sort by

297 publications mentioning hsa-mir-203a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-203a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 478
On the whole as miR-203 expression controls the expression of GAS41 which in turn controls the expression of miR 10b, it could be certain that miR 203 is a critical entity that regulates the expression of the oncogene GAS41 and oncogenic miR-10b in glioblastoma. [score:10]
Our data has shown a significant up regulation in GAS41 expression both at the mRNA and protein level, clearly reflecting an inverse correlation between miR-203 expression and GAS41 expression in glioma providing a possible clue for the over expression of this oncogene in human glioma. [score:10]
Over expression of miR-203 drastically suppress Robo1 which in turn suppress ERK phosphorylation and MMP-9 expression thereby repressing glioma cell invasion and migration by disrupting the Robo1/ERK/MMP-9 signaling cascade [20]. [score:9]
Simultaneously we found that GAS41 regulates miR-10b expression and miR-203 expression down regulated miR-10b expression by repressing GAS41. [score:9]
To further demonstrate that miR-203 negatively regulates endogenous GAS41 expression, we over-expressed miR-203 in both glioblastoma cell lines (HNGC2 and U87) and estimated its expression level by performing semi-quantitative RT PCR (S1 Fig). [score:8]
Mutant miR-203 showed no effect on GAS41 expression suggesting that miR-203 directly target 3’UTR of GAS41 and to suppresses its function. [score:8]
To explore if miR-203 could up regulate p53 tumor suppressor pathway by inhibiting GAS41 in GBM, we introduced pre- miR-203 in both glioblastoma cell lines used in the study and assessed the expression of GAS41 protein (S3 Fig) as well as the proteins related to p53 pathway by performing western blot analysis using antibodies against GAS 41, p53, phospo-p53 (ser15), p14, p21 and Mdm2. [score:8]
Our present observation showed that over expression of miR-203 down-regulate miR-10b expression substantially. [score:8]
Notably, restoration of miR-203 was able to up regulate of p53/p21 tumor suppressor axis, enhance apoptosis and inhibit migration through suppression of GAS41 probing a probability for better prognosis in glioblastoma. [score:8]
As our initial observationshowed that GAS41 is directly targeted by miR-203, our next question was to see whether miR-203 also down regulated the expression of miR-10b by repressing GAS41. [score:7]
miR-203 behaves as tumor suppressor and is down regulated in pancreatic, esophageal cancer and gliomas, whereas in epithelial ovarian cancer it is upregulated and act as oncogene. [score:7]
It is also well established that miR-203 is down regulated in human glioma and restored expression of miR-203 could negatively regulate migration potential by targeting Robo1/ERK/MMP-9 Signaling cascade [20]. [score:7]
Here our results show that down regulating the expression of p53 result in diminishing the expression of both pri and mature miR-203 in HNGC2 and U87 glioblastoma cell line. [score:6]
Our findings therefore suggest that upregulated expression of GAS41 along with concomitant reduction of miR-203 play a significant role in glioblastoma proliferation. [score:6]
Over -expression of miR-203 resulted in down regulation of GAS41 that lead to induction of p53/p21/p14 tumor suppressor pathway. [score:6]
Previous reports have demonstrated that miR-203 act as a tumor suppressor miRNA and its expression is significantly down regulated in multiple cancers [38– 41]. [score:6]
We observed elevation of p53, phospo-p53 (ser15), p14, p21 expression when miR-203 was over expressed, whereas the expression of Mdm2 was reduced compared to control in both HNGC2 and U87 cell lines (Fig 5A). [score:6]
To have an in depth understanding, we over-expressed miR-203 in glioma cells and analyzed GAS41 expression at both protein and RNA level. [score:5]
Though it is well understood that p53 regulate miR-203 expression in various cancer cell linesvery little is known about its regulation in Glioma. [score:5]
We observed a clear enhancement of miR-10b expression in cells co -transfected with miR-203 and GAS41 over expressing construct. [score:5]
** represents p value <0.01vs control (F) Quantitative Real time PCR studies showing expression of miR-203 in HNGC2 and U87 cells upon over expression of GAS41. [score:5]
Ectopic expression of miR-203 inhibits migration of glioma cells via GAS41. [score:5]
All together this study put forward a new role of miR-203 as tumor suppressor miRNA that in turn control GAS41 expression in human glioblastoma cell line. [score:5]
0159092.g008 Fig 8 (A)Western blot analysis showing relative expression of proteins related to apoptosis (Bax, Bcl-2, Cyto-C, Caspase-3) in HNGC2 and U87 cells transfected with either empty vector or miR-203 over expressed plasmid. [score:5]
To confirm the apoptotic event umpired by miR-203 over expression, we performed western blot analysis after isolating total protein from both the cell lines transfected with over expressed miR-203. [score:5]
In contrast, our study reveal that miR-203 suppress glioma cell migration by targeting GAS41. [score:5]
Over expression of miR-203 stimulates cell apoptosis and suppresses cell proliferation in human glioblastoma. [score:5]
Therefore we hypothesized that miR-203 expression inversely correlates with the expression of both miR-10b and GAS41 in glioblastoma cell (data not shown). [score:5]
These result suggest that miR-203 expression is indeed bowed down in glioma as GAS41 expression is predominant in these cell types. [score:5]
Nevertheless, miR-203 has also been implemented in esophageal and acute lymphoblastic leukemia cells that results in suppression of proliferative activity by targeting DNp63 and ABL1 [44, 45]. [score:5]
To demonstrate whether miR-203 has any connection in the modulation of miR-10b expression in glioma cell lines, we performed miR-10b expression studies in HNGC2 and U87 cell lines transfected with miR-203 and empty vector (EV) by performing quantitative real time PCR. [score:5]
To further understand and demonstrate the physiological relation between GAS41 and miR-203, and to understand the link of GAS41 to miR-203, we have used miRNA target prediction software to predict the target site of miR-203 with GAS41. [score:5]
miR-203 mediated GAS41 suppression promotes activation of p53 tumor suppressor pathway. [score:5]
Here our results clearly depict that miR-203 mediated suppression of GAS41 effectively induced p53 expression as well as p21 and p14 [ARF]gene. [score:5]
In this report, we show GAS41 as a novel target for miR-203 where an inverse correlation between both occurs at transcription as well as translation level. [score:5]
Moreover, expression of miR-203 suppressed cell proliferation and migration in triple negative breast cancer cell line [41]. [score:5]
In conclusion the present study showed an interesting connectivity that miR-203 acts as a tumor suppressor in glioblastoma and its appearance is inversely correlated with GAS41 expression. [score:5]
Our results indicate that p21 transcriptional activation is probably due to miR-203 mediated suppression of GAS41, as over expression of GAS41 nullifies the transcriptional activation of p21. [score:5]
Therefore it was our interest to see whether down regulation of miR-203 could revert GAS41 expression in Glioma cells. [score:4]
We simultaneously checked the expression of miR-203 in the same cells in which p53 expression was depleted by transfecting with p53 siRNA, A significant reduction in both primary and mature miRNA level of miR-203 was observed compared cells transfected with scrambled siRNA that served as controls (Fig 6D) suggesting a clear indication that p53 is required for miR-203 mediated cellular activities. [score:4]
Interestingly, miR-203 also down regulate miR-10b expression by repressing GAS41 in gliomas producing a proficient induction of apoptosis and preventing migration. [score:4]
miR-203 down regulates GAS41 expression in glioblastoma cell. [score:4]
Our results demonstrate that miR-203 which is down regulated in glioblastoma cell lines combat apoptosis, and promote migration and proliferation potentially by targeting GAS41 in vitro. [score:4]
miR-203 is known for its tumor suppressive activity by negatively regulating cell proliferation and invasion and enhancing chemotherapeutic intervention [19– 22]. [score:4]
Here we have demonstrated that miR-203 serve as a tumor suppressor miRNA by negatively regulating GAS41. [score:4]
A clear decrease in the level of miR-203 expression was observed in cells transfected with over expressed GAS41 as compared to EV (pCMV Tag1) (Fig 3F). [score:4]
Some reports have also demonstrated down regulated expression of miR-203 is association with GBM. [score:4]
S4 Fig miR-203 inhibit glioma proliferation and induce apoptosis (A) Cell viability studies in HNGC2 and U87 cells after transfection either with empty vector or miR-203 over -expressing vector at different time intervals (12,24,48 and 72h) (B) Colony formation assay after miR-203 transfection into HNGC2 and U87 cells. [score:4]
In contrast, HNGC2 or U87 cells co -transfected with miR-203 mimic and mutant 3’UTR of GAS41 construct (GAS41-mut) did not show any change in luciferase signal as compared to control confirming the connectivity of expression of GAS41 with mir203 expression (Fig 2B & 2C). [score:4]
To facilitate GAS41- miR-203 regulationprototype, we over expressed GAS41 in glioblastoma cell lines by transfecting with pCMV-GAS41 construct which contains GAS41 coding region fused with C terminal FLAG into pCMV-Tag1 vector (S1 Fig) and evaluated miR-203 expression level. [score:4]
All together our data strongly support miR-203 mediated p21 transcriptional activation by suppressing GAS41 though an in depth study for understanding the direct relation is needed. [score:4]
miR-203 down regulates miR-10b expression via GAS41. [score:4]
These results confirmed that up regulation of p21 transcription mediated by miR-203 is indeed responsible for the down regulation of GAS41 by directly associating with it. [score:4]
These results conclude that miR-203 negatively regulate GAS41 expression in human glioma. [score:4]
miR-203 mediated GAS41 suppression lead to activation of p21 transcription. [score:3]
It is also well documented that over expression of miR-203 could promote apoptosis and impair proliferation and migration [40, 41]. [score:3]
We also postulated a linkage between miR-203, GAS41 and miR-10b an oncomiR abundantly expressed in multiple cancer including glioblastoma. [score:3]
It is also known that ectopic expression of miR-203 controls migration, proliferation and apoptosis in prostate cancer [38, 39]. [score:3]
Transfection with miR-203 in both the cell lines amplified GAS41 mRNA expression (Fig 3E). [score:3]
Histograms representing the % of wound heal area in HNGC2 and U87 cells transfected with empty vector, miR-203 plasmid or miR-203 plus GAS41 (B) Western blots showing expression of proteins associated with migration event (E cadherin, N cadherin, Snail, MMP-9) in cells transfected with EV or miR-203. [score:3]
miR-203 suppress GAS41. [score:3]
The function of miR-203 as a tumor suppressor miRNA has long been established in number of cancer cell lines [38– 41]. [score:3]
In addition, we observed activation of p53 pathway gene upon GAS41 suppression by miR-203. [score:3]
A major reduction of miR-10b level was observed when miR-203 was over expressed in glioma cells. [score:3]
GAS41 is a novel target of miR-203. [score:3]
In support of earlier findings, our result also delineates that miR-203 function as a tumor suppressor in glioblastoma. [score:3]
We found only one putative target binding site of miR-203 (297–317) in the 3’UTR of GAS41 (Fig 2A). [score:3]
0159092.g003 Fig 3 (A) Real time PCR studies showing the expression of GAS41 in HNGC2 and U87 cells transfected with miR-203. [score:3]
Although it is evident that miR-203 is suppressed in prostate cancer [55] as well as colorectal carcinoma [56], a recent report has also shown that loss of miR-203 leads to enhanced invasion and migration in breast cancer cell. [score:3]
To demonstrate whether congregation of miR-203 is at transcriptional or post-transcriptional level, we analyzed the expression level of both primary and mature form of miR-203. [score:3]
miR-203 has several predicted protein targets that are oncogenic in nature. [score:3]
This initial observation leads us to speculate that miR-203 may play a significant role in interfering with GAS41 expression in human glioblastomas. [score:3]
miR-203 maintains p53 stabilization and loss of p53 impairs miR-203 expression. [score:3]
Bars represent RQ (2 [-ddct]) of pri-miR-203 and mature miR-203 expression normalized with U6. [score:3]
Our result also supported the notion that overexpression of miR-203 leads to reduction in p53/MDM2 interaction and p53 accumulation. [score:3]
This further suggests that p53 restoration is dispensable for miR-203 mediated suppression of glioblastoma proliferation. [score:3]
GAS41 mediates suppression of miR-10b through miR-203. [score:3]
There was an enhancement of E cadherin expression and reduction in the level of N-cadherin MMP 9 and snail1 upon miR-203 transfection in HNGC2 and U87 cell line (Fig 9B). [score:3]
clearly showed a reduced GAS41 signal upon miR-203 over expression, whereas no change was observed in glioblastoma cells transfected with empty vector. [score:3]
More interestingly, evidences show that increased miR-203 expression is connected with poor survival in pancreatic tumor. [score:3]
0159092.g005 Fig 5 (A) Western blots analysis showing the expression of proteins related to p53pathway (p53, P-p53, p21, p14, Mdm2) in HNGC2 and U87 cells transfected with mir-203. [score:3]
All together the observation suggested that loss of function of GAS41 either by miR-203 or by specific siRNA resulted in activation of p53 pathway and over expression of GAS41 reverted the entire pathway and retained Glioma growth. [score:3]
In contrast, over expression of miR-203 leads to decreased cell viability and cell cycle arrest in G1phase in laryngeal cancer [40]. [score:3]
Here our data showed that miR-203 over expression leads to apoptotic cell death in both U87 and HNGC2 glioblastoma cell line. [score:3]
0159092.g004 Fig 4 (A) Quantitative Real time PCR analysis showing the expression of miR-10b in HNGC2 and U87 cells transfected with miR-203 plasmid. [score:3]
This clearly delineated that miR-203 specifically binds to the 3’UTR of GAS41 in glioma cells which in turn establishes the association of mRNA—miRNA at post transcriptional level which could lead to suppression of GAS41. [score:3]
We have also assessed the transcriptional activity of p21 upon miR-203 over expression in glioblastoma cell line. [score:3]
Earlier reports demonstrated over expression of miR-203 in prostate, laryngeal, and breast cancer cell lines [40, 41, 43]. [score:3]
U87 and HNGC2 cells were transfected either with miR-203, GAS41 siRNA and FLAG-GAS41 overexpressed construct. [score:3]
miR-203 induces p53 pathway by targeting GAS41. [score:3]
Inverse correlation of GAS41 and miR-203 expressions in human glioblastoma cell lines. [score:3]
Expression of endogenous miR-203 is low in Glioma cells. [score:3]
Here for the first time we have shown miR-203 proficiently target GAS41 and reduce cancer cell migration. [score:3]
Conversely, depletion of GAS41 protein level was observed when both the glioblastoma cell lines were subjected to miR-203 over expression (Fig 3B). [score:3]
A clear reduction in the expression of MDM2 level was observed in p53 immunoprecipitatesfrom cells exposed to miR-203 compared to control cells transfected with empty vectors (Fig 6A), demonstrating that miR-203 definitely interferes with the interaction of p53/MDM2, and there by promoting the degradation of MDM2 and leading to the stabilization and accumulation of p53. [score:2]
This was further validated by assaying the luciferase activity of GAS41 wild type 3’ UTR expressing vector with a mutant miR-203. [score:2]
These clearly indicate that miR-203 plays a major role for maintaining glioma tumor cell migration and invasion putting up the probability of miR-203 to be a novel candidate for therapeutic development for gliomas. [score:2]
Recent studies have shown that down regulation of miR-203 is associated with chemo resistance in human glioblastoma by inducing EMT via SNAIL1. [score:2]
Over expression of miR-203 virtually blocked the migration potential in HNGC2 and U87 cells as compared to empty vector transfected control (Fig 9A), whereas cells transfected with GAS41 CDS resulted in aggressive migration. [score:2]
miR-203 regulate p21 promoter activity. [score:2]
There was a sharp depletion of primary and mature miR-203 expression in HNGC2 and U87 cells compared to normal human brain cells (Fig 1D) indicating an inverse correlation of miR- 203 with GAS41 in both HNGC2 and U87 cell lines. [score:2]
MiR-203 inhibit migration via GAS41. [score:2]
miR-203 mediated GAS41 Regulation. [score:2]
Though some report demonstrate silencing of YEATS4/GAS41 is capable of inducing apoptosis, but studies relating to association of miR-203 and GAS41 in glioma progression and apoptosis are still in its infancy. [score:1]
Next we sought to examine whether miR-203 could stabilize p53 by interfering with intracellular p53/MDM2 interaction in U87 and HNGC2 cell line. [score:1]
However the role of miR-203 in inducing apoptosis in glioblastoma is enigmatic. [score:1]
0159092.g007 Fig 7 (A) showing p21FL promoter activity in HNGC2 and U87 cell line transfected with PGL3vector, p21FL promoter and p21FL (full length) plus miR-203. [score:1]
5X 10 [5] HNGC2 and U87 cells were seeded in 60 mm dish and allowed to grow for 24 h followed by transfection with miR-203 plasmid construct. [score:1]
0159092.g006 Fig 6 (A) Co immunoprecipitation studies using antip53 antibody in HNGC2 and U87 cells transfected with empty vector and miR-203 construct for 24 hr. [score:1]
Glioma cells were transfected with empty vector control, miR-203 plasmid and miR-203 plus GAS41 construct and migration of cells were observed at specific time interval of 0h, 24h and 48h after transfection. [score:1]
Proteins were isolated from cells treated with miR-203 along with control samples and examined. [score:1]
Bars represent relative pri-miR-203 and mature miR-203 level normalized to U6 RNA in the same sample. [score:1]
We observed a clear depletion in miR-10b level in miR-203 transfected U87 and HNGC2 cells. [score:1]
Simultaneously no change was observed in cells transfected with miR-203 and pCMV-Tag1 empty vector (Fig 4C). [score:1]
U87 and HNGC2 cell were transfected with EV and miR-203 construct by using lipofectamine 2000 (Invitrogen) in serum free media. [score:1]
After 24 hr interval cells were transfected with miR-203 construct and the media was replaced with fresh media. [score:1]
We therefore performedCo-immunoprecipitation(Co-IP) studies where in p53 was immunoprecipitated from HNGC2 and U87 cells transfected with miR-203 and empty vector(EV) and immunoprecipitated p53 was hybridized with specific antibody against MDM2. [score:1]
Inverse correlation between GAS41 and miR-203. [score:1]
miR-203 negatively modulate GAS41 in glioblastoma cell line. [score:1]
β-actin is used as gel loading control (D) Quantitative PCR analysis of pri-miR-203 and mature miR-203 in cells introduced with scrambled siRNA (scrsi) and p53 siRNA (p53 si). [score:1]
miR-203 plasmid construct was added at a final concentration of 50nM. [score:1]
Cells were transfected with miR-203 plasmid construct and incubated for 24 hour at 37 [°]C. Subsequently cells were fixed in 4% par formaldehyde for 30 min, permeabilized in 0.1% Triton X-100, and labeled with fluorescein-12-dUTP using terminal deoxynucleotidyltransferase. [score:1]
Here in our study we have reported the biological event of miR-203 in human glioblastoma. [score:1]
Blots were visualized with chemiluminescence reagent (Millipore) and observed by ChemiDoc XRS system (BIO-RAD) HNGC2 and U87 cells were seeded on cover slips and allowed to grow for 24hours at 37 [ο]C followed by transfection with miR-203 plasmid construct. [score:1]
We have also shown a unique role of GAS41 in connecting the functional relationship between miR-10b and miR-203. [score:1]
Consistent with these reports, we have also found endogenous miR-203 is significantly down regulated in glioblastoma cell lines as compared to normal cell. [score:1]
These results clearly showed that miR-203 play a imperative role in triggering apoptosis and combating cell growth and proliferation in glioma cell lines. [score:1]
Though role of miR-203 in case of cancer cell migration is broadly elucidated, but there is no report in context to GAS41 association. [score:1]
Hence p53RES (-2500 to -1400) is essential for activation of p21 promoter in response to miR-203. [score:1]
Mutant form of miR-203 binding site on GAS41 3’UTR was produced by base substitution in the primer of the miR-203 binding site followed by amplification and DpnI mediated site-directed mutagenesis [31]. [score:1]
These results confirmed that miR-203 attenuates glioma migration through inactivation of GAS41. [score:1]
We therefore co transfected full length p21 promoter and miR-203 mimic into HNGC2 and U87 cell lines. [score:1]
A clear increase in luciferase signal was seen when cells were co transfected with miR-203 mimics and p21promoter construct, whereas same cell lines introduced with empty vector and p21 promoter construct were unable to raise luciferase signal (Fig 7A). [score:1]
miR-203 induces apoptosis in glioblastoma cells. [score:1]
So we wanted to know whether miR-203 could elevate p21 transcriptional level by inactivating GAS41, as p21 promoter shows a strong repression when associated with Gas41. [score:1]
We transiently co -transfected both the reporter construct in to HNGC2 and U87 cell line along with miR-203. [score:1]
Cells were grown to 70% confluence and co -transfected with miR-203 construct and psiCHECK-2-GAS41 3’ UTR using Lipofectamine-2000 transfection reagent (life Technologies). [score:1]
To address this we cloned 3’UTR region of GAS41 (GAS41-wt) into Promega psiCHECK2 luciferase vector and further co transfected to HNGC2 and U87 cells with miR-203 mimic. [score:1]
All the above experiments were performed in triplicates (A) Co immunoprecipitation studies using antip53 antibody in HNGC2 and U87 cells transfected with empty vector and miR-203 construct for 24 hr. [score:1]
Thereafter they were transfected with miR-203 plasmid construct. [score:1]
Thus we obscured miR-203 level by introducing antagomiR-203 in both HNGC2 and U87 cell lines (Fig 3D). [score:1]
S3 Fig (A) of GAS41 in HNGC2 and U87 cells transfected with Empty vector (EV) and miR-203 plasmid construct. [score:1]
Furthermore our data suggests miR-203 mediated p21 activation is specific to p53RES (-2500 to -1400). [score:1]
Recent study identified that upon exposure to DXR,p53 post-transcriptionally stimulate several miRNAs, such as miR-203,miR-16,miR-206,miR-103 by processing pri-miRNA to pre-miRNA mediated by Drosha in the nucleus[53]. [score:1]
miR-203 dispensable for p53 stabilization. [score:1]
[1 to 20 of 145 sentences]
2
[+] score: 351
Other miRNAs from this paper: hsa-mir-21, hsa-mir-204, hsa-mir-646, hsa-mir-203b
Finally, experiments in vitro further confirmed that forced miR-203 expression could inhibit cell proliferation, migration and invasion of renal cancer cells by down -regulating FGF2 expression, which further elucidates the molecular mechanism involved in renal cancer progression and may suggest novel findings for targeted treatment. [score:10]
Diao et al. revealed that miR-203 exerted its tumor suppressive effect by directly targeting p63 and leukemia inhibitory factor receptor in rhabdomyosarcoma cells, which promoted myogenic differentiation by inhibiting the Notch and the JAK1/STAT1/STAT3 pathways [16]. [score:10]
In the study, we showed that FGF2 was a direct target of miR-203 and restoration of miR-203 could down-regulate the expression of FGF2 in 786-O cells. [score:9]
In conclusion, our results provided evidence that miR-203 was dramatically down-regulated in renal cancer and the decreased expression of miR-203 expression was associated with more aggressive tumor phenotype and poorer overall survival in ccRCC patients. [score:8]
D. Down-regulated expression of miR-203 increased the expression of FGF2 at the protein level in 786-O cells. [score:8]
Moreover, western blot analysis was used to detect the expression of FGF2 regulated by miR-203 in 786-O. Our results showed that miR-203 mimics significantly inhibited expression of FGF2 (Figure  3C). [score:8]
Based on miR target analysis using the websites targetscan, PicTar and miRanda, miR-203 was identified as a potential regulator of FGF2 expression. [score:8]
C. Overexpression of miR-203 inhibited the expression of FGF2 at the protein level in 786-O cells. [score:7]
qRT-PCR was performed to detect the expression of miR-203 in human renal cancer cell lines (786-O, ACHN, Caki-1 and Caki-2) and normal human proximal tubule epithelial cell line HK-2. We found that the average expression of miR-203 was down-regulated in 4 renal cancer cell lines when compared with the normal human proximal tubule epithelial cell line HK-2 (Figure  1A, P < 0.05). [score:7]
Ectopic expression of miR-203 could inhibit cell proliferation, migration and invasion capacity of renal cancer cells by targeting FGF2. [score:7]
Mechanistic investigations confirmed FGF2 as a direct target of miR-203, and up-regulation of miR-203 could decrease expression of FGF2. [score:7]
In contrast, down-regulation of miR-203 expression promoted renal cancer cell growth and metastasis (P < 0.05). [score:6]
To explore whether miR-203 was down-regulated in renal cancer tissues, the expression of miR-203 was determined in 90 pairs of ccRCC tissues and adjacent non-tumor tissues. [score:6]
miR-203 expression was down-regulated in renal cancer and negatively correlated with advanced clinical stage. [score:6]
The expression of miR-203 in ccRCC tissues was significantly down-regulated (Figure  1B, P < 0.05). [score:6]
Taken together, these results indicated that miR-203 was down-regulated in renal cancer, and a reduced expression of miR-203 may play key roles in the progression of renal cancer. [score:6]
FGF2 was up-regulated and negatively correlated with miR-203 expression in ccRCC. [score:6]
B. Down-regulation of miR-203 by transfection with miR-203 inhibitor in 786-O cells. [score:6]
786-O cells were seeded in 12-well plates and incubated overnight, then transiently transfected with miR-203 mimic, miR -negative control of mimics (miR-Ctrl), miR-203 inhibitor and miR -negative control of inhibitor (anti-miR-Ctrl) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:5]
Kaplan-Meier survival analysis showed that patients with low miR-203 expression (31.2, 95% CI: 23.5-38.9) had shorter overall survival than those with high miR-203 expression (42.2, 95% CI: 34.3-49.9) (Figure  1C, P < 0.05, log-rank test). [score:5]
The high miR-203 group had miR-203 expression levels higher than the mean value and the low miR-203 group had miR-203 expression levels lower than the mean value. [score:5]
In the present study, our data showed that the expression of miR-203 was significantly down-regulated in renal cancer cells and ccRCC tissues compared with normal human proximal tubule epithelial cells and adjacent non-tumor tissues. [score:5]
Wang et al. demonstrated that miR-203 suppressed the proliferation and migration and promoted the apoptosis of lung cancer cells by targeting SRC [17]. [score:5]
In addition, overall survival of patients with low miR-203 expression was less than those with high expression of miR-203. [score:5]
Correlation between expression levels of miR-203 and its target genes in RCC tissues was analyzed using Spearman’s correlation coefficient. [score:5]
Further investigation showed that ectopic expression of FGF2 partially reversed the inhibition effect of enforced miR-203 expression on the malignant phenotypes of renal cancer cells. [score:5]
FGF2 over -expression partially attenuated the tumor suppressive effect of miR-203. [score:5]
Transient forced expression of miR-203 inhibited renal cancer cell growth and metastasis (P < 0.05). [score:5]
Our study suggested that miR-203 could be a potential prognostic marker and functions as a tumor suppressor in human renal cancer by post-transcriptionally targeting FGF2. [score:5]
Similarly, in vitro migration and invasion assays showed that over -expression of miR-203 inhibited the migration and invasion ability of 786-O cells (P < 0.05, Figure  2E, G). [score:4]
Mutations within potential miR-203 binding sites were generated by nucleotide replacement of wild-type sequence to inhibit miR-203 binding. [score:4]
In this study, we found that miR-203 could inhibit cell proliferation, migration and invasion of renal cancer cells, which suggested that miR-203 could play a key role in the regulation of cell growth and metastasis of renal cancer cells. [score:4]
Figure 3 miR-203 directly targets FGF2 in renal cancer cells. [score:4]
Siu et al. found that loss of EGFR signaling-regulated miR-203 promotes prostate cancer bone metastasis and tyrosine kinase inhibitors resistance [19]. [score:4]
Finally, the roles of miR-203 in regulation of tumor proliferation, migration, invasion, and target gene expression were further investigated. [score:4]
Our study showed miR-203 was down-regulated in renal cancer cell lines and ccRCC specimens (P < 0.05). [score:4]
miR-203 directly target FGF2 in human renal cancer cells. [score:4]
MiR-203 mimic and miR-203 inhibitor were obtained from Applied Biosystems. [score:3]
To further explore the relationship between FGF2 and miR-203 in vivo, qRT-PCR was used to examine the expression of FGF2 in one set of ccRCC tissue and their matched non-tumor tissues (20 pairs). [score:3]
Figure 2 Effects of miR-203 expression on proliferation, migration and invasion of renal cancer cells. [score:3]
Then, the association of miR-203 expression with clinicopathological features and survival was later analyzed. [score:3]
miR-203 inhibited cell proliferation, migration and invasion of renal cancer cells. [score:3]
These results suggested that miR-203 could be a useful prognostic marker and a potential therapeutic target in human renal cancer. [score:3]
Decreased expression of miR-203 was associated with a more aggressive tumor phenotype in ccRCC patients. [score:3]
Respectively, the low miR-203 expression in ccRCC specimens was associated with advanced clinical features and poorer prognosis (P < 0.05). [score:3]
E. The inverse correlation between FGF2 and miR-203 expression in 20 ccRCC samples was determined using Spearman’s correlation analysis (r = −0.8340, P <0.05) * P <0.05. [score:3]
As showed in Table  1, miR-203 expression was significantly associated with histological grade, tumor stage and lymph node metastasis (Table  1, P < 0.05), but no significant association with patients’ gender, age and tumor size (Table  1, P > 0.05). [score:3]
Then, the association of miR-203 expression with clinicopathologic features of ccRCC patients and its prognostic value was explored. [score:3]
Furthermore, multivariate analysis showed that relative expression of miR-203, histological grade, tumor stage and lymph node metastasis were independent prognostic factors for overall survival of ccRCC patients (Table  2). [score:3]
These results suggested that miR-203 expression level can be developed as a powerful independent molecular biomarker for the predicting of overall survival (HR: 3.071, 95% CI: 1.719-6.374, P = 0.001) in ccRCC patients. [score:3]
Figure 1 Low expression of miR-203 was found in ccRCC tissues and associated with poorer overall survival. [score:3]
Taken together, these findings indicated that restoration of FGF2 markedly attenuated the tumor suppressive effect of miR-203. [score:3]
A. Over -expression of miR-203 by transfection with miR-203 mimics in 786-O cells. [score:3]
These results demonstrated that miR-203 was able to suppress the progression of renal cancer. [score:3]
miR-203 expression was an independent prognostic marker of overall ccRCC patient survival in a multivariate analysis (P < 0.05). [score:3]
Moreover, our data indicated that there was an inverse correlation between miR-203 and FGF2 expression (P < 0.05, Figure  4E). [score:3]
C. The Kaplan–Meier analysis revealed that low expression of miR-203 was associated with poorer overall survival of ccRCC patients. [score:3]
The predicted binding of miR-203 with FGF2 3’UTR was shown (Figure  3A), suggesting that miR-203 might be a potential miRNA -targeting FGF2. [score:3]
From those data, we concluded that decreased expression of miR-203 would play a critical role in the progression of renal cancer. [score:3]
First, quantitative real-time PCR (qRT-PCR) was performed to detect miR-203 expression in renal cancer cell lines and clear cell RCC (ccRCC) specimens. [score:3]
The restoration of FGF2 markedly attenuated tumor suppressive effects of miR-203 on renal cancer cells. [score:3]
786-O cells were transfected with miR-203 mimics or miR-Ctrl with FGF2 over -expression plasmid. [score:3]
To confirm that FGF2 is the direct target of miR-203, luciferase reporter assay was performed. [score:3]
We further investigated whether FGF2 over -expression could attenuate the tumor suppressive effects of miR-203. [score:3]
Low miR-203 expression predicted poor prognosis in patients with RCC. [score:3]
In contrast, the proliferation rate of 786-O cells transfected with miR-203 inhibitor was increased (P < 0.05, Figure  2D). [score:3]
These data suggested that FGF2 was a target of miR-203 in renal cancer cells. [score:3]
A. The expression level of miR-203 was lower in renal caner cell lines compared with normal human proximal tubule epithelial cell line HK-2. B. The expression levels of miR-203 were significantly decreased in ccRCC tissues compared to adjacent non-tumor tissues. [score:3]
Then, patients with ccRCC were classified into two groups based on the mean value (0.38) of relative miR-203 expression. [score:3]
Tian et al. showed miR-203 expression was significantly lower in laryngeal squamous cell carcinoma and correlated with poor differentiation, advanced clinical stages and lymph node metastasis [15]. [score:3]
Whereas silencing of miR-203 significantly increased expression of FGF2 (Figure  3D). [score:3]
Increasing evidence has shown that microRNAs function as oncogenes or tumor suppressors in human malignancies, but the roles of miR-203 in human RCC is still unclear. [score:3]
The 3′ untranslated region (UTR) of human FGF2 gene that was predicted to interact with miR-203 was synthesized and inserted into pMIR-REPORT (Ambion), yielding pMIR-REPORT FGF2. [score:3]
As in Table  2, Univariate analysis showed that the overall survival of patients with ccRCC was associated with miR-203 expression level, histological grade, tumor stage and lymph node metastasis (P < 0.05). [score:3]
Our result showed that miR-203 significantly inhibited the luciferase activity of the wild-type (Wt) 3′UTR of FGF2, without effect on its mutant (Mut) (P < 0.05, Figure  3B). [score:3]
Zhang suggested that miR-203 suppressed tumor growth and invasion through repressing Ran in esophageal cancer [18]. [score:3]
Our data further demonstrated that FGF2 was a target of miR-203. [score:3]
CCK-8 assay, migration assay and invasion assay revealed that over -expression of FGF2 significantly reversed the tumor suppressive effects of miR-203 on 786-O cell (P < 0.05, Figure  4A-C). [score:2]
However, the dysregulation of miR-203 and its possible involvement in renal cell carcinoma has not been reported. [score:2]
Consistent with this result, silencing of miR-203 resulted in a significant increase in renal cancer cell migration and invasion ability (P < 0.05, Figure  2F, H). [score:1]
In this study, first, we investigated the expression of miR-203 in renal cancer cells and ccRCC tissues. [score:1]
MiR-203 located at chromosome 14q32-33 and has been identified as a skin-specific keratinocyte derived miRNA involved in keratinocyte differentiation [14]. [score:1]
A. The wild type and mutant complementary sequences of the FGF2 mRNA 3’UTR are shown with the miR-203 sequence. [score:1]
E-H. were utilized to analyze the effect of miR-203 on cell migration (E,F) and invasion (G,H) of 786-O cells. [score:1]
786-O cells in 12-well plates were co -transfected with miR-203 mimic and the pcDNA-FGF2 plasmid. [score:1]
Furthermore, FGF2 levels were increased and negatively correlated with miR-203 levels in ccRCC tissues. [score:1]
Taken together, these data suggested that miR-203 impacted on renal cancer cells partially by inactivation of FGF2. [score:1]
Renal cancer miR-203 FGF2 Progression Renal cell carcinoma (RCC) is the most common solid cancer of the adult kidney, accounting for approximately 90% of kidney neoplasms and 3% of all adult malignancies [1]. [score:1]
[1 to 20 of 88 sentences]
3
[+] score: 330
We identified five downregulated miRNAs (miR-26b, miR-125b, miR-203, miR-218, and miR-373) and one upregulated miRNA (miR-15a) when we compared miRNA expression in HNSCC cells versus primary human keratinocytes (Figure 1A). [score:8]
We curated our microarray expression data for genes significantly downregulated by miR-203 and overlapped these hits (171 genes) with a list of 993 miR-203 predicted target genes from 11 publically available algorithms. [score:8]
Overexpression of SPARC or NUAK1 alone led to a small increase in metastasis of miR-203 cells, whereas overexpression of LASP1 alone caused a pronounced stimulation, which was comparable to overexpressing all three proteins (Figures 6C, S6E, and S6E). [score:7]
We engineered control and miR-203 expressing SCC13 cells to stably express all 16 possible combinations of miRNA-insensitive cDNAs (lacking 3′ UTRs) encoding LASP1, NUAK1, and SPARC, and validated correct target gene reconstitution by western blotting (Figure 6B). [score:7]
To assess the function of the deregulated miRNAs in HNSCC, we generated two YFP-luciferase -expressing cell lines—SCC13 (established facial SCC; Rheinwald and Beckett, 1981) and SJG15 (primary lingual SCC; Goldie et al., 2012)—in which we knocked down miR-15a or stably overexpressed miR-26b, miR-125b, miR-203, miR-218, or miR-373 using lentiviral approaches (Figure S1A). [score:7]
miR-203 Directly Targets a Cohort of Genes Upregulated in HNSCC. [score:7]
We conclude that miR-203 inhibits lung metastasis, not by triggering differentiation, but by directly targeting the prometastatic genes LASP1, SPARC, and NUAK1, which are prognostic factors in human HNSCC. [score:6]
Overexpression of miR-203 or knockdown of miR-15a suppressed metastasis in both cell lines, as determined by endpoint lung metastatic burden, ex vivo fluorescence microscopy, and histology (Figures 1E and S1E–S1H). [score:6]
To validate the results of our analysis, we showed that overexpression of miR-203 led to downregulation of LASP1, NUAK1, SPARC, and THBS2 in SCC13 and SJG15 cells (Figure 5E). [score:6]
We conclude, on the basis of miR-203 knockdown and overexpression, that miR-203 inhibits lung metastasis of HNSCC. [score:6]
As such, the rewiring of miR-203 function from regulating differentiation to inhibiting metastasis is likely to be explained by changes in target gene selection from differentiation-relevant proteins, such as TP63, to metastasis-promoting factors, such as LASP1, SPARC, and NUAK1. [score:6]
To probe the mechanisms by which miR-203 regulates metastasis, we performed genome-wide expression profiling and gene set enrichment analysis (GSEA) of miR-203 -expressing SCC13 and SJG15 cells versus scrambled controls. [score:6]
Dox-inducible miR-203 expression did not affect in vitro proliferation of adherent cells (Figure S4B), but reduced the anchorage-independent growth of SCC13 cells in soft agar (Figure S4C), consistent with the effect of constitutive expression (Figure 2B). [score:5]
We conclude that miR-203 inhibits lung metastasis by inhibiting exit from dormancy, rather than by preventing migration from the primary tumor or entry into the lung. [score:5]
Xenografting 10 [5] miRNA expressing SCC13 cells revealed that overexpression of miR-203 and knockdown of miR-15a modestly reduced tumor burden after 26 days compared with control. [score:5]
In advanced metastatic prostate cancer, miR-203 targets BIRC5 (Saini et al., 2011), whereas in breast cancer metastasis it targets SNAI2 (Ding et al., 2013). [score:5]
Expression of miR-203 was either never induced (mimicking cells lacking miR-203), induced before intravenous injection (day 0, phenocopying constitutive miR-203 expression), or induced 10 (dormancy phase of engrafted cells), 29 (establishment of micrometastases), or 56 days (macrometastatic colonization) after injection. [score:5]
Expression of miR-203 and its downstream effectors correlates with HNSCC overall survival outcomes, indicating the therapeutic potential of targeting this signaling axis. [score:5]
miR-203 Expression Inhibits Lung Metastasis. [score:5]
Whereas miR-203 was strongly expressed in the suprabasal, differentiated layers of normal epidermis, confirming previous reports (Yi et al., 2008), its expression was 35-fold lower in matched cutaneous SCCs (Figure 2A). [score:5]
In support of this prediction, there was no difference between control and miR-203 -expressing SCC13 tongue tumors and lung metastases in expression of markers of undifferentiated keratinocytes, including keratin-5, keratin-14, α6-integrin, and p63. [score:5]
In vivo genetic reconstitution experiments show that miR-203 inhibits lung metastasis by suppressing the prometastatic activities of three factors involved in cytoskeletal dynamics (LASP1), extracellular matrix remo deling (SPARC), and cell metabolism (NUAK1). [score:5]
Indeed, miR-203 regulates tumor progression in breast and prostate cancer, but the targets of its action are very distinct among tissue types. [score:4]
In light of the development of targeted strategies to deliver nucleic acids into tumor cells (Davis et al., 2008), we envision the potential value of using miR-203 mimetics to alleviate otherwise therapeutically intractable metastatic HNSCC. [score:4]
Moreover, we found significant negative correlations between RNA sequencing (RNAseq) read counts of miR-203 and each of its three direct targets, but not TP63, across 225 HNSCC patients in TCGA (Figure S2A). [score:4]
Transfection of exogenous miR-203 molecules (mimics) into 293T cells led to specific upregulation of miR-203 levels (Figure 5H). [score:4]
Therefore, deregulation of miR-203 in HNSCC (and potentially other tumor types) is due, at least in part, to focal CNAs that alter multiple tumor- and/or metastasis-suppressive pathways. [score:4]
Therefore, we employed functional in vivo approaches to identify miR-203 as a potent negative regulator of HNSCC metastasis by targeting a panel of prometastatic effector proteins (Yi et al., 2008). [score:4]
In addition, knockdown of LASP1 reduced the clonogenic potential of SCC13 cells in vitro (Figures S6F and S6G), recreating the phenotype observed when miR-203 is expressed in the SCC13 cell line (Figure 2B). [score:4]
Dox induction of miR-203 in SCC13 and SJG15 cells led to downregulation of LASP1, NUAK1, and SPARC, but not THBS2 (Figure 5G). [score:4]
Our mechanistic studies identify LASP1, SPARC, and NUAK1 as important direct downstream effectors for miR-203 -mediated inhibition of HNSCC metastasis. [score:4]
To determine whether or not LASP1, NUAK1, and SPARC are direct miR-203 targets, we cloned the 3′ UTRs into a luciferase reporter construct. [score:4]
miR-203 Regulates Multiple Postextravasation Events and Inhibits Established Metastases. [score:4]
We thus confirmed LASP1, NUAK1, and SPARC as direct target genes of miR-203 in human HNSCC. [score:4]
Individual or combined reintroduction of NUAK1, SPARC, and/or LASP1 was sufficient to bolster the lung metastatic colonization by SCC13 expressing miR-203 (Figure 6C–6F). [score:3]
The reduction in tumor size upon expression of miR-203 was due to a lag in the initial rate of growth, and from week 2 onward the rate of tumor growth was comparable to that in control SCC13 cells (Figures 2C and S3A). [score:3]
Effect of miR-203 Expression on Primary Tumor Growth. [score:3]
We next used a doxycycline (dox)-inducible system to temporally control miR-203 expression (Figures 4A, 4B, and S4A). [score:3]
To assess the impact on tumor growth in more detail, we xenografted 10 [4] SCC13 cells expressing miR-203 or scrambled control hairpin (SCR) and monitored tumors for up to 50 days (Figure 2C). [score:3]
The clinical relevance of the miR-203 target genes was confirmed in patient data. [score:3]
Activation of miR-203 for the duration of the experiment resulted in a 95% inhibition of endpoint lung metastatic burden (Figures 4C and 4D). [score:3]
GSEA also revealed that signatures of human keratinocyte differentiation were positively enriched in miR-203 -expressing HNSCC cells (Kretz et al., 2012; Mulder et al., 2012; Sen et al., 2010; Figures 5A and 5B). [score:3]
The 3′ UTR of TP63, a known downstream target of miR-203 (Yi et al., 2008), served as a positive control. [score:3]
No difference in tumor incidence was observed between miR-203- and SCR -expressing cells (Figure 2D). [score:3]
Genome-wide expression changes elicited by miR-203 were negatively enriched for signatures of metastasis in primary human HNSCC arising in various anatomical locations within the aerodigestive tract (Cromer et al., 2004; O’Donnell et al., 2005; Rickman et al., 2008; Figure 5A). [score:3]
Whereas control SCC13 and SJG15 cells colonized the majority of the lung area, cells expressing miR-203 only generated small metastatic lesions or remained as clusters of individual cells (Figure S3F). [score:3]
Instead, miR-203 controls HNSCC metastasis by targeting a network of prometastatic proteins, including LASP1, SPARC, and NUAK1. [score:3]
We conclude that miR-203 overexpression does not affect the number of tumor-initiating cells or the overall tumor growth rate, but causes a delay before tumor growth becomes established, which results in a reduction in tumor size. [score:3]
An examination of RFP and GFP signals from lung metastases in each cohort of animals, as well as in situ hybridization for miR-203, confirmed dox -dependent, sustained expression of miR-203 in vivo (Figures S4D–S4F and data not shown). [score:3]
For this purpose, we used SJG27 cells (primary lingual SCC), which express high levels of miR-203 and do not readily metastasize. [score:3]
A dox-rich diet (Harlan) was used to induce miR-203 expression in vivo. [score:3]
miR-203 mimics repressed the LASP1, NUAK1, SPARC, and TP63 3′ UTR reporters, while mutation of the various miR-203 binding sites blocked miR-203 -mediated regulation of each 3′ UTR (Figure 5I). [score:3]
To identify prometastatic miR-203 target genes, we used an integrated genomics, bioinformatics, and experimental approach (Figure 5D). [score:3]
We confirmed miR-203 expression by in situ hybridization (Figure S3B). [score:3]
Using an integrated approach, we reveal that miR-203 inhibits metastasis independently of its effects on differentiation. [score:3]
This suggests that miR-203 not only functionally switches between tissue homeostasis and cancer progression, as shown here, but also switches targets depending on the cancer type. [score:3]
Expression of miR-203 significantly increased survival time (Figure 2H) and reduced the endpoint lung metastatic burden (Figure 2I). [score:3]
With miR-203 presenting the most compelling case as a metastasis-suppressor gene, we explored its clinical relevance in a cohort of 219 HNSCC patients from The Cancer Genome Atlas (TCGA) (data available through the TCGA Data Portal; Figure 1G). [score:3]
Thirty hours after intravenous injection, multiphoton confocal imaging of individual GFP [+] tumor cells and tomato lectin-labeled blood vessels revealed that a similar proportion (∼90%) of control and miR-203 -expressing SCC13 cells had successfully extravasated (Figure 4G). [score:3]
We activated miR-203 expression at defined time points following intravenous injection of SCC13 cells (Figure 4B). [score:3]
Consistent with these results, miR-203 -expressing SCC13 and SJG15 cells exhibited a dose -dependent impairment in lung colonization following tail-vein injection (Figure 2G). [score:3]
Our studies uncover miR-203 as a potent suppressor of key postextravasation events during lung metastasis. [score:3]
Thus, each miR-203 target promotes metastasis in the presence of miR-203, with the effect of LASP1 being most pronounced. [score:3]
To examine miR-203 expression in vivo, we performed in situ hybridization in 28 cases of primary and/or metastatic skin SCCs with matched normal skin from the same patients, and three further cases of skin SCC (total of 11 patients; Table S1). [score:3]
Consistent with our earlier findings (Figure 2), SCC13 cells expressing miR-203 together with three empty-vector controls (3xEV) did not colonize the lungs, whereas 3xEV SCC13 SCR cells generated numerous macrometastatic lesions (Figure 6C). [score:3]
Patients with miR-203-low tumors also exhibited significantly more lymph node -positive disease and lymphovascular invasion—two major prognostic factors for eventual distant metastasis. [score:3]
A Screen of miRNAs in HNSCC Identifies miR-203 as a Metastasis Suppressor. [score:3]
We confirmed that miR-203 expression was sustained in SCC13 lung metastases (Figure S3G). [score:3]
Expression of miR-203 significantly prolonged the time required for SCC13 and SJG15 cells to reach input levels of lung bioluminescence, suggesting that miR-203 extended the dormancy phase of engrafted cells (Figure 2G), mirroring the phenotype observed in primary tumors (Figure 2C). [score:3]
We report that miR-203, a miRNA that triggers differentiation in multilayered epithelia, inhibits multiple postextravasation events during HNSCC lung metastasis. [score:3]
However, ex vivo bioluminescence and fluorescence imaging of lungs showed that miR-203 -expressing SCC13 cells founded smaller metastases than control cells (Figure 2F). [score:3]
Reexpression of miR-203 from 10 or 29 days was sufficient to block 80% of the endpoint lung metastatic burden (Figures 4C and 4D). [score:3]
This may explain the lack of a correlation between T stage and miR-203 expression in HNSCC patients, since, at least in xenografts, the effect on tumor size is more marked at early time points (Figure 1G). [score:3]
Thus, we propose that miR-203 undergoes a context -dependent functional switch from regulating normal differentiation to acting as a differentiation-independent roadblock to metastasis. [score:2]
Taken together, these data suggest that miR-203 regulates the outgrowth of tumor cells once they have reached the lung. [score:2]
miR-203 regulates in vivo lung metastasis without triggering differentiation • Restoring miR-203 in already established metastases elicits regression • LASP1, NUAK1, and SPARC are downstream prometastatic effectors of miR-203 • The miR-203-LASP1/SPARC/NUAK1 axis is prognostic of overall survival in HNSCC Adult stratified epithelia are maintained by a balance between stem cell self-renewal and differentiation (Arwert et al., 2012; Blanpain and Fuchs, 2006). [score:2]
Knockdown of miR-203 reduced the time to metastatic progression (Figure 3C) and enhanced the total lung metastatic burden (Figure 3D). [score:2]
Hence, although miR-203 primed the transcriptional landscape of HNSCC cells toward a differentiated state, primary tumors and lung metastases did not exhibit alterations in differentiation status in vivo. [score:1]
