB dependent, which is broadly controlled by miR-210 during course of L. donovani infection. [score:1]
The transfection with mimic of miR-210 significantly (p < 0.001) reduced the luciferase activities of genes fused to TNF-α receptor family 3′ UTR. [score:1]
[1 to 20 of 57 sentences]
12
[+] score: 187
The regulation of distinct biological pathways by ISCU downregulation suggests a potential therapeutic approach of synthetic lethality whereby drugs that mediate DNA damage repaired by the iron-sulfur cluster containing helicases Rad3 [39] or Fanconi anaemia [37] could be use in synergy with PARP inhibitors, or inhibitors of glycolysis [36] and glutaminolysis in the subgroup of patients with highest miR-210 levels. [score:9]
We compared miR-210 expression in our published series of breast cancer [14] with our hypoxia metagene of clustered mRNAs [25] and combined assessment with target prediction algorithms showed ISCU was the highest predicted target, and three known target genes also sit in highly-ranked positions were selected by this approach (Supporting Material and Methods S1, Supporting Table S1). [score:8]
We analysed the mRNA from the tumours and found marked upregulation of miR-210 and reciprocal downregulation of ISCU mRNA (Figure 4D). [score:7]
Hypoxia strongly suppressed a luciferase reporter containing the 3′UTR of ISCU that included the putative miR-210 target site and this suppression could be partially rescued by transient transfection of anti-210 (Supporting Figure S2E). [score:7]
By downregulating ISCU, miR-210 decreases Krebs cycle enzyme activity and mitochondrial function, provides a major mechanism for the increased free radical generation in hypoxia, increases cell survival under hypoxia, induces a switch to glycolysis in normoxia and hypoxia (Warburg and Pasteur effects) and upregulation of the iron uptake required for cell growth. [score:7]
Taken together, these observations demonstrate that miR-210 downregulates ISCU mRNA and protein levels by targeting its 3′UTR. [score:6]
We recently analysed its expression in a series of 216 breast cancer patients and showed miR-210 expression was correlated with many HIF1α targets at mRNA level (as measured by a hypoxia metagene) and was strongly associated with poor patient survival. [score:5]
Inhibition of endogenous miR-210 significantly rescued the suppression of ISCU mRNA, although this was not complete (Figure 1C and Supporting Figure S2A). [score:5]
ISCU suppression is associated to miR-210 over -expression and relapse-free survival in breast cancer and HNSCC. [score:5]
While this work was in preparation, three new miR-210 targets were validated, i. e. HOXA1, HOXA9 and FGFRL1, and the analysis of tumour xenografts derived from cancer cell lines overexpressing miR-210 suggested a potential involvement of miR-210 in tumour growth initiation [40]. [score:5]
C, miR-210 qPCR expression (DDCT) plotted as a function of ISCU mRNA expression (Affymetrix arrays) in the Oxford-Manchester HNSCC cancer series where ISCU was initially found to be associated to hypoxia (left), and relapse free survival for samples with high ISCU and low ISCU split by median value in the Chung et al. HNSCC series (right). [score:5]
The expression levels of miR-210 and ISCU mRNA under hypoxia are relative to their normoxic expression levels at 24 hrs (N). [score:5]
0010345.g005 Figure 5 A, miR-210 qPCR expression (DDCT) plotted as a function of ISCU mRNA expression (Illumina arrays) in the Oxford breast cancer series (left), and, relapse free survival for samples with high ISCU and low ISCU split by median in the Oxford breast cancer series (right). [score:5]
A, miR-210 qPCR expression (DDCT) plotted as a function of ISCU mRNA expression (Illumina arrays) in the Oxford breast cancer series (left), and, relapse free survival for samples with high ISCU and low ISCU split by median in the Oxford breast cancer series (right). [score:5]
MiR-210 negatively regulates aconitase and complex I activity in MCF7 and HCT116, and upregulates glycolysis. [score:4]
This may be relevant in situations where miR-210 upregulation occurs in normoxia. [score:4]
Figure S2 ISCU expression is regulated by miR-210. [score:4]
Our studies clearly show miR-210 regulates the expression of ISCU RNA and protein using the mimic in normoxia in cancer cell lines. [score:4]
Clusters of genes anti-correlated to miR-210 expression were formed as described previously [25]; Spearman correlation was used to identify genes significantly anti-correlated miR-210 and false discovery rate (FDR) was estimated using a permutation -based method [42]. [score:4]
Hypoxia in cancers results in the upregulation of hypoxia inducible factor 1 (HIF-1) and a microRNA, hsa-miR-210 (miR-210) which is associated with a poor prognosis. [score:4]
Similar to the regulation of miR-210 under hypoxia, ISCU suppression at the transcript level was dependent on HIF1α and not HIF2α (Supporting Figures S1C and S1D). [score:4]
In this report we show the major biological effects of miR-210 targeting ISCU, all of which are likely to contribute to important phenotypes in cancer. [score:3]
Recently, ISCU has been identified as a miR-210 target also in normal pulmonary endothelial cells [20], where it contributes to the Pasteur effect and controls the level of ROS production in hypoxia, suggesting its potential adaptive role to hypoxia in the context of pulmonary endothelium. [score:3]
MiR-210 regulates ISCU expression in MCF7 cells. [score:3]
Relative expression of ISCU normalised to β-actin, miR-210 normalised to three small nucleolar controls, RNU43, RNU44 and RNU48. [score:3]
Derived only from sequence -based algorithms, some of the previously validated targets of miR-210 include Ephrin A3 [15], E2F3 [16], RAD52 [17], CASP8AP2 [18], and MNT [19]. [score:3]
There was a highly significant inverse relationship of miR-210 to ISCU expression in 216 patients with breast cancer (rho = −0.39, p<0.001) (Figure 5A, left). [score:3]
In conclusion, we have found a major new mechanism for the response of cancer cells to hypoxia, co-ordinated by miR-210 suppression of ISCU and the subsequent decrease in activity of iron-sulfur cluster proteins (Supporting Figure S5). [score:3]
Columns show mean fold difference in miR-210 expression between hypoxia and the parallel normoxia control samples using RNU48 as a reference; bars show s. e. m.. [score:3]
Table S1 Top predicted mir-210 targets using tumour data plus algorithms. [score:3]
Figure S1 Expression of miR-210 and ISCU in cancer cell lines. [score:3]
B, mRNA expression of the transcript hosting the miR-210 precursor plotted as a function of ISCU mRNA expression measure by Affymetrix U133b and U133a respectively in the Uppsala breast cancer series (left), and relapse free survival for samples with high ISCU and low ISCU split by median in the Uppsala breast cancer series (right). [score:3]
In human cancer cell lines and tumours, we found that miR-210 targets the mitochondrial iron sulfur scaffold protein ISCU, required for assembly of iron-sulfur clusters, cofactors for key enzymes involved in the Krebs cycle, electron transport, and iron metabolism. [score:3]
We found that the mitochondrial iron sulfur cluster homologue ISCU was the highest predicted target for miR-210. [score:3]
Mutations in many of these Fe-S cluster enzymes including succinate dehydrogenase subunits SDHD, SDHB and SDHC [35] and fumarate hydratase [36] are implicated in hyperproliferative disorders and cancer, demonstrating an important link between cellular metabolism and subsequent transformation and highlights a role for HIF, via a miR-210-ISCU axis in these processes. [score:2]
Figure S5 Hypoxia regulates ISCU via HIF1α induction of miR-210. [score:2]
Furthermore, the phenomenon of reciprocal regulation of miR-210 and ISCU by hypoxia was also found in many other cell lines (Supporting Figures S1E and S1F). [score:2]
Induction of these major hallmarks of cancer show that a single microRNA, miR-210, mediates a new mechanism of adaptation to hypoxia, by regulating mitochondrial function via iron-sulfur cluster metabolism and free radical generation. [score:2]
In contrast to the hypoxic induction of ROS and alleviation with anti-210 observed in our study, Chan et al. could not measure any significant change in ROS production after exposure to hypoxia, and showed an inverted trend when miR-210 was inhibited [20]. [score:1]
ISCU mRNA quantified by RTPCR was inversely correlated to miR-210 and decreased most significantly when cells were exposed to more severe hypoxia for longer periods (Figure 1B and Supporting Figure S1B). [score:1]
0010345.g004 Figure 4 A, apoptosis (Annexin V+ cells) was measured in MCF7 (left) and HCT116 (right) cells treated with miR-210 inhibitor or mimic, after 48 hours exposure to 0.1% oxygen or normoxia. [score:1]
0010345.g001 Figure 1 A, miR-210 increases under hypoxia, with the most robust induction seen at 48 hrs with 0.1% oxygen. [score:1]
D, RT-PCR for ISCU and miR-210 in U87 xenografts treated with anti-angiogenic therapy (bevacizumab). [score:1]
Representative images from miR-210 transfected are shown on the left panels and the mean ± s. e. m. of approximately 300 cells are shown on the right panels (***, p<0.001). [score:1]
In addition to Complex I, Complexes II and III also contain Fe-S clusters and we speculate that the activities of all three complexes could be decreased in a miR-210 dependent manner. [score:1]
In the Uppsala series [27] we could assess the precursor miR-210 using the Affymetrix probes (Affymetrix U133b, 230710_at) and this also showed an inverse relationship of the precursor to ISCU and poor survival (Figure 5B). [score:1]
A, miR-210 increases under hypoxia, with the most robust induction seen at 48 hrs with 0.1% oxygen. [score:1]
MiR-210 and ISCU mRNA undergo reciprocal regulation. [score:1]
Furthermore, the normoxic ROS production observed with mimic-210 was almost completely prevented with a miR-210 resistant ISCU construct. [score:1]
We recapitulated the observed hypoxic induction of miR-210 by transfecting MCF7 and HCT116 with mimic-210 in normoxia. [score:1]
Additionally, transfection of the ISCU2 construct nearly completely reversed the free radical induced by miR-210 (Figure 3C). [score:1]
Conversely, in hypoxia, we observed that the induction of miR-210 was associated with an increase in ROS, and this could be almost completely reversed by anti-210. [score:1]
B, after transfecting MCF7 cells with scrambled LNA or mir-210 LNA and exposed to 0.1% oxygen or normoxia (48 hrs), the cells were re-plated (100 and 500 cells/well). [score:1]
The only data available for comparison of miR-210 with ISCU RNA in human tumour samples is from our breast and head and neck series. [score:1]
miR-210 represses ISCU 3′-UTR and reduces ISCU protein. [score:1]
Effects of miR-210 on apoptosis and survival in normoxia and hypoxia. [score:1]
There was a striking difference in the effects of mir-210 in these opposing conditions. [score:1]
A, apoptosis (Annexin V+ cells) was measured in MCF7 (left) and HCT116 (right) cells treated with miR-210 inhibitor or mimic, after 48 hours exposure to 0.1% oxygen or normoxia. [score:1]
In agreement with previous publications [13], [14], miR-210 was robustly induced in MCF7 and HCT116 by hypoxia (1% or 0.1% oxygen) at 24 and 48 hrs, with maximal induction observed at 48 hours in 0.1% oxygen (Figure 1A and Supporting Figure S1A). [score:1]
miR-210 expression was measured by qPCR. [score:1]
This was induced in normoxia by miR-210 and thus is similar to the Warburg effect. [score:1]
We have previously shown miR-210 can be detected at an elevated level in serum of cancer patients [38] so it will be of interest if they reflect the metabolic state of their primary cancer and hence could be used in future therapy selection. [score:1]
We then antagonised miR-210 induced under hypoxic conditions with anti-210. [score:1]
This study thus reveals a new pathway activated in hypoxic tumours, mediated by miR-210 affecting mitochondrial enzyme activity and free radical generation and highlights the importance of mitochondrial metabolism in hypoxia biology [3]. [score:1]
Transfection was performed with Dharmacon anti-210, miR-210 mimic, or control oligos (Thermo Scientific, CO, USA), at a final concentration of 20 nM, using Optimem serum-free medium and Oligofectamine reagent (both from Invitrogen, Paisley, UK) as per the manufacturer's protocol. [score:1]
We and others [13] have shown miR-210 is robustly induced by hypoxia in many cell lines, via HIF1α [14]. [score:1]
[1 to 20 of 66 sentences]
13
[+] score: 171
Anti-miR-210 inhibitor transfection: anti-miR™ miRNA inhibitor (Applied Biosystems, Foster City, CA), single-stranded RNA -based inhibitor was used for inhibition of miRNA activity. [score:9]
In addition MiR-155 transduction greatly reduces both the myeloid and erythroid colony formation of normal human hematopoietic stem-progenitor cells [9], miR-221 and miR-222 inhibit normal erythropoiesis and erythroleukemia cell growth via kit protein down-regulation [10], miR-451 and GATA transcription factors were shown to comprise a regulatory circuit that modulates erythroid maturation [11- 13], miR-210 is involved in increased expression of the γ-globin gene in differentiating erythroid cells [14]. [score:9]
In this cellular mo del MiR-210 up-regulation is inhibited by inhibitors of ERK and PI3K/Akt pathways. [score:7]
c) The figure shows the fold expression of the analyzed miR-210 in K562 control cells and in cells in which the expression of PKCα is knocked-down in presence and absence of MTH. [score:6]
a) The figure shows the fold expression of the analyzed miR-210 in K562 control cells and in cells in which the expression of PLCβ1 is modulated. [score:5]
MiR-210 was also found up-regulated in most solid tumors and its expression correlates with an adverse clinical outcome and with metastatic potential [34, 35]. [score:5]
As it is clearly appreciable, during erythroid induction of PLCβ1 overexpressing K562 cells we assist to a dramatic decrease of miR-210 expression. [score:5]
Inhibition of miR-210 activity by using anti-miR-210 treatment in K562 cells showed a significant depletion of miRNA-210 level as well as globin expression. [score:5]
Real-Time PCR analysis of the expression of mir-210 was performed using let-7c expression as housekeeping control. [score:5]
Fig 3 a) The figure shows the fold expression of the analyzed miR-210 in K562 control cells and in cells in which the expression of PLCβ1 is modulated. [score:5]
We also showed that inhibition of miR-210 caused the significant reduction of globin gene expression in K562 erythroid cell line. [score:5]
In fact we observed that PLCβ1 overexpression led to a loss of induction of miR-210 expression after MTH treatment. [score:5]
Fig 4 Inhibition of miR-210 activity by using anti-miR-210 treatment in K562 cells showed a significant depletion of miRNA-210 level as well as globin expression. [score:5]
When we silenced PKCα by RNAi technique, we found a decrease in miR-210 and γ-globin expression levels, which led to a severe slowdown of cell differentiation in K562 cells and these effects were the same encountered in cells overexpressing PLCβ1. [score:5]
Several miRNAs were identified as deeply involved in the erythroid phenotype, including miR-15a, miR-16-1, miR-126, miR-144, miR-451 and miR-210 are believed to regulate several functions of erythroid cells such as maturation and proliferation of early erythroid cells, expression of fetal γ-globin genes and enucleation [5]. [score:4]
Our results provide experimental support for the idea that PLCβ1 is involved in the control of erythroid differentiation by means of the regulation of miR-210 expression, likely through a PKCα -mediated-pathway. [score:4]
Our results suggest that PLCβ1 signaling is involved in the differentiation process induced by MTH by regulating both γ-globin and miR-210 expression. [score:4]
Taken together, these results thus suggest that PLCβ1 signaling is involved in the erythroid differentiation process as assessed by γ-globin induced by MTH through miR-210 regulation and that this process is likely dependent on the amount of PLCβ1 expression level. [score:4]
Recently it has been demonstrated that Pancreatic Stellate cells induce the expression of miR-210 in pancreatic cancer cells [37]. [score:3]
Expression of miR-210 in MTH -treated K562. [score:3]
Twenty-four hours after the transfection, we induced K562 differentiation with MTH for 5 days and the expression of both miR-210 and γ-globin have been analyzed. [score:3]
On the whole our data hint at a new pathway leading to erythroid differentiation that links PLCβ1 signaling with the expression of miR-210 and eventually of γ-globin. [score:3]
In the current study we identified miR-210 as a target of PLCβ1. [score:3]
Determination of γ-globin expression in the presence of anti-miR-210 showed a partial but significant reduction of γ-globin mRNA levels under the MTH treatment at 72 h. Transfection with scramble (scr) caused no effect. [score:3]
Expression of the miRNA-210 in MTH -treated cells was determined by qRT-PCR. [score:3]
As it is clearly appreciable, during erythroid induction of K562 cells miR-210 expression increases. [score:3]
Recently it has been described that miR-210 is a highly expressed miR in the erythroid precursor cells and is induced during MTH mediated erythroid differentiation of K562. [score:3]
MiR-210 has been mechanistically linked to the control of a wide range of cellular responses known to influence normal cell developmental as well as a number of hypoxia -dependent disease states, including tissue ischemia, inflammation, and tumorogenesis [17]. [score:3]
Moreover, K562 cells silencing for the expression of the PLCβ1 induces an increase of miR-210 levels. [score:3]
MiR-210 inhibitor (anti-miR-210) or negative control molecules (scrambled oligonucleotide) were transfected into K562 cells or day 7 erythroid precursor cells using Lipofectamine 2000 (Invitrogen Carlsbad, CA) at a final concentration of 10 nM. [score:3]
Effect of PLCβ1 expression on miRNA-210 after MTH treatment. [score:3]
Recent data identify a novel miR-210, whose expression is enhanced in association with erythroid differentiation and induction to fetal hemoglobin (HbF) production. [score:3]
To address the functional relevance of PLCβ1 in erythropoiesis, we have modulated PLCβ1 expression into MTH treated K562 cells and studied its effect on erythroid differentiation and miR-210 profile. [score:3]
MiR-210 is a member of a new class of regulatory miRNAs that play an important role in erythroid maturation [29]. [score:2]
MiR-210 is an important microRNA target that has been demonstrated to be associated with MTH -mediated induction of erythroid differentiation of leukemic K562 cells and HbF production in erythroid precursor cells from β-thalassemia patients [14]. [score:2]
PLCβ1 regulates miR-210 through PKCα. [score:2]
Because of these assumptions we decided to investigate whether the PLCβ1 signaling pathway could be involved in MTH -induced erythroid differentiation of K562 cells and to examine whether PLCβ1 regulates miR-210 expression. [score:2]
Moreover, PLCβ1 silencing resulted in an increase in miR-210 expression after 5 days of MTH administration, even if only slightly, as compared with wild type differentiating cells. [score:2]
These data confirmed that PLCβ1 can regulate miR-210 levels through PKCα signaling pathway. [score:2]
On the other hand, K562 cells silenced for the expression of the PLCβ1 show an increase of miR-210 levels as compared to control cells. [score:2]
Fig. 3A shows the expression of the analyzed miR-210 when RNA from K562 cells treated for 5 days with MTH is compared to that isolated from control untreated cells. [score:2]
As can be seen in Fig. 5c, miR-210 levels increased in differentiated cells, but PKCα knock-down cells did not show increase of miR-210 levels. [score:2]
For microRNA quantization reverse transcriptase reactions were performed using TaqMan MicroRNA Revese Transcription Kit (Applied Biosystems for hsa-miR-210 and the 7700 Sequence Detection System version 1.7 (Applied Biosystems, Foster City, CA, USA). [score:1]
This suggest that the role of PLCβ1 during erythropoiesis is linked to that of miR-210 even though our results do not fully explain the mechanism of action of PLCβ1 within the cells but the results obtained are indeed compatible with previously results that demonstrated a role for PLCβ1 in erythropoiesis [24, 25]. [score:1]
These data showed a possible connection between PLCβ1, PKCα and miR-210 modulation in K562 cell differentiation. [score:1]
Moreover, miR-210 is induced following MTH-treatment also in erythroid precursor cells from human donors [14]. [score:1]
The aim of this study was to investigate the PLCβ1 effect on miRNA-210 expression after MTH treatment. [score:1]
The result showed that transfection of K562 cells with 10nM anti-miR-210 caused a significant reduction of miR-210 levels (Fig. 4). [score:1]
The level of endogenous miR-210 in K562 control cells cultured for five days with MTH was increased as we expected. [score:1]
Moreover to examine the effect of decreased levels of PKCα on erythroid differentiation, we evaluated, in the same samples, the expression of miR-210. [score:1]
Loss of function study of miR-210. [score:1]
Enhanced PLCβ1 level and reduced miR-210 level accompanies erythroid differentiation. [score:1]
In keeping with these data, miR-210 has been proposed as a novel tumor hypoxia marker [36]. [score:1]
[1 to 20 of 53 sentences]
14
[+] score: 163
The level of expression of oncogenic miR-21, miR-221, miR-210 including the tumor suppressor miR Let-7a were found to be consistently up-regulated in TNBC tissues as well as in their corresponding sera and cancer cell lines, MDA-MB-231, MCF-7, whereas miR-145 and miR-195 were regularly downregulated (p<0.001) (Table 2a and 2b, Figs 1A, 2A and 2D). [score:11]
In comparison to other breast cancer subtypes, DNBC, SNBC and TNBC patients also showed significantly a higher expression of miR-21, miR-221, miR-210 and Let-7a (Table 2a; Fig 1B)It was observed that the upregulated expression of four miRNAs was found to be increased with the increasing histopathological grade and clinical stage but also with the younger age, premenopausal stage, early menarche, smoking, higher mitotic activity, higher ki67 expression and lymph node negativity of TNBC. [score:10]
In comparison to other breast cancer subtypes, DNBC, SNBC and TNBC patients also showed significantly a higher expression of miR-21, miR-221, miR-210 and Let-7a (Table 2a; Fig 1B) It was observed that the upregulated expression of four miRNAs was found to be increased with the increasing histopathological grade and clinical stage but also with the younger age, premenopausal stage, early menarche, smoking, higher mitotic activity, higher ki67 expression and lymph node negativity of TNBC. [score:10]
Of six miRNAs, the expression of four miRNAs, miR-21, miR-221, miR-210 and Let-7a were found to be significantly upregulated while the other two miRNAs, miR-195 and miR-145 were downregulated in both paired tumor tissue and sera of triple negative breast cancer patients. [score:9]
Out of six microRNAs screened, four of them, miR-21; miR-221; miR-210 including the tumor suppressor miR Let-7a were consistently upregulated whereas two miR-145 and miR-195 were regularly downregulated in TNBC tissue as compared to that of adjacent normal tissue (Table 2a). [score:8]
The upregulated expression of four miRNAs, miR-21, miR-210, miR-221 and Let-7a showed a significant (p ≤ 0.05) correlation with several most common clinicopathological and demographic variables such as age, menopausal status, oral contraceptives use, Ki67 expression, tumor grade, clinical stage, and BMI of TNBC patients (Table 1 and S1 Table). [score:8]
A screening approach employing any of these four significantly overexpressed miRNAs individually can still reveal a good but lower diagnostic accuracy when compared to the three upregulated miRNAs (miR-21; miR-221; miR-210) and/or two downregulated miRNAs (miR-195 and miR-145) combined together (Fig 4G–4I). [score:8]
We find that three oncogenic miRNAs, miR-21, miR-221 and miR-210 were consistently overexpressed while two tumor suppressor miRNAs, miR-195 and miR-145 were always downregulated in paired tumor tissue and sera as well as cell lines of TNBC compared to TPBC or other subtypes of breast cancer. [score:7]
Further, Pearson’s correlation coefficient analysis of 4 upregulated miRs (miR-21, miR-221, miR-210 and Let-7a) demonstrated a highly significant positive correlation of miRNA expression profiles between paired sera (r = 0.758, r = 0.647, r = 0.767 and r = 0.668 respectively, p<0.0001) and tissue samples (r = 0.881, r = 0.858, r = 0.748 and r = 0.629 respectively, p<0.0001) and it increased with the increasing severity (grade/ stage) of breast cancer (Fig 3A–3D). [score:6]
The results showed a significant correlation of the panel of five miRNAs, three over expressed miR-21, miR-221, miR210 and two downregulated miR-195 and miR-145 in the tissues (Pearson’s r = 0.881, r = 0.858, r = 0.748, r = −0.464 and r = −0.438 respectively, p<0.0001) and in their corresponding sera (r = 0.758, r = 0.647, r = 0.767, r = −0.451 and r = −0.379 respectively, p<0.0001). [score:6]
Radojicic et al.,[16] demonstrated overexpression of miR-21, miR-210 and miR-221 while miR-10b, miR-145, miR-205, miR-122a were significantly downregulated in TNBC. [score:6]
However, the relative expression level of miR-221 and miR-210 did not significantly alter in benign tumors but it did show an increased expression. [score:5]
A (miR-21); B (miR-221); C (miR-210); D (miR-195); E (miR-145); F (Let-7a); (G) comparative ROC of all six miRNAs (miR-21; miR-221; miR-210; miR-195, miR-145 and Let-7a); (H) combined ROC of three miRs (miR-21; miR-221 and miR-210); (I) combined ROC of two downregulated miRNAs (miR-195 and miR-145). [score:4]
We observed that while miR-21, miR-221, miR-210 and Let-7a were overexpressed as a function of severity of lesion or tumor grade and stage of tissue and paired sera, miR-145 and miR-195 showed down regulation. [score:4]
Areas under the curve (AUC) and p-values were highly significant for miR-21, miR-221, miR-210 and Let-7a in both tumor tissue and sera suggesting for an enormous potential of these four upregulated miRNAs as biomarker for TNBC. [score:4]
All the four upregulated miRs showed a higher sensitivity and specificity of 100% and 95% for miR-21, 100% and 100% for miR-221, 95% and 95% for miR-210 and 95% and 95% for Let-7a. [score:4]
The over expression of miR-210 alone was found to be associated with BRCA1 mutation. [score:4]
A highly significant correlation has been observed for aberrant tissue overexpression of miR-21, miR-221, miR-210 and Let-7a between tumor grade and stage of TNBCs and their corresponding sera. [score:3]
The hsa-miR-210 overexpression is induced by hypoxia in a HIF-1alpha (Hypoxia inducing factor- 1α) and VHL (von Hippel-Lindau) -dependent fashion [29]. [score:3]
0158946.g002 Fig 2(A) Expression level of selected miRNAs (miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a) in total serum samples from breast cancer patients and healthy individuals. [score:3]
A significant association (p<0.001) was also observed for an increased expression of miR-210 and miR-21 (11.41 and 18.81 fold change) with obesity and menarche (11.85 and 19.48 fold change) (see S1 Table). [score:3]
Taken together, the result demonstrated that four miRs i. e., miR-21, miR-221, miR-210 and Let-7a were significantly overexpressed in cell lines of TNBC as in TNBC tissue and sera. [score:3]
0158946.g001 Fig 1 (A) The expression level of miR-21, miR-221, miR-210, miR-195, miR-145 and Let-7a in total breast tumour and adjacent normal tissues. [score:3]
miR-21 was also marginally increased in benign fibroadenoma while miR-221, miR-210 and Let-7a were underexpressed. [score:3]
The fold change expression levels of miR-21, miR-221, miR-210 and Let-7a were 34.64, 28.35, 27.82 and 17.90 respectively which were significantly different from those of normal breast tissues but also from all other breast cancer (BC) subtypes (see Table 2a; Fig 1B). [score:3]
The target genes of miRNA-210 are involved in cell proliferation, mitochondrial metabolism, DNA repair (RAD52), chromatin remo deling, and cell migration. [score:3]
Our study also showed a significantly (P< 0.05) higher expression of specifically miR-210, miR-221 (11.28; 18.87 fold change) in oral contraceptive users in TNBC. [score:3]
We analyzed the expression pattern of a set of six selected microRNAs- miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a in four subtypes of breast cancer tissues including adjacent normal tissues. [score:3]
Since an altered expression level of six selected microRNAs, miR-21, miR-221, miR-210, miR-145, miR-195 and Let-7a is known to be frequently involved in breast carcinogenesis, these have been examined in paired TNBC tissue and serum samples in comparison to that of adjacent normal tissue margins and normal serum. [score:3]
When we compared TNBC with TPBC patients it exhibited significantly a highest fold change expression of miR-21 (34.64 vs 4.90; p < 0.001), followed by miR-221 (28.35 vs 1.33; p < 0.001), miR-210 (27.82 vs 1.57; p < 0.001) and Let-7a (17.90 vs 0.67; p< 0.001) (Table 2a). [score:2]
