sort by

227 publications mentioning hsa-mir-196a-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-196a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 361
Other miRNAs from this paper: hsa-mir-196a-1
In this study, we identify HOXA5 as a direct target of miR-196a, and demonstrate that upregulation of miR-196a significantly reduces HOXA5 expression at both transcriptional and protein level in NSCLC cells. [score:9]
First, we demonstrated that targeted knock-down of miR-196a expression in SPC-A1 cells led to significant inhibition of cell proliferation, migration and invasion. [score:8]
Our findings indicate that miR-196a is significantly up-regulated in NSCLC tissues, and regulates NSCLC cell proliferation, migration and invasion, partially via the down-regulation of HOXA5. [score:8]
Furthermore, bivariate correlation analysis revealed that low expression of HOXA5 was more likely correlated with high levels of miR-196a (Figure 6F), suggesting that the downregulation of HOXA5 may be due to enhanced miR-196a expression in NSCLC. [score:8]
To selectively down-regulate or over-express miR-196a, miR-196a inhibitors or mature miR-196a mimics and their corresponding negative controls (anti-miR-NC or miR-NC, respectively) were transiently transfected into SPC-A1 or A549 cells. [score:8]
In previous studies from our group, we reported that aberrant over -expression of miR-196a and the resultant down-regulation of its target p27kip1, contributes to gastric carcinogenesis [11]. [score:8]
These data indicate that down-regulation of HOXA5 expression promotes NSCLC cell proliferation, migration and invasion, phenocopying the over -expression of miR-196a in A549 cells. [score:8]
Additionally, western blot analysis showed that HOXA5 protein expression was clearly up-regulated following transfection of SPC-A1 cells with miR-196a inhibitors. [score:8]
To verify whether these genes were direct targets of miR-196a, the wild-type 3’ untranslated region (UTR) of HOXA5 and FOXO1 were fused directly downstream of the firefly luciferase gene (pLuc). [score:7]
In esophageal cancer, miR-196a over -expression promotes cell proliferation, anchorage-independent growth and suppresses apoptosis by directly regulating ANXA1 [16]. [score:7]
Our analysis showed that miR-196a suppressed the expression of HOXA5 both at the mRNA and protein levels, and luciferase assays confirmed that miR-196a directly bound to the 3’untranslated region of HOXA5. [score:7]
As miR-196a was over-expressed in NSCLC and targeted HOXA5 by binding to its 3’UTR, we next determined whether HOXA5 expression was negatively associated with miR-196a levels in primary NSCLC patient tissues. [score:7]
Our results reveal that inhibition of HOXA5 expression in A549 cells significantly promotes cell proliferation, migration and invasion, consistent with the results of ectopic miR-196a expression in the same cells. [score:7]
Therefore, the observed miR-196a -mediated inhibition of cell growth and invasion is likely due to simultaneous targeting of multiple targets in NSCLC. [score:7]
Downregulation of HOXA5 is inversely correlated with miR-196a expression in NSCLC. [score:6]
Furthermore, analysis of the correlation of miR-196a expression with clinical pathological features of NSCLC patients, revealed a significant association between miR-196a up-regulation and advanced pathological stage (I/II, n = 20) vs (III/IV, n = 14) and NSCLC lymph-node metastasis (Figure 1A). [score:6]
In summary, we demonstrate that miR-196a over -expression is a common event underlying NSCLC, and may function as an oncogene by directly targeting HOXA5. [score:6]
miR-196a expression is up-regulated in human NSCLC tissues. [score:6]
To explore the molecular mechanism by which miR-196a contributes to the proliferation and invasion of NSCLC cells, we searched for potential targets as predicted by commonly cited programs such as TargetScan, PicTar and miRanda. [score:5]