Although miR-203 promotes differentiation of normal epidermal stem cells (Jackson et al., 2013; Yi et al., 2008), our study shows that it does not promote carcinoma differentiation in vivo. [score:1]
Western blotting showed a miR-203 -dependent reduction in LASP1, NUAK1, and SPARC protein levels (Figure 5J). [score:1]
LASP1, NUAK1, and SPARC Are Functionally Important Prometastatic Downstream Effectors of miR-203 that Are Prognostic of Overall Survival in HNSCC. [score:1]
We next asked whether endogenous miR-203 was necessary to prevent metastasis. [score:1]
Hence, miR-203 is a prognostic indicator of overall survival and propensity for metastasis. [score:1]
Genes associated with the actions of miR-203 in other cancers, such as BIRC5 (Saini et al., 2011), SNAI2 (Ding et al., 2013), P63 (Yi et al., 2008), and c-Jun (Sonkoly et al., 2012), were not enriched in our samples. [score:1]
Although it was not statistically significant, animals in which miR-203 was induced for only the final 2 weeks of the experiment had ∼40% lower lung metastasis (Figures 4C and 4D) accompanied by a moderate reduction in lesion size and number (Figure 4E). [score:1]
These results suggest that the mechanism by which miR-203 controls metastasis is distinct from its prodifferentiation function in normal epidermis (Yi et al., 2008). [score:1]
There was no difference in circulating tumor DNA content between mice bearing miR-203 or control SCC13 primary tumors (Figures 2E and S3C). [score:1]
Reintroducing miR-203 into already established pulmonary nodules elicits their regression, suggesting the potential for therapeutic modalities aimed at activating miR-203 in cancer cells to treat metastatic HNSCC. [score:1]
Silencing miR-203 (miR-203 KD) in YFP-luciferase-labeled SJG27 cells did not impair proliferation in vitro (Figures S3H and S3I), but did enhance formation of clonogenic spheres in soft agar (Figure 3A). [score:1]
Clusters of individual cells were visible in control, but not miR-203 KD, lungs, further suggesting a role for miR-203 in maintaining dormancy (Figure S3J). [score:1]
Our data indicate that miR-203 is an upstream governor of several distinct cellular pathways that converge to enforce a poorly metastatic cell state, and highlight the importance of cellular context in determining the effects of a specific miRNA on metastasis. [score:1]
Unlike most anticancer agents and antimetastatic strategies currently in clinical trials (Valastyan and Weinberg, 2011), miR-203 can antagonize metastasis even after cancer cells have seeded the lung and formed clinically advanced nodules. [score:1]
Ex vivo fluorescence microscopy of lungs confirmed that reintroduction of miR-203 substantially reduced the number and size of lung metastases (Figure 4E). [score:1]
Using high-resolution copy-number data for 322 HNSCC patients from TCGA, we detected a copy-number alteration (CNA) harboring miR-203 that was focally deleted in 15% of cases (Figure S2B). [score:1]
Inducible reactivation of miR-203 in already established lung metastases reduces the overall metastatic burden. [score:1]
In conclusion, our studies highlight miR-203 and its effectors as promising routes for therapeutic intervention in metastatic HNSCC. [score:1]
This suggests that miR-203 uses mutually exclusive genetic strategies to prime the transcriptional landscape of HNSCC cells toward a poorly metastatic cell state and a differentiated state. [score:1]
A similar negative enrichment between miR-203 and metastasis signatures was also found in melanoma, breast, prostate, and endometrial tumors, all of which have a tendency to metastasize (data not shown). [score:1]
The miR-203 locus was also deleted in cutaneous melanoma (34% of cases), lung adenocarcinoma (29% of cases), and glioblastoma multiforme (28% of cases) (Figure S2C). [score:1]
We found that miR-203 significantly reduced both the average number and size of spheres formed by SCC13 in soft agar (Figure 2B and data not shown), consistent with the observation that when 10 [5] cells were injected into the tongue, miR-203 reduced tumor growth (Figure 1B). [score:1]
To investigate the functional contribution(s) of LASP1, NUAK1, and SPARC to miR-203 -induced inhibition of metastasis, we conducted genetic rescue experiments in vivo (Figure 6A). [score:1]
Together, these results suggest that miR-203 enforces a transcriptional landscape in human HNSCC cells that is restrictive for metastasis. [score:1]
Therefore, miR-203 does not alter the ability of cells from the primary tumor to enter the circulation, but does hamper their capacity to expand following engraftment in the lungs. [score:1]
Ex vivo fluorescence microscopy and anti-keratin-5 IHC showed that miR-203 KD cells generated more numerous and larger nodules than control cells (Figure 3E). [score:1]
[1 to 20 of 104 sentences]
4
[+] score: 319
Other miRNAs from this paper: hsa-mir-146a, hsa-mir-203b
NHK stably expressing HPV8 E6, E7, E6/E7 or the corresponding pLXSN control cells were analyzed for (E) p63 protein expression by in relation to actin expression (shown is one experiment out of three), (F) ΔNp63α mRNA or (G) miR-203 expression by qRT-PCR. [score:9]
Also miR-203 mimic transfection led to a significant up-regulation of involucrin expression in E6 expressing HaCaT cells (Fig 4G and 4I, S3E Fig). [score:8]
Moreover, miR-203 targets other cellular factors including c-myc [48], another important regulator of proliferation, suppressor of cytokine signaling 3 (SOCS3) [49] or IL-8 [50] and it cooperates with other miRNAs to suppress the B lymphoma Mo-MLV insertion region 1 homolog (BMI1), which is involved in self-renewal [51]. [score:8]
Expression of HPV8 E6 significantly counteracted PMA -induced miR-203 and involucrin up-regulation as well as PMA -mediated ΔNp63α suppression in NHK (Fig 5A–5C). [score:8]
Importantly, when we knocked-down C/EBPα in NHK, this did not only reduce C/EBPα mRNA but also potently suppressed endogenous miR-203 expression (Fig 5F) indicating that C/EBPα plays a role in miR-203 regulation. [score:7]
Notably, we identified the transcription factor C/EBPα, a well-known suppressor of UV -induced skin carcinogenesis, as a p300 -dependent target of the HPV8-encoded E6 oncoprotein and as a critical inducer of miR-203 gene expression. [score:7]
In contrast, HPV8 E6 expressing HaCaT cells displayed lower constitutive miR-203 expression levels and Ca [2+] -mediated miR-203 induction was significantly suppressed (Fig 2E and 2F, S2C Fig). [score:7]
HPV16 E6 and HPV16/31 E7 were shown to down-regulate miR-203 expression via distinct mechanisms [30, 31]. [score:6]
The HPV31 E7 protein was shown to down-regulate miR-203 expression upon phorbol ester induced differentiation [30]. [score:6]
In situ stainings confirmed congruent suprabasal expression patterns of C/EBPα and miR-203 in non-lesional skin of EV-patients and strong down-regulation of both factors in HPV8 -positive EV-lesions in vivo, supporting our in vitro data. [score:6]
In this study we show that the HPV8 E6 protein is a potent suppressor of miR-203, a key regulator of ΔNp63α expression, proliferation and differentiation in keratinocytes. [score:6]
The HPV8 Δaa132-136-E6 deletion-mutant, which is unable to bind to p300 [18, 46], neither conferred down-regulation of C/EBPα in organotypic cultures nor of its transcriptional target miR-203. [score:6]
Correspondingly, in HPV8 E6 expressing keratinocytes miR-203 was significantly down-regulated (Fig 1G). [score:6]
miR-203 suppression and p63 up-regulation in lesional skin of EV-patients. [score:6]
We have identified the transcription factor CCAAT/enhancer -binding protein α (C/EBPα), a well-known driver of keratinocyte differentiation [34, 35], as a novel target of the HPV8 E6 protein regulating miR-203 expression. [score:6]
HPV16 E6 prevents miR-203 expression by targeting p53. [score:5]
In fact, for the mucosal HR-HPV types, it was reported that the E6, E7 and E5 proteins have the capacity to suppress miR-203 expression [30– 32]. [score:5]
Our study for the first time documents that miR-203, a key regulator of epidermal proliferation and differentiation, is potently down-regulated in HPV8 -positive EV-lesions. [score:5]
We have identified C/EBPα, a differentiation-inducing transcription factor as a novel inducer of miR-203 and the HPV8 E6 protein as a potent suppressor of C/EBPα and miR-203 expression. [score:5]
p63 and miR-203 expression are altered in HPV8 E6 expressing HaCaT cells. [score:5]
In contrast, the miR-203 target p63 displayed complementary expression patterns (Fig 1A and 1B, S6 Fig) corresponding well to the in vitro data. [score:5]
Notably, high levels of miR-203 are inhibitory to HPV amplification in differentiating keratinocytes indicating that inhibition of the miR-203 pathway is crucial for the viral life cycle [30]. [score:5]
HPV8 -positive EV-lesions showing viral cytopathic effects displayed strongly reduced expression of C/EBPα and miR-203 (Fig 7B and 7E) and in highly dysplastic or invasive lesions expression of both factors was almost undetectable (Fig 7C and 7F). [score:5]
IL-8 even appears to be suppressed by HPV8 E6 [52] pointing to the regulation of IL-8 by pathways other than miR-203 in HPV8 E6 -positive keratinocytes. [score:4]
p300 regulates C/EBPα and miR-203 expression. [score:4]
In contrast, cells expressing the miR-203-regulated ‘stemness-maintaining’ factor p63, are highly amplified. [score:4]
To further explore a role of endogenous p300 for miR-203 expression, we knocked-down p300 in NHK as confirmed by analysis (S4B Fig). [score:4]
HPV8 E6 down-regulates miR-203. [score:4]
C/EBPα and miR-203 are both down-regulated in the lesional epidermis of EV-patients. [score:4]
Here, we demonstrate that in human HPV8-infected EV skin lesions, the ‘stemness-repressing’ microRNA-203 is strongly down-regulated. [score:4]
miR-203 is up-regulated in response to differentiation-inducing agents including Ca [2+], Vitamin D3 or phorbol ester -induced protein kinase C (PKC) activity [21, 23]. [score:4]
Since our data revealed C/EBPα as a novel inducer of miR-203 expression we were interested whether HPV8 E6 might regulate this important transcription factor. [score:4]
EMSAs with nuclear extracts from C/EBPα overexpressing cells showed binding to a well-known C/EBP -binding site [45] as well as to the specific C/EBP -binding site within the miR-203 hairpin sequence (Fig 5G). [score:3]
Cells were stimulated with 1.2 mM calcium for 72 h. (*p<0.05) (TIF) 10 nM p63-specific siRNA (or si-control) (A, D) or 20 nM hsa-miR-203 (or control -mimic) (B, E) were transfected in HPV8 E6 expressing and pLXSN control HaCaT cells. [score:3]
To assess the impact of HPV8 E6 on miR-203 expression under differentiation conditions, we also stimulated HaCaT cells with Ca [2+], a potent inducer of keratinocyte differentiation [38]. [score:3]
HPV8 E7, by contrast, had a less strong effect on miR-203 expression but was able to enhance the impact of E6. [score:3]
C/EBPα mRNA or miR-203 expression levels were determined by qRT-PCR. [score:3]
Notably, the ability of HPV8 E6 -expressing cells to close the gap in the scratch assay was significantly impaired after p63 knock-down (Fig 3D) or miR-203 mimic transfection (Fig 3E). [score:3]
Notably, in our study HPV8 E6 efficiently suppressed miR-203 also in the p53-mutated cell line HaCaT [37]. [score:3]
We further explored a potential role of C/EBPα as a direct transcriptional regulator of miR-203. [score:3]
These data indicated that HPV8 E6 exerts its inhibitory effects on miR-203 also in keratinocytes with mutated p53. [score:3]
This isoform is targeted by miR-203 in mammary epithelial cells mediating subversion of stem cell properties [25]. [score:3]
So far, it has been unclear whether or not beta-HPV, which encode an E6 and E7 but no E5 gene (summarized in [33]), can impair miR-203 expression. [score:3]
C/EBPα and miR-203 expression in non-lesional and HPV8 -positive lesional skin of Epidermodysplasia verruciformis patients. [score:3]
This involved suppression of miR-203. [score:3]
10 nM p63-specific siRNA (or si-control) (A, D) or 20 nM hsa-miR-203 (or control -mimic) (B, E) were transfected in HPV8 E6 expressing and pLXSN control HaCaT cells. [score:3]
As expected from findings in normal human skin [36], miR-203 displayed a complementary expression pattern and was detected in suprabasal spinous as well as granular layers but not in basal or parabasal keratinocytes (Fig 1C). [score:3]
A major target of miR-203 in suprabasal keratinocytes is the transcription factor p63, a member of the p53 family [20, 21]. [score:3]
HPV8 E7 alone had a less strong effect but enhanced the impact of E6, particularly on miR-203 suppression. [score:3]
MiR-203 was up-regulated by 1.2 mM Ca [2+] after 72 h as shown by and qRT-PCR in control cells. [score:3]
Differentiation suppression by HPV8 E6 involves the miR203/p63-pathway. [score:3]
C/EBPα is a direct transcriptional regulator of miR-203. [score:3]
The hsa-miR-203 mimic reduced p63 protein and ΔNp63α mRNA levels in the controls and reverted p63 almost to basal levels in HPV8 E6 expressing HaCaT cells (see Fig 4G and 4H, S3B Fig). [score:3]
HPV8 E6 expressing cells were scratched 24 h after 10 nM p63-siRNA (or si-control) (D), or 20 nM miR-203 -mimic transfection (or control -mimic) (E) and analyzed as in (B). [score:3]
This suggests that miR-203 and further targets aside from ΔNp63α might play a broader role in E6 -mediated reprogramming of the host cell during cutaneous beta-HPV infection. [score:3]
This pattern matched well with miR-203 expression pattern in the same biopsy (Fig 7D). [score:3]
This potently suppressed miR-203 (Fig 6G). [score:3]
Notably, in lesional skin of EV-patients p63 -expressing cell layers were dramatically expanded and this corresponded to an almost complete absence of miR-203 (Fig 1B and 1D). [score:3]
Since miR-203 and p63 are major regulators of epidermal homeostasis, which may be disturbed during genus beta-HPV infection in vivo, we compared expression patterns of both factors in non-lesional and HPV8 -positive lesional skin of EV-patients. [score:3]
p63 and miR-203 regulation in EV-lesions and by HPV8 oncoproteins in NHK in vitro. [score:2]
HPV8 E6 engages the miR-203/p63-pathway to regulate key keratinocyte functions. [score:2]
When compared to HPV8 wildtype-E6, the Δ8E6 mutant was unable to suppress miR-203 and involucrin and to induce p63 at mRNA and protein levels in NHK (Fig 6C–6F). [score:2]
While miR-203 function has been intensively investigated, little is known about the regulation of miR-203 expression in human keratinocytes. [score:2]
MiR-203 is also suppressed by mucosal HR-HPV, and this is necessary to maintain genome amplification in keratinocytes under differentiating conditions [30]. [score:2]
PMA activates several differentiation-inducing pathways including transcription factors of the AP-1- and C/EBP-families, which are both involved in PMA -induced miR-203 regulation ([23] and this study). [score:2]
How p53 affects miR-203 is currently unclear, since p53 did not directly bind to predicted binding sites within the miR-203 promoter [31]. [score:2]
MiR-203 is a suppressor of self-renewal in skin [22]. [score:2]
In order to corroborate our findings in vivo we stained skin sections of EV-patients for C/EBPα and compared the respective expression patterns to miR-203 by in situ hybridization. [score:2]
Lack of miR-203 promoter activation by C/EBPα using constructs comprising a mutated C/EBPα binding site confirmed a direct effect of C/EBPα on miR-203 transcription. [score:2]
HPV16 E6 can regulate miR-203 via p53 [31]. [score:2]
The finding that C/EBPα, a member of the CCAAT/enhancer -binding protein family, is involved in miR-203 regulation is particularly interesting. [score:2]
PMA strongly stimulated this miR-203-reporter construct in NHK (Fig 5H), while knock-down of C/EBPα significantly reduced basal as well as PMA-stimulated reporter activity. [score:2]
2.5x10 [5] cells were seeded into 6-well plates and transfected the next day with 10 nM siRNA directed against p63, p300, C/EBPα, 20 nM hsa-miR-203 mimic or control siRNA (S1 Table) and 5 μl Lipofectamine RNAiMax reagent (Invitrogen, Darmstadt, Germany). [score:2]
These results demonstrated a direct role of C/EBPα for miR-203 transcription. [score:2]
The short hsa-miR-203 promoter (+47 nt to +73 nt) was generated by direct cloning of annealed oligonucleotides into pGL3Basic vector (wildtype: 5’- CGCGTCAGTTCTGTA GCGCAATTGTGAAATGT C-3’ and 5’- TCGAGACATTTCACA ATTGCGCTACAGAACTG A-3’; mutated: 5’- CGCGTCAGTTCTGTAGC TC GA GTGTGAAATGT C-3’ and 5’- TCGAGACATTTCACA CT CG AGCTACAGAACTG A-3’). [score:2]
Together these data provided evidence that p300 binds to the regulatory region of C/EBPα, a novel inducer of miR-203, and that HPV8 E6 interferes with this binding activity. [score:2]
Similar results were obtained when drastically shortened forms of a miR-203 reporter construct (+47 nt to +73 nt) were used comprising either the wildtype or the mutated C/EBPα-BS but largely omitting other regulatory regions within the miR-203 gene, (Fig 5J). [score:2]
1006406.g008 Fig 8 A novel p300/C/EBPα/miR-203 -dependent pathway by which the cutaneous HPV8 E6 protein may expand p63 -positive keratinocytes and disturb epidermal homeostasis. [score:1]
This process is governed by microRNA-203 (miR-203), which promotes epidermal differentiation and induces cell-cycle exit [20– 22]. [score:1]
In summary, we have identified a novel p300/C/EBPα/miR-203/p63 pathway important for epidermal homeostasis. [score:1]
5 nM hsa-miR-203 detection probe (cat. [score:1]
ΔNp63α mRNA was determined in relation to RPL13A, miR-203 level to RNU6B by the 2 [ΔΔCt] method. [score:1]
Mucosal HR-HPV E7 interfered with differentiation -induced miR-203 involving the PMA-inducible MAPK/PKC-pathway [30]. [score:1]
These experiments demonstrated for the first time binding of the transcription factor C/EBPα to a specific binding site within the miR-203 gene. [score:1]
Cells transfected with p63 siRNA or hsa-miR-203 were scratched 24 h after transfection. [score:1]
Our data provide evidence for a novel p300/C/EBPα/miR-203 -dependent pathway, which links HPV8 infection to the expansion of p63 -positive cells in the epidermis of EV-patients. [score:1]
The following antisense probe was used to detect miR-203: 5’-GTGAAATGTTTAGGACCACTAG-3’. [score:1]
1006406.g001 Fig 1Sections of non-lesional skin (A, C) and HPV8 -positive lesional skin (B, D) from EV-patients were stained using antibodies against p63 (A, B) or probes against miR-203 (C, D). [score:1]
HPV8 E6 involves the miR203/p63-pathway to reprogram keratinocyte functions. [score:1]
In silico analysis of the miR-203 gene revealed a C/EBPα binding site (GCGCAAT, nt +57 to +63) within the miR-203 hairpin sequence. [score:1]
siRNA and hsa-miR-203 mimic sequences. [score:1]
These data provided evidence that keratinocyte reprogramming by HPV8 E6 involves the miR-203/p63 pathway. [score:1]
A novel p300/C/EBPα/miR-203 -dependent pathway by which the cutaneous HPV8 E6 protein may expand p63 -positive keratinocytes and disturb epidermal homeostasis. [score:1]
1006406.g007 Fig 7Sections of non-lesional skin (A, D) and HPV8 -positive lesional skin (B, C, E, F) from EV-patients were stained in red using antibodies against C/EBPα (A-C) and in blue by in situ hybridization with a probe against miR-203 (D-F). [score:1]
Sections of non-lesional skin (A, D) and HPV8 -positive lesional skin (B, C, E, F) from EV-patients were stained in red using antibodies against C/EBPα (A-C) and in blue by in situ hybridization with a probe against miR-203 (D-F). [score:1]
1006406.g005 Fig 5. (A-C) NHK stably expressing HPV8 E6 or corresponding pLXSN control cells were stimulated with 50 ng/ml PMA for 24 h. (A) miR-203 levels were measured in qRT-PCR and normalized to RNU6B by the 2 [ΔΔCt] method. [score:1]
Immunohistochemical staining and miR-203 in situ hybridization. [score:1]
Our data demonstrate that C/EBPα can bind to a predicted binding site within the miR-203 gene [22] thereby stimulating miR-203 transcription. [score:1]
miRNA was transcribed using TaqMan MicroRNA RT Kit (Life technologies) with oligonucleotides for hsa-miR-203 and hsa-RNU6B in each reaction. [score:1]
The hsa-miR-203 promoter (-1165 nt to +70 nt; nomenclature according to [51] was amplified from human DNA using 5’- ACGCGTTGCTGCCCAACCCCATAC-3’ and 5’- CTCGAGCTCCCCTGGATTGGTCGC-3’ (restriction enzyme sequences in italics) and cloned upstream a firefly luciferase into pGL3-Basic vector (Promega, Madison, USA). [score:1]
The impact of HPV8 E6 on mir-203, p63 and involucrin expression was also investigated in NHK after stimulation with phorbol 12-myristate 13-acetate (PMA), which induces differentiation in cultured normal human keratinocytes [34, 40]. [score:1]
[1 to 20 of 101 sentences]
5
[+] score: 317
Other miRNAs from this paper: hsa-mir-203b
Previous reports have shown that EIF5A2 is frequently upregulated in CRC and promotes CRC cell migration and invasion 26, and our results suggest that miR-203 downregulates the expression of EIF5A2 at the mRNA and protein levels by directly binding to its 3′ UTR. [score:10]
Compared with the adjacent non-tumor mucosal tissues, the EIF5A2 mRNA was significantly upregulated in 72 CRC tissues and this upregulation was strongly correlated with the downregulation of miR-203 (Fig. 5G,H). [score:9]
In addition, the overexpression of EIF5A2 markedly abrogated miR-203 -mediated suppression of these events, indicating that miR-203 regulates CRC proliferation and invasion, at least partly, by directly blocking EIF5A2 expression. [score:9]
In contrast, the downregulation of miR-203 with a miR-203 inhibitor resulted in a significant increase in the expression of EIF5A2 in SW480 cells (Fig. 5E). [score:8]
Further studies demonstrated that the overexpression of miR-203 suppresses in vitro cell proliferation and invasion, promotes apoptosis, and inhibits in vivo tumor growth and metastasis. [score:7]
These data indicate that miR-203 might act as a tumor suppressor and that its over -expression in cancer cells might inhibit cell proliferation. [score:7]
The controversial results suggested that the functions of miR-203 were possibly related to its tissue- and time -dependent expression during distinct cellular processes and the expression levels of its target genes. [score:7]
These findings indicated that miR-203 might negatively regulate the expression of EIF5A2 by directly targeting its 3′-UTR. [score:7]
Conversely, the effective knockdown of miR-203 with miR-203 inhibitors significantly enhanced the proliferation (Supplementary Figure 2A,B) and decreased the apoptotic levels (Supplementary Figure 2C) of SW480 cells, which have a relatively higher endogenous miR-203 expression. [score:6]
Moreover, we also found that the overexpression of miR-203 significantly suppressed tumor growth, invasion and metastasis of CRC by targeting EIF5A2 in vitro and in vivo assays. [score:6]
The bioinformatic algorithm TargetScan was used to predict EIF5A2 as a putative target for miR-203, which might contribute to its tumorigenic functions in CRC (Fig. 5A). [score:5]
Moreover, the overexpression of miR-203 led to a significant decrease in EIF5A2 expression at both the mRNA (Fig. 5C) and protein levels (Fig. 5D). [score:5]
To elaborate the molecular mechanisms by which miR-203 suppresses CRC growth and metastasis, we searched for candidate target genes of miR-203 that might be involved in the pathogenesis of CRC. [score:5]
These findings indicate that miR-203 is a tumor suppressor gene and represents a potential therapeutic target and prognostic marker for CRC. [score:5]
The overexpression of miR-203 inhibited CRC growth and invasion via a repression of EIF5A2 in vitro and in vivo. [score:5]
Our results indicated that miR-203 induced the expression of E-cadherin and β-catenin but repressed the expression of MMP-9, vimentin, MTA1 and RAC1 (Fig. 4C). [score:5]
In conclusion, our data further confirmed that miR-203 suppressed tumor growth and invasion by repressing EIF5A2 expression. [score:5]
Consistent with the in vitro results, the overexpression of miR-203 in LOVO cells significantly suppressed the overall tumor growth in vivo (Fig. 3D). [score:5]
Therefore, we hypothesized that the up-regulation of EIF5A2 directly mediates miR-203-medicated cancer biology. [score:5]
MiR-203 suppresses CRC tumor growth in vitro and in vivoTo determine whether miR-203 had an effect on the malignant phenotype of CRC cells, we established SW620 and LOVO colon cancer cell lines that stably express miR-203. [score:5]
In addition, CRC patients with low miR-203 expression had worse prognoses than did patients with a high miR-203 expression. [score:5]
The ectopic EIF5A2 expression in the miR-203-transduced cells attenuated the inhibitory effect of miR-203 on CRC growth (Fig. 6A,B). [score:5]
The overexpression of miR-203 significantly inhibited the proliferation of CRC cells (Fig. 3A). [score:5]
MiR-203 inhibits CRC migration and invasion in vitro and in vivoGiven that the expression of miR-203 is associated with the metastatic property of CRC, we wondered whether miR-203 plays a potential role in CRC cell invasion and metastasis. [score:5]
To evaluate the clinical significance of miR-203 expression, we divided the CRC patients into two groups (low and high miR-203 expression) with the median miR-203 expression levels serving as the cutoff point between the two groups. [score:5]
To further elaborate on this critical issue, we forced EIF5A2 expression in SW620 and LOVO cells stably expressing miR-203, which was confirmed by a western blot analysis (Fig. 6D). [score:5]
How to cite this article: Deng, B. et al. MiRNA-203 suppresses cell proliferation, migration and invasion in colorectal cancer via targeting of EIF5A2. [score:4]
The downregulation of miR-203 was correlated with an increased and more-advanced TNM stage and lymph node metastasis. [score:4]
miR-203 directly targets EIF5A2. [score:4]
miR-203 was downregulated in the CRC clinical specimens and the human CRC cell lines. [score:4]
In summary, our findings demonstrated that miR-203 is down-regulated and is inversely related to TNM stage and lymph node metastasis in CRC. [score:4]
Taken together, these results indicated that EIF5A2 was a direct functional downstream target of miR-203 in CRC cells. [score:4]
Relationship between the clinicopathological factors and miR-203 expression in primary CRC. [score:3]
The lentiviral constructs expressing miR-203 were packaged with the pPACKH1 lentivector packaging kit (SBI) in HEK293T cells using the X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland). [score:3]
do) were used to predict the potential target genes of miR-203. [score:3]
However, other reports found that miR-203 was overexpressed and acted as an oncogene in bladder cancers 28 and pancreatic adenocarcinoma 29. [score:3]
Given that the expression of miR-203 is associated with the metastatic property of CRC, we wondered whether miR-203 plays a potential role in CRC cell invasion and metastasis. [score:3]
pcDNA3.1-EIF5A2 or the control plasmid pcDNA3.1(+) and inhibitors of miR-203 and scrambled oligonucleotide controls were transfected into CRC cells in 6-well plates using the X-tremeGENE HP DNA Transfection Reagent according to the manufacturer’s instructions. [score:3]
These results demonstrated that miR-203 inhibited not only tumor growth and metastasis but also reversed chemoresistance in CRC. [score:3]
The effects of miR-203 overexpression can be reversed by the induction of EIF5A2. [score:3]
There was no statistically significant association between miR-203 expression and the other clinicopathological parameters, including age, gender, tumor size, location, and histological grade. [score:3]
To further explore the role of miR-203 in tumor invasion and metastasis in vivo, we injected LOVO-miR-203 cells that were stably expressing miR-203 or vector -transfected control cells into nude mice through the tail vein. [score:3]
Consistent with the data obtained from the CRC clinical specimens, miR-203 was downregulated in all of the CRC cell lines compared with the normal HIEC line (Fig. 1D). [score:3]
As shown in Fig. 2C, the protein levels of Bcl-2, Mcl-1, cyclin D1, and p-AKT were decreased, but Bax was increased in SW620 and LOVO cells that stably overexpress miR-203 (Fig. 3C). [score:3]
In contrast, the migration and invasiveness of SW480 cells increased when endogenous miR-203 was silenced with a miR-203 inhibitor (Supplementary Figure 3). [score:3]
Furthermore, to identify whether miR-203 is perturbed, not only during cancer initiation but also during CRC progression, we examined the expression levels of miR-203 at different stages of CRC. [score:3]
In addition, the overexpression of miR-203 enhanced the sensitivity of paclitaxel to p53-mutated colon cancer cells. [score:3]
To understand the prognostic significance of miR-203 in CRC, a Kaplan-Meier survival analysis was performed to assess the relationship between the expression of miR-203 and the overall survival. [score:3]
Differences between the groups were determined by a Student’s t-test (two tailed), and the relationship between EIF5A2 and miR-203 expression was explored by a Spearman’s correlation. [score:3]
In this study, we first confirmed that the expression of miR-203 in CRC tissues was significantly lower than in adjacent non-tumor mucosa tissues. [score:3]
Similarly, the restoration of EIF5A2 significantly promoted HCC cell invasion, which was inhibited by miR-203 (Fig. 6C). [score:3]
A reduction in the levels of miR-203 in the primary tumors with metastasis was also noted compared to the primary tumors without metastasis (P < 0.05) (Fig. 1B), which suggested that the downregulation of miR-203 was closely related to the increase of CRC metastasis. [score:3]
To determine whether miR-203 had an effect on the malignant phenotype of CRC cells, we established SW620 and LOVO colon cancer cell lines that stably express miR-203. [score:3]
We further examined miR-203 expression in a series of human CRC cell lines and a normal HIEC line. [score:3]
miR-203 did not have an effect on the luciferase activity of the EIF5A2-MUT2 luciferase reporter (Fig. 5B), which indicated that miR-203 mediated the expression of EIF5A2 by binding the 2697–2703 nucleotide of the EIF5A2 3′ UTR. [score:3]
Univariate and multivariate analyses of the association of prognosis with clinicopathologic parameters and miR-203 expression in CRC patients. [score:3]
miR-203 inhibited cell growth and tumor growth. [score:3]
MiRNA negative control (scramble control inhibitor) and anti-miR-203 were obtained from Dharmacon (Austin, TX, USA) and transfected with the X-tremeGENE HP DNA Transfection Reagent (Roche) in SW480 cells at a final concentration of 50 nM. [score:3]
miR-203 suppresses cell migration and invasion in vitro and in vivo. [score:3]
Survival curves of the CRC patients according to miR-203 expression. [score:3]
Interestingly, the SW620 and LOVO cells, which have high metastatic capacities, expressed the lowest levels of miR-203. [score:3]
MiR-203 is downregulated in CRC tissues. [score:3]
In this study, we revealed that miR-203 expression was significantly lower in CRC tissues and was associated with tumor-node-metastasis stage, lymph node metastasis and a poor prognosis in CRC patients. [score:3]
RNA was quantified using a NanoDrop 2000 (Nano-drop Technologies, Wilmington, DE, USA) and stored at −80 C. For miR-203 expression, a stem-loop reverse transcription-polymerase chain reaction (RT-PCR) was carried out using an All-in-One™ miRNA quantitative RT-PCR (qRT-PCR) Detection Kit (GeneCopoeia, Rockville, MD, USA) according to the manufacturer’s protocols. [score:3]
MiR-203 directly targets EIF5A2 in CRC cells. [score:3]
Taken together, these observations indicated that miR-203 significantly inhibits CRC cell migration and invasion in vitro and in vivo. [score:3]
We further identified EIF5A2 as a downstream target gene of miR-203 using a luciferase assay and a western blot. [score:2]
MiR-203 inhibits CRC migration and invasion in vitro and in vivo. [score:2]
MiR-203 suppresses CRC tumor growth in vitro and in vivo. [score:2]
qRT-PCR analyses were used to confirm the knockdown efficacy of miR-203 after a 48 h transfection. [score:2]
The apoptosis assays demonstrated that miR-203 overexpression significantly promoted apoptosis in SW620 and LOVO cells (Fig. 3B). [score:2]
The results showed that miR-203 expression was significantly lower in CRC tumor tissues compared to adjacent non-tumor tissues (Fig. 1A). [score:2]
A mutation was generated in the EIF5A2 3′UTR sequence at the complementary site for the seed region of miR-203. [score:2]
Moreover, a univariate analysis showed that miR-203, lymph node metastasis, and tumor-node-metastasis stage were significantly associated with overall survival (OS) in CRC patients (Table 2). [score:1]
The sequence containing the pre-miR-203 was amplified by PCR and inserted into the lentiviral plasmid pCDH-CMV-EF1-copGFP vector (System Biosciences, Mountain View, CA, USA) to generate pCDH-miR-203 (miR-203). [score:1]
To further explore the biological functions of miR-203 in CRC cells, we determined the effect of miR-203 on cell growth and invasion. [score:1]
Interestingly, the patients with higher plasma miR-203 levels had a better overall survival (Fig. 2B). [score:1]
Further experiments revealed that miR-203 is anti-proliferative and anti-invasive and its proapoptotic effects occur through alterations of the PI3K/Akt and β-catenin pathways and multiple genes. [score:1]
These results suggested that miR-203 is decreased in CRC and might play an important role in CRC progression. [score:1]
The median survival time was 54 months in the miR-203 low group (n = 40) and 77 months in the miR-203 high group (n = 32). [score:1]
The results showed that reduced miR-203 levels were significantly associated with shorter overall survival times (P < 0.001) (Fig. 2A). [score:1]
Transwell assays without Matrigel suggested that miR-203 dramatically inhibits the migration of SW620 and LOVO cells when compared with the vector groups (Fig. 4A). [score:1]
To create a 3′-UTR luciferase reporter construct of EIF5A2, a wild-type 3′UTR segment of EIF5A2 that contains putative miR-203 binding sites was amplified and cloned into the XhoI and NotI sites downstream of the luciferase reporter gene in psiCHECK-2 (Promega, Madison, WI, USA). [score:1]
Whether miR-203 is involved in the malignant behavior of human colorectal cancer cells remains unclear. [score:1]
The luciferase assays revealed that the overexpression of miR-203 significantly reduced the luciferase activity of the EIF5A2-WT (P < 0.01) and EIF5A2-MUT2 (P < 0.01) luciferase reporters when compared with the vector (Fig. 5B). [score:1]
Lower levels of miR-203 are associated with poor clinicopathological features and prognosis in CRC. [score:1]
A significant inverse correlation between the levels of miR-203 and EIF5A2 was also observed in the CRC tissues by a Pearson correlation analysis. [score:1]
A multivariate analysis showed that miR-203 was an independent prognostic indicator for OS (Table 2). [score:1]
We found that miR-203 levels decreased during CRC progression (Fig. 1C). [score:1]
The statistical analysis of the 72 cases of CRC revealed that lower levels of miR-203 were significantly associated with the clinical tumor-node-metastasis stage and lymph node metastases (P < 0.01) (Table 1). [score:1]
We conducted mutagenesis of the 3′-UTR in the miR-203 seed complementary site as described previously 36. [score:1]
To verify the in silico prediction, luciferase reporter constructs carrying the 3′ UTR miR-203 potential -binding site or one of two mutant -binding sites of EIF5A2 were created and co -transfected with miR-203 or a vector into HEK293T cells. [score:1]
To further confirm that miR-203 directly interacts with EIF5A2, an RNA pull-down assay was utilized to explore the miR-203 -mediated binding of RISC to the EIF5A2 mRNA. [score:1]
EIF5A2 is involved in miR-203 -mediated CRC cell proliferation, migration and invasion. [score:1]
[1 to 20 of 94 sentences]
6
[+] score: 312
Ectopic expression of miR-203a-3p inhibited while inhibiting miR-203a-3p expression increased NPC cell proliferation, migration and invasion in vitro. [score:9]
In addition, wound healing assay and transwell migration and invasion assays showed that up-regulation of miR-203a-3p significantly suppressed cell migration (Fig.   3d and f, P < 0.01) as well as invasion ability (Fig.   3e, P < 0.01) while inhibiting miR-203a-3p expression could enhance cell migration and invasion (Fig.   3d-f, P < 0.01) in the two NPC cell lines. [score:8]
As shown in Fig.   5b and c, miR-203a-3p up-regulation inhibited LASP1 expression both on protein and mRNA levels. [score:8]
In summary, our study demonstrated that miR-203a-3p is downregulated in NPC, and miR-203a-3p inhibited NPC cell proliferation and metastasis through targeting LASP1. [score:8]
Ectopic expression of miR-203a-3p significantly suppressed cell proliferation, migration and invasion in vitro, and inhibited tumor growth and metastasis in NPC in vivo. [score:7]
LASP1 level was inhibited by ectopic miR-203a-3p expression, while LASP1 plasmid transfection restored its expression in NPC cells both in miR-203a and miR-ctrl groups (Fig.   6a). [score:7]
In this study, we found that the mature form of miR-203, miR-203a-3p, was downregulated in NPC tissues and could suppress cell proliferation and metastasis both in vitro and in vivo. [score:6]
Moreover, up-regulation of LASP1 also abrogated the suppressive effects of miR-203a-3p on migration and invasion in NPC cells in vitro (Fig.   6d-f, P < 0.05). [score:6]
LASP1 up-regulation partially reversed the miR-203a-3p -mediated inhibition of cell proliferation (Fig.   6b, P < 0.01) and colony formation ability (Fig.   6c, P < 0.05). [score:6]
These data suggest that miR-203a-3p was down-regulated in NPC and may function as a tumor suppressor. [score:6]
Given our discovery that miR-203a-3p is frequently downregulated in NPC tissues, outlining a potential molecular target for NPC treatment. [score:6]
Data are presented as mean ± S. D. MiR-203a-3p expression profile in 62 NPC and 6 normal nasopharyngeal epithelial samples using GEO database c. P-value was calculated using the Student’s t-test The effects of miR-203a-3p on cell proliferation, migration and invasion were then evaluated in two representative NPC cell lines: CNE2 and SUNE1, through overexpressing (Fig.   2a) and inhibiting (Fig.   3a) miR-203a-3p expression. [score:5]
Ectopic expression of miR-203a-3p significantly suppressed the proliferative, migratory and invasive capabilities of NPC cells in vitro. [score:5]
Relative expression of miR-203a-3p in NP69 and NPC cell lines by real-time PCR a. Relative expression of miR-203a-3p in normal nasopharyngeal epithelial (n = 7) and NPC tissues (n = 16) b. Each experiment was independently repeated for at least three times. [score:5]
Furthermore, ectopic expression of miR-203a-3p inhibited NPC xenograft tumor growth and lung metastases in vivo. [score:5]
Collectively, miR-203a-3p suppresses tumor growth and metastasis through targeting LASP1 in NPC. [score:5]
Ectopic expression of miR-203a remarkably inhibited tumor growth 18 days after tumor formation (Fig.   4a and b; P < 0.01). [score:5]
These results confirmed that miR-203a-3p mediated NPC tumor suppression through inhibiting LASP1. [score:5]
LASP1 over -expression partially abrogated the tumor suppression by miR-203a-3p in NPC cell lines. [score:5]
b- f Overexpression of LASP1 abrogated the inhibition on cell proliferation, migration and invasion by miR-203a-3p. [score:5]
In addition, ectopic expressing of LASP1 partially reversed the miR-203a-3p -mediated inhibition of proliferation, migration and invasion in NPC in vitro. [score:5]
of the LASP1 mRNA 3′-UTR sequences targeted by miR-203a-3p a. Quantification of LASP1 mRNA levels by quantitative RT-PCR b and LASP1 protein expression by western blotting c after transfection with miR-203a-3p mimic or miR-Ctrl. [score:5]
A recent study screened for differentially expressed miRNAs in NPC tissues through high-throughput microarray assays and found that miR-203 may down-regulated in NPC tissues [19]. [score:5]
Ectopic expression of LASP1 partially reversed miR-203a-3p -mediated inhibition on proliferation, migration and invasion in NPC cells. [score:5]
Ectopic expression of miR-203a-3p inhibited LASP1 level both on protein and mRNA level. [score:5]
As shown by our results, miR-203a-3p expression was significantly downregulated in NPC cell lines when compared with the immortalized nasopharyngeal epithelial cell line NP-69 [31, 32] (Fig.   1a). [score:5]
In the present study, we confirmed that the mature form of miR-203, miR-203a-3p, was down-regulated in both NPC cell lines and tissue samples. [score:4]
As shown in Fig. 2b and c, ectopically miR-203a-3p expression significantly inhibited proliferation and colony formation ability compared with the control groups in CNE2 and SUNE1 cells (P < 0.01). [score:4]
miR-203a-3p was reported as a tumor suppressor and disregulated in many malignancies including nasopharyngeal carcinoma (NPC). [score:4]
Moreover, data from the GEO database also confirmed that miR-203a-3p was significantly down-regulated in nasopharyngeal carcinoma (n = 62) in comparison with normal nasopharyngeal samples (n = 6) (GSE36682) (Fig. 1c, P < 0.001). [score:4]
Fig. 5LASP1 is a direct target of miR-203a-3p in NPC cells. [score:4]
In the present study, we identified LASP1 as a direct target of miR-203a-3p in nasopharyngeal carcinoma, in agreement with previous findings in head and neck cancer, breast cancer, esophageal carcinoma, prostate and lung cancers [22– 28]. [score:4]
Data are presented as mean ± S. D. ; ** P < 0.01 compared with the Lenti-vector group, Student’s t-test To explore the molecular mechanism by which miR-203a-3p exerts its biological function, we identified LASP1 as a potential target for miR-203a-3p using two publicly available databases (Targetscan and miRanda, Fig.   5a). [score:4]
These results indicate that LASP1 is a functional target of miR-203a-3p in regulating NPC cell proliferation and metastasis. [score:4]
To determine that whether LASP1 is a direct target of miR-203a-3p, CNE-2 and SUNE-1 cells were co -transfected with miR-203a-3p mimic or miR-Ctrl (50 nM, RiboBio) and the pSin-EF2-puro-LASP1 (LASP1) or empty pSin-EF2-puro-Vector (Vector) (2 μg; Addgene, Cambridge, MA, USA). [score:4]
Furthermore, LASP1 was identified as a direct target of miR-203a-3p in NPC. [score:4]
LASP1 is a direct target of miR-203a-3p in NPC cells. [score:4]
The dysregulation of miR-203a-3p indicated a potential tumor suppressor role in NPC. [score:4]
Fig. 6LASP1 is involved in miR-203a-3p mediated tumor suppression. [score:3]
CNE2 and SUNE1 cells were transfected with miR-203a-3p inhibitor (Anti-miR-203a, 100 nM), negative control (Anti-Ctrl, 100 nM) or PBS (Blank). [score:3]
On the contrary, miR-203a-3p inhibition significantly increased cell proliferation (Fig.   3b, P < 0.01) and colony formation ability (Fig.   3c P < 0.01) in NPC in vitro. [score:3]
Taken together, these results indicate that miR-203a-3p act as a tumor suppressor in NPC cell lines in vitro. [score:3]
MiR-203 has been reported down-regulated in NPC tissues through microarray analysis [19]. [score:3]
Dual-luciferase reporter assay was used to identify the direct target of miR-203a-3p. [score:3]
A photograph of nude mice carrying tumors a. Volumes of all tumors were detected every 3 days b. SUNE-1 cells stably overexpressing miR-203a (Lenti-miR-203a) or negative control empty lenti-vector (Lenti-vector) were intravenously injected via the tail vein and the formation of lung metastases was assessed after 8 weeks. [score:3]
Each experiment was independently repeated at least three times MiR-203, which is now named as miR-203a, have been demonstrated to be an important tumor suppressor participating in the pathogenesis of esophageal [24, 33], prostate [23, 34], lung cancers [27, 35] including nasopharyngeal carcinoma [19– 21]. [score:3]
The newly identified miR-203a-3p/LASP1 pathway provides further insights into the initiation and progression of NPC, which may represent a novel therapeutic target for NPC. [score:3]
LASP1 was identified as a direct target of miR-203a-3p, which was confirmed by real-time PCR and western blotting assay. [score:3]
Taken together, these findings suggest that miR-203a suppresses tumor growth and metastasis in NPC in vivo. [score:3]
The expression profiles of miR-203a-3p were also investigated in NPC tissues obtained from Gene Expression Omnibus (GEO) (http://www. [score:3]
MiR-203a-3p is down-regulated in NPC cell lines and tissues. [score:3]
To explore the effect of miR-203a-3p on NPC cells, CNE-2 and SUNE-1 cells were transfected with miR-203a-3p mimic, miR-203a-3p inhibitor and their respective negative control(RuiboBio) using Lipofectamine 2000 reagent (Invitrogen). [score:3]
Expression levels of miR-203a-3p were further investigated in NPC tissues, which was found to be significantly downregulated in NPC tissues as compared with normal nasopharyngeal epithelial tissues (Fig. 1b, P = 0.03). [score:3]
SUNE1 cells stably overexpressing miR-203a (Lenti-miR-203a) or negative control empty pSin-EF2-vector (Lenti-vector) were subcutaneously injected into right flank of each nude mouse (n = 6). [score:3]
MiR-203a-3p/LASP1 pathway may provide novel insight into the molecular mechanisms regulating progression of NPC, and may provide novel therapeutic targets for the treatment of NPC. [score:3]
Up to now, this is the first study which confirmed the proliferation, migration and invasion suppressive effect of miR-203a-3p in NPC both in vitro and in vivo. [score:3]
LASP1 is involved in miR-203a-3p mediated tumor suppression. [score:3]
The expression level of miR-203a-3p in human NPC tissues and cell lines was detected via real-time PCR (RT-PCR). [score:3]
Additionally, the LIM and SH3 domain protein (LASP1) was identified as a functional target of miR-203a-3p as previously reported in other malignancies such as esophageal squamous cell carcinoma, breast cancer etc. [score:3]
When cells were transfected with the Wt LASP1 3’-UTR, co-transfection of miR-203a-3p inhibited luciferase activity significantly. [score:3]
At 24 h after transfection, lentiviruses expressing miR-203a (Lenti-miR-203a) or negative control empty lenti-vector (Lenti-vector) were harvested and used to infect SUNE-1 cells, and stably transfected cells were selected using puromycin and validated by quantitative RT-PCR. [score:3]
A recent study found that miR-203 reduced radioresistance of NPC cells through inhibiting IL-8/AKT pathway [21]. [score:3]
The expression of miR-203a-3p was decreased in NPC tissues and cell lines in comparison with normal nasopharyngeal tissues and cell line. [score:3]
Firstly, we established the xenograft tumor mo del by subcutaneously injecting SUNE-1 cells stably overexpressing pre-miR-203a sequence (Lenti-miR-203a) or empty lenti-vector (Lenti-vector) into the dorsal flank of nude mice. [score:3]
For the xenograft tumor growth mo del, 1 × 10 [6] SUNE-1 cells stably overexpressing miR-203a or negative control were suspended in 200 μl PBS, and then subcutaneously injected into the dorsal flank of the nude mice. [score:3]
To confirm this result, we detected miR-203a-3p expression in both NPC cell lines and tissues. [score:3]
For the metastasis assay, SUNE-1 cells stably overexpressing miR-203a or negative control were suspended in PBS, and 1 × 10 [6] cells (200 μl) were injected via the tail vein. [score:2]
Recent studies found that miR-203 participated in NPC radioresistance and chemoresistance through negatively-regulate IL8/AKT pathway and ZEB2 [20, 21], respectively. [score:2]
MiR-203a-3p suppresses NPC cell proliferation, invasion and migration in vitro. [score:2]
MiR-203 was reported to be down-regulated in NPC tissues through high-throughput microarray assay [19]. [score:2]
MiR-203a-3p inhibits tumor growth and metastasis in NPC in vivo. [score:2]
Data are presented as mean ± S. D. ; * P < 0.05; ** P < 0.01 compared with the miR-Ctrl group, Student’s t-test To further determine that LASP1 is one of the functional targets of miR-203a-3p, CNE2 and SUNE1 cells are co -transfected with either miR-203a-3p mimic or negative control (miR-203a or miR-Ctrl) and either the pSin-EF2-puro-LASP1 (LASP1) plasmid or empty pSin-EF2-puro-Vector (Vector) as control. [score:2]
Each experiment was independently repeated at least three times MiR-203 was reported to be down-regulated in NPC tissues through high-throughput microarray assay [19]. [score:2]
Microscopic observation of H&E staining slides revealed that metastatic nodules were significantly fewer and smaller in miR-203a group (Fig.   4e and f; P < 0.01). [score:1]
The function of miR-203a-3p in vivo was detected through NPC xenograft tumor growth and lung metastatic mice mo del. [score:1]
CNE2 and SUNE1 cells were transfected with miR-203a-3p mimic (50 nM), miR-Ctrl (50 nM), or the same volume of PBS (Blank). [score:1]
Nasopharyngeal carcinoma miR-203a-3p LASP1 Proliferation metastasis Nasopharyngeal carcinoma (NPC) is an endemic malignancy in China [1]. [score:1]
3′-UTR reporter plasmids (2 μg), and miR-203a-3p mimic (50 nM) or miR-Ctrl (50 nM) using Lipofectamine 2000 reagent (Invitrogen). [score:1]
Moreover, miR-203a-3p level was also decreased in NPC tissues in comparison with normal nasopharyngeal tissues. [score:1]
CNE-2 and SUNE-1 cells were co -transfected with either miR-203a-3p mimic or negative control (miR-203a or miR-Ctrl) and either the pSin-EF2-puro-LASP1 (LASP1) plasmid or empty pSin-EF2-puro-Vector (Vector). [score:1]
However, miR-203 expression in nasopharyngeal carcinoma and its biological function on proliferation and metastasis have barely been investigated in NPC. [score:1]
U6 or GAPDH were used as internal controls for miR-203a-3p and LASP1, respectively. [score:1]
Taken together, our data suggest that miR-203a-3p/LASP1 pathway may play an important role in NPC initiation and progression. [score:1]
LASP1 3′-UTR reporter genes (2 μg) and miR-203a-3p mimic or miR-Ctrl (50 nM) d. Each experiment was independently repeated at least three times. [score:1]
Eight weeks later, we found that lung metastatic nodules were significantly fewer in the miR-203a group than in the control group (Fig.   4c and d; P < 0.01). [score:1]
The pre-miR-203a sequence was cloned into the lentiviral plasmid pSin-EF2-puromycin (Addgene, Cambridge, MA, USA); pSin-EF2-miR-203a or negative control pSin-EF2-vector was then co -transfected into 293FT cells with the psPAX2 packaging plasmid (Addgene) and the pMD2. [score:1]
We then explored the biological function of miR-203a-3p in NPC. [score:1]
[1 to 20 of 87 sentences]
7
[+] score: 276
To assess whether miR-203 directly regulates SNAI2 expression through the target site in the 3′-UTR of SNAI2, reporter constructs containing either the wild-type (WT) SNAI2 3′-UTR or SNAI2 3′-UTR with mutation at the predicted miR-203 target sequence were cotransfected into U251AR cells together with miR-203, miRNA control, anti-miR-203 or anti-miRNA control. [score:10]
In summary, SNAI2 is upregulated in the imatinib-resistant GBM cells and a direct target of miR-203, and their expression is negatively correlated in GBM patients. [score:9]
Our findings suggest that after developing drug resistance, miR-203 expression is reduced leading to a higher expression of SNAI2 and other targets, and the cells become more mesenchymal-like and invasive. [score:7]
The direct targeting of SNAI2 by miR-203 led us to hypothesize that downregulation of SNAI2 by miR-203 in resistant GBM cells could be involved in drug resistance and/or EMT. [score:7]