As observed in tumor tissues, the miR-21, miR-221, miR-210 and Let-7a were also found to be overexpressed in their paired sera (13.99; 14.97, 8.39 and 11.84 fold change, p < 0.001; Table 2b) as compared to that of normal sera, though at a lower level than those observed for tissue miRNA (Fig 2A). [score:2]
E Regulation P value miR-21 4.90±0.51 up0.001 * 8.85±2.05 up0.0001 * 14.59±2.09 up0.0001 * 34.641±5.22 up0.0001 * miR-221 1.33±0.41 up 0.417 2.97±0.53 up0.001 * 19.05±2.56 up0.001 * 28.35±4.04 up0.001 * miR-210 1.57±0.50 up 0.255 2.99±1.11 up 0.82 18.00±2. [score:2]
Reverse transcription as well as Real-Time PCR for miRNA expression analysis was carried out using primers for hsa-miR-21, hsa-miR-221, hsa-miR-210, hsa-miR-195, hsa-miR-145 and hsa-miR-Let-7a and SnRNA U6 was used as a reference control. [score:2]
E Regulation P value miR-21 2.42±0.52 up0.005 * 4.17±0.77 up0.001 * 7.84±1.77 up0.001 * 13.99±2.11 up0.0001 * miR-221 0.45±0.17 down0.003 * 1.81±27 up0.006 * 8.24±1.36 up0.001 * 14.97±2.24 up0.001 * miR-210 0.88±0.42 down 0.41 1.59±0.74 up 0.868 7.30±1.27 up0. [score:2]
For paired serum, miR-21 had a AUC value of 0.959 (95% CI: 0.9071–1.000, p < 0.0001) with 95% sensitivity and 81% specificity, miR-221 of 0.810 (95% CI: 0.6629–0.9570, p < 0.0001) with 81% sensitivity and 72% specificity, miR-210 of 0.998 (95% CI: 0.9911–1.000, p < 0.0001) with 100% sensitivity and 100% specificity and Let-7a of 0.966 (95% CI: 0.9237–1.008, p < 0.0001) with 91% sensitivity and 86% specificity (Table 4b). [score:1]
9570)p = 0.0004 * miR-210 100% 100% 0.9979 (0.9911–1.000)p < 0.0001 * miR-195 78% 65% 0.6767 (0.5098–0.8437)p = 0.0400 * miR-145 78% 91% 0.8837 (0.7862–0.9812)p < 0.0001 * Let-7a 91% 86% 0.9660 (0.9237–1.008)p < 0.0001 * AUC: Area Under the Curve; CI: Confidence Interval; * Significant. [score:1]
The role of hypoxia -induced miR-210 in cancer progression. [score:1]
[1 to 20 of 37 sentences]
15
[+] score: 149
Recent studies showed that miR-210 was upregulated in BC tissues[19, 20], and the overexpression of miR-210 was associated with a poor survival, promoted cell growth and migration, and inhibited apoptosis of BC cells [21]. [score:8]
The results showed that the miR-210 expression in the BC tissues was significantly upregulated in comparison to that in adjacent normal tissues (P<0.001, Fig 1A). [score:6]
To confirm previously reported high miR-210 expression levels in BC tissues[25], we examined miR-210 expressions in 40 pairs of human BC tissues and corresponding non-cancerous tissues using qRT–PCR. [score:5]
The comparison between miR-210 expression in paired serum and primary tumors revealed that high levels of miR-210 represented higher expressions in most cases of primary BC tissues. [score:5]
We selected 10 BC patients with the highest serum miR-210 expression (high group) and another 10 BC patients with the lowest serum miR-210 expression (low group). [score:5]
To confirm the hypothesis, we first examined the miR-210 expression of cultured medium in BC cell lines (5637 and T24) and found miR-210 were expressed in cultured medium of both 5637 and T24 cells. [score:5]
MiR-210, the master hypoxamir, is upregulated in most human solid tumors and generally exhibits oncogenic properties [17, 18]. [score:4]
And the levels of serum miR-210 from patients with relapsed BC were upregulated and reached the levels of that in pre-operative patients. [score:4]
Recent studies demonstrated miR-210 was upregulated in BC tissues [19, 20]. [score:4]
These results indicate that miR-210 might be released from primary bladder tumor cells into the surrounding environment, implying that the serum miR-210 might originate from primary BC cells and its serum expression level could reflect tumor dynamics of cancer patients with BC. [score:3]
The expression levels of serum miR-210 in 168 BC patients and 104 controls were examined using qRT-PCR. [score:3]
In this study, first, we confirmed the higher miR-210 expressions in BC tissues and cell lines than in adjacent normal tissues and a human uroepithelial cell line. [score:3]
The results showed that the expression levels of miR-210 in BC cell lines were significantly higher than that in the human uroepithelial cell line (Fig 1B). [score:3]
As a result, increased tendencies of the miR-210 expression were confirmed in both cell number- and time-course -dependent manners (Fig 5). [score:3]
The miR-210 expression in primary BC tissues and BC cell lines. [score:3]
0135168.g002 Fig 2 (A) The serum miR-210 expression in 168 BC patients and 104 controls. [score:3]
More importantly, a significant difference in serum expression of miR-210 was observed between both groups of patients with NMIBC and MIBC (P<0.0001, Fig 3A). [score:3]
In further analysis, we divided the BC patients into NMIBC and MIBC, and found that the serum miR-210 from both NMIBC and MIBC were significantly upregulated compared to the controls (P<0.0001 and P<0.0001, respectively). [score:3]
These findings were consistent with other reports that high miR-210 expression in BC tissue was associated with muscle-invasive aggressiveness [19, 20]. [score:3]
The statistical results showed that serum miR-210 expression in BC patients was significantly correlated with T stage (P = 0.000) and M stage (P = 0.040). [score:3]
The expression level of miR-210 was significant higher in primary BC tissues than in adjacent normal tissues (P<0.001). [score:3]
Comparison of circulating miR-210 expressions in different groups. [score:3]
0135168.g003 Fig 3(A) The serum miR-210 expression in 84 NMIBC, 84 MIBC and 104 controls. [score:3]
Moreover, we examined the circulating miR-210 expression levels in paired pre- and post-operative serum samples from 40 BC patients who underwent curative cystectomy, and found that the levels of serum miR-210 were significantly reduced in the post-operative group (P<0.0001) (Fig 4A). [score:3]
We also found that high miR-210 expression in serum was associated with advanced T stage and the presence of metastasis. [score:3]
And the results indicated that the levels of miR-210 were significantly upregulated in BC patients compared to healthy controls (P<0.0001, Fig 2A). [score:3]
The expression and clinical significance of circulating miR-210 in BC remains unclear at this time. [score:3]
We found that pre-operative miR-210 expression levels in serum are useful to detect BC, predict muscle invasion and histological degree, and reflect tumour dynamics. [score:3]
There were no significant associations between serum miR-210 expression and the patient’s gender, age, N stage or Grade (all P >0.05) (Table 1). [score:3]
0135168.g004 Fig 4(A) Comparison of serum miR-210 expressions between pre- and post-operative samples from BC patients. [score:3]
Circulating expression of miR-210 has also been described in other solid cancers, such as breast cancers[22], kidney cancer [34], and pancreatic cancer [35]. [score:3]
As a result, in 9 patients of the high group, miR-210 expression in BC FFPE tissues showed higher (90%) than that in patients of the low group (S2 Fig). [score:3]
These findings indicated that the serum expression level of miR-210 could be reflective of tumour dynamics and might monitor tumor status. [score:3]
MiR-210 expression and clinicaopathological feature in BC patients [median (interquartile range)]. [score:2]
MiR-210 expression in human BC tissues and BC cell lines. [score:2]
MiR-210 expression in serum of patients with BC. [score:2]
Taken together, the findings demonstrated that the circulating levels of miR-210 could reflect the tumor dynamics in BC patients. [score:1]
The corresponding FFPE tissues of these patients were collected and then the miR-210 expressions were evaluated. [score:1]
In this study, we focused our analysis on the clinical impact of circulating miR-210 on detection and surveillance of BC, with the hypothesis that circulating miR-210 could serve as a minimally invasive biomarker for BC patients. [score:1]
It has been demonstrated that high circulating miR-210 could serve as a biomarker of tumor presence and treatment response to drug therapies in patients with breast cancer [22]. [score:1]
Comparison of miR-210 levels in serum and corresponding cancer tissues. [score:1]
This study is the first to demonstrate the potential role of serum miR-210 in detection of BC. [score:1]
We also investigated whether serum miR-210 expression levels could reflect tumor dynamics in BC. [score:1]
The level of serum miR-210 in the relapse group was significantly increased (P<0.0001) and exhibited a similar level to that in the pre-operative samples (Fig 4B). [score:1]
And our data clearly demonstrated that the miR-210 levels in cultured medium of BC cell lines significantly increased in both cell number- and time-course -dependent manners, while the miR-210 levels in cultured medium of the human uroepithelial cell line remained unchanged (data not shown). [score:1]
In conclusion, our results provide compelling evidence that serum miR-210 could be used as a noninvasive biomarker for screening, stage predicting and monitoring BC. [score:1]
Therefore, it might be a challenge to discriminate whether high circulating miR-210 level is specifically associated with BC itself or if this is only a common phenomenon which manifests as a result of perturbations in the host immune response during progression of any cancer [36]. [score:1]
However, the relatively low AUC and the considerable overlap in distributions of serum miR-210 in NMIBC and MIBC indicate that serum miR-210 could not be used to accurately differentiate between MIBC and NMIBC. [score:1]
Further research showed miR-210 levels could not only distinguish NMIBC patients from healthy control patients, but also MIBC from NMIBC with AUC value of 0.736. [score:1]
Moreover, we determined whether the miR-210 level in culture medium could reflect the status of BC cell lines and might be released from cancer cells. [score:1]
0135168.g001 Fig 1(A) Comparison of miR-210 levels in 40 pairs of primary BC tissues and adjacent normal tissues. [score:1]
Nevertheless, serum miR-210 may serve to assess the relative likelihood of muscle-invasive BC in the absence of more reliable circulating biomarkers. [score:1]
Also, we investigated the miR-210 expression in human BC cell lines (T24 and 5637) and a human uroepithelial cell line (SV-HUC-1). [score:1]
Comparison of medium miR-210 level in BC cells (5637 and T24). [score:1]
We addressed this issue by demonstrating that a positive significant correlation existed between primary tumor tissue and serum levels of miR-210 and that serum miR-210 levels fell postoperatively in a subset of patients, highlighting the specificity of miR-210 as a specific biomarker for BC. [score:1]
The AUC of miR-210 used to distinguish NMIBC (Ta–T1) and MIBC (T2–T4) patients from the controls were 0.858 (95% CI, 0.800–0.904) and 0.938 (95% CI, 0.893–0.968), respectively (Fig 3B and 3C). [score:1]
Then, we focused on the clinical significance of circulating miR-210 in BC. [score:1]
In light of these observations, we postulate miR-210 might be a candidate for exploration as circulating biomarkers of BC and may provide predictive information for improving cancer treatment. [score:1]
The role of serum miR-210 in predicting tumor stage in patients with BC. [score:1]
And serum miR-210 could reliably differentiate NMIBC patients from MIBC patients, as evidenced by an AUC value of 0.736 (95% CI, 0.662–0.800) (Fig 3D). [score:1]
Evaluation of monitoring tumor dynamics using miR-210 expression of cultured medium in BC cell lines. [score:1]
[1 to 20 of 61 sentences]
16
[+] score: 144
Other miRNAs from this paper: hsa-mir-140, hsa-mir-145, hsa-mir-675
Interestingly, we discovered the overexpression of miR-210 and HIF-1 α upon hypoxia simultaneously, as shown in Figure 1. It is declared that hypoxia might induce the overexpression of HIF-1 α as well as the upregulated miR-210 in C28/I2 cells. [score:8]
All the findings illustrated that hypoxia induced the upregulated HIF-1 α and miR-210 expression in C28/I2 cells. [score:6]
It also was supposed that the upregulated HIF-1 α might be associated with overexpression of miR-210 in C28/I2 cells. [score:6]
With the overexpression of HIF-1 α, time course of miR-210 expression was assessed on hypoxic or normoxic exposure also, as shown in Figure 1(c). [score:5]
Nevertheless, the expression of Bcl-xl and PHD-2 mRNA was significantly increased either in cells with knockdown HIF-1 α or in cells without gene knockdown by artificially adding miR-210 (Figure 3). [score:5]
All these data revealed that the artificial downexpression of miR-210 could depressed the expression of HIF-1 α and HIF-1 α associated molecules under hypoxic situation. [score:5]
These findings revealed that the effects of HIF-1 α on response to hypoxia were pivotal in chondrocytes and also demonstrated that the downregulated miR-210 induced the apoptosis and decreased the viability in hypoxic chondrocytes in an HIF-1 α -dependent way. [score:4]
In this research, we focus on expression of miR-210 and HIF-1 α on hypoxic environment, the relationships of miR-210 and HIF-1 α, and the possible regulatory mechanisms of miR-210 in hypoxic chondrocytes. [score:4]
We also detect the expression of HIF-1 α (Figure 4(b)) and miR-210 (Figure 4(d)) to confirm the efficiency of gene knockdown at the same time. [score:4]
It has been demonstrated MiR-210, one of specific sets of microRNA molecules induced by hypoxia, is robustly upregulated by HIF-1 α. However, no report refers to hypoxia inducing the activation of the HIF-1 α/miR-210 signaling pathway in chondrocytes. [score:4]
It demonstrated the miR-210 and HIF-1 α had no effect on viability of chondrocytes upon normoxic exposure, whereas downregulation of miR-210 could significantly decrease the cell viability upon hypoxic situation, in contrast to that with no silenced miR-210 in nonsilenced HIF-1 α C28/I2 cells. [score:4]
In the present research, we also found that the downregulated miR-210 significantly increased the apoptotic rate of chondrocytes in response to hypoxia (Figure 5(b)). [score:4]
Previously, we found the upregulated HIF-1 α and miR-210 in C28/I2 cells. [score:4]
However, the confirmation of direct targets of miR-210 which have effect on response to hypoxia is necessary and will be challenging in chondrocytes. [score:4]
All data illustrated that the HIF-1 α played a centraxonial role in miR-210 modulating the viability of hypoxic C28/I2 cells; on the other hand, downregulated miR-210 decreased the cell viability depending in HIF-1 α -dependent way. [score:4]
Furthermore, we detect the apoptotic rate and viability in silenced HIF-1 α hypoxia chondrocytes with downregulated miR-210 (Figures 4(c) and 5(b)). [score:4]
The overexpression of miR-210 was added artificially and the genes of HIF-1 α and miR-210 were silenced in C28/I2 cells to confirm the hypothesis. [score:3]
The physiological effect of HIF-1 α which was modulated by miR-210 was indicated through detecting the targets of HIF-1 α, for example, PHD and BCL-xL. [score:3]
It was found that downregulated miR-210 stimulated the apoptosis compared to that with control RNA and miR-210 mimics in nonsilenced HIF-1 α cells. [score:3]
The maximum differences in miR-210 expression took place at 72 h in C28/I2 cells (P = 0.007). [score:3]
So it is uncertain if miR-210 acts as promoter or inhibitor in proliferation. [score:3]
Artificially adding miR-210 could remarkably affect the expression of HIF-1 α in C28/I2 cells rather than that in cells with silenced HIF-1 α genes. [score:3]
Cell viability and proliferation were examined in hypoxic or normoxic C28/I2 cells by MTT assay at 48 h. The results showed that there was no obvious change in viability of normoxic C28/I2 cells, in which the expression of miR-210 or/and the HIF-1 α was knocked down (Figure 4(a)). [score:3]
Moreover, miR-210 is a hypoxia-inducible factor (HIF)-1 target gene in response to hypoxia in various cancer cell lines [31– 33]. [score:3]
MiR-210 Was Involved in an HIF-1 α-Dependent Way in C28/I2 CellsTo further investigate the relationship of miR-210 and HIF-1 α, we assessed the expression of HIF-1 α according to repressed miR-210 by transfection with miR-anti in C28/I2 cells on normoxic or hypoxic exposure to 24 h and 48 h. Firstly, the relative expression of miR-210 was detected by qRT-PCR to verify the efficiency of transfection. [score:3]
To further investigate the relationship of miR-210 and HIF-1 α, we assessed the expression of HIF-1 α according to repressed miR-210 by transfection with miR-anti in C28/I2 cells on normoxic or hypoxic exposure to 24 h and 48 h. Firstly, the relative expression of miR-210 was detected by qRT-PCR to verify the efficiency of transfection. [score:3]
So we also reflected the effect of HIF-1 α regulation by miR-210 according to assessing the downsteam factors (PHD and BCL-xL). [score:2]
The results illustrated that hypoxic regulation of miR-210 is HIF-1 α independent in C28/I2 cells, as shown in Figures 2 and 3. Up to date, it is the first report on hypoxia inducing the activation of the HIF-1 α/miR-210 signaling pathway in chondrocytes. [score:2]
It displayed that the expression of miR-210 was enhanced significantly on hypoxic exposure, compared with that on normoxic exposure. [score:2]
In our study, we discovered that the miR-210 played a role as a positive regulator of viability in hypoxic chondrocytes (Figure 4(c)). [score:2]
All the results revealed that the downstream miR-210 could not affect the apoptosis in normoxic C28/I2 cells, and downstream miR-210 enhanced the apoptosis of cells upon hypoxic situation depending on the HIF-1 α. To show the hypoxia responsiveness of chondrocytes, we analyzed the expression of HIF-1 α and miR-210 in C28/I2 cells on hypoxic exposure, compared with that on normoxia. [score:2]
In miR-210 respect, miR-210 is modulated by HIF-1 α according to directly binding to HRE (hypoxia responsive element), which is the proximal miR-210 promoter [29]. [score:2]
The mirVana qRT-PCR miRNA Detection Kit (Ambion, Austin, TX, USA) and qRT-PCR Primer Sets were utilized to detect the expression of miR-210. [score:2]
Furthermore, HIF-1 α knockdown affected the apoptosis significantly, and adding miR-210 mimics did not change the effect on apoptosis which happened in HIF-1 α silenced cells (Figure 5(b)). [score:2]
In this research, to study the life cycle of chondrocytes in physiological environment, we compared the expression of miR-210 and HIF-1 α in C28/I2 cells upon hypoxia with that upon normoxia. [score:2]
Hypoxia Induced the Up-Steam HIF-1 α and miR-210 in C28/I2 CellsTo show the hypoxia responsiveness of chondrocytes, we analyzed the expression of HIF-1 α and miR-210 in C28/I2 cells on hypoxic exposure, compared with that on normoxia. [score:2]
We also revealed that the depressed miR-210 modulated the enhanced apoptosis and the repressed viability in hypoxic chondrocytes in an HIF-1 α -dependent way. [score:1]
We firstly reported the hypoxia inducing the activation of the HIF-1 α/miR-210 signaling pathway in chondrocytes. [score:1]
C28/I2 cells were transfected with miR-210 mimics (20 nM) or anti-miRs (50 nM) or siRNAs of HIF-1 α (30 nM) by siPORT NeoFX Transfection Agent (Ambion, Austin, TX, USA) as manufacturer's protocol. [score:1]
miR-210 had been conformed as protective to transformed cells, endothelial cells, and mesenchymal stem cells in prohibiting apoptosis in response to hypoxia [37– 39]. [score:1]
All the results revealed that the downstream miR-210 could not affect the apoptosis in normoxic C28/I2 cells, and downstream miR-210 enhanced the apoptosis of cells upon hypoxic situation depending on the HIF-1 α. Chondrocytes, the resident cells of cartilage and intervertebral disc, have crucial effects on articulation of joints and homeostasis of joint and intervertebral disc upon hypoxia in the whole life [1, 2]. [score:1]
It was assumed that HIF-1 α/miR-210 signaling pathway might be activated by hypoxia in C28/I2 cells. [score:1]
miR-210 abundance was enhanced in HIF-1 α -dependent manner following parasite infection in human primary macrophages [30]. [score:1]
We found the significantly decreased miR-210 in cells treated with miR-anti on hypoxia, as shown in Figure 2(a). [score:1]
It was suggested that Bcl-xl and PHD-2 were modulated by multimolecules, besides mainly by HIF-1 α. All these data suggested that miR-210 was involved in an HIF-1 α -dependent way in C28/I2 cells. [score:1]
The antimiR negative control and control RNA (miR-210 mimics control) (Ambion, Austin, TX, USA) were used as its endogenous reference. [score:1]
Decreased miR-210 Repressed the Cell Viability and Proliferation in Chondrocytes. [score:1]
It was shown that the effects of miR-210 on Bcl-xL and PHD-2 were coincident with those on HIF-1 α. These results demonstrated that MiR-210 was involved in a HIF-1 α -dependent way in C28/I2 cells also. [score:1]
The miR-210 mimics and anti-miR of miR-210 were purchased from Ambion (Ambion, Austin, TX, USA). [score:1]
It was documented that repressed miR-210 decreased the proliferation in carcinoma of the head and neck as well as adenocarcinoma of the pancreas [40, 41]. [score:1]
It was suggested that miR-210 and HIF-1 α could not affect apoptosis of the C28/I2 cells upon normoxia (Figure 5(a)). [score:1]
In addition, we evaluated the effect of miR-210 on HIF-1 α in C28/I2 cells by knocking down the HIF-1 α and artificially adding miR-210 upon hypoxic exposure to 48 h. There was dramatically decreased expression of HIF-1 α as well as HIF-1 α associated molecules in cells with silencing HIF-1 α genes compared to those with si-control. [score:1]
To further observe the influences of miR-210 on the hypoxic chondrocytes, we treated cells on hypoxia with the same method as those on normoxia. [score:1]
Decreased miR-210 Induced Hypoxic Chondrocytes Apoptosis. [score:1]
Hypoxia Induced the Up-Steam HIF-1 α and miR-210 in C28/I2 Cells. [score:1]
[1 to 20 of 55 sentences]
17
[+] score: 127
They also found an accumulation of intracellular iron and decreased matrigel invasion after inhibiting ISCU through transfection of the Swan-71 trophoblasts which suggests that downregulation of ISCU by miR-210 could inhibit trophoblast invasion, a common precursor to PE. [score:8]
In addition, the inflammatory factor tumor necrosis factor-α (TNF-α) could upregulate miR-210 expression while suppressing KCMF1 levels. [score:8]
While it has been reported that placental miR-210 expression is upregulated in PE patients there are few targets of miR-210 that have been identified in the etiology of PE. [score:8]
They also found an upregulation of miR-210 and downregulation of ISCU (iron–sulfur cluster scaffold homolog) in PE placentas (59). [score:7]
We demonstrated that both HIF-1α and NF-κB p50 bind the miR-210 promoter and induce its expression, were also significantly upregulated in poly I:C treated mouse placentas. [score:6]
A steroidogenic enzyme, hydroxysteroid (17-β) dehydrogenase 1 that is expressed mainly in the syncytiotrophoblasts of chorionic villi of the placenta is a direct target of miR-210. [score:6]
Both ephrin-A3 (EFNA3) and homeobox-A9 (HOXA9) are known for different biological functions such as cell migration and vascular remo deling and development during embryogenesis are direct targets of miR-210. [score:5]
Potassium channel modulatory factor 1 (KCMF1) was predicted to be a target of miR-210 using target prediction algorithms. [score:5]
In this review, we will discuss about the role of miR-210 and miR-155 that are consistently seen to be upregulated in PE patients and the important pathways they affect. [score:4]
These findings demonstrate that in a TLR3 -induced preeclamptic mouse mo del, placental miR-210 expression is induced via HIF-1α and NF-κB p50 which may contribute to the development of PE (63). [score:4]
miR-210 has been strongly linked with hypoxia that leads to insufficient trophoblast invasion and abnormal spiral artery remo deling contributing to PE (57) and is upregulated by (HIF-1α) which binds to HIF responsive element on the proximal promoter 400 bp upstream (58). [score:4]
By overexpressing miR-210, HIFs control the response to hypoxia on a cellular level by regulating genes involved in different processes such as angiogenesis, erythropoiesis, cell proliferation, differentiation, apoptosis, inflammation, and metabolism. [score:4]
In addition, we demonstrate that miR-210 directly targets signal transducer and activator of transcription 6 (STAT6) resulting in decreases of IL-4 production which causes the balance of pro to anti-inflammatory cytokine production in favor of pro-inflammatory cytokines. [score:4]
Transcription factors that regulate the miR-210 expression include hypoxia-inducible factors (HIF-1α, HIF-2α), and NF-κB (56). [score:4]
First, Pineles et al. screened 157 miRNAs using qRTPCR and demonstrated that miR-210 is upregulated in PE placentas. [score:4]
Their data suggest that the upregulation of miR-210 represses mitochondrial function via mitochondria -associated ISCU. [score:4]
KCMF1 is experimentally validated as a direct target of miR-210 using dual luciferase assay in HTR8/SVneo cells. [score:3]
Ectopic expression of miR-210 in trophoblast cells attenuated cell migration and invasion. [score:3]
Zhang and colleagues demonstrated that miR-210 expression is increased in placentas of PE patients and is also rapidly induced by hypoxia in trophoblast cell lines (57). [score:3]
Several subsequent studies by Zhu et al., Mayor-Lynn et al., and Enquobahrie et al., further confirmed increased expression of miR-210 in the placentas of PE women (53– 55). [score:3]
They found an inverse correlation—when there was an overexpression of miR-210 in their trophoblast cell lines there was a decrease in ISCU. [score:3]
One study hypothesized that overexpression of miR-210 would cause mitochondrial dysfunction in PE. [score:3]
Luo et al. first demonstrated that the levels of KCMF1 were significantly lower in placentas of PE patients and inversely correlate with miR-210 expression (62). [score:3]
Therefore, miR-210 expression may contribute to the occurrence of PE by interfering with KCMF1 -mediated signaling in the human placenta. [score:3]
In particular, one miRNA, miR-210 has been shown to be overexpressed in preeclamptic placentas by several independent groups (52, 53). [score:3]
This group found that miR-210 is not only regulated by HIF-1α but also by NF-kB p50. [score:2]
In this review, we will discuss our current understanding of the role of the most consistently dysregulated miRNAs, miR-210 and miR-155 in PE. [score:2]
The role of miR-210 in angiogenesis, iron metabolism, and trophoblast invasion is well established but the role of miR-210 in the regulation of genes related to immune responses is only beginning to emerge. [score:2]
miR-210 is an intronic miRNA located within genetic loci of transcript AK123483. [score:1]
Other angiomiRs such as miR-210 and miR-155 will be discussed in detail later in this review. [score:1]
This study is yet another pathophysiological finding that connects miR-210 and PE. [score:1]
Another study using a high throughput screening (HTS) -based miRNA profiling of human placentas demonstrated miR-210 to be increased in PE patients. [score:1]
Several miRNAs, including miR-16, miR-29b, miR-34a, miR-155, miR-210, and miR-675, decrease proliferation and migration of trophoblasts. [score:1]
The Role of miR-210 in PE. [score:1]
Poly I:C treatment of human CTBs significantly increased HIF-1α, NF-κB p50, and miR-210 levels. [score:1]
These studies taken together suggest that the multitude of miR-210 functions that affect different pathways during PE, such as mitochondrial dysfunction, angiogenesis, and immune system. [score:1]
miR-210: the master hypoxamir. [score:1]
[1 to 20 of 37 sentences]
18
[+] score: 122
In the experimental approaches described, upregulation of γ-globin gene expression can be achieved by different miRNA -based approaches, including the use of pre-miRNA targeting the 3′UTR region of the BCL11A mRNA, or the use of pre-miR-210, possibly targeting the coding region. [score:10]
We have previously reported the following observations on miR-210: (a) miR-210 expression is high in erythroid precursors from β-thalassemia patients displaying high production of fetal hemoglobin (HbF) and effective response to HbF inducers; (b) miR-210 increases following mithramycin (MTH) treatment of K562 cells and human erythroid progenitors from normal and β-thalassemic subjects; (c) this increase is associated with erythroid induction and elevated expression of γ-globin genes; (d) an anti-miR against miR-210 interferes with the mithramycin -induced changes of gene expression [19, 20]. [score:7]
Inhibition of miR-210 expression leads to a reduction of the globin gene expression and delayed maturation in K562 and erythroid progenitor cells, indicating that miR-210 contributes to hypoxia -induced erythroid differentiation in both K562 cells and β-thalassemia/HbE erythroid progenitor cells. [score:7]
These observations clearly support the hypothesis that miR-210 plays a role in regulating the expression of the BCL11A gene through a direct binding to the coding sequence of BCL11A mRNA. [score:5]
Nakada C. Tsukamoto Y. Matsuura K. Nguyen T. L. Hijiya N. Uchida T. Sato F. Mimata H. Seto M. Moriyama M. Overexpression of miR-210, a downstream target of HIF1α, causes centrosome amplification in renal carcinoma cellsJ. [score:5]