miR-196a expression was significantly up-regulated in cancerous tissues (median ratio of 22.9-fold, p < 0.01) compared with corresponding normal tissues. [score:5]
To determine whether apoptosis was a contributing factor to cell growth inhibition, we performed Hochest staining and flow-cytometric analysis of SPC-A1 cells after transfection with miR-196a inhibitors. [score:5]
Taken together, these results indicate that inhibition of miR-196a suppresses cell growth, but is not associated with induction of apoptosis. [score:5]
In addition, enforced expression of miR-196a in A549 cells triggered a significant silencing effect on endogenous HOXA5 expression, both at the mRNA and protein level. [score:5]
We also analyzed miRNA expression profiles in NSCLC patient tissues by miRNA microarray, and identified miR-196a as the most highly up-regulated miRNA compared with corresponding normal tissues [12]. [score:5]
qRT-PCR analysis of miR-196a levels was performed 48 h post-transfection, and revealed that miR-196a expression was reduced 0.52-fold following transfection with miR-196a inhibitors and increased 24.7-fold after transfection with miR-196a mimics. [score:5]
Furthermore, an increasing number of reports indicate that miR-196a plays important roles in development, immunity and tumor pathogenesis via the targeting of specific genes [13- 17]. [score:4]
Figure 5 miR-196a directly targets the HOXA5 gene. [score:4]
These results indicate that over -expression of miR-196a may play an important role in NSCLC progression and development. [score:4]
We also show that miR-196a may function as an oncogene by directly targeting HOXA5. [score:4]
To assess the biological role of miR-196a in NSCLC, we investigated the effect of targeted knockdown or overexpression of miR-196a on cell proliferation and apoptosis. [score:4]
qRT-PCR analysis revealed that inhibition of miR-196a in SPC-A1 cells led to increased expression of endogenous HOXA5 mRNA compared with control. [score:4]
Consistent with our previous microarray analysis, miR-196a was dramatically upregulated in NSCLC tissues. [score:4]
HOXA5 is a direct target of miR-196a. [score:4]
Of these, four cell lines (SPC-A1, NCI-H1650, NCI-H1299 and SK-MES-1) expressed higher levels of miR-196a compared with the normal, bronchial epithelial cell line, 16HBE, while A549 cells expressed relatively low endogenous levels of miR-196a (Figure 1B). [score:4]
Sitedirected mutagenesis of the miR-196a target site in the HOXA5-3’-UTR was performed using the Quick-change mutagenesis kit (Stratagene, Hei delberg, Germany) and named HOXA5 -3’-UTR-Mut, in which 3’-UTR-WT was used as a template. [score:4]
Since the expression of miR-196a was frequently up-regulated in NSCLC, we investigated whether this might be mediated by epigenetic mechanisms, including DNA demethylation. [score:4]
miR-196a was highly expressed both in NSCLC samples and cell lines compared with their corresponding normal counterparts, and the expression of miR-196a may be affected by DNA demethylation. [score:4]
These results indicate that up-regulation of miR-196a in NSCLC cells may be affected by DNA demethylation. [score:4]
Furthermore, our observation of a correlation between elevated miR-196a levels and decreased HOXA5 levels in NSCLC tissues, indicates that down-regulation of HOXA5 may be a mechanism by which miR-196a exerts its oncogenic functions. [score:4]
Thus, miR-196a may represent a potential therapeutic target for NSCLC intervention. [score:3]
In addition, to stably sustain the expression of miR-196a in A549 cells, cells were transfected with pCDNA/miR-196a vector or pCDNA/miR-NC empty vector control. [score:3]
The pCDNA/miR-196a, mature miR-196a mimics or si-HOXA5 was transfected into cultured A549 cells respectively, and miR-196a inhibitors were transfected into cultured SPC-A1 cells. [score:3]
MiR-196a inhibitors transfected SPC-A1 cells (3000/well), and pCDNA/miR-196a or si-HOXA5 transfected A549 cells (2000/well) were allowed to grow in 96-well plates. [score:3]