Moreover, reintroduction of SNAI2 markedly antagonized the inhibitory effect of miR-203 on cell invasion (Figure 6F), abolished the mRNA expression of E-cadherin and restored ZEB1 and vimentin expression (Figure 6G). [score:7]
MiR-203 was among the top downregulated miRNAs in U87AR cells and its downregulation was further validated by qRT-PCR (Figure 3A). [score:7]
In this study, we screened for miRNAs that were differentially expressed in the imatinib-resistant GBM cells, and identified that miR-203 was significantly downregulated. [score:6]
As shown in Figure 3B, C, the IC50 values of imatinib, VP-16 and TMZ in the U251AR and U87AR cells transfected with miR-203 were significantly decreased by 1.9-3.3-fold, suggesting that upregulation of miR-203 expression could enhance the sensitivities of U251AR and U87AR cells to all the three anticancer drugs. [score:6]
miR-203 is downregulated in imatinib-resistant GBM cells and its re -expression sensitizes cells to anticancer drugs and reverses EMT-like properties. [score:6]
Moreover, we examined the expression of those EMT marker that we had analyzed upon overexpression of miR-203 and also after knockdown of SNAI2 (Figure 5H). [score:6]
As shown in Figure 4F, SNAI2 expression was negatively correlated with miR-203 expression in clinical GBM samples (Pearson's correlation r= −0.402, p=0.003). [score:5]
These results are supported by clinical data where we found an inverse correlation between the expression of miR-203 and its target SNAI2 in GBM samples. [score:5]
We found that miR-203 suppressed EMT and chemoresistance by targeting SNAI2 in GBM cells. [score:5]
In contrast, in U87 cells, which express low levels of SNAI2, miR-203 inhibition by transfection with anti-miR-203 increased the mRNA and protein levels of SNAI2 (Figure 4C, D). [score:5]
Ectopic expression of SNAI2 significantly rescued miR-203 -induced inhibition of drug resistance (Figure 6E). [score:5]
The predicted target genes of miR-203 were retrieved from miRTarBase and TargetScan databases. [score:5]
Moreover, miR-203 suppressed the EMT and chemoresistance of GBM cells by targeting SNAI2. [score:5]
Finally, to determine the potential clinicopathological implications of altered miR-203 expression, we examined the expression levels of miR-203 in the specimens from 80 patients with glioma by qRT-PCR. [score:5]
Silencing of SNAI2 increased E-cadherin expression and decreased the mesenchymal markers ZEB1 and vimentin, showing that the involvement of miR-203 in EMT could, at least in part, be via targeting SNAI2. [score:5]
Importantly, miR-203 may serve as an important molecular biomarker for the GBM patients with drug resistance problem and a target for treatment of this lethal disease. [score:5]
Moreover, patients with higher expression levels of miR-203 survived longer (p = 0.0017) than patients with lower expression levels (Figure 7D). [score:5]
To further define the involvement of SNAI2 in the suppression of chemoresistance and EMT by miR-203, SNAI2 was transfected into miR-203 -overexpressing U251AR cells. [score:5]
Finally, to examine the pathological relevance of this interaction, we detected the expressions of miR-203 and its target SNAI2 in human GBM tissues. [score:5]
These results demonstrate that miR-203 directly interacts with SNAI2 mRNA and represses its expression. [score:4]
Next we explored the roles of miR-203 and its target SNAI2 in regulating EMT and drug resistance in GBM cells. [score:4]
Downregulation of miR-203 correlates with chemotherapy resistance and poor patient survival in GBM. [score:4]
SNAI2 is a direct target of miR-203. [score:4]
In summary, our study indicates that miR-203 is an effective inhibitor of EMT and chemoresistance, and consequently has an important role in the development of GBM. [score:4]
Furthermore, downregulation of miR-203 confers tumorigenicity ability to esophageal squamous cell carcinoma cells [30]. [score:4]
Re -expression of miR-203 in U251AR and U87AR cells sensitizes cells to anticancer drugs and reverses EMT while knockdown of miR-203 promotes resistance to anticancer drugs in U251 and U87 cells. [score:4]
In this study, we demonstrated that the imatinib-resistant U251AR and U87AR cells underwent EMT, and miR-203 was downregulated in these cells and clinical relapsed GBM specimens. [score:4]
The half maximal inhibitory concentrations (IC50) values of anticancer drugs (imatinib, VP-16 and TMZ) in the imatinib-resistant cells and their parental cells transfected with miR-203 or anti-miR-203 were determined by cell counting kit-8 (CCK-8) assay to test the effect of miR-203 expression on the sensitivities of GBM cells to imatinib, VP-16 and TMZ. [score:4]
Previous studies have shown that miR-203 is downregulated in metastatic prostate cancer [28] and colorectal carcinoma [29]. [score:4]
Knockdown of SNAI2 could indeed partially phenocopy the effects observed on sensitization to anticancer drugs upon overexpression of miR-203 (Figure 5D). [score:4]
Low expression of miR-203 in GBM is associated with chemotherapeutic resistance and poor patient prognosis. [score:3]
However, the expression of miR-203 was positively correlated with the tumor grading (WHO I-II vs. [score:3]
Finally, we found that the expression of miR-203 was significantly reduced (p=0.0026) in relapsed GBM tissues (Figure 7C). [score:3]
qRT-PCR and western blotting analysis demonstrated that, in U251AR cells with high levels of SNAI2, restoration of miR-203 reduced the mRNA and protein expression of SNAI2 (Figure 4C, D). [score:3]
Silencing of SNAI2 phenocopies the effects of miR-203 re -expression on sensitization of U251AR cells to anticancer drugs and reversion of EMT. [score:3]
However, other reports also suggest that elevated expression of miR-203 in pancreatic tumors is associated with poorer survival [32]. [score:3]
These results indicate that miR-203 may have a dual function as both a tumor suppressor and an oncogene, depending on the cellular context and tumor type. [score:3]
Western blotting analysis showed that miR-203 significantly increased the expression of epithelial marker E-cadherin while decreased that of mesenchymal markers ZEB1 and vimentin in miR-203 -transfected U251AR and U87AR cells (Figure 3G). [score:3]
We further disclose that high expression of miR-203 predicts better prognosis in human GBM. [score:3]
To quantitate miR-203 expression, total RNA was polyadenylated and reversely transcribed using miRNAs qPCR Quantitation Kit (Genepharma, Shanghai, China). [score:3]
Transduction of miR-203 caused marked inhibition of the WT SNAI2 3′-UTR, but had no effect on mutant SNAI2 3′-UTR (Figure 4E). [score:3]
miR-203 targets SNAI2. [score:3]
Therefore, SNAI2 overexpression due to reduction of miR-203 may result in EMT and chemoresistance in GBM via these pathways. [score:3]
We cloned the miR-203 response element (wide type or mutated) in the 3′-untranslated regions (3′-UTR) of SNAI2 into psiCheck2 plasmid downstream of luciferase reporter gene. [score:3]
To further evaluated the clinical significance of miR-203 expression in chemotherapeutic resistance and patient prognosis of GBM, SNAI2 expression was detected in tissues from 35 cases of patients with primary GBM and 16 cases of patients with relapsed GBM by immunohistochemistry. [score:3]
Additionally, we found that miR-203 re -expression could induce cell apoptosis in U251AR and U87AR cells (Supplementary Figure 2). [score:3]
Additionally, miR-203 may relieve E-cadherin from transcriptional repression by targeting SNAI2 signaling. [score:3]
The relationship between SNAI2 and miR-203 expression was explored by Pearson correlation. [score:3]
Re -expression of miR-203 was capable not only of reversing EMT but also of sensitizing cells to anticancer drugs and reducing invasion and migration. [score:3]
The relationships between clinicopathologic characteristics and miR-203 expression levels in patients with glioma are summarized in Table 1. No significant association between miR-203 expression level and patient's sex or age was observed in any of the 80 glioma cases. [score:3]
Finally, we correlated the expression of miR-203 with the clinicopathological status and prognosis of GBM patients. [score:3]
Next, we asked whether miR-203 re -expression could reverse EMT-like properties of the imatinib-resistant GBM cells. [score:3]
Figure 3(A) qRT-PCR data validation of the downregulation of miR-203 in imatinib-resistant GBM cells compared with their parental cells, normalized to U6RNA, which was obtained from miRNA microarrays. [score:3]
A recent study by Ding et al. [31] described the tumor suppressive effects of miRNA-203 in breast cancer, showing that loss of miRNA-203 led to increased invasion and metastatic potential of the cell system, similar to the results we have shown in GBM. [score:3]
We next explored the molecular mechanisms responsible for the drug resistance and EMT-suppressive effect of miR-203. [score:3]
Our present data further demonstrate that and that miR-203 -mediated inhibition of SNAI2 is dependent on a conversed motif in the 3′-UTR of SNAI2. [score:3]
Expression of miR-203 was determined by qRT-PCR assay after miR-203 or anti-miR-203 was successfully transferred into U251AR or U87 cells, respectively (Supplementary Figure 1A, B). [score:2]
Meanwhile, miR-203 inhibition by anti-miR-203 substantially increased luciferase activities of WT SNAI2 3′-UTR compared with anti-miRNA control (Figure 4E). [score:2]
Thus, DNA methylation may be involved in the regulation of miR-203 in imatinib resistant GBM cells. [score:2]
To investigate whether SNAI2 is regulated by miR-203, we next transfected cells with miR-203 or anti-miR-203 and examined SNAI2 expression. [score:2]
Cells were transiently transfected with 100 nmol/l of miR-203 mimics (miR-203), antagomirs (anti-miR-203) and miRNA negative control, or 60 nmol/l short hairpin RNA (shRNA) specific to SNAI2, scrambled shRNA negative control (shNC) (Genepharma, Shanghai, China) by using Lipofectamine 2000 and OPTI-MEM I (Invitrogen). [score:1]
Figure 4(A) Sequence alignment of human miR-203 with 3′-UTR of SNAI2. [score:1]
The seed sequence of miR-203 (top) matches 3′-UTR of SNAI2 (middle). [score:1]
Associations between miR-203 expression levels and clinicopathologic characteristics in 80 patients with glioma. [score:1]
To explore the potential role of miR-203 in drug resistance and EMT, we used a miR-203 mimic (miR-203) and antagomir-203 (anti-miR-203) to modulate cellular levels of miR-203 in GBM cells. [score:1]
In contrast, the IC50 values of imatinib, VP-16 and TMZ in the U251 and U87 cells transfected with anti-miR-203 were increased by 2.4-3.2-fold (Figure 3D, E), indicating that loss of miR-203 promotes resistance to anticancer drugs. [score:1]
Importantly, the significance and clinical relevance of miR-203 were further demonstrated in GBM patients. [score:1]
Thus, it is a great strength of our present study which demonstrated that miR-203 reversed the resistance of GBM cells to three different anticancer drugs. [score:1]
Kaplan–Meier survival curves were generated to evaluate the correlation of miR-203 expression levels with survival rate. [score:1]
SNAI2 (also known as slug), a transcriptional repressor of E-cadherin, was one of the potential candidates, which gained our attention, because of the importance of SNAI2 in EMT and drug resistance [13, 14] and the high conservation of the putative miR-203 -binding sequences in the SNAI2 3′-UTR (Figure 4A). [score:1]
[1 to 20 of 74 sentences]
8
[+] score: 263
In summary, the expression of miR-203 is downregulated in lung cancer cells, and miR-203 can negatively regulate the expression of PKCα. [score:9]
miR-203 was reported to act as a tumor-suppressive microRNA, and its expression was downregulated in laryngeal carcinoma cells [37]. [score:8]
Because miR-203 functions in cell proliferation and migration by negatively regulating PKCα, the next step would be to search for the downstream target of PKCα; this target may be a common substrate, MARCKS, or the AKT-ERK pathway, which is regulated at least in part by miR-203 [41]. [score:7]
In conclusion, our results demonstrate that miR-203 directly recognizes the 3’-UTR of the PKCα mRNA transcript and binds to it to downregulate its expression. [score:7]
In view of the effects that miR-203 has in modulating cell migration through the inhibition of PKCα, we suggest the generation of an experimental metastasis mo del to investigate whether the overexpression of miR-203, or the knockdown of PKCα, would suppress metastasis in vivo. [score:6]
Consequently, overexpression of PKCα rescued miR-203 mediated downregulation of the proliferation rates of A549 cells (Figure 4F). [score:6]
Studies from another group showed that miR-203 expression was downregulated in the LNCaP, Du145, PC3, VCaP, and MDA-PCa-2b prostate cancer cell lines [38]. [score:6]
Our data suggest that miR-203 regulates the expression of PKCα at both the transcript and protein levels, and considering greater decrease in PKCα protein, it might act more on translational repression than mRNA degradation. [score:6]
We determined the proliferation rates of A549 cells with decreased expression of PKCα or overexpression of miR-203 using the Cell Counting Kit-8. In contrast with the control siRNA -transfected cells, cells transfected with si-PKCα proliferated at a significantly lower rate (Figure 4B). [score:5]
The ectopic expression of miR-203 in prostate cancer cell lines could influence proliferation, apoptosis, and migration [38, 39], whereas the overexpression of miR-203 in laryngeal carcinoma cells reduced cell viability and led to a cell cycle arrest in G1 phase [37]. [score:5]
B, representative images of Transwell analysis of A549 cells that were transfected with ncRNA, pre-miR-203, pre-miR-203 plus PKCα overexpression plasmid, or PKCα overexpression plasmid alone, are shown in the upper panel, and a statistical analysis is shown in the lower panel (mean ± S. D. ; ** p<0.01). [score:5]
To determine whether the overexpression of miR-203 had any effect on the levels of PKCα, we repeated the above experiments and examined the expression of PKCα protein and mRNA 24 h after transfection. [score:5]
miR-203 expression may have resulted in more apoptosis than treatments with si-PKCα because multiple apoptosis genes coordinately modulating cell apoptosis may be targeted by miR-203. [score:5]
For comparison, the expression levels of miR-203 in ncRNA -transfected cells were set at 1. The y-axis shows arbitrary units representing the relative miR-203 expression levels. [score:5]
Additionally, expression of miR-203 suppressed cell proliferation and migration in human triple -negative breast cancer cells [40]. [score:5]
Using quantitative real-time PCR analysis, we demonstrated that the expression of miR-203 was significantly lower in human lung cancer tissues than in the adjacent normal tissues (Figure 2A); in contrast, PKCα mRNA expression was noticeably higher in cancer cells (Figure 2B). [score:5]
With the help of three programs (TargetScan, PicTar and miRanda), we predicted that miR-203 targets the PKCα mRNA transcript. [score:5]
miR-203 inhibits the migration of A549 cells by targeting PKCα. [score:5]
F, cell viability assay at 12, 24, 36, and 48 h after transfection of A549 cells with ncRNA, pre-miR-203, pre-miR-203 plus PKCα overexpression plasmid, or PKCα overexpression plasmid alone (mean ± S. D. ; ** p<0.01; *** p<0.001). [score:4]
PKCα is a direct target of miR-203. [score:4]
To determine whether the negative regulatory effects miR-203 exerted on PKCα expression were mediated through the binding of miR-203 to the presumed sites in the 3’-UTR of the PKCα mRNA, we fused part of the PKCα 3’-UTR, which includes the predicted miR-203 binding sites, downstream of the firefly luciferase reporter plasmid. [score:4]
Compared to cells transfected with pre-miR-203, the cells transfected with pre-miR-203 and the PKCα overexpression plasmid exhibited significantly higher levels of PKCα (Figure 4D), suggesting that miR-203-resistant PKCα rescued the PKCα suppression caused by miR-203. [score:4]
Regulation of PKCα expression by miR-203. [score:4]
As shown in Figure 3D, mutations in the complementary seed sites almost fully rescued the repression of the reporter activity caused by the expression of pre-miR-203. [score:4]
Taken together, our data suggest that miR-203 probably modulate cell migration by downregulating PKCα. [score:4]
Taken together, miR-203 might regulate other genes, although PKCα is certainly an important target of miR-203 due to its effects on other cellular functions. [score:4]
These results suggest that miR-203 might promote cell apoptosis, but this effect only partially relies on its downregulation of PKCα. [score:4]
The role of miR-203 mediated PKCα downregulation in cell proliferation, apoptosis, and cell migration. [score:4]
These results suggest that miR-203 might inhibit cell proliferation by silencing PKCα. [score:3]
Differential expression patterns of miR-203 and PKCα in human lung cancer tissues. [score:3]
The expression level of miR-203 was analyzed by quantitative RT-PCR, while PKCα protein level was assessed by Western blot using an antibody against PKCα. [score:3]
A plasmid designed to specially express the full-length open reading frame (ORF) of PKCα without the miR-203-responsive 3’-UTR was constructed and transfected into pre-miR-203 transfected A549 cells. [score:3]
All cells that were transfected with pre-miR-203 showed a significantly increased expression of the mature miR-203 (Figure 3A). [score:3]
A, overexpression of miR-203. [score:3]
However, siRNA against PKCα only partially phenocopied the apoptotic phenotype elicited by miR-203 overexpression. [score:3]
0073985.g003 Figure 3A, overexpression of miR-203. [score:3]
Subsequently, we investigated whether overexpression of PKCα is sufficient to reverse the inhibitory effects of miR-203 on PKCα and biological processes in lung cancer cells. [score:3]
Based on computational predictions and experimental validation, we identified PKCα as a novel target for miR-203. [score:3]
Therefore, therapeutic strategies that enhance miR-203 expression or that silence PKCα have the potential to benefit lung cancer patients. [score:3]
A, quantitative real-time PCR analysis of the relative miR-203 expression in 6 pairs of lung cancer tissue (LCT) and noncancerous tissue (NCT) samples. [score:3]
Furthermore, when A549 cells were simultaneously transfected with pre-miR-203 and the PKCα overexpression plasmid, PKCα dramatically recovered the migration attenuated by miR-203 (Figure 6B). [score:3]
Moreover, perfect base pairing between the seed region (the core sequence that encompasses the first 2-8 bases of the mature miRNA) and the cognate targets was noted (Figure 1A), and the miR-203 binding sequences in the PKCα 3’-UTR are highly conserved across species (Figure 1B). [score:3]
The predicted interactions between miR-203 and its target sites in the PKCα 3’-UTR are illustrated in Figure 1A. [score:3]
0073985.g002 Figure 2. A, quantitative real-time PCR analysis of the relative miR-203 expression in 6 pairs of lung cancer tissue (LCT) and noncancerous tissue (NCT) samples. [score:3]
For further validation, human lung adenocarcinoma A549 cells were transfected with ncRNA or pre-miR-203, and the cells were analyzed for the expression of miR-203 by quantitative RT-PCR 24 h after transfection. [score:3]
As shown in this figure, there is one potential miR-203 target site in the 3’-UTR of the PKCα mRNA sequence. [score:3]
We found that expression of miR-203 in lung cancer tissues was significantly lower than that of the adjacent normal tissues. [score:3]
D, Western blot analysis of the protein level of PKCα in A549 cells transfected with ncRNA, pre-miR-203, or pre-miR-203 plus PKCα overexpression plasmid, and a statistical analysis is shown in the right panel (mean ± S. D. ; ** p<0.01). [score:3]
As shown in Figure 3B, the expression of PKCα protein was significantly reduced by the introduction of pre-miR-203, whereas cells transfected with the scrambled ncRNA maintained a considerable amount of PKCα protein. [score:3]
Based on this, we examined the expression patterns of miR-203 and PKCα in the same 6 pairs of lung cancer and corresponding noncancerous tissue samples. [score:3]
The resulting plasmid was introduced into A549 cells along with a transfection control plasmid expression β-galactosidase and pre-miR-203 or the scrambled ncRNA. [score:3]
miR-203 overexpression was achieved by transfecting cells with pre-miR-203, a synthetic RNA oligonucleotide that mimics the miR-203 precursor, and a ncRNA served as a negative control. [score:3]
As expected, overexpression of miR-203 resulted in a significant decrease in the luciferase reporter activity, which was normalized to β- galactosidase activity, when compared to cells treated with the scrambled ncRNA (Figure 3D). [score:2]
We showed that miR-203 negatively regulated cell proliferation and migration by silencing PKCα, and miR-203 could also modulate cell apoptosis. [score:2]
The role of PKCα regulation by miR-203 in apoptosis. [score:2]
For example, survivin, a novel anti-apoptosis protein, is regulated by miR-203 [37, 38]. [score:2]
Validation of PKCα regulation by miR-203. [score:2]
The PKCα mRNA levels in lung cancer tissues were found to be higher when compared to the non-tumor tissues; however, miR-203 expression was significantly lower in the tumor tissues. [score:2]
To investigate the cellular phenotypes triggered by the miR-203 mediated downregulation of PKCα, A549 cells were transfected with either pre-miR-203 or si-PKCα and analyzed for changes in cell proliferation, apoptosis and migration. [score:2]
D, direct recognition of the PKCα 3’-UTR by miR-203. [score:2]
Furthermore, we introduced point mutations into the corresponding seed complementary sites in the PKCα 3’-UTR to eliminate the predicted miR-203 binding site. [score:2]
The role of the regulation of PKCα by miR-203 in cellular proliferation. [score:2]
For the luciferase reporter assays, cells were cultured in 6-well plates, and each well was transfected with 2 μg firefly luciferase reporter plasmid, 2 μg β-galactosidase expression vector (Ambion), and equal amounts of scrambled ncRNA or pre-miR-203 using Lipofectamine 2000 (Invitrogen). [score:2]
0073985.g006 Figure 6A, Transwell analysis of A549 cells treated with equal doses of scrambled ncRNA or pre-miR-203, or equal doses of control siRNA or si-PKCα. [score:1]
Identification of the conserved miR-203 binding sites within the PKCα mRNA 3’-UTR. [score:1]
It has also been shown that miR-203 functions in various cancers. [score:1]
Similarly, cells transfected with pre-miR-203 had decreased levels of PKCα mRNA, relative to cells transfected with the ncRNA (Figure 3C). [score:1]
Furthermore, a significant difference was observed in the proliferation rates between the cells transfected with ncRNA and pre-miR-203 (Figure 4C). [score:1]
Moreover, we investigated whether certain cellular phenotypes, such as cell proliferation, apoptosis and cell migration, were regulated by the miR-203 mediated regulation of PKCα. [score:1]
Cells were treated with ncRNA, pre-miR-203, or siRNAs for 6 h and were suspended in serum-free DMEM medium at a concentration of 4×10 [5] cells/mL; then, 4×10 [4] cells/well was added to the upper chamber. [score:1]
We then investigated apoptosis in cells with an increased miR-203 expression or silenced PKCα by flow cytometry analysis. [score:1]
B, Immunoblot for endogenous PKCα protein in A549 cells that were either mock transfected or transfected with ncRNA or pre-miR-203 for 24 h. GAPDH was used as a loading control. [score:1]
For each well, equal doses (100 pmol) of scrambled ncRNA, pre-miR-203, scrambled siRNA, or si-PKCα were added. [score:1]
B, sequence alignment of the putative miR-203 binding sites across species. [score:1]
C, quantitative RT-PCR analysis of PKCα mRNA levels in A549 cells treated with scrambled ncRNA or pre-miR-203. [score:1]
A partial sequence of the human PKCα 3’-UTR, which includes the predicted miR-203 binding sites, was synthesized by Invitrogen, with an additional 3'-phosphorylation modification. [score:1]
0073985.g005 Figure 5A549 cells were transfected with equal doses of scrambled ncRNA or pre-miR-203, or equal doses of control siRNA or si-PKCα. [score:1]
Firefly luciferase reporters containing either the wild-type (wt) or the mutant (mut) human PKCα 3’-UTR were co -transfected into A549 cells along with scrambled ncRNA, or pre-miR-203. [score:1]
For each well, 100 pmol scrambled ncRNA or pre-miR-203 was added. [score:1]
A, Transwell analysis of A549 cells treated with equal doses of scrambled ncRNA or pre-miR-203, or equal doses of control siRNA or si-PKCα. [score:1]
Either wild-type (wt) or mutant (mut) miR-203 binding sites (the sequence that interacts with the 2-8 bases of miR-203 were mutated) in the PKCα 3’-UTR are depicted. [score:1]
A, schematic description of the hypothesized duplexes formed by the interactions between the PKCα 3’-UTR binding sites and miR-203. [score:1]
Twenty-four hours after transfection with ncRNA, pre-miR-203, or siRNA, A549 cells were treated with 200 μM hydrogen peroxide (H [2]O [2]) for 30 min to induce apoptosis. [score:1]
Synthetic RNA molecules, including the pre-miR-203, and the scrambled non-coding RNA (ncRNA) were purchased from Ambion (Austin, TX, USA). [score:1]
0073985.g001 Figure 1A, schematic description of the hypothesized duplexes formed by the interactions between the PKCα 3’-UTR binding sites and miR-203. [score:1]
After A549 cells were transfected with pre-miR-203, ncRNA, or si-PKCα for 24 h, they were treated with 200 μM hydrogen peroxide for 30 min to induce apoptosis. [score:1]
A549 cells were transfected with equal doses of scrambled ncRNA or pre-miR-203, or equal doses of control siRNA or si-PKCα. [score:1]
[1 to 20 of 87 sentences]
9
[+] score: 253
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-122, hsa-mir-200c, hsa-mir-200a, hsa-mir-203b
Moreover, we demonstrated that decreased LASP1 expression is essential for the miR-203 -mediated inhibition of TNBC cell migration, showing that the over -expression of LASP1 could partially rescue the migration inhibition induced by miR-203 in MDA-MB-231 cells. [score:9]
Moreover, we showed that the over -expression of miR-203 could suppress the proliferation and migration of TNBC cells, accompanied by a decrease in the expression of BIRC5 and LASP1, suggesting that miR-203 has tumor-suppressive effects in TNBC. [score:9]
Figure 1 miR-203 was down-regulated in TNBC cell lines while BIRC5 and LASP1 expression was up-regulated. [score:9]
In our study, we identified the LASP1 transcript as a target of miR-203 in TNBC cells and found that inhibition of TNBC cell migratory capacity was accompanied by a reduction in LASP1 expression. [score:7]
Taken together, these results suggest that miR-203 may act as a tumor suppressor and is down-regulated in cancer development. [score:7]
In conclusion, our data suggest that miR-203 could inhibit the proliferation and migration of TNBC cells by directly regulating the expression of BIRC5 and LASP1. [score:7]
In this paper, we showed that miR-203 was down-regulated in TNBC cell lines and that the ectopic over -expression of miR-203 blocked tumor cell proliferation and migration in vitro. [score:6]
miR-203 post-transcriptionally down regulates BIRC5 and LASP1 expression by targeting the 3’-UTR regions of BIRC5 and LASP1. [score:6]
It was intriguing that in sharp contrast to the down-regulation of miR-203 in TNBC cells, BIRC5 and LASP1 expression is increased in TNBC cell lines compared to that in MCF-10A (Figure  1B&C). [score:5]
Figure 7 Over -expression of LASP1 significantly attenuated the effect of miR-203 on the inhibition of MDA-MB-231 cell migration. [score:5]
miR-203 expression was decreased in TNBC cell lines while BIRC5 and LASP1 expression was increased. [score:5]
Thus, miR-203 could be a potential therapeutic target for this disease. [score:5]
Therefore, the identification of BIRC5 as a miR-203 target gene may explain, at least in part, the molecular mechanism of tumor suppression by miR-203. [score:5]
We first confirmed that BIRC5 and miR-203 have been conducted into the cells (Figure  6A), then, we used colony formation assay to show that the inhibition of MDA-MB-231 cell proliferation by miR-203 could be partially rescued by BIRC5 up-regulated (Figure  6B). [score:5]
It was reported that forced miR-203 expression in esophageal cancer cell lines repressed ΔNP63 levels, inhibited cell growth and promoted apoptosis [17]. [score:5]
Because the down-regulated of miR-203 is common to a number of cancers, it has been hypothesized that miR-203 may play an important role in tumorigenesis and tumor development. [score:5]
The inhibition of MDA-MB-231 cell migration by miR-203 is attenuated by the over -expression of LASP1. [score:5]
The inhibition of MDA-MB-231 cell proliferation by miR-203 is attenuated by the over -expression of BIRC5. [score:5]
Figure 6 Over -expression of BIRC5 could significantly attenuate the effect of miR-203 on the inhibition of MDA-MB-231 cell proliferation. [score:5]
These observations suggest that miR-203 over -expression suppresses the mobility of TNBC cells in vitro. [score:5]
To explore the molecular mechanism of miR-203 activity, we used TargetScan 6.0 to search for target genes of miR-203, especially for genes with potential roles in promoting tumor cell proliferation and migration. [score:5]
Moreover, we showed that BIRC5 over -expression could partially abrogate the proliferate inhibition induced by miR-203. [score:5]
To provide direct evidence that down-regulation of BIRC5 is required for the anti-tumorigenic effects of miR-203, we transfected MDA-MB-231 cells with pcDNA-BIRC5 and miR-203 precursor. [score:5]
Moreover, a potential miR-203 targeting site was predicted in the 3’-UTRs of BIRC5 and LASP1 by TargetScan 6.0 (Figure  3C). [score:5]
It has also reported that individual miRNAs are capable of regulating dozens of distinct mRNAs, so we considered the possibility that miRNA-203 might act on several target genes rather than a single target. [score:5]
These data suggest that the reduced expression of miR-203 facilitates the development and metastasis of TNBC. [score:4]
Consistent with our results, miR-203 expression is down regulated in several cancer cells, including liver cancer [11], prostate cancer [13], and some types of leukemia [9]. [score:4]
Furthermore, BIRC5 and LASP1 were identified as two direct functional targets of miR-203 in TNBC cells. [score:4]
To provide direct evidence that miR-203 inhibits the migration of TNBC cells through the LASP1 -mediated signal pathway, we transfected MDA-MB-231 cells with miR-203 precursor and pcDNA-LASP1. [score:4]
Moreover, up-regulated of BIRC5 and LASP1 was able to abrogate the effects induced by transfection with the miR-203 precursor. [score:4]
We found that a decrease of BIRC5 and LASP1 mRNA in TNBC cells after treated (Figure  3B), so we believe that miRNA-203 regulates BIRC5 and LASP1 expression at both protein and mRNA levels. [score:4]
Mutant BIRC5 and LASP1 3’-UTRs bearing a substitution of three nucleotides (TTT to CCC) in the miR-203 target sequence were generated using a Site-Directed Mutagenesis Kit (Agilent Technologies). [score:4]
The deletion or epigenetic silencing of a miRNA that normally represses the expression of one or more oncogenes might lead to carcinogenesis, tumor growth and invasion, as has been demonstrated for miR-200, miR-122 and miR-203 [8- 10]. [score:3]
Interestingly, the over -expression of miR-203 repressed the migration of the MDA-MB-231 and MDA-MB-468 cells. [score:3]
In the present study, we showed that miR-203 is down-regulated in TNBC cell lines compared with the normal breast cell line. [score:3]
Both miR-203 and LASP1 siRNA signicantly inhibited cell migration in TNBC cells, also. [score:3]
We identified two potential miR-203 target genes: BIRC5 and LASP1. [score:3]
Previous reports have shown that the over -expression of miR-203 has an impact on growth in prostate and laryngeal cancer cell lines [13, 14]. [score:3]
These data clearly indicate that the ectopic over -expression of BIRC5 could efficiently block the effect on proliferation caused by miR-203. [score:3]
showed that a statistically significant inhibition of TNBC cell proliferation occurred after treatment with the miR-203 precursor (Figure  2A). [score:3]
We examined the influence of miR-203 on the endogenous expression of BIRC5 and LASP1 proteins by western blot. [score:3]
These results demonstrated that miR-203 targets the predicted site within the 3’-UTRs of BIRC5 and LASP1 mRNA in TNBC cell lines. [score:3]
This key observation indicates that the negative control of BIRC5 levels is a critical aspect of the tumor-suppressive activity of miR-203 in TNBC. [score:3]
These data may implicate miR-203 expression is negatively correlated with BIRC5 and LASP1. [score:3]
Moreover, the activation of miR-203 may be a potentially useful novel strategy for inhibiting TNBC growth and metastasis. [score:3]
Based on this rationale, we selected two candidate miR-203 targets, BIRC5 and LASP1, for further study. [score:3]
Real-time PCR was performed to detect the expression of miR-203 in TNBC cell lines. [score:3]
These data suggest that miR-203 may function as a tumor suppressor in TNBC cells. [score:3]
miR-203 expression was normalized to that of U6 in each sample. [score:3]
Figure 3 BIRC5 and LASP1 were identified as miR-203 target genes. [score:3]
Both miR-203 and BIRC5 siRNA signicantly inhibited cell proliferation in TNBC cells. [score:3]
miR-203 inhibited proliferation and migration of TNBC cells. [score:3]
miR-203 precursor and control microRNA (miRNA) were transfected into triple -negative breast cancer (TNBC) cell lines and the effects of miR-203 up-regulation on the proliferation and migration of cells were investigated. [score:2]
The migration assay showed that the over -expression of LASP1 could partially rescue the migratory capacity of MDA-MB-231 cells treated with the miR-203 precursor (Figure  7B). [score:2]
QPCR assay was also carried out to detect BIRC5 and LASP1 expression at mRNA level after transefected with miR-203 precursor in TNBC cells. [score:2]
Intriguingly, BIRC5 and LASP1 expression were significantly decreased in miR-203 -transfected MDA-MB-231 and MDA-MB-468 cells compared with control miRNA -transfected cells (Figure  3A). [score:2]
Luciferase assays were also performed to validate BIRC5 and LASP1 as miR-203 targets. [score:2]
miR-203 is significantly down regulated in several cancers, including hepatocellular carcinoma [11], colon cancer [12], prostate cancer [13], and laryngeal cancer [14]. [score:2]
To investigate whether the 3’-UTRs of BIRC5 and LASP1 are functional targets of miR-203 in breast cancer cells, we co -transfected the miR-203 precursor (or control miRNA) and pMIR-BIRC5-3’-UTR plasmid (or mutant) or pMIR-LASP1-3’-UTR plasmid (or mutant) into cells. [score:1]
To evaluate the function of miR-203, the 3’-UTRs of BIRC5 and LASP1 with a miR-203 targeting sequence were cloned into the pMIR-REPORT luciferase reporter vector (Ambion). [score:1]
However, the function of miR-203 in breast cancer remains unclear, especially in TNBC. [score:1]
Cells were co -transfected with luciferase reporter plasmids and miR-203 precursor (or control miRNA) along with Renilla Luciferase phRG-TK (Promega) as an internal control using Lipofectamine 2000 (Invitrogen). [score:1]
Cells were transiently transfected with miR-203 precursor (Applied Biosystems) or negative control miRNA, BIRC5 siRNA (Sigma), LASP1 siRNA (Sigma) or control siRNA at a final concentration of 200nM. [score:1]
However, co-transfection with the miR-203 precursor did not significantly alter mutant BIRC5 or LASP1 3’-UTR reporter activity (Figure  3D). [score:1]
We detected the abundance of miR-203 in triple -negative human breast cancer cell lines: MDA-MB-468 and MDA-MB-231 and a normal breast cell line: MCF-10A, by real-time PCR. [score:1]
TNBC cell lines (MDA-MB-468 and MDA-MB-231) showed significant miR-203 repression than normal breast cell line MCF-10A. [score:1]
[1 to 20 of 66 sentences]
10
[+] score: 243
Mechanistically, miR-203 directly targets LIN28B, which is a critical repressor of the maturation of miRNAs, particularly let-7. Previous studies have defined a regulatory loop consisting of Lin28 and let-7, in which LIN28B suppresses let-7 maturation and let-7, in turn, directly targets LIN28B 21 22. [score:10]
Here we showed that the overexpression of miR-203 results in increased expression of let-7, and knockdown of let-7 reversed the inhibitory effects of miR-203 overexpression on tumor cell growth. [score:10]
More importantly, restoration of LIN28B expression with a miR-203-resistant LIN28B overexpression plasmid completely reversed the miR-203 -induced cellular phenotypes, suggesting that targeting LIN28B is a major mechanism by which miR-203 exerts its tumor-suppressive functions. [score:9]
Consequently, the expression levels of let-7 were decreased (Fig. 3C), suggesting that the induction of miR-203 inhibits LIN28B expression and subsequently rescues the suppression of let-7 by LIN28B. [score:9]
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In summary, the present findings indicate that LIN28B is crucial for the proliferation and invasion of lung cancer cells due to its suppression of let-7 biogenesis and that miR-203 enhances let-7 biogenesis by silencing LIN28B expression, and consequently functions as a critical tumor suppressor during lung tumorigenesis. [score:7]
Because a single miRNA can target multiple genes, and multiple miRNAs can target a single gene, we cannot rule out the possibility that additional targets are simultaneously affected by miR-203. [score:7]
Taken together, the findings of this study show that miR-203 directly targets LIN28B and enhances let-7 biogenesis to suppress tumor growth in lung cancer. [score:6]
Compared to the cells transfected with the miR-203 agomir alone, the cells co -transfected with the miR-203 agomir and the LIN28B overexpression plasmid exhibited a significantly increased proliferation rate (Fig. 4B), suggesting that miR-203-resistant LIN28B rescued the suppression of LIN28B expression induced by miR-203 and attenuated the anti-proliferative effect of miR-203. [score:6]
To determine the regulatory level at which miR-203 influenced LIN28B expression, we repeated the experiments above and examined the expression of LIN28B mRNA after transfection. [score:6]
Together, our results indicate that miR-203 directly recognizes and binds to the 3′-UTR of the LIN28B mRNA transcript and suppresses LIN28B expression, which in turn enhances let-7 biogenesis in lung cancer cells. [score:6]
In this study, let-7 expression was found to be concordant with the miR-203 expression in normal and tumor tissues, underscoring the coordinated regulation of these two miRNAs via LIN28B as a link. [score:6]
On the other hand, the expression of the LIN28B protein was increased in A549 and 95D cells transfected with the miR-203 antagomir (Fig. 3B), leading to the subsequent downregulation of let-7 in A549 and 95D cells (Fig. 3C). [score:6]
Additionally, the expression of miR-203 suppressed cell proliferation and migration in human triple -negative breast cancer cells 62. [score:5]
Thus, miR-203 and its target, LIN28B, had opposite expression patterns and biological functions in lung cancer cells. [score:5]
As anticipated, the overexpression of miR-203 significantly suppressed the LIN28B protein levels in A549 and 95D cells (Fig. 3B). [score:5]
miR-203 inhibits the proliferation and promotes the apoptosis of lung cancer cells by suppressing LIN28B and enhancing let-7 biogenesis. [score:5]
A mammalian expression plasmid (pReceiver-M02-LIN28B) designed to specially express the full-length open reading frame (ORF) of human LIN28B without the miR-203–responsive 3′-UTR was purchased from GeneCopoeia (Germantown, MD, USA). [score:5]
How to cite this article: Zhou, Y. et al. miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancer. [score:5]
The ectopic expression of miR-203 in prostate cancer cell lines could influence their proliferation, apoptosis, and migration 58 59, and the overexpression of miR-203 in laryngeal carcinoma cells reduced the cell viability and led to cell cycle arrest in the G1 phase 61. [score:5]
To overexpress LIN28B, a plasmid expressing the LIN28B ORF without the miR-203-responsive 3′-UTR was transfected into A549 cells. [score:5]
Direct post-transcriptional regulation of LIN28B expression through miR-203. [score:5]
To determine whether the negative regulatory effects of miR-203 on LIN28B expression were mediated through the binding of miR-203 to the presumed sites in the 3′-UTR of the LIN28B mRNA, the full length 3′-UTR of LIN28B containing the two presumed miR-203 binding sites was placed downstream of the firefly luciferase gene in a reporter plasmid. [score:4]
As expected, miR-203 was observed to be significantly downregulated in NSCLC tissues (Fig. 2B). [score:4]
The correlation between miR-203 and LIN28B was further examined by evaluating LIN28B expression in the A549 and 95D human NSCLC cell lines after overexpression or knockdown of miR-203. [score:4]
Therefore, modulation of LIN28B by miR-203 may explain, at least in part, why the downregulation of miR-203 during lung tumorigenesis can promote tumor growth. [score:4]
Neither overexpression nor knockdown of miR-203 affected the LIN28B mRNA levels in either cell line (Fig. 3D). [score:4]
Thus, based on computational predictions and the inverse correlation between miR-203 and LIN28B protein levels in NSCLC, we inferred that LIN28B expression was regulated by a miR-203 -mediated post-transcriptional mechanism. [score:4]
These results indicated that miR-203 might modulate cell proliferation and apoptosis by downregulating LIN28B in lung cancer cells. [score:4]
Neither overexpression nor knockdown of miR-203 changed the luciferase activity of the mutant luciferase reporter (Fig. 3E). [score:4]
Knockdown of miR-203 was achieved by transfecting cells with a miR-203 antagomir, which was a chemically modified antisense oligonucleotide designed to specifically target mature miR-203. [score:4]
miR-203 enhances let-7 biogenesis by directly targeting LIN28B. [score:4]
The efficient overexpression and knockdown of miR-203 in A549 and 95D cells are shown in Fig. 3A. [score:4]
Identification of conserved miR-203 target sites within the 3′-UTR of LIN28B. [score:3]
For the overexpression of miRNAs, 10 pmol of miR-203 agomir or let-7 agomir were used. [score:3]
Next, we analyzed the biological consequences of LIN28B suppression mediated by miR-203 in lung cancer cells. [score:3]
Accordingly, miR-203 -induced let-7 provides a conserved mechanism to explain the suppressive role of miR-203 during lung tumorigenesis. [score:3]
Furthermore, when A549 cells were simultaneously transfected with the miR-203 agomir and the LIN28B overexpression plasmid, the pro-apoptotic effect of miR-203 was dramatically attenuated (Fig. 4C and D). [score:3]
Moreover, there was perfect base pairing between the seed regions (the core sequence that encompasses the first 2–8 bases of the mature miRNA) and the cognate targets, and the miR-203 binding sequences in the LIN28B 3′-UTR were highly conserved across species (Fig. 2A). [score:3]
In these experiments, the overexpression of miR-203 was achieved by transfecting cells with a miR-203 agomir, which was a synthetic RNA oligonucleotide that mimics the miR-203 precursor. [score:3]
The minimum free energy values of the hybrids between miR-203 and LIN28B mRNA were −20.4 and −24.8 kcal/mol, which are well within the range of previously confirmed miRNA-target pairs. [score:3]
In this study, we found that miR-96 can inhibit the proliferation and promote the apoptosis of lung cancer cells and that LIN28B silencing can mimic the miR-203 -induced cellular phenotypes. [score:3]
Subsequently, we determined the expression levels of miR-203 in the same 7 pairs of NSCLC tissues and corresponding noncancerous tissues. [score:3]
The effects of LIN28B targeting via miR-203 on the proliferation and apoptosis of A549 cells. [score:3]
Furthermore, we introduced point mutations into the corresponding complementary sites in the 3′-UTR of LIN28B to eliminate the predicted miR-203 binding sites. [score:2]
We next investigated whether miR-203 can directly target LIN28B in NSCLC. [score:2]
For the miRNA knockdown, 10 pmol of miR-203 antagomir or let-7 antagomir were used. [score:2]
For the luciferase reporter assays, A549 and 95D cells were seeded in 6-well plates and co -transfected with 2 μg of firefly luciferase reporter plasmid, 2 μg of β-galactosidase (β-gal) expression plasmid (Ambion), and 10 pmol of miR-203 agomir, miR-203 antagomir, or scrambled negative control RNA using Lipofectamine 2000 (Invitrogen). [score:2]
In addition, the expression of miR-203 correlated more negatively with the LIN28B protein levels compared with the LIN28B mRNA levels, as illustrated with Pearson’s correlation scatter plots (Fig. 2C and D). [score:2]
To investigate whether the regulation of cell proliferation and apoptosis by miR-203 is executed in a LIN28B -dependent manner, we co -transfected A549 cells with the miR-203 agomir and a LIN28B overexpression plasmid. [score:2]
These results suggest that LIN28B functions as a link between the miRNAs miR-203 and let-7. We next investigated whether the overexpression or knockdown of miR-203 influenced cell proliferation and apoptosis by affecting let-7 biogenesis. [score:2]
These results demonstrated that miR-203 specifically represses LIN28B protein at the post-transcriptional level to enhance let-7 biogenesis. [score:1]
Detection of an inverse correlation between the miR-203 and LIN28B levels in NSCLC tissue samples. [score:1]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
The cellular miR-203 levels increased by approximately 20-fold when A549 and 95D cells were transfected with the miR-203 agomir, and these levels dropped to approximately 50% of the normal levels when the A549 and 95D cells were treated with the miR-203 antagomir. [score:1]
The resulting plasmid was transfected into A549 and 95D cells along with a transfection control plasmid (β-gal) and one of the following: miR-203 agomir, miR-203 antagomir, or scrambled negative control RNA. [score:1]
As expected, the luciferase activity was intensively reduced in cells transfected with the miR-203 agomir (Fig. 3E). [score:1]
As shown in Fig. 2A, we observed two potential miR-203 binding sites within the 3′-UTR of LIN28B mRNA. [score:1]
In contrast, the luciferase activity was significantly increased in cells transfected with the miR-203 antagomir (Fig. 3E). [score:1]
To test the binding specificity, the sequences that interact with the seed sequence of miR-203 were mutated (from AUUUCA to UAAAGU), and the mutant LIN28B 3′-UTR was inserted into an equivalent luciferase reporter plasmid. [score:1]
The results showed that the percentage of apoptotic cells was significantly higher among the A549 cells transfected with the miR-203 agomir but was lower among the A549 cells transfected with the miR-203 antagomir (Fig. 4C and D). [score:1]
[1 to 20 of 61 sentences]
11
[+] score: 241
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-373, hsa-mir-193b, hsa-mir-203b
demonstrated that the expression of miR-203 was significantly downregulated in prostate cancer specimens and miR-203 overexpression inhibited cell proliferation, adhesion and invasion by inhibiting Rap1A expression. [score:14]
Moreover, overexpression of RAB22A increased the N-cadherin and Vimentin mRNA expression and inhibited E-cadherin mRNA expression in miR-203 overexpressing MG-63 cells (Fig 5E). [score:11]
In conclusion, we determined that miR-203 is downregulated in osteosarcoma cell lines and tissues, and overexpression of miR-203 inhibited osteosarcoma cell proliferation and migration via targeting RAB22A. [score:10]
0132225.g003 Fig 3 (A) Overexpression of miR-203 can induce the E-cadherin mRNA expression and inhibit N-cadherin and Vimentin mRNA expression using qRT-PCR. [score:9]
We showed that overexpression of miR-203 can induce the E-cadherin mRNA expression and inhibit N-cadherin and Vimentin mRNA expression (Fig 3A). [score:9]
Furthermore, as determined by western blot, we also demonstrated that ectopic expression of miR-203 can enhance the protein expression of E-cadherin and inhibit the protein expression of N-cadherin and Vimentin (Fig 3B). [score:9]
In this study, we confirmed that the miR-203 expression is significantly decreased in osteosarcoma tissues and revealed that miR-203 could inhibit cell proliferation through directly targeting RAB22A in osteosarcoma. [score:8]
In addition, forced overexpression of miR-203 inhibited the osteosarcoma cell proliferation and migration and inhibited reversion of EMT. [score:7]
In addition, forced overexpression of miR-203 inhibited the osteosarcoma cell proliferation and migration and inhibited MErT. [score:7]
We also found that miR-203 overexpression inhibited the mRNA expression of Twist, Snail, Slug, and Zeb1, which are the EMT transcription factors (Fig 3C). [score:7]
Take together, our results showed that miR-203 may act as a tumor suppressor gene in osteosarcoma partly by regulating RAB22A expression. [score:6]
In this study, our results showed that expression of level of miR-203 was downregulated in osteosarcoma cell lines and tissues. [score:6]
Up-regulation of miR-203 expression was discovered at 48 hours after miR-203 mimic transfection (Fig 2A). [score:6]
For example, enforced expression of miR-203 attenuated colorectal cancer cell proliferation, invasion and migration by regulating Zinc finger protein 217 (ZNF217) expression[44]. [score:6]
In our study, we found the expression level of miR-203 was downregulated in osteosarcoma cell lines and tissues. [score:6]
Furthermore, the expression of miR-203 was downregulated in osteosarcoma tissues compared with their corresponding nontumor tissues (Fig 1B and 1C). [score:5]
As showed in Fig 2B and 2C, miR-203 overexpression reduced cell proliferation and inhibited cell migration in the MG-63 cells. [score:5]
miR-203 overexpression inhibited cell proliferation and migration. [score:5]
Overexpression of miR-203 inhibited reversion of EMT. [score:5]
Furthermore, miR-203 overexpression in MG-63 cells reduced RAB22A mRNA and protein expression. [score:5]
To find the molecular mechanisms responsible for the effect of miR-203 in osteosarcoma, we used Target Scan databases to predict target genes of miR-203. [score:5]
Overexpression of miR-203 inhibited Mesenchymal-to-Epithelial reversion Transition (MErT). [score:5]
We rescued the expression of RAB22A in miR-203 overexpressing MG-63 cells. [score:5]
showed that miR-203 could be a potential prognostic marker and functions as a tumor suppressor in human renal cancer by post-transcriptionally targeting FGF2. [score:5]
miR-203 overexpression in MG-63 cells reduced RAB22A mRNA and protein expression (Fig 4C and 4D). [score:5]
We examined the miR-203 levels in human osteosarcoma cell lines (MG-63, SOSP-9607, SAOS-2, and U2OS) and one normal osteoblast cell line (hFOB) using qRT-PCR and found that miR-203 expression was downregulated in human osteosarcoma cell lines compared to in hFOB(Fig 1A). [score:5]
miR-203 directly targets the RAB22A in osteosarcoma cells. [score:4]
Increasing data have shown that miR-203 is deregulated and functions as a tumor suppressor gene in various human cancers including cervical cancer, prostate cancer, breast cancer, colorectal cancer and glioblastoma[30, 40– 43]. [score:4]
Moreover, we identified RAB22A as a direct target of miR-203 and in osteosarcoma cell. [score:4]
miR-203 was downregulated in human osteosarcoma cell lines and tissues. [score:4]