Bianchi N. Zuccato C. Lampronti I. Borgatti M. Gambari R. Expression of miR-210 during erythroid differentiation and induction of γ-globin gene expressionBMB Rep. [score:5]
This homology (13 C-G or U-A and 3 G-U) is similar or even higher than the homology between miR-210 and other validated miR-210-target mRNAs (Figure 2A), such as PLK1 (polo-like kinase 1: 11 C-G or U-A and 4 G-U), ROD1 (Regulator of Differentiation 1: 15 C-G or U-A and 2 G-U) and E2F3 (E2F transcription factor 3: 12 C-G or U-A and 2 G-U) as elsewhere published [38, 39, 40]. [score:4]
We have reported that miR-210 is involved in erythroid differentiation and, possibly, in γ-globin gene up-regulation [19, 20]. [score:4]
The result published by Sarakul demonstrated that miR-210 was up-regulated in K562 and β-thalassemia/HbE progenitor cells cultured under hypoxic condition. [score:4]
Since the location of the miR-210 binding site occurs in a region common to all the BCL11A isoforms, we hypothesize that it could be important for post-transcriptional regulation of the general expression of BCL11A gene, including the overall amount of produced BCL11A-XL isoform. [score:4]
However, the effects of the transfection with pre-miR-210 are restricted to BCL11A and γ-globin gene expression, and no changes of the other erythroid markers CD71 and GPA were detectable suggesting that the treatment with pre-miR-210 is not sufficient to induce the activation of the full program of erythroid differentiation and, therefore, should be combined with other inducers of erythroid differentiation in order to fully induce HbF accumulation. [score:3]
Our study suggests that, in addition to the already reported binding of miR-486-3p to the 3′UTR sequence of the BCL11A mRNA, the coding mRNA sequence of BCL11A can be targeted by miR-210 (see the scheme reported in Figure 7). [score:3]
In the present study, we have identified a coding sequence of BCL11A mRNA as possible target of miR-210. [score:3]
Altogether, these data indicate that miR-210 is able to target the BCL11A miR-210 binding site, generating however, at least in these experimental conditions, unstable hybrids (unlike fully complementary DNA and RNA sequences). [score:3]
Figure 1 shows the location of the putative miR-210 binding site within the BCL11A mRNA coding sequence, as found employing miRWalk 2.0, a database on predicted and validated microRNA targets (http://zmf. [score:3]
Tools available online were used to identify the base pairing between the coding sequence of the target genes MYB [27], KLF-1 [28], BCL11A [29, 30], and the microRNA has-miR-210-3p. [score:3]
The following results sustain this hypothesis: (a) interactions between miR-210 and the miR-210 BCL11A mRNA site were demonstrated by SPR -based biomolecular interaction analysis (BIA) (see Figure 2B); (b) the miR-210 site of BCL11A-XL is conserved through molecular evolution, possibly indicating that these sequences play key biological functions (see Figure 2A); (c) forced expression of miR-210 leads to decrease of BCL11A mRNA and increase of γ-globin mRNA content in erythroid cells, including erythroid precursors isolated from β-thalassemia patients (see Figure 4 and Figure 5). [score:3]
The results obtained are shown in Figure 6A and clearly indicate that transfection with pre-miR-210 leads to decreased expression of BCL11A mRNA (left side of the panel) and increased γ-globin mRNA content (middle side of the panel). [score:3]
In order to verify whether the effects of the transfection with pre-miR-210 are restricted to BCL11A and γ-globin gene expression, additional erythroid associated markers (CD71 and Glycophorin A), were studied in transfected ErPCs. [score:3]
In addition to the theoretical point of view, these data are of interest, in our mind, from the applied point of view, since might indicate a novel strategy to inhibit BCL11A by mimicking miR-210 functions. [score:3]
Further controls, including studies on the effects of miRNAs unable to target the BCL11A mRNA and analysis of the effects of miR-210 on BCL11A mRNA carrying a mutated and not functional miR-210 binding site should be considered for deeper validation. [score:2]
In order to obtain information on the biological effects of miR-210 on BCL11A-XL regulated genes, a K562(BCL11A-XL) clone (clone #12) was employed. [score:2]
Decrease of BCL11A-XL and Increase of γ-Globin after Transfection of a K562(BCL11A-XL) Clone with Pre-miR-210. [score:1]
A miR-210 binding site was found only in BCL11A sequence. [score:1]
One of the possible microRNA involved in HbF production is miR-210. [score:1]
He J. Wu J. Xu N. Xie W. Li M. Li J. Jiang Y. Yang B. B. Zhang Y. MiR-210 disturbs mitotic progression through regulating a group of mitosis-related genesNucleic Acids Res. [score:1]
After pretreatment with three 10 μL pulses with 50 mM NaOH–1 M NaCl, an injection of 10 ng/μL biotinylated oligonucleotide carrying sequences mimicking the miR-210 binding site of the BCL11A mRNA (IDT Integrated DNA Technologies, Coralville, IA, USA) was performed, followed by a wash with 50 mM NaOH. [score:1]
Sawant M. Colah R. Ghosh K. Nadkarni A. Does HbF induction by hydroxycarbamide work through MIR210 in sickle cell anaemia patients?Br. [score:1]
The objective of the present paper was to identify possible binding of miR-210 to transcription repressors and verify its possible function. [score:1]
This miR-210 binding site covers the nucleotide region 789–798 of the BCL11A mRNA, which is common to all the BCL11A isoforms (see Figure 3B). [score:1]
The interaction between miR-210 and the immobilized BCL11A(miR-210) oligonucleotide occurs within seconds, while miR-221 and miR-222 sequences did not bind. [score:1]
Interestingly, the hybrid miR-210/BCL11A(miR-210) was not fully stable, as expected from the lack of 100% complementarity between these two sequences (compare RUres with RUfin values). [score:1]
Transfection of Erythroid Precursor Cells with Pre-miR-210 Leads to a Decrease of BCL11A-XL and an Increase of γ-Globin mRNA. [score:1]
However, as reported in Figure 3A, the BCL11A miR-210 site is highly conserved. [score:1]
Presence of miR-210 Binding Sites within mRNA Sequences Coding Repressors of γ-Globin Gene Transcription: The Coding Sequence of BCL11A mRNA Contains a Putative miR-210 Binding Site. [score:1]
The involvement of miR-210 in erythroid differentiation was also reported by Sarakul et al. [21], Bavelloni et al. [22] and Sawant et al. [23]. [score:1]
Hybridization to the immobilized oligonucleotide was performed by a 20 μL injection of 2.3 μM microRNA (miR-210, miR-221, miR-222, IDT), followed by a wash with 15 μL HBS-EP [+] buffer and a regeneration of the sensor chip with a 5 μL pulse of 50 mM NaOH. [score:1]
Cells transfections were performed using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) accordingly to manufacturer’s instruction, with the indicated concentrations (range 30–270 nM) of hsa-miR-210 pre-miR™ miRNA precursor (PM10516, Ambion-ThermoFisher Scientific). [score:1]
For instance, a recent paper by Bavelloni et al. confirmed a six-fold increase of miR-210 following treatment of K562 cells with mithramycin. [score:1]
The comparison of the effects of pre-miR-210 with those of a negative control supports the sequence-specificity of the effects. [score:1]
The possible involvement of miR-210 in HbF production is also supported by the recent communication by Sawant et al., suggesting that HbF induction by hydroxycarbamide works through miR-210 in sickle cell anemia patients [23]. [score:1]
Interaction of miR-210 with BCL11A Sequences Mimicking the miR-210 Binding Site of BCL11A mRNA. [score:1]
The location of the miR-210 binding site is within the BCL11A mRNA coding sequence and exhibits partial single stranded secondary structure interaction (RNAfold WebServer, http://rna. [score:1]
In order to obtain an efficient capture of 5′-biotinylated oligonucleotide mimicking the miR-210 binding site of BCL11A mRNA onto the sensor chip, the well documented streptavidin-biotin interaction was employed. [score:1]
The ability of miR-210 to specifically interact with miR-210 binding site of BCL11A mRNA has been validated by SPR -based analysis with the Biacore™ X100 biosensor (Figure 2B). [score:1]
In fact, the extent of homology between miR-210 and the BCL11A miR-210 binding site is 59.1%. [score:1]
The extent of complementarity between the human BCL11A sequences (NM_022893) with mature miR-210 is 72.7%, and is located at nucleotides 789–798, with a predicted seed length of 10, and a 0.0024 p-value. [score:1]
After seven days of cell culture phase II, the cells were treated for additional five days in the presence of 200 nM hsa-miR-210 pre-miR™ miRNA precursor (PM10516, Ambion-ThermoFisher Scientific, Waltham, MA, USA) or Pre-miR™ miRNA Precursor Negative Control #1 (Ambion-ThermoFisher Scientific). [score:1]
In order to validate these observation at the protein level, BCL11A protein production by K562(BCL11A-XL) clone #12 cells transfected with pre-miR-210, was studied and the results, presented in Figure 5C, demonstrate a significant decrease of BCL11A in transfected cells. [score:1]
The miR-210 Putative Binding Sites of BCL11A Are Conserved through Molecular Evolution. [score:1]
de/apps/zmf/mirwalk/), as well as inspection of the recent published paper by Fasanaro et al. [37], describing an integrated approach to identify miR-210 binding sites within mRNA sequences. [score:1]
After 14 days, cells were (a) untreated, (b) transfected with 200 nM pre-miR-210 or (c) transfected with 200 nM of pre-miR negative control. [score:1]
A biotinylated oligonucleotide mimicking the miR-210 binding site within BCL11A mRNA (sequence: 5′-biot-GTTTCTCTTGCAACACGCACAG-3′) was immobilized on a SA sensor chip and miR-210, miR-221 (control #1) and miR-222 (control #2) were injected obtaining the sensorgrams shown in Figure 2B. [score:1]
Figure 5A,B shows that transfection of K562(BCL11A-XL) clone #12 cells with pre-miR-210 leads to a sharp concentration dependent decrease of BCL11A transcripts (Figure 5A) and, at the same time, an increase of γ-globin mRNA content (Figure 5B). [score:1]
Interestingly, the nucleotide sequences surrounding the BCL11A miR-210 site exhibit some nucleotide variation. [score:1]
[1 to 20 of 55 sentences]
19
[+] score: 122
Other miRNAs from this paper: hsa-mir-21, hsa-mir-208a, hsa-mir-34a, hsa-mir-146a, hsa-mir-208b
Emerging evidence has demonstrated that the induction of miR-210-3p, as a robust target of hypoxia-inducible factors (HIFs), is a consistent feature of the hypoxic response in both normal and malignant cells, and its overexpression has been detected in a variety of diseases with hypoxic components (Devlin et al., 2011; Kelly et al., 2011; Cicchillitti et al., 2012; Hale et al., 2014; Qu et al., 2014; Wang et al., 2014). [score:7]
Negative regulation of Hif1a expression and TH17 differentiation by the hypoxia-regulated microRNA miR-210. [score:5]
Overexpression of miR-210, a downstream target of HIF1a, causes centrosome amplification in renal carcinoma cells. [score:5]
Expression of miR-210 during erythroid differentiation and induction of gamma-globin gene expression. [score:5]
miR-210-3p has also been reported to regulate the maturation and proliferation of early erythroid cells (Kosaka et al., 2008), and the expression of fetal g-globin genes and enucleation (Bianchi et al., 2009). [score:4]
Several functions related with erythroid cells were demonstrated to be regulated by miR-210-3p, including maturation and proliferation of early erythroid cells, expression of fetal g-globin genes and enucleation (Kosaka et al., 2008; Bianchi et al., 2009). [score:4]
miR-210-3p has been reported as the master regulator of hypoxic tumor response in various cancers (Huang et al., 2009; Greither et al., 2010) by disturbing mitosis through targeting multigenes involved in mitotic progression (He et al., 2013). [score:4]
Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation. [score:4]
miR-21, miR-210, miR-34a, and miR-146a/b are up-regulated in human atherosclerotic plaques in the Tampere Vascular Study. [score:4]
MicroRNA-210 regulates cancer cell proliferation through targeting fibroblast growth factor receptor-like 1 (FGFRL1). [score:3]
A hypoxia -induced positive feedback loop promotes hypoxia-inducible factor 1alpha stability through miR-210 suppression of glycerol-3-phosphate dehydrogenase 1-like. [score:3]
In this study, we observed a correlation in expression of miR-210-3p between the plasma and peripheral blood cells. [score:3]
Increases in the plasma -based expression of miR-210-3p have been reported in the context of various cancers and other hypoxia -induced pathological conditions (Raitoharju et al., 2011; Greco et al., 2012; Whitehead et al., 2013; Huang and Zuo, 2014; Ono et al., 2015). [score:3]
Various of miR-210 targets have been identified, pointing to their roles in mitochondrial metabolism, angiogenesis, DNA damage response, apoptosis, and cell survival (Huang and Zuo, 2014). [score:3]
E2F transcription factor 3 (E2F3) and fibroblast growth factor receptor-like1 (FGFRL1) were identified as miR-210 targets involved in cell cycle control (Nakada et al., 2011; Tsuchiya et al., 2011). [score:3]
Figure 3The correlations of miR-210-3p expression levels in peripheral blood cells with hematological indices and plasma EPO concentrations (n = 212). [score:3]
The concentrations of miR-210-3p and EPO are presented as the mean ± SEM, and other variables are expressed as the mean ± SD. [score:3]
For example, the receptor tyrosine kinase ligand Ephrin-A3 (EFNA3) was identified as a miR-210 target for promoting the angiogenic properties of vascular endothelial growth factor (VEGF) (Fasanaro et al., 2008). [score:3]
Considering that hypoxia can affect the expression of miR-210-3p in a variety of cells, such as peripheral blood cells as observed in this study and endothelial cells (Fasanaro et al., 2008), we speculate that the increased plasma miR-210-3p might derive from these cells and other tissue cells in chronic hypoxic environments. [score:3]
Expression level of miR-210-3p in peripheral blood cells. [score:3]
MicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3. [score:2]
Furthermore, we determined miR-210-3p expression levels in peripheral blood cells using qRT-PCR assay. [score:2]
Therefore, in the present study, we examined and compared the expression levels of miR-210-3p in both plasma and peripheral blood cells samples from Han Chinese subjects residing in Nanjing, which lies at sea level (Nanjing Han), Han Chinese who have recently immigrated from the plains to placeTibet (Tibet Han) and ethnic Chinese Tibetans. [score:2]
The results of miR-210-3p in blood cells were in agreement with those of plasma samples, showing that the expression level of miR-210-3p was markedly increased in the Tibet Han and Tibetan groups compared to the Nanjing Han group (1.98-fold increase, P < 0.001; 2.29-fold increase, P < 0.001, respectively) (Table 2). [score:2]
An Argonaute 2 switch regulates circulating miR-210 to coordinate hypoxic adaptation across cells. [score:2]
But the origin of plasma miR-210-3p is not clear. [score:1]
U6 was used as an internal reference for the qRT-PCR analysis of miR-210-3p in peripheral blood cells because its Cq values did not show differences among the three studied groups (Figure S3). [score:1]
Figure 2The correlations of absolute concentrations of plasma miR-210-3p with hematological indices and plasma EPO concentrations (n = 212). [score:1]
miR-210 is a well-known miRNA induced under hypoxic condition in several types of tissues and cells, and it contributes to cellular adaptation to hypoxic environments (Huang et al., 2010). [score:1]
Our study further demonstrated a relationship between erythropoiesis and miR-210-3p in hypoxia environments. [score:1]
Relationships of miR-210-3p with hematological indices and EPO. [score:1]
the log [10] of the amount of the synthetic miR-210-3p (Figure S2). [score:1]
To the best of our knowledge, this report is the first demonstrating that a high-altitude hypoxic environment has remarkable influences on human circulating miR-210-3p. [score:1]
Enhanced erythroid cell differentiation in hypoxic condition is in part contributed by miR-210. [score:1]
In addition, plasma miR-210-3p concentrations were also found to be related to plasma EPO concentrations. [score:1]
Plasma miR-210-3p concentrations. [score:1]
The plasma level of miR-210-3p also exhibited a significantly positive correlation with plasma EPO concentration (Figure 2D); however, no significant correlation was found between miR-210-3p levels in blood cells and plasma EPO concentrations (Figure 3D). [score:1]
However, no marked difference in plasma miR-210-3p concentration was observed between the Tibet Han group and the Tibetan group (P = 0.620). [score:1]
We defined that the levels of miR-210-3p in plasma and blood cells were affected by high altitude hypoxic environments and that miR-210-3p might act as a circulating factor in response to hypoxic environments. [score:1]
A recent study demonstrated that hypoxia induced differentiation of both K562 and β-thalassemic erythroid progenitor cells, and this induction was at least in part mediated by miR-210 (Sarakul et al., 2013). [score:1]
A direct plasma assay of circulating microRNA-210 of hypoxia can identify early systemic metastasis recurrence in melanoma patients. [score:1]
Subsequently, we used Spearman's rank correlation analysis to test for the correlations between the relative concentrations of miR-210-3p to MIR2911 in plasma and relative concentrations of miR-210-3p to U6 in blood cell in all of the studied individuals. [score:1]
Figure S2 Standard curve of miR-210-3p using synthetic miRNA. [score:1]
Our results provided additional information regarding the molecular mechanisms of human adaptation to life at high altitude hypoxia, and miR-210-3p might contribute to this process. [score:1]
This result indicated that plasma miR-210-3p might partly originate from peripheral blood cells. [score:1]
miR-210: more than a silent player in hypoxia. [score:1]
We also analyzed the correlations between miR-210-3p and hematological indices. [score:1]
Similarly, the miR-210-3p level was also higher in the Tibetan group than in the Tibet Han group; however, the difference did not achieve statistical significance (P = 0.280). [score:1]
MiR-210 disturbs mitotic progression through regulating a group of mitosis-related genes. [score:1]
Emerging roles of miR-210 and other non-coding RNAs in the hypoxic response. [score:1]
Figure 1 Spearman's rank correlation between miR-210-3p in plasma and in peripheral blood cells. [score:1]
The plasma absolute concentrations of miR-210-3p were also significantly higher in the Tibet Han and Tibetan groups than in the Nanjing Han group (P = 0.004, P < 0.001, respectively) (Table 2). [score:1]
Correlation between plasma miR-210-3p and miR-210-3p in peripheral blood cells. [score:1]
We found that miR-210-3p in both plasma and blood cells was significantly higher in samples from either Tibet Han subjects or from Tibetan subjects than in samples from Nanjing Han subjects. [score:1]
MiR-210: the master hypoxamir. [score:1]
More importantly, miR-210-3p was identified as deeply involved in the erythroid phenotype. [score:1]
Furthermore, we demonstrated strong positive relationships of circulating miR-210-3p with hematological parameters. [score:1]
Figure S4 The relative concentrations of miR-210-3p in plasma samples from Nanjing Han, Tibet Han, and Tibetan groups. [score:1]
Consequently, the absolute concentrations of miR-210-3p in plasma and the relative concentrations of miR-210-3p to U6 in blood cells showed significantly positive correlations with RBC, HGB and HCT values (Figures 2A–C, 3A–C) in all of the studied subjects. [score:1]
We speculate that miR-210-3p might mainly be secreted by the above-mentioned cells via cell-derived microvesicles or exosomes, or as microvesicles-free miRNAs into the circulation (Zen and Zhang, 2012) in response to hypoxic conditions, resulting in the increase of plasma miR-210-3p level. [score:1]
However, whether miR-210-3p might act as a circulating factor in response to hypoxic environments has barely been explored. [score:1]
Hypoxia-inducible factor 1-α induces miR-210 in normoxic differentiating myoblasts. [score:1]
[1 to 20 of 62 sentences]
20
[+] score: 106
Hence, miR-210 when inhibited increases the level of apoptosis in HeLa cells [46]; miR-22 promotes cell survival in UV irradiated cells through a tumor suppressor gene down-regulation [74]; down-regulation of miR-25 in ovarian cancer cells induces apoptosis [75]; miR-155 was described as having anti-apoptotic effects in murine macrophages during Helicobacter pylori infection [76]; and miR-133b is known to inhibit pro-survival molecules MCL-1 and Bcl-w proteins, two members of the BCL-2 family [47]. [score:13]
Am J Physiol Lung Cell Mol Physiol 86 Yang W, Sun T, Cao J, Liu F, Tian Y, et al (2012) Downregulation of miR-210 expression inhibits proliferation, induces apoptosis and enhances radiosensitivity in hypoxic human hepatoma cells in vitro. [score:8]
It is however interesting to note that several miRNAs in addition to miRNA-210 i. e., miR-23, miR-24, miR-26a, miR-26b, miR-29a and miR-107 up-regulated through time course infection in our study were described as hypoxia-related [77], [78], negatively regulating HIF-1α through factor inhibiting-HIF-1α (FIH) [79] or induced by this TF [80]. [score:7]
In order to check if the mRNA expression of these chemokines was negatively correlated with the up-regulation of all the corresponding targeting miRNAs (i. e., let-7a, miR-25, miR-23b, miR-26a, miR-132, miR-140, miR-146a, miR-146b, miR-155 and miR-210) identified in Table S2, we measured their levels using qRT-PCR. [score:6]
We hence hypothesized that pro-caspase3 could be targeted by miR-210 in infected human MDM, thereby inhibiting their apoptosis. [score:5]
Although silencing miR-210 in infected macrophages did not reverse the L. major -induced pro-caspase-3 inhibition, we cannot exclude that this anti-apoptotic function of miR-210 takes place through the targeting of other pro-apoptotic molecules. [score:5]
Leishmania virulence factors or other parasit e exosome components involved in cell-cell contact might also be involved in mir-210 up-regulation in human macrophage upon L. major infection. [score:4]
However, the biological significance of L. major -induced miR-210 may lie in non-apoptotic biological processes, as miR-210 has been recently described to down-regulate NF-κB1 (the p105 precursor of p50 NF-κB subunit) [87]. [score:4]
This absence of effect could be attributed either to the partial effect of miR-210 silencing on its expression (46%, data not shown) although statistically significant (p = 0.0014), or to specific regulation of caspase-3 in MDM that differs from that observed in HeLa cells [46]. [score:4]
Finally, following parasite infection, miR-210 abundance was enhanced in HIF-1α -dependent manner, though it did not contribute to inhibiting anti-apoptotic pathways through pro-apoptotic caspase-3 regulation. [score:4]
In order to check if the observed up-regulation of miR-210 was specifically under HIF-1α control, we used siRNA to silence this TF before infection (HIF-1α silencing leads to a 90% decrease in HIF-1α protein abundance; Tiffin and Sysco Consortium, submitted paper). [score:4]
indicate that miR-210 was crescendo up-regulated since 6 h post-infection in parasite infected macrophages (Fig. 4, panel A). [score:4]
0002478.g004 Figure 4Time course of miRNA-210 and procaspase-3 expression levels in L. major infected human primary macrophages. [score:3]
Time course of miRNA-210 and procaspase-3 expression levels in L. major infected human primary macrophages. [score:3]
In cells transfected with control siRNA, and as expected, miRNA-210 was overexpressed in infected cells in comparison to non-infected ones. [score:3]
Indeed, miR-210 has been shown to promote cell survival by targeting caspase-8 -associated protein 2 in rat mesenchymal stem cells [84], E2F3 transcription factor in human pulmonary artery smooth muscle cell [85] and apoptosis-inducing factor, mitochondrion -associated, 3 (AIFM3) in hypoxic human hepatoma cells [86]. [score:3]
To investigate if miR-210 up-regulation in infected macrophages might contribute to the anti-apoptotic behavior of Leishmania-infected macrophages through caspase-3 inhibition, we first measured pro-caspase 3 abundance in infected cells compared to non infected cells and then monitored the potential effect of miR-210 silencing on expression of this pro-apoptotic molecule. [score:3]
Expression of miR-210 was monitored by real-time PCR during the time course of in vitro L. major infection in MDM from three new donors. [score:3]
HIF-1α silencing leads to a reduction by about 40% of miR-210 expression in non-infected cells (p = 0.001) and up to 60% in infected cells (p = 0.00002), indicating that induction of miR-210 is largely dependent on parasite -induced HIF-1α activation (Fig. 4, panel B). [score:3]
The siRNA used are anti-miR-210 miRNA inhibitor (AM10516, Ambion), anti-HIF-1α siRNA (SI04249308, Qiagen) or negative control siRNA (1027280, Qiagen). [score:3]
MiR-210 expression has been described to be mainly transcriptionally controlled by hypoxia -induced factor-1 alpha (HIF-1α) (reviewed in [48]). [score:2]
MiR-210 expression at 3, 6, 12, and 24 h in infected cells relatively to non-infected cells (panel A), after siRNA-control or HIF-1α-silencing transfections in non-infected and infected cells (panel B). [score:2]
To our knowledge, our study is the first one showing miR-210 induction in response to a pathogen; further investigation is warranted in order to clarify the biological significance of this up-regulation in response to L. major infection. [score:2]
For this study, we focused on the role of one of these deregulated miRNA in infected macrophages, namely miR-210. [score:2]
Being particularly interested in putative regulators of apoptotic and anti-apoptotic pathways (Tiffin and Sysco Consortium, submitted paper), we identified one particular microRNA, miR-210, that could possibly affect the abundance of apoptotic proteins like procaspase-3, a key actor of apoptosis triggered by both intrinsic and extrinsic pathways. [score:2]
Levels of miR-210 were then monitored in macrophages incubated for 24 h with L. major parasites. [score:1]
Among the miRNAs for which levels were modulated during L. major infection, several were described as playing a possible role in apoptosis e. g., miR-210, [46] miR-22, miR-155 and miR-133b [47]. [score:1]
Conversely, it was also shown that silencing of miR-210 in HeLa cells induced caspase-3 activity [46]. [score:1]
However, miR-210 silencing did not affect the abundance of procaspase-3 (data not shown). [score:1]
[1 to 20 of 29 sentences]
21
[+] score: 101
The expression of miR-210 was 1.8-fold higher in placental samples from high-altitude pregnancies compared to sea-level placentas (p = 0.06; Figure 5D), whilst the mRNA expression of its downstream target gene COX10 was 27% lower (p<0.01), and COX10 protein expression was 30% lower (p<0.05) (Figure 5E and 5F). [score:8]
Curiously, whilst miR-210 appears to be amongst the most robustly and consistently upregulated micro -RNAs in hypoxia in some carcinoma cell lines [24], [46], [47], it is downregulated in others [48]. [score:7]
Supporting a post-transcriptional regulatory mechanism, we observed a strong upregulation of miR-210 in fibroblasts following hypoxia, perhaps reinforcing the idea of mitochondrial suppression playing a protective role in hypoxia [23], [44], [45]. [score:7]
Following our finding that complex I and complex IV protein subunits were decreased in both placental cell types in response to hypoxic conditions, we investigated the expression of miRNA-210, a known regulator of these complexes, along with the expression of its targets COX10 (cytochrome c oxidase assembly protein; a subunit of complex IV) and ISCU1/2 (iron-sulfur cluster scaffold proteins), to determine whether the miRNA pathway might play a mechanistic role in this context. [score:6]
This may be due to miR-210 upregulation, or protein synthesis inhibition, which Yung et al. [28] found to be present in the same placentas as were studied here. [score:6]
Expression of microRNA-210 and its Targets is Altered in Hypoxic Placental Fibroblasts. [score:5]
Induction of miR-210, downregulation of ETS, COX10 and ISCU 1/2 protein levels of high-altitude human placentas. [score:4]
While these results strengthen the direct correlation between miR-210 and its targets in fibroblasts, an additional mechanism is likely to be at play in JEG3 cells. [score:4]
Stabilization of hypoxia-inducible factor-1α (HIF-1α) under hypoxic conditions leads to a downregulation of mitochondrial oxygen consumption [20], [21], and the HIF-responsive microRNA-210 (miR-210) has been strongly implicated in this response [22], [23]. [score:4]
As our in vitro data suggests protein synthesis inhibition and miR-210 -driven mechanisms likely regulate mitochondrial function in hypoxia, therefore we examined whether similar effects occurred in vivo using placentas from high-altitude pregnancies in which a high level of phosphorylation of eIF2α has been recently identified [28]. [score:4]