miR-196a expression was significantly higher in patients with a higher pathological stage and lymph-node metastasis. [score:3]
Second, to further understand the biological role of miR-196a in regulating NSCLC development and progression, a series of in vivo studies using xenograft mo dels are required. [score:3]
To further confirm that miR-196a -mediated reduction of luciferase activity from the pLuc- HOXA5 3’-UTR vector was due to direct interaction between miR-196a and its putative binding site, we mutated the miR-196a binding site by site-directed mutagenesis, resulting in pLuc- HOXA5-3’-UTR-Mut. [score:3]
Finally, we observed an inverse correlation between HOXA5 and miR-196a expression in NSCLC tissues. [score:3]
Expression of miR-196a was analyzed in 34 NSCLC tissues and five NSCLC cell lines by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). [score:3]
The aberrant expression of miR-196a is a frequent event in various cancers, suggesting that miR-196a may play an important role in tumorigenesis and tumor progression. [score:3]
Higher expression of miR-196a in NSCLC tissues was associated with a higher clinical stage, and also correlated with NSCLC lymph-node metastasis. [score:3]
This suggests that high expression of miR-196a may be involved in NSCLC carcinogenesis. [score:3]
We next performed qRT-PCR analysis to examine the expression of miR-196a in five human NSCLC cell lines, including both adenocarcinoma and squamous carcinoma subtypes. [score:3]
The aim of the present study was to examine the expression pattern of miR-196a in NSCLC and its clinical significance, as well as its biological role in tumor progression. [score:3]
Conversely, introducing miR-196a into A549 cells, which express relatively low levels of endogenous miR-196a, induced corresponding malignant tumor cell behaviors. [score:3]
Specifically, miR-196a expression was significantly higher at later stages of NSCLC development or in specimens displaying more extensive metastasis compared with their normal counterparts. [score:3]
Effect of DNA methylation on miR-196a expression. [score:3]
Luciferase reporter plasmids were constructed to confirm the action of miR-196a on downstream target genes, including HOXA5. [score:3]
Mature miR-196a mimics and miR-196a inhibitors (Anti-miR-196a) were purchased from Sigma-Aldrich and Applied Biosystems, AB, Ambion, respectively. [score:3]
Following treatment of 16HBE cells with DNA demethylating agent (5-aza-CdR), the expression of miR-196a was determined by qRT-PCR (Figure 2B) and CpG island methylation was assessed by bisulfite sequencing (Figure 2C). [score:3]
For the mutated construct, the miR-196a target site 5’- GATATTTTTATTCAAA CTACCTA -3’ was substituted with a 5’- GATATTTTTATTCTTTGATGGAA -3’ fragment. [score:3]
Figure 2 Analysis of the correlation between methylation status and expression of miR-196a. [score:3]
SPC-A1 cells transfected with miR-196a inhibitors were cultured in six-well plates, and were incubated with Hoechst 33342 solution (50 ng/ml, Sigma, St Louis, MO, USA) for 10 min at room temperature. [score:3]
SPC-A1 cells transiently transfected with miR-196a inhibitors or anti-miR-NC, were harvested at 48 h after transfection by trypsinization. [score:3]
However, unlike previous descriptions in breast cancer, alteration of miR-196a expression did not impact apoptosis in NSCLC cells. [score:3]
The mature miR-196a is transcribed from two miR-196a genes, miR-196a-1 and miR-196a-2. Recently, miRNA profiling studies indicate that miR-196a is overexpressed in several tumor tissues, including NSCLC [9- 12]. [score:3]
16HBE cells (2.5 × 10 [5]) were seeded into six-well culture plate on day 0 and exposed to 0, 2 or 5 μM 5-aza-CdR(Sigma-Aldrich)for day 1 to day 3. Thereafter, the cells treated with 5-aza--CdR were harvested on day 3 and used for detection of miR-196a expression or methylation analysis. [score:3]