CCK8 assay showed that overexpression of RAB22A increased the miR-203 overexpressing MG-63 cells proliferation (Fig 5D). [score:4]
RAB22A was found as a direct target of miR-203 inosteosarcoma cells by using bioinformatics analysis, and western blot. [score:4]
demonstrated that miR-203 induces the cells apoptosis by directly targeting Yes-1 in oral cancer cells. [score:4]
Furthermore, the migration abilities of miR-203 overexpressing MG-63 cells were increased after RAB22A vector transfection (Fig 5F). [score:3]
Ectopic expression of miR-203 led to a reduction of luciferase activity when the reporter construct contained the RAB22A 3’UTR in MG-63 cells (Fig 4B). [score:3]
RAB22A overexpression blocks the roles of miR-203. [score:3]
reported that miR-203 expression was lower in imatinib-resistant glioblastoma (GBM) cells (U251AR, U87AR) that underwent epithelial-mesenchymal transition (EMT) than in their parental cells (U251, U87). [score:3]
miR-203 enhances chemosensitivity to 5-fluorouracil by targeting thymidylate synthase in colorectal cancer. [score:3]
Ectopic expression of miR-203 led to a reduction of luciferase activity when the reporter construct contained the RAB22A 3’UTR in MG-63 cells. [score:3]
However, the expression and role of miR-203 in osteosarcoma is still unknown. [score:3]
Take together, our results demonstrated that miR-203 act as a tumor suppressor miRNA and suggested its involvement in osteosarcoma progression and carcinogenesis. [score:3]
These studies may help to explain the important role of miR-203 in development and progression in osteosarcoma. [score:2]
However, the role of miR-203 in osteosarcoma is still unknown. [score:1]
0132225.g002 Fig 2. (A) qRT-PCR was performed to measure the miR-203 expression in MG-63 cells at 48 hours after miR-203 mimic transfection. [score:1]
0132225.g001 Fig 1. (A) qRT-PCR was performed to detect the miR-203 levels in human osteosarcoma cell lines (MG-63, SOSP-9607, SAOS-2, and U2OS) and one normal osteoblast cell line (hFOB). [score:1]
There is a potential miR-203 binding site of RAB22A gene. [score:1]
Previous studies demonstrated that miR-203 acts as a important role in various cancers[29– 31]. [score:1]
0132225.g004 Fig 4. (A) RAB22A gene harbored a potential miR-203 binding site using a stringent bioinformatics approach. [score:1]
These data demonstrated that restoration of miR-203 may be a potential therapeutic strategy for treatment of osteosarcoma. [score:1]
Cells were transfected with miR-203 mimic or scramble by Lipofectamine 2000 (Invitrogen) following to the manufacturer’s instructions. [score:1]
miR-203 mimic and negative control (scramble) were obtained from RIBOBIO (Guangzhou, China). [score:1]
A total of miR-203 mimic (or scramble), pGL3, RAB22A-3’UTR-WT or RAB22A-3’UTR-MUT vectors were contransfected into the MG-63 cells using Lipofectamine 2000 following to the manuscript’s instruction (Invitrogen). [score:1]
We identified that RAB22A gene harbored a potential miR-203 binding site using a stringent bioinformatics approach (Fig 4A). [score:1]
[1 to 20 of 53 sentences]
12
[+] score: 227
In this study, using a well-studied murine mo del of human schistosomiasis, we show that Schistosoma infection down-regulates the miR-203-3p expression, and that IL-33, an inducer of type 2 immunity, is a direct target of miR-203-3p in hepatic stellate cells. [score:9]
Having found that IL-33 is a target of miR-203-3p and that elevation of miR-203-3p leads to a reduction of IL-13 in the liver, we hypothesized that down-regulation of miR-203-3p during the progression of hepatic schistosomiasis could lead to higher expression of IL-13 in ILC2s via increased levels of IL-33 in HSCs. [score:8]
Taken together, these data indicate that miR-203-3p regulates the expression of IL-13 in ILC2s by targeting IL-33 in HSCs, thus modulating the expression of ECM by HSCs, during the progression of hepatic schistosomiasis. [score:8]
Here, we created a schematic diagram showing the molecular mechanism underpinning the regulation of type 2 pathology after infection by miR-203-3p (Fig 6): The toxic challenge derived from parasite eggs trapped in the liver tissue induces the down-regulation of miR-203-3p in HSCs, which relieves the inhibition to IL-33. [score:7]
After 3 days in culture, cells were transfected with 40 nM miR-203-3p mimics, negative control (NC) miRNA mimics, miR-203-3p inhibitors, or negative control (NC) miRNA inhibitors for 48 h, then the expression of IL-33 was detected by qPCR (C) and western blot (D). [score:7]
To test whether IL-33 is a direct target of miR-203-3p, we first generated a reporter construct that contains the firefly luciferase gene fused to the 3’ UTR from Il33 mRNA containing a putative miR-203-3p target site (Fig 4A). [score:6]
Importantly, our data indicate that miR-203-3p targets IL-33, an inducer of type 2 immunity [16, 17], in HSCs to regulate the expression of IL-13 in hepatic group 2 innate lymphoid cells (ILC2s) during infection. [score:6]
We found that, when primary HSCs from uninfected mice were cultured on plastic plates, expression of miR-203-3p in these cells was significantly reduced, while the level of Il33 mRNA was significantly elevated, accompanied by a dramatic increase in collagen expression (S4 Fig). [score:5]
IL-33, an IL-1-related cytokine, is an inducer of type 2 immunity in several organs [18], and is a potential target of miR-203-3p, predicted by TargetScan database. [score:5]
Thus, our study highlights the crucial role of miR-203-3p in the initiation of type 2 pathology during schistosome infection, and suggests miR-203-3p as a potential target for fibrotic diseases. [score:5]
Therefore, miR-203-3p might serve as a useful target in the treatment of these fibrotic diseases. [score:5]
MiR-203-3p targets IL-33 to regulate the expression of IL-13 in hepatic ILC2 cells during infection. [score:5]
As expected, miR-203-3p expression was clearly elevated, while collagen and α-Sma expressions were distinctly reduced in HSCs after rAAV8-pri-miR-203-3p intervention (S2 Fig), suggesting that miR-203-3p could modulate the activation of HSCs in vivo. [score:5]
Our data revealed that, at both the mRNA and protein levels, elevation of miR-203-3p distinctly reduced the expression of IL-33, while depletion of miR-203-3p significantly increased the expression of IL-33 (Fig 4C and 4D). [score:5]
Our data showed that, similar to the expression pattern in whole liver, the expression of miR-203-3p in hepatocytes and HSCs began to decrease at day 42 post-infection, while the level of Il33 mRNA was elevated at the same time (Fig 3C and 3D). [score:5]
Infection induces the down-regulation of miR-203-3p in HSCs, resulting in the elevation of IL-33. [score:4]
1006957.g006 Fig 6 Infection induces the down-regulation of miR-203-3p in HSCs, resulting in the elevation of IL-33. [score:4]
In this study, our data also indicated that IL-33 is crucial for inducing the progression of type 2 pathology after infection, as significant reductions in hepatic fibrosis and IL-13-producing ILC2s were observed upon down-regulation of IL-33 in the liver, which resulted from rAAV8 -mediated elevation of miR-203-3p. [score:4]
, and downregulation of miR-203-3p leads to elevated levels of IL-33 in HSCs, initiating type 2 pathology after infection. [score:4]
However, we provided evidence that human IL-33 is also a direct target of miR-203-3p in the HSCs (S5 Fig). [score:4]
In contrast, mutation of 5 nt in the miR-203-3p seed sequence led to a complete abrogation of reporter inhibition (Fig 4B). [score:4]
Our data showed that significantly decreased miR-203-3p expression and increased collagen and α-Sma expression were observed in the infected mice without rAAV8-pri-miR-203-3p treatment compared with uninfected mice (S2 Fig). [score:4]
Importantly, we show that miR-203-3p targets IL-33, an inducer of type 2 immunity, in HSCs to regulate the expansion and IL-13 production of hepatic ILC2s during infection. [score:4]
This includes miR-203-3p as the most down-regulated [15]. [score:4]
IL-33 is a direct target of miR-203-3p in HSCs. [score:4]
To examine the role of miR-203-3p in schistosomiasis in vivo, mice were first challenged with a lethal dose of S. japonicum cercaria and then intravenously injected with either rAAV8-pri-miR-203-3p vector sustainedly expressing the miRNA, control vector, or PBS at day 10 post-infection. [score:3]
Finally, we analyzed IL-33 levels in primary HSCs from infected livers treated with rAAV8-pri-miR-203-3p, and found that IL-33 expression was markedly reduced (Fig 4E and 4F). [score:3]
1006957.g003 Fig 3(A, B) The expression of miR-203-3p (A) and Il-33 mRNA (B) in the livers during infection was detected by qPCR. [score:3]
Analysis of miR-203-3p and IL-33 expression in the liver during infection. [score:3]
Cells were collected at various time points to detect the expression of Il33 mRNA, Col1α1 mRNA, and miR-203-3p using qPCR. [score:3]
However, the expression of both miR-203-3p and Il33 mRNA in KCs was unchanged during the observed time (Fig 3C and 3D). [score:3]
We found that expression of miR-203-3p began to decrease in the liver at day 32 post-infection, reaching its lowest levels at day 42 and 52 (Fig 3A); in contrast, the level of Il33 mRNA was maintained during the early stage of infection, then significantly elevated by day 42 post-infection (Fig 3B). [score:3]
We also characterized the relative abundance of miR-203-3p and Il33 mRNA in different hepatic cell compartments, and found that, in both the uninfected and infected livers, miR-203-3p was selectively expressed in hepatocytes and HSCs (Fig 3E), whereas Il33 was primarily expressed in HSCs (Fig 3F and 3G). [score:3]
Thus, our study highlights the crucial role of miR-203-3p and its target IL-33 in the initiation of type 2 pathology during schistosome infection. [score:3]
S5 Fig(A) Sequence alignment of miR-203-3p and its target sites in 3’ UTRs of human Il33. [score:3]
We transfected miR-203-3p mimics or inhibitors into primary HSCs from uninfected mice, and quantified the level of IL-33 by qPCR or western blot. [score:3]
Again, the expression of miR-203-3p was significantly increased in the rAAV8-pri-miR-203-3p treated mice (Fig 2B). [score:3]
1006957.g004 Fig 4(A) Sequence alignment of miR-203-3p and its target sites in 3’ UTRs of Il33. [score:3]
Taken together, these results suggest that the activated HSCs in infected livers are a source of IL-33, and that IL-33 is a potential target of miR-203-3p in HSCs. [score:3]
In addition, we detected the expression of miR-203-3p and Il33 during the progression of HSC activation in vitro. [score:3]
For transfection, HSCs were transfected with 40 nM miR-203-3p mimics (Qiagen), miR-203-3p inhibitors (Qiagen), or negative controls at day 3 after seeding using Lipofectamine 3000 (Invitrogen). [score:3]
In addition, we noticed that the target site of miR-203-3p in the 3’UTR of Il33 gene is not conserved from mouse to human. [score:3]
To express miR-203-3p, pri-miR-203-3p fragment was amplified by PCR from C57/B6 mouse genomic DNA using primer pri-miR-203-3pF (5´AACAGGTCCTCGCACAGAGTGCAGCCCGGC 3´) and pri-miR-203-3pR (5´AACAGGTCCTCCACCCCCGCGCCCCTCTCA3´), then cloned into the PpuMI restriction site in the intron of pscAAVCBPI GLuc plasmid [36]. [score:2]
Considering that elevation of miR-203-3p attenuates type 2 pathology, we speculated that miR-203-3p could regulate the initiation of type 2 immunity after infection. [score:2]
In this study, we used a murine mo del of Schistosoma japonicum (S. japonicum) to investigate the role of miR-203-3p, a miRNA down-regulated following infection in the progression of hepatic schistosomiasis [15]. [score:2]
Schematic diagram of the role of miR-203-3p in the initiation of type 2 pathology after infection. [score:1]
The human or mouse wild-type or mutant 3’ UTRs of IL-33 containing the predicted miR-203-3p binding sites were synthesized (South Gene Technology, China) and cloned into the pGL3.0-control vectors according to the manufacturer’s instructions (Promega). [score:1]
Amounts of Col1α1, Col3α1, and α-Sma mRNA were dramatically reduced in livers of mice treated with rAAV8-pri-miR-203-3p (Fig 1G, 1H and 1I). [score:1]
1006957.g001 Fig 1(A) Mice were infected percutaneously with 30 S. japonicum cercariae at day 0 and treated with rAAV8-PI (n = 10) or rAAV8-pri-miR-203-3p vectors (n = 10) at a dose of 1×10 [11] virus genomes, or PBS (n = 10) by tail vein injection at day 10 post-infection. [score:1]
Consistent with the antenuated fibrotic phenotype, a strong reduction in mRNA levels of Il13 and Tgf-β1 was detected in livers of mice treated with rAAV8-pri-miR-203-3p (Fig 1J and 1K). [score:1]
qPCR analysis of levels of miR-203-3p in the liver samples (B). [score:1]
Elevation of miR-203-3p partially reverses schistosome -induced hepatic fibrosis. [score:1]
Moreover, we observed that, following elevation of miR-203-3p in HSCs using rAAV8-pri-miR-203-3p vectors, the number of ILC2s and production of IL-13 in these cells were markedly reduced (Fig 5A and 5B). [score:1]
In addition, we detected the alteration of the cytokines that are associated with type 2 immune response in liver tissues after elevation of miR-203-3p. [score:1]
S4 FigLevels of miR-203-3p, IL-33, and collagen in HSCs during in vitro activation were detected by qPCR. [score:1]
Relationship between miR-203-3p and IL-33 in human system. [score:1]
Validation of the relationship between miR-203-3p and IL-33. [score:1]
This construct was transiently transfected into 293T cells together with miR-203-3p mimics or a negative control miRNA. [score:1]
To analyze the relationship between miR-203-3p and IL-33, we evaluated their expression during the progression of hepatic schistosomiasis. [score:1]
We found that recombinant adeno -associated virus 8 (rAAV8) mediated elevation of miR-203-3p in the liver protected mice from lethal infection through alleviating type 2 pathology. [score:1]
rAAV8 -mediated elevation of miR-203-3p protects mice against lethal schistosome infection by attenuation of type 2 pathology. [score:1]
In this study, we demonstrate that efficient and sustained elevation of miR-203-3p in liver tissues, using the highly hepatotropic rAAV8, protects mice against lethal schistosome infection by alleviating hepatic fibrosis. [score:1]
Production of IL-13 in hepatic ILC2s and STAT6 activation in HSCs after elevation of miR-203-3p in the infected livers. [score:1]
To this end, we isolated primary HSCs from infected mice after administration with vectors to quantify mRNA levels of miR-203-3p, Col1α1, Col3α1, and α-Sma. [score:1]
MiR-203-3p regulates the activation of HSCs. [score:1]
Infected mice received rAAV8-PI or rAAV8-pri-miR-203-3p vectors at a dose of 1×10 [11] virus genomes or PBS by tail vein injection at day 10 post-infection. [score:1]
We observed a marked reduction in luciferase activity in cells transfected with miR-203-3p mimics together with Il33-UTR (Fig 4B). [score:1]
The reduced miR-203-3p leads to elevated levels of IL-33, promoting the expansion and IL-13 production of hepatic group 2 innate lymphoid cells and thus initiating type 2 pathology. [score:1]
293T cells were seeded in 24-well plates, then transfected with 40 nM miR-203-3p or a negative control (Qiagen) and co -transfected with 0.8 μg per well wild-type IL-33 3’ UTR-luc or mutant IL-33 3’UTR-luc, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
By 6 weeks post-infection, mice receiving rAAV8-pri-miR-203-3p displayed a significant reduction in ECM deposition as shown by hydroxyproline quantification (Fig 1C) and Masson’s trichrome staining (Fig 1D and 1F), whereas the size of hepatic granulomas in all groups was similar as shown by H&E staining (Fig 1E and 1F). [score:1]
Striped bars, uninfected mice (n = 4); white bars, mice receiving PBS (n = 4); grey bars, mice receiving rAAV8-PI (n = 4); black bars, mice receiving rAAV8-pri-miR-203-3p (n = 4). [score:1]
In addition, we investigated the expression of miR-203-3p and Il33 mRNA in different hepatic cell compartments, including hepatocytes, HSCs, and Kupffer cells (KCs). [score:1]
Six of ten mice receiving rAAV8-pri-miR-203-3p survived to the end of the study (i. e. 80 days; Fig 1A). [score:1]
Importantly, rAAV8 -mediated elevation of miR-203-3p in liver tissues protects mice against lethal schistosome infection by alleviating hepatic fibrosis. [score:1]
The infected mice were treated with praziquantel to kill the parasites, then received rAAV8-PI or rAAV8-pri-miR-203-3p vectors at a dose of 1×10 [11] virus genomes or PBS by tail vein infection at day 42 post-infection. [score:1]
Levels of miR-203-3p, IL-33, and collagen in HSCs during in vitro activation were detected by qPCR. [score:1]
We found that a single dose of rAAV8-pri-miR-203-3p protected infected mice from the lethal effect of schistosomiasis. [score:1]
Our data revealed that the level of miR-203-3p in the rAAV8-pri-miR-203-3p treated group was significantly higher than in the control groups (Fig 1B). [score:1]
rAAV8 -mediated elevation of miR-203-3p has therapeutic potential for hepatic fibrosis induced by schistosome infection. [score:1]
Striped bars, uninfected mice (n = 3); white bars, mice receiving PBS (n = 3); grey bars, mice receiving rAAV8-PI (n = 3); black bars, mice receiving rAAV8-pri-miR-203-3p (n = 3). [score:1]
The identity of pri-miR-203-3p was verified by sequencing. [score:1]
Striped bars, uninfected mice (n = 3); white bars, mice receiving PBS (n = 6); grey bars, mice receiving rAAV8-PI (n = 6); black bars, mice receiving rAAV8-pri-miR-203-3p (n = 6). [score:1]
The levels of miR-203-3p, Col1α1, Col3α1, α-Sma, Ifn-γ, Tnf-α, Tgf-β1, Il4, Il5, Il10, Il13, and Il33 were detected using the SYBR Green Master Mix kit (Roche). [score:1]
Elevation of miR-203-3p protects hosts from lethal schistosome infection by relieving type 2 pathology. [score:1]
[1 to 20 of 84 sentences]
13
[+] score: 226
Other miRNAs from this paper: hsa-mir-203b
Here, we showed that miR-203 could significantly inhibit ΔNp63 protein expression without changing the expression level of ΔNp63 mRNA, suggesting that miR203 negatively regulated the expression of ΔNp63 at the posttranscriptional level in ESCC. [score:10]
Moreover, it was reported that inhibition of miR-203 expression could significantly increase the proliferation of Hela cells [26], whilst re -expression of miR-203 could inhibit the proliferative capacity of cells in human head and neck squamous cell carcinoma [14], hepatocellular carcinoma [16], chronic myelogenous leukemia and B cell leukemia [13]. [score:9]
MiR-203 posttranscriptionally down-regulates ΔNp63 expression by targeting the 3' untranslated region of ΔNp63. [score:9]
These results imply that re -expressing ΔNp63 could significantly attenuate the inhibitory effect of miR-203 on cell proliferation, suggesting that the miR-203 inhibits the proliferation of ESCC cells through the ΔNp63 -mediated signal pathway. [score:7]
It was reported that MicroRNA-203 (miR-203) located in a region at chromosome 14 [13], which contains a high density of microRNAs (including about 12% of the known human microRNA gene), exhibited significantly down-regulated expression in some tumors such as head and neck squamous cell carcinomas [14], hematopoietic malignancy [13] and colon cancer [15]. [score:6]
It was reported that the expression of miR-203 was significantly down-regulated in some tumors, including head and neck squamous cell carcinomas [14], hematopoietic malignancy [13] and colon cancer [15]. [score:6]
In human ESCC, genome-wide microRNA expression profile assay showed that the expression level of miR-203 was significantly down-regulated in tumor tissue compared with the matched normal tissue [19- 21]. [score:6]
This result, combined with the fact that the expression level of ΔNp63 protein in the cells cotransfected with miR-203 and pcDNA-ΔNp63 was significantly higher than that in cells cotransfected with control microRNA and empty pcDNA plasmid (Additional file 1, Figure S4), suggest that miR-203 might regulate the proliferation of ESCC cells through multiple target genes. [score:6]
Moreover, re -expression of ΔNp63 in cells transfected with miR-203 significantly attenuated the miR-203 induced inhibition of cell proliferation. [score:5]
com/1471-2407/11/57/prepub Results of the expression of miR-203, p63 isoforms (ΔNp63 and TAp63) in Eca109 and TE-1 cell lines; the proliferative capacity of cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid (or with control microRNA and empty pcDNA plasmid); the expression level of ΔNp63 protein in cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid (or with control microRNA and empty pcDNA plasmid); cell cycle analysis of Eca109 and TE-1 cell transfected with miR-203 and ΔNp63 siRNA. [score:5]
As shown in Figure S1, mature miR-203 was highly expressed in cells transfected with miR-203 while the expression level of miR-203 was still very low in cells transfected with control microRNA 48 hr posttransfection. [score:5]
In the case of esophageal cancer, genome-wide microRNA expression profile analysis revealed that the expression level of miR-203 was 2- to 10-fold lower in tumor than in the matched normal tissues [19- 21]. [score:5]
Click here for file of the expression of miR-203, p63 isoforms (ΔNp63 and TAp63) in Eca109 and TE-1 cell lines; the proliferative capacity of cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid (or with control microRNA and empty pcDNA plasmid); the expression level of ΔNp63 protein in cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid (or with control microRNA and empty pcDNA plasmid); cell cycle analysis of Eca109 and TE-1 cell transfected with miR-203 and ΔNp63 siRNA. [score:5]
The inhibition of the proliferation of ESCC cells by miR-203 could be significantly attenuated by the re -expressing of ΔNp63. [score:5]
Subsequent studies showed that miR-203 could repress the expression of ΔNp63 and inhibit cell proliferation in human epithelial precursor cells as well as human head and neck squamous cell carcinoma cells, suggesting that miR-203 is a key molecule controlling the ΔNp63 -mediated cell proliferation in some normal and tumor cells [14, 18]. [score:5]
Figure 4 Re -expressing ΔNp63 could significantly attenuate the effect of miR-203 on the inhibition of ESCC cell proliferation. [score:5]
MiR-203 could down-regulate endogenous ΔNp63 expression at the posttranscriptional level. [score:5]
Moreover, we demonstrated that re -expressing ΔNp63 in miR-203 transfected ESCC cells could significantly attenuate miR-203 induced inhibition of cell proliferation. [score:5]
The effect of ΔNp63 re -expression on miR-203 induced inhibition of cell proliferation was studied by cell proliferation assay in cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid (without the 3'-UTR of ΔNp63). [score:4]
Taken together, our results suggest that miR-203 may function as a tumor suppressor by regulating ΔNp63 -mediated signal pathways in human ESCC. [score:4]
Here, we have demonstrated that miR-203 could down-regulate the proliferation of ESCC cells, probably through the ΔNp63 -mediated signal pathway. [score:4]
However, whether miR-203 regulates the expression of ΔNp63 in ESCC has not been identified before. [score:4]
In addition, ΔNp63, an important oncogene regulating cell proliferation in some tumors [17], was recently identified as a target gene of miR-203 in human epithelial precursor cells, as well as human head and neck squamous cell carcinoma cells [14, 18]. [score:4]
We scanned the basal expression levels of miR-203 in the ESCC cell lines by real time PCR. [score:3]
Our data implied that miR-203 could inhibit cell proliferation in human ESCC through ΔNp63 -mediated signal pathway. [score:3]
showed that the expression level of ΔNp63 mRNA exhibited no significantly difference between cells transfected with miR-203 and those transfected with control microRNA. [score:3]
Our results suggest that miR-203 may inhibit the cell proliferation in ESCC through the ΔNp63 -mediated signal pathway. [score:3]
The regulation of ΔNp63 expression in ESCC cells by miR-203 was studied by luciferase reporter assay, RT-PCR and western blot analysis in cells transfected with miR-203. [score:3]
At 48 hr posttransfection, western blot revealed that the expression level of ΔNp63 in cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid was significantly higher than that in cells cotransfected with miR-203 and empty pcDNA plasmid (Figure 4A and 4B). [score:3]
In the present study, we found that the proliferative capacity of ESCC cells transfected with miR-203 was significantly lower than that of cells transfected with control microRNA, suggesting that miR-203 could inhibit the proliferative capacity of ESCC cells. [score:3]
It was found that both Eca109 and TE-1 expressed very low level of miR-203 (Additional file 1, Figure S1). [score:3]
The sequences of miR-203 were: Sense: 5'-GUGAAAUGUUUAGGACCACUAG-3', Anti-sense: 5'-CUAGUGGUCCUAAACAUUUCAC-3', A scrambled microRNA with no homology to any known human microRNA was used as negative control: Sense: 5'-GUUGAACUGUUAAGAACCACUGG-3', Anti-sense: 5'-CCAGUGGUUCUUAACAGUUCAAC-3', The siRNA oligonucleotides targeting ΔNp63 were designed as previously described [25]: Sense: 5'-AACAGCCAUGCCCAGUAUGUA-3'; Anti-sense: 5'- UACAUACUGGGCAUGGCUGUU-3'. [score:3]
Our data suggest that re -expressing miR-203 might benefit the treatment of ESCC. [score:3]
The sequences of miR-203 were: Sense: 5'-GUGAAAUGUUUAGGACCACUAG-3', Anti-sense: 5'-CUAGUGGUCCUAAACAUUUCAC-3', A scrambled microRNA with no homology to any known human microRNA was used as negative control: Sense: 5'-GUUGAACUGUUAAGAACCACUGG-3', Anti-sense: 5'-CCAGUGGUUCUUAACAGUUCAAC-3',The siRNA oligonucleotides targeting ΔNp63 were designed as previously described [25]: Sense: 5'-AACAGCCAUGCCCAGUAUGUA-3'; Anti-sense: 5'- UACAUACUGGGCAUGGCUGUU-3'. [score:3]
Subsequent studies showed that the expression level of miR-203 is inversely correlated with the capacity of cell proliferation in human head and neck squamous cell carcinoma [14], hepatocellular carcinoma [16], chronic myelogenous leukemia and B cell leukemia [13]. [score:3]
These findings suggest that miR-203 might function as a tumor suppressor gene in a variety of tumors. [score:3]
We found that both miR-203 and ΔNp63 siRNA signicantly inhibited cell proliferation in ESCC. [score:3]
We further detected the expression of ΔNp63 protein and mRNA by western blot and qRT-PCR in Eca109 and TE-1 cells transfected with miR-203 (or control microRNA). [score:3]
These results indicate that the 3'-UTR of ΔNp63 mRNA is a functional target of miR-203 in ESCC cells. [score:3]
These results suggest that miR-203 could inhibit the proliferation of ESCC cell. [score:3]
showed that the expression level of ΔNp63 protein was significantly decreased in cells transfected with miR-203 as compared to the cells transfected with control microRNA. [score:2]
In summary, we have demonstrated that miR-203 and ΔNp63 play an important role in ESCC cell proliferation regulation. [score:2]
In light of the previous reports, we hypothesized that miR-203 might regulate the proliferation of ESCC cells through the ΔNp63 -mediated signal pathway. [score:2]
As shown in Figure 3C and 3D, the expression of ΔNp63 protein was decreased by approximately 80% in cells transfected with miR-203 as compared to the cells treated with control microRNA at 48 hr posttransfection (0.08 ± 0.02 vs. [score:2]
These findings suggested that there might be a functional connection between miR-203 and ΔNp63 in cell proliferation regulation. [score:2]
Therefore, using 2 human ESCC cell lines (Eca109 and TE-1) as a mo del system, here we set out to investigate the effect of miR-203 and ΔNp63 on the proliferation of ESCC cell, as well as the regulation of the expression of ΔNp63 by miR-203 in ESCC. [score:2]
showed that the expression level of ΔNp63 protein was significantly higher in cells cotransfected with miR-203 and pcDNA-ΔNp63 as compared to the cells transfected with miR-203 and empty pcDNA. [score:2]
MiR-203 could inhibit the proliferation of ESCC cell lines. [score:2]
Figure 1 MiR-203 inhibits the proliferation of ESCC cell lines. [score:2]
MiR-203 can significantly inhibit the proliferation of ESCC cell through the ΔNp63 -mediated signal pathway. [score:2]
Meanwhile, cells transfected with miR-203 exhibited significantly lower colony forming efficiency as well as significantly longer population doubling time than those transfected with control microRNA (Figure 1D-F). [score:1]
showed that proliferative index (PI) of cells transfected with miR-203 was significantly lower than that of cells transfected with control microRNA. [score:1]
Based on these findings, we propose that miR-203 might be used as a therapeutic agent for ESCC. [score:1]
Transfection condition: 1 × 10 [6 ]cells (Eca109 or TE-1) were cotransfected with 50 pmol of miR-203 and pcDNA-ΔNp63 (or empty pcDNA). [score:1]
showed that apoptotic index (AI) of cells transfected with miR-203 was significantly higher than that of cells transfected with control microRNA. [score:1]
Then, 1 × 10 [6 ]cells were cotransfected with 50 pmol of microRNA-203 (or control microRNA), 1 μg of Luc-ΔNp63 (or Luc-ΔNp63-mut) plasmid, and 1 μg of pMIR-REPORT β-Gal vector using Lipofectamine 2000. [score:1]
1 × 10 [6 ]cells cultured in a well of 6-well cell culture plate were transiently transfected with 50 pmol of miR-203 double-stranded mimics (or control microRNA) and ΔNp63 siRNA oligonucleotide duplexes (or control siRNA) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol, respectively. [score:1]
To determine whether the 3'-UTR of ΔNp63 mRNA is a functional target of miR-203 in ESCC cells, we evaluated the reporter activity in cells cotransfected with miR-203 (or control microRNA) and Luc-ΔNp63 plasmid (or Luc-ΔNp63-mut plasmid). [score:1]
Recently, using bioinformatic analysis, Lena et al. [14] and Yi et al. [18] independently reported that the 3'-UTR of ΔNp63 contain the miR-203 binding site. [score:1]
The effect of miR-203 and ΔNp63 on cell proliferation was determined in cells transfected with miR-203 mimic and ΔNp63 small interfering RNA (siRNA), respectively. [score:1]
showed that the proliferative capacity of cells cotransfected with miR-203 and pcDNA-ΔNp63 was significantly higher than that of cells cotransfected with miR-203 and empty pcDNA. [score:1]
As shown in Figure 3A, cells cotransfected with miR-203 and Luc-ΔNp63 plasmid showed a significant decrease of reporter activity in comparison with those cotransfected with the control microRNA and Luc-ΔNp63 plasmid. [score:1]
Subsequent studies showed that the cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid had a significantly higher proliferative index, as well as a significantly lower apoptotic index than those cotransfected with miR-203 and empty pcDNA plasmid (Figure 4C and 4D). [score:1]
Transfection condition: Cells (1 × 10 [6]) of Eca109 and TE-1 were transfected with 50 pmol of miR-203 (or control microRNA). [score:1]
showed that the PDT of cells transfected with miR-203 was significantly longer than that of cells transfected with control microRNA. [score:1]
showed that the colony forming efficiency (CFE) of cells transfected with miR-203 was significantly lower than that of cells transfected with control microRNA. [score:1]
Therefore, we propose that miR-203 might be used as a therapeutic agent for human ESCC. [score:1]
However, we noticed that the proliferative capacity of the ESCC cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid, though much higher than that of the cells cotransfected with miR-203 and empty pcDNA plasmid, is still significantly lower than that of the cells cotransfected with control microRNA and empty pcDNA plasmid (Additional file 1, Figure S3). [score:1]
showed that cells cotransfected with miR-203 and Luc-ΔNp63 plasmid exhibited a significant decrease of reporter activity in comparison with those cotransfected with the control microRNA and Luc-ΔNp63 plasmid (a). [score:1]
In addition, cells treated with miR-203 had a significantly lower proliferative index and a significantly higher apoptotic index than cells transfected with control microRNA (Figure 1A-C and Additional file 1, Table. [score:1]
Meanwhile, cells cotransfected with miR-203 and pcDNA-ΔNp63 plasmid exhibited a significantly higher colony forming efficiency, as well as a significantly shorter population doubling time than the control cells (Figure 4E and 4F). [score:1]
However, the effect of miR-203 on the cell proliferation in human ESCC has not been reported. [score:1]
It was reported that the 3'-UTR of ΔNp63 contains the miR-203 binding site [14]. [score:1]
The full-length 3'-UTR of ΔNp63 mRNA containing the miR-203 binding site was amplified by PCR (Forward: 5'-ggggagctcatataagaactcttgcagtct-3'; Reverse: 5'-gggaagcttggtgtacattcttctagaac-3'). [score:1]
However, the effect of miR-203 and ΔNp63 on the proliferation of ESCC cells, as well as the functional relationship between miR-203 and ΔNp63 in ESCC cells has not been documented. [score:1]
However, the reporter activity of cells cotransfected with miR-203 and Luc-ΔNp63-mut plasmid showed no significant difference with that of cells cotransfected with control microRNA and Luc-ΔNp63-mut plasmid (b). [score:1]
[1 to 20 of 76 sentences]
14
[+] score: 220
Using the trans-well invasion, wound healing, angiogenesis, and western blot assays, we found that silencing HOXD3 resulted in the suppression of cell invasion, migration, angiogenesis, downregulation of VEGFR, N-cadherin and MMP9 expression, and up-regulation of E-cadherin expression, all of which were comparable to the effects seen following miR-203a overexpression in SMMC-7721/Hep3B cells (Fig.   3). [score:14]
Western blotting showed that miR-203a expression inhibited the expression of VEGFR, MMP9 and N-cadherin while increasing the expression of E-cadherin (Fig.   1D) Figure 1Overexpression of miR-203a suppressed HCCs metastasis, invasion and angiogenesis. [score:13]
In this study, by overexpressing or silencing miR-203a and HOXD3 expression in HCC cells, we show that HOXD3 can be targeted by miR-203a and directly regulates the expression of VEGFR to inhibit HCC metastasis, invasion, and angiogenesis. [score:13]
In this context, our results demonstrate that overexpression of miR-203a inhibits HOXD3, which then indirectly leads to down-regulation of the VEGFR pathway, thereby suppressing tumor invasion, migration, and angiogenesis in HCC. [score:11]
By western blotting, the expression of VEGFR, N-cadherin and MMP9 were found to be up-regulated, whereas that of E-cadherin was down-regulated, in HCC cells transfected with the miR-203a inhibitor (Fig.   2D). [score:11]
Inhibition of miR-203a expression increases the HCCs invasion and angiogenesis in vitroInhibition of miR-203a expression increases HCC cell invasion and angiogenesis in vitroTo investigate the function of miR-203a further, the miR-203a inhibitor or its control were transfected into SMMC-7721 and Hep3B cells. [score:9]
In a previous study, we found that overexpression of miR-203a or knockdown of HOXD3, resulted in the suppression of AKT and ERK phosphorylation and activation. [score:6]
Figure 6 HOXD3 targeted by miR-203a suppresses cell metastasis and angiogenesis directly through the VEGFR signal pathway in human hepatocellular carcinoma cells. [score:6]
Based on these studies, we propose that miR-203a targets HOXD3 directly and acts through the VEGFR signaling pathway to suppress angiogenesis (Fig.   6). [score:6]
T These results further suggest that miR-203a suppresses tumor invasion and angiogenesis by directly targeting HOXD3. [score:6]
However, the effect of overexpression of HOXD3 was contrary to lose the function of HOXD3, and overexpression of HOXD3 could eliminate the effects of miR-203a on HCC cells (Fig.   4). [score:5]
Inhibition of miR-203a expression increases the HCCs invasion and angiogenesis in vitro. [score:5]
In our previous study, we found that miR-203a targets HOXD3 and, through the EGFR/AKT and ERK signaling pathways, leads to suppression of HCC cell proliferation [20]. [score:5]
Meanwhile, compared with cotransfected with miR-203a and HOXD3-ctrl, the expression of VEGFR, MMP9, N-cadherin was upregulated after cotransfected with miR-203a and HOXD3 (Fig.   4D). [score:5]
The construction of miR-203a and HOXD3 expression vectors and the synthesis of ASO-miR-203a (antisense oligonucleotide of miR-203a, miR-203a inhibitor), si-ctrl and si-HOXD3 were performed as described previously [20]. [score:5]
To further demonstrate that miR-203a suppresses migration through HOXD3, we constructed an HOXD3 overexpression vector, which was then co -transfected with either miR-ctrl or miR-203a into SMMC-7721 cells and Hep3B cells. [score:5]
Inhibition of miR-203a expression increases HCC cell invasion and angiogenesis in vitroTo investigate the function of miR-203a further, the miR-203a inhibitor or its control were transfected into SMMC-7721 and Hep3B cells. [score:5]
Inhibition of miR-203a expression increases HCC cell invasion and angiogenesis in vitro. [score:5]
To determine whether miR-203a also regulates angiogenesis, human umbilical vein endothelial cells (HUVECs) were transfected with either a miR-203a -expressing vector or its control. [score:4]
However, the underlying molecular mechanisms by which miR-203a regulates invasion, metastasis, and angiogenesis in HCC, via targeting of HOXD3 in HCC cells, has yet to be fully elucidated. [score:4]
Using trans-well invasion and wound healing assays, we found that inhibition of miR-203a expression increased HCC cell invasion and angiogenesis (Fig.   2A,B). [score:4]
In the wound-healing assay, we found that overexpression of miR-203a inhibited the migration of SMMC-7721 and Hep3B cells (Fig.   1B). [score:4]
Combining with the assay of correlation between miR-203a expression levels and clinicopathological characteristics of HCC patients, it showed that miR-203a expression levels were significantly associated with tumor TNM stage (Table  1), suggesting that miR-230a plays a tumor-suppressive role. [score:4]
In our previous and new researches, we found miR-203a was downregulated in HCC tissues (Fig. S 1) and HCCs. [score:4]
HOXD3 knockdown has effects similar to those of miR-203a overexpression in HCC cells. [score:4]
It is well known that miRNAs, acting as either oncogenes or tumor suppressors, participate in numerous biological processes, such as invasion, metastasis and angiogenesis 6– 9. Similar to other members of the miR-203 family, miR-203a has been reported to act as an anti-oncogenic miRNA in some cancers 10, 11. [score:3]
The data showed that HCC patients with high levels of miR-203a expression had high survival rates (Fig. S 2). [score:3]
Notably, miR-203a expression decreased angiogenesis by attenuating tube formation in HUVECs (Fig.   1C). [score:3]
In our previous research, we found that HOXD3 is a target gene for miR-203a [20]. [score:3]
However, after co-transfection of miR-203a and HOXD3, we found that the expression of miR-203a attenuated these effects of HOXD3 in SMMC-7721 and Hep3B cells (Fig.   4A–C). [score:3]
Furthermore, from miR-203a gain- and loss-of-function studies, we discovered that overexpression of miR-203a reduced tumor angiogenesis (Figs  1, 2). [score:3]
In a previous study, we confirmed that miR-203a could target the 3’-UTR region of the HOXD3 mRNA. [score:3]
From the current study, we showed that the expression of EMT marker E-cadherin and N-cadherin protein levels has changed, when gain and lose the function of miR-203a and HOXD3. [score:3]
In our current study, we hypothesized that reduced expression of miR-203a may be responsible for metastasis and angiogenesis in HCC cells. [score:3]
Overexpression of HOXD3 attenuates the effects of miR-203a on HCC cells. [score:3]
In vivo, we used lentiviral vectors to stably express miR-203a in SMMC-7721 cells. [score:3]
The present study therefore suggests that miR-203a may act as a tumor suppressor and HOXD3 may play the role of an oncogene; and thus, may provide a beneficial strategy for future HCC therapy. [score:3]
miR-203a suppresses HCC invasion and angiogenesis both in vitro and in vivo. [score:3]
Figure 2Inhibitor of mir-203a increased HCCs metastasis, invasion and angiogenesis. [score:3]
These data support the hypothesis that abnormal expression of miR-203a affects invasion, metastasis, and tube formation in HCC cells. [score:3]
As shown in Fig.   1C, angiogenesis was significantly suppressed by LV-miR-203a compared with the control. [score:2]
Lin, Q. H. et al. ERGIC3, which is regulated by miR-203a, is a potential biomarker for non-small cell lung cancer. [score:2]
The same trend was seen in the tube formation assay, with increased tube formation observed in cells transfected with the miR-203a inhibitor (Fig.   2C). [score:2]
Next, miR-ctrl, miR-203a, ASO-NC, ASO-miR-203a, si-ctrl, siHOXD3, HOXD3-ctrl and HOXD3 were transfected into HUVECs for 24 h, incubated them without serum free medium for 24 h, and transfectant HUVECs (4 × 10 [4]) were resuspended in 100 μl of conditioned media with 1% FBS and seeded on Matrigel-coated 96-well plate. [score:1]
To investigate the function of miR-203a further, the miR-203a inhibitor or its control were transfected into SMMC-7721 and Hep3B cells. [score:1]
However, the function of miR-203a in tumor invasion, migration, and angiogenesis was not clear. [score:1]
To verify the role of miR-203a in tumors, the TCGA database was used to analyze the relationship between miR-203a and survival rate. [score:1]
We used HUVEC cells to assess the function of miR-203a in tumor angiogenesis in vitro, and xenograft tumor growth to demonstrate the role of miR-203a in angiogenesis in vivo. [score:1]
In the trans-well invasion assay, SMMC-7721 and Hep3B cells overexpressing miR-203a showed significantly decreased invasive abilities compared with cells transfected with the vector control (Fig.   1A). [score:1]
[1 to 20 of 49 sentences]
15
[+] score: 213
Entinostat elicits hypomethylation of miR-203 promoter and downregulation of DNMT1The expression of miR-203 is frequently downregulated due to promoter methylation in cancers of breast, prostate, liver, and hematologic malignancies [31– 36]. [score:9]
While either miRZip-203 or miRZip-542-3p had little effect on entinostat -mediated reduction of Survivin, inhibition of both miR-203 and miR-542-3p attenuated entinostat's inhibitory effect on Survivin (Figure 6A), suggesting that miR-203 and miR-542-3p worked cooperatively in entinostat action to downregulate Survivin. [score:8]
Figure 12Entinostat enhances expression of miR-203 (in vitro and in vivo) and miR-542-3p (in vitro) via inhibition of HDAC, downregulation of DNMT1, and/or other mechanisms to reduce Survivin, and thereby potentiate paclitaxel -induced apoptosis in NSCLC cells. [score:8]
Entinostat enhances expression of miR-203 (in vitro and in vivo) and miR-542-3p (in vitro) via inhibition of HDAC, downregulation of DNMT1, and/or other mechanisms to reduce Survivin, and thereby potentiate paclitaxel -induced apoptosis in NSCLC cells. [score:8]
Thus, it is conceivable to hypothesize that novel therapies which are able to induce expression of miR-203 will effectively downregulate Survivin, and therefore sensitize the cancer cells to paclitaxel treatment. [score:6]
Our analysis suggests that miR-203 is frequentlydownregulated due to promoter methylation in NSCLC, and the reduced miR-203 is inversely correlated with the expression of Survivin and DNMT1 (Figure 11D). [score:6]
The expression of miR-203 is frequently downregulated due to promoter methylation in cancers of breast, prostate, liver, and hematologic malignancies [31– 36]. [score:6]
Collectively, our studies indicate that inhibition of DNMT1 is at least one of the major mechanisms for entinostat to lift epigenetic silencing of miR-203, which results in downregulation of Survivin and thereby enhances paclitaxel -mediated antitumor activity against NSCLC (Figure 12). [score:6]
Thus, our studies indicate that entinostat, likely through upregulation of miR-203, potentiates the antitumor activity of paclitaxel against NSCLC via inhibition of cell proliferation and induction of apoptosis in vivo. [score:6]
MiR-203 and/or miR-542-3p mimics specifically downregulate Survivin and significantly enhance paclitaxel -induced growth inhibition and apoptosis in NSCLC cells. [score:6]
Taken together, our data indicate that both miR-203 and miR-542-3p contribute to entinostat -mediated reduction of Survivin; and upregulation of the two miRNAs is necessary and sufficient for entinostat potentiation of paclitaxel -induced growth inhibition and apoptosis in NSCLC cells. [score:6]
The expression levels of miR-203, but not miR-542-3p, are significantly increased, associated with miR-203 promoter hypermethylation, and inversely correlated with the expression of DNMT1 and Survivin in NSCLC tumors. [score:5]
As a consequence, simultaneous inhibition of miR-203 and miR-542-3p significantly reversed entinostat enhancement of paclitaxel -induced growth inhibition and apoptosis (Figure 6B–6D). [score:5]
Collectively, our data demonstrate that elevated expression of DNMT1 may give rise to miR-203 promoter hypermethylation, and thereby lead to Survivin overexpression in NSCLC. [score:5]
Figure 11The expression levels of miR-203, but not miR-542-3p, are significantly increased, associated with miR-203 promoter hypermethylation, and inversely correlated with the expression of DNMT1 and Survivin in NSCLC tumors(A) The expression levels of miR-203 and miR-542-3p in NSCLC tumors and their self-paired normal adjacent lung tissues (n = 20) were measured by qRT-PCR and normalized to RNU6B. [score:5]
The correlations between miR-203 promoter methylation and miR-203 expression, between miR-203 and Survivin expression, and between DNMT1 and Survivin expression were evaluated by Pearson's correlation coefficient (r). [score:5]
Lentiviral miRZip expression system (scramble control, miRZip-203, or miRZip-542-3p) was applied to fulfill specific inhibition of miR-203 or miR-542-3p in NSCLC cells. [score:5]
Entinostat downregulates Survivin via induction of miR-203 and miR-542-3p. [score:4]
Entinostat elicits hypomethylation of miR-203 promoter and downregulation of DNMT1. [score:4]
Specific knockdown of miR-203 and/or miR-542-3p reverses entinostat-enhanced paclitaxel -mediated growth inhibition and apoptosis in NSCLC cells. [score:4]
Figure 8Entinostat demethylates miR-203 promoter in NSCLC cells correlated with the downregulation of both protein and mRNA levels of DNMT1 in vitroA549 and H460 cells were untreated or treated with entinostat (3 μmol/L for A549, 1 μmol/L for H460) for 24 or 48 h. (A) Some cells were collected and subjected to DNA extraction. [score:4]
Recent studies show that a number of miRNAs, including miR-203 and miR-542-3p, play critical roles in regulating Survivin expression in cancer cells [45]. [score:4]
Entinostat demethylates miR-203 promoter in NSCLC cells correlated with the downregulation of both protein and mRNA levels of DNMT1 in vitro. [score:4]
We then sought to understand if the induction of miR-203 and/or miR-542-3p was required for entinostat -induced downregulation of Survivin. [score:4]
Interestingly, entinostat significantly upregulated miR-203 (not miR-542-3p); and this induction was further enhanced when entinostat was combined with paclitaxel (Figure 7D). [score:4]
In summary, we demonstrate that entinostat downregulates Survivin via induction of miR-203 and miR-542-3p in vitro and/or in vivo, and thereby potentiates paclitaxel -mediated antitumor activity against NSCLC. [score:4]
The lentiviral miRZip-203 or miRZip-542-3p was applied to specifically inhibit miR-203 or miR-542-3p, respectively. [score:3]
It seemed that miR-542-3p or two miRNA mimic(s) were more effective than miR-203 mimic to enhance paclitaxel -induced growth inhibition (Figure 5B). [score:3]
Although the expression levels of miR-203 are much lower in lung cancer cell lines than that in normal bronchial epithelial cells [37], it is unclear if this reduction is due to miR-203 promoter methylation. [score:3]
More importantly, a significant inverse correlation was detected between miR-203 (not miR-542-3p) and the expression of Survivin (r = −0.561, P = 0.01) or DNMT1 (r = −0.502, P = 0.024). [score:3]
It appeared that chemotherapy alone had no effect on the miRNAs in vitro, as treatment of A549 or H460 cells with paclitaxel did not alter the expression of either miR-203 or miR-542-3p (Data not shown). [score:3]
To test this hypothesis, we first examined the expression of miR-203 and miR-542-3p as well as Survivin and DNMT1 in 20 freshly-obtained NSCLC samples and their self-paired normal adjacent lung tissues (Table 1). [score:3]
Clinical studies show that increased DNMT1 positively correlates with miR-203 promoter methylation and overexpression of Survivin in NSCLC tumors. [score:3]
Our discovery that increased DNMT1 negatively correlates with miR-203 expression in NSCLC offers a representative paradigm regarding the cross-talk between genetic and epigenetic alterations. [score:3]
Here, we showed that epigenetic silencing of miR-203, leading to Survivin overexpression, played a key role in determining the sensitivity of NSCLC cells to paclitaxel. [score:3]
Statistics of the relative expression values of miR-203, miR-542-3p, Survivin, and DNMT1 in the self-paired clinical samples from patients with NSCLC. [score:3]
Taken together, our data suggest that entinostat elicits miR-203 promoter hypomethylation via reduction of DNMT1 in vitro and in vivo, and thereby enhances expression of this miRNA in NSCLC cells. [score:3]
Quantitative real-time (qRT)-PCR showed that entinostat significantly induced miR-203 and miR-542-3p, two Survivin -targeting miRNAs [27, 28], in a dose- and time -dependent manner (Figure 4). [score:3]
Entinostat selectively increases the expression levels of miR-203 and miR-542-3p in A549 and H460 cells. [score:3]
We next explored whether the induction of miR-203 and/or miR-542-3p was sufficient to inhibit Survivin. [score:3]
Nonetheless, majority of the studies are carried out in preclinical mo dels, it is currently unknown whether the expression of miR-203 and/or miR-542-3p is altered in NSCLC tumors. [score:3]
Our data presented in this manuscript with entinostat to enhance miR-203 expression strongly support this notion. [score:3]
As a global enzyme maintaining DNA methylation status, how does the dysregulated DNMT1 link to specific silencing of miR-203 in NSCLC is an unsolved question. [score:2]
Independent-samples t-test showed that the expression of miR-203, but not miR-542-3p, was significantly reduced in NSCLCs as compared to that in normal lung tissues (Table 2). [score:2]
QRT-PCR analyses found that the expression levels of miR-203, but not miR-542-3p were significantly decreased in NSCLCs as compared to that in normal lung tissues (Figure 11A). [score:2]
The relative mRNA abundance of miR-203, miR-542-3p, Survivin, and DNMT1, as well as the methylation status of miR-203 promoter in the clinical samples of NSCLC patients. [score:1]
NS, no significance Figure 5A549 and H460 cells were either mock transfected or transfected with miR-203 mimic (40 nmol/L), or miR-542-3p mimic (10 nmol/L), or combinations of two miRNA mimics. [score:1]
NS, no significance Figure 5A549 and H460 cells were either mock transfected or transfected with miR-203 mimic (40 nmol/L), or miR-542-3p mimic (10 nmol/L), or combinations of two miRNA mimics. [score:1]
N) miR-203 methylation miR-542-3p (C vs. [score:1]
The expression levels of miR-203, miR-542-3p, Let-7c, and miR-29b were measured by qRT-PCR. [score:1]