Here, we found significant upregulation of miR-210 in high-altitude placentas, which was similar to hypoxic placental fibroblasts, though the increase was milder in comparison. [score:4]
MicroRNA-210 expression is induced in hypoxic fibroblasts but not in hypoxic JEG3 cells; RNA and protein expression of COX10 and ISCU 1/2 are decreased in both fibroblasts and JEG3 cells cultured in hypoxic condition (1% O2). [score:4]
In support of this, miR-210 was upregulated in isolated trophoblast cells after a short exposure to hypoxia over 8h [27]. [score:4]
This increase in miR-210 in hypoxic fibroblasts also corresponded with a decrease in mRNA and protein levels of its targets COX10 (p = 0.07; 1% O [2] vs. [score:3]
Alternatively, in JEG3 cells, there was no change in miR-210 expression under hypoxic conditions (Figure 3B). [score:3]
Finally, we extended our investigation into human placentas from high-altitude pregnancies, comparing expression levels of mitochondrial proteins, miR-210 and its targets with those in placentas from sea-level pregnancies. [score:3]
However, protein expression of ISCU1/2 was 21% lower (p = 0.06), (Figure 5F), suggesting that miR-210 is likely involved in post-transcriptional repression of ISCU1/2. [score:3]
High-altitude Pregnancy is Associated with Increased Expression of miR-210. [score:3]
Furthermore, we measured the expression of miR-210 and its downstream targets, to determine whether they could be implicated in a potential mechanism. [score:3]
HIF -mediated induction of miR-210 is, therefore, a potential mechanism underlying placental remo delling in the oxidatively-stressed high-altitude placenta, and is known to be elevated in placental tissue derived from pre-eclamptic patients [25], [26], [27], and in a recent study was shown to regulate trophoblast mitochondrial respiration in pre-eclampsia [27]. [score:2]
Real-time PCR of miRNA targets was performed using TaqMan MicroRNA assays (hsa-miR-210) according to manufacturer’s instructions and normalised to a reference miRNA (RNU48). [score:2]
C) MiR-210 expression in sea-level and high-altitude placentas. [score:2]
Altogether, these findings suggest that different placental cell types utilise distinct mechanisms to regulate mitochondrial function: hypoxic fibroblasts initiate a miR-210 -based process whereas trophoblast-like JEG3 cells may use an alternative mechanism. [score:2]
MiR-210 expression in A) fibroblasts and in B) JEG3. [score:2]
Remarkably, exposure of placental fibroblasts to 1% O [2] resulted in a substantial increase in miR-210 levels, 12.8 and 9.7 fold greater than fibroblasts grown at 21% O [2] (p<0.001) and 10% O [2] (p = 0.001), respectively (Figure 3A). [score:1]
Studies on BeWo cells [47], found an induction of miR-210 after 24h and 48h of incubation at 1% O [2]. [score:1]
Interestingly, COX10 levels remained unchanged with only a mild reduction in ISCU1/2 levels supporting the idea that miR-210 induction is responsible for these changes in hypoxia. [score:1]
Since JEG3 cells are metabolically very active, it is possible that they induce miR-210 for a shorter time period than placental fibroblasts, and this might account for the variability seen after 4 d of hypoxic exposure. [score:1]
In JEG3 cells, hypoxia led to higher transcriptional levels of ISCU1/2 and COX10, but surprisingly the protein levels were drastically lower despite the apparent absence of a miR-210 induction. [score:1]
No such changes were noted in JEG3 cells, however, though it has been suggested that there are tissue-specific responses of miR-210 in both transformed and primary cell types [46]. [score:1]
[1 to 20 of 30 sentences]
22
[+] score: 88
Down-regulation of miR-34c and up-regulation of miR-183 and miR-210 were identified in cancer groups. [score:7]
Compared to normal control lung tissue, down-regulation of miR-34c and up-regulation of miR-183 and miR-210 were identified in caner groups (p < 0.05 for each). [score:6]
But miR-34c expression levels were similar between two groups, and miR-210 showed not significant but higher expression tendency in EGFR mutation groups than wild type. [score:6]
It is reasonable to assume that pulmonary adenocarcinomas with high miR-210 expression, which were found to be related to aggressive behavior in this study, will surely be a target that can be treated with anti-glycolytic agents. [score:5]
Expression of miR-210 is linked to tumor proliferation, migration, and poor clinical outcome in breast cancer [36], and miR-210 is highly expressed in most solid tumors, including late stages of lung cancer [37]. [score:5]
In this study, the oncogenic role of miR-210 was presumed from higher expression in lung adenocarcinoma tissue than normal lung and positive statistical association between miR-210 expression and T stage, TNM stage, poor differentiation. [score:5]
Chen et al. suggested that cells with high miR-210 expression were significantly responsible to agents that inhibit glycolytic pathway, in vitro [39]. [score:5]
Increased miR-210 expression showed a higher tendency toward pleural invasion and heavy smokers, EGFR mutation group than wild type group. [score:4]
We identified three microRNAs (miR-34c, miR-183, and miR-210) which showed significant altered expression in all groups of lung adenocarcinoma by microarray study. [score:3]
Herein, we identified that miR-34c, miR-183, and miR-210 showed significantly altered expression in some lung adenocarcinomas. [score:3]
The chi-square test was used to assess miR-34c, miR-183, miR-210 expression with respect to clinicopathological parameters. [score:3]
Additionally, heavy smokers have a tendency to show high expression level of miR-210. [score:3]
We identified three microRNAs (miR-34c, miR-183, and miR-210) which showed significantly altered expression in all groups of lung adenocarcinoma by microarray study. [score:3]
Increased miR-210 expression was found to be significantly associated with T stage (p = 0.019), TNM stage (p = 0.007), and showed a higher tendency toward pleural invasion (p = 0.094). [score:3]
Aberrant expression of miR-210 was independently associated with T stage (p = 0.019), and TNM stage (p = 0.007). [score:3]
Expression levels of miR-34c, miR-183, and miR-210 were significantly different between normal control group and cancer groups (p = 0.034, <0.000, and 0.036, respectively; Fig.   2a). [score:3]
Here, we show that miR-34c may act as a potential tumor suppressor gene and miR-183 and miR-210 have a potential oncogenic role in pulmonary adenocarcinoma. [score:3]
To investigate the potential biologic roles of three miRNAs, we further subclassified lung adenocarcinomas into “high” and “low” groups in the expression of miR-34c, miR-183, miR-210, based on the mean of expression after normalization [8], and performed survival analysis by univariate Kaplan-Meier method. [score:3]
Three miRNAs, miR-34c, miR-183, and miR-210, which with showed statistical differences in their expression among three groups, were selected. [score:3]
Expression levels of miR-34c, miR-183, and miR-210 were significantly different between normal control group and cancer groups (p = 0.034, <0.000, and 0.036, respectively). [score:3]
In conclusion, we show that miR-34c may act as a potential tumor suppressor gene and miR-183 and miR-210 have a potential oncogenic role, using FFPE samples with various histopathologic parameters. [score:3]
Tumor differentiation was significantly associated with miR-34c, miR-183, and miR-210 expression levels (p = 0.037, 0.029, and 0.003, respectively). [score:3]
miR-210 promotes glycolytic pathway in order to facilitate more rapid tumor growth [38]. [score:1]
From all these considerations, we suggest miR-210 may participate in tumorigenesis and tumor progression. [score:1]
miRNA miR-34c miR-183 miR-210 NSCLC Epidermal growth factor receptor Lung cancer is the major leading cause of cancer mortality [1], and non-small cell lung cancer (NSCLC) occupies about 80 % of lung cancer. [score:1]
[1 to 20 of 25 sentences]
23
[+] score: 84
In the case of hsa-miR-210, we have not established which target(s) is responsible for the reversal of cap -dependent translation inhibition of RB, CA9, aggressive growth in vivo, and the reduced sensitivity to MEK inhibitor in MML-1 cells engineered with hsa-miR-210 miR decoy. [score:9]
Figure 3Abrogation of hsa-miR-210 regulation with miRNA decoys completely reverses hypoxia -induced protein translation in vitro and makes MML-1 cells less sensitive to MEK inhibition (GSK1120212/trametinib) in vivo by accelerating tumor progression(A) qRT-PCR analysis shows marked induction of hsa-miR-210HG expression across the three cell lines in response to hypoxia. [score:8]
Contrary to that, here we show that engineering MML-1 cells to express a hsa-miR-210 decoy did not block tumor growth in vivo, rather it accelerated growth and caused the cells to be less sensitive to inhibition of the established therapeutic target MEK. [score:7]
The most surprising data from this study was that all cell lines did not: 1) express similar amount of hsa-miR-210, 2) respond similar to hypoxia in terms of protein expression of CA9, RB or p-4EBP1 and 3) respond similar to expression of hsa-miR-210 decoy [44]. [score:7]
Abrogation of hsa-miR-210 regulation with miRNA decoys completely reverses hypoxia -induced protein translation in vitro and makes MML-1 cells less sensitive to MEK inhibition (GSK1120212/trametinib) in vivo by accelerating tumor progression. [score:6]
To investigate if inhibition of hsa-miR-210 would impact the cells response to targeted therapies, we treated mice with MEK inhibitor trametinib, since this is an approved treatment against BRAF mutated melanoma [29]. [score:5]
Previously, hsa-miR-210 expression was shown to be associated with aggressive tumors and poor prognosis across malignancies; thereby making it and/or its downstream targets attractive candidates for therapeutic intervention [45– 47]. [score:5]
It is thus plausible that the tumor promoting effects seen e. g. in myeloid-derived suppressor cells expressing hsa-miR-210 [47] is not visible in our system. [score:5]
Moreover, we show that targeting of hsa-miR-210 in metastatic melanoma cells might have lethal consequences, as they tend to become more aggressive and less sensitive to MEK inhibition in vivo. [score:5]
Abrogation of hsa-miR-210 regulation with a miRNA decoy completely reverses the hypoxia -induced protein expression changes. [score:4]
hsa-miR-210 is known as the “hypoxiamir” or “hypoxia master regulator” [43], underscoring its role in hypoxia and its regulation. [score:3]
Taken together, these data indicate that the behavior of cells when exposed to low oxygen vary depending on levels of basal hsa-miR-210 expression. [score:3]
Hence, our data suggest that hsa-miR-210 belongs to the list of miRNA's including hsa-miR-26 that can act either as an oncogene or as a tumor suppressor [48– 50] depending on the cell and the micro-environmental context. [score:3]
Loss of hsa-miR-210 function with a miR decoy renders MML-1 cells less sensitive to MEK inhibition (GSK1120212, trametinib) in vivo and accelerates tumor progression. [score:3]
Loss of hsa-miR-210 function with a miR decoy renders MML-1 cells less sensitive to MEK inhibition (GSK1120212, trametinib) in vivo and accelerates tumor progressionOur RNAseq data were generated from melanoma cells grown in mice. [score:3]
To investigate the underlying cause of the relative insensitivity of MML-1 cells expressing decoy, a Reactome Pathway Database map of potential hsa-miR-210 (Supplementary Figure S1B) targets was investigated. [score:1]
An obvious difference could be that in our system, we blocked hsa-miR-210 function in the tumor cells only and the cells were grown in an immune compromised host. [score:1]
miR-210-decoy. [score:1]
Moreover, hsa-miR-210HG contains a hypoxia inducible factor (HIF) response element (HRE), and the non-protein coding transcript is processed to form the mature hsa-miR-210 [21, 22]. [score:1]
hsa-miR-210HG is a non-protein coding transcript encoding the intronic miRNA hsa-miR-210 whereas no publications or database predictions of function exist for hsa-miR-600HG. [score:1]
Our results suggest that hsa-miR-210 has a different role in different contexts or cell types. [score:1]
Next, we therefore injected MML-1 cells or MML-1 cells engineered with the hsa-miR-210 decoy subcutaneously into the flanks of NOG mice. [score:1]
Since the transcriptomic analysis suggested that hypoxia was most likely the driver of expression differences between the PDXs and CDXs, we next investigated the role of hsa-miR-210 in the hypoxia -induced phenotype. [score:1]
[1 to 20 of 23 sentences]
24
[+] score: 79
While miR-221, miR-125b, miR-34a and miR-100 were up-regulated and miR-130b, miR-210 and miR-185 were down-regulated in obese subjects; miR-130b and miR-210 were both down-regulated during differentiation and in subcutaneous fat depots from obese subjects. [score:10]
Of those 70 miRNAs up- or down-regulated during adipocyte differentiation, 2 of the most significantly over-expressed (miR-30c and miR-378) and 4 of the most down-regulated (miR-210, miR-221, miR-424 and miR-503) were selected for validation by semi-quantitative Real Time-PCR. [score:9]
Surprisingly, miR-923 and miR-210 levels showed an opposite expression pattern between cell lines, since both were down-regulated in obese pre-adipocytes while up-regulated in obese mature adipocytes when compared to cells from lean subjects (Table 1). [score:8]
Of note there, miR-10a, miR-34a, miR-100 (in both pre-adipocytes and mature adipocytes), miR-210 and miR-99a (only in mature adipocytes) were up-regulated in cell lines from obese subjects (Table 1) and correlated with BMI [Table S3] while miR-221 (in both pre-adipocytes and adipocytes), miR-210 (in pre-adipocytes) and miR-125b (in adipocytes) were significantly down-regulated (Table 1). [score:7]
Thus, FAS, ACC, FABP4, PPARg, ADIPOQ and RBP4 gene expression levels were significantly and directly correlated with miR-30c and miR-378 but significantly and inversely related with miR-210, miR-221, miR-503 and miR-424 expression levels in RNA samples from cell lines [Figure S2]. [score:6]
1) Differential miRNA Expression between Lean and Obese Cell Lines before and after In Vitro Differentiation and during Adipogenesis MiR-10a (in both pre-adipocytes and mature adipocytes), miR-34a, miR-100, miR-30a (only in pre-adipocytes), miR-99a and miR-210 (only in mature adipocytes) were up-regulated in cells and subcutaneous fat depots from obese when compared to those obtained from lean individuals. [score:5]
Among miRNAs correlated with fating triglycerides, only miR-210 (r = −0.388, p = 0.040) was down-regulated during adipogenesis. [score:4]
Importantly, among these 15 miRNAs, miR-130b (r = −0.406, p = 0.032), miR-210 (r = −0.362, p = 0.049), miR-100 (r = 0.411, p = 0.030), miR-221 (r = 0.436, p = 0.020) and miR-125 (r = 0.477, p = 0.010) were down-regulated during differentiation. [score:4]
According to our data, miR-210 was down-regulated during adipocyte differentiation but not in DM-2 subjects. [score:4]
The most remarkable were miR-503 (−6.7-fold), miR-221 (−4.9-fold), miR-424 (−4.6-fold), miR-210 (−4.3-fold) and miR-31* (−2.6-fold), that were down-regulated in mature adipocytes. [score:4]
On the other hand, miR-210 was up-regulated in pre-adipocytes and inversely associated with BMI and triglycerides. [score:4]
MiR-10a (in both pre-adipocytes and mature adipocytes), miR-34a, miR-100, miR-30a (only in pre-adipocytes), miR-99a and miR-210 (only in mature adipocytes) were up-regulated in cells and subcutaneous fat depots from obese when compared to those obtained from lean individuals. [score:3]
The miRNA expression levels were assessed by RT-PCR for miR-210 (MIMAT 0000267), miR-221 (MIMAT 0000278), miR-503 (MIMAT 0002874), miR-424 (MIMA 0001341), miR-378 (MIMAT 0000732), and miR-30c (MIMAT 0000244). [score:3]
Klöting et al. [26] also described miR-210 as down-regulated in subcutaneous fat from DM-2 individuals when compared to healthy individuals. [score:3]
It should be noted that, while 3 of these miRNAs (miR-30c, miR-210 and miR-221) have been previously described as obesity and/or adipogenesis-related [11], [26], the 3 others (miR-503, miR-378 and miR-424) were not. [score:1]
IntegratedSeveral miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
This miR-210 is linked to hypoxic stress response, a well recognized component of the tumor environment [37]. [score:1]
21 hsa-miR-140-3p −1.22 hsa-miR-450a −1.23 hsa-miR-210 †† −1.24 1.48 hsa-miR-26b −1.25 hsa-miR-10b −1.25 −1.25 hsa-miR-101 −1.26 −1.28 hsa-let-7c −1.28 hsa-miR-98 −1.29 −1.21 hsa-miR-23a −1.30 hsa-miR-22* −1.34 −1.42 hsa-miR-337-3p −1.38 −1.23 hsa-miR-31 −1.39 −1.34 hsa-miR-365 −1.43 −1.38 hsa-miR-137 −1.46 −1.45 hsa-miR-494 −1.55 hsa-miR-29b −1.82 −1.93 hsa-miR-221 † −1.88 −1.84 hsa-miR-29c −2.33 hsa-let-7i 1.21 hsa-miR-125b † −1.24 hsa-miR-195 −1. [score:1]
Several miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
[1 to 20 of 19 sentences]
25
[+] score: 73
The results show that CDF treatment significantly decreased the relative levels of miR-21 and miR-210, and mRNA expression of HIF-1α, VEGF, IL-6, EZH2, Nanog, and Oct4 the tumor tissues (Figure 6B), suggesting that CDF in a tumor mo del in vivo could inhibit the expression of miRNAs and mRNAs that are associated with CSCs and deregulated under hypoxic conditions in vitro. [score:8]
The data from several experimental studies have indicated that hypoxia -induced higher expression of miR-210 is associated with hypoxia -induced downstream targets VEGF and carbonic anhydrase 9 (CAIX) in cancer cells by a HIF-1α -dependent mechanism [15], [32], which suggests that miR-210 may have a regulatory role in the promotion of tumor angiogenesis [11]– [13], [23], [33], [34]. [score:6]
Here, we show that CDF can inhibit cell survival, clonogenicity, migration/invasion, and angiogenesis, and the CSC self-renewal capacity in human PC cells in vitro under hypoxic conditions, consistent with the inhibition of miR-21, miR-210, HIF-1α, and CSC signature gene markers. [score:5]
We also examined the effect of CDF treatment on the expression of miR-21 and miR-210, and the mRNA expression of HIF-1α, VEGF, and CSC signature markers in the tumor tissues. [score:5]
It has been found that hypoxia decreased the expression of miR-101, a potential anti-oncogenic molecule, and increased expression of miR-21 and miR-210, pro-oncogenic molecules in several cancers including PC [14], [15]. [score:5]
CDF decreased the expression of cell proliferation marker Ki-67, and other markers of tumor aggressiveness such as HIF-1α, VEGF, EZH2, EpCAM as well as the expression of HIF-1α, VEGF, IL-6, EZH2, Nanog, Oct4 mRNAs, miR-21, and miR-210 in pancreatic tumor tissues (orthotopic tumors induced by human MiaPaCa-2 cells). [score:5]
Effect of CDF on tumor growth and the expression of Ki-67, EZH2, HIF-1α, VEGF, EpCAM, miR-21, and miR-210 in vivo We conducted the animal experiment in orthotopic mouse mo del by the injecting MiaPaCa-2 cells into the pancreas for the development of tumor. [score:4]
Recent experimental evidence has shown that hypoxia could regulate the expression of a number of miRNAs, including anti-oncogenic (let-7 and miR-101), and pro-oncogenic (miR-21 and miR-210) miRNAs [10], [12], [13], [15], [23], [24]. [score:4]
Effect of CDF on the microRNA (miRNA) expression of miR-21 and miR-210 in PC cells under hypoxic conditions. [score:3]
The higher expression of miR-210 has been reported to be highly associated with poor clinical prognosis in PC and other cancers [31]. [score:3]
Effect of CDF on tumor growth and the expression of Ki-67, EZH2, HIF-1α, VEGF, EpCAM, miR-21, and miR-210 in vivo. [score:3]
As shown in Figure 3, hypoxia induced the relative miRNA levels of miR-21 and miR-210 in AsPC-1 and MiaPaCa-2 cells whereas CDF decreased the levels of miR-21 and miR-210 in PC cells under hypoxic conditions, suggesting that CDF is a potent agent in attenuating hypoxia -induced expression of miR-21 and miR-210 in human PC cells. [score:3]
In this study, we found that hypoxia led to an increase in the expression of miR-210 in PC cells and CSC-like sphere cells. [score:3]
Effect of CDF on the expression of Nanog, Oct4, EZH2, miR-21, and miR-210 in PC cells under hypoxic conditions. [score:3]
These findings suggest that hypoxia -induced miR-210 may play an important role in the tumor microenvironment, which further suggest that targeting miR-210 would provide a novel therapeutic strategy such as the usefulness of CDF for the treatment of human malignancies. [score:3]
In this study, we examined the effect of hypoxia on cell migration, invasion and angiogenesis, and expression of VEGF, IL-6, CSC signature genes, miR-21 and miR-210 in PC cells under hypoxic conditions. [score:3]
More importantly, our previously published study using a mouse orthotopic mo del of human PC showed anti-tumor activity of CDF [17], [19], which was consistent with inhibition of HIF-1α, VEGF, CSC signatures, miR-21, and miR-210. [score:3]
The results show that CDF increased the relative miRNA levels of let-7c,d, miR-101, and miR-200b and decreased the relative levels of miR-210 in MiaPaCa-2 tumor sphere cells under hypoxic conditions (Figure 5B). [score:1]
A large body of experimental evidence has shown that miR-210 is a hypoxia -induced miRNA in a variety of cells including cancer cells [7]. [score:1]
Finally, we examined the effect of CDF on miR-21, miR-210, HIF-1α, VEGF, and CSC signature markers in vivo. [score:1]
In order to examine the effect of CDF on miRNA expression in PC cells under hypoxic conditions, we measured the relative levels of miR-21 and miR-210 under hypoxic conditions by real-time RT-PCR. [score:1]
[1 to 20 of 21 sentences]
26
[+] score: 61
These results indicated that the 5′-product of ATD_15.52 cleavage by hDicer alone can effectively inhibit the processing of pre-miR-210. [score:3]
For the pre-miR-33a:AL-33a and pre-miR-210:AL-210 pairs, very effective inhibition was observed, even at a low concentration of the oligomer (Fig. 3B). [score:3]
ATD_13.6 selectively binds to pre-miR-210 and inhibits its processing by hDicer. [score:3]
The inhibition of pre-miR-210 cleavage was also observed when the full-length oligomer and both its fragments were added to the reaction mixture. [score:3]
Nevertheless, the most prominent inhibition of miRNA production by 2OMe-AL-210 was observed for the complementary precursor, pre-miR-210. [score:3]
Again, to prove that the selective inhibition of pre-miR-210 cleavage by ATD_15.52 (precisely by its 5′ fragment) results from the specific interactions between the two molecules, we performed control reactions involving several pre-miRNA species, i. e., pre-miR-16-1, -21, and -33a (Fig. S2B). [score:3]
Our previous experiments demonstrated that ATD_13.6 efficiently inhibits pre-miR-210 cleavage and only slightly affects pre-miR-33a processing (Fig. 1A). [score:3]
To test whether the selective inhibition of pre-miR-210 cleavage by ATD_13.6 results from the specific interactions between these two molecules, we performed control reactions involving several pre-miRNA species, i. e., pre-miR-16-1, -21, and -33a. [score:3]
The concentrations of the radiolabeled pre-miR-210 and of the enzyme were the same in all samples; only the amount of the oligomer was altered. [score:1]
Interestingly, among the selected oligomers, ATD_13.6 (Fig. 1) and ATD_15.52 (Fig. 2) selectively and permanently repressed the excision of miR-210 from its precursor. [score:1]
We found that the production of miR-210 was significantly reduced after the addition of 5′-ATD_15.52 (to approximately 10%). [score:1]
This observation indicates that the three molecules: pre-miR-210, ATD_13.6 and hDicer may mutually interact. [score:1]
Positions of free ATD_13.6, the ATD_13.6:hDicer, and the ATD_13.6:pre-miR-210:hDicer complexes are indicated. [score:1]
Radiolabeled ATD_15.52 or one of its fragments (5′-ATD_15.52 or 3′-ATD_15.52) was denatured and renatured alone (−) or in the presence of pre-miR-210 (+). [score:1]
Consequently, the native structure of pre-miR-210 is disrupted (Fig. 2D). [score:1]
The amount of the 5′-terminally labeled pre-miR-210 and its cleavage products was determined for each reaction, and the efficiency of miR-210 production in the presence or absence of the oligomer (i. e., the oligomers’ capacity to inhibit the digestion of pre-miR-210 by hDicer) was calculated. [score:1]
The data obtained revealed that pre-miR-210 and ATD_13.6 indeed form a complex (Fig. 1C). [score:1]
Radiolabeled pre-miR-210 was incubated with hDicer in the presence of ATD_15.52, one of its fragments (5′- or 3′-ATD_15.52) or both fragments (5′+3′ ATD_15.52). [score:1]
The results of the EMSA experiment involving radiolabeled ATD_15.52 or its fragments and pre-miR-210 revealed that 5′-ATD_15.52 forms a very stable complex with pre-miR-210 (Fig. 2C). [score:1]
Our earlier studies also showed that ATD_15.52, another oligomer that specifically repressed miR-210 production, was bound by hDicer (Fig. S1B) and cut into two fragments: a 21-nt long 5′-fragment (5′-ATD_15.52) and a 35-nt long 3′-fragment (3′-ATD_15.52) (Fig. 2A). [score:1]
ATD_15.52 was also capable of forming a complex with pre-miR-210, albeit less effectively than its 5′ fragment. [score:1]
The above results clearly demonstrated that interactions between pre-miR-210 and selected RNA oligomers can influence the efficiency and/or pattern of precursor digestion by hDicer. [score:1]
The results of the experiments performed for four pairs, 2OMe-AL-16-1_2:pre-miR-16, 2OMe-AL-21:pre-miR-21, 2OMe-AL-33a:pre-miR-33a, and 2OMe-AL-210:pre-miR-210, are shown (Fig. 6). [score:1]
0077703.g003 Figure 3(A) The predicted secondary structures of four tested pre-miRNAs (pre-miR-16-1, pre-miR-21, pre-miR-33a and pre-miR-210). [score:1]
The obtained results revealed that AL-33a and AL-210 formed stable complexes with pre-miR-33a and pre-miR210, respectively. [score:1]
The position of the ATD_13.6 and pre-miR-210 complex is indicated by the arrow. [score:1]
A set of reaction mixtures containing the same amounts of radiolabeled ATD_13.6 (100 nM) and hDicer, and gradually increasing amounts of the substrate pre-miR-210 (from 0 to 60 µM) were prepared. [score:1]
The control reaction lacked pre-miR-210. [score:1]
A different effect was observed for two other examined pairs, pre-miR-33a/AL-33a and pre-miR-210/AL-210. [score:1]
The diagrams show the average efficiency of miR-210 production based on three independent experiments; error bars represent the standard deviations. [score:1]
These oligomers specifically affected miR-210 maturation by binding both Dicer and pre-miR-210 (Figs. 1, 2, 3, S1 and S2). [score:1]
Exclusively for one reaction in which pre-miR-210 was added to the ATD_13.6 and hDicer, another slowly migrating complex was formed. [score:1]
To determine whether these observations are specific cases of a more general rule, we tested the effects of four 12-nt oligomers, AL-16-1, AL-21, AL-33a and AL-210, on pre-miR-16-1, pre-miR-21, pre-miR-33a and pre-miR-210 processing. [score:1]
The obtained results confirmed that ATD_13.6 formed complexes only with pre-miR-210. [score:1]
Radiolabeled ATD_13.6 was denatured and renatured alone (−) or in the presence of pre-miR-210 (+). [score:1]
The obtained results suggested that ATD_13.6 might interact not only with hDicer but also with pre-miR-210. [score:1]
The positions of the complexes formed by ATD_15.52 or its 5′-fragment and pre-miR-210 are indicated by arrows. [score:1]
The position of the ATD_13.6/or ATD_15.52 and pre-miR-210 complex is indicated. [score:1]
In the experiment shown, equimolar concentrations of Dicer and radiolabeled ATD_13.6, and increasing amounts of pre-miR-210 were used (molar ratios from 1∶1 to 1∶600). [score:1]
Almost no miR-16-1 or miR-210 was produced at a 100-fold molar excess of 2OMe-AL-16-1_2 or 2OMe-AL-210. [score:1]
The 3′ fragment did not interact with the miR-210 precursor. [score:1]
The prediction of the secondary structure of the pre-miR-210∶5′-ATD_15.52 complex using the RNAstructure program showed that 12–13 nucleotides of the 5′ fragment can base-pair with the apical fragment of pre-miR-210. [score:1]
To learn more about the mechanism underlying this process, we examined whether 5′-ATD_15.52 could interact with pre-miR-210. [score:1]
After the addition of pre-miR-210 to the mixture containing ATD_13.6 and hDicer, the reactions were incubated at 37°C for 30 min. [score:1]
0077703.g001 Figure 1(A) Radiolabeled pre-miR-210 or pre-miR-33a was incubated with hDicer in the presence of ATD_13.6. [score:1]
[1 to 20 of 45 sentences]
27
[+] score: 59
Amongst the miRNAs with the greatest fold-change between ccRCC and normal kidney cortex were the upregulated miRNAs miR-122-5p, miR-224-5p, miR-210-5p, the downregulated miR409-3p, and the upregulated miR-21-3p. [score:10]
Interestingly, upregulation of miR-210 was also reported in other malignancies, including breast and head and neck cancer, and found to correlate with prognosis [22,23], although in some studies downregulation of miR-210 was found in cancer, e. g. breast cancer in comparison with benign breast epithelium and esophageal cancer [24]. [score:7]