Similarly, invasion of SPC-A1 cells was also reduced 59% following inhibition of miR-196a. [score:3]
Therefore, the functional role of miR-196a may be tissue- and cell type-specific, and the detailed mechanisms of miR-196a and its targets are worthy of further study. [score:3]
miR-196a inhibitors or mimics were transfected into NSCLC cell lines, and the levels of HOXA5 mRNA and protein were monitored (Figure 5C and 5D). [score:3]
In vitro functional assays demonstrated that modulation of miR-196a expression affected NSCLC cell proliferation, migration and invasion. [score:2]
For the colony formation assay, a total of 500 miR-196a inhibitors transfected SPC-A1, pCDNA/miR-196a or si-HOXA5 transfected A549 cells were placed in a fresh six-well plate and maintained in media containing 10% FBS, replacing the medium every 4 days. [score:2]
We show, possibly for the first time, that the miR-196a/HOXA5 axis regulates the proliferation and invasion of NSCLC cells. [score:2]
As shown in Figure 4A, inhibition of miR-196a impeded the migration of SPC-A1 cells by approximately 64% compared with control. [score:2]
We hypothesized that epigenetic modification of CpG-rich regions within the regulatory regions of miR-196a may be involved in aberrant transcriptional activation. [score:2]
MiR-196a significantly inhibited luciferase activity (~45%) of the wild-type pLuc- HOXA5 3’UTR reporter. [score:2]
Similarly, the results of colony-formation assays revealed that clonogenic survival was decreased following inhibition of miR-196a in SPC-A1 cells, and enhanced in pCDNA/miR-196a transfected A549 cells (Figure 3C and 3D). [score:2]
Alteration of miR-196a expression had no significant effect on cell apoptosis compared with control cells (data not shown). [score:2]
In addition, we demonstrate that miR-196a expression is elevated in NSCLC cell lines compared with the 16HBE normal human bronchial epithelial cell line, with the exception of A549 cells. [score:2]
Further studies of miR-196a will undoubtedly enhance our knowledge of how miR-196a functions in regulating NSCLC cell growth and metastasis. [score:2]
Expression of miR-196a was induced 12.2-fold in stably transfected A549/miR-196a cells, compared with control (Figure 1C and 1D). [score:2]
In colorectal cancer, high levels of miR-196a were observed to activate the Akt signaling pathway, promote cancer cell detachment, migration, invasion and chemosensitivity, and increase the development of lung metastases in mice [10, 17]. [score:2]
We found that miR-196a expression was significantly increased 4.4- or 5.1-fold in 5-aza-CdR treated cells compared with control, and the frequency of methylation was decreased from 78.2% to 67%. [score:2]
qRT-PCR assays were performed to detect miR-196a and HOXA5 expression using the PrimeScript RT reagent Kit and SYBR Premix Ex Taq (TaKaRa, Dalian, China) according to the manufacturer’s instructions. [score:2]
These data indicate that miR-196a is an onco-miRNA that can promote the migratory and invasive phenotype of NSCLC cells. [score:1]
Although miR-196a has been implicated in several other cancers, its role in non-small cell lung cancer (NSCLC) is unknown. [score:1]
Two candidate genes, HOXA5 and FOXO1, were selected for further analysis, owing to their relatively high prediction score and their complementary structure with miRNA-196a (Figure 5A). [score:1]
miR-196a was detected in 34 pairs of NSCLC tissues by qRT-PCR. [score:1]
Bioinformatic analysis identified a canonical CpG island in the promoter region of the miRNA-196a-1 loci (Figure 2A); however, no canonical CpG island was found in the promoter region of the miRNA-196a-2 loci (data not shown). [score:1]
Figure 3 Effect of miR-196a on cell proliferation in vitro. [score:1]
Indeed, several key oncogenic functions have been attributed to miR-196a in the context of tumorigenesis. [score:1]