The combinations of entinostat and paclitaxel exert potent antitumor activity against NSCLC likely due to dramatic reduction of DNMT1 through an unknown mechanism to release promoter methylation -mediated epigenetic silencing of miR-203. [score:1]
and unmethylation-specific PCR (USP) analyses of miR-203 promoter were performed as described in Methods. [score:1]
Hypermethylation of miR-203 promoter was discovered in 11 of 20 NSCLC tumors. [score:1]
showed that treatment with entinostat lowered miR-203 promoter methylation and increased unmethylation levels (Figure 8A), implying that entinostat might induce miR-203 in NSCLC cells via demethylation of miR-203 promoter. [score:1]
Hypermethylation of miR-203 promoter is associated with lower levels of miR-203 and higher levels of both DNMT1 and Survivin in NSCLC tumorsWe next focused our clinical studies on miR-203 and miR-542-3p. [score:1]
The HDACi entinostat selectively reduced Survivin via induction of miR-203 and miR-542-3p, and thereby significantly enhanced paclitaxel -induced apoptosis in NSCLC cells. [score:1]
NS, no significance A549 and H460 cells were either mock transfected or transfected with miR-203 mimic (40 nmol/L), or miR-542-3p mimic (10 nmol/L), or combinations of two miRNA mimics. [score:1]
The hypermethylation was inversely correlated with the levels of miR-203 in NSCLC (r = −0.668, P = 0.001; Figure 11C). [score:1]
To explore if miR-203 reduction might be attributed to its promoter methylation, we examined the methylation status of miR-203 promoter in the clinical samples. [score:1]
While transfection with the mimic of either miR-203 or miR-542-3p slightly decreased Survivin, the combinations of both miRNA mimics profoundly reduced Survivin in A549 and H460 cells (Figure 5A). [score:1]
The relative mRNA abundance of miR-203, miR-542-3p, Survivin, or DNMT1 was presented as 2 [^−ΔΔCt]. [score:1]
We next focused our clinical studies on miR-203 and miR-542-3p. [score:1]
Hypermethylation of miR-203 promoter is associated with lower levels of miR-203 and higher levels of both DNMT1 and Survivin in NSCLC tumors. [score:1]
[1 to 20 of 63 sentences]
16
[+] score: 203
Other miRNAs from this paper: hsa-mir-21, hsa-mir-26b, hsa-mir-203b
By Western blot analysis (Figure 3B), miR-203 overexpression had no influence on EGFP expression from pEGFP, while it reduced EGFP levels expressed from pEGFP-3′UTR (down to ≈10% of the levels seen in the scrambled Ctrl miRNA group, quantification shown in Figure 3C). [score:7]
Given that Hakai was found up-regulated in human colon adenocarcinomas [6], [14], we extended our study by analyzing miR-203 expression by in situ hybridization. [score:6]
In light of our results and the tumour suppressive function described for miR-203 in other cancer types [32]– [35], we propose that miR-203 could be a potentially useful prognostic marker and a therapeutic target in colon cancer. [score:5]
Apart from the validated miR-203 targets, there are numerous predicted miR-203 targets waiting for validation; they include mRNAs encoding proteins implicated in the pathways MAPK, Wnt, Notch, or IRS, which may also affect cell proliferation. [score:5]
The effect of miR-203 upon Hakai levels was specific, as reduction or overexpression of other miRNAs that were not predicted to target Hakai mRNA, such as miR-21, did not influence Hakai protein levels (Figure S2). [score:5]
Our results demonstrate that miR-203 targets Hakai mRNA by binding to the 3′UTR of the Hakai mRNA, lowering Hakai expression and decreasing cell proliferation. [score:5]
The antiproliferative function of miRNA-203 was reported a few years ago [46], but the complete set of targets have not been identified, still an obstacle to understand miR-203 function in cellular proliferation is the lack of well established validated targets for specific type of cancer tissues. [score:5]
In addition, in prostate cancer, CKAP2, LASP1, BIRC5, WASF1, ASAP1 and RUNX2 mRNAs were recently identified as new miR-203 targets, suggesting that miR-203 could be a new prognostic marker and a therapeutic target in metastasis of prostate cancer [45]. [score:5]
The effect of miR-203 on Hakai expression was tested in HeLa cells, which did not express E-cadherin, as shown in Figure S1 and previously published [30]. [score:5]
Our findings indicate that miR-203 mainly reduces Hakai protein levels, with only a slight effect on Hakai mRNA levels, suggesting that miR-203 controls Hakai translation, in keeping with the mechanisms of miRNA -mediated repression of translation [24], [37]. [score:5]
Here, we describe the identification of miRNA-203 as a negative regulator of Hakai expression. [score:4]
Hakai is a Direct Target of miR-203. [score:4]
Taken together, these results indicate that the 3′UTR of Hakai mRNA contains sequences through which miR-203 directly represses Hakai expression levels. [score:4]
Taken together, these results suggest that reduced miR-203 levels in cancer tissues could contribute to the up-regulation of Hakai levels. [score:4]
miR-203 represses the expression of other proliferative proteins in epithelial tissues, such as survivin or bcl-w [33], [36], so Hakai may function as one of several protein coordinately regulated by miR-203 in order to modulate cell proliferation. [score:4]
B, 48 h after cotransfection of the plasmids with scrambled control miRNA or Pre-miR-203, the level of EGFP expressed was analyzed by Western blotting. [score:3]
G, western blotting analysis (Top) and quantification by densitometry (Bottom) of AKT2 levels in HeLa cells expressing either pre-miR-203 or anti-miR-203, processed as described in D. Western blotting signals were quantified by densitometry and shown in 1D. [score:3]
Hakai and miR-203 expression in colon tissues. [score:3]
Therefore, the regulation of Hakai by miR-203, at least, partially contributes to the regulation of cell proliferation. [score:3]
0052568.g001 Figure 1A, schematic representation of Hakai mRNA depicting two predicted miR-203 target sites within the Hakai 3′UTR. [score:3]
Other mRNA targets have been previously described for miR-203. [score:3]
miR-203 and Hakai Expression in Tumour and the Adjacent Healthy Colon Tissues. [score:3]
Expression of the parent control EGFP reporter (pEGFP) and the Hakai 3′-UTR miR-203 site (pEGFP-3′UTR) was tested in cells transfected with either scrambled Ctrl miRNA or pre-miR-203. [score:3]
Finally, the effect of the transfected pre-miR-203 and anti-miR-203 in HeLa cells was also slightly seen on Akt2 (Figure 1G), a previously described target for miR-203 in bladder cancer [31], [32]. [score:3]
Significant differences in EGFP expression from pEGFP-3′UTR cotransfected with scrambled control miRNA (Ctrl) and pEGFP-3′UTR cotransfected with pre-miR-203 are indicated (***p<0.001). [score:3]
These findings were verified by fluorescence microscopy (Figure 3D), where EGFP fluorescence was markedly and selectively reduced after overexpression of pre-miR-203 in cells transfected with pEGFP-3′UTR. [score:3]
A, schematic of EGFP reporter constructs bearing either no Hakai mRNA sequences (pEGFP) or miR-203 target sites on the Hakai 3′-UTR (pEGFP-3′UTR). [score:3]
To study if miR-203 levels correlated inversely with Hakai expression levels, we assessed miR-203 abundance by in situ hybridization in four paired samples (Figure 6B). [score:3]
By Targetscan search (version release 5.1), the type of predicted sites for miR-203 was 7mer-1A (a match to positions 2–7 of the mature miRNA, the seed sequence, followed by an ‘A’). [score:3]
To elevate miR-203 levels, the precursor miR-203 transcript (pre-miR-203) was transfected and after 48 h after transfection, Hakai expression was analyzed by reverse transcription followed by quantitative real-time PCR (RT-qPCR) and Western blotting. [score:3]
To investigate whether miR-203 repressed Hakai expression through the predicted target sites on the Hakai 3′-UTR, we studied the influence of miR-203 on EGFP reporter constructs bearing the segments of the Hakai mRNA with the predicted mi-203 sites (Figure 3A). [score:3]
These data support the notion that miR-203 could broadly contribute to reduce Hakai expression. [score:3]
In addition, 48 h after transfection of antisense transcripts to reduce the levels of miR-203 (anti-miR-203), Hakai protein levels were higher in the scrambled Ctrl miRNA and un -transfected cells (Figure 1E), again in the absence of changes in Hakai mRNA levels (Figure 1F), suggesting that miR-203 influences Hakai mRNA translation rather than its degradation. [score:3]
Hakai and miR-203 expression levels were also analyzed in SW480 and in SW620 colon cell lines (Figure 2C and 2D), two cell lines established from a primary colon adenocarcinoma and its lymph node metastasis, respectively. [score:3]
A, schematic representation of Hakai mRNA depicting two predicted miR-203 target sites within the Hakai 3′UTR. [score:3]
Our findings support the notion that miR-203 function as a tumour suppressor [35], [36]. [score:3]
In light of the influence of miR-203 on Hakai, future studies to test whether miR-203 expression is broadly reduced in cancer are warranted. [score:3]
Moreover, ectopically expressed pEGFP-Hakai, lacking its 3′UTR, was cotransfected together with the pre-miR-203, anti-miR-203 and scrambled control miRNA. [score:3]
miR-203 was predicted to bind to Hakai mRNA at two sites within 3′-UTR, positions 1965 to 1977 and from 2172 to 2198 (Targetscan) (Figure 1A). [score:3]
0052568.g003 Figure 3 A, schematic of EGFP reporter constructs bearing either no Hakai mRNA sequences (pEGFP) or miR-203 target sites on the Hakai 3′-UTR (pEGFP-3′UTR). [score:3]
In this study, we describe the repression of Hakai expression by miR-203. [score:3]
Furthermore, immunohistochemcal analysis revealed that Hakai protein levels were higher in paired colon cancer tissues compared to adjacent healthy colon tissues and an inverse correlation was found for miR-203 levels by in situ hybridization, further suggesting a tumour suppressor role for miR-203 in colon cancer. [score:2]
Influence of miR-203-regulated Hakai on cell proliferation. [score:2]
miR-203 shows an attenuated expression in three of colon tumour tissues compared to normal colon tissues and no differences were detected in the other case analysed (data not shown) or when using control U6 probe (Figure 6B, middle panel). [score:2]
B, in situ hybridization (ISH) for miR-203 (upper panel) and U6 snRNA (as control probe, middle panel) expression in colon cancer tissues compared to normal colon tissue. [score:2]
Pre-mir-203- transfected HeLa cells, which express low levels of Hakai protein (Figure 1 and 2), showed reduced cell numbers compared to scrambled Ctrl miRNA population, while transfection of anti-miR-203 increased Hakai protein levels (Figure 1 and 2), and cell numbers (Figure 4A). [score:2]
By in situ hybridization, miR-203 presented lower levels of miR-203 in 3 healthy samples compared to colon cancer from 4 pairs analyzed, supporting the inverse correlation between Hakai expression and miR-203 levels. [score:2]
miR-203 Regulates Hakai Protein Levels. [score:2]
To examine if the effects of miR-203 on cell proliferation were dependent on changes in Hakai abundance, we studied the effect of knocking down Hakai on the proliferation rate of cultured epithelial cells. [score:2]
In conclusion, up to date, miR-203 is the first validated miRNA to influence Hakai protein levels. [score:1]
Together with the changes in DNA replication and cell cycle distribution profiles, these results indicate that the miR-203 affected cell proliferation. [score:1]
Influence of miR-203 on Hakai levels in several cell lines. [score:1]
Influence of miR-203 on cell proliferation. [score:1]
Our results have identified Hakai as a critical effector of miR-203 actions on cell proliferation (Figure 4 and 5). [score:1]
Importantly, the anti-miR-203-triggered increase in cell numbers was specifically dependent on the presence of Hakai, as concomitant Hakai silencing by siRNA in cells transfected with anti-miR-203 completely prevented the anti-miR-203-elicited proliferation, as shown by BrdU incorporation analyses and by counting cell numbers using hemocytometer (Figure 5C and 5D). [score:1]
B, the effect of modulating miR-203 levels in A549 cells was studied as described 1D and 1E. [score:1]
Transfection of HEK293 and A549 cells with anti-miR-203 similarly elevated Hakai levels, while pre-miR-203 lowered Hakai levels (Figure 2A and 2B, respectively). [score:1]
D, endogenous miR-203 levels in human colorectal cell lines (SW480 and SW620) by RT-qPCR (lower panel). [score:1]
The levels of Hakai and miR-203 were monitored in other cultured human epithelial cell lines (human lung adenocarcinoma A549, and human embryonic kidney HEK293 cells). [score:1]
D, the effect of the indicated transfected miR-203 on Hakai levels in HeLa cells were tested in HeLa whole-cell lysates by Western blotting (Top) and quantified by densitometry (Bottom), using Hakai antibody and α-tubulin as loading control for normalization. [score:1]
C, forty-eight h after transfection with scrambled Ctrl miRNA, Anti-miR-203, or Pre-miR-203, HeLa cells were subjected to FACS analysis. [score:1]
miR-203 modulates Hakai levels in HeLa cells. [score:1]
Alignment of consensus sequences of Hakai mRNA with miR-203; top strand, Hakai sequence; bottom strand, miR-203. [score:1]
miR-203 Mediates Changes in Cell Proliferation through its Influence on Hakai Levels. [score:1]
E, the levels of Hakai and loading control α-tubulin were tested in whole-cell lysates by Western blotting 48 h after transfecting HeLa cells with the anti-miR-203 or scrambled control miRNA. [score:1]
F, the levels of Hakai mRNA 48 h after transfection of HeLa cells with the anti-miR-203, or scrambled control miRNAs (each normalized to HPRT levels), were analyzed by RT-qPCR. [score:1]
miR-203 was also reported to be epigenetically silenced in hematopoietic malignancies and hepatocellular carcinomas [34], [35]. [score:1]
The pre-miRNA and anti-miRNA for human miR-203 and miR-21, and scrambled negative controls (Ctrl) miRNA were obtained from Life Technologies (Applied Biosystems, UK) and used at final concentration of 3 µM. [score:1]
As shown in Figure 5E, the increase in Hakai protein triggered by anti-miR-203 was abolished in cells co -transfected with siRNA-Hakai and anti-miR-203. [score:1]
Finally, the detected higher Hakai protein levels in SW620 correlated with reduced miR-203 levels, while low Hakai levels in SW480 correlated to an increased miR-203 levels (Figure 2C and 2D). [score:1]
miR-203 influence on Hakai reporter construct. [score:1]
It was used miR-203 probe and LNA U6 snRNA for detection of control probe and scramble microRNA probe. [score:1]
For instance, miR-203 reduces p63 in skin differentiation [42], [43], and Akt2, Src, c-jun, survivin and bcl-w in bladder cancer [33], [34], [36], [44]. [score:1]
Ectopic reporters containing the 3′UTR of Hakai protein showed that miR-203 elicited its repressive influence at least in part through the Hakai 3′UTR, which contains two miR-203 in silico predicted sites (Figure 3A). [score:1]
miR-203 belongs to miRNA families poorly conserved among mammals or vertebrates. [score:1]
These findings agree with the hypothesis that miR-203 could help to maintain low levels of Hakai in normal tissues, and that reduced miR-203 levels in colon cancer tissues could contribute to maintain elevated Hakai levels. [score:1]
In addition, flow cytometry analysis of cell cycle distribution further revealed that pre-miR-203 -transfected population had the smallest S and G2/M phases and the largest G1 phase, while anti-miR-203 -transfected cells had the largest proportion of S-phase and G2/M compartments (Figure 4C and 4D). [score:1]
Other cell types were previously shown to be affected similarly following modulation of miR-203 levels [32]– [35]. [score:1]
A, the effect of modulating miR-203 levels in 293 cells was studied as described in 1D and 1E; Western blot analysis (left panel) and quantification by densitometry (right panel). [score:1]
0052568.g002 Figure 2A, the effect of modulating miR-203 levels in 293 cells was studied as described in 1D and 1E; Western blot analysis (left panel) and quantification by densitometry (right panel). [score:1]
Probes for miR-203 and miR-21 (Applied Biosystems, UK) were used and U6 snRNA probe was employed for normalization. [score:1]
C, quantification of panel B showing the effect of scrambled Ctrl miRNA or pre-miR-203 on pEGFP and pEGFP-3′UTR. [score:1]
The implication of miR-203 in different malignancies, such as prostate or bladder cancers, was extensively studied in the past [33], [45]. [score:1]
Supporting this point, the increased cell proliferation seen after lowering miR-203 was strongly dependent on the presence of Hakai, since Hakai silencing abolished the proliferative phenotype (Figure 5C and 5D). [score:1]
Taken together, our data support the view that miR-203 lowers cell proliferation at least in part by reducing Hakai protein levels. [score:1]
[1 to 20 of 85 sentences]
17
[+] score: 202
In conclusion, we found that CD82 enhanced the expression of miR-203 and directly downregulated FZD2 expression. [score:9]
The target protector designed for the miR-203 target site in FZD2 mRNA completely negated the inhibitory effects of the miR-203 mimic and CD82 on FZD2 mRNA expression. [score:9]
We predicted the target site of miR-203 in the 3′UTR of FZD2 mRNA by miRanda software, and the specific complimentary sequence for the target site was synthesized using miScript Target Protector (Qiagen). [score:7]
To confirm whether miR-203 targeted FZD2 directly, we perform target inhibition assays (Fig 4). [score:7]
Furthermore, c-Met receptor inhibits the expression of miR-203, and forced expression of CD82 attenuates c-Met signaling in h1299 cells. [score:7]
Additionally, target inhibition assays designed for this binding site revealed that miR-203 targeted FZD2 mRNA directly. [score:7]
Interestingly, miR-203 inhibits cancer stem cell maintenance by self-renewal inhibition through indirect induction of DKK1, a secreted antagonist of the canonical Wnt pathway [29]. [score:6]
0131350.g004 Fig 4Target inhibition assay for determination of the effects of miR-203 on FZD2 mRNA expression. [score:6]
miR-338-3p was significantly downregulated in h1299/CD82 cells (0.354-fold), whereas miR-203 was significantly upregulated (2.095-fold), as compared with h1299/zeo cells. [score:6]
Effects of miR-338-3p and miR-203 on the expression levels of FZD mRNAs in h1299 cellsTo examine the functional effects of miR-338-3p and miR-203 on the regulation of FZDs, we transiently transfected h1299/zeo and h1299/CD82 cells with miR-338-3p or miR-203 mimics or inhibitors. [score:6]
Target inhibition assay for determination of the effects of miR-203 on FZD2 mRNA expression. [score:6]
After subsequent analyses, only miR-203 inhibited FZD2 expression at the mRNA and protein levels. [score:5]
The miR-203 mimic inhibited cell migration in h1299/zeo cells (Fig 7A, 7B and 7G), while the miR-203 inhibitor induced cell migration in h1299/CD82 cells (Fig 7D, 7E and 7H). [score:5]
Forty-eight hours after transfection, miRNA levels of miR-338-3p and miR-203 were significantly decreased in h1299/zeo cells transfected with the miR-338-3p inhibitor and h1299/CD82 cells transfected with the miR-203 inhibitor (Fig 2A and 2D). [score:5]
In this previous report, overexpression of miR-203 in A549 cells was shown to reduce AKT phosphorylation and the expression of its substrate GSK3β. [score:5]
The miR-203 mimic inhibited migration in h1299/zeo cells, and the miR-203 inhibitor induced migration in h1299/CD82 cells, reaching approximately 80% that of h1299/zeo cells. [score:5]
Therefore, this novel mechanism for the regulation of FZD2 expression via miR-203 could be utilized for epigenetic therapy for cancer stem cells. [score:4]
To examine the functional effects of miR-338-3p and miR-203 on the regulation of FZDs, we transiently transfected h1299/zeo and h1299/CD82 cells with miR-338-3p or miR-203 mimics or inhibitors. [score:4]
As a result, we selected 11 miRNAs (miR-27a, miR-27b, miR-145, miR-185, miR-197, miR-203, miR-221, miR-222, miR-338-3p, miR-376a, and miR-376b) that were potentially regulated by CD82 to target FZD2, -3, -5, -7, and -9 for further study (Table 1). [score:4]
However, the mechanism through which CD82 downregulates miR-203 is still unclear. [score:4]
Of these, miR-203 and mir-338-3p were regulated by CD82 overexpression. [score:4]
Effects of miR-338-3p and miR-203 on the expression of FZD mRNA. [score:3]
Effects of miR-338-3p and miR-203 on the migration ability of h1299 cellsTo elucidate the functional effects of FZD2 downregulation by miR-203, cell migration was quantitatively examined by wound healing assay. [score:3]
h1299 cells (h1299/zeo, h1299/CD82) were transfected with miR-203 mimic, miR-203 inhibitor, or miR controls. [score:3]
To elucidate the functional effects of FZD2 downregulation by miR-203, cell migration was quantitatively examined by wound healing assay. [score:3]
This is the first report that miR-203 directly regulated FZD2 mRNA and protein levels. [score:3]
These reports suggest that CD82 enhances the expression of miR-203 via attenuation of c-Met signaling. [score:3]
Effects of miR-338-3p and miR-203 on the expression levels of FZD mRNAs in h1299 cells. [score:3]
0131350.g008 Fig 8 miR-203 targeted the FZD2 gene. [score:3]
miR-203 targeted the FZD2 gene. [score:3]
In contrast, h1299 cells transfected with miR-203 mimic showed significant downregulation of FZD2 mRNA levels compared to control cells (0.268-fold; Fig 3C). [score:3]
An miR-203 mimic was transfected into h1299 cells with or without target protector. [score:3]
0131350.g005 Fig 5Effects of miR-203 on the expression of Frizzled (FZD) proteins. [score:3]
Thus, miR-203 can inhibit both canonical and noncanonical Wnt pathways. [score:3]
0131350.g003 Fig 3Effects of miR-338-3p and miR-203 on the expression of FZD mRNA. [score:3]
Various types of miR-203 target genes have been reported, including versican, an extra cellular matrix proteoglycan [18], phospholipase D2 (PLD2) [20], Robo1/ERK/MMP9 [19], PI3KCA [23], CREB1 [24], LASP1, NUAK1, and SPARC [25]. [score:3]
miR-203 has been reported to act as a tumor suppressor in malignant melanoma [18], glioma [19, 20], and esophageal squamous cell carcinoma [21], but as a tumor promoter in epithelial ovarian cancer [22]. [score:3]
Accumulating evidence has demonstrated the presence of abnormal miR-203 expression in cancer stem cell. [score:3]
h1299/zeo cells transfected with the miR-203 mimic showed significant downregulation of FZD2 protein levels compared to parental and control cells (0.701-fold; Fig 5A and 5B). [score:3]
Effects of miR-338-3p and miR-203 on the protein levels of FZDs in h1299 cellsNext, we examined the protein levels of FZDs by immunoblot analysis in h1299 cells transfected with miRNA mimics or inhibitors. [score:3]
An miR-203 mimic was transfected into h1299 cells with various concentrations of target protector according to the manufacturer’s instructions. [score:3]
Effects of miR-203 on the expression of Frizzled (FZD) proteins. [score:3]
As shown in Fig 8, FZD2 had one potential complimentary miR-203 -binding site within its 3′-UTR, suggesting that FZD2 was targeted by miR-203. [score:3]
MicroRNA-203 accelerates apoptosis in LPS-stimulated alveolar epithelial cells by targeting PIK3CA. [score:2]
In contrast, h1299/CD82 cells transfected with the miR-203 inhibitor showed a significant increase in FZD2 protein levels compared to parental and control cells (1.546-fold; Fig 5A and 5B). [score:2]
Moreover, miR-203 also regulated cell migration, a critical component of metastatic progression, in cancer cells through CD82. [score:2]
Effects of miR-338-3p and miR-203 on the migration ability of h1299 cells. [score:1]
The FZD2 3′-UTR sequence and complementary miR-203 -binding sequences are shown. [score:1]
Transfection with miR-338-3p and miR-203 mimics significantly increased the miRNA levels in h1299/CD82 cells transfected with miR-338-3p mimic and in h1299/zeo cells transfected with the miR-203 mimic (Fig 2B and 2C). [score:1]
This function corresponds to that of CD82 and supports the potential crosstalk between CD82 and miR-203. [score:1]
2014.06.125 24996183 24Noguchi S, Kumazaki M, Mori T, Baba K, Okuda M, Mizuno T, et al. Analysis of microRNA-203 function in CREB/MITF/RAB27a pathway: comparison between canine and human melanoma cells. [score:1]
Importantly, in this study, we confirmed the functional effects of miR-203 transfection in cancer cells. [score:1]
Effects of miR-338-3p and miR-203 on the protein levels of FZDs in h1299 cells. [score:1]
0131350.g007 Fig 7Effects of miR-203 and miR-338-3p transfection on the migration of h1299 cells. [score:1]
Effects of miR-203 and miR-338-3p transfection on the migration of h1299 cells. [score:1]
[1 to 20 of 55 sentences]
18
[+] score: 197
Other miRNAs from this paper: hsa-mir-203b
Because c-Abl expression is upregulated in these cells, this raises the possibility that reduced miR-203 expression may be associated with the upregulation of c-Abl in asthmatic airway smooth muscle cells. [score:11]
Since miR-203 is able to diminish the expression of c-Abl, ERK1/2 phosphorylation, and cell proliferation, it is likely that miR-203 regulates c-Abl expression, which in turn affects ERK1/2 activation and smooth muscle cell proliferation. [score:6]
miR-203 downregulates the expression of c-Abl in HASM cells. [score:6]
To assess whether endogenous miR-203 has a role in regulating c-Abl, HASM cells were transfected with either 20 nmol/L miR-203 inhibitor or negative control for miR inhibitor. [score:6]
These results suggest that miR-203 regulates c-Abl expression by affecting both mRNA degradation and protein translation. [score:6]
Treatment with miR-203 inhibitor increases the expression of c-Abl in HASM cells. [score:5]
The expression level of miR-203 was expressed as the ratio of miR-203 over U6-2 RNA. [score:5]
miR-203 inhibitor is small, chemically modified single-stranded RNA molecules designed to specifically bind to and inhibit endogenous miR-203. [score:5]
miR-203 (CAT#4464066), miR-control (CAT#4464058), miR-203 inhibitor (CAT#4464084), and miR inhibitor negative control (CAT#4464076) were purchased from Ambion/Life Technologies. [score:5]
Figure 2Treatment with miR-203 inhibitor increases the expression of c-Abl in human airway smooth muscle (HASM) cells. [score:5]
The introduction of miR-203 inhibited the expression of c-Abl and BCR-c-Abl in tumor cells, and attenuated tumor cell proliferation in c-Abl -dependent manner. [score:5]
Figure 1Treatment with miR-203 inhibits the expression of c-Abl at mRNA and protein levels in human airway smooth muscle (HASM) cells. [score:5]
Since miR-203 is able to regulate the expression of c-Abl (Figs. 1, 2), and c-Abl has been implicated in smooth muscle cell proliferation (Jia et al. 2012; Wang et al. 2013a; Chen and Tang 2014), we questioned whether miR-203 affects smooth muscle cell proliferation. [score:4]
miR-203 regulates smooth muscle cell proliferation by controlling c-Abl expression, which subsequently modulates the activation of ERK1/2. [score:4]
These results suggest that miR-203 is able to negatively regulate the expression of c-Abl in smooth muscle cells. [score:4]
In summary, our present results suggest that miR-203 is a negative regulator of c-Abl expression in smooth muscle cells. [score:4]
Moreover, the expression of total ERK1/2 in cells was not affected by treatment with miR-203. [score:3]
Exposure to miR-203 inhibits the PDGF -induced proliferation in asthmatic HASM cells (n = 5). [score:3]
Treatment with miR-203 inhibits proliferation and ERK1/2 phosphorylation in asthmatic smooth muscle cells. [score:3]
In the present study, treatment with miR-203 reduced the expression of c-Abl mRNA by 35%. [score:3]
In addition, the binding of miR-203 to the 3′ UTR of c-Abl may repress the translation of c-Abl in cells (Bartel 2004; Joshi et al. 2011). [score:3]
The expression of miR-203 is reduced in asthmatic HASM cells. [score:3]
Figure 6The expression of c-Abl protein, mRNA, and miR-203 in control and asthmatic human airway smooth muscle (HASM) cells. [score:3]
Figure 4Exposure to miR-203 inhibits the platelet-derived growth factor (PDGF) -induced phosphorylation of ERK1/2. [score:3]
The introduction of miR-203 inhibitor resulted in an increase in c-Abl mRNA and protein in these cells (Fig. 2). [score:3]
miRNA sequence analysis suggests that miR-203 is likely to target the 3′ UTR of c-Abl (Bueno et al. 2008) (Fig. 1A). [score:3]
In contrast, treatment with miR-203 inhibited the PDGF -induced ERK1/2 phosphorylation in asthmatic HASM cells (Fig. 7B). [score:3]
In this report, the treatment with miR-203 inhibited the PDGF -induced ERK1/2 phosphorylation in smooth muscle cells. [score:3]
Furthermore, the expression of total AKT in cells was not affected by treatment with miR-203. [score:3]
In this report, treatment with miR-203 attenuated the expression of c-Abl in smooth muscle cells. [score:3]
Exposure to miR-203 inhibits the PDGF -induced proliferation in HASM cells. [score:3]
Furthermore, treatment with miR-203 mimic did not affect the expression of ERK1/2 and AKT in cells, suggesting the selectivity of miR-203 mimic. [score:3]
Moreover, exposure to the miR-203 inhibitor, which is able to bind to and block endogenous miR-203, increased the level of c-Abl in these cells. [score:3]
Treatment with miR-203 inhibits the PDGF -induced proliferation of HASM cells. [score:3]
Moreover, the introduction of miR-203 inhibited the PDGF induced smooth muscle cell proliferation. [score:3]
The expression of miR-203 was reduced in murine T-cell lymphomas. [score:3]
Using an c-Abl mRNA 3′ UTR reporter, Bueno et al. demonstrated that miR-203 directly binds to the 3′ UTR of c-Abl mRNA (Bueno et al. 2008; Craig et al. 2011). [score:2]
To determine whether AKT activation is regulated by miR-203, we assessed the effects of miR-203 on AKT phosphorylation in cells. [score:2]
The objective of this study was to evaluate whether miR-203 is involved in the regulation of c-Abl expression in smooth muscle cells. [score:2]
As shown in Figures 1 and 2, miR-203 is able to regulate c-Abl in smooth muscle cells. [score:2]
To the best of our knowledge, this is the first evidence that miR-203 is capable of regulating smooth muscle cell proliferation. [score:2]
The expression of miR-203 was lower in asthmatic HASM cells as compared to control HASM cells (Fig. 6C). [score:2]
Compared to miR-control, transfection with miR-203 attenuated the expression of c-Abl in HASM cells at mRNA (Fig. 1B) and protein (Fig. 1C) levels. [score:2]
Furthermore, the levels of miR-203 were diminished in asthmatic airway smooth muscle cells. [score:1]
Figure 3Treatment with miR-203 attenuates the platelet-derived growth factor (PDGF) -induced proliferation of human airway smooth muscle (HASM) cells. [score:1]
miR-203 may bind to complementary sequences in the 3′ UTR of c-Abl, which activates the RNA -induced silencing complex and induces c-Abl mRNA degradation (Bartel 2004). [score:1]
miR-203 level is reduced in asthmatic HASM cells. [score:1]
The results suggest that miR-203 is able to degrade c-Abl mRNA and protein. [score:1]
The level of miR-203 in asthmatic HASM cells was normalized to control HASM cells. [score:1]
miR-203 has been implicated in the pathogenesis of T-cell lymphomas. [score:1]
We compared the expression of miR-203 in control and asthmatic HASM cells by the miR-specific qPCR assay. [score:1]
To assess the role of miR-203 in smooth muscle cells, HASM cells were transfected with miR-203 mimics or miR-control for 3 days. [score:1]
Exposure to miR-203 did not blunt basal ERK1/2 phosphorylation in asthmatic cells. [score:1]
Moreover, the introduction of miR-203 attenuated the growth factor -induced ERK1/2 phosphorylation and the proliferation in asthmatic HASM cells. [score:1]
The PDGF -induced proliferation was attenuated in asthmatic HASM cells transfected with miR-203 (Fig. 7A). [score:1]
Treatment with miR-203 attenuates the PDGF -induced ERK1/2 phosphorylation in asthmatic cells. [score:1]
Stimulation with PDGF induced a significant increase in AKT phosphorylation in cells treated with miR-control or miR-203 (Fig. 5). [score:1]
PDGF -induced ERK1/2 phosphorylation is reduced in HASM cells treated with miR-203. [score:1]
We also determined the effects of miR-203 on asthmatic HASM cell proliferation. [score:1]
We assessed the effects of miR-203 on ERK1/2 phosphorylation in HASM cells. [score:1]
miR sequence analysis suggests that miR-203 is able to bind to the 3′ UTR of human c-Abl mRNA, which is verified by studies on a c-Abl mRNA 3′ UTR reporter (Bueno et al. 2008). [score:1]
However, exposure to miR-203 attenuated the level of c-Abl protein by 60%. [score:1]
Exposure to miR-203 did not attenuate ERK1/2 phosphorylation in cells without PDGF stimulation. [score:1]
Furthermore, we examined the role of miR-203 in ERK1/2 phosphorylation and the proliferation in smooth muscle cells in response to activation with a growth factor. [score:1]
Representative western blots illustrating the effects of miR-203 on AKT phosphorylation (Ser-473). [score:1]
The results suggest that miR-203 does not affect AKT activation in smooth muscle cells. [score:1]
However, the PDGF -induced ERK1/2 phosphorylation was reduced in HASM cells treated with miR-203 (Fig. 4). [score:1]
Figure 7Treatment with miR-203 attenuates the platelet-derived growth factor (PDGF) -induced proliferation and ERK1/2 phosphorylation in asthmatic human airway smooth muscle (HASM) cells. [score:1]
The results suggest that miR-203 is also able to blunt the growth factor -mediated pathway and proliferation in asthmatic airway smooth muscle cells. [score:1]
HASM cells were transfected with either miR-control or miR-203. [score:1]
Cell (4.8 × 10 [4]) were plated in the F12 medium supplemented with 10% FBS (Invitrogen) for ≥18 h. Cells were then transfected with miR-203 mimic or miR-control. [score:1]
Treatment with miR-203 does not influence the PDGF -induced AKT phosphorylation. [score:1]
Human airway smooth muscle (HASM) cells transfected with miR-control or miR-203 were stimulated with 10 ng/mL platelet-derived growth factor (PDGF) for 10 min or they were not stimulated followed by immunoblot analysis. [score:1]
Treatment with miR-203 attenuates the PDGF -induced ERK1/2 phosphorylation. [score:1]
Cells transfected with miR-control or miR-203 were stimulated with 10 ng/mL PDGF for 10 min or they were not stimulated. [score:1]
Representative western blots illustrating the effects of miR-203 on ERK1/2 phosphorylation (Thr202/Tyr204) in human airway smooth muscle (HASM) cells. [score:1]
However, we do not rule out the possibility that miR-203 may also affect other cellular processes (such as programmed cell death), which may also reduce the PDGF -induced increase in cell numbers. [score:1]
Figure 5Treatment with miR-203 does not affect AKT phosphorylation in cells. [score:1]
However, exposure to miR-203 did not affect AKT phosphorylation in smooth muscle cells. [score:1]
Treatment with miR-203 does not affect AKT phosphorylation. [score:1]
[1 to 20 of 80 sentences]
19
[+] score: 197
For hsa-miR-203-3p, TargetScan predicted 3916 target genes, miRanda predicted 9208 targets, and DIANA predicted 3836 targets. [score:9]
As shown in the Venn diagram, three different miRNA target prediction programs predicted that the miR-203 precisely targets the six genes without OTX2 and NR2E3 genes (Supplementary Tables S2–S4), whereas miR-221 targets only RORB and THRB genes by three target prediction programs (Figure 1C). [score:9]
These data indicated that a miR-203 inhibitor could induced expressions of several retina development-relevant genes including miR-203 targets, DKK1, CRX and NRL, following transfections of anti-miR-203. [score:8]
Conversely, Anti-miR-203 up-regulates those target genes through inhibiting of miR-203. [score:8]
To provide evidence for direct targets of miR-203, we performed a luciferase assay and analyzed, whether treatments of miR-203 can directly reduce the expression of three target genes DKK1, CRX and NRL. [score:8]
Predictions of hsa-miR-203 (GUGAAAUGUUUAG GACCACUAG) targets were performed using three different online miRNA target prediction programs, namely, TargetScanHuman (Release 5.2), miRanda (Release August 2010) and DIANA microT (Version 3.0). [score:7]
As described above, anti-miR-203 up-regulated retina development-relevant genes DKK1, CRX and NRL, which are predicted as targets of miR-203. [score:7]
Transfections of a miR-203 inhibitor can induce expressions of retina development-relevant genes in AESCs. [score:6]
Targets were selected among seven representative retina development-relevant genes (C) Predicted target genes of both candidate miRNA, miR-150 and miR-203, were illustrated as a Venn diagram. [score:6]
Thus, controlling the expression of miR-203 with an anti-miR-203 affects the expression of these crucial neural retina development genes and guides the differentiation of somatic stem cells toward a neural retina cell fate. [score:6]
In this project, we show that miR-203 is expressed abundantly in somatic stem cells and that anti-miR-203 can induce the expression of neural retina developmental factors. [score:6]
Furthermore, the down-regulation of miR-203 targets explains the reason for the induction of the retina differentiation. [score:6]
These data demonstrate that miR-203 directly interacts with the predicted target binding sites of miR-203 in the 3′-UTRs of target genes DKK1, CRX, NRL, NEUROD1 and RORB. [score:6]
miR-203 directly targets genes involved in neural retina development. [score:5]
miR-203 targets retina development-relevant genes. [score:4]
Upon treatment with anti-miR-203, retina development genes were expressed in these cells, and the cells were consequently converted to PR cell types. [score:4]
miR-203 directly regulates retina development-relevant genes. [score:4]
miR-203 targets multiple retina development-relevant genes. [score:4]
Unlike the miRNAs discussed above, a novel finding of miR-203′s role in neural retina differentiation suggests that miR-203 targets six retina development-specific factors at various stages, such as the retina progenitor, PR precursor and mature PR (Figure 6). [score:4]
In conclusion, we have shown that miR-203 is abundantly expressed in somatic stem cells and represses three retina development-specific factors. [score:4]
Of the 20 identified miRNAs, miR-203 and miR-221 are two most highly expressed miRNAs. [score:3]
Of three genes, NRL, DKK1 and NEUROD1 showed that the luciferase activity was significantly suppressed in the presence of miR-203 (Figure 5C). [score:3]
Thus, successive treatments of a miR-203 inhibitor can induce the retina maturation of AESCs into the cone PR subtype. [score:3]
Next, we co -transfected this luciferase vector including binding sites and a reporter construct together with miR-203 into HEK-293FT cells to determine whether the predicted binding sites in each 3′-UTR were responsible for gene expression. [score:3]
Three days after a transfection of anti-miR-203, the expression level of DKK1 was increased by two-fold (Figure 2B). [score:3]
Cells were transfected with anti-miR-203 (Anti-miR miRNA Inhibitor; Ambion) at a final concentration of 30 nM. [score:3]
This reporter construct could be targeted by miR-203. [score:3]
The gene expression levels of retina maturation-relevant genes were gradually changed following transfections of anti-miR-203 (Figure 4B). [score:3]
Moreover, the expression of miR-203 after miR -induced retina differentiation was not detectable. [score:3]
miR-203 inhibition induces the initial differentiation of AESCs into neural retina. [score:3]
A fragment of the 3′-UTR containing the predicted miR-203 target binding sequence (CATTTCA) was amplified by RT-PCR. [score:3]
According to previous target predictions, we treated somatic stem cells with anti-miR-203 to block the function of mature miR-203 (Figure 2A). [score:3]
The results of target predictions significantly indicated miR-203 as a retina-relevant miRNA. [score:3]
Interestingly, the opsin was expressed to a greater extent in anti-miR-203-differentiated cells than in the cocktail -induced PR-like cells (Figure 3D). [score:3]
Thus, we assumed that the inhibition of miR-203 could induce the neural retina differentiation of somatic stem cells. [score:3]
As above mentioned, a single transfection of anti-miR-203 was not enough to induce the expression of mature PR markers (Figure 2D). [score:3]
Interestingly, the expression levels of miR-203 in both somatic stem cell types following retina differentiation were significantly decreased compared to the retina tissue. [score:2]
The hypothesis of retina differentiation from somatic stem cells directly by treatments of anti-miR-203 was shown. [score:2]
Figure 5(A) A quantitative RT-PCR shows the relative expression level of miR-203 in somatic stem cells that were undifferentiated, differentiated by a neural retina-specific cocktail of exogenous factors (DKK1) or differentiated by anti-miR-203 compared to human retina tissue (Retina). [score:2]
Compared to the retina tissue, the expression level of miR-203 in AESCs and UCB-MSCs was significantly higher, specifically 44-fold and 27-fold, respectively (Figure 5A). [score:2]
The 3′-UTR sequence of the RORB transcript contains two predicted miR-203 binding sites (#1 at nucleotides 944-965 and #2 at nucleotides 1058-1079). [score:1]
We next attempted to treat anti-miR-203 for the retina maturation. [score:1]
To better understand the effects of anti-miR-203 in an induction of retina differentiation, we investigated the relative expression level of miR-203 in the somatic stem cells, the cocktail -induced PR-like cells, the miR -induced PR-like cells and retina tissues. [score:1]
The 3′-UTR sequence of the NEUROD1 transcript contains two predicted miR-203 binding sites (#1 at nucleotides 511-532 and #2 at nucleotides 683–704). [score:1]
Based on these data, we cultured AESCs for 21 days following transfections of anti-miR-203. [score:1]
Mature miR-203 is involved in neural retina differentiation as a repressor of genes, such as DKK1, CRX and NRL. [score:1]
In this study, we show that anti-miR-203 treatment can mediate the differentiation of somatic stem cells into neural retina cell types, particularly PR cells. [score:1]
With successive treatments of anti-miR-203, somatic stem cells can be differentiated into PR cell types. [score:1]
After 3 weeks, cells were maintained without the cocktail of exogenous factors or anti-miR-203. [score:1]
Figure 3(A) A differentiation scheme of successive treatments of anti-miR-203 shows the neural retina differentiation of AESCs over the course of 28 days. [score:1]
Figure 6 Mature miR-203 is involved in neural retina differentiation as a repressor of genes, such as DKK1, CRX and NRL. [score:1]
To address this, we cultured AESCs for 28 days following three successive transfections of anti-miR-203 (Figure 3A). [score:1]
It appears that the retina differentiation using cocktail and anti-miR-203 diminished miR-203′s presence in somatic stem cells and subsequently induced the retina differentiation. [score:1]
The 3′-UTR sequence of the DKK1 transcript contains two predicted miR-203 binding sites (#1 at nucleotides 346-368 and #2 at nucleotides 549-570). [score:1]
The long-term treatment of anti-miR-203 can induce retina maturation of AESCs. [score:1]
By the other one, we cultured cells in the differentiation medium and repeatedly treated anti-miR-203 (Ambion) to the cells every 7 days. [score:1]
21 days after treatments of anti-miR-203, morphologies of the cells were turned to a neuron-like shape (Figure 4A). [score:1]
The 3′UTR sequence of the CRX transcript contains four predicted miR-203 binding sites (#1 at nucleotides 317–345, #2 at nucleotides 360–388, #3 at nucleotides 638–666 and #4 at nucleotides 3158–3179). [score:1]
Figure 2(A) A schematic of anti-miR-203 treatment during the retina differentiation of AESCs for 21 days. [score:1]
The 3′-UTR sequence of the NRL transcript contains one predicted miR-203 binding site (#1 at nucleotides 446-467). [score:1]
[1 to 20 of 60 sentences]
20
[+] score: 196
Studies showed that miR-200 inhibits EMT by targeting ZEB1 and ZEB2[52] and our studies showed that overexpression of miR-200a, miR-200b, miR-15a, miR-429, and miR-203 decreased the protein expression of Mesenchymalmarkers i. e. N-cadherin, Vimentin, Snail, β-Catenin (Fig 3A, 3B and 3C) showing these miRNAs can promote mesenchymal to epithelial transition (MET). [score:9]
Overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 not only down-regulated the expression of BMI1protein, but also that of RING1A and RING1B, which also belong to PRC1 complex(Figs 1B, 2A and 2B). [score:8]
Ourstudies show that altering the expression of a group of miRNAs that include miR-15a, miR-200a, miR-200b, miR-429, and miR-203 produced a significant down-regulation of the expression of BMI1 in the breast cancer cell lines, MDAMB-231 and BT549. [score:8]
Overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 leads to inhibition ofPRC-1 group of protein expression. [score:7]
A significant down-regulation in the expression of BMI1 was seen in cells having the ectopic expression of miR-15a, miR-200a, miR-200b, miR-429 and miR-203 when compared to control cells transfected with scrambled miRNAs (Fig 1B). [score:7]
Interestingly, overexpression of miR-200a, miR-200b and miR-203 in MDAMB-231 cells followed by treatment with SAHA lead to a down-regulation of HDAC1, HDAC2, HDAC6 and HDAC8 protein expression levels when compared to SAHA treated control cells transfected with scramble miRNAas well as cells that were treated with SAHA alone (Fig 6E). [score:7]
Our previous experiments demonstrated that the ectopic expression of miR-200a, miR-200b, miR-15a, miR-429, miR-203 inhibited the expression of PRC1 group of protein BMI1. [score:7]
Our results uniquely showed that miR-200a, miR-200b, miR-15a, miR-429, miR-203 significantly down-regulatedprotein expression levels of Ub-H2A in MDAMB-231 and BT-549 cells (Fig 2A and 2B). [score:6]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 were overexpressed in MDAMB-231 cells and the expression of mesenchymal markers, N-cadherin, Vimentin, ZEB-1, snail andβ-catenin were checked at protein level. [score:5]
Our studies with qRT-PCR show that a limited set of miRNAs(miR-200a, miR-200b, miR-15a, miR-429, and miR-203)are up-regulated upon knock-downof PRC1 complex of protein BMI1(Fig 1A). [score:5]
Protein expression of various HDACs in cells having overexpression of miR-200a, miR-200b and miR-203. [score:5]
0190245.g002 Fig 2 Expression of BMI1, RING1A, RING1B and Ub-H2A in MDAMB-231(A) and BT549 (B) cells having overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
We also show for the first time that the sensitivity of MDAMB-231 cells to cisplatinand histone deacetylase inhibitor (HDACi) SAHAis elevated upon overexpressing miR-15a and miR-200a, miR-200b, miR-203. [score:5]
S5 Fig Expression of CD44 in CSCs cells having overexpression miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
Protein expression of BMI1wasanalyzed by performing western blotting in BT-549 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203. [score:5]
0190245.g003 Fig 3 Level of expression of N-cadherin, Vimentin, β-Catenin, ZEB-1, Snailin MDAMB-231cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203(A). [score:5]
Level of expression of N-cadherin, Vimentin, β-Catenin, ZEB-1, Snailin MDAMB-231cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203(A). [score:5]
Expression of BMI1, Ub-H2A protein in MDAMB-231cells transfected with Anti-miR- 200a, Anti-miR-200b, Anti-miR-15a, Anti-miR-449, Anti-miR-203 (C) BMI1, RING1A localization in MDAMB-231 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-449, miR-203under confocal microscopy (D, E). [score:5]
Expression of BMI1, RING1A, RING1B and Ub-H2A in MDAMB-231(A) and BT549 (B) cells having overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
Cooperative effect ofmiR-200a, miR-200b, miR-203 and SAHA down-regulate HDACs inMDAMB-231 cells. [score:4]
Only miR-200a, miR-200b and miR-203 were up-regulated when MDAMB-231 and BT-549 cells were treated with SAHA, aHDACi. [score:4]
To confirm that miR-15a, miR-200a, miR-200b, miR-203 and miR-429, have the binding sites in 3′UTRs of BMI1 and regulates the expression of BMI1 in MDAMB-231, cells were seeded in 12-well plates and co -transfected with the individual miRNA along with wild (wt) BMI1in psiCHECK2 vector as well as with mutant (Mut) BMI1psiCHECK2 reporter plasmids separately. [score:4]
We have shown that the miR-200a, miR-200b, miR-15a, miR-429 and miR-203 coordinately regulate expression of PRC1 group of proteins and also affect the rate of Mesenchymal to Epithelial transition (MET) in MDAMB-231 cells. [score:4]
Expression of miR-15a, miR-200a, miR-200b, miR-429, miR-203 were elevated in BMI1 knock-down samples in both MDAMB-231 and BT-549 cells compared to un -transfected MDAMB-231 and BT-549 cells that served as control(Fig 1A). [score:3]
To see whether these miRNAs have any effect on the expression of Ki-67, which in turn controls cell proliferation, we performedimmunocytochemistry and western blotting studies in MDAMB-231 cells transfected withmiR-200a, miR-200b, miR-15, miR-429, miR-203. [score:3]
After 24 hrs, miR-15a, miR-200a, miR-200b, miR-429 and miR-203 were ectopically expressed and the cells were incubated for 24 hrs. [score:3]
Tocorroborate specifically that these miRNAstarget BMI1, MDAMB-231 cells were transfected with anti-miR-15a, anti-miR-200a, anti-miR-200b, anti-miR-429 and anti-miR-203. [score:3]
Antagonizing miR-15a, miR-200a, miR-200b, miR-429, and miR-203 reversed the effects generated by overexpression of these miRNAsconfirming the roles of these miRNAs on BMI1 protein and Ub-H2A116 (Fig 2C). [score:3]
S2 Fig data showing expression of RING1B in MDAMB-231cells upon transfection with miR-15, miR-200a, miR-200b, miR-429 and miR-203. [score:3]
Protein expression of BMI1 and Ub-H2A in CD44+ population transfected with miR-200a, miR-200b, miR-15a, miR-429 and miR-203 (C). [score:3]
Both MDAMB-231 and BT-549 cells were treated with 2μM of SAHA and the expression levels of miR-200a, miR-200b, miR-15a, miR-429, and miR-203 was checked. [score:3]
indicated a significant increase in miR-200a, miR-200b and miR-203 expression whereas miR-15a, miR-429, did not show any significant change(Fig 6D). [score:3]
Cells were transfected with overexpressedmiR-200a, miR-200b, miR-15a, miR-429, miR-203, and subjected to treatment with 5 μg/ml of cisplatin. [score:3]
miR-200a, miR-200b, miR-15a, miR-429, miR-203 inhibits migration and cell proliferation. [score:3]
After 24 hrs, miR-15a, miR-200a, miR-200b, miR-429 and miR-203 were ectopically expressed and the cells were incubated for 48 hrs. [score:3]
MDAMB-231cells having overexpressedmiR-200a, miR-200b, miR-15a, miR-429, miR-203 were allowed to incubate for 48hrs and plated in a Transwell chamber and further allowed to incubate for 24hrs. [score:3]
studies showed a reduced N-cadherin, Vimentin signal upon miR-200a, miR-200b, miR-15a, miR-15a, miR-429, and miR-203 overexpression compared to control cells transfected with scramble miRNA vector(Fig 3B and 3C) confirming that miR-200a, miR-200b, miR-15a, miR-429, and miR-203 plays a very crucial role in METby regulating BMI1. [score:3]
Also to check the cell viability upon overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203 we perfomed the trypan blue assay. [score:2]
miR-200a, miR-200b, miR-15a, miR-429, miR-203 regulate PRC1 proteins in MDAMB-231 cells. [score:2]