The most abundantly upregulated miRNAs were miR-21-3p, miR-451-3p and miR-210-3p, of which miR-21 had an expression level in RCC exceeding 140,000 read counts/million. [score:6]
This might explain the lack of effect on proliferation or apoptosis in our cell line miR-210 knock down experiments, but differences in miR-210 target expression of FGFRL1 might be another explanation. [score:6]
confirmed overexpression of miR-21, miR-122 and miR-210 and downregulation of miR-199 and miR-532 (Figure 4). [score:6]
In accordance with our sequencing results, miR-122-5p and miR-210-3p showed the largest fold-change in expression levels between tumor and normal kidney cortex tissue in agreement with the deep-sequencing findings. [score:3]
Anti-miRNA inhibitor (100 nM) of either miR-210-3p or miR-27a-3p, respectively, or scrambled Negative Control (100nM, Applied Biosystems) with fluorescently labeled oligonucleotides (100 nM, BLOCK-iT, Invitrogen) was transfected into a renal cell line SKRC7 by Lipofectamine 2000 (Invitrogen). [score:3]
We subsequently performed a limited set of functional analysis of 2 of the PCR-confirmed highly differentially expressed miRNAs, miR-210-3p and miR-27a-3p. [score:3]
Both miR-210 and miR-27a were linked to predicted target genes which are of interest with regard to cell proliferation and apoptosis (see Table 1). [score:3]
Expression of miR-210 might merely reflect the hypoxia status known to be typically present in ccRCC and serve as a surrogate marker for tumor hypoxia because miR-210 is the most robustly induced miRNA under hypoxia [18,22,23]. [score:3]
Our exploratory experiments showed that proliferation and apoptosis of SKRC7 cells were not affected by knocking down miR-210 or miR-27a following transfection with specific antagomirs. [score:2]
Following transfecting the RCC cell line SKRC7 with miR-210 and miR-27a, respectively, we efficiently knocked down both miRNAs as demonstrated by PCR (data not shown). [score:2]
The lack of effect on proliferation and/or apoptosis after knocking down miR-210 and miR-27a in one ccRCC cell line may indicate that the effect of these miRNAs on the endpoints chosen do not apply to ccRCC and/or to this particular cell line only, or that the conditions to affect proliferation and/or apoptosis require a more intricate interplay of more factors. [score:2]
Data in other tumor types suggested that miR-210 is indeed involved in proliferation. [score:1]
The percentage of Annexin V+/PI+double positive SKCR7 cells were as follows: 1.62 and 3.9%; 1.28 and 3.62% and 3.58 and 4.50% Annexin V+/PI+ SKCR7 cells, respectively at 24 and 48 hr for anti-miR-210-3p, anti-miR-27a-3p and scrambled control treated SKRC7 cells. [score:1]
No significant enhancement of the percentage of apoptotic cells at 24 and 48 hr as evidenced by Annexin V+/PI+double positivity was observed following addition of anti-miR-210-3p, anti-miR-27a-3p and scrambled control to SKRC7 cells. [score:1]
[1 to 20 of 16 sentences]
28
[+] score: 56
MicroRNA-210 and another up-regulated miRNA in preeclamptic placenta, miR-518c, have been reported to target hydroxysteroid (17-beta) dehydrogenase 1 (HSD17B1), a steroidogenetic enzyme expressed in the placenta and responsible for the conversion of estrone to 17β-estradiol [114]. [score:8]
Using primary trophoblast cells prepared from placenta with severe PE, it was found that elevated expression of miR-210 is responsible for mitochondrial dysfunctionin part due to its ability to suppress the expression of iron-sulfur cluster scaffold homologue (ISCU) (Table 1) [12, 113]. [score:7]
The level of miR-210 increases in response to low oxygen tension in many different cell types and it is up-regulated in hypoxia associated diseases, such as cancer and PE [99]. [score:6]
For example, several up-regulated miRNAs in preeclamptic placenta, including miR-210 [83, 105], miR-20b [136], miR-29b [23], miR-16 [25], miR-155 [117] and miR-675 [115], have been demonstrated or suggested to inhibit angiogenesis and/or trophoblast proliferation, migration and invasion. [score:6]
Furthermore, while many studies have reported miR-210 as one of the most strongly upregulated miRNAs in PE (Table 2), one report showed that miR-210 expression was not significantly changed in placentas from PE patients as compared to normotensive patients by real-time PCR [14]. [score:5]
In trophoblast cells, miR-210 levels are also strongly upregulated by hypoxia [12]. [score:4]
HIF-1α is directly recruited to the HRE region in miR-210 promoter, which leads to induction of miR-210 expression [103]. [score:4]
Using an LNA probe specific for miR-210, ISH revealed that miR-210 is primarily expressed in both villous trophoblasts and iEVTs [12]. [score:3]
In addition to HIF-1α, p50, a subunit of the hypoxia-responsive transcription factor nuclear factor kappa-B (NFκB), also mediates the effect of hypoxia on miR-210 expression in trophoblast cells [105]. [score:3]
Several miRNAs, including miR-210 [105], miR-34a [84, 131] and miR-29b [23, 84] have inhibitory effects on trophoblast cell invasion. [score:3]
It was reported that miR-210 inhibited the migration and invasion capability of trophoblast cells by repressing Ephrin-A3 and Homeobox-A9 [105]. [score:3]
In turn, miR-210 stabilizes HIF-1α by targeting glycerol-3-phosphate dehydrogenase 1-like (GPD1L) mRNA [104]. [score:3]
The miR-210 gene is located within the intron of the hypoxia-inducible AK123483 gene [101]. [score:1]
[1 to 20 of 13 sentences]
29
[+] score: 52
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-96, hsa-mir-182, hsa-mir-183
Yang et al. discovered that miR-210 downregulation inhibited cell growth and induced cell apoptosis in human hepatoma cells [32]. [score:6]
In this study, we have shown that miR-183-96-182 cluster or miR-210 suppression by the corresponding miRNA-mower not only inhibited growth and migration but also induced apoptosis in human bladder cancer cells. [score:5]
Tandem bulged miRNA binding sites were inserted into the 3′ untranslated region (UTR) of the SV-40 promoter -driven Renilla luciferase gene to construct two “miRNA-mowers” for suppression of miR-183-96-182 cluster or miR-210. [score:5]
miR-183-96–182 cluster and miR-210 were found to be up-regulated in human bladder cancer, suggesting that they may play important roles as oncogenes in this cancer [15]. [score:4]
Expression of miR-210 was linked to tumor growth, invasion and poor patient survival [31]. [score:3]
Several miR-210 targets that influence cell growth, apoptosis, and migration have already been identified, such as E2F transcription factor 3 (E2F3) [36], fibroblast growth factor receptor like 1 (FGFRL1) [37], homeobox A1 (HOXA1) [38], FLICE -associated huge protein (FLASH)/caspase-8 -associated protein-2 (Casp8ap2) [39] and Ephrin-A3 (EFNA3) [33]. [score:3]
Inhibitions (%) [a] Cell lines miRNA- mowers miR-96 miR-182 miR-183 miR-210 T24 miRM- 183/96/182 49.33±2.46 47.34±4.23 52.67±5.11 −3.42±4.23 T24 miRM-210 2.42±3.85 −2.13±3.51 3.19±4.25 69.67±3.58 UM- UC-3 miRM- 183/96/182 46.33±3.57 46.13±3.41 51.37±3.89 2.55±3.52 UM- UC-3 miRM-210 1.78±3.31 2.33±3.03 −2.39±2.63 70.65±4. [score:3]
In summary, anti-growth effects mediated by apoptosis and anti-migration effects were both induced by the synthetic miRNA-mowers targeting miR-183-96-182 cluster or miR-210 in the bladder cancer cells. [score:3]
In this paper, we present two useful genetic devices–the miR-183-96-182-cluster-mower (miRM-183/96/182) and the miR-210-mower (miRM-210)–that target miRNAs with the partially complementary sequences. [score:3]
At the same time, the expression level of miR-210 also could not be changed by miRM-183/96/182. [score:3]
Fasanaro et al. discovered that anti-miR-210 transfection decreased cell migration, inhibited cell growth and induced apoptosis [33]. [score:3]
miR-210 has been known to regulate hypoxia, which is important for cancer cell survival and invasion. [score:2]
These results suggested that miR-183/96/182 cluster and miR-210 play important roles in the regulation of biological behaviors of bladder cancer cells. [score:2]
miR-210 has emerged as a novel tumor biomarker regulated by hypoxia. [score:2]
Bulged miRNA binding sites for the miR-96, miR-182, miR-183, and miR-210 and the linkers between them were designed and chemically synthesized. [score:1]
To demonstrate the modularity of the devices, we inserted another 6 tandemly arrayed copies of binding sites for miR-210 into the 3′ UTR of reporter gene to generate miRM-210 by using the same vector. [score:1]
miR-183/96/182 cluster and miR-210 are shown to play oncogenic roles in bladder cancer. [score:1]
The unique seed region of miR-210 distinguishes it from all of the other miRNAs. [score:1]
Either the combination DNA part for the miR-183-96-182 cluster containing 2 copies of binding sites for each cluster miRNA or the specific DNA part for miR-210 containing 6 copies of binding sites for miR-210 was cloned into siCHECKTM-2 luciferase vector (Promega, Madison, WI, USA) digested with Xhol and Notl. [score:1]
[1 to 20 of 19 sentences]
30
[+] score: 49
For upregulated miRNAs, L. m. -infected BMDM were transfected with miRNA inhibitors (mmu-miR-155-5p: MIN0000165, Qiagen; mmu-miR-210-5p: MIN0017052, Qiagen). [score:6]
Autophagy-related miRNAs mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p were differentially expressed in L. m. -infected BMDM in the late infection phase and directly influenced the parasite clearanceTo identify additional regulatory mechanisms, involved in the autophagic clearance of L. m. amastigotes, the small RNA transcriptome at 24 h p. i. was analyzed with Affymetrix® chips (Fig.   10a). [score:5]
Fig. 10Global analysis of differentially expressed miRNAs in L. m. -infected BMDM, bioinformatical prediction of miRNA interactions with LISA, and infection rates of L. m. -infected BMDM after transfection with mmu-miR-101c or mmu-miR-129-5p mimics as well as mmu-miR-155-5p or mmu-miR-210-5p inhibitors. [score:5]
Transfection of L. m. -infected BMDM with miRNA mimics for mmu-miR-101c and mmu-miR-129-5p, or with an mmu-miR-210-5p inhibitor in the late infection phase, resulted in significantly decreased infection rates, which suggests that these miRNAs might influence autophagic processes directly (Fig.   10c). [score:4]
Autophagy-related miRNAs mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p were differentially expressed in L. m. -infected BMDM in the late infection phase and directly influenced the parasite clearance. [score:4]
Therefore, miR-210 was upregulated in a hypoxia-inducible factor 1 alpha (HIF1A) -dependent manner [88, 89]. [score:4]
Transfection with mimics of mmu-miR-101c and mmu-miR-129-5p, as well as with an inhibitor of mmu-miR-210-5p, demonstrated direct effects of the respective miRNAs on parasite clearance in L. m. -infected BMDM. [score:4]
ATG5, BNIP3, CTSE, MIF, UB, and miRNAs mmu-miR-155-5p and mmu-miR-210-5p, were overexpressed. [score:3]
In addition to overexpression in L. m. -infected murine BMDM, miR-155 and miR-210 were also enhanced in primary human macrophages after infection with L. m. [88]. [score:3]
In contrast to the expected decrease of infection rates from transfection of L. m. -infected BMDM with an mmu-miR-210-5p inhibitor and an mmu-miR-129-5p mimic, the infection rates also decreased after treatment with an mmu-miR-101c mimic. [score:3]
Transfection of L. m. -infected BMDM with an mmu-miR-210-5p inhibitor as well as with mmu-miR-101c and mmu-miR-129 mimics significantly decreased the infection rates of these cells. [score:3]
c A significant decrease in the infection rates was detected in L. m. -infected BMDM after transfection with mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p compared to L. m. -infected BMDM transfected with a negative control of miRNA mimics or inhibitors. [score:2]
Direct influences on parasitic clearance were shown for (1) the proteins BNIP3 and CTSE, and (2) the miRNAs mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p. [score:2]
Furthermore, mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p were involved in parasite clearance from BMDM. [score:1]
[1 to 20 of 14 sentences]
31
[+] score: 48
Although expression of intragenic miR-9-1 is host gene-independent [9], we cannot exclude the possibility that the expression of miR-34b and miR-210 genes may also be coordinately controlled by regulatory mechanisms of their host genes. [score:6]
miR-210 is a hypoxia inducible gene which may inhibit cancer cell survival and proliferation through targeting FGFRL1 [60]. [score:5]
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
This help explain why a significant inverse methylation -expression relationship was not observed for miRNA-34b, miRNA-210, or miRNA-375 as the average proportion of methylated miR-34b, miR-210, or miR-375 in SM and GC samples was relatively low (2% ~ 15%). [score:3]
We further analyzed the miRNA levels of 20 pairs of fresh GC and SM samples and found a significantly higher expression level of miRNA-200b, miRNA-375, and miRNA-210 in SMs than in GCs (Paired t-test: Ps≤0.030; Additional file 1: Figure S12). [score:3]
We also observed methylation changes in miR-200b, miR-193b, miR-203, and miR-210 CpG islands in the development of GCs that has not been previously reported. [score:2]
These findings strongly suggest that methylation of these miR CpG islands is related to the development of GCs (trend-test, miR-9-1, P < 0.001; miR-9-3, P < 0.001; miR-34b, P = 0.008; miR-137, P < 0.001; miR-210, P = 0.001; Table 1). [score:2]
It has been reported that miR-210 may directly bind to vacuole membrane protein 1 (VMP1) and promote cancer metastasis [61]. [score:2]
Inversed relationship between miR methylation of CpG islands and their corresponding expression levelsTo investigate the relationship between the above aberrant miR methylation and the transcription of the corresponding miR gene, we quantified the mature miRNA levels of miR-9-1, miR-9-3, miR-34b, miR-137, miR-210, miR-200b, (and miR-375), whose methylation status is related to the development of GC (and GC host adaptation) as described above, in a set of human cell lines with different methylation status of miR CpG islands. [score:2]
Expression levels of miR-200b and miR-210 were determined using a standard polyA RT-PCR assay. [score:2]
According to the possible cause effect relationship between H. pylori infection and the development of GCs, miR-210 inactivation by DNA methylation may play a role in gastric carcinogenesis. [score:2]
miR-210 methylation correlated with H. pylori infection. [score:1]
DHPLC chromatogram of methylated and unmethylated miR-210 in various cell lines. [score:1]
Methylation frequency of 5 miR CpG islands (miR-9-1, miR-9-3, miR-137, miR-34b, and miR-210) gradually increased while the proportion of methylated miR-200b gradually decreased during gastric carcinogenesis (Ps < 0.01). [score:1]
We found that miR-210 methylation not only correlated with the severity of gastric pathogenesis, but also correlated with H. pylori infection. [score:1]
In the present study, we found that methylation or demethylation of all 7 tested miR CpG islands (GC-related miR-9-1, miR-34b, miR-9-3, miR-137, miR-210, miR-200b and host-related miR-375) was consistently, inversely correlated to a statistically significant level with their corresponding miRNA levels in a number of human cell lines in vitro. [score:1]
Similarly, higher miR-210 methylation was observed in GCs with distant metastasis than in GCs without distant metastasis (P = 0.048). [score:1]
As expected a significant difference in the positive rate or the proportion of methylated miR-9-3, miR-34b, miR-210, and miR-200b was not observed between GC and SM samples. [score:1]
miR-210 methylation showed high correlation with H. pylori infection. [score:1]
H. pylori -positive gastritis/normal and SM samples showed significantly higher methylation of miR-210 methylation than H. pylori -negative samples (P = 0.036 and 0.022, respectively; Figure 2A and B). [score:1]
Except for miR-9-1 and miR-137, the methylation positive rates or proportions of methylated miR-9-3, miR-34b, miR-210, and miR-200b in GCs were similar to those in SMs (Table 1). [score:1]
miR-210 methylation has been previously reported to be presented in glioma [62]. [score:1]
Such a relationship was not observed for miR-34b and miR-210 (Figure 3L, N). [score:1]
These results confirmed that miR-9-1 and miR-137 methylation was a tumor-specific event and that miR-9-3, miR-34b, and miR-210 methylation, as well as miR-200b demethylation, was a field-effect that occurred during gastric carcinogenesis. [score:1]
[1 to 20 of 25 sentences]
32
[+] score: 46
Fluorescence in situ hybridization (FISH) was conducted in an area containing at least 85% tumor in order to appropriately visualize the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b in FFPE tissues of GC patients (Fig. 4b), and these experiments provided consistent results concerning the miRNA levels that the five miRNAs were up-regulated in GC patients. [score:6]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b The putative target genes of the miRNAs were identified by miRanda, miRDB, miRWalk, RNA22, and Targetscan. [score:5]
Interestingly, miR-20a, miR-210, and miR-92b were significantly up-regulated in the arterial circulation which might suggest that circulating miR-20a, miR-210, and miR-92b could be absorbed and transmitted to distant body sites and participate in biological processes (including tumorigenesis, metastasis and other pathways). [score:4]
MiR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in GC tissues by qRT-PCR (a: 30 pairs of tumor and matched normal tissues) and FISH (b: pictures were selected from 10 pairs of GC tissues and matched normal tissues). [score:4]
Interestingly, in arterial plasma, miR-20a, miR-210 and miR-92b were significantly up-regulated while miR-185 was significantly decreased with a fold-change of 1.37, 2.35, 3.34 and 0.44, respectively (Supplementary Table S5 online). [score:4]
In the training and testing phases of our experiment, miR-185, miR-20a, miR-210, miR-25 and miR-92b were found to be significantly up-regulated in GC. [score:4]
When the results of two stages were combined, miR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in peripheral plasma of GC patients compared with NCs (Fig. 2). [score:3]
As shown in Fig. 4a, the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b was significantly higher in tumor than in normal tissues, and this correlation was consistent with results obtained from peripheral plasma. [score:3]
None of the five miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) from GC patients demonstrated a significantly different expression level in peripheral plasma exosomes as compared to controls (Supplementary Table S6 online). [score:2]
Meanwhile, based on The Cancer Genome Atlas (TCGA) data set, miR-210 was identified as a member of the pan-cancer oncogenic miRNA superfamily 34. [score:1]
High level of circulating miR-210 was found in pancreatic ductal adenocarcinoma 39, clear cell renal cell carcinoma 40 and adrenocortical tumors 41. [score:1]
In the larger cohort, 5 of 11 miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) were consistent with those in the training stage (Table 2; the other miRNAs were shown in the Supplementary Table S2 and Table S3 online). [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b; N: normal controls; T: tumor. [score:1]
MiR-210, as a typical hypoxia-related miRNA, was reportedly induced by a hypoxia inducible transcription factor (HIF) dependent mechanism 31 32. [score:1]
The areas under the curve (AUC) were 0.65 (95% confidence interval (CI): 0.57–0.72), 0.67 (95% CI: 0.61–0.74), 0.75 (95% CI: 0.68–0.82), 0.65 (95% CI: 0.58–0.73) and 0.69 (95% CI: 0.62–0.76) for miR-185, miR-20a, miR-210, miR-25 and miR-92b, respectively (Supplementary Figure S1 online). [score:1]
Recently, serum miR-210 was reported to be one of four serum miRNAs (miR-103, miR-107, miR-194 and miR-210) which could serve as biomarkers for the early detection of diffuse-type GC 33. [score:1]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b. [score:1]
Their results showed that the four miRNAs in our study (miR-25, miR-20a, miR-185 and miR-210) were co-purified with the Ago2 ribonucleoprotein complex other than exosomes in plasma while the form of miR-92b was undefined in the circulation. [score:1]
The mechanism of miR-210 in GC has not been explicitly reported, but it may promote growth and metastasis in various other cancer types, serving as a negative prognostic factor 35. [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b. [score:1]
[1 to 20 of 20 sentences]
33
[+] score: 45
miR-150 was the most down-regulated miRNA in the T vs N comparison; miR-10b was significantly down-regulated in all three contrasts; miR-122 and miR-146a were differentially expressed in the M vs T comparison; and miR-210 was up-regulated in the M vs T and M vs N comparisons. [score:12]
miR-100 and mir-99a, both putative tumor suppressors, were under- expressed in T vs N and over-expressed in M vs T. Identification of DEM confirmed that more miRNAs are modulated in T vs N than in M vs T comparison; however, DEMs in metastasis compared with primary tumors may be of great importance, since they include miR-10b, miR-210 and miR-708, which are key regulators of several processes related to disease progression, such as DNA repair, angiogenesis, hypoxia, EMT induction, and cancer recognition by the immune system [16- 18]. [score:9]
miR-100 and mir-99a, both putative tumor suppressors, were under- expressed in T vs N and over-expressed in M vs T. Identification of DEM confirmed that more miRNAs are modulated in T vs N than in M vs T comparison; however, DEMs in metastasis compared with primary tumors may be of great importance, since they include miR-10b, miR-210 and miR-708, which are key regulators of several processes related to disease progression, such as DNA repair, angiogenesis, hypoxia, EMT induction, and cancer recognition by the immune system [16- 18]. [score:9]
We quantified three down-regulated (miR-150, miR-10b, miR-146a) and two up-regulated miRNA (miR-210 and miR-122). [score:7]
While only few mRNAs were found to be differentially expressed between primary colorectal carcinoma and liver metastases, miRNA expression profiles can classify primary tumors and metastases well, including differential expression of miR-10b, miR-210 and miR-708. [score:7]
To confirm array data for miR-150, miR-146a, miR-10b, miR-122 and miR-210 and to validate miR-145/c-Myc and miR-182/ENTPD5 relationships, we conducted qRT- PCR experiments, as previously described [52]. [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 44
Increased miR-210 directly repressed GPD1L protein expression through binding to 3′UTR of GPD1L gene and further repressed prolyl hydroxylases (PHDs) activity, subsequently promoting HIF-1α protein expression [46]. [score:6]
And GPD1L expression was negatively correlated with miR-210, which was experimentally validated and confirmed to regulate GPD1L levels through direct interaction with the mRNA 3′ UTR. [score:5]
The hub gene GPD1L was negatively correlated with hsa-miR-210 (r = −0.17, FDR = 7.91E-02), which was experimentally validated and confirmed that the predicted hsa-miR-210 binding site on GPD1L 3′ UTR is a bona fide target and that has-miR-210 regulated GPD1L protein levels through direct interaction with the mRNA 3′ UTR [46]. [score:5]
Third, interestingly, Kelly et al. identified the enzyme GPD1L as a novel regulator of HIF-1α stability and a direct target of miR-210 in its 3′ UTR [46]. [score:5]
Consistent with the above feedback loop activity, the present study showed that GPD1L was negatively correlated with miR-210 and consistently downregulated in obese subjects. [score:4]
miR-210 was regarded as “master miRNA” of hypoxic response as it has been found to be upregulated by hypoxia in virtually all cell types tested to date [54]. [score:4]
On the contrary, GPD1L was found to be upregulated in obese subjects in response to weight loss and maintenance induced by LCD, because during LCD the state of relative hypoxia was attenuated, resulting in the decreased miR-210 and subsequently the increased GPD1L. [score:4]
The present study linked the regulation of miR-210 on GPD1L, the biological importance of GPD1L in adipose tissue, obesity and insulin resistance with the hypoxia -induced feedback loop. [score:2]
Figure 5A potential mechanism of HFD -induced obesity based on hypoxia -induced feedback loop with miRNA-210 regulating GPD1L. [score:2]
As oxygen levels decreased (hypoxia), HIF-1α protein and transcriptional activity increased, triggering accumulation of miR-210. [score:1]
Based on the hypoxia -induced feedback loop, HFD induced a state of relative hypoxia, resulting in the accumulation of miR-210 and subsequently the decreased GPD1L. [score:1]
GeneGene-level p-value [a] GS GS p-value MM MM p-valueRank [b] miRNA r [c] p-value FDR GPD1L 2.67E-02 −0.23 1.06E-03 0.90 1.29E-71 1 hsa-miR-210 −0.17 7.37E-03 7.91E-02 CCDC50 2.12E-02 −0.20 4.68E-03 0.85 6.79E-58 2 hsa-miR-501-3p −0.19 3.93E-03 5.05E-02 NAALAD2 8.05E-03 −0.24 5.76E-04 0.85 1.47E-57 3 hsa-miR-140-3p −0.29 1.97E-05 7.98E-04 ALDH1L1 4.94E-03 −0.28 7.13E-05 0.85 3.15E-57 4 hsa-miR-342-5p −0.27 5.13E-05 1. 76E-03 ADH1B 3.14E-02 −0.27 8.82E-05 0.85 4.39E-56 5 — — — — ADH1A 5.00E-02 −0.26 1.83E-04 0.82 2.34E-50 6 hsa-miR-590-3p −0.09 1.06E-01 4.46E-01 PCCA 2.38E-02 −0.21 2.68E-03 0.82 3.87E-49 8 hsa-miR-301b −0.25 2.08E-04 5.42E-03 ORMDL3 3.87E-03 −0.29 3.04E-05 0.80 3.29E-45 9 hsa-miR-362-3p −0.20 2.12E-03 3.23E-02EPB41L4B [d] 7.42E-05 −0.29 3. 47E-05 0.67 2.63E-27 28 has-miR-3613-3p −0.11 6.46E-02 3.4E-01GS, gene significance; MM, module membership. [score:1]
However, together with the findings from four clinical studies with longitudinal weight-loss and weight-gain interventions, we were able to infer causal links among diet interventions, miR-210, gene GPD1L and weight change in the mechanism of HFD -induced obesity (Fig.   5), which was worthy of further validation by functional experiments. [score:1]
During HFD, the oxygen levels decreased (a state of relative hypoxia), HIF-1α protein and transcriptional activity increased, triggering accumulation of miR-210. [score:1]
This is possibly because in obese adipose tissue the increased stability of HIF-1α was caused by decreased GPD1L due to the accumulation of miR-210. [score:1]
Increased miR-210 caused decreased GPD1L protein and a further inactivation of the PHDs, resulting in increased HIF-1α protein. [score:1]
[1 to 20 of 16 sentences]
35
[+] score: 43
In the six studies based on the tissues from lung squamous carcinoma patients [24,26,29-31,33], nineteen deregulated miRNAs were consistently reported in at least two studies (8 up-regulated and 11 down-regulated) with miR-210 as the most frequent reported up-regulated miRNA (Table 5). [score:11]
Four up-regulated microRNAs (miR-210, miR-21, miR-31 and miR-182) and two down-regulated mcroiRNAs (miR-126 and miR-145) were consistently reported both in squamous carcinoma and adenocarcinoma -based subgroup analysis, with the other 14 microRNAs solely reported in one or the other subset. [score:7]
In conclusion, the top two most consistently reported up-regulated microRNAs were miR-210 and miR-21. [score:4]
Four up-regulated miRNAs (miR-210, miR-21. [score:4]
In conclusion, the top two most consistently reported up-regulated miRNAs were miR-210 and miR-21. [score:4]
In the subset of four studies about lung adenocarcinoma [20, 22, 30, 32], seven miRNAs were consistently reported, with miR-210 as the most frequent reported up-regulated miRNA (Table 6). [score:4]
In the panel of consistently reported up-regulated microRNAs, miR-210 was reported in nine studies and miR-21 was reported in seven studies. [score:4]
In the panel of consistently reported up-regulated miRNAs, miR-210 was reported in nine studies (average FC: 2.65) and miR-21 was reported in seven studies (average FC: 4.39). [score:4]
In the context of the inconsistent profiles between tissue -based and plasma -based result, however, some consistently reported miRNAs in tissue -based profiling studies, for example, a panel of miR-21, miR-210 and miR-486-5p, have been validated in plasma -based studies to confirm their diagnostic value in the diagnosis of lung cancer with solitary pulmonary nodules [39]. [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 42
hy926 cells Not shown HIF1A Angiogenesis[123] miR-200b HMVECs Downregulated upregulated ETS1 Angiogenesis hypoxia[135, 136] HUVECs KLF2 miR-210 HUVECs Upregulated EFNA3 Angiogenesis hypoxia[131, 132, 150] HIF3A miR-424 HUVECs, hMVECs, hBOECs and hMBECs Upregulated CUL2 Angiogenesis[137] HIF1A* miR-429 HUVECs Upregulated HIF1A Hypoxia[12, 109] HIF3A miR-433 HUVECs Downregulated HIF1A Proliferation and migration[138] miRNAs proven to directly bind HIF mRNAs are in bold, and indirect effects are marked with “*” ARNT aryl hydrocarbon receptor nuclear translocator, CUL2 cullin-2, EFNA3 ephrin A3, EGLN1 prolyl hydroxylase domain-containing protein 2 (PHD2), ETS1 ETS Proto-Oncogene 1, Transcription Factor, HIF1A hypoxia-inducible factor 1-alpha, HIF1AN hypoxia-inducible factor 1-alpha inhibitor, HIF3A hypoxia-inducible factor 3 alpha, KLF2 Kruppel-like factor 2 The miR-17 family includes miR-17, miR-18a/b miR-20a/b, miR-93 and miR-106a/b. [score:23]