Conversely, transfection of A549 cells with miR-196a mimics promoted cell migration and invasion ability ~2.5-fold (Figure 4B). [score:1]
All plasmid vectors (pCDNA/miR-196a and pCDNA/miR-NC ) for transfection were extracted by DNA Midiprep or Midiprep kit (Qiagen, Hilden, Germany). [score:1]
The level of miR-196a was detected in 34 NSCLC samples and adjacent, histologically normal tissues by qRT-PCR, and normalized to U6. [score:1]
pCDNA/miR-196a was then co -transfected with various luciferase 3’ UTR constructs into HEK293T cells. [score:1]
We also show that DNA demethylation may underlie the aberrant expression of miR-196a in NSCLC, and these findings are currently under further investigation in our laboratory. [score:1]
Figure 1 qRT-PCR analysis of miR-196a in NSCLC tissues and matched normal tissues. [score:1]
MTT assay revealed that cell growth was significantly impaired in SPC-A1 cells transfected with miR-196a inhibitors, while proliferation of A549 cells was increased in pCDNA/miR-196a transfected cells compared with controls (Anti-miR-NC or pCDNA/miR-NC, respectively) (Figure 3A and 3B). [score:1]
In this study, we first examined the expression of miR-196a in 34 paired normal/tumor tissues from NSCLC patients, and then investigated the clinical implications. [score:1]
The effect of DNA methylation on miR-196a expression was investigated by 5-aza-2-deoxy-cytidine treatment and bisulfite sequencing. [score:1]
Figure 4 Effect of miR-196a on cell migration and invasion in vitro. [score:1]
Manipulation of miR-196a levels in NSCLC cells. [score:1]
miR-196a promotes migration and invasion of NSCLC cells. [score:1]
Effect of miR-196a on cell proliferation and apoptosis. [score:1]
Human HEK293T cells grown in a 48-well plate were co -transfected with 200 ng of either mock pCDNA/miR-NC or pCDNA/miR-196a, 10 ng of firefly luciferase reporter comprising wild type or mutant 3’UTR of HOXA5 gene, and 2 ng of pRL-TK (Promega, Madison, WI, USA) using Lipofectamie 2000 (Invitrogen, USA). [score:1]
[1 to 20 of 104 sentences]
2
[+] score: 351
The finding that adoptive expression of miR-196a in NSCLC cells induced a consistent down-regulation of HOXA9, suggests that miR-196a -mediated HOXA9 down-regulation contributes to the pro-migratory effects exerted by miR-196a in NSCLC cells, though we can not formally exclude that HOXA9 regulation by miR-196 may take part also to the regulation of proliferative pathways. [score:11]
We confirmed that FoxO1 and p27 were bona fide targets of miR-196a in NSCLC cells, by performing immunoblot analyses in BEAS-2B cells expressing miR-196a and in NCI-H460 cells in which the endogenous expression of miR-196a had been suppressed by use of anti-miR-196a (Figure 7C). [score:9]
As deregulation of CDK inhibitors such as p27 is commonly observed in tumor cells [75], overexpression of miR-196 may represent one mechanism whereby the activity of this important cell cycle inhibitor is impaired in cancer. [score:8]
Quantitative RT-PCR analysis indicated that adoptive expression of miR-196a in H460-shAKT1 cells induced a consistent down-regulation of HOXA9 expression compared to the empty vector (Figure 8C). [score:7]
See Supplementary Figure S3 for expression of miR-196a in NCI-H460 cells transduced with control (EV) or antimiR-196a expressing lentiviruses (Supplementary Figure S3C) and NCI-H460-shAKT1 cells transduced with control (EV) or miR-196a expressing lentiviruses (Supplementary Figure S3D). [score:7]
See Supplementary Figure S3 for expression of miR-196a in BEAS-2B cells transduced with control (EV) or miR-196a expressing lentiviruses (Supplementary Figure S3A) and BEAS-AKT1-E17K cells transduced with control (EV) or antimiR-196a expressing lentiviruses (Supplementary Figure S3B). [score:7]
Taken together, these results indicate that miR-196 plays a critical role in the pathogenesis of lung cancer, and that at least some of the oncogenic activities of miR-196a may depend on suppression of the expression of the transcription factor FoxO1 and/or the cyclin -dependent kinase inhibitor p27. [score:7]