Here we illustrate the unique role of miRNAsin their dramatic participation in breast cancer cells and our data demonstrates that the levels of PRC group of proteins in breast cancer cell lines MDAMB-231 and BT-549 can be altered by using the miRNAs i. e. miR-200a, miR-200b, miR-15a, miR-429and miR-203 which have possible binding sites at the 3’UTR sequences of BMI1. [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-203 weretransfected into both MDAMB-231(Fig 2A) and BT-549 (Fig 2B) cells. [score:1]
wt-BMI1 3’ UTR and Mut-BMI1 3’UTR were overexpressed along with miR-200a, miR-200b, miR-15a, miR-429, miR-203 and luciferase activity was measured (C,D). [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 reduces rate of migration invasion and anchorage-independent growth ofMDAMB-231 cells. [score:1]
No significant change was observed upon co-transfection of Mut-3’BMI1 UTR with miR-15a, miR-200a, miR-200b, miR-429, and miR-203(Fig 1D). [score:1]
To further our observation we next performed immunocytochemistry in MDAMB-231 cells transfected with miR-200a, miR-200b, miR-15a, miR-429, and miR-203. [score:1]
Antagonizing miR-200a, miR-200b, miR-15a, miR-429, and miR-203 enhances BMI1. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 were transfected into the cells. [score:1]
After 24 hrs, cells were transfected with miR-200a, miR-200b, miR-15a, miR-429 and miR-203. [score:1]
Levels of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 in MDAMB-231 and BT-549 cells treated with SAHA. [score:1]
Anti-proliferative activity of miR-200a, miR-200b, miR-15a, miR-429, miR-203 in various cancers has been previously reported [25, 27]. [score:1]
miR-200a, miR-200b, miR-15a, miR-429and miR-203 promote Mesenchymal to Epithelial transition. [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-203 were transfected to BT-549 and MDAMB-231cells in 60 mm dishes and the cells were incubated for 48 hrs. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 could bring an exciting new dimension in the field of clinical management of human cancer in coming future. [score:1]
The binding sites of the miR-200a, miR-200b, miR-15a, miR-203 and miR-429 on BMI1 3’ UTR and EZH2 3’ UTR were identified with the help of the software tool, miRTarBase (http://mirtarbase. [score:1]
miR-15a, miR-200a, miR-200b, miR-429 and miR-203 showed a clear binding to the 3’UTR of BMI1 (S1 Fig). [score:1]
4104042–001), anti-miR-203 (Exiqon, cat#. [score:1]
miR-200a, miR-200b, miR-429, and miR-203 induce Mesenchymal to Epithelial transition. [score:1]
PMIRH200bPA-1, miR-203 Cat#. [score:1]
The vector with the wild-type BMI1 3’UTR was co -transfected along with miR-15a, miR-200a, miR-200b, miR-429, and miR-203 respectively into MDAMB-231 cells. [score:1]
[1 to 20 of 59 sentences]
21
[+] score: 186
Among the genes identified in the SAM analysis there were (I) miRNAs specifically up-regulated in psoriasis (e. g. miR-203), (II) miRNAs with increased expression in both psoriasis and atopic eczema (e. g. miR-21), (III) miRNAs specifically down-regulated in psoriasis (e. g. miR-99b), and (IV) miRNAs uniformly down-regulated in both skin diseases (e. g. miR-122a), as compared to healthy skin. [score:13]
The up-regulation of miR-203 in psoriatic plaques was concurrent with the down-regulation of an evolutionary conserved target of miR-203, suppressor of cytokine signaling 3 (SOCS-3), which is involved in inflammatory responses and keratinocyte functions. [score:11]
Although here we exemplified SOCS-3 as a target of miR-203 and showed its down-regulated expression in psoriasis, it is not likely that miR-203 functions in psoriasis are mediated solely through the suppression of this protein. [score:10]
Thus, the up-regulation of miR-203 may have important implications for psoriasis pathogenesis by preventing the up-regulation of SOCS-3 in response to cytokines. [score:7]
The specific expression of miR-203 in skin and in keratinocytes (Fig. 2 and 3) as well as its specific up-regulation in psoriasis (Fig. 1) suggested that this miRNA plays a role in the regulation of keratinocyte functions. [score:7]
Among the target genes of miR-203 we focused on suppressor of cytokine signaling-3 (SOCS-3), an evolutionarily conserved high-score target of miR-203 with a 10-nucleotide complementarity to the mature, biologically active form of miR-203 in human, mouse, rat and dog (Table S1, Fig. 4A). [score:7]
To identify the cell types expressing the identified psoriasis -associated miRNAs in the skin, we systematically analyzed the expression of miR-203, miR-146a, miR-21 and miR-125b in a panel of cells present in healthy and/or inflamed skin including both resident cells (keratinocytes, dermal fibroblasts and melanocytes) and leukocyte/immune cell subsets (CD4 [+], CD8 [+] and CD4 [+]CD25 [high] T cell subsets, NK cells, granulocytes, B cells, dendritic cells and mast cells). [score:5]
To explore whether the presence of miR-203 binding sites in the 3′ untranslated region (UTR) of mRNAs correlates with gene function, we determined if putative miR-203 targets contain significantly more or fewer genes from any given biological process than expected given the gene ontology (GO) category's frequency in the 3′UTR database (Figure S1). [score:5]
miR-203, which was specifically expressed in skin among 21 different human organs, showed a keratinocyte-specific expression being virtually absent in all other cell types analyzed (Fig. 3). [score:5]
Analysis of SOCS-3 protein expression by immunohistochemistry showed a complementary pattern with the miR-203 expression (Fig. 4B). [score:5]
In situ hybridization using LNA -modified nucleotide probes revealed that miR-203 is expressed in the suprabasal layers of the epidermis in normal skin, confirming its keratinocyte-specific expression observed in vitro (Fig. 4B). [score:5]
analysis showed that miR-203, a miRNA specifically up-regulated in psoriasis, was expressed more than 100-fold higher in skin compared with most other organs. [score:5]
Putative targets of miR-203 were identified using TargetScan 3.0 algorithm. [score:5]
To understand the functions of miR-203 we used a two-step sequential approach: (I) using algorithms based on a systematic analysis of the structural requirements for target site function in vivo, we predicted genes that can be regulated by this miRNA (Table S1); (II) we investigated the biological functions of the predicted target genes. [score:4]
Out of the several thousand GO categories, the top significant (p<0.01) target categories were dominated by processes related to signal transduction, cell cycle, morphogenesis and cell growth suggesting a role for miR-203 in the regulation of these biological processes in the skin (Figure S1). [score:4]
In contrast to miR-203 and miR-146a, miR-21 was significantly up-regulated both in psoriasis (p<0.001) and atopic eczema (p<0.001) as compared with healthy skin. [score:3]
The expressions of the functionally active, mature forms of miR-203, miR-21, miR-146a and miR-125b were analyzed using quantitative real-time PCR in 20 healthy organs and tissues (each a pool of three donors) as well as in healthy skin (n = 26), lesional atopic eczema (n = 20) and psoriasis (n = 25) skin samples. [score:3]
The psoriasis-specific overexpression of miR-203 and miR-146 suggests that they may play specific roles in the pathogenesis of psoriasis and not only a general role in skin inflammation. [score:3]
This suggests that the suppression of SOCS-3 by miR-203 in psoriatic lesions would in turn lead to constant activation of STAT3. [score:3]
In contrast to miR-203, the mature forms of miR-146a, miR-21 and miR-125b were detected in all studied organs, however, their expression showed distinct patterns. [score:3]
To obtain further insights into the function of the psoriasis -associated miRNAs, we systematically analyzed the expression of miR-203, miR-146a, miR-21 and miR-125b in skin and a panel of 20 additional human organs obtained from healthy individuals (Fig. 2). [score:3]
0000610.g002 Figure 2 The expressions of the functionally active, mature forms of miR-203, miR-21, miR-146a and miR-125b were analyzed using quantitative real-time PCR in 20 healthy organs and tissues (each a pool of three donors) as well as in healthy skin (n = 26), lesional atopic eczema (n = 20) and psoriasis (n = 25) skin samples. [score:3]
miR-203, miR-146a, miR-21 and miR-125b show distinct expression patterns in human organs and cells types. [score:3]
The expressions of the functionally active, mature forms of miR-203, miR-146a, miR-21 and miR-125b were analyzed in the cellular constituents of the skin including primary adult keratinocytes, dermal fibroblasts, melanocytes, monocyte-derived dendritic cells (MDDCs), polymorphonuclear leukocytes (PMN), granulocytes, eosinophils, CD69 [+] cells, CD19 [+] cells, CD56 [+ ]cells, CD4 [+]CD25 [high] cells, CD8 [+] cells, CD4 [+] cells and mast cells using quantitative real-time PCR. [score:3]
The occurrence of GO terms associated with miR-203 targets were analyzed using the Gene ontology Tree Machine and the Gene Set Analysis Toolkit (http://bioinfo. [score:3]
Moreover, miR-203 was expressed at a significantly (p<0.01) higher level in psoriasis than in atopic eczema skin specimen. [score:3]
To confirm the results obtained by microarray profiling, we performed quantitative real-time PCR analysis of miR-203, miR-146a, miR-21 and miR-125b expression on RNA samples obtained from lesional skin of patients with psoriasis (n = 25), healthy skin (n = 26) or atopic eczema lesions (n = 20). [score:3]
In addition to skin, miR-203 was only expressed at lower levels in organs that also contain squamous epithelium, esophagus and cervix. [score:3]
No significant up-regulation of miR-203 was observed in atopic eczema skin lesions compared with healthy skin (Fig. 1C). [score:3]
0000610.g003 Figure 3The expressions of the functionally active, mature forms of miR-203, miR-146a, miR-21 and miR-125b were analyzed in the cellular constituents of the skin including primary adult keratinocytes, dermal fibroblasts, melanocytes, monocyte-derived dendritic cells (MDDCs), polymorphonuclear leukocytes (PMN), granulocytes, eosinophils, CD69 [+] cells, CD19 [+] cells, CD56 [+ ]cells, CD4 [+]CD25 [high] cells, CD8 [+] cells, CD4 [+] cells and mast cells using quantitative real-time PCR. [score:3]
The putative targets site of miR-203 is highly conserved among species. [score:3]
Among the miRNAs overexpressed in psoriasis, we identified a keratinocyte-specific miRNA (miR-203) and a leukocyte-derived miRNA (miR-146a). [score:3]
0000610.g004 Figure 4(A) SOCS-3 is an evolutionarily conserved target of miR-203. [score:3]
Instead, the function of miR-203 can be interpreted as a function of the sum of all of its target proteins and the consequence of their interactions. [score:3]
In comparison to healthy skin, the expression of miR-203 was increased in psoriatic lesional skin in all epidermal layers (Fig. 4B), consistent with the real-time PCR results. [score:3]
Expression of miR-203, miR-146a, miR-21 and miR-125b in human organs. [score:3]
The height of the red bar represents the number of genes observed in the GO category and also in the set of putative miR-203 targets. [score:3]
Next, we analyzed the expression pattern of miR-203 and SOCS-3 in lesional skin of psoriasis patients and in healthy skin (Fig. 4B). [score:3]
The evolutionary conserved targets of miR-203. [score:3]
SOCS-3 may be a molecular target of miR-203 posttranscriptional repression. [score:3]
Expression of miR-203, miR-146a, miR-21 and miR-125b in the cellular constituents of the skin. [score:3]
Our data suggest that miR-203 plays a specific role in the pathogenesis of psoriasis by regulating inflammation-, proliferation- and morphogenesis -associated processes in the skin. [score:2]
Thus, future research in the forthcoming years will be needed to understand fully the consequence of the deregulation of miR-203 and other miRNAs in psoriasis. [score:2]
A plausible link between miR-203 and keratinocyte dysfunction in psoriasis through the regulation of SOCS-3 signaling. [score:2]
The 8mer seed sequence in the 3′UTR of SOCS-3 gene corresponding to miR-203 binding site is underlined. [score:1]
In contrast to miR-146, nothing is known about the function of the keratinocyte-specific miRNA, miR-203. [score:1]
In situ hybridization In situ transcriptional levels of miR-203 were determined on frozen sections (10 µm) of skin biopsy specimens from six psoriasis patients and six healthy individuals according to the manufacturer's instructions (Exiqon). [score:1]
In situ transcriptional levels of miR-203 were determined on frozen sections (10 µm) of skin biopsy specimens from six psoriasis patients and six healthy individuals according to the manufacturer's instructions (Exiqon). [score:1]
[1 to 20 of 48 sentences]
22
[+] score: 169
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a, hsa-mir-429, hsa-mir-203b
Conversely, miRNA expression analysis in endometrial carcinosarcomas, a bona fide example of EMT in vivo, revealed a marked downregulation of miR-203 and miR-200 family members in the mesenchymal areas, concomitant to the upregulation of EMT inducers, including SNAI1 [25]. [score:9]
In addition, in line with previous results [9], [10], overexpression of SNAI1 in our MCF7-SNAI1 cell mo del induced an upregulation of ZEB1 (our unpublished observation) which targets miR-203 and the miR-200s [6], [7], [27]. [score:8]
Interestingly, these analyses highlighted miR-203, whose expression was downregulated in our EMT mo del and mesenchymal cancer cell lines, as well as highly correlated to the expression of the miR-200s. [score:8]
Interestingly, previous studies in prostate cancer progression and metastasis showed that miR-203 expression not only controlled cell migration and invasion of prostate cancer cell lines, but also suppressed prostate cancer metastasis in vivo via repression of prometastatic targets such as ZEB2 [30], [31]. [score:7]
B) qRT-PCR analyses of miR-203 expression levels normalized to U44 expression and expression levels in non -induced cells. [score:7]
These results indicate that miR-203, but not the miR-200s, directly regulates SNAI1 expression, thus linking miR-203 and SNAI1 in a double negative feedback loop and suggesting convergent yet not identical roles for these miRNAs in the regulation of SNAI1-orchestrated processes. [score:6]
Mir-203 expression levels were determined by qRT-PCR and normalized to U44 expression and expression levels in HTB129-ctrl cells. [score:6]
Further expression profiling in human primary and metastatic cancers showed that miR-203 and miR-200 family members were significantly suppressed in the latter, suggesting a direct involvement in cancer metastasis [26]. [score:6]
Further, ZEB1/2 inhibit miR-203 promoter activity [27] and in turn miR-203 targets and represses ZEB2 [30]. [score:5]
HTB129 cells expressed high levels of ZEB1/2 factors, but in the present cellular context, miR-203 expression did not lead to significant decrease of ZEB2 mRNA. [score:5]
Large-scale analysis of miRNA expression signatures, and miR-203 expression during SNAI1 induction in MCF7-SNAI1 cells. [score:5]
Altogether these data suggest that SNAI1 regulates expression of miR-203 and both miR-200 clusters in a coordinated manner, and that these miRNAs co-act in SNAI1-regulated programs. [score:5]
Altogether these results show that miR-203 significantly reduces SNAI1 expression and promotes epithelial-like features such as a more cohesive phenotype and reduced motility, motivating us to investigate whether miR-203 could directly target SNAI1. [score:4]
Co-regulated overexpression of miR-203 and miR-200 family members has been reported during early stages of human stem cell differentiation into epidermal cells suggesting their participation to this process [24]. [score:4]
In MCF7-SNAI1 cells, ectopically expressed SNAI1 lacks its natural 3′UTR [18] and therefore, these cells are not suitable to study whether miR-203 regulates SNAI1 messenger RNA (mRNA). [score:4]
This may be due, in part, to incomplete miR-203 -mediated repression of SNAI1 which has been shown previously to promote upregulation of ZEB factors [32]. [score:4]
In line with our findings, overexpressed SNAI1 reduced promoter activity of miR-203 [27], and of the miR-200c cluster [7], [27], in a HEK293T and HCT116 cell system, respectively. [score:3]
For exogenous miR-203 expression, hsa-miR-203 stem-loop sequence (MI0000283) −200/+192 relative to the first and last nucleotide of the stem-loop, was synthesized and cloned into BglII/ HindIII sites of the pSUPER. [score:3]
The ability of miR-203 to directly target SNAI1 was evaluated by luciferase reporter assays in MDA231 cells, using SNAI1-3′UTR reporter constructs - wild type or lacking the predicted miR-203 target sites. [score:3]
SNAI1 represses miR-203 and miR-200b expression. [score:3]
Overexpression of miR-203 in MDA231 cells reduced the activity of the wild type SNAI1-3′UTR, but not the mutant construct (Fig. 2F). [score:3]
In future, further dissection of the molecular links between EMT master regulators and miR-200s/miR-203, together with the consideration of quantitative binding parameters, will allow completing our core network and will contribute to the better understanding of key regulatory circuits underlying EMT. [score:3]
Figure S2 Ectopic miR-203 expression levels in stably transfected HTB129 cells. [score:3]
Therefore, we decided exploring the regulation of miR-203 and miR-200 family members through SNAI1, and their integration into regulatory networks governing epithelial cell plasticity. [score:3]
MiR-203 downregulates endogenous SNAI1 and promotes epithelial-like properties in breast cancer cells. [score:3]
HTB129 cells stably expressing miR-203 were generated by pSUPER-miR203 vector transfection and puromycin selection. [score:3]
E) Predicted miR-203 target sites within SNAI1 3′UTR. [score:3]
HTB129-ctrl and HTB129-miR203 cells were subjected to A) qRT-PCR analyses of SNAI1 mRNA expression in HTB129-ctrl and HTB129-miR203 cells, B) fluorescent staining with DAPI (blue) and phalloidin (red) (scale bar, 20 µm), C) migration and D) invasion assays. [score:2]
MiR-203, but not the miR-200s, directly represses SNAI1. [score:2]
First, we assayed miR-203 expression during SNAI1 induction in our EMT mo del by qRT-PCR analyses. [score:2]
Thus, the feedback regulationmiR-203 on SNAI1” is crucial for switching from an epithelial to a mesenchymal state and in stabilising the core network in both states. [score:2]
By a large-scale analysis on epithelial plasticity, we highlighted miR-203 and its molecular link with SNAI1 and the miR-200 family, key regulators of epithelial homeostasis. [score:2]
0035440.g002 Figure 2 HTB129-ctrl and HTB129-miR203 cells were subjected to A) qRT-PCR analyses of SNAI1 mRNA expression in HTB129-ctrl and HTB129-miR203 cells, B) fluorescent staining with DAPI (blue) and phalloidin (red) (scale bar, 20 µm), C) migration and D) invasion assays. [score:2]
0035440.g003 Figure 3A) The top panel corresponds to the core network integrating described interactions between miR-203, miR-200s (miR-200), SNAI1, ZEB1, ZEB2 and E-cadherin (CDH1). [score:1]
In silico analysis predicted two binding sites for miR-203, but none for miR-200 family members, within the 3′UTR of the SNAI1 mRNA (Fig. 2E) (microRNA. [score:1]
EMT core network integrating the miR203/SNAI1 and miR200/ZEB double negative feedback loops. [score:1]
MiR-203 was continuously repressed upon SNAI1 induction, similarly to the miR-200b cluster (Fig. 1B; Fig. S1). [score:1]
We integrated the novel miR203/SNAI1 feedback loop together with the known miR200/ZEB feedback loops [5] into an a priori SNAI1-centered EMT core network (Fig. 3A), based on our present and published data. [score:1]
C) Relative luciferase activity of miR-203 and miR-200b promoter constructs in non -induced (NI) and SNAI1 -induced cells. [score:1]
MiR-203 is associated with SNAI1 and the miR-200s. [score:1]
Next, we investigated the role of miR-203 in relationship with SNAI1 expression in breast carcinoma cells. [score:1]
puro vector (pSUPER-miR-203) (OligoEngine) (DNA2.0). [score:1]
HTB129-miR203 cells lost their typical fibroblastic, dispersed phenotype and acquired a more compact and cohesive appearance (Fig. 2B). [score:1]
Integration of miR203/SNAI1 in an EMT core network. [score:1]
F, G) Relative luciferase activity of SNAI1-3′UTR wild type (wt) or mutant (mut) in MDA231 cells transfected with control (F, G), miR-203 (F) or miR-200a/c (G) precursors. [score:1]
HTB129-miR203 cells further lost about 25% of their migratory and 15% of their invasive capacity (Fig. 2C, D). [score:1]
A) Representative proliferation curves of HTB129-ctrl and HTB129-miR203 cells. [score:1]
By combining computational biology and experimental approaches, we propose a novel EMT core network integrating two fundamental negative feedback loops, miR203/SNAI1 and miR200/ZEB. [score:1]
Furthermore, our experimental data connected miR-203 and the transcription factor SNAI1 in a double negative feedback loop. [score:1]
Next, to show the importance of the miR203/SNAI1 feedback loop on the network dynamics, we performed an ‘edgetic’ (edge-specific gene tic) perturbation, by removing the “miR-203 on SNAI1” interaction [34]. [score:1]
Here, we performed a large-scale analysis highlighting miR-203 as consistently associated with epithelial plasticity and correlated to the miR-200 family which plays a key role in epithelial homeostasis. [score:1]
Collectively, these factors may attenuate the effects of miR-203 -mediated repression of SNAI1 in HTB129-miR203 cells. [score:1]
HTB129 cells stably transfected with miR-203 (HTB129-miR203) exhibited a significant decrease in SNAI1 mRNA (Fig. 2A, Fig. S2). [score:1]
Wild type human GAPDH- and SNAI1-3′UTR, and mutant SNAI1-3′UTR lacking the predicted miR-203 binding sites, were synthesized and cloned into the psiCHECK™-2 (Promega) vector at XhoI/ NotI sites (DNA2.0). [score:1]
Dynamic simulations revealed stable epithelial and mesenchymal states, and underscored the crucial role of the miR203/SNAI1 feedback loop in state transitions underlying epithelial plasticity. [score:1]
A) The top panel corresponds to the core network integrating described interactions between miR-203, miR-200s (miR-200), SNAI1, ZEB1, ZEB2 and E-cadherin (CDH1). [score:1]
B) Percentage of early apoptotic HTB129-ctrl and HTB129-miR203 cells, as determined by flow cytometry using AnnexinV/Propidium iodide staining (BD Pharmingen). [score:1]
Hsa-miR-203 promoter region [27] was synthesized and cloned into pGL3-basic reporter using KpnI/ HindIII sites (DNA2.0). [score:1]
We integrated this novel miR203/SNAI1 with the known miR200/ZEB feedback loops to construct an a priori EMT core network. [score:1]
Figure S3 Proliferation curves of and percentage of early apoptotic events in HTB129-ctrl and HTB129-miR203 cells. [score:1]
We further showed that miR-203 and miR-200b promoter activity significantly decreased upon 12 h of SNAI1 induction (Fig. 1C). [score:1]
During SNAI1 -induced EMT in MCF7 breast cancer cells, miR-203 and miR-200 family members were repressed in a timely correlated manner. [score:1]
Importantly, miR-203 repressed endogenous SNAI1, forming a double negative miR203/SNAI1 feedback loop. [score:1]
Dynamic simulation revealed the existence of two stable states for this network and showed that the miR203/SNAI1 loop plays a crucial role in the switch from an epithelial to a mesenchymal state and in the stabilization of the core network in these two states. [score:1]
[1 to 20 of 64 sentences]
23
[+] score: 156
Figure 7The PCAT3/PCAT9-miR-203/SNAI2 axis controls xenograft growth of LNCaP cells in vivo(A) Representative pictures of tumors from LNCaP xenografts in the groups of control siRNA, PCAT3 siRNA, PCAT9 siRNA, PCAT3 siRNA + control inhibitor, PCAT9 siRNA + control inhibitor, PCAT3 siRNA + miR-203 inhibitor, PCAT9 siRNA + miR-203 inhibitor, PCAT3 siRNA + pSIN, PCAT9 siRNA +pSIN, PCAT3 siRNA + pSIN-SNAI2 or PCAT9 siRNA + pSIN-SNAI2, respectively. [score:9]
LNCaP cells were transfected with control siRNA, PCAT3 siRNA, PCAT9 siRNA, PCAT3 siRNA plus control inhibitor, PCAT9 siRNA plus control inhibitor, PCAT3 siRNA plus miR-203 inhibitor, PCAT9 siRNA plus miR-203 inhibitor, PCAT3 siRNA plus pSIN, PCAT9 siRNA plus pSIN, PCAT3 siRNA plus pSIN-SNAI2 or PCAT9 siRNA plus pSIN-SNAI2 were injected subcutaneously into the upper area of the hind limb. [score:9]
a: control siRNA; b: PCAT3 siRNA; c: PCAT9 siRNA; d: PCAT3 siRNA plus control inhibitor; e: PCAT9 siRNA plus control inhibitor; f: PCAT3 siRNA plus miR-203 inhibitor; g: PCAT9 siRNA plus miR-203 inhibitor; h: PCAT3 siRNA plus pSIN; i: PCAT9 siRNA plus pSIN; j: PCAT3 siRNA plus pSIN-SNAI2; k: PCAT9 siRNA plus pSIN-SNAI2. [score:9]
Figure 8 Upon tumor development, a reciprocal suppression between miR-203 and lncRNAs PCAT3/PCAT9 regulates the transcription and translation of SNAI2. [score:7]
Functionally, inhibition of miR-203 or overexpression of SNAI2 alleviated the suppressive effect of PCAT3 siRNA and PCAT9 siRNA on PCa proliferation, migration and xenograft growth. [score:7]
Upon tumor development, a reciprocal suppression between miR-203 and lncRNAs PCAT3/PCAT9 regulates the transcription and translation of SNAI2. [score:7]
The groups were shown in Figure 6: control siRNA, PCAT3 siRNA, PCAT9 siRNA, PCAT3 siRNA plus control miRNA inhibitor, PCAT9 siRNA plus control miRNA inhibitor, PCAT3 siRNA plus miR-203 inhibitor, PCAT9 siRNA plus miR-203 inhibitor, PCAT3 siRNA plus pSIN empty lentivirus, PCAT9 siRNA plus pSIN empty lentivirus, PCAT3 siRNA plus pSIN-SNAI2 lentivirus or PCAT9 siRNA plus pSIN-SNAI2 lentivirus were transfected or infected into LNCaP and 22Rv1 cells to investigate their effects on cell proliferation. [score:7]
miR-203 has been reported to be downregulated in prostate cancer and associated with cancer metastasis by targeting BMI1, LASP1, ZEB2 and SNAI2 [25– 29]. [score:6]
MTT assay indicated that inhibition of miR-203 or overexpression of SNAI2 significantly alleviated the suppressive effect of PCAT3 siRNA or PCAT9 siRNA on cell viability (Figure 6A and 6B). [score:6]
Similar observation was seen in the F-actin staining whereby the LNCaP cell shape in the groups control siRNA, PCAT3 siRNA + miR-203 inhibitor, PCAT9 siRNA + miR-203 inhibitor, siRNA + pSIN-SNAI2 lentivirus and PCAT3 siRNA + pSIN-SNAI2 lentivirus was more elongated than cells in other groups (Figure 6F). [score:5]
Therefore, we conclude that both PCAT3 and PCAT9 form a reciprocal repression regulatory loop with miR-203 to regulate prostate cancer proliferation and progression by modulating SNAI2 expression. [score:5]
Additionally, we found that the expression level of miR-203 was up-regulated in LNCaP and 22Rv1 cells transfected with PCAT3 or PCAT9 siRNA, compared with control siRNA (Figure 5F and 5G). [score:5]
Moreover, transwell migration assay demonstrated that silence of miR-203 or SNAI2 overexpression rescued the migration ability of LNCaP and 22Rv1 cells suppressed by PCAT3 or PCAT9 siRNA (Figure 6C–6E). [score:4]
In our previous studies and some other literatures, the transcription factor SNAI2 have been reported to be a direct target of miR-203 in multiple cancers (Figure 4G). [score:4]
For instance, Boll K et al. demonstrated that miR-130a, miR-203 and miR-205 jointly targeted several components of the mitogen-activated protein kinase (MAPK) and androgen receptor (AR) signaling pathways to interfere with progression to castration resistance [43]. [score:3]
Moreover, the expression of PCAT3 and PCAT9 was significantly decreased in cells transfected with miR-203 mimic, which was confirmed by qRT-PCR (Figure 5A–5D) and RNA-FISH (Figure 5E). [score:3]
Figure 5(A, B, C, D and E) Detection of PCAT3 and PCAT9 expression using qRT-PCR (A–D) and RNA-FISH (E) in LNCaP and 22Rv1 cells transfected with miR-203 mimic. [score:3]
The differential expression of PCAT3/PCAT9, miR-203 and SNAI2 leads to the induction of specific cellular processes, such as cell hyperproliferation, or epithelial-mesenchymal transition and angiogenesis, which promote tumor growth and progression. [score:3]
n = 6. (D– F) Quantitative RT-PCR to determine the average expression levels of PCAT3, PCAT9 and miR-203 in the tumors in indicated groups. [score:3]
Schematic representation to show the expression and function of the PCAT3/PCAT9-miR-203-SNAI2 axis in prostate cancer. [score:3]
Semi quantitative-RT-PCR to detect the expression of miR-203 in LNCaP (F) and 22Rv1 (G) cells transfected with control siRNA, PCAT3 siRNA or PCAT9 siRNA. [score:3]
In addition, the xenograft growth rate was significantly rescued by miR-203 inhibitor or pSIN-SNAI2 lentivirus. [score:3]
The PCAT3/PCAT9-miR-203/SNAI2 regulatory axis regulates prostate cancer cell proliferation and migration. [score:3]
In addition, the transfection efficacy and regulations among PCAT3, PCAT9, miR-203 and SNAI2 in the xenograft tissues were confirmed by quantitative RT-PCR or immunohistochemistry (Figure 7D–7G). [score:2]
The PCAT3/PCAT9-miR-203-SNAI2 axis participates in the regulation of xenograft growth in PCa in vivo. [score:2]
In our future study, we will systematically elucidate the relationship between androgen and the PCAT3/PCAT9-miR-203-SNAI2 regulatory axis. [score:2]
Although broadly characterized as a tumor suppressor in PCa, to our knowledge, data on the upstream regulatory mechanism of miR-203 in PCa have not yet been well elucidated. [score:2]
In the present study, we demonstrate that PCAT3 and PCAT9 regulates tumorigenesis, migration, angiogenesis, stemness and metastasis in prostate cancer via modulating the miR-203/SNAI2 axis. [score:2]
As expected, the luciferase report assay indicated that miR-203 mimic inhibited the luciferase activity of the wild type SNAI2 3′-UTR reporter (SNAI2 3′-UTR-WT), but no change was observed for the luciferase activity in the mutant reporter (SNAI2 3′-UTR-Mut) (Figure 4H and 4I). [score:2]
The PCAT3/PCAT9-miR-203-SNAI2 axis participates in the regulation of xenograft growth in PCa in vivoTo further delineate the in vivo function of PCAT3/PCAT9-miR-203-SNAI2 axis in PCa, xenograft tumor mo del were established in BALB/C nude mice. [score:2]
Thus, the regulation and function of VEGF in the PCAT3/PCAT9-miR-203-SNAI2 axis were also illustrated in this study. [score:2]
In addition, it is quite interesting to observe whether and how androgen modulates the PCAT3/PCAT9-miR-203-SNAI2 regulatory axis in PCa. [score:2]
Herein, we also performed a luciferase report assay to determine the effect of miR-203 on SNAI2 expression in LNCaP and 22Rv1 cells. [score:2]
To further determine the role of PCAT3/PCAT9-miR-203-SNAI2 in prostate cancer proliferation and progression, rescue experiments were conducted. [score:1]
Reciprocal repression of PCAT3 and PCAT9 with miR-203 in PCa. [score:1]
However, our unpublished data have demonstrated that the miR-203-SNAI2 axis play an important role in androgen-independent DU145 and PC3 cells. [score:1]
Most importantly, deciphering the molecular mechanisms for the PCAT3/PCAT9-miR-203-SNAI2 axis linked to prostate cancer initiation and progression is of great importance for developing new diagnostic and therapeutic method. [score:1]
PCAT3 and PCAT9 promote tumor cell proliferation and progression in PCa by sponging the miR-203-SNAI2 pathway. [score:1]
Both PCAT3 and PCAT9 function as decoys for the miR-203-SNAI2 axis. [score:1]
Figure 4(A, B and G) Putative miR-203 -binding sites in the mRNAs of PCAT3 (A) and PCAT9 (B), and the 3′-UTR of SNAI2 (G). [score:1]
cDNA fragments of PCAT3 and PCAT9 and 3′-UTR fragment of SNAI2 with miR-203 binding sites were amplified from the cDNA and genomic DNA of LNCaP cells respectively and cloned into the downstream of the Renilla luciferase gene of the psiCHECK-2 vector (Promega, Fitchburg, WI, USA) at SgfI or PmeI sites. [score:1]
These results suggest the miR-203-SNAI2 axis may be of great importance in PCAT3/PCAT9 guided prostate tumor growth in vivo. [score:1]
Some literatures have shown that miR-203 and SNAI2 are related to androgen and involved in androgen receptor (AR) signaling pathways. [score:1]
Several studies have also showed that the miR-203/SNAI2 axis plays a broad-spectrum role in various types of cancers [34– 38]. [score:1]
To further delineate the in vivo function of PCAT3/PCAT9-miR-203-SNAI2 axis in PCa, xenograft tumor mo del were established in BALB/C nude mice. [score:1]
Herein, it is much meaningful to determine the function of PCAT3/PCAT9-miR-203-SNAI2 axis in different types of prostate cancer stem cells in our future study. [score:1]
Our previous studies and some other literatures have demonstrated that the miR-203-SNAI2 axis play a pivotal role in tumorigenesis [34– 38]. [score:1]
StarBase v2.0 predicted that both PCAT3 and PCAT9 contain two conserved binding sequences complementary to miR-203 seed regions (Figure 4A and 4B). [score:1]
Sun T et al. also identified seven miRNAs, including miR-221, miR-222, miR-23b, miR-27b, miR-15a, miR-16-1, and miR-203, which are differentially expressed in the androgen-sensitive LNCaP cells and the hormone resistant LNCaP-abl cells and hypothesized that these miRNAs may characterize certain subtypes of human castration resistant prostate cancer [44]. [score:1]
The PCAT3/PCAT9-miR-203/SNAI2 axis controls xenograft growth of LNCaP cells in vivo. [score:1]
In summary, our data systematically show that the PCAT3/PCAT9-miR-203-SNAI2 axis play a pivotal role in tumorigenesis, migration, angiogenesis and stemness in prostate cancer (Figure 8). [score:1]
In the present study, we demonstrated that both PCAT3 and PCAT9 could function as sponges to modulate the effect of miR-203-SNAI2 axis in PCa. [score:1]
[1 to 20 of 52 sentences]
24
[+] score: 137
Other miRNAs from this paper: hsa-mir-203b
Overexpression of miR-203 in Panc-1 cells was sufficient to induce upregulation of epithelial markers (Snail, ZO-1 and β-catenin) and was followed by a decrease of mesenchymal marker expression (Zeb-1, vimentin and fibronectin). [score:8]
In this study, using western blot analysis, we also observed that miR-203 mimic treatment for 24 h significantly upregulated the expression of epithelial markers (Snail, ZO-1 and β-catenin) followed by a decrease of mesenchymal marker expression (Zeb-1, vimentin and fibronectin) (Fig. 2). [score:8]
We also showed that miR-203 inhibits cell migration and invasion via caveolin-1. The present study suggests that miR-203 expression may be a useful indicator of the metastatic potential and provide a new therapeutic target in this common malignancy. [score:7]
By contrast, miR-203 inhibitor was able to inhibit caveolin-1 protein expression. [score:7]
Our studies suggest that miR-203 may also be considered a suppressor of cancer cell migration, invasion and EMT transition in pancreatic cancer, and that miR-203 expression may be a useful indicator of the metastatic potential and provide a new therapeutic target in this common malignancy. [score:6]
The downregulation of miR-203 expression has been described in several types of cancer, including hepatocellular carcinomas (15), breast cancer (16) and pancreatic cancer (12). [score:6]
We observed that the caveolin-1 protein level was increased by approximately 330% (Fig. 3A and B) upon treatment of Panc-1 cells with miR-203 for 24 h under conditions that significantly inhibited the expression of mesenchymal markers (Fig. 2). [score:5]
miR-203 was also upregulated in the pancreatic cancer cells, as shown by miR array analysis, compared with normal human pancreatic duct epithelial cells, suggesting that miR-203 expression is a new prognostic marker in pancreatic adenocarcinoma patients (12). [score:5]
miR-203 acts as a tumor suppressor in chronic myelogenous leukemias, acute lymphoblastic leukemias and in hepatocellular carcinomas where its expression is silenced by chromosomal deletion or promoter CpG island hypermethylation (17). [score:5]
miR-203 inhibits the EMT by targeting caveolin-1. Discussion. [score:5]
We observed that exogenous miR-203 altered the expression of associated proteins following caveolin-1 knockdown by siRNA. [score:4]
miR-203 pleiotropically regulates the expression of a cohort of effectors involved in cancer stem cell self-renewal, cytoskeletal remo deling and tissue-specific metastatic spreading pathways. [score:4]
Regulation of caveolin-1 expression by miR-203 in Panc-1 cells. [score:4]
Previous results have correlated miR-203 downregulation with increased proliferative, invasive and metastatic potential of transformed cells in other malignancies (14). [score:4]
In our study, we have identified caveolin-1 as miR-203 direct target mRNAs involved in these events. [score:4]
We observed that exogenous miR-203 altered the expression of associated proteins after caveolin-1 knockdown by siRNA. [score:4]
To assess whether caveolin-1 is responsible for the miR-203 -dependent inhibition of cell migration and invasion, the miR-203 mimic was transfected into Panc-1 cells treated with caveolin-1 siRNA, and then to examine whether induction of caveolin-1 by miR-203 plays a role in cell migration (Fig. 5A) and invasion (Fig. 5B). [score:3]
These results suggest that miR-203 suppresses cell invasion in Panc-1 cells. [score:3]
miR-203 inhibited cell migration and invasion in Panc-1 cells. [score:3]
These results suggest that miR-203 altered the expression of associated proteins of the EMT phenotype in Panc-1 cells. [score:3]
Our data suggest that miR-203 inhibits cell migration and invasion via caveolin-1 in pancreatic cancer cells. [score:3]
In Panc-1 cells, treatment with miR-203 mimics strongly inhibited cell migration. [score:3]
miR-203 is an antiproliferative microRNA involved in skin differentiation that targets the 3′-UTR of the ‘stemness-maintaining’ transcription factor ΔNp63α (14). [score:3]
In this study we show that miR-203 inhibits cancer cell migration, invasion and EMT transition, in pancreatic cancer. [score:3]
When caveolin-1 was silenced by caveolin-1 siRNA, miR-203 did not suppress cell migration and invasion. [score:3]
A previous study showed that miR-203 is downregulated in metastatic pancreatic cancer cell lines compared to normal epithelial pancreatic cells, a result that suggests that miR-203 deficiency contributes to prostate cancer progression and metastasis (12). [score:3]
A time-course of the expression of caveolin-1 was examined after miR-203 mimics-treatment in Panc-1 cells. [score:3]
miR-203 altered the expression of associated proteins in Panc-1 cells. [score:3]
miR-203 is a keratinocyte-derived miR that promotes epithelial differentiation from proliferative basal progenitors in the dermis by suppressing p63, a member of the p53 family (9, 10). [score:3]
Caveolin-1 mRNA was induced 4.7-fold after 2 days of treatment with miR-203 mimics and gradually decreased after 7 days (Fig. 3C), suggesting that caveolin-1 is likely to be regulated by miR-203 signaling. [score:2]
These results indicate that caveolin-1 is essential for miR-203 -dependent cell migration and invasion. [score:1]
Panc-1 cells were seeded at a density of 2×10 [5] cells per well in six-well plates and transfected with miR-203 mimics or negative miRNA control (GenePharma, Shanghai, China), or human caveolin-1 siRNA or a control siRNA (BIONEEC, Shanghai, China) using the using Lipofectamine 2000 (Invitrogen), following the manufacturer’s instructions. [score:1]
miR-203 transcription is specifically repressed by the EMT activator Zeb-1, contributing to the invasive and metastatic behavior of pancreatic and colorectal cancer cells (16). [score:1]
By contrast, transfection of the miR-203 mimic alone significantly elevated cell migration (Fig. 1A) and invasion (Fig. 5B). [score:1]
One day after the Panc-1 cells were treated with control or miR-203 mimics, a single scratch wound was created in the well, and the time-course of wound closure was monitored (Fig. 1A). [score:1]
The results of the cell invasion assay indicated that miR-203 inhibited the invasiveness of Panc-1 cells compared with blank cells, as indicated by a marked decrease in the number of cells that invaded the bottom well (P<0.05, Fig. 1B). [score:1]
miR-203 transcription is specifically repressed by the EMT activator Zeb-1, contributing to the invasive and metastatic behavior of pancreatic and colorectal cancer cells (13). [score:1]
We observed that the caveolin-1 mRNA or protein levels are modulated by miR-203 in Panc-1 cells. [score:1]
In vitro wound healing assays and Transwell/Matrigel invasion assays following miR-203 transfection in Panc-1 cells suggest that its expression is sufficient to reduce migratory ability and invasiveness. [score:1]
When caveolin-1 was silenced by caveolin-1 siRNA, miR-203 did not alter the level of cell migration and invasion. [score:1]
[1 to 20 of 40 sentences]
25
[+] score: 109
PIK3CA was also shown to be a direct target of miR-203, whose downregulation was found to increase AKT signaling in gastric cancer [38]. [score:7]
Figure 2(A) Absolute expression level of miR-203 from next-generation sequencing analysis of 38 fresh frozen tumors demonstrated a significant upregulation of miR-203 among short-term survivors (p = 0.006). [score:6]
Even though potential downstream targets of miR-203 were not included in the scope of this study, there have been several reports that suggest a wide scope of potential candidate targets whose levels are modulated by miR-203. [score:5]
Another group reported that miRNA-203 was observed to be downregulated in both CRC and CRC cell lines compared to normal colon mucosa, and that lower expression was associated with larger CRC tumor and more advanced stage tumors [35]. [score:5]
MiR-203 is also predicted to target the 3′UTR of several genes for which aberrant expression levels have been associated with tumorigenesis and metastasis, such as PTP4A, PRKCB, and RAB10 [39]. [score:4]
Curative intent of surgical resection can be further strengthened by prognostic factors including CRS, mutational status, and miR-203 expression. [score:4]
MiR-203 expression was shown to be upregulated in both CRC and CRLM compared to normal colon mucosa and implicated in epithelial to mesenchymal transition [34]. [score:4]
In addition to CRC and CRLM, miRNA-203 expression was found to be deregulated in various cancer types, which may potentially reflect the tissue specific nature of miRNA-203. [score:4]
In univariate analyses as shown in Table 2A, lower miR-203 expression in CRLM tumor samples, as well as negative margin and low risk CRS were all significantly associated with long-term survival (p = 0.012, p = 0.001, p = < 0.001, respectively). [score:3]
Importantly, the concordance index for the CRS and margin status was higher when miR-203 expression level was added. [score:3]
On the other hand, miRNA-203 was overexpressed in pancreatic adenocarcinoma [43], prostate cancer [44], ovarian cancers [45], and metastatic breast cancer [46]. [score:3]
In lung cancer cells, miR-203 was found to promote apoptosis through targeting SRC [37]. [score:3]
Relative expressions and biological roles of miRNA-203 in CRC and CRLM remain to be elucidated. [score:3]
Moreover, the addition of information gained from miR-203 expression improved the concordance index, which was 0.776 based on margin status and CRS, to 0.843. [score:3]
After adjusting for margin status and CRS, lower expression of miR-203 remained significantly associated with long-term survival (OR = 0.52, p = 0.010). [score:3]
After adjusting for these variables, higher miR-203 expression remained an independent predictor of shorter survival (p = 0.010). [score:3]
Higher tumor miR-203 expression is associated with worse post-resection survival. [score:3]
MiR-203 was shown to be down-regulated in melanoma [40], hepatocellular carcinoma [41], and cholangiocarcinoma [42]. [score:3]
In this expanded cohort of 91 patients, we observed a significantly higher miR203 expression in patients with poor prognosis (Figure 2B, p = 0.020, one-sided Wilcoxon rank sum test). [score:3]
These studies in aggregate suggest both cancer promoting and suppressive potential for miR-203 in CRC depending on the context. [score:3]
Specifically, this was the first study showing miR-203 differential expression to be associated with survivorship after CRLM resection. [score:3]
Through unbiased small -RNA sequencing of human tumor RNAs, we identified miR-203 as a miRNA that is differentially expressed between the two survivor groups studied (Figure 1, log [2]Foldchange = 1.02, p-value = 0.006). [score:3]
After adjusting for CRS and KRAS status, miRNA-203 differential expression in long-term survivors remained significant (Table 2B and 2C, p = 0.016 and p = 0.033, respectively). [score:3]
Expression level of tumoral miR-203 was significantly increased among short-term survivors (Figure 2A, p = 0.006). [score:3]
One report implicated miR-203 as a negative regulator of ZNF 217 [36]. [score:2]
MiR-203 expression levels were significantly different between short-term vs. [score:2]
In this study, we identified miR-203 to be differentially regulated between short and long-term survivors after CRLM resection. [score:2]
This growing body of evidence implicated the important role of miR-203 level in regulating CRC progression. [score:2]
MiR-203 expression can be used as an independent prognostic biomarker. [score:2]
In conclusion, short-term survivors after CRLM resection exhibit significantly higher miR-203 expression in their CRLM tissues and preoperative sera compared to long-term survivors. [score:2]
Elevated serum miR-203 levels is associated with worse post-resection survival. [score:1]
Relative miRNA-203 expression levels were derived using 2 [^](−ΔΔCt) method, where ΔΔCt was calculated by subtracting the average ΔCt value in long-term survivors from individual ΔCt values for each sample. [score:1]
To assess the potential of miR-203 as a minimally invasive biomarker, we obtained preoperative sera from an independent cohort of 46 patients with CRLM. [score:1]
These studies warrant further large-scale studies to develop an approach to stratify patients according to their miR-203 status and additional molecular factors. [score:1]
Our findings support a role for miR-203 in promoting colorectal cancer metastatic relapse. [score:1]
It is possible that miR-203, after study in a larger cohort, will enhance our ability to personalize treatment plans by capturing the appropriate level of risk associated with a patient's CRLM. [score:1]
After CRLM resection, short-term survivors exhibited significantly higher miR-203 levels relative to long-term survivors. [score:1]
After adjusting for CRS and KRAS status, short-term survivors were found to have significantly higher miR-203 levels (p = 0.016 and p = 0.033, respectively). [score:1]
Our unbiased study also implicated miR-203 in CRC pathogenesis. [score:1]
MiR-203 was significantly overexpressed in tumors of short-term survivors compared to long-term survivors. [score:1]
[1 to 20 of 40 sentences]
26
[+] score: 106
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-1271, hsa-mir-203b
As shown in Figure 5E–5F, miR-203 mimics suppressed proliferation rate and invasive capacity of MG-63 cells, however, this effect was dramatically reversed by cotransfection with Bmi-1. This suggests that miR-203 suppresses osteosarcoma progression through targeting Bmi-1. After having validated that Bmi-1 was a direct target of miR-203, we sought to determine whether circRNA-0008717 promoted Bmi-1 expression through sponging miR-203. [score:12]
As shown in Figure 5E–5F, miR-203 mimics suppressed proliferation rate and invasive capacity of MG-63 cells, however, this effect was dramatically reversed by cotransfection with Bmi-1. This suggests that miR-203 suppresses osteosarcoma progression through targeting Bmi-1. (A) The putative sequences of miR-203 and Bmi-1 with two binding sites. [score:7]
We also validated that miR-203 was silenced in osteosarcoma and the downregulated miR-203 suppressed cell proliferation and invasion. [score:6]
As shown in Figure 4G, miR-203 significantly inhibited luciferase activity of wild type reporter for cirRNA-0008717, however, miR-203 did not inhibit the luciferase activity of reporter vector containing the mutant binding sites of cirRNA-0008717. [score:5]
We found that circRNA-0008717 plays a oncogenic role in osteosarcoma via the sponge of miR-203 to promote thymidylate synthase expression, and consequently suppress osteosarcoma progression. [score:5]
miR-203 targets BMI-1 and suppresses osteosarcoma cell proliferation and invasion. [score:5]
Finally, our gain and loss-functional assays verified that circRNA-0008717 promotes osteosarcoma progression by sponge activity of miR-203 and upregulation of Bmi-1 expression. [score:5]
To further identify whether Bmi-1 in osteosarcoma cells responded to miR-203 through direct interactions with its 3′-UTR, we cloned the wild type 3′-UTR of the putative miR-203 target or mutant sequences into reporter plasmid downstream of the luciferase gene. [score:4]
RT-qPCR showed that miR-203 was significantly downregulated in osteosarcoma tissues and cell lines (Figure 4B and 4C). [score:4]
Moreover, knockdown of circRNA-0008717 significantly promoted miR-203 expression (Figure 4E), however, miR-203 failed to influence cirRNA-0008717 level (Figure 4F). [score:4]
By performing bioinformatics analysis and subsequent functional validation, we identified Bmi-1 as the direct target of miR-203. [score:4]
RT-qPCR and western blot assay showed that miR-203 mimics inhibited Bmi-1 expression at both transcript and protein level, respectively (Figure 5B). [score:4]
CircRNA-0008717 promotes osteosarcoma progression by sponge activity of miR-203 and upregulation of Bmi-1. DISCUSSION. [score:4]
Although the role of miR-203 in malignancies are conflicting, miR-203 acts as a tumor suppressor in tumor progression of osteosarcoma [39]. [score:3]
The miR-203 mimics, and small interfering RNAs (siRNAs) that specifically target Bmi-1 (si-Bmi-1) was synthesized by GenePharma (Shanghai, China). [score:3]
According to miRBase prediction, miR-203 could target Bmi-1 3′UTR with a high score (Figure 5A). [score:3]
Mechanistic analysis indicated that circRNA-0008717 suppressed the capacity of proliferation, migration and invasion of osteosarcoma cells through specifically sponging miR-203 and releasing Bmi-1. The concept of “circular RNA” was first proposed in 1976, Sanger and colleagues found that viroids are single-stranded covalently closed circRNA molecules pathogenic to certain higher plants [22]. [score:3]
Moreover, circRNA-0008717 acts as a tumor oncogene through sponging miR-203 and thereby promoting the function of Bmi-1. Therefore, circRNA-0008717 may serve as a promising predictive biomarker and therapeutic target for osteosarcoma patients. [score:3]
Spearman correlation test suggested that circRNA-0008717 was negatively correlated with miR-203 expression (Figure 4D). [score:3]
CircRNA-0008717 directly binds to miR-203 in osteosarcoma cells. [score:2]
The circRNA-0008717 sequence with mutation of miR-203 binding site was synthesized using overlap extension PCR and cloned into psiCHECK2 vector designated as psiCHECK2-circRNA-0008717-Mut. [score:2]
Take a step further, we sought to determine that circRNA-0008717 regulates cell proliferation and invasion through sponging miR-203 and subsequently elevating Bmi-1. Bmi-1 silencing vector was then constructed (Figure 6E). [score:2]
Previous studies have showed that miR-203 exhibited aberrant expression in multiple malignancies compared with their normal tissues [38]. [score:2]
MiR-203, located at the chromosome 14q32.33, is one of the most frequently mentioned miRNAs. [score:1]
The mutant vector for miR-203 binding site was constructed and termed as psiCHECK2-Bmi-1–3′ UTR-Mut. [score:1]
Furthermore, RIP showed that the enrichment of Bmi-1 and miR-203 was significantly decreased in MG-63 cells transfected with circRNA-0008717 vector (Figure 6D). [score:1]