Furthermore, recent studies in human chondrocytes [131] and hepatocellular carcinoma cells [132] confirmed that miR-210 directly targets the mRNA of HIF3A and suppresses this HIF protein expression. [score:8]
Overexpression of miR-210 in HUVECs enhances VEGFA and vascular endothelial growth factor receptor-2 (VEGFR2) expression and thereby promotes angiogenesis [130]. [score:5]
Conversely, HIF-1 promotes the expression of several hypoxamiRs including miR-210 [97], miR-146a [98], miR-145 [99], miR-382 [100], miR-191 [101], miR-363 [102], miR-421 [103] in tumor cells, miR-204 in neuronal cells [104], miR-30a and miR-21 in cardiomyocytes [105, 106], miR-687 in embryonic kidney cells [107], miR-155 in intestinal epithelial cells [108], and miR-429 [109] and miR-19a [110] in endothelial cells. [score:3]
Hence, miR-210 could contribute to the HIF switch between HIF-1/HIF-2 and HIF-3. During acute hypoxia, miR-210 levels are induced by HIF-1/HIF-2 to prevent HIF-3 accumulation, while during chronic hypoxia HIF-1/HIF-2 levels decline and lead to the reduction of miR-210 and subsequent HIF-3 signaling. [score:1]
The hypoxic changes in both miR-210 and miR-429 also provide a mechanistic explanation for HIF-3α accumulation during chronic hypoxia. [score:1]
miR-210 is the most consistently and significantly induced miRNA during hypoxia. [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 41
Other miRNAs from this paper: mmu-mir-132, hsa-mir-132, mmu-mir-210
normoxia (Supplementary Figure  IIIe), and observed a modest but significant upregulation following miR-210 inhibition in hypoxic APCs (p < 0.05 vs. [score:6]
Among the differentially expressed microRNAs, the Agilent array identified miR-210 to be strongly upregulated in human APCs exposed to hypoxia. [score:6]
However, the LEP gene and intracellular or secreted LEP protein expression were not affected by the miR-210 inhibition (Supplementary Figure  IIIb–d). [score:5]
Also, in hypothalamic neurons and NIH/3T3 reporter cells, miR-210 enhances LEP signalling by inhibiting the protein-tyrosine phosphatase PTP1B, which acts as a negative regulator through the dephosphorylation of the LEPR -associated Janus kinase 2 (JAK2) 25, 26. [score:4]
It should be pointed out that, in our study, miR-210 was upregulated by ~14 folds in APCs following induction of hypoxia, whereas, in Wu’s study, pre-miR-210 treatment increased the mature form of miR-210 by 124 fold [25]. [score:4]
Effective inhibition of miR-210 was confirmed by qPCR, either in normoxia or hypoxia (Supplementary Figure  IIIa). [score:3]
We next inhibited miR-210 in four human APC lines using a specific antago-miR. [score:3]
A study from Wu’s group showed that forced expression of miR-210 in HL-1 cardiomyocytes by transfection with a lentivirus carrying the miR-210 precursor stimulates the release of angiogenic factors, including Lep [25]. [score:3]
In addition, a recent investigation showed that forced miR-210 expression remarkably increases LEP secretion in murine HL-1 cardiomyocytes [25]. [score:1]
We found that miR-210 silencing does not affect the ability of hypoxic APCs to produce and release LEP. [score:1]
Our research provides important information regarding the putative interaction between LEP and miR-210. [score:1]
However, in human APCs, miR-210 is not responsible for modification of LEP secretion or signalling. [score:1]
This data was confirmed by qPCR analysis, showing a 14-fold increase in miR-210 levels after 48 h exposure to hypoxia (Supplementary Figure  IIIa). [score:1]
Hypoxia activates miR-210, which in other cell types activates LEP production and PTP1B -mediated dephosphorylation of pJAK2. [score:1]
Protein lysates from APC lines from miR210 inhibition experiments were tested by assay to investigate the regulation of pJAK2 Tyr 1007/1008 (Ray Biotech, Cambridge Bioscience). [score:1]
[1 to 20 of 15 sentences]
38
[+] score: 40
They observed that the inhibition of HIF-1α decreased the miR-210 expression and autophagy and that the silencing of miR-210 up-regulated BCL-2 expression. [score:10]
We should underline that some of these miRNAs (Table 3) are expressed in the 90% of the ES patients, such as the up-regulated miR-210 (11p15.5), Let-7a (9q22.32), Let-7e (19q13.41), miR-181b (1q32.1) and the down-regulated miR-1908 (11), miR-659 (22q13.1) and miR-937 (8q24.3). [score:9]
A more detailed representation of the up and down regulation of miRNAs is presented in Table 2. An interesting observation is that three of the four up-regulated miRNAs (miR-210, LET-7a, miR-181b) (Table 3) were also the most significant miRNAs, as shown in Table 2. The raw data of global miRNAs expression analysis is available at the Gene Expression Omnibus [15]. [score:9]
A more detailed representation of the up and down regulation of miRNAs is presented in Table 2. An interesting observation is that three of the four up-regulated miRNAs (miR-210, LET-7a, miR-181b) (Table 3) were also the most significant miRNAs, as shown in Table 2. The raw data of global miRNAs expression analysis is available at the Gene Expression Omnibus [15]. [score:9]
Sun Y et al. [39] demonstrated that HIF-1α and miR-210 showed a significant increase under hypoxic condition. [score:1]
Xie X. Wu W. Liang L. Han S. Chen T. Pan S. Xue M. Li S. Prognostic role of microRNA-210 in various carcinomas: A meta-analysis Int. [score:1]
Sun Y. Xing X. Liu Q. Wang Z. Xin Y. Zhang P. Hu C. Liu Y. Hypoxia -induced autophagy reduces radiosensitivity by the HIF-1α/miR-210/BCL-2 pathway in colon cancer cells Int. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 37
a Over -expression of miR-31 restores chemo-response by reducing stathmin expression; miR-101/stathmin pathway contributes to radioresistance in human NPC; down-regulation of miR-193b promotes migration and proliferation of tumor cells by targets stathmin; miR-223 regulates stathmin by JNK signaling pathway to regulate MPM cell motility; b up-regulation of miR193b reduces proliferation and migration by inhibiting stathmin and uPA; silencing of miR-210 promotes proliferation of cancerous cells; transfection of miR-142 and miR-223 decreases expression of stathmin and IGF-1R to inhibit proliferation of cancerous cells; c microrna-9 inhibits cell proliferation, vasculogenic mimicry and tumor growth through controlling stathmin expression; miR-101 suppresses autophagy via targets stathmin and down-regulation of miR-101 is linked to the increase of cellular proliferation and invasiveness. [score:32]
Stathmin is considered as a target of miR-210 and down-regulation of miR-210 increases the proliferation of gastric epithelial cells by activating stathmin [73]. [score:5]
[1 to 20 of 2 sentences]
40
[+] score: 37
Other miRNAs from this paper: hsa-mir-31
For example, when we demonstrated that miR-210 was highly expressed in cancer, infeasible comparison can be done between studies as no reference substance can be found in the existing included studies, such as a miRNA sharing the same expression in cancer patients and cancer-free individuals. [score:5]
Thus, unusual expression of hypoxia-inducible miR-210 may link to cancer, as hypoxia is a common feature of the neoplastic microenvironment [25]. [score:3]
Firstly, the mechanism of miR-210 abnormally expressed in cancer is not completely understood; more scientific and technological methods should be used in future basic research to provide better understanding of biological roles of miR-210 in cancer, hence lightening up the diagnostic value of miR-210. [score:3]
What is more, the sample size was too small in our study with only 3 studies focused on the miR-210 expression in cancer in Asian population and no study explored the miR-210 function in only African populations, which resulted in unavoidable limitations. [score:3]
The results all together indicated a relatively moderate diagnostic accuracy of miR-210 in distinguishing cancer patients and cancer-free individuals. [score:1]
Thus, we performed the present meta-analysis to summarize the overall accuracy of miR-210 in cancer detection and further identify its value in clinical use. [score:1]
Thus, 12 records related to miR-210 in cancer detection were finally included in the meta-analysis [5, 16– 18, 26– 28, 32– 36]. [score:1]
What is more, future research should focus on the combined usage of miR-210 with other miRNAs and make improvement in technic consensus such as data normalization. [score:1]
Not happening singly but in pairs, Anjuman et al. also found that single miR-210 test generated 0.77 accuracy in diagnosis of lung cancer, while the combined analysis of miR-210 and miR-31 had a better overall diagnostic performance with 0.83 [28]. [score:1]
For instance, we know that single miR-210 can cover a broad spectrum of cancers and the combination of miR-210 and other miRNAs may contribute to the accuracy improvement, but the combination way, as well as the unique group for specific cancer, needs to be further clarified. [score:1]
We conducted a literature research in database including PubMed, EMBASE, CNKI, Wan Fang library before August 6, 2014, in order to identify the relevant records about miR-210 in cancer. [score:1]
For instance, the improvement in diagnostic performance of miR-210 with sensitivity 0.84 and specificity 0.82 in the diagnosis of breast cancer was pronounced by Madhavan et al., which lightens the potential value of miR-210 with relatively better accuracy in supplement of the current screening tools [29]. [score:1]
Thus, due to the moderate accuracy, the application of miR-210 serving as a clinical biomarker still has a long way to go. [score:1]
For example, Anjuman et al. found that miR-210 were present in considerably higher levels in sputum of lung cancer patients than cancer-free individuals and yielded diagnostic accuracy of 0.77 in lung cancer detection [28]. [score:1]
However, the diagnostic accuracy of miR-210 was inconsistent in literature due to the inescapable limitation of single study. [score:1]
The pooled results in our study were sensitivity of 0.70 (95% CI: 0.62–0.78), specificity of 0.76 (95% CI: 0.70–0.81), and the AUC of 0.80 (95% CI: 0.70–0.83), indicating a moderate diagnostic efficiency of miR-210 in diagnosis of cancer. [score:1]
In addition, the cut-off values of miR-210 were varied in different studies and different cancers, which may result in the higher accuracy from lower cut-off value. [score:1]
As the results in our analysis, a single miR-210 in cancer detection may lack sensitivity and specificity, but there are several areas we need to focus on in the future research in order to promote the usage of miR-210 in clinical treatment. [score:1]
Since Wang et al. firstly demonstrated the miR-210 might have a prediction value for pancreatic cancer with sensitivity 0.42 and specificity 0.73, more researches have been done to explore the possible clinical usage of miR-210 [16, 26– 28]. [score:1]
Recent studies suggested that hypoxic condition, which is a feature for solid tumor, may increase the level of miR-210 as miR-210 is related to the hypoxia-inducible factor- (HIF-) 1a and HIF-2a [41– 43]. [score:1]
MicroRNA-210 (miRNA-210, miR-210), a member of miRNAs, has been largely studied in the past several years and has been identified as a major induced miRNA under hypoxia [23, 24]. [score:1]
Among the 13 studies, 6 explore the association between miR-210 expression and lung cancer, 2 investigated that in breast cancer, and the other 5 focused on pancreatic cancer (n = 2), renal cancer (n = 2), and leukemia (n = 1). [score:1]
Thus, more fundamental research with long follow-up period should pay attention to the heterogeneity of miR-210 in cancer based on populations. [score:1]
Thus, the miR-210 may serve as a noninvasive biomarker to supply the existing diagnostic methods. [score:1]
Large efforts have been made to investigate the link between abnormal miRNA expression and cancer, including the miR-210, the most consistently hypoxia -induced miRNA [41]. [score:1]
In conclusion, the results in current meta-analysis showed that the application of miR-210 as the first-line screening tool in clinical treatment was immature due to lack of accuracy. [score:1]
The key words we used in the research were “cancer” or “tumor” or “neoplasm” or “malignancy” or “neoplasia” and “microRNA-210” or “miR-210” or “has-miR-210” and “sensitivity” or “specificity” or “ROC curve” or “accuracy. [score:1]
[1 to 20 of 27 sentences]
41
[+] score: 36
Other miRNAs from this paper: mmu-mir-210
By targeting, both directly and indirectly, several components of the oxidative phosphorylation mitochondrial machinery, miR-210 expression impacts on metabolism, contributing to the switch towards glycolysis observed in hypoxia [11]. [score:7]
According with a pro-angiogenic role of miR-210, tissue perfusion and capillary density in mouse ischemic hindlimbs are both increased by the injection of CD34+ umbilical cord blood cells expressing miR-210 [16] and miR-210 overexpression induces angiogenesis in the normal adult mouse brain [17]. [score:5]
Moreover, miR-210 expression in normoxic endothelial cells stimulates the formation of capillary-like structures, and VEGF -driven cell migration, at least in part, by targeting ephrin-A3 (EFNA3) adhesion molecule [12]. [score:5]
The present study provides a possible key of interpretation for the above discrepancies, as HIF-1 targets behaved differently as classifiers, with GLUT-1, ALDO-C, and VEGF-A being lower and miR-210 higher in the global population of LLIs. [score:3]
Few HIF-1ɑ targets were selected as an example of the multiple cell function controlled by this transcription factor, i. e. angiogenesis and survival (ADM, VEGF-A and miR-210), glucose metabolism (ALDO-C, GLUT-1), migration (CXCR4), and cellular homeostasis (AK3). [score:3]
Additionally, miR-210 expressing cells display increased angiogenic factor signaling [13- 15]. [score:3]
ALDO-C and miR-210 were similarly distributed between the healthy and non-healthy LLIs, making these factors promising candidates for life-span, but not for health-span determination. [score:1]
0.86 (0.23-5.89) p=0.003) whereas miR-210 was increased (median (range): 2.13 (0.02-98.64) vs. [score:1]
Very interesting is also the association of increased miR-210 levels with LLI. [score:1]
However, miR-210 impact on mitochondrial metabolism and reactive oxygen species production might also be important [11]. [score:1]
In particular, we and others identified miR-210 as a master “hypoxamiR” modulating cell metabolism and survival as well as angiogenesis [10]. [score:1]
Further investigations are granted to confirm the potential of HIF targets and miR-210 to discriminate between LLIs and controls and between healthy versus non-healthy LLIs. [score:1]
RNA expression levels of BPIFB4 and components of the ischemia-responding HIF-1ɑ pathway (namely CXCR4, AK3, ALDO-C, ADM, VEGF-A, GLUT-1 and miR-210) were measured in peripheral blood circulating MNCs. [score:1]
Figure 1 Box plots of the mRNA levels (log2 scale) of BPIFB4 and HIF-1ɑ -associated factors (CXCR4, ALDO-C, ADM, miR-210, VEGF-A, GLUT-1, AK3) in LLIs (N=45) versus controls (N=63). [score:1]
Box plots of the mRNA levels (log2 scale) of BPIFB4 and HIF-1ɑ -associated factors (CXCR4, ALDO-C, ADM, miR-210, VEGF-A, GLUT-1, AK3) in LLIs (N=45) versus controls (N=63). [score:1]
One can speculate that this might be related to the cell migration stimulatory function of miR-210 [29] [12]. [score:1]
[1 to 20 of 16 sentences]
42
[+] score: 36
miR-210, a hypoxia-inducible miRNA, inhibited apoptosis of HPASMC cells in hypoxia by downregulating E2F3 [58]. [score:6]
It has been reported that miR-210 expression in pancreatic cancer (PC) cells was induced by hypoxia through a HIF-1α -dependent pathway, and E2F3 was identified as its potential target [56]. [score:5]
Also, E2F3 was confirmed to be down-regulated upon induction of miR-210 in ovarian cancer and miR-210 linked hypoxia with regulation of cell cycle and played a crucial role in ovarian cancer onset [57]. [score:5]
In a recent research, tissue inhibitor of metalloproteinases-1 (TIMP-1) was reported to lead to a pro-tumourigenic increase of miR-210 in lung adenocarcinoma cells along with their exosomes and E2F3, a downstream target of miR-210, was decreased in the presence of TIMP-1 [59]. [score:5]
Gene copy aberrations of the miR-210 locus were very frequent in ovarian cancer, and its reduction could induce deregulation of the hypoxia response by targeting E2F3, which in turn promoted tumor development [57]. [score:5]
Downstream targets of miR-210, namely FGFRL1, E2F3, VMP-1, RAD52 and SDHD, were declined in the presence of TIMP-1. It was finally identified that TIMP-1 -induced PI3K/AKT/HIF-1/miR-210/EphA3 signaling displayed pro-angiogenic properties [59]. [score:3]
Interestingly, miR-210 was reported to exert its anti-apoptotic effects of human pulmonary artery smooth muscle cell (HPASMC) by targeting E2F3 [58]. [score:3]
The miR-210 gene, located at the tip of the short arm of chromosome 11, is found to be differentially expressed in different neoplasms and consistently stimulated under hypoxic conditions [55]. [score:3]
More interestingly, TIMP-1 was able to increase miR-210 in tumor cell and in exosomes by induction of PI3K/AKT/HIF-1 signaling, and this increase of miR-210 in exosomes displayed a pro-angiogenic effect in vitro. [score:1]
[1 to 20 of 9 sentences]
43
[+] score: 35
Huang X. Ding L. Bennewith K. L. Tong R. T. Welford S. M. Ang K. K. Story M. Le Q. T. Giaccia A. J. Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation Mol. [score:4]
In human breast cancer cells, the miR-210 -mediated repression of Iscu1/2 expression is also linked to the regulation of iron homeostasis via the modulation of Fe–S cluster assembly in IRP1 and through a miR-210 seed sequence in the 3′UTR of TfR that would, perhaps paradoxically, limit Tf -dependent iron uptake [48]. [score:4]
miRNA Target mRNA Reference(s) miR-Let-7d DMT (∆IRE), BACH1Andolfo et al. (2010) [42], Hou et al. (2012) [43] miR-122 HFE, HJVCastoldi et al. (2009) [44] miR-196 BACH1Hou et al. (2010) [45] miR-200b FTHShpyleva et al. (2009) [46] miR-210 ISCU, TFRChan et al. (2009) [47], Yoshioka et al. (2012) [48] miR-214 LactoferrinLiao et al. (2010) [49] miR-320 TFRSchaar et al. (2009) [50] miR-485-3p FPNSangokoya et al. (2013) [51] miR-584 Lactoferrin ReceptorLiao et al. (2010) [52] Whereas hepcidin is considered to be the primary means of regulating systemic iron homeostasis, a family of cytosolic RNA binding proteins known as Iron Regulatory Proteins (IRP) is considered to be the global regulators of cellular iron homeostasis. [score:4]
Utilization of iron is influenced directly by miR-210 which targets the Fe–S cluster assembly proteins Iscu1/2 thereby decreasing mitochondrial metabolism. [score:4]
Current evidence suggests that the hypoxia-inducible miR-210 targets Fe–S cluster biogenesis and assembly via the regulation of the iron-sulfur cluster scaffold proteins Iscu1/2 [47, 48]. [score:4]
The importance of miRNA similar to miR-210 and miR-320 in the regulation of iron metabolism in vivo and in non-cancerous cell lines remains to be established, though these findings may represent potential therapeutic targets for sequestering iron from cancerous and tumorigenic cell types. [score:4]
For example, overexpression of miR-210 decreases TfR protein abundance in MCF7 cells [48]. [score:3]
The effect of miR-210 -dependent repression of Iscu1/2 expression on cellular metabolism is discussed below, though the role of miR-210 on IRP1 function (e. g. [score:3]
Given the overlap between iron and/or oxygen sensing and maintenance of iron homeostasis, the potential for miR-210 to repress Fe–S cluster biogenesis, and thereby contribute to the regulation of IRP1 activity, remains of considerable interest. [score:2]
Interestingly, a hypoxia response element -binding site for HIF-1α was identified in the promoter of miR-210, a miRNA demonstrated to repress the Fe–S cluster assembly proteins Iscu1/2 [47, 75]. [score:1]
This relationship between HIF-1α and miR-210 extends the role through which HIF-1α coordinates cellular metabolism with oxygen availability. [score:1]
In fact, the miR-210 -dependent repression of Iscu1/2 is associated with a decline in mitochondrial energy production [47]. [score:1]
[1 to 20 of 12 sentences]
44
[+] score: 35
The upregulation of miR-21 and miR-210 and the downregulation of miR-486-5p correlate with the use of tobacco and with the size of pulmonary nodules. [score:7]
Nakada C. Tsukamoto Y. Matsuura K. Nguyen T. L. Hijiya N. Uchida T. Sato F. Mimata H. Seto M. Moriyama M. Overexpression of miR-210, a downstream target of HIF1α, causes centrosome amplification in renal carcinoma cells J. Pathol. [score:5]
In sputum samples, miR-31 and miR-210 are upregulated. [score:4]
Huang X. Ding L. Bennewith K. L. Tong R. T. Welford S. M. Ang K. K. Story M. Le Q. T. Giaccia A. J. Hypoxia-inducible miR-210 regulates normoxic gene expression involved in tumor initiation Mol. [score:4]
According to our findings, the upregulation of miR-210 is a non-invasive biomarker in serum samples [63] and sputum [64]. [score:4]
Further, heavy smokers experience global repression of miRNA versus light smokers; three of these miRNAs are differentially expressed (miR-146b-3p, miR-150, and miR-210), as validated in a second set of alveolar macrophage samples [79]. [score:3]
The increased expression of miR-210 is also detected in a variety of other tumors and correlates with advanced breast and oral cancers [117, 118]. [score:3]
miR-146b-3p, miR-150, and miR-210 are downregulated in alveolar macrophages of smokers compared with nonsmokers. [score:3]
In the literature, miR-210 is associated with tumorigenesis and hypoxia pathways [119, 120]. [score:1]
According to the studies addressed in this review, the major miRNAs associated with tobacco and alcohol are miR-21, miR-34a, miR-34c [30, 97, 98, 109], miR-223 [12, 70], miR-375, and miR-210 [63, 64], which are involved in many signaling pathways, such as proliferation [52], transformation [9, 13], inflammation [9, 13], angiogenesis [13], apoptosis, and the cell cycle [12, 30, 70, 71, 98, 109]. [score:1]
[1 to 20 of 10 sentences]
45
[+] score: 35
In silico target identification for selected isomiRsWe selected the three most highly expressed isomiRs of two miRNAs (miR-210 and miR-285) for in silico target identification assays. [score:6]
Due to the importance of the seed region in all target prediction algorithms, isomiRs with 5′ end modification in both selected miRNAs (Fig. 9E) contained the highest number of unique potential target genes (63 and 42 genes for miR-210 and miR-285, respectively). [score:5]
In the case of miR-210, although a similar number of highly confident predicted target genes were predicted for all the three isomiRs, there were only a fraction of these (24 genes), which overlapped with each other as well as the mature miRNA sequence whose total potential targets were notably fewer (Fig. 9C). [score:5]
To compare the specificity of different isomiRs of two selected miRNAs (miR-210 and miR-285) on target regulation, we generated potential binding sites on all annotated Ae. [score:4]
Likewise, alteration in isomiR production ratio was detected for 3′ multiple nucleotide addition (3MNA) isomiRs in miR-210-3p, miR-2b-3p and miR-34-5p, which showed significant down-regulation in DENV infected mosquitoes (Fig. 3A). [score:4]
We selected the three most highly expressed isomiRs of two miRNAs (miR-210 and miR-285) for in silico target identification assays. [score:4]
The Venn diagrams presented in (C, D) represent a subset of shared potential target genes for miR-210 and miR-285, respectively. [score:3]
However 3MNE isomiR production rate considerably decreased for miR-210-3p in DENV infected samples. [score:1]
A similar effect was seen for 3′ single nucleotide addition (3SNA) for miR-210-3p, but an opposing effect for miR-34-5p (Fig. 3B). [score:1]
DENV infection significantly increased the isomiR production rate of miRNAs miR-2c, miR-210 and miR-34. [score:1]
3MNE and 3MNA isomiRs of miR-210-3p proved to be more highly abundant in DENV-infected mosquitoes in comparison with other miRNAs in the 3′ modification class of isomiRs. [score:1]
[1 to 20 of 11 sentences]
46
[+] score: 33
, High Wycombe, UK) analysis of 1733 human microRNAs and validation by qRT-PCR showed microRNA-21, microRNA-99a, microRNA-100, microRNA-125b, microRNA-138, microRNA-147b, microRNA-148a, microRNA-210, microRNA-376a, and microRNA-455-3p to be significantly upregulated, whereas microRNA-31-star, microRNA-330-3p, microRNA-330-5p, microRNA-378d, microRNA-422a, and microRNA-486-5p were significantly downregulated. [score:7]
MicroRNA-21 (p = 4.3817E-07), microRNA-31 (p = 0.0003), microRNA-99a (p = 0.0406), microRNA-100 (p = 4.0492E-08), microRNA-125b (p = 0.0001), microRNA-138 (p = 0.0301), microRNA-147b (p = 0.0028), and microRNA-210 expression (p = 0.0044) were significantly upregulated in PDAC stage II vs. [score:6]
p < 0.05 indicates significance Kaplan-Meier survival analysis revealed significantly improved overall survival and recurrence-free survival rates in PDAC patients with low expression of microRNA-21 (cutoff 4.7; p = 0.0181; p = 0.0149), microRNA-99a (cutoff 2.5; p = 0.0325; p = 0.1711), microRNA-100 (cutoff 5.0; p = 0.0004; p = 0.0111), microRNA-125b (cutoff 1.6; p = 0.0491; p = 0.0373), and microRNA-210 (cutoff 4.6; p = 0.0161; p = 0.0116) in the adjuvant setting (Fig.   4). [score:3]
After normalization to benign noninflammatory controls (n = 13) by the ΔΔCt method, poor adjuvant gemcitabine mono-chemotherapy response was significantly related to overexpression of microRNA-21 (p = 0.0366), microRNA-99a (p = 0.0163), microRNA-100 (p = 0.0157), and microRNA-210 (p = 0.0252) (Fig.   3). [score:3]
Poor response to chemotherapy was significantly correlated to overexpression of microRNA-21 (p = 0.029), microRNA-99a (p = 0.037), microRNA-100 (p = 0.028), and microRNA-210 (p = 0.021) in tissue samples of PDAC patients UICC stage II. [score:3]
Fig. 3The 2 [-ΔΔCt] expression level of microRNA-21 (a), microRNA-99a (b), microRNA-100 (c), and microRNA-210 (d) in PDAC UICC stage II with good and bad response. [score:3]
In smaller clinical studies, microRNA-210 has been reported to be overexpressed in PDAC patients and associated with a worse outcome [24]. [score:3]
p < 0.05 indicates significanceKaplan-Meier survival analysis revealed significantly improved overall survival and recurrence-free survival rates in PDAC patients with low expression of microRNA-21 (cutoff 4.7; p = 0.0181; p = 0.0149), microRNA-99a (cutoff 2.5; p = 0.0325; p = 0.1711), microRNA-100 (cutoff 5.0; p = 0.0004; p = 0.0111), microRNA-125b (cutoff 1.6; p = 0.0491; p = 0.0373), and microRNA-210 (cutoff 4.6; p = 0.0161; p = 0.0116) in the adjuvant setting (Fig.   4). [score:3]
Univariate Cox regression overall and recurrence-free survival analyses identified microRNA-21 (p = 0.0231; p = 0.0211), microRNA-99a (p = 0.0393; p = 0.1864), microRNA-100 (p = 0.0013; p = 0.0163), microRNA-125b (p = 0.0578; p = 0.0472), and microRNA-210 (p = 0.0211; p = 0.0168) as unfavorable prognostic factors in resected and adjuvant -treated PDAC UICC stage II patients (Table  5). [score:1]
Fig. 4Prognostic impact of microRNA-21 (a, b), microRNA-99a (c, d), microRNA-100 (e, f), microRNA-125b (g, h), and microRNA-210 (i, j) on overall survival (right column) and recurrence-free survival (left column) in PDAC UICC stage II patients. [score:1]
[1 to 20 of 10 sentences]
47
[+] score: 32
Other miRNAs from this paper: hsa-mir-526b, hsa-mir-518b, hsa-mir-517a, hsa-mir-455
This raised our interest because miR210 expression is stimulated by hypoxia-inducible factors (HIF), 40, 41, 42 suggesting a potential hypoxia-related relationship between the three miRNAs we found to be differentially expressed in PE samples. [score:5]
Further validating the quality of our samples, we detected miR526B, miR518B, and miR517A, three representative miRNAs encoded in the placenta-specific C19MC, as well as miR210, an miRNA shown previously to be upregulated in placenta from PE patients 26, 27, 28 (Figure 2c). [score:4]
However, miR210 was significantly upregulated in placenta from PE patients (Figure 2e), consistent with previous reports. [score:4]
Intriguingly, miR210 is a well-known target of HIF2A 40, 42 and, thus, would be expected to be responsive to MUC1 regulation. [score:4]
Previous studies aimed at the identification of irregular expression of miRNAs in placenta from PE patients revealed increased levels of miR210. [score:3]
Indeed, we observed decreased miR210 levels not only after knockdown of HIF2A but also upon knockdown of MUC1 (Figure 5b). [score:3]
Because MUC1 is repressed by miR455-3P, miR210 levels are thus kept in check indirectly by miR455-3P (Figure 5c). [score:2]
The above results are consistent with the miR210 and miR455 levels that we found to be negatively correlated in placenta samples from PE and control patients (Figures 2e and f) and suggest that MUC1 and HIF2A levels are higher in PE than in control samples. [score:1]
Besides miR210, we have identified miR455 as a further prognostic miRNA. [score:1]
Importantly, in contrast to elevated miR210 levels, miR455-3P and miR455-5P levels were significantly lower in PE placenta than in controls. [score:1]