A different approach to correlate the expression of miR-196a with the activity of the PI3K/AKT pathway was to determine the effects of suppressing the expression and/or activity of AKT isoforms in 2 different NSCLC cell lines (NCI-H460, A549) on miR-196a levels. [score:7]
Figure 9 In conclusion, the data reported here provide strong support to the concept that expression of miR-196a is modulated by the most common alterations that contribute to the development of NSCLC, including activating mutations of PIK3CA (E545K) and AKT1 (E17K), and/or the loss of PTEN expression. [score:7]
Expression of miR-196a promoted anchorage-independent growth in vitro also in BEAS-2B cells, whereas its inhibition obtained by transducing a lentivirus expressing an antimiR-196a, partially counteracted the pro-mitogenic effects induced by mutant AKT1 in BEAS-AKT1-E17K cells (Figure 5D). [score:7]
These experiments demonstrated that the deletion of the seeds in both FoxO1 and p27 suppressed the activity of miR-196a, thus suggesting that miR-196a reduces the expression of FoxO1 and of p27 by directly binding the seed sequences in their 3′-UTR (Figure 7D, left and right, respectively). [score:6]
It should be noted that, while high miR-196a levels have been unequivocally associated with advanced clinical stage of disease and lymph-node metastasis, [71] the clinical significance of miR-196a up-regulation in NSCLC remains to be further confirmed, due to the small number of samples analyzed in this study. [score:6]
Expression of miR-196a expression in immortalized human bronchial epithelial cells (BEAS-2B) and/or its silencing in NSCLC cells harboring a PIK3CA mutation (NCI-H460), affected anchorage -dependent and -independent proliferation, migration and tumor growth in xenografts, further extending previous work performed in SPC-A1 and/or A549 cells in vitro [54]. [score:6]
Here we demonstrate that suppression of miR-196a expression by use of antimiR-196a in BEAS-2B and NCI-H460 cells reduced in vitro anchorage -dependent and -independent growth, in vitro migration and in vivo tumor growth of cells subcutaneously injected into immunodeficient mice (n = 4/group). [score:5]
To further dissect the biological contribution of miRNAs to aberrant PI3K/AKT signaling in NSCLC cells, we searched for miR-196a targets using TargetScan, microRNA. [score:5]
The results presented in this study, indicate that miR-196a is significantly overexpressed in human NSCLC-derived cell lines (n=9/11) and primary lung cancer samples (n=19/28), in particular, it is overexpressed in 9/12 SCC, 4/8 CAR, 3/5 ADC, 2/2 LCC, 1/1 ADS. [score:5]
Of these 81 showed high levels of miR-196a expression (51.2%) whereas in the remaining 265 non-mutant samples miR-196a was overexpressed in 130 (49%). [score:5]
In addition, exposure of A549 NSCLC cells to MK2206, a pharmacological inhibitor of all AKT isoforms, markedly decreased AKT phosphorylation and significantly impaired miR-196a expression (Figure 4B). [score:5]
Data from the literature indicate that HOXA9, a negative regulator of migration in NSCLC cells, is a direct target for miR-196a [63, 64]. [score:5]
Conversely, overexpression of miR-196a in NCI-H460sh-AKT1 cells caused a partial rescue of growth rate inhibited by AKT1 interference (Figure 5C). [score:5]
B. Relative mRNA expression of miR-196a by qRT-PCR in A549 cells treated with MK2206 and immunoblot for the expression of p-AKT and AKT1. [score:5]
Notably, BEAS-2B cells expressing AKT1-E17K showed similar modulation of p27 and FoxO1 proteins as BEAS-2B cells expressing miR-196a, and NCI-H460 cells interfered for AKT1 showed similar modulation of CDKN1B and FoxO1 proteins as H460 cells-antimiR-196a. [score:5]
First, we found that expression of miR-196a increased migration of BEAS-2B cells of approximately 3-fold, whereas its inhibition by the antimiRNA in BEAS-AKT1-E17K cells counteracted the pro-migratory effects induced by mutant AKT1 (Figure 6A). [score:5]