The RIP experiment using Bmi-1 antibody (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA) to pull down miR-203 was also performed. [score:1]
Figure 5(A) The putative sequences of miR-203 and Bmi-1 with two binding sites. [score:1]
Subsequently, luciferase reporter assay was performed to verify that miR-203 directly interacted with circRNA-0008717. [score:1]
As shown in Figure 6F and 6G, circRNA-0008717 significantly promoted cell proliferation rate, however, this effect was significantly abrogated by cotransfection with miR-203 mimics or si-Bmi-1 vector. [score:1]
Similarly, the enhanced cell invasive capacity of both cell lines induced by circRNA-0008717 was abolished by cotransfection with miR-203 mimics or si-Bmi-1 vector (Figure 6H). [score:1]
Our study also suggests that Bmi-1 is necessary for the anti-oncogenic role of miR-203, which is consistent with the previous studies. [score:1]
Figure 4(A) The putative sequences of miR-203 and circRNA-0008717 with two binding sites. [score:1]
According to miRBase prediction, circRNA-0008717 possessed two complementary sequences to miR-203 seed region (Figure 4A). [score:1]
[1 to 20 of 34 sentences]
27
[+] score: 98
When cells were exposed to 75 mM ethanol for 5 days followed by a withdrawal period for 5 days, the expression of miR-7 and miR-15B was significantly down-regulated, the expression of miR-152 and miR-153 was unchanged and miR-203 was down-regulated to the extent that it could not be detected (Table 1). [score:11]
Chronic exposure of these cells to 75 mM ethanol for five days resulted in a significant up-regulation of the expression of miR-7 and miR-144 and down-regulation of miR-203 and miR-15B with no significant change in the expression of miR-152 or miR-153 (Table 1). [score:11]
Chronic ethanol exposure resulted in a significant up-regulation of the expression of miR-7 and miR-144 and down-regulation of miR-203 and miR-15B. [score:9]
Specifically, miR-203, miR-144, miR-15B and miR-153 are all predicted to target the α1 isoform of the GABA [A] receptor, miR-7 and miR-153 are known to act co-operatively to regulate the expression of α-synuclein and miR-203, miR-144, miR-152, miR-7 and miR-15B are predicted to target isoforms of the 14-3-3 family. [score:8]
Interestingly, ethanol withdrawal resulted in an up-regulation of miR-7, miR-152, miR-203 and miR-15B similar to the expression changes seen in post mortem human brain. [score:6]
The expression of miR-203 was down-regulated to the extent that it could not be detected. [score:6]
The expression of miR-203 and miR-152 (~2 fold) was up-regulated following chronic-intermittent ethanol treatment and returned to near normal levels once ethanol was removed (Table 2). [score:6]
Interestingly, ethanol withdrawal resulted in an up-regulation of miR-7, miR-152, miR-203 and miR-15B similar to the expression changes seen in post mortem human brain [15]. [score:6]
The expression of miR-203 was significantly reduced following chronic-intermittent ethanol exposure, and this reduced expression level persisted following the 5 day withdrawal period. [score:5]
Here we measured the expression of six miRNAs—miR-7, miR-153, miR-152, miR-15B, miR-203 and miR-144—which are predicted to target key genes involved in chronic alcoholism and other neurodegenerative disease. [score:5]
We measured the expression of six miRNAs—miR-7, miR-153, miR-152, miR-15B, miR-203 and miR-144—which are predicted to target key genes involved in chronic alcoholism and other neurodegenerative diseases. [score:5]
Overall, exposure of these cells to chronic ethanol resulted in significant down-regulation of miR-7, miR-15B, miR-152 and miR-203 which persisted even after removal of ethanol. [score:4]
We selected six miRNAs—miR-7, miR-152, miR-153, miR-144, miR-203 and miR-15B—which are predicted to target key genes involved in chronic alcoholism including GABA [A] receptors [18], α-synuclein [19], regulators of G protein signaling [20], and the 14-3-3 family of molecular chaperones [21]. [score:4]
Chronic-intermittent exposure resulted in up-regulation of miR-153 and miR-203. [score:4]
MiR-7, miR-152, miR-153 and miR-15B were expressed in the 1321 N1 cell line whereas miR-144 and miR-203 were below the threshold for reliable detection. [score:3]
In addition, miR-203 was expressed at much lower levels than the other four miRNAs. [score:3]
HEK293T cells expressed all six miRNAs under investigation although miR-144 and miR-203 were found at much lower levels than the other four miRNAs. [score:1]
We measured the changes in expression of six miRNAs (miR-7, miR-153, miR-152, miR-144, miR-203 and miR-15B) in HEK293T cells, SH SY5Y neuroblastoma and 1321 N1 cells following ethanol treatment. [score:1]
[1 to 20 of 18 sentences]
28
[+] score: 92
Among those significantly differentially expressed miRNAs, five downregulated (miR-26b-5p, miR-200c-3p, miR-203a, miR-223-3p, miR-363-3p) and three upregulated (miR-328, miR-574-3p, miR-1825) miRNAs were selected as a result of detailed literature search for further confirmation with qRT-PCR. [score:9]
MicroRNA profiling of CD133 [+] and CD133 [−] LCa samples with microarray revealed that miR-26b, miR-203, miR-200c, and miR-363-3p were significantly downregulated and miR-1825 was upregulated in CD133 [+] larynx CSLCs. [score:7]
Correlation of those microRNAs expressions supports a recent report, which demonstrated that decreased expressions of miR-200c, miR-363, and miR-203 were associated with poor prognosis in human head and neck squamous cell carcinoma [81]. [score:5]
Expressions of miR-26b, miR-200c, and miR-203 were significantly correlated with miR-363-3p, miR-203, and miR-363-3p expressions, respectively. [score:5]
Among those, miR-26b (Fig.   2a, b), miR-200c (Fig.   2c, d), miR-203 (Fig.   2e, f), and miR-363-3p (Fig.   2g, h) were found to have significantly reduced expression in CD133 [+] larynx CSLCs, whereas miR-1825 (Fig.   2i, j) were validated to have increased expression in these CD133 enriched LCa cells. [score:5]
e Relative expression levels of miR-203 in each CD133 [+] and CD133 [−] sample pairs, and (f) mean relative expression levels miR-203 in CD133 [+] cells with respect to CD133 [−] cells. [score:5]
Besides, coordinated loss of miR-200c and miR-203 has been found to result in enhanced translation of the multiple targets and chronic activation of NF-κB, PI3K-Akt, and Ras-Erk pathways, leading to B cell transformation, which suggest that collaborative actions of multiple miRNAs rather than a single miRNA ensure the robustness of biological processes [82]. [score:5]
We here also demonstrated that miR-200c, and miR-203 expressions were significantly correlated with miR-203, and miR-363-3p expressions, respectively, in CD133 [+] LCa tissue samples. [score:5]
As to the analysis of validated targets of these miRNAs, miRTarBase database analysis revealed that miR-26b, miR-200c, miR-203, and miR-363-3p, and miR-1825 cooperatively target stem cell associated signaling pathways like Wnt, Hedgehog, and Notch (Fig.   4). [score:5]
Additionally, miR-200c and miR-203 cooperatively inhibit stem cell factors’ expressions in both cancer cells and mouse embryonic stem cells [80]. [score:5]
MiR-203 was found to induce differentiation of normal epidermal stem cells [76, 77] and its expression was reported to be inhibited during EMT in stem cell-enriched cancer cell subpopulation [78]. [score:4]
In this study, we have found miR-200c and miR-203 to be downregulated in CD133 [+] larynx CSLCs, supporting their potential involvement in carcinogenesis as driving forces for tumor initiation, progression, metastasis, and recurrence. [score:4]
As to miR-203, it has been found to be downregulated in head and neck region cancers including LCa [60, 74, 75]. [score:4]
To evaluate their correlation, we used Pearson correlation analysis, which demonstrated that miR-26b, miR-200c, and miR-203 expressions were significantly correlated with miR-363-3p, miR-203, and miR-363-3p expressions, respectively, in CD133 [+] LCa tissue samples (Fig.   3). [score:3]
Lower miR-203 expression was significantly associated with poor differentiation, advanced clinical stages, lymph node metastasis and decreased 5-year overall survival in LCa [79]. [score:3]
Besides, we included miR-200c and miR-203 since they are strongly associated with stemness and cancer, although these miRNAs are not in the top 10 differentially expressed miRNAs. [score:3]
To validate the differential expression of miR-26b, miR-200c, miR-203, miR-223, miR-328, miR-363-3p, 574-3p, and miR-1825, a total of 25 pairs of CD133 [+] and CD133 [−] cell populations collected from 25 tumor samples including those used in microarray experiments were studied. [score:3]
Furthermore, miRWalk analysis showed that 3’UTR of several oncogenes were predicted to be targeted by miR-26b (202 out of 348 oncogenes), miR-200c (161 out of 348 oncogenes), miR-203 (216 out of 348 oncogenes), and miR-363-3p (175 out of 348 oncogenes). [score:3]
In addition to miR-200c and miR-203, which have been demonstrated in distinct cancers as having CSLCs specific deregulation pattern, we propose miR-1825, miR-363-3p, and miR-26b as specific miRNAs with potential roles in acquisition and maintenance of stem cell associated features as well as in contributing to tumor initiation, progression, metastasis, chemoresistance, and recurrence. [score:2]
showed that miR-203 has lower expression in stage III samples compared to stage II tumor samples. [score:2]
Besides, miR-1825 has a tendency to have increased and miR-363-3p and miR-203 have a tendency to have decreased expression in T4 stage tumors compared to early stage tumors, although not significant. [score:2]
MiR-200c and miR-203 have previously been extensively studied in various contexts, and both miRNAs are associated with the stemness of normal stem cells and CSLCs. [score:1]
Yellow, high fold change in CD133 [+] patient sample as compared to its corresponding CD133 [−] paired sample; blue, high fold change in CD133 [−] sample compared to CD133 [+] paired sample The qRT-PCR results confirmed that five of the eight selected miRNAs had a differential expression between groups: miR-26b, miR-200c, miR-203, miR-363-3p, and miR-1825 (Fig.   2, p values and fold changes are provided in Table  2). [score:1]
Yellow, high fold change in CD133 [+] patient sample as compared to its corresponding CD133 [−] paired sample; blue, high fold change in CD133 [−] sample compared to CD133 [+] paired sample The qRT-PCR results confirmed that five of the eight selected miRNAs had a differential expression between groups: miR-26b, miR-200c, miR-203, miR-363-3p, and miR-1825 (Fig.   2, p values and fold changes are provided in Table  2). [score:1]
[1 to 20 of 24 sentences]
29
[+] score: 82
Other miRNAs from this paper: hsa-mir-204, hsa-mir-211, hsa-mir-203b
It is downregulated in melanoma tissues, which is associated with the poor prognosis of melanoma patients [24], and loss of miR-203 expression at the invasive front of primary cutaneous melanoma is associated with increased thickness and disease progression [8], Moreover, miR-203 also has inhibitory effects on the proliferation, migration, and invasion of melanoma cells via targeting versican and BMI1 [7, 25]. [score:12]
Besides, we suggest that the upregulation of RAB22A in melanoma may be due to the decreased expression of miR-203, which could directly target RAB22A. [score:9]
We found that overexpression of miR-203 significantly decreased the protein expression of RAB22A, while knockdown of miR-203 by specific siRNA remarkably enhanced the RAB22A protein expression in melanoma cells (Figure 6). [score:8]
These findings suggest that the downregulation of miR-203 may contribute to the upregulation of RAB22A in melanoma cells. [score:7]
In this study, we found that RAB22A was a direct target gene of miR-203, and its protein expression was negatively regulated by miR-203 in A375 cells. [score:7]
These findings suggest that the upregulation of RAB22A in melanoma may partly be due to the decreased expression of miR-203. [score:6]
MiR-203 was previously reported to be significantly downregulated in melanoma, and function as a tumor suppressor. [score:5]
RAB22A is a target gene of miR-203, a tumor suppressive miR in melanoma. [score:5]
Accordingly, RAB22A is a directly target gene of miR-203 in A375 cells. [score:4]
In fact, the targeting relationship between miR-203 and RAB22A was also reported in osteosarcoma [13]. [score:3]
As shown in Figure 7C, real-time PCR data indicated that miR-203 was significantly downregulated in melanoma tissues compared with benign nevi. [score:3]
Figure 6(A) Real-time PCR was used to examine the miR-203 levels in A375 cells transfected with miR-203 mimic or scramble miR mimic (miR-NC), and then (B) western blot was used to examine the protein expression of RAB22A. [score:3]
In this study, we also found that miR-203 was significantly downregulated in melanoma tissues and cell lines, when compared with benign nevi and HM cells, respectively. [score:3]
MiR-203 has previously been reported to play a suppressive role in melanoma [7, 8, 24, 25]. [score:2]
RAB22A siRNA (Santa Cruz, USA), non-specific siRNA (Santa Cruz), pcDNA3.1-RAB22A ORF plasmid, blank pcDNA3.1 vector, miR-203 mimic, scramble miR-203, anti-miR-203 (5′-TAGTGGTCCTAAACATTTCA-3′) or Lipofectamine 2000 (Thermo Fisher, USA) was diluted with serum-free medium, respectively. [score:1]
As shown in Figure 7B, the luciferase activity was significantly decreased in A375 cells transfected with miR-203 mimic and WT RAB22A 3′UTR reporter plasmid, which was abolished by MT RAB22A 3′UTR reporter plasmid. [score:1]
We further investigated the association between the miR-203 and RAB22A expression in melanoma tissues. [score:1]
Therefore, our study expands the importance of miR-203/RAB22A axis in human cancers. [score:1]
Real time RT-PCR was conducted to detect the mRNA level of RAB22A or miR-203 using SYBR [®] GreenMastermix kit (Bio-Rad Laboratories, Hercules, CA) p, and β-actin and U6 were used to be normalized as internal control. [score:1]
[1 to 20 of 19 sentences]
30
[+] score: 75
Fig. 5. miR-203a-3p overexpression downregulates NOVA1 and upregulates IKAP protein levels. [score:9]
Moreover, we confirmed that overexpression of a dysregulated miRNA in FD, miR-203a-3p, induced underexpression of NOVA1 transcripts and corrected IKBKAP mRNA alternative splicing, leading to a concomitant decrease of NOVA1 and increase of IKAP protein expression. [score:8]
To choose the best miRNA for experimental expression variation, we selected one that exhibited the lowest level of expression in FD cells (Table 1; Fig.  S2) and the highest rate and number of target mRNAs involved in nervous system function (genes shaded in gray on Table S4), and therefore further focused our study on the miR-203a-3p– NOVA1 relationship. [score:7]
Interestingly, we also found that miR-203a-3p overexpression induced a reduction of NOVA1 protein levels (Fig.  5, middle panel), which is also associated with an important increase of IKAP expression (Fig.  5, upper panel). [score:5]
shows expression level of IKAP and NOVA1 proteins in one culture of FD hOE-MSCs and one FD clone overexpressing miR-203a-3p. [score:5]
As expected, such an overexpression of miR-203a-3p induced a drastic decrease of the NOVA1 mRNA expression level (Fig.  4A). [score:5]
Regarding the miRNA we chose to focus on, miR-203a-3p, it is mainly known to play a role in epithelial differentiation and tumorigenesis, but recent work has established that this miRNA can modulate the expression level of NEGR1, which encodes a protein implicated in neurite outgrowth during neuronal development (Benaich et al., 2014; Kaur et al., 2016; Taube et al., 2013; Yi et al., 2008). [score:4]
Transduction of lentivirus expressing miR-203a-3p in FD cells induced efficient overexpression (by ∼1000-fold) compared to non-transduced controls (Fig.  S4). [score:4]
A long non-coding RNA, BC048612 and a microRNA, miR-203 coordinate the gene expression of neuronal growth regulator 1 (NEGR1) adhesion protein. [score:4]
e. m. value of hsa-miR-137, hsa-miR-376c-3p, hsa-miR-203a-3p and hsa-miR-146a-5p relative expression level in two series of biological replicates from the first microfluidics arrays (five control and five FD hOE-MSCs) and the second arrays (four healthy control and four FD hOE-MSCs), respectively normalized by hsa-miR-320a (for both hsa-miR-137 and hsa-miR-376c-3p), hsa-miR-330-3p and hsa-miR-324-5p. [score:3]
Rewiring of an epithelial differentiation factor, miR-203, to inhibit human squamous cell carcinoma metastasis. [score:3]
Histograms represent the level of expression of NOVA1 mRNA (A) and IKBKAP transcripts (B) in two primary cultures of FD hOE-MSCs at different cell passages (p9 and p13) and two FD clones (#1 and #2) obtained after transduction with miR-203a-3p lentiviral constructs, as determined by RT-qPCR. [score:3]
We demonstrated that overexpression of miR-203a-3p leads to a decrease of NOVA1, counter-balanced by an increase of IKAP, supporting a potential interaction between NOVA1 and IKAP. [score:3]
Fig. 4. miR-203a-3p overexpression induces antagonistic effects on NOVA1 and IKBKAP WT transcripts levels. [score:3]
We validated a significant underexpression in FD compared to control hOE-MSCs for all four miRNAs: miR-137, miR-376c-3p, miR-203a-3p and miR-146a-5p (Fig.  2). [score:2]
In brief, small hairpin sequence corresponding to miR-203a-3p was cloned into the pLenti6/V5-DEST vector, which was then packaged into replication-incompetent lentiviral particles in HEK293FT cells by co-transfecting pLenti6/V5 plasmid with the ViraPower Packaging Mix. [score:1]
These results underscore a link between miR-203a-3p, NOVA1 and IKAP. [score:1]
To modulate NOVA1, one culture of FD hOE-MSCs was transduced with the pLenti6/V5-DEST/miR-203a-3p construct to generate several clones. [score:1]
Therefore, our data linking miR-203a-3p with NOVA1 would corroborate miR-203a-3p contribution in the nervous processes. [score:1]
Therefore, these results demonstrate a possible link between miR-203a-3p, NOVA1 and IKAP. [score:1]
Epigenetic silencing of microRNA-203 is required for EMT and cancer stem cell properties. [score:1]
One culture of FD hOE-MSCs was transduced with the pLenti6/V5-DEST/miR-203a-3p lentivirus for 24 h with Polybrene at 6 µg/ml (ThermoFisher Scientific, Invitrogen, Carlsbad, CA). [score:1]
[1 to 20 of 22 sentences]
31
[+] score: 73
Studies interrogating the expression of miR-203 have suggested that high-level expression is observed in skin and in the esophagus, an organ sharing anatomical similarities with skin [14]. [score:5]
No difference was found in miR-203 expression between the patients with grades A and B. Another limitation was the failure to recruit patients with non-GERD-related disease. [score:5]
3.3. miR-203 Level in Exfoliated Cells of the Tongue Coating Was Downregulated in Patients with GERD. [score:4]
In summary, we demonstrated that miR-203 was significantly downregulated in exfoliated cells of the tongue coating in patients with GERD. [score:4]
miR-203 expression has been shown to be dysregulated in several malignancies, including gastric cancer, esophageal cancer, lung cancer, squamous cell carcinoma, and cervical cancer [16– 20]. [score:4]
In keeping with our initial observation, miR-203 was significantly downregulated in GERD specimens as compared to those levels in Ctrls (P < 0.0001) (Figure 2). [score:3]
Consistent differences in expression levels between Barrett's esophagus (BE) and normal epithelia were noted in multiple studies for miR-203 [13]. [score:3]
Our study demonstrated that miR-203 in exfoliated cells of the tongue coating was significantly downregulated in GERD patients as compared with Ctrls. [score:3]
In this study, we hypothesised that miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205 expression might be altered in tongue coating in response to chronic gastroesophageal reflux. [score:3]
These results suggest that the expression level of miR-203 may be useful a marker for discriminating GERD from Ctrls, with the advantage that this technique is noninvasive and inexpensive. [score:3]
Meanwhile, we observed a statistically significant downregulation of miR-203 in GERD as compared to Ctrls (P < 0.0001) (Figure 1). [score:3]
However, we found no difference in miR-203 expression in exfoliated cells of the tongue between GERD patients with inflamed and uninflamed esophageal mucosa. [score:3]
Specifically, Wijnhoven et al. [10] have shown that miR-203 and miR-205 are high in normal squamous epithelium and low in columnar epithelia, while miR-21, miR-143, miR-145, miR-194, and miR-215 are significantly upregulated in columnar tissues compared with normal squamous epithelium. [score:3]
This finding suggests that gastroesophageal reflux alters the expression of miRNAs, including miR-203 identified in our study, in exfoliated cells of the tongue coating. [score:3]
miR-203 in exfoliated cells of the tongue coating was significantly downregulated in GERD patients as compared with Ctrls (P < 0.0001) with ROC curve areas of 0.94 (95% CI: 0.90–0.97) and a sensitivity and specificity of 91.7% and 87.3%, respectively, in the GERD subjects and Ctrls. [score:3]
We validated our findings across an independent cohort, thereby confirming that miR-203 was significantly downregulated in GERD as compared to Ctrl levels. [score:3]
To assess differential expression of miRNAs in exfoliated cells of the tongue coating between GERD (n = 24) and Ctrls (n = 24), 6 candidate miRNAs (miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205) were selected. [score:3]
miR-203 is significantly downregulated in Barrett's esophagus (BE) and was also reduced for comparisons of Barrett's high grade dysplasia (HGD), or esophageal adenocarcinoma (EAC) tissues as compared to that in esophageal mucosa in several studies [21, 22]. [score:3]
Recently, miR-203 has been indicated to play a key role in the regulation of normal immunity or inflammation response [23, 24]. [score:2]
Similarly, in performing whole mouse embryo in situ hybridization, Yi et al. detected miR-203 signal in the epidermis and the tongue [15]. [score:1]
3.4. miR-203 Level in Exfoliated Cells of the Tongue Coating Can Be Used to Distinguish GERD Patients from Ctrls. [score:1]
miR-203 and miR-205 are high in normal squamous epithelium and low in columnar epithelia [10]. [score:1]
These results suggest that miR-203 can be used to discriminate individuals with GERD from Ctrls. [score:1]
These miRNAs including miR-203 could target genes and pathways that may contribute to GERD pathogenesis; however, the specific molecular mechanism remains to be determined and awaits further investigation. [score:1]
We evaluated the expression levels of miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205 in exfoliated cells of the tongue coating in patients with GERD and Ctrls across a discovery cohort of 48 specimens. [score:1]
Our study demonstrated that miR-203 in exfoliated cells of the tongue coating can be used as a potential noninvasive biomarker for the diagnosis of GERD. [score:1]
We suggest that miR-203 testing may assist in the diagnosis of patients with symptoms suggestive of GERD. [score:1]
The sensitivity and specificity of miR-203 were 91.7% and 87.3%, respectively, in the GERD subjects and Ctrls. [score:1]
Comparing GERD subjects with Ctrls, ROC curve areas of miR-203 were found to be 0.94 (95% CI: 0.90–0.97) (Figure 3). [score:1]
[1 to 20 of 29 sentences]
32
[+] score: 69
Genes with miR-203 target sites are much more likely to be downregulated after miR-203 overexpression, and downregulated genes are highly enriched for genes with miR-203 target sites (p<0.0001). [score:13]
The significantly downregulated mRNAs with target sites for miR-203 provide an excellent subset of targets to unravel the miRNA -induced effect. [score:8]
All differentially expressed genes are plotted in the left graph, while only the differentially expressed genes containing miR-203 target sites are plotted in the right graph. [score:7]
As an example, we found BIRC5, the gene encoding for survivin and predicted to be a direct target of miR-203, to be downregulated after miR-203 transfection. [score:7]
After transfection with miR-203, we observed a very strong enrichment of miR-203 targets in the downregulated genes (figure 5a), a phenomenon previously observed for several miRNAs [24]. [score:6]
For two miRNAs, miR-16 and miR-203, we examined whether in vitro long-term inhibition translated to a reduction in tumor growth in an in vivo xenograft mo del. [score:5]
Survivin is an antiapoptotic protein important in melanoma biology [25], and its regulation by miR-203 can explain the reduced proliferation seen after miR-203 overexpression. [score:4]
One of these miRNAs, miR-203, was originally described as a regulator of skin differentiation [20], and has more recently been shown to inhibit melanoma growth by inducing senescence [26]. [score:4]
Parental cells or cells stably expressing an empty vector, a miR-16 construct or a miR-203 construct were injected subcutaneously in nude mice. [score:3]
A comparison of the inhibitory effects of miRNAs on these cell lines and A375 is given in figure 4. miRNAs yielded very similar effects in all cell lines, with a notable exception for miR-184 and miR-203 in SK-MEL-28. [score:3]
Together, these data provide an initial step to a more complete understanding of the mechanisms by which miR-203 restricts melanoma cell growth, and they exemplify how transcriptome analysis can be employed to unravel functions of miRNAs of interest. [score:1]
Finally, we selected mir-203 from the list of 20 high-confidence hits, because it is known to play a crucial role in skin differentiation [20]. [score:1]
After overnight attachment the cells were transfected overnight with miR-203 mimics (Ambion) or Pre-miR™ miRNA Precursor Molecules - Negative Control #2 (ambion AM17111) both at a concentration of 100 nM and 12 ul X-tremeGENE siRNA Transfection Reagent per well (Roche). [score:1]
The next day cells were transfected with miRNA mimic control #2 (Ambion), BRAF siRNA pool (Dharmacon) or miR-203 mimic (Ambion), at 100 nM concentration using RNAiMAX (Invitrogen). [score:1]
Relative expression was calculated as the ratio of relative reads mapping to a gene in the miR-203 -transfected sample and the relative reads mapping to a gene in the control -transfected sample. [score:1]
The BIRC5 transcript and its protein product survivin are both reduced after miR-203 transfection, but also after siBRAF transfection. [score:1]
Transcriptome analysis after miR-203 transfection. [score:1]
We have explored the effects of one of the miRNAs, miR-203, on the transcriptome of A375 cells. [score:1]
0043569.g005 Figure 5 (A) A375 cells were transfected with either miR-203 or scrambled control and the transcriptome was quantified by RNA-Seq. [score:1]
[1 to 20 of 19 sentences]
33
[+] score: 61
The qRT-PCR analysis indicated that 2 miRNAs (miR-21 and miR-133b) were deregulated in both EAC and GC, and 6 miRNAs (up-regulated: miR-194, miR-31, miR-192, and miR-200a; down-regulated: miR-203 and miR-205) in EAC, as compared to BE but not in GC, indicating their potential unique role in EAC. [score:7]
We found that 2 miRNAs (miR-192, and miR-194) were up-regulated and 3 miRNAs (miR-205, miR-203, and miR-31) were down-regulated in BE as compared to NS (Figures 2 and 3). [score:6]
Although the targets of miR-203 have not been characterized in EAC, its down-regulation was reported in metastatic breast cancer cell lines and has been linked to increased motility and invasion by targeting SNA12, a transcription factor that enhances invasion and migration [29]. [score:6]
We showed the up-regulation of miR-194, miR-192, miR-21, miR-31, and miR-200a (Figure 2, Table 3) and the down-regulation of miR-133b, miR-203, and miR-205 in EAC as compared to BE (Figure 3, Table 3). [score:6]
Our validation confirmed the up-regulation of miR-194, miR-192, miR-21, and miR-200a, and the down-regulation of miR-203, miR-205, miR-133b, and miR-31 in EAC as compared to NS. [score:6]
miR-203 and miR-205 were down-regulated in EAC but not in GC (Table 4, Figure 5). [score:4]
Analysis of clinicopathological features indicated that down-regulation of miR-203 is significantly associated with progression and tumor stages in EAC. [score:4]
The down-regulation of miR-203 was significantly associated with progression and tumor stage in EAC (p [ANOVA] = 0.0006, p [I&II] = 0.054, p [II&III] = 0.002, and p [I&III = ]0.01). [score:4]
On the other hand, miR-133b, miR-200a, miR-205, and miR-203 did not display any significant differential expression between isolated BE and BE adjacent to HGD (Figure 8, Table 5). [score:3]
This finding suggests that miR-203 could be targeting key pathways associated with tumor progression in EAC. [score:3]
We demonstrated an inverse correlation between miR-203 expression levels and EAC progression. [score:3]
The log10 values of fold expression of the 8 miRNAs (miR-192, miR-200a, miR-194, miR-21, miR-203, miR-205, miR-31, and miR-133b) were used for hierarchical clustering. [score:3]
0064463.g007 Figure 7 The expression levels of the 4 miRNAs (miR-203, miR-194, miR-192, and miR-200a) were evaluated in EAC tissue samples of stages I, II and III by means of qRT-PCR. [score:1]
0064463.g003 Figure 3 The expression of 4 miRNAs (miR-205, miR-133b, miR-203, and miR-31) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
The expression of 4 miRNAs (miR-205, miR-133b, miR-203, and miR-31) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
The expression levels of the 4 miRNAs (miR-203, miR-194, miR-192, and miR-200a) were evaluated in EAC tissue samples of stages I, II and III by means of qRT-PCR. [score:1]
0064463.g005 Figure 5The expression levels of the 6 miRNAs (miR-194, miR-192, miR-203, miR-205, miR-200a, and miR-31) were measured by means of qRT-PCR in 13 BE, 34 EAC, 45 NG, and 33 GC tissue samples. [score:1]
miR-194, miR-192, miR-200a, miR-21, miR-203, miR-205, miR-133b, and miR-31 were selected for validation using 46 normal squamous (NS), 23 Barrett’s esophagus (BE), 17 Barrett’s high grade dysplasia (HGD), 34 EAC, 33 gastric adenocarcinoma (GC), and 45 normal gastric (NG) tissues. [score:1]
[1 to 20 of 18 sentences]
34
[+] score: 56
Other miRNAs from this paper: hsa-mir-203b
Since it has been recently reported that 16E5 expression in keratinocytes up-regulates p63 through down-regulation of miR-203 [26], we wondered whether the decrease of p63 observed upon KGFR expression in our cellular mo del could be a consequence of an opposite modulation exerted by the viral protein and the receptor on miR-203. [score:11]
The HPVs, which require for their replication the maintenance of proliferation in differentiating cells, appear to control p63 expression through either E7 or E5 oncoproteins: to do this, both proteins down-regulate the cellular miR-203 [26, 32]. [score:6]
Quantitative real time relative RT-PCR shows that KGFR overexpression does not counteract the down-modulating effect mediated by 16E5 on miR-203 expression level. [score:5]
KGFR expression triggers a miR-203-independent down-modulation of p63 and counteracts the p63 up-modulation consequent to 16E5 expression. [score:5]
KGFR down-regulates p63 through a miR-203 independent mechanism. [score:4]
In agreement with these studies, our findings confirmed that also in our cell mo del E5 enhances the p63 expression down -regulating miR-203. [score:4]
It has been demonstrated that, during differentiation, p63 is specifically down-regulated by miR-203 [28, 29]. [score:4]
The results confirmed that KGFR overexpression was not able to contrast the 16E5 -mediated down-modulation of miR-203 (Fig. 6h), further indicating that the effect of KGFR on p63 (Fig. 6c-f) is not controlled by miR-203. [score:3]
In this scenario, E5 might be able to up-modulate p63 through two independent distict pathways: the first, well established, mediated by miR-203 and the second, miR-203 independent, triggered by down-modulation of KGFR expression and signaling. [score:3]
One of the main molecular mechanisms known to drive the shift from the basal to suprabasal layers of stratified epithelial tissues is the down-modulation of the transcription factor p63, and in particular of its isoform ΔNp63, target of the miR-203 [27]. [score:3]
Quantitative real-time RT-PCR in HaCaT pCI-neo, HaCaT E5 and HaCaT KGFR cells confirmed the down-modulation of miR-203 in cells expressing 16E5 and indicated that this modulation was evident upon differentiation following TG-treatment (Fig. 6g). [score:3]
On the other hand, we found that also KGFR is involved in the balance of p63, inducing a ligand -dependent decrease of p63 transcription, which is regulated by a miR-203 independent mechanism. [score:2]
Finally, the analysis of miR-203 expression level was assessed in KGFR/E5 doubly transfected cells and compared to that observed in E5 singly transfected. [score:2]
However, in HaCaT KGFR cells, miR-203 was not up-modulated, but decreased if compared to control cells (Fig. 6g), indicating that the receptor -mediated down-modulation of p63 (Fig. 6c) is regulated by a miR-203 independent mechanism. [score:1]
[1 to 20 of 14 sentences]
35
[+] score: 55
In addition, miR-203 inhibits proliferation, migration, EMT and tumor angiogenesis in a variety of tumor cells by targeting SNAI2 [91, 92], which in turn suppresses miR-203, forming a double negative feedback loop for the regulation of EMT [92]. [score:8]
Overexpression of miR-203 suppresses the expression of BMI1 and colony formation in esophageal squamous cell carcinoma cell line [90]. [score:7]
Although the number of studies that analyzed the miRNA expression and/or functions in colorectal CSCs is still limited, miRNAs, such as miR-200 family miRNAs, miR-203, miR-137, miR-34a and miR-221, function as the regulator of stem cell properties in colorectal CSCs by targeting various genes involved in the regulation of CSC properties (Figure 2A). [score:7]
Functional validation in CRC cell lines has confirmed that miR-194, miR-200b, miR-203 and miR-429, which share target genes and pathways, have abilities to suppress the stem/serrated/mesenchymal subtype [77]. [score:5]
miR-203 plays important role in stem cell regulation by targeting p63 and/or BMI1. [score:4]
Yu X. Jiang X. Li H. Guo L. Jiang W. Lu S. H. Mir-203 inhibits the proliferation and self-renewal of esophageal cancer stem-like cells by suppressing stem renewal factor bmi-1Stem Cells Dev. [score:4]
miR-203 located on human chromosome 14q32 is a putative tumor suppressor gene. [score:3]
Among them, miR-200bc and miR-203 coordinately suppressed the stem cell properties of colorectal CSCs and normal intestinal stem/progenitor cells. [score:3]
Ding X. Park S. I. McCauley L. K. Wang C. Y. Signaling between transforming growth factor beta (tgf-beta) and transcription factor snai2 represses expression of microRNA miR-203 to promote epithelial-mesenchymal transition and tumor metastasisJ. [score:3]
Marisetty A. L. Singh S. K. Nguyen T. N. Coarfa C. Liu B. Majumder S. Rest represses mir-124 and mir-203 to regulate distinct oncogenic properties of glioblastoma stem cellsNeuro. [score:2]
On the other hand, the EZH2-miR-203-BMI1 regulatory axis functions for the proliferation of neural stem/progenitor cells [87]. [score:2]
Liu P. P. Tang G. B. Xu Y. J. Zeng Y. Q. Zhang S. F. Du H. Z. Teng Z. Q. Liu C. M. miR-203 interplays with polycomb repressive complexes to regulate the proliferation of neural stem/progenitor cellsStem Cell Rep. [score:2]
Coordinated Regulation of miR-200 and miR-203 in Colorectal CSCs. [score:2]
3.1. miR-200b/c and miR-203. [score:1]
3.1.3. miR-203. [score:1]
RE1 silencing transcriptional factor (REST), EZH2 and SNAI1/2 are upstream transcriptional repressors of miR-203 [84, 85, 86, 87]. [score:1]
[1 to 20 of 16 sentences]
36
[+] score: 53
When we inhibited miR-203a-3p in HFKs expressing HPV16 E6/E7 via a locked nucleic acid (LNA) inhibitor, we were able to further decrease miR-203a-3p levels, which resulted in higher TP63 and BMI1 mRNA levels (Fig.  5). [score:7]
Effects of a miR-203a-3p mimic (MIM, green) or an LNA inhibitor (light blue) on TP63 (A) and BMI1 (B) levels in HPV16 E6/E7 -expressing HFKs. [score:5]
Integration of the miR-seq and RNA-seq data revealed 85 potential targets of miR-203a-3p in HPV16 E6/E7 -expressing HFKs. [score:5]
FIG 5  Modulation of miR-203a-3p targets and analysis of miR-203a-3p expression. [score:5]
Using a miR mimic to overexpress miR-203a-3p, we restored miR-203a-3p levels in HPV16 E6/E7 -expressing HFKs and observed decreased TP63 and BMI1 steady-state mRNA levels. [score:5]
Inhibition of miR-203a-3p was accomplished with a miRCURY LNA miR power inhibitor (4100339-101; Exiqon). [score:5]
Chen T, Xu C, Chen J, Ding C, Xu Z, Li C, Zhao J 2015 MicroRNA-203 inhibits cellular proliferation and invasion by targeting Bmi1 in non-small cell lung cancer. [score:4]
Overexpression of miR-203a-3p was achieved with a miRCURY LNA miR mimic (472239-001; Exiqon). [score:3]
One example of a well-studied miR that we validated from our curated list is miR-203a-3p, which is thought to act as a “switch” between epithelial proliferation and differentiation by targeting TP53-related TP63 (37). [score:3]
FIG 2  Validation of selected miRs identified by (A to D) Validation of miR-15b-5p (A), miR-16-5p (B), miR-193b-3p (C), and miR-203a-3p (D) levels in HPV16 E6/E7 -expressing (red) and control vector-transduced (blue) HFKs. [score:3]
The Laimins laboratory first showed that HPVs block the induction of miR-203a-3p during differentiation through E7 -mediated interference of the mitogen-activated protein kinase (MAPK)/protein kinase C pathway and that miR-203a-3p inhibition was necessary for HPV genome amplification upon differentiation, as well as for long-term maintenance of HPV episomes (38). [score:3]
We examined two canonical miR-203a-3p targets, TP63 and BMI1 (40). [score:3]
Our miR-seq and reverse transcription-quantitative PCR (RT-qPCR) data suggest that miR-203a-3p levels are decreased by both HPV16 E6 and E7 (Fig.  5). [score:1]
Taken together, our data show that both HPV16 E6 and E7 function to reduce miR-203a-3p levels. [score:1]
[1 to 20 of 14 sentences]
37
[+] score: 47
Further data indicated that re -expression of miR-203 could inhibit EBV -induced S-phase entry and in vivo transformation via regulating E2F3 [43]. [score:6]
E2F3 and CCNG1 was identified as targets of miR-203 in nasopharyngeal carcinoma (NPC), while latent membrane protein 1 (LMP1) was responsible for downregulation of miR-203 [43]. [score:6]
miR-203 could inhibit glioma cells invasion by target E2F3 [42]. [score:5]
Another report showed that miR-203 was positively correlated with the sensitivity of glioma cells to chemotherapy and re -expression of miR-203 increased glioma cells to temozolomide by targeting E2F3 [42]. [score:5]
The glad news was put forward that miR-203 may function as a tumor suppressor in glioma progression, suggesting that targeting miR-203/E2F3 axis could be a rational therapeutic strategy for glioma [42]. [score:5]
Another study showed that miR-203 expression was also lower in highly invasive glioma cells or tissues and the inverse expression patterns between miR-203 and E2F3 in invasive glioma tissues were verified [42]. [score:5]
During the early stages of EBV latency, miR-203 was observed to be decreased in EBV-infected epithelial cells and EBV -associated NPC, occurring, implying that EBV-LMP1 downregulated miR-203 and ulteriorly controlled E2F3. [score:4]
EBV down-regulated miR-203 through the oncoprotein LMP1, which contributed to higher incidence of tumor in epithelial cells. [score:4]
In malignant melanoma, miR-203 was reported to induce senescence by cell cycle arrest through targeting E2F3 [41]. [score:3]
Meanwhile, E2F3a and E2F3b were testified as targets of miR-203 in human malignant melanoma Mewo cells [41]. [score:3]
Furthermore, EBV-LMP1/miR-203/E2F3 axis may be used as a potential biomarker for the diagnosis and therapeutic agent of EBV -associated NPC [43]. [score:1]
[1 to 20 of 11 sentences]
38
[+] score: 45
miRNA-31 downregulation conferred resistance to radiotherapy and chemotherapy in several types of cancers [37], [38], and downregulation of miRNA-30a [39], miRNA-203 [40], miRNA-183 [41], miRNA-130a [42], miRNA-24 [43] and miRNA-23a [43], and upregulation of miRNA-193b [44] increased tumor cells resistant to chemotherapy. [score:10]
Our results showed that miRNA-23a, miRNA-203, miRNA-31, miRNA-30a, miRNA-183, miRNA-130a, and miRNA-24 were downregulated, and miRNA-193b upregulated in the radioresistant NPC cells, suggesting that deregulation of these miRNAs might be involved in the NPC radioresistance. [score:8]
These results indicated that IL-8 might be a target of miRNA-23a in the NPC tissues, and downregulaion of miRNA-203 and upregulation of IL-8 might be involved in the clinical NPC radioresistance. [score:6]
These results indicated that IL-8 might also be a target of miRNA-23a in the NPC tissues, and downregulaion of miRNA-203 and upregulation of IL-8 might be involved in the clinical NPC radioresistance. [score:6]
In the miRNA-target gene regulatory network, IL-8 was cotargeted by the three miRNAs (miRNA-23a, miRNA-203 and miRNA-660). [score:6]
In the miRNA-gene regulatory network of radioresistant NPC cells, IL-8 was cotargeted by the three down-miRNAs (miRNA-203, miRNA-23a and miRNA-660) (Figure 2, Table 4), which was validated by qRT-PCR analysis (Figure 1C). [score:4]
To test whether miRNA-23a can specifically target IL-8, a dual-luciferase reporter with the 3′UTR of IL-8 (Catalog#, HmiT009678-MT01; GeneCopoeia, USA) and miRNA-203 mimic or mimic control (RiboBio) were cotransfected into the radioresistant NPC CNE2-IR cells using Lipofectamine 2000 as previously described [35]. [score:3]
In this network, ten genes (SOCS6, SMAD2, CDKN2B, PPARGC1A, FOS, FOSL2, IL8, IRS2, JAK1, WDR32) were coregulated by six miRNAs (miRNA-23a, miRNA-24, miRNA-30a, miRNA-545, miRNA-203, miRNA-660) (Figure 2, Table 4). [score:2]
[1 to 20 of 8 sentences]
39
[+] score: 43
Three under-expressed miRNAs (miR-203, miR-885-5p, and miR-320c) were predicted to participate in RNA transport pathway through regulating their potential gene targets. [score:6]
0114627.g004 Figure 4 Three under-expressed miRNAs (miR-203, miR-885-5p, and miR-320c) were predicted to participate in RNA transport pathway through regulating their potential gene targets. [score:6]
Four differentially expressed miRNAs (including miR-203, miR-299-5p, miR-885-5p, and miR-320c) were predicted to participate in Wnt signaling pathway through regulating their potential gene targets. [score:6]
0114627.g005 Figure 5 Four differentially expressed miRNAs (including miR-203, miR-299-5p, miR-885-5p, and miR-320c) were predicted to participate in Wnt signaling pathway through regulating their potential gene targets. [score:6]
0114627.g002 Figure 2. TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
0114627.g003 Figure 3 Four differentially expressed miRNAs (including miR-203, miR-299-5p, miR-885-5p, and miR-320c) were selected as examples for examining miRNA-mRNA relationships in RNA degradation. [score:3]
Nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:3]
nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were further quantitated by TaqMan miRNA assays (Applied Biosystems). [score:2]
Furthermore, we found that let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b were significantly increased in individual exosomal samples from human BMSCs. [score:1]
[1 to 20 of 10 sentences]
40
[+] score: 41
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
iso1 had a more pronounced differential expression (i. e. 2-fold upregulation) than hsa-miR-203 (i. e. 1.6-fold change (35)) in PP versus NN. [score:6]
Taken together, the high abundance and upregulation of 5′-isomiRs of hsa-miR-203 and hsa-miR-142 may indicate their functional roles in inflammatory and hyperproliferative phenotype of psoriatic lesions. [score:4]
hsa-miR-203-3p has been found to target, among many other mRNAs, Δp63 that has multiple functions during skin development (53, 54). [score:4]
One prominent example is hsa-miR-203 in which 5′-isomiRs accumulated to more than 40% reads and were more than 2-fold upregulated in psoriasis. [score:4]
Figure 1. (A) miR-203 hairpin with 5′-isomiRs and the major miRNA expressed in human skin. [score:3]
Remarkably, the 3p arm of miR-203 hairpin carried the most abundant 5′-isomiRs, which ranked the 8th of all major miRNAs and miRNA isoforms expressed in human skin (Table 2). [score:3]
Because miR-203 in mammals has been characterized in skin morphogenesis as a repressor in the suprabasal layers of the epidermis (53, 54), the upregulation of hsa-miR-203. [score:2]
One illustrating example is the hsa-miR-203 hairpin (Figure 1), where the arm abundance of 5′-isomiRs on the 3p arm was more than 40% versus 1.3% on the 5p arm. [score:1]
iso1) versus ∼200 reads from the 5p arm (hsa-miR-203. [score:1]
Interestingly, hsa-miR-203. [score:1]
For example, the abundance of the 5′-isomiRs from miR-203-3p accounted for 45.5% of the total miR-203-3p abundance whereas the abundance of the 5′-isomiRs from let-7a-5p was only 0.61% of the total let-7a-5p abundance. [score:1]
The 3p arm of murine mmu-miR-203 hairpin also had a higher 5′-isomiR arm abundance (34.9%) than the 5p arm (2%) (Supplementary Table S3), suggesting that the mechanism of yielding 5′-isomiRs of miR-203 is conserved in mammals. [score:1]
Given that hsa-miR-203-3p. [score:1]
hsa-miR-203, found in suprabasal layers of the epidermis, limits the proliferative potential of keratinocytes and establishes a well-defined boundary between proliferating and terminally differentiating keratinocytes (53, 54). [score:1]
of 5′-isomiR reads Arm abundance hsa-miR-203 GAAAUGU 3p 8 8,774,451 45.5 hsa-miR-140 CCACAGG 3p 37 1,072,944 39.5 hsa-miR-126 GUACCGU 3p 54 776,502 13.8 hsa-miR-199b ACAGUAG 3p 55 724,009 27.0 hsa-miR-101 UACAGUA 3p 57 662,855 27.3 hsa-miR-10a CCCUGUA 5p 59 661,921 22.7 hsa-miR-143 UGAGAUG 3p 69 619,911 1.8 hsa-miR-378a UGGACUU 3p 71 402,197 6.0 hsa-miR-29a UAGCACC 3p 77 334,605 18.1 hsa-let-7a AGGUAGU 5p 89 269,329 0.6 The arm abundance of a 5′-isomiR is the percentage of all reads mapped to one arm that represents the 5′-isomiR. [score:1]
In light of the function of many miRNAs (e. g. miR-203 and miR-142) in skin and psoriasis, DE 5′-isomiRs (such as miR-203-3p. [score:1]
hsa-miR-203-3p and the most abundant 5′-isomiR, hsa-miR-203-3p. [score:1]
The most prominent example was miR-203-3p. [score:1]
The horizontal color lines indicate the annotated major miR-203 (red), and its less abundant 5′-isomiR, miR-203. [score:1]
Indeed, 39 miRNA hairpins, e. g. the hairpin of miR-203, had high 5′-heterogeneities on the 3p arms but low 5′-heterogeneities on the 5p arms, supporting the previous observation of a higher fi delity of Drosha than Dicer (34). [score:1]
Dominance of a 5′-isomiR on one arm over the other of a miRNA hairpin was prominent, exemplified by the 5′-isomiR of hsa-miR-203 (Figure 1B), where more than 8 million reads were from the 3p arm (hsa-miR-203. [score:1]
This is further illustrated by the two sharp boundaries separating major miR-203 and the flanking reads, indicated by the arrows in Figure 1A and the two vertical lines in Figure 1B. [score:1]
[1 to 20 of 22 sentences]
41
[+] score: 40
Other miRNAs from this paper: hsa-mir-203b
Expression of LASP1 is regulated i) by tumor suppressor p53 on the genomic level as shown for hepatocellular carcinoma [18] and ii) on the protein level by microRNA mir-203 as described for esophageal squamous cell carcinoma [19], breast cancer [20], and PCa [21, 22]. [score:6]
In summary, our results suggest that LASP1 overexpression, most likely mediated by the loss of mir-203 expression, is involved in progression and metastasis of PCa. [score:5]
Relative mir-203 expression values are presented as mean ± SEM. [score:3]
Here, we investigated the LASP1 expression pattern in a large series of surgically treated high-risk PCa samples (n=161) and correlated LASP1 protein levels with mir-203 expression levels in a subset of the same tumors (n=138). [score:3]
qRT-PCR revealed a correlation between high LASP1 protein levels and reduced mir-203 expression in the PCa tissue samples. [score:3]
Expression levels of mir-203 are significantly reduced from BPH over PCa (p=0.006) to LNM (p=0.036) while in return LASP1 protein levels are increased, supporting the hypothesis of LASP1 as a potential marker for aggressive PCa (Figure 5). [score:3]
Figure 5 Reduced mir-203 levels correspond to enhanced LASP1 protein concentrations mir-203 expression was analysed by qRT-PCR. [score:3]
For PCa a significant correlation between high cytosolic LASP1 protein levels (IRS>5) as well as high nuclear LASP1 levels (NUC≥10%) and reduced mir-203 expression is observed (p=0.002 and p=0.038, respectively). [score:3]
LASP1 and mir-203 expression in BPH, PCa and LNM. [score:3]
Reduced mir-203 levels correspond to enhanced LASP1 protein concentrations mir-203 expression was analysed by qRT-PCR. [score:3]
To investigate the role of mir-203 on LASP1 expression in PCa, we assessed the mir-203 levels for a subset of our cohort described in Table 2 (15 BPH, 138 high-risk PCa and 12 corresponding PCa/LNM) by qRT-PCR and matched the RNA data with the LASP1 IRS values determined by IHC (Table 2). [score:1]
Consistently, in several cancer entities such as breast cancer [20], bladder cancer [28], squamous cell carcinoma [19] and now PCa, increased LASP1 protein levels are connected to reduced mir-203 RNA levels and concomitant enhanced cell proliferation and migration. [score:1]
A: Kaplan-Meier plot displaying patients' probability for PSA progress stratified by cytosolic LASP1 positivity (IRS>5) and negativity (IRS<5) B: Kaplan-Meier plot displaying patients' probability for PSA progress stratified by nuclear LASP1 positivity (NUC≥10%) and negativity (NUC<10%) To investigate the role of mir-203 on LASP1 expression in PCa, we assessed the mir-203 levels for a subset of our cohort described in Table 2 (15 BPH, 138 high-risk PCa and 12 corresponding PCa/LNM) by qRT-PCR and matched the RNA data with the LASP1 IRS values determined by IHC (Table 2). [score:1]
mir-203 levels are reduced in prostate cancer. [score:1]
mir-203 - qRT-PCR. [score:1]
[1 to 20 of 15 sentences]
42
[+] score: 39
Other miRNAs from this paper: hsa-mir-205, hsa-mir-203b
miR-203 is expressed at high levels in the suprabasal layers of stratified epithelia, where it targets p63 expression in order to inhibit proliferation and promote differentiation [53]. [score:9]
Supplementary Figure Legends CaSki cells express ΔNp63, not TAp63 and E7-p63 regulatory axis does not involve microRNA-203 Loss of E7 induces cell cycle arrest Gamma irradiation does not induce the expression of TAp63 isoform p63 modulates DDR Loss of p63 induces DDR This work was supported by the funds given to B. S. S. by the UoM and scholarship given to S. E. by King Abdulaziz University, the Kingdom of Saudi Arabia. [score:6]
It has been shown in differentiating human foreskin keratinocytes that expression of HPV-31 E7 down-regulates miR-203, which leads to accumulation of p63 [26]. [score:6]
Coimbra EC Expression profile of microRNA-203 and its deltaNp63 target in cervical carcinogenesis: prospects for cervical cancer screeningAnticancer Res. [score:5]
Interestingly, E7-depletion led to reduced expression of miR-203, suggesting that in HPV-transformed cervical cells, E7-miR-203-p63 axis is not functional (Supplementary Fig.   1Sb). [score:3]
It has been shown in cervical tissues and cervical cancer that miR-203 and p63 co-exist and display a similar expression pattern [54]. [score:3]