26, 27, 28, 29, 30, 36, 37 Our results are consistent with these findings and thus validate miR210 as a robust biomarker for PE. [score:1]
Importantly, we also detected miR455-3P and miR455-5P, which were both more abundant than U6 snRNA and miR210 in the control RNA samples (Figure 2c). [score:1]
Prospective tests assessing miR210/miR455-3P and miR210/miR455-5P ratios may predict PE with high specificity (Supplementary Figure 5). [score:1]
On the contrary, miR210 was more abundant in PE samples. [score:1]
[1 to 20 of 14 sentences]
48
[+] score: 31
The up-regulation of miR-210, miR-21 and miR-155 as well as down-regulation of let-7i and miR-33a, were among those that were predicted to target mRNAs associated with transcriptional activity leading to enhanced cell proliferation, survival and migration as well as a decrease in growth arrest and apoptosis (Bruning et al., 2011; Clark et al., 2014). [score:9]
MiR-210 and miR-29a have been identified as positive regulators of osteocyte differentiation by inhibiting the TGF-beta/activin signaling pathway through the inhibition of the target gene AcvR1b in MSC (He et al., 2013). [score:8]
The miRNAs identified in this study that were up-regulated by hypoxia (miR-210, miR-29b) in young MSC and down-regulated (miR-196a, miR-148b) in aged MSC were shown to be involved in promoting osteocytes lineage differentiation. [score:7]
MiR-210 and miR-21 were reported to regulate cell proliferation by targeting fibroblast growth factor receptor-like 1 (FGFRL1) (Table 5) (Huang, Le & Giaccia, 2010; Tsuchiya et al., 2011). [score:4]
In our studies, a similar trend could be observed where miR-210 was predicted to target the putative gene TGF-beta that might be involved in promoting osteogenesis and adipogenesis in young MSC. [score:3]
[1 to 20 of 5 sentences]
49
[+] score: 31
By targeting several transcripts, miR-210 regulates multiple aspects of cellular response to hypoxia such as inhibiting apoptosis (Fasanaro et al., 2008; Zaccagnini et al., 2014), promoting the shift from mitochondria respiration to glycolysis (Chan et al., 2009) and inducing angiogenesis (Fasanaro et al., 2008; Alaiti et al., 2012). [score:6]
miR-21, miR-146a, and miR-210 regulate multiple functions relevant to cardiovascular diseases and exercise. [score:4]
Up-regulation of miR-210 by vascular endothelial growth factor in ex vivo expanded CD34+ cells enhances cell -mediated angiogenesis. [score:4]
We determined the expression of angiogenesis-related miRNAs (miR-20a, miR-126, miR-210, miR-221, miR-222, miR-328; Dews et al., 2006; Poliseno et al., 2006; Kuehbacher et al., 2007; Fasanaro et al., 2008; Soeki et al., 2016), inflammation-related miRNAs (miR-21, miR-146a, miR-155; Taganov et al., 2006; Urbich et al., 2008; Wang et al., 2017) and cardiac or muscle-specific/enriched miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-378, miR-486, miR-499, miR-940; Chen et al., 2006; Soci et al., 2016; Xu et al., 2016). [score:3]
MicroRNA-210 as a novel therapy for treatment of ischemic heart disease. [score:2]
MicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3. [score:2]
Then we analyzed the correlations of miR-21, miR-146a, miR-210, and miR-221 changes after acute exercise with biochemical indexes. [score:1]
Figure 3Correlation analysis between the changes of miR-21 (A), miR-146a (B), miR-210 (C) and miR-221 (D) following acute exercise and cardiac function (EF%), exercise capacity (AT VO [2], peak VO [2], and peak work load) at baseline. [score:1]
Hypoxia -induced miR-210 modulates tissue response to acute peripheral ischemia. [score:1]
Circulating miR-208b was decreased and miR-221 was increased after long-term exercise, while circulating miR-221, miR-21, miR-146a, and miR-210 were decreased response to acute exercise. [score:1]
Here we correlated the decrease of miR-21, miR-146a, miR-210, and miR-221 after acute exercise with the cardiac function and exercise capacities at baseline, however, no robust correlations were found (Figure 3). [score:1]
Our study, for the first time, showed that miR-146a, miR-21, miR-221, and miR-210 were decreased in response to acute exercise in basketball athletes. [score:1]
Thus, the decrease of miR-21 and miR-210 in present study may reflect the initial cellular response to hypoxia after acute exercise, such as increased cell apoptosis and enhanced mitochondrial metabolism. [score:1]
The results showed that long-term exercise training significantly decreased serum miR-208b and increased miR-221, while acute exercise decreased circulating miR-221, miR-21, miR-146a, and miR-210 (Figure 2). [score:1]
Circulating mir-208b was decreased and mir-221 was increased after long-term exercise training, while circulating mir-221, mir-21, mir-146a, and mir-210 were decreased post-acute exercise. [score:1]
miR-210 has been found induced by hypoxia in a variety of ischemic conditions and tissues (Bostjancic et al., 2009; Biswas et al., 2010; Hu et al., 2010). [score:1]
[1 to 20 of 16 sentences]
50
[+] score: 30
We suggest that under acquired chemoresistance, accumulation of mutant p53 induces expression of miR-21-5p, miR-31*, miR-125b-5p, miR-210-3p, miR-330-3p, miR-378a-3p, miR-422a and miR-486-5p which in turn enhances proliferation by upregulating Bcl-2 expression in PDAC cells. [score:8]
MiR-screening revealed significantly upregulated (miR-21, miR-99a, miR-100, miR-125b, miR-138, miR-210) and downregulated miRs (miR-31*, miR-330, miR-378) in chemoresistant PDAC (p<0.05). [score:7]
In MIA-PaCa-2-GR cell clones miR-125b, miR-210, miR-21, miR-100, miR-148a, miR-99a and miR-455-3p were significantly upregulated, whereas miR-330-3p, miR-330-5p, miR-486-5p, miR-422a and miR-31-star were significantly downregulated (Fig 6B). [score:7]
In smaller clinical studies, miR-210 has been reported to be overexpressed in PDAC patients, correlating with a worse outcome [16]. [score:3]
Interestingly, most of our chemoresistance-specific miRs (miR-21-5p, miR-100-5p, miR-125b-5p, miR-210-3p, miR-330-3p, miR-378a-3p, miR-486-5p) are predicted by IPA to be regulated by TP53 gene (Fig 10). [score:2]
MiR-21-5p, miR-100-5p, miR-125b-5p, miR-210-3p, miR-330-3p, miR-378a-3p, and miR-486-5p are predicted by IPA to be regulated by TP53 gene. [score:2]
Some of these miRs, such as miR-21, miR-99a, miR-100, and miR-210 are already known as potential oncogenes (oncomiRs) in PDAC. [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 29
In the present study, miR-210 expression was less stimulated by FvFcR than OKT3; as such, the recombinant antibody had less of an effect on this negative regulator of FOXP3 expression relative to the mAb. [score:6]
a miR-155, b miR-21, c miR-146a, d miR-210, e miR-17, f miR-590-5p, g miR-106b, h miR-301a miR-155 was consistently overexpressed following both antibody treatments: OKT3 seemed to induce stronger expression than FvFcR (Fig.   2a). [score:5]
a miR-155, b miR-21, c miR-146a, d miR-210, e miR-17, f miR-590-5p, g miR-106b, h miR-301a miR-155 was consistently overexpressed following both antibody treatments: OKT3 seemed to induce stronger expression than FvFcR (Fig.   2a). [score:5]
miR-210 appears to bind to two targeting sites in the FOXP3 mRNA 3′UTR to regulate human Treg differentiation [36]. [score:4]
Eight of the tested miRNAs (miR-155, miR-21, miR-146a, miR-210, miR-17, miR-590-5p, miR-106b and miR-301a) were statistically significantly up- or down-regulated relative to untreated cells. [score:4]
The miR-210 expression profile was unique in exhibiting minimal variability between donors following FvFcR stimulation. [score:3]
FvFcR stimulated miR-210 less robustly than OKT3 (Fig.   2d). [score:1]
As they were the least variable, the CD3 [+] T cell expression profiles of eight distinct miRNAs, miR-155, miR-21, miR-146a, miR-210, miR-17, miR-590-5p, miR-106b and miR-301a, were further investigated (Fig.   2 and Additional file 1: Table S5). [score:1]
[1 to 20 of 8 sentences]
52
[+] score: 28
[19] miR-210, a known hypoxia-regulated miR, has been found to be upregulated in many cancers. [score:5]
We found that elevated levels of miR-27a/b, miR-210, and miR-454 expression were associated with shorter OS, while the levels of miR-454 and miR-374a/b expression were associated with DFS. [score:5]
The results of this study showed that lower expression of miR-155 predicted worse OS in TNBC patients, while elevated levels of miR-21, miR-27a/b, miR-210, and miR-454 expression were associated with shorter overall survival times. [score:5]
The fixed-effects mo del revealed that elevated miR-210 expression was predictive of shorter OS (crude HR: 2.41; 95% CI: 1.15–5.08) (Fig. 6). [score:3]
3.7Two studies determined the association between miR-210 expression and prognosis in TNBC (n = 107), of which 1 provided OS data[14] and 1 provided OS and DFS data. [score:3]
Two studies determined the association between miR-210 expression and prognosis in TNBC (n = 107), of which 1 provided OS data[14] and 1 provided OS and DFS data. [score:3]
miR-210 and TNBC prognosis. [score:1]
Figure 6 Forest plot of the HRs for the association between miR-210 and TNBC survival. [score:1]
Six miRs (miR-155, miR-21, miR-27a/b, miR-374a/b, miR-210, and miR-454) were assessed in the meta-analysis. [score:1]
Among these miRs, 6 (miR-155, miR-21, miR-27a/b, miR-374a/b, miR-210, and miR-454) were reported by at least 2 studies (Table 2). [score:1]
[1 to 20 of 10 sentences]
53
[+] score: 28
For instance, TUBG1 is inhibited by mir-152, STMN1 is inhibited by mir-210, LRRFIP2 and UNG are inhibited by mir-214, GCN1L1 is inhibited by mir-221, RPL37 is inhibited by mir-381, and PIGN is inhibited by mir-320a and mir-653. [score:13]
Additionally, STMN1 is inhibited by mir-210 (c [il] = −0.25071) and LRRFIP2 is inhibited by the mir-214 (c [il] = −0.48908). [score:5]
The specific core GEN of old men showed that STMN1 and LRRFIP2 are inhibited by mir-210 and mir-214, respectively, and DNA methylation of SMAD4 and LEF1, which may lead to dysregulation of the MAPK signaling and Wnt signaling pathways as well as deregulation of the cell cycle and apoptosis, thus resulting in cancer. [score:5]
Therefore, designing drugs to the DNA methylated genes, CTCF, CD27 and CCR7, or the genes inhibited by miRNAs, mir-210 and mir-214, STMN1 and LRRFIP2, may improve the male-specific aging process. [score:3]
We observed that there are two core miRNAs, mir-210 and mir-214, that regulate STMN1 and LRRFIP2, respectively which are involved in the MAPK and Wnt signaling pathways, respectively. [score:2]
[1 to 20 of 5 sentences]
54
[+] score: 25
MiR-203 leads to G1 phase cell cycle arrest in laryngeal carcinoma cells by directly targeting survivin and miR-210 targets antiapoptotic Bcl-2 expression and mediates hypoxia -induced neuroblastoma cell apoptosis [52]. [score:8]
We also found 4 miRNAs (miR-10a, miR-203, miR-210, and miR-449b) upregulated and 3 miRNAs downregulated (miR-134, miR-145, and miR-149) in both tDCs and aDCs. [score:7]
We observed that, at 24 h of maturation, 5 miRNAs (miR-10a, miR-203, miR-210, miR-30a, and miR-449b) were upregulated in both tDCs and aDCs compared with iDCs while 3 miRNAs (miR-134, miR-145, and miR-149) were downregulated. [score:6]
Upregulated miR-203, miR-210, and miR-449b play a role in cell cycle control and inducting apoptosis. [score:4]
[1 to 20 of 4 sentences]
55
[+] score: 24
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-203b
Intriguingly, both HERV-K and HERV-F expression were significantly associated with levels of hypoxia-related genes like HIF-1α mRNA expression (r [S] = 0.444; p = 3.0 × 10 [-6] and 0.359; p = 0.0002; respectively) or miR-210 expression (r [S] = 0.399; p = 0.001 and r [S] = 0.366; p = 0.002; respectively). [score:7]
Furthermore, as a secondary end point we analyzed the correlation of the mRNA expression of HERV-K and HERV-F with the RNA expression of known apoptosis-related [B-cell cll/lymphoma 2 (BCL2)] or hypoxia-related (miR-210, miR-199a, Hypoxia inducible factor 1a) genes as well as known epigenetically regulated genes (miR-203, H2A. [score:6]
HIF-1α is a key regulator of the hypoxic response, and miR-210 is the most prominent microRNA upregulated by hypoxia (Kulshreshtha et al., 2007). [score:5]
Expression analyses for BCL2 mRNA, miR-203 and miR-210 (Greither et al., 2012), HIF-1α mRNA (Kessler et al., 2010) and miR-199a (Keßler et al., 2016) were carried out as previously described. [score:3]
Intriguingly, we identified a significant association of the HERV-K and -F expression with those of the hypoxia-related genes HIF-1α and miR-210. [score:3]
[1 to 20 of 5 sentences]
56
[+] score: 24
Furthermore, it has been well documented that HIF-1 regulates miR-210 expression (38). [score:4]
McCormick R. I. Blick C. Ragoussis J. Schoe del J. Mole D. R. Young A. C. Selby P. J. Banks R. E. Harris A. L. miR-210 is a target of hypoxia-inducible factors 1 and 2 in renal cancer, regulates ISCU and correlates with good prognosisBr. [score:4]
In the present study, several miRs were found to be upregulated by hypoxia, including miR-210 (Figure 1) in gastric cancer cells (MKN1). [score:4]
Huang X. Ding L. Bennewith K. L. Tong R. T. Welford S. M. Ang K. K. Story M. Le Q. T. Giaccia A. J. Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiationMol. [score:4]
Hong L. Han Y. Zhang H. Zhao Q. Qiao Y. miR-210: a therapeutic target in cancerExpert Opin. [score:3]
The famous hypoxamiR, miR-210, targets various genes, including BNIP-3, an anti-apoptotic gene that increases cancer cell proliferation and survival (37). [score:3]
miR-210 is the most dominant angiomiR (26) and is induced by hypoxia (hypoxamiR) in a broad spectrum of cancer types (27). [score:1]
miR-210 has already been reported to be involved in various cellular responses in hypoxic cells and a pleiotrophic hypoxamir (17). [score:1]
[1 to 20 of 8 sentences]
57
[+] score: 23
Previously shown to be upregulated in PE [54], miR210 is known to downregulate the THSD7A gene [55]. [score:7]
Our PAS-Seq data also confirm upregulation of miR210 and downregulation of miR214 in PE [54]. [score:7]
Luo, R. et al. Hypoxia-inducible miR-210 contributes to preeclampsia via targeting thrombospondin type I domain containing 7A. [score:3]
Lee DC miR-210 Targets Iron-Sulfur Cluster Scaffold Homologue in Human Trophoblast Cell LinesAm. [score:3]
Pri-miRNAs exhibiting particularly high placental expression include the chromosome 14 and 19 miR clusters (C14MC and C19MC, respectively), the miR-371–3 cluster and the mir210 host gene (mir210HG) 50– 52. [score:3]
[1 to 20 of 5 sentences]
58
[+] score: 22
The mir-210 expression levels remained stable in the cells regardless of treatment group (Fig.   4b), most likely reflecting the cells endogenous mir-210 expression. [score:5]
Included on the array were also four well known miRNAs, which are wi dely expressed and relevant in placenta research; hsa-miR-141*, hsa-miR-210, hsa-miR-16 [49] and hsa-miR-222 [50]. [score:3]
The miRNAs belonging to the C19 miRNA cluster (C19MC) and the 371–373 cluster, as well as four commonly expressed miRNAs (mir-210; mir-222; mir-16; mir-141*) were analysed using a custom TaqMan® miRNA array card from Applied Biosystems (The full list of miRNA sequences are listed in Supplementary information  S2). [score:3]
Mir-210, mir-222 and mir-16, were expressed in all samples including the controls. [score:3]
Following miRNA array analysis, four miRNAs were selected based on changes in expression; mir-517c, mir-517a, mir-519a and mir-210. [score:3]
In the array analysis, there was significantly lower expression of mir-210 in the PE STBEV treated cells compared to cells treated with STBEVs from normal pregnancies (p = 0.022, Table  S3). [score:2]
This also suggests that the STBEVs contain very low levels of mir-210, consistent with previous studies showing that trophoblast cells release vesicles mainly containing C19MC miRNAs [25]. [score:1]
Based on the array results, four miRNAs (mir-517a, mir-517c, mir-519a and mir-210) were selected for further analysis using RTqPCR. [score:1]
The mir-210 (d) was present in controls cells and unaffected by STBEV treatment. [score:1]
[1 to 20 of 9 sentences]
59
[+] score: 21
Next, miR-221-3p and miR-210-3p mimics or inhibitors were transfected into MCF-7 and MDA-MB-468 cells to determine if they negatively regulate ADAMTS6 expression. [score:6]
No significant change in expression was observed between control and miR-210-3p mimic or inhibitor -transfected BC cells (Supplementary Figure S3). [score:5]
The results showed that miR-221-3p and miR-210-3p expression was inversely correlated to ADAMTS6 expression in most cell lines. [score:5]
MiR-221-3p/miR-210-3p mimic/negative control and inhibitor/negative control were purchased from GeneCopoeia (Rockville, MD). [score:3]
Based on the high predicted frequency, we chose 10 candidates (has-miR-144-3p, hsa-miR-18b-5p, hsa-miR-222-5p, hsa-miR-221-3p, hsa-miR-24-3p, hsa-miR-27a-5p, hsa-miR-27b-3p, hsa-miR-9-5p, hsa-miR-210-3p, hsa-miR-661) that promote BC development (confirmed from previous studies) [21– 30] for verification (Supplementary Figure S1). [score:2]
[1 to 20 of 5 sentences]
60
[+] score: 21
Likewise, miR-210 was recently shown to inhibit signaling by targeting NF-ΚB1/p50 [34]. [score:5]
On the other hand, miR-210 and miR-375 overexpression significantly inhibited TNF induced reporter activity by 8.1- and 14.3-fold (P ≤0.005, Figure 3B), respectively. [score:5]
miR-24, miR-125b and miR-210 are direct NF-κB targets and were hits in our screen [31- 33]. [score:4]
Next, we selected representative miRNAs for secondary screening: those that activated the reporter in the -TNF screen (miR-517a, miR-517c), inhibited the reporter in the +TNF screen (miR-210, miR-375), or activated the reporter in both screens (miR-483). [score:3]
Both of these findings are consistent with our screening data and suggest miR-125b and miR-210 are feedback regulators of NF-κB signaling. [score:2]
Surprisingly, miR-210 induced basal reporter activity by 6.4-fold (Figure 3A; P = 0.02). [score:1]
Interestingly, none of the validated hits from our +TNF secondary screen (miR-210, miR-375 or miR-483) were hits in the Keklikoglou et al. study. [score:1]
[1 to 20 of 7 sentences]
61
[+] score: 21
Although miR-210 overexpression or repression was not found to significantly modify CDK10 expression in two breast cancer cell lines [71], miR-210 may play an important role in controlling CDK10 expression in vivo. [score:7]
CDK10 transcripts were detected in miR-210-enriched RISC complexes in HEK-293 cells, and were found to be downregulated in HUVEC cells exposed to hypoxia, which strongly induces miR-210 expression [69]. [score:6]
Interestingly, miR-210 is overexpressed in lymph node- negative, estrogen receptor -positive breast cancers, and a correlation is observed between its expression level and the aggressiveness of the tumors [70]. [score:5]
Moreover, miR-210 expression appears to represent a good prognostic marker of the patients under tamoxifen treatment [71]. [score:3]
[1 to 20 of 4 sentences]
62
[+] score: 21
Tumorigenesis in CRC E-cadherin[41, 42] miR-135b HCC cell metastasis; CRC proliferation HSF1, MSH2[44, 45] miR-29b Apoptosis promotion Bcl-2 and Mcl-1, MMP-2[47, 48] miR-142-3p HCC and CRC proliferation RAC1, CD 133, Lgr 5, ABCG2[60, 62, 107] miR-210 HCC metastasis; overexpressed in CRC VMP1, CPEB2[51, 52] miR- 181a Oncogenic role in HCC; poor survival in patients with CRC CDX2, GATA6, NLK, EGFR[64, 65] miR- 224 Oncogenic role in HCC; prognostic marker in CRC SMAD4, API-5[49, 63]Previous studies indicated that miR-34a inhibits tumor growth, miR-21 promotes apoptosis resistance of tumor cells proliferation while the miR-200 family is strongly associated with the epithelial- mesenchymal transition (EMT) [18, 19]. [score:5]
Tumorigenesis in CRC E-cadherin[41, 42] miR-135b HCC cell metastasis; CRC proliferation HSF1, MSH2[44, 45] miR-29b Apoptosis promotion Bcl-2 and Mcl-1, MMP-2[47, 48] miR-142-3p HCC and CRC proliferation RAC1, CD 133, Lgr 5, ABCG2[60, 62, 107] miR-210 HCC metastasis; overexpressed in CRC VMP1, CPEB2[51, 52] miR- 181a Oncogenic role in HCC; poor survival in patients with CRC CDX2, GATA6, NLK, EGFR[64, 65] miR- 224 Oncogenic role in HCC; prognostic marker in CRC SMAD4, API-5[49, 63] Previous studies indicated that miR-34a inhibits tumor growth, miR-21 promotes apoptosis resistance of tumor cells proliferation while the miR-200 family is strongly associated with the epithelial- mesenchymal transition (EMT) [18, 19]. [score:5]
For instance, miR-210 and miR-155, which are overexpressed in HCC and CRC, promote the metastatic potential of HCC cells by targeting the vacuole membrane protein 1 (VMP1), in this way being an example of tumor- to- stroma communication (Figure 1) [39, 50, 51, 52]. [score:5]
We have revealed common small non-coding RNA molecules (miR-26a, miR-195, miR- miR-126, miR-122, miR-21, miR-155, miR-9, miR-135b, miR-29b, miR-142-3p, miR-210, miR-181, miR- 224) in HCC and CRC, which suppress the expression of multiple genes involved in tumor- stromal interactions, immune invasion and tumor angiogenesis. [score:5]
Additionally, it was shown that serum miRNA-210 could be a predictive biomarker for treatment response and prognosis in HCC patients [46]. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 21
For example, miRNA-205 increased NPC cells radioresistance by directly targeting PTEN [15], miRNA-221 and miRNA-222 regulated gastric carcinoma cells radioresistance by targeting PTEN [16], downregulation of miRNA-210 expression enhanced radiosensitivity in hypoxic human hepatoma cells [17], overexpression of miRNA-421 lead to a pronounced DSB repair defect and clinical hypersensitivity in SKX squamous cell carcinoma [18], silencing of miRNA-21 increased radiosensitivity through inhibiting a PI3K/AKT pathway and enhancing autophagy in malignant glioma cells [19], and upregulation of NF-κB -dependent miRNA-125b promoted cell survival by targeting p38α upon ultraviolet radiation [20]. [score:21]
[1 to 20 of 1 sentences]
64
[+] score: 20
[21]Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[21] Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[30] Three of the downregulated miRNAs (miR-148a, miR-181c and miR-210) are normally highly expressed during lactation in the mouse mammary gland. [score:6]
[1 to 20 of 3 sentences]
65
[+] score: 20
Similar to miRNA deregulation in AD, human lymphoblastoid cells up-regulate miR-34a and down-regulate miR-210 following arsenic treatment, as well as up-regulate miR-125b, -130, -145 and miR-181b under conditions of folate deficiency [187]. [score:11]
The up-regulation of miR-125b and down-regulation of miR-9 and miR-210 have been consistently reported in different studies on miRNA expression profiling of AD-affected brain (Table 2). [score:9]
[1 to 20 of 2 sentences]
66
[+] score: 19
Finally, miR-20b exemplified the miRNAs upregulated in HPV -positive tonsillar tumors and downregulated in HPV -negative tonsillar tumors, and miR-210 exemplified those upregulated in tonsillar tumors of either etiology (Additional file 12: Figure S6). [score:10]
Expression values of miR-210 and miR-20b differentially expressed in tonsillar tumors of both etiologies on miRNA arrays. [score:5]
The deregulated expression of the other miRNAs was confirmed (miR-9 in 100 %, miR-141 in 59 %, miR-200a in 87 %, miR-125b-2* in 89 %, miR-335 in 54 %, miR-221 in 67 %, miR-20b in 93 % of HPV -positive tumors and in 87 % of HPV -negative tumors, and miR-210 in 100 % of tumors of both etiologies). [score:4]
[1 to 20 of 3 sentences]
67
[+] score: 19
Furthermore, high levels of the oncogenic miR-210 were associated with disease recurrence and short overall survival in head and neck squamous cell carcinoma and this miRNA is also upregulated in CC [30, 141]. [score:6]
Recently, it has been reported that miR-210 directly targets MNT mRNA [76]. [score:4]
Since it is well documented that MYC promotes cell proliferation in cervical cancer and in squamous intraepithelial lesions of the uterine cervix [78], it is possible that miR-210 is involved in cervical carcinogenesis through the promotion of MYC overexpression. [score:3]
HPV16 positive SiHa and CaSki cell lines have shown an overexpression of miR-182, miR-183, and miR-210. [score:3]
miR-210 is located within the intron of a noncoding gene on human chromosome 11 and it is highly expressed in CC (Table 1) [30]. [score:3]
[1 to 20 of 5 sentences]
68
[+] score: 19
” iSimp tags the following syntactic constructs: (i) A conjunction in the form of a list of elements (“miR-21, miR-210, miR-155, and miR-196a”), (ii)  A conjunction (“proven or predicted”), (iii)  The appositive construct involving the two noun phrases “four miRNAs” and “miR-21, miR-210, miR-155, and miR-196a”, (iv)  The reduced relative clause “all implicated in the development of pancreatic cancer with either proven or predicted target genes”, which modifies the noun phrase “four miRNAs” (v) Another reduced relative clause “involved in critical cancer -associated cellular pathways”, which modifies the noun phrase “target genes” Using constructs (i) and (iii) we can replace “four miRNAs” by “miR-21” in the construct (iv) and thus generate “miR-21 is implicated in the development of pancreatic cancer …”. [score:7]
” iSimp tags the following syntactic constructs: (i) A conjunction in the form of a list of elements (“miR-21, miR-210, miR-155, and miR-196a”), (ii)  A conjunction (“proven or predicted”), (iii)  The appositive construct involving the two noun phrases “four miRNAs” and “miR-21, miR-210, miR-155, and miR-196a”, (iv)  The reduced relative clause “all implicated in the development of pancreatic cancer with either proven or predicted target genes”, which modifies the noun phrase “four miRNAs” (v) Another reduced relative clause “involved in critical cancer -associated cellular pathways”, which modifies the noun phrase “target genes” Using constructs (i) and (iii) we can replace “four miRNAs” by “miR-21” in the construct (iv) and thus generate “miR-21 is implicated in the development of pancreatic cancer …”. [score:7]
For example, consider the following sentence: We have profiled four miRNAs, miR-21, miR-210, miR-155, and miR-196a, all implicated in the development of pancreatic cancer with either proven or predicted target genes involved in critical cancer -associated cellular pathways. [score:4]
Additional simplifications are also generated for the remaining elements of the list (miR-210, miR-155, or miR-196a). [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 18
Compared to the corresponding normal tissue, miR-210 is significantly upregulated in most solid tumors [22– 25]. [score:3]
Clinically, enhanced expression of miR-210 is strongly associated with poor outcome and metastatic potential [25, 26]. [score:3]
Similar to miR-210, miR-373 promotes tumor invasion and metastasis, as demonstrated by its overexpression in the nonmigratory and nonmetastatic phenotype MCF7 cells, which enhanced cancer cell migration and invasion in vitro and in vivo [27]. [score:3]
More interestingly, under normoxic conditions, the expression levels of miR-210 are reduced in tumor-derived cell lines. [score:3]
Of these, miR-210 and miR-373 have been studied extensively as hypoxia-regulated miRNAs with a role in cancer [21]. [score:2]
One reasonable interpretation of this phenomenon suggests that the tumor hypoxic microenvironment may contribute to the high levels of miR-210 found in vivo. [score:1]
Thus, miR-373, similar to miR-210, is induced during hypoxia and acts as an oncogene, providing a link to hypoxia -induced tumor progression. [score:1]
Mechanistically, select miRNAs including miR-210, 155, 107, 21, 20a, 20b, 26, 27, 31, 373, and 495 may play a role in cancer under hypoxia conditions by acting as oncogenes [20]. [score:1]
Data from recent studies have indicated that miR-210, 30b, 93, and 181b were consistently induced in response to low oxygen with some notable similarities [13– 15]. [score:1]
[1 to 20 of 9 sentences]
70
[+] score: 17
The up-regulation of miR-210 indicated the qualified hypoxic conditions, and miR-584-5p expression also increased similarly, which suggested that miR-584-3p was being regulated at the transcriptional level (Figure 1E). [score:7]
The most highly up-regulated miRNA, miR-210, was identified as a novel miRNA marker of hypoxia (Figure 1A). [score:4]
Several recent reports have confirmed that numerous highly expressed miRNAs, such as miR-10b [27], miR-21 [44– 46], miR-210 [47], and miR-221/222 [18], are predictive of poor prognosis in glioma patients. [score:3]
The hypoxic miRNA marker miR-210 and the target miRNA miR-584-3p are indicated. [score:3]
[1 to 20 of 4 sentences]
71
[+] score: 17
Ultimately, according to the miRNAs’ fold change and expression level, five up-regulated miRNAs (miR-630, miR-222-5p, miR-210-3p, miR-34a-5p and miR-34b-5p) and two down-regulated miRNAs (miR-335-3p and miR-15b-3p) were chosen for microarray validation by RT-PCR (Table  1). [score:9]
b Quantitative real-time RT-PCR validation of five up-regulated and two down-regulated miRNAs (mean ± SD, n = 3) Table 1 Fold change of the seven selected miRNAs and their forward primer sequences used for RT-PCR miRNA Name Fold Change Forward Primer for RT-PCR miR-630 4.14 GCGAGTATTCTGTACCAGGGAAGGT miR-222-5p 3.84 CGCTCAGTAGCCAGTGTAGATCCT miR-210-3p 3.23 CTGTGCGTGTGACAGCGG miR-34a-5p 2.59 CTGGCAGTGTCTTAGCTGGTTGT miR-34b-5p 2.44 GCGTAGGCAGTGTCATTAGCTGATTG miR-335-3p 0.45 CGGCGTTTTTCATTATTGCTCCTGACC miR-15b-3p 0.33 CGGGCGAATCATTATTTGCTGCTCTA To identify the connections between the grading of nuclear opacity and expression levels of miRNAs, Pearson correlation coefficient was introduced (Fig.   3). [score:7]
However, for miR-222-5p, miR-210-3p, miR-34b-5p and miR-15b-3p, the relations were moderate (R = 0.436, 0.428, 0.398, 0.489) and statistically insignificant (P > 0.05). [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 17
By the end of the year 2010, miR-199a-3p and miR-210 were found to suppress HBsAg expression by directly targeting the HBV S protein coding region and pre-S1 region, respectively [37]; miR125a-5p was then shown to interfere with the viral translation, down -regulating the expression of the surface antigen [38], while miR-1 increases HBV transcription by upregulating farnesoid X receptor α (FXRA), a nuclear receptors binding to the HBV core promoter and regulating HBV transcription and replication. [score:17]
[1 to 20 of 1 sentences]
73
[+] score: 17
These include miR-210, which is also commonly identified as “hypoxia miR” is expressed in the heart and it increases under hypoxic conditions, including in cardiac myocytes[18– 21] and miR-24, which is upregulated in the myocardium and its endothelial cells, but downregulated in cardiac myocytes following the experimental induction of an ischemic event in mice[22, 23]. [score:9]
In ARCADIA, a selection of the aforementioned miRs (miR-1, miR-24, miR-133a, miR-133b, miR-210) together with the negative control (for cardiac expression) liver-specific-miR-122 were measured both in whole plasma and its exosomal fraction. [score:1]
The miR-210 exosome/whole plasma concentration ratio also increased (Fig 4D) at 24h post-CPB. [score:1]
miR-210: The Master Hypoxamir. [score:1]
Finally, the exosomal concentrations of miR-1, miR-133a, miR-24, miR-210 and miR-133b were strongly positively correlated with cTn-I (Fig 8). [score:1]
Cardiac-expressed (miR-1, miR-24, miR-133a/b, miR-208a/b, miR-210), non-cardiovascular (miR-122) and quality control miRs were measured in whole plasma and in plasma exosomes. [score:1]
We have found that after surgery, miR-24 and miR-210 were substantially enriched in the total pool of plasma exosomes. [score:1]
This suggests the possibility that after CABG miR-24 and miR-210 are predominantly released via exosomes, while miR-1 and miR-133 are released via exosomes and exosome-independent mechanisms in similar proportions. [score:1]
The concentration of total exosomes was positively correlated with the concentration of exosomal miR-1, miR-133a, miR-24, miR-210 and miR-133b (Fig 7). [score:1]
[1 to 20 of 9 sentences]
74
[+] score: 17
Several miRNAs were detected in cardiac tissue at different stages of development and are highly expressed in the fetal heart, including miR-212, miR-210 and miR-423 [41]. [score:4]
In addition, we selected six miRNAs (miR-328-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-874-5p and miR-93-5p) with low or moderate expression levels based on the array analysis and with known association with cardiac pathologies and its related process [26– 33]. [score:3]
The blue and orange lines indicate the two main clusters of samples To validate the data obtained from the miRNA microarray, RT-qPCR was performed to re-examine the expression level of nine miRNAs, namely miR-328-5p, miR-4750-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p. [score:3]
As for atrial myocardial samples from infants with CHDs, we found significantly different expression of six miRNAs (miR-210-5p with a P-value of 0.014, miR-423-3p with a P-value of 0.034, miR-143-3p with a P-value of 0.018, miR-564 with a P-value of 0.024, miR-770-5p with a P-value of 0.025, and miR-874-5p with a P-value of 0.040) between prior and after CPB (Fig.   4). [score:3]
Moreover, Huang et al. found that miR-210 is involved in cellular hypoxia, regulation of angiogenesis and apoptosis [36]. [score:2]
The significance of the differences in the expression was confirmed for seven miRNAs namely miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p) (P < 0.05) in the atrial myocardial samples from patients with CHDs after CPB compared to before CPB by RT-qPCR (Fig.   3). [score:2]
[1 to 20 of 6 sentences]
75
[+] score: 17
miR-210, miR-125a-5p, miR-424, miR-181a and miR-23b were most significantly up-regulated in hypoxia -treated HPASMC (Figure 5D), whereas miR-124, miR-888*, miR-541 and miR-223 were the most down-regulated miRNAs (Figure 5E). [score:7]
Three miRNAs (miR-21, miR-16 and miR-210) with different expression levels in the HEK293 cells were reverse transcribed into cDNAs with S-Poly(T), oligo(dT) or stem-loop RT primers, respectively. [score:2]
Only five miRNAs (miR-210, miR-665, miR-637, miR-183* and miR-516a-5p) showed >1.5-fold induction (Figure 5G). [score:1]
Hsa-miR-21 (A), hsa-miR-16 (B) and has-miR-210 (C) were amplified and detected with SYBR Green I followed by melting curve analysis. [score:1]
The LOD for miR-210 and miR-223 (a low abundant miRNA in HEK293 cells) in a qPCR reaction were 1.0 pg and 10.0 pg, respectively. [score:1]
To test if a simultaneous cDNA synthesis can be used for profiling of multiple miRNAs, we examined the expression of miR-199a-3p and miR-210 using the mixed cDNA samples prepared from the pooled RT primers (including 1, 5, 15, 30, 60, 90, 120, 180, 240, and 360 pre-mixed RT primers) in a single RT reaction. [score:1]
Consistent with previous reports [45], [46], miR-210 demonstrated the most pronounced increase induced by hypoxia in HPASMC. [score:1]
Similarly, the sensitivity with the S-Poly(T) method was increased 4.6/8.3 times and 35.5/91.1 time for miR-16 and miR-210, respectively, in comparison with the poly(A) and stem-loop methods. [score:1]
The amplification efficiency was 96% (miR-92a), 95% (miR-210), 91% (miR-16), 90% (miR-90), and 101% (miR-223), respectively, and the correlation coefficients (R [2]) for each miRNAs was >0.99. [score:1]
However, miR-210 was the only validated miRNA induced by hypoxia significantly (Figure 5H), as miR-665, miR-637, miR-183* and miR-516a-5p all resulted in non-specific amplification with the S-Poly(T) method (data not shown). [score:1]
[1 to 20 of 10 sentences]
76
[+] score: 16
In male samples, we found that miR-6878-3p (p =  0. 0823) down-regulated and miR-210-5p (p =  0. 2033) up-regulated similar to our array findings. [score:7]
Some of the miRNAs showing differential expression in OA, (such as miR-146a, miR-26a, and miR-210) had previously been associated with cartilage pathophysiology and other musculoskeletal diseases 36– 40. [score:5]
Real-time PCR validation showing change in miRNA expression in female samples [n = 9 (NON-OA) and n = 16–18 (OA)] (a) miR-16-2-3p (p = 0.085), (b) miR-6821-5p (p = 0.017), (c) miR-26a-5p (p = 0.01), and d) miR-146a-5p (p = 0.01830) and e) miR-210-5p (p = 0.2033) and f) miR-6878-3p (p = 0.0823) in male samples [n = 9 (NON-OA) and n = 15 (OA)]. [score:3]
Real-time PCR was performed on randomly selected miRNAs (miR-6878-3p, miR-210-5p, miR-16-2-3p,miR-26a-5p, miR-146a-5p and miR-6821-5p) to validate miRNA array data in age matched male (NON-OA, n = 9 and OA, n = 15) and female donor samples (NON-OA, n = 9 and OA, n = 16-18). [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 16
p53 and HIF-1 can induce the expression of specific microRNAs, such as miR-34a and miR-210, and further mediate the biological functions of microRNA targets which are involved in glycolysis process. [score:5]
Figure 4 p53 and HIF-1 can induce the expression of specific microRNAs, such as miR-34a and miR-210, and further mediate the biological functions of microRNA targets which are involved in glycolysis process. [score:5]
miR-210 disrupts mitochondrial respiration and inhibits glucose metabolism via TCA cycle, resulting in a metabolic shift from mitochondrial OXPHOS to glycolysis and accelerating the Warburg effect of cancer cells [90]. [score:3]
Additionally, miR-210 is a unique HIF-responsive “hypoxamir” that is evolutionarily conserved and ubiquitously expressed in hypoxic cells and tissues. [score:3]
[1 to 20 of 4 sentences]
78
[+] score: 15
Moreover, they demonstrated that miR-210 in BEC-derived EVs could be transferred into lung fibroblasts and inhibited ATG7 expression and induced myofibroblast differentiation (Fujita et al., 2015). [score:5]
miRNA(s) Source Donor cell Recipient cell Target gene Reference miRNA-210 Cell culture BEC Fibroblast ATG7Fujita et al., 2015 miRNA-191,miRNA-126, miR125a Cell culture EC MacrophagesSerban et al., 2016 miR-204 Mouse lung MSC Lung immune cells and immune cells STAT3 pathwayLee et al., 2012 miR-146a, miR-155 Cell culture DC Immune cellAlexander et al., 2015 BEC, bronchial epithelial cell; EC, endothelial cell; MSC, mesenchymal stem cell; DC, dendritic cell. [score:3]
Ong et al. reported that exosomes purified from cardiac endothelial cells overexpressing HIF-1 delivered miR-126 and miR-210 to recipient cardiac progenitor cells (CPCs). [score:3]
Furthermore, conclusive evidence of EV -mediated miRNA transfer and miRNA functioning as a modulator of intercellular crosstalk and COPD pathogenesis was reported by Fujita et al. They observed that the levels of miR-210 expression in both BECs and BEC-derived EVs were significantly increased after CSE exposure. [score:3]
The research indicated that CSE exposure changed the composition of BEC-derived EVs and recognized miR-210 as an autophagy factor in myofibroblast differentiation (Fujita et al., 2015). [score:1]
[1 to 20 of 5 sentences]
79
[+] score: 15
Such as miR-133b with a high expression in HC, the miR-133b/PPP2R2D signaling pathway affects the effectiveness of cDDP chemotherapy [69], upregulation of miR-133b shortens the latency of cervical carcinoma [55, 111], miR-133b is directly up-regulated by AR in androgen -dependent PCa [24], overexpression of miR-133b as VHL-specific miRNAs in pheochromocytoma and paraganglioma [112], Overexpression of miR-133b in less aggressive LNCaP cells boosted cell proliferation and cell-cycle progression [25] and have decreased survival in progression bladder cancer [79], compared to primary colorectal tumors, the cases with liver metastases demonstrated increased expression of miR-210 and miR-133b and associated with lower survival [113]. [score:15]
[1 to 20 of 1 sentences]
80
[+] score: 15
Other miRNAs from this paper: hsa-mir-101-1, hsa-mir-101-2, hsa-mir-424
It has been reported that hypoxia increases IPF fibroblast proliferation by inducing miR-210 expression, which in turn reduces the c-myc inhibitor MNT [11]. [score:5]
In one study, hypoxia was demonstrated to increase IPF fibroblast proliferation via miR-210 -mediated regulation of the c-Myc inhibitor MNT [11]. [score:4]
Hypoxia -induced increases in miR-210 level is in a HIF-2α -dependent fashion and appears early and persists through day 6. In the current study, we propose that hypoxia increases fibroblast proliferation by activating NFATc2 signaling via HIF-2α, which in turn regulates cell cycle protein expression. [score:4]
Bodempudi V miR-210 promotes IPF fibroblast proliferation in response to hypoxiaAm. [score:1]
It is conceivable that effects of HIF-2 on fibroblast proliferation may be mediated by several pathways - an early pathway through miR-210 and NFATc2 nuclear translocation and later effects involving NFATc2 transcriptional activity. [score:1]
[1 to 20 of 5 sentences]
81
[+] score: 15
Eight up-regulated miRNAs, including miR-19a-3p, miR-877-3p, miR-148a-3p, miR-212-5p, miR-1825, miR-210-3p, miR-940, and miR-134-5p, and two down-regulated miRNAs, miR-3609 and miR-145-5p, were identified as statistically significant different miRNAs. [score:7]
Reportedly, up-regulated miR-210 in the placenta has been associated with the pathogenesis of PE[3], and miR-1233 might be a potential biomarker of early PE[4]. [score:4]
MiR-210 is a hypoxia-inducible miRNA[15] and inhibits invasion of trophoblast cells[16]. [score:3]
Predictive value of miR-210 as a novel biomarker for pre-eclampsia: a systematic review protocol. [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 15
Specifically, the expression of miR-133a, associated with cardiomyogenic differentiation [50], was strongly up-regulated, together with the expression of miR-210 and mir-34a, involved in stem cell survival [51] and negative growth control [52], respectively. [score:8]
In particular, 20 microRNAs were up-regulated >2-fold (among which miR-133a, miR-34a, and miR-210) and 10 were down-regulated (such as miR-155). [score:7]
[1 to 20 of 2 sentences]
83
[+] score: 15
The five potential candidate miRNAs (hsa-miR-140-5p, hsa-miR-210, hsa-miR-362-5p, hsa-miR-590-3p, and hsa-miR-671-3p) may be important factors related to BSS in DM and can be used as biomarkers for diagnosis and drug targets for treating DM with BSS. [score:3]
ARFRP1, which was predicted as the target gene of miR-210, has been proved to play an important role in lipoprotein maturation in the liver by influencing lipidation and assembly of proteins to the lipid particles [43]. [score:3]
were chosen from GO annotations in which target genes were significantly enriched (−log [10](P-value) > 5), which included hsa-miR-140-5p, hsa-miR-210, hsa-miR-362-5p, hsa-miR-590-3p, and hsa-miR-671-3p. [score:3]
Their miRNAs were selected as the potential candidate miRNAs of BSS in DM, which were hsa-miR-140-5p, hsa-miR-210, hsa-miR-362-5p, hsa-miR-590-3p, and hsa-miR-671-3p (Table 4). [score:1]
miRNA PCR arrays in left ventricular specimens, which were collected from streptozotocin -induced diabetic mice, found a dysregulation of 316 out of 1008 total miRNAs compared with controls, and ingenuity pathway analysis revealed that miR-210 was implicated in myocardial signaling networks triggering oxidative stress [42]. [score:1]
59 (−1.21) −0.44 (−1.06) −0.25 (−0.87) −0.59 (−1.21) hsa-miR-192-5p −0.38 (−2.75) −0.34 (−2.71) −0.16 (−2.53) −0.15 (−2.51) hsa-miR-196a-3p −1.06 (−0.97) −0.68 (−0.59) −0.87 (−0.78) −0.54 (−0.45) hsa-miR-210 −0.54 (−0.3) −0.81 (−0.57) −0.77 (−0.53) −0.42 (−0.18) hsa-miR-22-3p −0. [score:1]
Another functional study indicated that modifications in the levels of miR-210 primarily resulted in increased β-cell apoptosis in diabetic mice [41]. [score:1]
A study in Zucker diabetic fatty rats (ZDF rats) revealed that miR-210 was found increased over the course of the diabetic progression [40]. [score:1]
Based on the analysis, it showed that five miRNAs were closely related to BSS in DM, including hsa-miR-140-5p, hsa-miR-210, hsa-miR-362-5p, hsa-miR-590-3p, and hsa-miR-671-3p. [score:1]
[1 to 20 of 9 sentences]
84
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
In contrast, the miRNAs up-regulated in the liver (miR-199-3p, miR-199-5p, miR-21, miR-214 and miR-210) showed significantly higher levels in mouse serum at 12 weeks post infection (Fig. 2), however these failed to differentiate S. mansoni infected from uninfected humans (Fig. S4). [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
The 5 host miRNAs were detectable in serum (miR-21, miR-199-3p, miR-199-5p, miR-210, miR-214) but showed variable abundance and failed to differentiate ‘egg -positive’ and ‘egg -negative’ participants (Fig. S4). [score:1]
[1 to 20 of 5 sentences]
85
[+] score: 14
On the other hand, hsa-miR-210 and let-7c are overexpressed in the saliva of patients diagnosed with pancreatitis, but could not be detected in the saliva of control patients (Table 4). [score:3]
Taken together, we demonstrate for the first time that salivary miRNA are indicative of pancreatic disease and can be used to diagnose unresectable PDAC (hsa-miR-21, hsa-miR-23a, hsa-miR-23b) or pancreatitis (hsa-miR-210). [score:3]
We found that hsa-miR-210 and let-7c are overexpressed in the saliva of patients with pancreatitis as compared to the control group, with sensitivity of 100% and 75%, and specificity of 100% and 80%, respectively. [score:2]
However, our study tends to indicate that hsa-miR-21, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with pancreatitis, while hsa-miR-210 is detected in the saliva of a fraction of patients with PDAC. [score:1]
Taken together, we demonstrate herein for the first time that salivary miRNA could be valuable biomarkers for distinguishing patients with unresectable PDAC from healthy controls, and that salivary miR-210 may help detect pancreatitis. [score:1]
On the other hand, hsa-miR-210 was detected in the saliva of patients with PDAC. [score:1]
In addition, hsa-miR-210 presents remarkable specificity and sensitivity for pancreatitis, either chronic or acute (100%, Table 3). [score:1]
On the other hand, Let-7c and hsa-miR-210 were absent in the saliva of control patients but readily detectable in the saliva of patients with pancreatitis, with exquisite specificity and selectivity (hsa-miR-210). [score:1]
In this pilot study, we found that four salivary miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c) successfully segregated PDAC patients from cancer-free donors, while hsa-miR-210 and let-7c indicate pancreatitis and hsa-miR-216 discriminates pancreatitis from cancer. [score:1]
[1 to 20 of 9 sentences]
86
[+] score: 14
Interestingly, a recent study by Fasanaro et al. reported that SMILE/TMTC3 mRNA is inversely modulated after miR-210 over -expression or inhibition [17]. [score:5]
One of the responses to hypoxia via miR-210 involves indirect targets implicated in amino acid catabolism [17]. [score:4]
Of note, miR-210 expression is induced by hypoxia, which was shown to induce UPR as a pro-survival mechanism in tumor cells [18]. [score:3]
Interestingly, membrane trafficking is one of the functions that is modified in response to miR-210 modulation and that could be set off by hypoxia, according to Fasanaro et al. [17]. [score:1]
Our results in proteolysis suggests that SMILE may be part of the response to hypoxia - and thus to ER stress - via miR-210 or not. [score:1]
[1 to 20 of 5 sentences]
87
[+] score: 14
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-221, hsa-mir-222
This study has determined that 197 of 217 genes are targeted and downregulated by only four of the miRNAs: miR-24, miR-210, miR-221, and miR-222 in which miR-24 was the most important because numerous target genes, represented in Tables 2 and 3, are controlled and regulated by miR-24. [score:9]
Moreover miR-210, miR-221, and miR-222 were significantly proficient to regulate more than one target gene which were associated with pancreatic cancer in this network. [score:4]
In addition, miR-24, miR-210, miR-221, and miR-222 are the most important among miRNAs. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 14
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
Of the up-regulated miRNAs (in the metastatic library), miR-210 has been reported to be up-regulated in prostate carcinomas relative to BPH samples [23] and miR-301 has been linked to prostate cancer metastasis [37]. [score:7]
[1 to 20 of 2 sentences]
89
[+] score: 13
In total, 65 microRNAs were identified to exhibit differential expression in either LHR expressing S KOV3 cells or LH -treated cells, a few of which have been found in the genomic fragile regions that are associated with abnormal deletion or amplification in cancer, such as miR-21, miR-101-1, miR-210 and miR-301a. [score:5]
In additional to those above, the most prominent and “hypoxia-responsive” miRNA, miR-210, was found to be unregulated by LH, which modulates the expression of genes promoting cell survival and tumor growth under hypoxic condition [46]. [score:4]
It should be noted that the S KOV3 cancer cells may have already undergone some copying abnormalities, such as the amplification of miR-21 and the loss of miR-210, which may contribute to the observed gene expression level in the control cancer cells. [score:3]
For example, the loss of 11p15 (covering miR-210) is found in ovarian cancer [31] and 17q23 (covering miR-301a and miR-21) is amplified in breast cancer [32], as well as those reported in [33], [34]. [score:1]
[1 to 20 of 4 sentences]
90
[+] score: 13
MicroRNA-210 regulates cancer cell proliferation through targeting fibroblast growth factor receptor-like 1 (FGFRL1). [score:3]
Notably, several of the miRNAs we found to be misexpressed in lgl mutant tissues have also been linked to human cancers, including let-7 (Boyerinas et al., 2010), miR-9a (Hildebrandt et al., 2010; Lehmann et al., 2008; Zhang et al., 2012) and miR-210 (Tsuchiya et al., 2011). [score:3]
For validation, the expression levels of let-7, miR-210 and miR-9a in Day 0 lgl mutant tissues were compared to controls using Real-Time PCR with small RNA U6 as a housekeeping gene (data not shown). [score:2]
Of these, a core set of 10 miRNAs was found to be consistently dysregulated across all time points: let-7, miR-210, miR-9a, miR-275, miR-1, miR-993, miR-100, miR-1004, miR-980 and miR-317 (Fig.  2E). [score:2]
Global microRNA expression profiling identifies MiR-210 associated with tumor proliferation, invasion and poor clinical outcome in breast cancer. [score:2]
Of the ten Drosophila miRNAs identified, let-7, miR-210, miR-1, miR-100, and miR-9a have homologues in humans as evidenced in miRBase (Griffiths-Jones et al., 2006). [score:1]
[1 to 20 of 6 sentences]
91
[+] score: 13
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, dme-mir-184, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-277, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-bantam, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-184, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-33b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-1000, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
Thus, it is striking that we see these same two forms of miR-210 expressed in mosquitoes. [score:3]
Only one copy of the miR-210 precursor is present in these insect genomes, therefore such differences cannot be attributed to processing from multiple pri-miRNAs. [score:1]
Furthermore, of the 19 reads aligning to miR-210 in the Ae. [score:1]
The numbers of reads with 3' or 5' nucleotide truncations or additions for individual miRNAs, B) miR-1, C) miR-210, and D) miR-252 are shown. [score:1]
Thus, these variations in the mature miRNA sequences, for both miR-252 and miR-210, do not appear to arise from differences in hairpin folding properties, and likely are a result of Drosha and/or Dicer processing. [score:1]
quinquefasciatus and Aedes miR-210, miR-252, and miR-2951 are examples of multiple, distinct miRNAs arising from one arm of a single hairpin (Figures 2 and 4). [score:1]
Interestingly, two dominant forms of miR-210, miR-210.1 and miR-210.2, one of which contains an extra 5' nucleotide, have been noted for D. melanogaster [18]. [score:1]
Due to variations in the 5' and 3' ends for the remaining 550 reads aligning to miR-210, the canonical 5' and 3' ends were actually represented by the second most frequently occurring sequence, which is annotated (Table 2). [score:1]
For miR-210, the most frequently occurring species was sequenced 301 times, while the second dominant species, one nucleotide longer with a cytosine at the 5' end, was sequenced 274 times. [score:1]
Our data provide strong evidence in support of the hypothesis that these two forms of miR-210 are evolutionarily conserved and are likely to function as at least partly distinct miRNAs in vivo. [score:1]
For both miR-210 and miR-252, two dominant miRNA species were identified (Figure 2C and 2D; Tables 1, 2). [score:1]
[1 to 20 of 11 sentences]
92
[+] score: 13
KSHV LANA has been shown to up-regulate hypoxia-inducible factor (HIF) [54], a direct inducer of miR-210 [55, 56], so the increase in miR-210 was predicted based on this mechanism. [score:5]
Also, while the change in miR-210 was not sufficient to meet our original P-value miRNA-Seq threshold, it was nonetheless found significantly up-regulated based on the Taqman assay. [score:3]
For miRNA expression, stem-loop qPCR was performed using TaqMan Universal master mix (Applied Biosystems) and the following microRNA assays: 000512 for miR-210-3p, 001274 for miR-410-3p, 002099 for miR-224-5p, 002331 for miR-409-5p, 002332 for miR-409-3p, 002341 for miR-708-5p, 002342 for miR-708-3p and 461775 for miR-3614-5p. [score:2]
All the changes are significant (P≤0.05) except that of miR-210 as detected by miRNA-Seq. [score:1]
We also examined the change in miR-210 by qRT-PCR. [score:1]
The levels of miR-210 by miRNA-Sequencing were slightly increased by KSHV infection, although the change did not achieve significance (P-value >0.05). [score:1]
[1 to 20 of 6 sentences]
93
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Transfection of miR-210 mimics into 3T3-L1 cells promoted the expression of adipogenic markers and adipocyte differentiation by targeting SHIP1, a negative regulator of the PI3K/Akt pathway. [score:6]
Additionally, ectopic inhibition of the endogenous miR-210 during adipogenesis possibly blocks adipocyte differentiation [87]. [score:3]
Liang et al. showed that the expression of miR-210 was highly increased during 3T3-L1 adipogenesis. [score:3]
Glucose homeostasis[180] miR-146b SIRT1 -induced deacetylation of FOXO1[181] miR-148a Wnt signaling pathway[182] miR-181 TNF-α[183] miR-199a Smad1[184] miR-204 Runx2[185] miR-210 Wnt signaling pathway[65] miR-320 RUNX2[186] miR-371 Epigenetic modifications. [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 12
Furthermore, miR210, one of the most significantly up-regulated miRNAs in hypoxia, can identify early systemic metastasis recurrence in melanoma patients [49]. [score:4]
The hypoxic marker miR210 [24] was up-regulated more than 30-fold, confirming the effective hypoxic levels of our GMB cells culture conditions. [score:4]
The expression levels of miR210 increased under hypoxic culture conditions (Figure 2B, upper panel), indicating effective hypoxia. [score:3]
The hypoxia markers miR210 and miR224-3p are tagged by a red circle. [score:1]
[1 to 20 of 4 sentences]
95
[+] score: 12
Other miRNAs from this paper: mmu-mir-210
ISCU was shown to be a target of miR-210 that was frequently increased in cancer tissues 41, and ISCU was significantly downregulated in ovarian cancers 42 and medulloblastoma 43. [score:6]
Taken together, the data suggest that ISCU is a potential tumour suppressor that is inactivated through various mechanisms, such as p53 inactivation and miR-210 upregulation. [score:6]
[1 to 20 of 2 sentences]
96
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Reduced serum miR-210 expression was found in patients with complete remission, while high miR-210 expression was correlated with poor relapse-free survival and overall survival in AML patients [165]. [score:5]
In contrast, deregulation of the expression of miR-9, miR-33, miR-92a, miR-142-3p, miR-146a, miR-181a/c, miR-210, miR-215, miR-369-5p, miR-335, miR-454, miR-496, miR-518d, and miR-599 was associated with an unfavorable long-term clinical outcome in ALL patients [65, 67– 73]. [score:4]
For instance, miR-210 was up-regulated in the bone marrow and serum of AML patients compared with normal controls. [score:3]
[1 to 20 of 3 sentences]
97
[+] score: 12
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
Our data suggest that expression of miR-17-5p, miR-132, miR-134, miR-181a, miR-27a, miR-30e, miR-140, miR-147, miR-155, miR-197, and miR-210 play a role in the link between adipose tissue dysfunction and the development of obesity associated disorders including type 2 diabetes. [score:4]
[1 to 20 of 3 sentences]
98
[+] score: 12
No validated miRNA targeting Mx1 has been reported; thus, our miRNA target prediction result indicated that Mx1 can be negatively regulated by miR-342-3p and miR-210, which were both down expressed in H1N1 critically ill patients. [score:8]
We found that EGFR was regulated by miR-342, miR-155, miR-30b, miR-210, miR-192, let-7g, and miR-146b-5p, which were all down expressed in H1N1 critically ill patients. [score:4]
[1 to 20 of 2 sentences]
99
[+] score: 12
Many of these miRNAs (such as miR-142-3p, miR-155, miR-21 and miR-210) that were known to function as ‘oncogenes’ in previous studies were observed to be uniformly up-regulated, while other potential ‘tumor suppressors’ such as let-7c and miR-214 were down-regulated in our study (reviewed by Ramiro Garzon et al. [19] and Aurora Esquela-Kerscher et al. [20]). [score:9]
Our analysis identified a number of annotated cancer -associated miRNAs such as miR-142-3p, miR-155, miR-21, miR-210, let-7c and miR-214 exhibiting consistent deregulation in TCC, TGCT and ccRCC, which may suggest their general effects on human cancer development. [score:3]
[1 to 20 of 2 sentences]
100
[+] score: 12
The expression pattern of 12 specific upregulated miRNAs (miR-17-3p, miR-21, miR-106a, miR-146, miR-155, miR-191, miR-192, miR-203, miR-205, miR-210, miR-212, miR-214) in tumor samples was similar in the tumor plasma-derived exosomes and distinct from the control samples, indicating exosomal miRNAs could be relevant as a screening method for this tumor (122). [score:6]
In leukemia, the miR-210 can also be found in a subset of miRNAs upregulated in exosomes released by tumor cells under hypoxic conditions (117). [score:4]
King et al found an increased concentration of released exosomes and higher expression of exosomal miR-210 secreted by breast cancer cells under hypoxic conditions when compared to normoxic cells (116). [score:2]
[1 to 20 of 3 sentences]