As HPV-31 E7 has been shown to inhibit miR-203 expression in keratinocytes [26], we investigated a potential link between E7 and miR-203 in CaSki cells. [score:3]
To investigate the potential contribution of E7-miR-203 axis to p63 expression in CaSki cells, we assessed miR-203 levels in E7 -depleted cells by Q-PCR. [score:1]
Lena AM miR-203 represses ‘stemness’ by repressing DeltaNp63Cell Death Differ. [score:1]
Interestingly, our results showed that E7 depletion led to a decrease in miR-203 levels, rather than an increase as was shown in keratinocytes (Supplementary Fig.   1Sb). [score:1]
For miR-203 detection, TaqMan MicroRNA Reverse Transcription kit and TaqMan universal master mix (Applied Biosystems) were used. [score:1]
[1 to 20 of 11 sentences]
43
[+] score: 35
Other miRNAs from this paper: hsa-mir-3196, hsa-mir-203b
As previously reported, miR-203 targets Kif5b and regulates TYR expression and melanosome transport 32, which may explain the observed effects of exosomes. [score:6]
To further test the impact of these exosome -associated miRNAs on the process of pigmentation, Black and Caucasian ultraviolet B-irradiated keratinocytes were treated with anti-miR-203 or anti-miR-3196, respectively, to specifically downregulate their expressions and subsequent loading into exosomes (Supplementary Fig. 4c,d). [score:6]
Of note, miR-203 was highly expressed in Black exosomes (Fig. 4b), and this miR was recently reported to be a key regulator of melanogenesis in melanoma cells, increasing pigmentation and TYR protein levels 32. [score:4]
MITF-M gene expression was not modified, suggesting that miR-203 may act on TYR regulation independently of the MITF pathway. [score:4]
Similarly, these results reinforce a role of miR-203 in the upregulation of TYR in primary melanocytes in addition to melanoma cells as reported 32 and reveal for the first time a role for miR-3196 in melanogenesis. [score:4]
Our sequencing analysis reveals that miR-203 is overexpressed in exosomes secreted by Black keratinocytes. [score:3]
Pre-miR-203 transfection increased the intracellular melanin content (57.5±17%; Fig. 5d; P<0.01, t-test) and, in contrast to mir-3196, enhanced the expression of TYR (41±6.8%; P<0.01, t-test) and Rab27a (17±4.3%; P<0.01, t-test; Supplementary Fig. 5b). [score:3]
Exosomes from Black keratinocytes transfected with anti-miR-203 did not induce any significant variation as compared with exosomes from NHK transfected with anti-miR-NC (Fig. 4f), suggesting that additional exosome -associated components likely compensate for the lack of miR-203 or can even be expressed differently in these conditions. [score:2]
In sum, our results highlight that keratinocyte exosomes modulate their miRNA content to fine-tune melanocyte pigmentation via different signalling pathways (that is, miR-3196 and MITF -dependent or miR-203 and MITF-independent). [score:1]
Keratinocytes were transfected with anti-miR-203, anti-miR-3196 or anti-miR-NC (as control) and conditioned media were recovered after 48 h to isolate exosomes. [score:1]
Melanocytes were transfected with pre-miR-203, pre-miR-3196 or pre-miR-NC (as control) using Oligofectamine (Invitrogen). [score:1]
[1 to 20 of 11 sentences]
44
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
[1 to 20 of 2 sentences]
45
[+] score: 33
MiR-203 leads to G1 phase cell cycle arrest in laryngeal carcinoma cells by directly targeting survivin and miR-210 targets antiapoptotic Bcl-2 expression and mediates hypoxia -induced neuroblastoma cell apoptosis [52]. [score:8]
We also found 4 miRNAs (miR-10a, miR-203, miR-210, and miR-449b) upregulated and 3 miRNAs downregulated (miR-134, miR-145, and miR-149) in both tDCs and aDCs. [score:7]
We observed that, at 24 h of maturation, 5 miRNAs (miR-10a, miR-203, miR-210, miR-30a, and miR-449b) were upregulated in both tDCs and aDCs compared with iDCs while 3 miRNAs (miR-134, miR-145, and miR-149) were downregulated. [score:6]
Upon maturation, we identified 4 miRNAs (miR-7, miR-9, miR-155, and miR-182) consistently upregulated in aDCs and 4 other miRNAs (miR-17, miR-133b, miR-203, and miR-23b) in tDCs. [score:4]
Upregulated miR-203, miR-210, and miR-449b play a role in cell cycle control and inducting apoptosis. [score:4]
On the other hand, 4 different upregulated miRNAs (miR-17, miR-133b, miR-203, and miR-23b) are more important for tDCs induction than aDCs and iDCs after 6 h of maturation. [score:4]
[1 to 20 of 6 sentences]
46
[+] score: 33
Although Melar-New and Laimins previously reported that miR-203 is constantly repressed by the HR-HPV E7 proteins with subsequent upregulation of ΔNp63 [109], miR-203 downregulation and modest upregulation of p63 were also observed at late time points (96 h) in HaCaT-E5 cells [127], suggesting that the oncogenic roles of both the E7 and the E5 proteins are mediated by miR-203, but the regulation by the HPVE7 oncoprotein could be more important than the regulation by the E5 oncoprotein. [score:12]
In keratinocytes, the p63 family of transcription factors was identified as a primary target of miR-203 action, with ΔNp63 being the primary member expressed in epithelia and negatively regulated by miR-203 [108, 110]. [score:6]
The expression of miR-203 is also significantly reduced in cells where p53 function is compromised or after the degradation of p53 induced by E6, thereby providing more evidence as to how HPV infection could lead to deregulation of proliferation and differentiation in keratinocytes during the development of CC [113]. [score:5]
Otherwise, several downstream targets of p63 were increased in E7 -expressing cells, and their levels were inversely correlated with amounts of miR-203. [score:5]
Moreover, the HR-HPVE7 oncoprotein is the primary viral factor responsible for blocking expression of miR-203, probably by negative regulation of the transcription factor NF κB which has binding sites in the miR-203 promoter region (Figure 2(e)) [109, 112]. [score:4]
miR-203 is a critical molecule for inducing the transition of keratinocytes from a proliferative state in undifferentiated basal cells to a nonproliferative status in differentiated suprabasal cells [108]. [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 31
Upregulation of miR-203 expression inhibited cell migration - similar to siRNA -mediated LASP1 knockdown. [score:9]
In human head and neck squamous cell carcinoma, genetic reconstitution experiments proofed the direct effect of miR-203 on LASP1 (and on SPARC and NUAK1) and suppressed pro-metastatic cell activities [94]. [score:4]
These data indicate that the effect of miR-203 on cell function is mainly mediated by LASP1 downregulation. [score:4]
Another prominent LASP1 regulating miRNA is the tumor suppressor miR-203 [91]. [score:4]
A significant downregulation of miR-203 is also reported in triple -negative breast cancer cell lines. [score:4]
Conversely, up-regulation of LASP1 abrogated the effects induced by miR-203 transfection in these cell lines [95]. [score:4]
MiR-203 is often silenced in different malignancies, such as ESCC [92] and prostate cancer [68, 93], and its expression levels are inversely correlated with those of LASP1 in ESCC [92] and prostate cancer [68, 91]. [score:2]
[1 to 20 of 7 sentences]
48
[+] score: 31
As mentioned above, these miRNAs such as miR-203, miR-204, miR-205 and miR-217 negatively regulate RUNX2 expression, raising a possibility that miRNA -induced down-regulation of RUNX2 contributes to the suppression of malignant properties of pancreatic cancer cells such as drug resistance (Fig. 4). [score:9]
In addition to adipocyte and osteoblast differentiation, Saini et al. revealed that ectopic expression of miR-203 impairs the development of metastasis originated from prostate cancer in association with the down-regulation of pro-metastatic genes such as ZEB2, survivin and RUNX2 [164]. [score:7]
Taipaleenmäki H Browne G Akech J Zustin J van Wijnen AJ Stein JL Hesse E Stein GS Lian JB Targeting of Runx2 by miRNA-135 and miRNA-203 impairs progression of breast cancer and metastatic bone diseaseCancer Res. [score:5]
Recently, Taipaleenmäki et al. showed that malignant phenotypes of breast cancer cells are significantly suppressed by miR-135/miR-203-caused direct reduction of RUNX2. [score:4]
Miao L Xiong X Lin Y Cheng Y Lu J Zhang J Cheng N miR-203 inhibits tumor cell migration and invasion via caveolin-1 in pancreatic cancer cellsOncol Lett. [score:3]
Saini S Majid S Yamamura S Tabatabai L Suh SO Shahryari V Chen Y Deng G Tanaka Y Dahiya R Regulatory Role of mir-203 in Prostate Cancer Progression and MetastasisClin Cancer Res. [score:2]
Notably, miR-203, which prohibits prostate cancer cell metastasis, has also been shown to reduce migration/invasion capacity of pancreatic cancer cells [168]. [score:1]
[1 to 20 of 7 sentences]
49
[+] score: 30
In summary, miR-200c targeted PLCγ1, PKCβII, IKKβ, and MYD88; miR-203 targeted SYK, PKCβII, MYD88, PI3K class I (α/β/δ/γ), and RasGRP3; and miR-31 targeted CD79B, PKCβII, MYD88, and NIK in B cells. [score:7]
RasGRP3, a member of Ras guanyl nucleotide exchange factors, directly affects Ras activity and downstream phosphorylation of Erk and Akt in B cells 34. miR-203 recognized and downregulated RasGRP3 but not other RasGRP at the mRNA and protein levels (Fig. 6). [score:5]
For screening of target genes of the variable miRNAs (miR [3]: miR-200c, miR-203, and miR-31), we expressed each miRNA in SUDHL8 cells and then quantified mRNA incorporated in the miRNA-abundant RISC (Fig. 6a). [score:5]
miR-203 expression led to low Ras activity and resulted in low phosphorylation of Erk1/2 in lymphoma cells (Fig. 7f). [score:3]
miR-203 suppressed SYK at the mRNA and protein levels (Fig. 6). [score:3]
The focal cluster (low expression in lymphoma) included miR-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), miR-203, miR-205, miR-135b, and miR-31. [score:3]
The influence on miRNA function was calculated by luciferase reporter with miR-200c, miR-203, and miR-31 target sequences in 3′UTR (n = 3). [score:1]
The results showed that miR-200c, miR-203, and miR-31 prevented B cell activation (Fig. 5c). [score:1]
Functional loss of miR-200c, miR-203, and miR-31 in DLBCL cells. [score:1]
In particular, miR-200c, miR-203, and miR-31 commonly showed significant effects (Fig. 5b). [score:1]
[1 to 20 of 10 sentences]
50
[+] score: 29
Moreover, it was recently shown that miR-203 expression in keratinocytes is dependent on the regulation of the levels of the tumor suppressor gene p53 [34]. [score:6]
Using this approach, we have shown that miRNA-203 down-regulation is strongly associated with Time to Relapse (Table 4 and Figure 2A). [score:4]
These data suggest that miR-203 could be used as a biomarker for management of disease progression in ependymomas as a predictor for the likelihood of recurrence (Table 4). [score:3]
For miR-203, we observed that lower expression correlated to a trend to develop recurrences (Figure 2B). [score:3]
Finally, aberrant expression of miR-203 was correlated to different clinicopathologic variables in gastric and colorectal cancers [36]. [score:3]
MiR-203 expression was also associated to a worse survival of patients with pancreatic tumors [35]. [score:2]
For example, epigenetic silencing of miR-203 has been implicated in the regulation of the BCR-ABL gene in leukemia [32]. [score:2]
Interestingly, miR-203 also maps to human chromosome 14q32, but to another location (14q32.33). [score:1]
As shown in Figure 2B, all of these miRNAs exhibited statistically significant associations to time to relapse; except miR-203 that showed a trend towards significance. [score:1]
One such miR, miR-203, was identified as an independent marker for tumor relapse even when factoring in the clinicopathologic variables that are currently utilized in the clinics for prediction of clinical behavior. [score:1]
Importantly, miR-203 was identified as an independent factor for Time to Relapse after adjustment for all the known variables (Table 4). [score:1]
MiR-203 is also mapped to human chromosome 14, however it is located at a distance of approximately 3 megabases from the aforementioned imprinted cluster of miRNAs identified in our univariate analyses. [score:1]
Importantly, previous studies have shown the association of miR-203 to human cancers. [score:1]
[1 to 20 of 13 sentences]
51
[+] score: 29
As a result, suppressor of cytokine signalling 3 (SOCS-3), which is involved in immuneand keratinocyte-related functions and also a downstream target of miR203, is shown to be downregulated, thus providing a link between miR203 and keratinocyte dysfunction in psoriasis (29). [score:8]
In psoriatic skin, miR-203, miR-146a and miR-21 were found to be upregulated, but miR-125b displayed reduced expression. [score:6]
Once terminal differentiation has been initiated; miR203 expression is induced via the PKC/ AP-1 pathway (28) which leads to the suppression of p63 and thus halting the proliferative ability of the keratinocytes. [score:5]
Deregulation of miR203 can lead to pathological conditions as reported in psoriatic plaques where miR203 has been observed to be up-regulated. [score:5]
While miR203 may be an important marker for psoriasis and wound re-epithelization (30), its co -expression with other miRNA has also being reported in epidermal pathological conditions such as psoriasis, eczema and atopic dermatitis. [score:3]
For example, miR203 is involved in controlling early commitment of human embryonic stem cells to the keratinocyte lineage (25) and promoting epidermal differentiation and deregulating proliferation by rapidly inducing the cells to exit cell cycle, a hallmark of epidermal differentiation. [score:2]
[1 to 20 of 6 sentences]
52
[+] score: 29
Among them, 5 (namely miR-203a-3p miR-4510, miR-548aa, miR-376b-3p and miR-548v) inhibited GPC3 expression in HCC cells and acted as tumor suppressors in liver by inhibiting HCC cell growth and proliferation. [score:9]
Figure 3Five GPC3 -regulating miRNAs are downregulated in HCC (A) The relative expression of miR-4510, miR-203a-3p, miR-548aa, miR-376b-3p and miR-548v was measured by real-time quantitative RT-PCR in 19 NTL and 98 HCC. [score:5]
Altogether, our data showed that the five GPC3 -regulating miRNAs miR-4510, miR-203a-3p, miR-548aa, miR-376b-3p and miR-548v are significantly downregulated in HCC compared to NTL. [score:4]
However, miR-203a-3p and the control miR-219-5p had no significant inhibitory effect (Figure 2B). [score:3]
Altogether these results demonstrate that miR-4510, miR-203a-3p, miR-548aa, miR-376b-3p and miR-548v are potent inhibitors of HCC cell proliferation. [score:3]
No inverse correlation was observed when we compared expression of other miRNAs (miR-203a-3p, miR-548aa, miR-376b-3p and miR-548v) and the amount of GPC3 mRNA or protein in patient samples (Supplementary Figure 6A-6B). [score:2]
So far, only miR-203a-3p has been described as a mediator of liver carcinogenesis [32]. [score:1]
Instead, miR-4510, miR-203a-3p, miR-548aa, miR-376b-3p and miR-548v were significantly decreased in HCC (Figure 3A-3B). [score:1]
MiR-4510, miR-203a-3p, miR-548aa, miR-376b-3p and miR-548v exert an antitumor effect on HCC cells. [score:1]
[1 to 20 of 9 sentences]
53
[+] score: 29
It has been suggested that methylation of the CpG islands that are associated with miR genes (i. e. miR-203, miR-152, miR-124-1, miR-34b/c, miR-129-2, miR-9-1, miR-130b, miR-124-2, and miR-181c) might inversely correlate with their expression levels [12- 17]. [score:3]
However, a solid relationship between miR methylation and expression has not been thoroughly established as only weak supporting evidence has been provided in many of the previous studies, as we have summarized for 9 tested miR genes/clusters (extragenic miR-9-3, miR-137, miR-200b/200a/429, miR-203, miR-375; intragenic miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210) in this present study (Additional file 1: Table S2) [19- 27]. [score:3]
Thus, CpG islands of 9 disease-related miR genes, including 5 extragenic miR genes or gene clusters (miR-9-3, miR-137, miR-200b/200a/429, miR-203, and miR-375) and 4 intragenic genes or gene clusters (miR-9-1, miR-34b/c, miR-193b/365-1, and miR-210), were selected as the representative genes in the present study (Additional file 1: Table S1). [score:3]
It is reported that expression levels of some miR genes (including intragenic miR-152 and miR-34a/b/c and extragenic miR-203, miR-124-1/124-2, miR-129-2, and miR-181c) inversely correlate with methylation of their corresponding CpG islands [11, 13, 14, 16, 27, 38, 44]. [score:3]
We also observed methylation changes in miR-200b, miR-193b, miR-203, and miR-210 CpG islands in the development of GCs that has not been previously reported. [score:2]
These data imply that miR-375 (and miR-203) methylation is not GC-specific and might be one kind of host adaptation in the non-malignant tissues to the development of GCs. [score:2]
miR-375, miR-203, and miR-193b methylation might be host adaptation to the development of GCs. [score:2]
Therefore, we hypothesize that miR-203 and miR-193b methylation may also be a host adaptation to the development of gastritis or GCs. [score:2]
This implies that miR-203 and miR-375 methylation is not a GC-specific event, but rather a host adaptation to gastric carcinogenesis. [score:1]
Furthermore, methylation of the miR-203 and miR-375 CpG islands might be one kind of host adaptations to gastric carcinogenesis. [score:1]
We observed that the positive rate of miR-203 and miR-193b methylation increased in normal, gastritis, and SM tissues, but decreased in GCs as did miR-375 methylation pattern. [score:1]
In addition, miR-203 and miR-375 methylation increased gradually in gastritis and SM samples, but decreased in GC samples. [score:1]
DHPLC chromatogram of methylated and unmethylated miR-203 in various cell lines. [score:1]
miR-203 and miR-193b methylation has also been reported in hepatomas and prostate cancer, respectively [12, 37]. [score:1]
Elution profiles of miR-9-3, miR-200b, and miR-203 methylation was analyzed with an ultraviolet detector; other miR gene methylation was detected with the post column HSX-3500 Accessory (Transgenomic, Inc. [score:1]
Previous studies have shown that miR-203 methylation drives H. pylori -associated gastric lymphomagenesis [65]. [score:1]
However, correlation between H. pylori infection and miR-203 and miR-193b methylation was not found in any of the gastric tissue samples that were studied. [score:1]
[1 to 20 of 17 sentences]
54
[+] score: 27
ZEB1 can inhibit expression of miR-200c, miR-203 and miR-183, which in turn were shown to target BMI1, a known factor for stem cell renewal. [score:7]
ZEB1 expression results in downregulation of the miR-200 family, miR-203 and miR-183. [score:6]
Regarding other stem cell factors, putative conserved targets of miR-200c comprise KLF4 and SOX2, and p63 is a known target of miR-203. [score:5]
MiR-200c, miR-203 and miR-183 cooperatively inhibit BMI1 expression. [score:5]
MiR-203 inhibits p63 expression. [score:4]
[1 to 20 of 5 sentences]
55
[+] score: 26
Two independent studies found miR-203 to be significantly upregulated in both ALK(+) ALCL cell lines and primary tumors but not expressed in normal T-cells, the ALK(−) ALCL cell line Mac-1 and ALK(−) primary cases [27, 35]. [score:6]
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
Thus, the decreased expression of miR-181a and the increased expression of miR-203 in ALK(+) ALCL might provide a mechanism by which these tumors escape immune surveillance. [score:5]
Furthermore, miR-203 was identified by Steinhilber and colleagues as part of a signature of three miRNA (miR-181a, miR-146b-5p and miR-203) significantly regulated by the C/EBPβ transcription factor, which is specifically overexpressed in ALK(+) ALCL cell lines and shown to promote tumoral cell proliferation and survival (Table 2 and Table 3). [score:4]
In addition, this miRNA is one of the three miRNA (miR-181a, miR-146b-5p and miR-203) regulated by the C/EBPβ transcription factor. [score:2]
Although its function remains elusive, miR-203 seems to play a role in the immune response through the regulation of SOCS-3 [35]. [score:2]
2.2.4. miR-203. [score:1]
[1 to 20 of 7 sentences]
56
[+] score: 26
Other miRNAs from this paper: hsa-mir-218-1, hsa-mir-218-2, hsa-mir-708, hsa-mir-203b
Considering that miRNAs bind to the 3´UTR of survivin mRNA and alter protein translation, the finding of reduced miR-203 expression correlates well with enhanced survivin protein expression and is consistent with a number of studies in cancer cell lines. [score:7]
[22] To confirm that survivin is a direct target of miR-203 in our cellular system, we analyzed the effect of miR-203 on survivin protein expression in SGBS cells, a well-established human preadipocyte cell line. [score:6]
[23] Survivin protein expression was significantly reduced in cells transfected with an miR-203 mimic, whereas an miR-203 inhibitor significantly increased survivin protein levels (Figure 3d). [score:5]
Conditioned medium was collected after 48 h. miR-203a-3p mimic or miR-203a-3p hairpin inhibitor (50 nM) (GE Dharmacon, Chicago, IL, USA) or their respective controls were transfected into SGBS cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). [score:3]
[21] We observed that whereas the expression levels of miR-218 and miR-708 were unchanged between lean- and obese-derived hASCs, the level of miR-203 was significantly decreased in obese-derived hASCs (Figure 3c). [score:3]
Real-time PCR (qPCR) was conducted on a 7900HT Fast Real-Time PCR System using TaqMan Gene Expression Assays (Applied Biosystems) for survivin (Hs 00426651_m1), leptin (Hs00174497_m1) and specific Taqman probes for hsa-miR-203, hsa-miR-218 and hsa-miR-708. [score:2]
[1 to 20 of 6 sentences]
57
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The top negatively correlated (conserved) mouse miRNAs include miR-30a/d (targets Runx2) [57], miR-148a (targets Met/Snail) [58], miR-503 (targets Bcl-2 and Igf1r, implicated in involution) [59], miR-203 (targets the transcription factor p63) [60] and miR-34a (targets Dll1 and CD44, important for stem cell activity) [61, 62]. [score:11]
Many of these are likely to be relevant to lineage restriction in the mammary gland such as miR-203, which is expressed in luminal cells and targets the basal-restricted genes Snai2 and Trp63 [46– 48]. [score:5]
Zhang Z Zhang B Li W Fu L Fu L Zhu Z Epigenetic silencing of miR-203 upregulates SNAI2 and contributes to the invasiveness of malignant breast cancer cellsGenes Cancer. [score:4]
Ding X Park SI McCauley LK Wang CY Signaling between transforming growth factor beta (TGF-beta) and transcription factor SNAI2 represses expression of microRNA miR-203 to promote epithelial-mesenchymal transition and tumor metastasisJ Biol Chem. [score:3]
In the context of miRNAs that potentially control these pathways, we identified several luminal-restricted miRNAs, including miR-10a, miR-200a/b, miR-203, miR-148a. [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 24
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
Examining a specific KEGG pathway by down-regulation of miR-203, miR-204-5p, miR-205-5p, miR-211-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p in melanoma highlighted the mitogen-activated protein kinase (MAPK) signaling pathway. [score:4]
NS; and miR-203, miR-211-5p (and its homologue miR-204-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p were down-regulated in PCM vs. [score:4]
NS libraries; and for miR-203, miR-204-5p (and its homologue, miR-211-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p down-regulated in PCM vs. [score:4]
For example, we noted that the most abundant read counts of isomiRs for miR-205, miR-211, miR-15b, miR-26a, miR-203, let-7i, miR-142, miR-150, miR-146a and miR-451a, 6/10 top miRNAs deregulated in the specimens, were not represented as the abundant forms in miRBase (v18). [score:2]
To elucidate the extent of isomeric differences in melanoma miRNAs, we examined the read counts of isomiRs for miR-205, miR-211, miR-15b, miR-26a, miR-203, let-7i, miR-142, miR-150, miR-146a and miR-451a (Table S7 in file S1). [score:1]
1 (most abundant isomiR of miR451a), let-7i, miR-203 and miR-205 in two independent cohorts: 1) the very same samples that were sequenced (discovery) and 2) additional, independent specimens (validation, n = 101) (Table S2 in file S1). [score:1]
Our previous Sanger sequencing identified 7 of the current top-10 miRNAs: miR-205, miR-211, miR-15b, miR-26a, miR-451a, miR-203 and miR-23b [24]. [score:1]
[1 to 20 of 8 sentences]
59
[+] score: 23
The most important miRNAs and their target DDR genes involved in anticancer drug response are listed in Table 1. In the previous section, we pointed out that miR-203, miR-18a, and miR-31 are all differentially expressed in sensitive and resistant cells. [score:5]
The most important miRNAs and their target DDR genes involved in anticancer drug response are listed in Table 1. In the previous section, we pointed out that miR-203, miR-18a, and miR-31 are all differentially expressed in sensitive and resistant cells. [score:5]
miR-203 regulates a kinase important in the DDR process and ATM expression by binding to its 3′-UTR [24]. [score:4]
miR-203 is upregulated in the oxaliplatin-resistant colorectal cancer cell (CRC) lines HT29, HCT116, and R KO. [score:4]
miR-18a and miR-31, but not miR-203, are both expressed at a higher level in radiosensitive than in radioresistant cells [79, 80]. [score:3]
Zhou Y. Wan G. Spizzo R. Ivan C. Mathur R. Hu X. Ye X. Lu J. Fan F. Xia L. miR-203 induces oxaliplatin resistance in colorectal cancer cells by negatively regulating ATM kinase Mol. [score:2]
[1 to 20 of 6 sentences]
60
[+] score: 23
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a, hsa-mir-203b
The up-regulation of ZEB1 and Snail1 mRNAs correspond to a down-regulation of all miR-200 family members and miR-203 in FGFR2c expressing cells; no changes in the expression of transcription factor mRNAs or miRs are detected in FGFR2b overexpressing cells. [score:13]
Real-time RT-PCR performed in HaCaT cultures grown in complete medium and stably expressing FGFR2 isoforms or the empty vector demonstrated that the expression of FGFR2c is accompanied by a significant increase of Snail1 mRNA and a significant reduction of miR-203, while FGFR2b overexpression did not appear to affect them (Figure 6c, d). [score:7]
The expression profile of miR-203 was also analyzed in parallel, since it has been recently demonstrated that Snail1/miR-203 double negative loop is involved in EMT [34]. [score:3]
[1 to 20 of 3 sentences]
61
[+] score: 22
A tumor-suppressive miRNA, miRNA-203, is frequently downregulated in bladder cancer. [score:6]
Nevertheless, curcumin increases miR-203′s expression and then inhibits cancer cell growth to achieve its antitumor activity. [score:5]
For example, the expression of a tumor-suppressive miRNA, miR-203 is rather low in bladder cancer. [score:5]
Similarly, miR-203 is a tumor suppressor and it is inactive due to the hypermethylation of its promoter in bladder cancer cells. [score:3]
However, miR-203 expression can be augmented by curcumin with partial demethylation of its promoter [13]. [score:3]
[1 to 20 of 5 sentences]
62
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Hur et al. reported that serum miR-203 levels were significantly upregulated in a stage -dependent manner, and also that the strong expression of miR-203 was associated with poor survival in patients with CRC [81]. [score:6]
Low expression of serum miR-203 correlated with poor disease-free survival and OS. [score:5]
A multivariate analysis identified low serum miR-203 expression as an independent predictive marker for metastasis such as nodal, peritoneal, and distant metastases and a poor prognosis GC patients [79]. [score:3]
Imaoka et al. found that miR-203 expression in serum were significantly lower in stage IV than in stage I–III of GC patients [79]. [score:3]
Serum miR-203 expression was significantly lower in GC patients with worse malignant potential such as a higher T stage, vessel invasion, and nodal, peritoneal, and distant metastases. [score:3]
Moreover, increased miR-203 serum levels indicated a high risk for a poor prognosis, as well as metastasis to the lymph nodes, liver, and peritoneum [81]. [score:1]
[1 to 20 of 6 sentences]
63
[+] score: 21
The aims of the study were to 1) Determine the expression of miRNAs known to be differentially expressed between normal squamous and Barrett’s oesophagus mucosa (miR-203, 205, 143, 145, 194 and 215) in oesophageal squamous mucosa from individuals with ulcerative oesophagitis; 2) Assess the location of miRNA accumulation within the oesophageal epithelium; 3) Assess the role of these miRNAs in regulating proliferation and apoptosis, processes that contribute to tissue restoration in reflux-damaged mucosa. [score:6]
miR-203 and miR-205 are expressed at higher levels in squamous mucosa, and miR-143, miR-145, miR-194 and miR-215 are expressed at higher levels in Barrett’s oesophagus. [score:5]
Previous work from our laboratory which compared normal squamous oesophageal mucosa with Barrett’s oesophagus showed increased expression of miR-21, miR-143, miR-145, miR-194 and miR-215, and decreased expression of miR-203 and miR-205 in Barrett’s oesophagus. [score:4]
There were no significant differences between the 2 groups of squamous mucosae for the expression of miR-21, miR-194, miR-203 and miR-215. [score:3]
In this study we hypothesised that miR-203, 205, 143, 145, 194 and 215 expression might be altered in esophageal squamous mucosa in response to chronic gastro-oesophageal reflux. [score:3]
[1 to 20 of 5 sentences]
64
[+] score: 20
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-210, hsa-mir-203b
Moreover, HERV-K mRNA expression was significantly inversely associated with BCL2 mRNA expression (r [S] = -0.408; p = 0.0002) and miR-199a (r [S] = 0.361; p = 0.0004) expression, while solely HERV-F expression was significantly associated with miR-203 expression (r [S] = 0.333; p = 0.005). [score:11]
Furthermore, as a secondary end point we analyzed the correlation of the mRNA expression of HERV-K and HERV-F with the RNA expression of known apoptosis-related [B-cell cll/lymphoma 2 (BCL2)] or hypoxia-related (miR-210, miR-199a, Hypoxia inducible factor 1a) genes as well as known epigenetically regulated genes (miR-203, H2A. [score:6]
Expression analyses for BCL2 mRNA, miR-203 and miR-210 (Greither et al., 2012), HIF-1α mRNA (Kessler et al., 2010) and miR-199a (Keßler et al., 2016) were carried out as previously described. [score:3]
[1 to 20 of 3 sentences]
65
[+] score: 20
Craig et al. reported the strong downregulation of the putative tumor suppressor miRNA, miR-203, in human MALT lymphoma samples, which results from extensive promoter hypermethylation of the miR-203 locus and coincides with the deregulation of its target, ABL1. [score:9]
Treatment of lymphoma B cells with demethylating agents leads to increased miR-203 expression and concomitant downregulation of ABL1, confirming the effectiveness of epigenetic regulation of this miRNA. [score:7]
These results show that the transformation from gastritis to MALT lymphoma is epigenetically regulated by miR-203 promoter methylation and identifies ABL1 as a novel target for treatment [31]. [score:4]
[1 to 20 of 3 sentences]
66
[+] score: 19
CUR has been shown to induce the expression of the tumor suppressive miR-203 in bladder cancer. [score:5]
AKT2 and SRC have been determined to be targets of miR-203 in bladder cancer and their expression was decreased after CUR treatment [105]. [score:5]
Experimentally -induced miR-203 expression resulted in cisplatin-sensitivity. [score:3]
BBR induced miR-203 expression. [score:3]
Normally miR-203 is repressed in bladder cancer perhaps due to hypermethylation of its promoter region. [score:1]
CUR could induce the demethylation of the miR-203 promoter region in bladder cancer cell lines. [score:1]
miR-203 bound the 3-UTR of BCL-W [260]. [score:1]
[1 to 20 of 7 sentences]
67
[+] score: 19
The ectopic expression of miR-203 under control of the K14 promoter directly inhibits p63 expression and results in the aberrant expression of K10 in the epidermal basal layer. [score:10]
Among them, miR-203 has been shown to promote epidermal differentiation in vivo and keratinocyte differentiation in vitro by restricting proliferative potential and inducing cell cycle exit through one of its important targets, p63 [20]– [22]. [score:3]
In addition to miR-203, miR-302 and miR-92 have recently been reported to repress p63 expression in other tissues [23], [24]. [score:3]
In particular, miR-203 has been shown to promote epidermal differentiation by directly repressing p63 [20]. [score:2]
Therefore, miRNAs acting upstream of p63, such as miR-203, play an important role in epidermal differentiation. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 19
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. [score:5]
[1 to 20 of 3 sentences]
69
[+] score: 19
Other down-regulated miRNAs included miR-99a, which is deleted in the lung cancer cell line MA17 [34] and in serous ovarian cancer [33] and miR-203 whose gene is deleted in nasopharyngeal carcinoma [35] and is down-regulated in cervical cancer [18]. [score:7]
At least eight miRNAs showed significant down-regulation between normal cervical samples and the pre-neoplasic and neoplasic samples, namely miR-143, miR-145, miR-99a, miR-26a, miR-203, miR-513, miR-29a and miR-199a. [score:4]
By contrast, only two of the miRNAs, miR-149 and miR-203 showed significant down-regulation [18]. [score:4]
Eight miRNAs exhibited relative decreased expression with transition from normal cervix to atypical dysplasia to cancer (miR-26a, miR-143, miR-145, miR-99a, miR-203, miR-513, miR-29a, miR-199a) (Figure 4A). [score:3]
ERK/MAPK signaling (miR-203), PTEN signaling (miR-27a), VEGF signalling (miR-10a), p53 signaling (miR-205) and apoptosis signalling (miR-512-3p) were found once (Table 2 and table S3). [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 18
miR-34-5p (B), miR-410-3p (C), miR-449-5p (D) and miR-203 (E) expression, determined by Real-time PCR, was down-regulated in HPCx tumor tissues from gemcitabine -treated mice (p < 0.05). [score:6]
Thus, we identified potential miRNAs related to gemcitabine resistance in a human pancreatic cancer xenograft (HPCx) with miRNA microarray analysis and showed that miR-34-5p, miR-410-3p, miR-449-5p and miR-203 were significantly down-regulated in HPCx tumor tissues from gemcitabine -treated mice. [score:4]
Real-time PCR confirmed that miR-34-5p (Figure 1B), miR-410-3p (Figure 1C), miR-449-5p (Figure 1D) and miR-203 (Figure 1E) were down-regulated in HPCx tumor tissues from gemcitabine -treated mice (P < 0.05). [score:4]
Real-time PCR was used to detect the expression levels of miR-34-5p, miR-410-3p, miR-449-5p, miR-203, HMGB1, ARFIP1, GRIA2, CPEB4, NDFIP2, KLF6, PARG, OTX2, TMEFF2, TRPC1 and KLHL5. [score:3]
In contrast, the chemoresistance to gemcitabine was merely slightly repressed in human PDAC cells treated with miR-34-5p or miR-203 mimics (Supplementary Figure 2). [score:1]
[1 to 20 of 5 sentences]
71
[+] score: 17
miR-203 targeted SNAI2 [69], and SNAI2 directly bound to the miR-203 promoter to inhibit its transcription. [score:6]
Therefore, miR-203 also formed a double -negative feedback loop with SNAI2 in which each inhibited the other’s expression, thereby controlling EMT [70]. [score:5]
Furthermore, MiR-17-3p [88], as well as miR-124 and miR-203 [89], repressed vimentin expression by targeting its 3′UTR. [score:5]
Meanwhile, miR-203 repressed endogenous SNAI1, forming a double -negative miR203/SNAI1 feedback loop [68]. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Some miRNAs, miR-203 and miR-451, inhibit ABL and BCR-ABL expression directly [40]. [score:6]
The potential targets of the miRNAs listed above are c-IAP-1 and MCL1, which are important for tumor cell survival following treatment, while miR-23a, miR-30a, miR-30e, miR-203, miR-320 and miR424 are known to target BCR-ABL [48– 52]. [score:5]
In addition, increased expression of miR-212, miR-25 and/or miR-203 has been associated with a favorable overall survival, event-free and relapse-free survival in AML patients independent of cytogenetic subtypes [65, 116– 118]. [score:3]
The most frequently deregulated miRNAs in chronic myeloid leukemia include miR-10a, miR-17/92, miR-150, miR-203, and miR-328 [36]. [score:2]
Consistent with this notion, miR-203 is frequently silenced by monoallelic loss and hypermethylation of the remaining allele [41]. [score:1]
[1 to 20 of 5 sentences]
73
[+] score: 17
Other miRNAs from this paper: hsa-mir-31, hsa-mir-203b
In another HWS sample without inhibitor the reference gene 48u was detected, and in two of the 5 HWS samples with inhibitor miR-203 could be detected. [score:5]
Looking at tissue samples, we have shown another micro -RNA, miR-203, which is expressed only in keratinocytes (10, 11), to be over expressed in OLP lesions compared to healthy controls (12). [score:4]
Of the 15 samples analyzed in Part 2, both miR-203 and 48u could be detected in duplicate in three tissue samples previously analyzed (12) and one HWS sample where no saliva inhibitor had been added. [score:3]
As a control for the PCR reaction 5 cDNA samples from tissue previously analyzed for expression of miR-203 (12) were included (Fig. 1, Part 2). [score:3]
-Bio-Rad iQ5 (RT/PCR) As shown in figure 2 both miR-203 and the reference gene 48u could be detectedin 4 out of the 15 analyzedsamples. [score:1]
Figure 2 from Part 2 displaying results (CƬ-Mean) from the RT/PCR analysis of miR-203 and the refe-rence gene 48u. [score:1]
[1 to 20 of 6 sentences]
74
[+] score: 17
In a mo del system mimicking physiological conditions, this investigation has found that brown propolis exerts anti-inflammatory activity through an epigenetic mechanism of action, being able to increase the expression levels of miR-19a-3p and miR-203a-3p, downregulate mRNA coding for TNF-α and downregulate TNF-α itself—a well-known proinflammatory cytokine involved in the initiation and propagation phases of inflammatory response—by the induction of Nuclear Factor kB (NF-kB), which is in turn involved in many biological processes, such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis [31]. [score:7]
The results indicated that miR-19a-3p and miR-203a-3p, which target mRNA coding for TNF-α, were significantly upregulated by propolis. [score:6]
Green propolis did not induce any significant changes in the expression level of miR-203a-3p (data not shown). [score:3]
For miR-19a-3p and miR-203a-3p, we investigated changes in the expression levels of mRNA coding for TNF-α. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 16
During the whole time course of the mo del, PXN is a potential target of several downregulated (mmu-miR-203, -218, -30b, -30c, -27a and -21) and upregulated (mmu-miR-20b, -466g, -30d and -145) miRNAs. [score:9]
At ST, a decrease in mmu-miR-203 and -1 expression is expected to induce the upregulation of MMP-24 and TIMP-3 (Figure 9). [score:6]
It is of interest that a large number of modulated miRNAs were pointed out to interact with SRC (mmu-miR-197 and -230), CRK and CRKL (mmu-miR-203, -497, -218, -320, -214, -328), and various MAPKs (4 miRNAs for MAPK1, 3, 8 and 14; 7 miRNAs for MAPK9; 13 miRNAs for MAPK7; see Tables S5- S10 for details). [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 16
Upregulation of miR-203, as in our CRC data, has been shown to inhibit proliferation and metastasis in CRC. [score:6]
Differential expression of PRKCB was inversely associated with differential expression of miR-203a. [score:5]
Other direct biological associations were observed between MEF2C and miR-193b-3p and miR-203a, downstream of p38. [score:2]
Thirteen of the miRNAs:mRNA seed region matches (MEF2C with miR-203a; TGFBR1 with miR-2117 and miR-6071; DUSP4 with miR-193b-3p; PDGFRA with miR-17-5p, miR-19b-3p, miR-203a, miR-20a-5p, miR-20b-5p, miR-29b-3p, miR-501-3p; RASGRP3 with miR-429; and PRKCB and miR-203a) were inversely associated suggesting a greater likelihood of a direct effect between the miRNA and mRNA. [score:2]
PDGFRA was inversely associated with 7 miRNAs, 5 of which were in the miR17-92 cluster as well as with miR-203a and miR-501-3p. [score:1]
[1 to 20 of 5 sentences]
77
[+] score: 16
Recently, Zhou et al. showed that miR-203 played an important role in promoting the apoptosis and inhibiting the cell proliferation of lung cancer by downregulating LIN28B and upregulating let-7 biogenesis. [score:9]
Zhou Y. Liang H. Liao Z. Wang Y. Hu X. Chen X. Xu L. Hu Z. miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancerSci. [score:5]
Their results demonstrate a novel regulatory network among miR-203, LIN28B, and let-7 in lung cancer [63]. [score:2]
[1 to 20 of 3 sentences]
78
[+] score: 16
Regarding the number of target mRNAs; miR-944, miR-141-3p, and miR-203a ranked top three among down-regulated miRNAs, while miR-140-3p, miR-452-5p, and miR-137 located top three of up-regulated miRNAs (Figure 1). [score:9]
Consistent with previous reports [10, 11], miR-10b-5p (miR-10b) and miR-224 were overexpressed, miR-200c-3p (miR-200c) and miR-141-3p (miR-141) were significantly reduced in NSCLC cell lines, and our laboratory also reported reduced expression of miR-129-1-3p and miR-203a in the NSCLC sample [12, 13]. [score:5]
Lin Q. -H. Zhang K. -D. Duan H. -X. Liu M. -X. Wei W. -L. Cao Y. ERGIC3, which is regulated by miR-203a, is a potential biomarker for non-small cell lung cancer Cancer Sci. [score:2]
[1 to 20 of 3 sentences]
79
[+] score: 15
Shi L. Xin Q. Chai R. Liu L. Ma Z. Ectopic expressed miR-203 contributes to chronic obstructive pulmonary disease via targeting TAK1 and PIK3CA Int. [score:7]
For example, miR-203, miR-205, and miR-223 are upregulated in patients with gastric cancer who consume alcohol regularly [70]. [score:4]
It has been suggested that miR-203 contributes to the development of COPD through the repression of nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) signaling by targeting TAK1 and PI3KCA and that this miRNA can be used as a new biomarker for COPD diagnosis. [score:4]
[1 to 20 of 3 sentences]
80
[+] score: 15
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-122, hsa-mir-203b
LMP1 upregulates miR-29b to suppress TCL1 oncogene expression, [125] but downregulates miR-203 to increase E2F transcription factor 3 (E2F3) and cyclin G1 expression [126] and miR-15a to promote MYB and cyclin D1 expression. [score:15]
[1 to 20 of 1 sentences]
81
[+] score: 15
Other miRNAs from this paper: hsa-mir-10a, hsa-mir-10b, hsa-mir-146a, hsa-mir-146b, hsa-mir-203b
Transfection of KCs with miR-146b significantly suppressed ACKR2 mRNA expression; however, miR-10b and miR-203 had no significant effects on ACKR2 transcript levels (Fig. 2 b). [score:5]
27. b, three microRNAs (miR-10, miR-146, and miR-203) are predicted to bind the ACKR2 3′-UTR and are differentially expressed in psoriasis. [score:3]
Primo M. N., Bak R. O., Schibler B., and Mikkelsen J. G. (2012) Regulation of pro-inflammatory cytokines TNFα and IL24 by microRNA-203 in primary keratinocytes. [score:2]
miR-10, miR-146, and miR-203 are all differentially regulated in psoriasis (27, 37). [score:2]
d, absolute quantification of ACKR2 transcripts following transfection of LECs with miR-10 (i), miR-146b (ii), and miR-203 (iii). [score:1]
b, absolute quantification of ACKR2 transcripts following transfection of KCs with miR-146b (i), miR-10 (ii), and miR-203 (iii). [score:1]
In this way, we identified three microRNAs that were present in both lists, miR-10, miR-146, and miR-203. [score:1]
[1 to 20 of 7 sentences]
82
[+] score: 15
When miRNAs such as miR-31 and miR-203 were down-regulated in NEC tissues, they could potentiate the upsurge of proinflammatory signals mediated by TLR4, key transcription factor NFκB, hypoxia/oxidative regulators HIF1A and PTGS2, inflammatory cytokines and chemokines TNF and IL8, as well as angiogenic factor HBEGF, resulting in extensive mucosal injury (Fig 3). [score:5]
For example, miR-203 could target myd88 in macrophages against LPS or bacterial infection [24]. [score:3]
A proposed network of dysregulated miRNA/mRNA pairs in NEC suggested interaction at bacterial receptor TLR4 (miR-31, miR-451, miR-203, miR-4793-3p), mediated via key transcription factors NFKB2 (miR-203), AP-1 /FOSL1 (miR-194-3p), FOXA1 (miR-21-3p, miR-431 and miR-1290) and HIF1A (miR-31), and extended downstream to pathways of angiogenesis, arginine metabolism, cell adhesion and chemotaxis, extracellular matrix remo deling, hypoxia/oxidative stress, inflammation and muscle contraction. [score:2]
More importantly, other dysregulated miRNAs observed in our study, such as miR-451, miR-1290, miR-4725-3p, miR-4793-3p, miR-431 and miR-203, have not been previously reported in other inflammatory intestinal conditions. [score:2]
If proven effective at multiple hierarchies of the inflammatory cascade, specific miRNAs such as miR-31, miR-203 or miR-194-3p, could be developed for treatment to dampen the exaggerated immunologic response that contributes to the pathophysiology of NEC. [score:1]
Levels of 15 miRNAs: miR-223, miR-1290, miR-4725-3p, miR-4793-3p, miR-410, miR-187, miR-375, miR-203, miR-200b-5p, miR-194-3p, miR-200a, miR-215, miR-31, miR-192-3p and miR-141 were significantly different between NEC and SIP tissues (0.12–59.05 fold; Table 2). [score:1]
Interestingly, we identified miRNAs that could exhibit multiple interacting points at the upstream receptor and transcription factors as well as downstream effector genes e. g., miR-31 (TLR4, HIF1A, HBEGF), miR-194-3p (AP-1 /FOSL1, MMP9, TIMP1), miR-203 (TLR4, NFKB2, HBEGF, IL8, TNF, PTGS2), miR-1290 (FOXA1, THBS1) and miR-200b-5p (SOD2, FLT1). [score:1]
[1 to 20 of 7 sentences]
83
[+] score: 15
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
Moreover, miR-124 and miR-203 have been shown to be upregulated upon terminal differentiation in neurons and keratinocytes, respectively [33, 34]. [score:4]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 4 sentences]
84
[+] score: 15
Ten of these miRNAs had seed-region matches and six of these miRNAs, miR-150-5p, miR-196b-5p, miR-203a, miR-20b-5p, miR-501-3p, and miR-92a-3p, had negative beta coefficients between differentially expressed miRNA and mRNA, suggesting a greater likelihood for direct binding that would alter the gene expression. [score:6]
BCL2 was directly associated through seed-region match to miR-203a, which could also result in decreased expression of BCL2, which would activate the intrinsic apoptosis pathway. [score:4]
Several miRNAs, including miR-124 [2], miR-195 [3], miR-148a [4], miR-365 [5], miR-125b [6], miR-129 [7], miR-143 [8], and miR-203 [9], have been linked to apoptosis through regulation of genes such as BCL2 and PUMA, a member of the Bcl-2 family, involved in pro-apoptosis [1, 4, 6, 8, 9]. [score:2]
MiR-20b-5p and miR-501-3p were associated with CTSS, miR-92a-5p was associated with CSF2RB, and miR-203a was inversely associated with BCL2. [score:1]
Other genes and miRNA pairs that had both a seed-region match and a negative beta coefficient were TNFRSF10 with miR-196b-5p, CASP7 with miR-29b-3p, and BCL2 with miR-203a. [score:1]
Others have identified miR-203 as being associated with survivin [35], although we did not observe this association we did note that there was a seed-region match between miR-203b-5p and BIRC5. [score:1]
[1 to 20 of 6 sentences]
85
[+] score: 15
Other miRNAs from this paper: mmu-mir-203, mmu-mir-204, hsa-mir-204, hsa-mir-203b
In further support of its pro-tumorigenic properties, Sam68 overexpression may drive tumor progression by downregulating tumor suppressive miRNAs, including miR-203 and miR-204 [13, 16]. [score:8]
In some cancers, high expression of Sam68 correlates with low expression of certain miRNAs shown to target Sam68, such as in the case of miR-203 and miR-204 observed in neuroblastoma and breast cancer, respectively [13, 16]. [score:7]
[1 to 20 of 2 sentences]
86
[+] score: 15
Other miRNAs from this paper: hsa-mir-132, hsa-mir-203b
Considering that AHR inhibits pro-inflammatory cytokines production such as IL-6 and TNF-α in LPS-stimulated macrophages as similarly to miR-203, miR-203 may also be involved in AHR -mediated regulation of inflammatory responses in macrophages. [score:4]
In addition, it has been reported that miR-203 in macrophage RAW264.7 cells negatively regulates LPS -induced IL-6 and TNF-α by targeting MyD88 (82). [score:4]
10.1039/c3tx50083g 82 Wei J Huang X Zhang Z Jia W Zhao Z Zhang Y MyD88 as a target of microRNA-203 in regulation of lipopolysaccharide or Bacille Calmette-Guerin induced inflammatory response of macrophage RAW264.7 cells. [score:4]
Induced IDO mRNA may be controlled by miR-203 (not investigated), and the activity or amount of IDO protein is regulated at post-translational modification such as nitration of Tyr and ubiquitin ligation. [score:2]
For example, miR-203 has a putative binding site in the 3′UTR of IDO in mouse. [score:1]
[1 to 20 of 5 sentences]
87
[+] score: 14
For example, miR-200a and miR-200c were upregulated in all subtypes (mucinous, endometrioid, and clear cells), miR-200b and miR-141 were upregulated in serous as well as endometrioid carcinomas, and miR-21, miR-203, and miR-205 were upregulated only in endometrioid carcinomas. [score:10]
Iorio et al. (2007) showed that 11 miRNAs, including miR-21, miR-203, miR-146b, miR-205, miR-30-5p, and miR-30c as the most significantly induced, are differentially expressed after treatment with the demethylating agent 5-AZA. [score:3]
Twelve miRNAs were present at a higher proportion in malignant cells (es: mir-155, -29), while 31 were present at elevated levels exclusively in exosomes (es: miR-203, -205). [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 14
However, we did not observe an exact correlation since p27 protein levels increase until Day 6, before decreasing, where we might have expected the increasing levels of miR-24 to result in decreased p27 levels from Day 0 to Day 9. However, we had noted a similar delayed response during differentiation between miR-203 and its target p63 (McKenna et al., 2010), so we suggest that miR-24 may still contribute to the control of p27 levels during HFK differentiation, although other mechanisms are likely to also play a role and presumably override the regulation of p27 by miR-24 during the early period of differentiation. [score:4]
In our previous study of miR-203 expression in HFKs, we had demonstrated that miR-205 levels were not significantly altered by knockdown of p53 levels (McKenna et al., 2010). [score:4]
This is a similar finding to that which we had previously observed for miR-203 (McKenna et al., 2010) and is further evidence that HPV infection of cells can disrupt miRNA expression. [score:3]
We have previously reported that miR-203 expression in human foreskin keratinocytes (HFKs) is mediated by E6 activity through degradation of p53 (McKenna et al., 2010), and we concluded that it was likely that other miRNAs were similarly affected. [score:3]
[1 to 20 of 4 sentences]
89
[+] score: 14
[24] MiR-146 is upregulated in monocytes in response to LPS and downregulates genes involved in the signal transduction pathway of TLR4 signaling,[15] and miR-203 is enhanced in skin of patients with psoriasis. [score:7]
Based on these results, antagomirs were created against the top-4 upregulated miRNAs in this colitis-transfer mo del (miR-142-5p, miR-146b, miR-203, and miR-223; experiment #2). [score:4]
Several miRNAs were induced in the colon during colitis development, most significantly miR-223, miR-142-5p, miR-146B and miR-203. [score:2]
no cell transfer vehi