Suppression of AKT signaling on miR-196a expression in NSCLC cells. [score:5]
Overall these experiments indicate the existence of a tight loop between PI3K/AKT signaling and the expression of miR-196a in NSCLC cells that can be mediated by the binding of transcription factors regulated by PI3K/AKT to DNA sequences within the miR-196a promoter region. [score:4]
Conversely, dysregulation of miR-196 expression is frequently observed in many cancer types including pancreatic, breast, colorectal, esophageal and lung carcinomas, as well as leukemias [8, 11– 13, 70]. [score:4]
Among others, we found that the -1000/+0 promoter region of miR-196a contained the binding sites for FOXOq1, CREB3 and E2F, which are known to be activated by PI3K/AKT signaling [55– 57] and thus are candidates to transcriptionally mediate PI3K/AKT -dependent regulation of miR-196a expression in NSCLC cells. [score:4]
In fact, we exploited the TCGA dataset to correlate the presence of activating mutations in genes within the PI3K/AKT pathway with the expression of miR-196a in multiple NSCLCs. [score:4]
In fact, besides being controlled by miR-196, p27 expression is also regulated by FoxO transcription factors [72– 74]. [score:4]
Based on these evidences, and on the predicted binding sites for miR-196a identified in this study, we observed that FoxO1 and p27 are direct targets of miR-196a in NSCLC cells. [score:4]
In particular, aberrant expression of miR-196a has been frequently reported in various cancers including NSCLC [50– 53] and it represents a major regulator of migration in NSCLC cells [54]. [score:4]
As an alternative approach, we suppressed miR-196a in the NSCLC cell line NCI-H460, which harbors a heterozygous activating mutation (E545K) in PIK3CA, resulting in activation of the PI3K/AKT pathway. [score:4]
We reasoned that if the expression of miR-196a was under the transcriptional control of PI3K/AKT pathway, binding sites for Transcription Factors regulated by PI3K signaling in the promoter region of miR-196a should be identified. [score:4]
On the other hand, inhibition of miR-196a markedly reduced NCI-H460 cell migration, assessed in Boyden chamber assays (140±18.9 vs 10.5±0.3 migrated cells; Figure 6B), whereas adoptive expression of miR-196a in NCI-H460-shAKT1 cells rescued the impairment of cell migration induced by interference of AKT1 (158±26.8 vs 98±6.7). [score:4]
Figure 3 A. Relative mRNA expression of miR-196a by qRT-PCR in control BEAS-2B and derivatives. [score:3]
C. Expression of miR-196a in 28 human primary NSCLC samples by qRT-PCR. [score:3]
Importantly, miR-196a has multiple effects on p27 levels - both direct and indirect. [score:3]
Figure 7 A. Target prediction of miR-196a. [score:3]
Recent work has shown that miR-196 targets FoxO1 in cervical cancer cells [62] and p27 in gastric cancer cells [52]. [score:3]
Correlation between pAKT and miR-196a expression in NSCLC cell lines. [score:3]
C. Relative HOXA9 expression by qRT-PCR in NCI-H460-shAKT1-EV, NCI-H460-shAKT1-miR-196a cells. [score:3]
A. Relative mRNA expression of miR-196a by qRT-PCR in H460SCR, H460-shAKT1 and H460-shAKT2 cells. [score:3]
Relationship between activity of the PI3K/AKT pathway and the expression of miR-196a. [score:3]
In agreement with these results, we found that miR-196a rescued the reduction of migrated cells induced by suppression of AKT1 in NCI-H460-shAKT1 cells. [score:3]
MiR-196a also turned out to be the only DEM present in relevant networks (Figure 2B, Network 2) by IPA analysis where it was the most highly up-regulated among the DEMs of Network 2 (Supplementary Figure S2). [score:3]
MiR-196 is transcribed from three different genes denoted miR-196a-1, miR-196a-2 and miR-196b, with its expression strictly controlled in normal tissues [70]. [score:3]
First, we confirmed expression of miR-196a in BEAS-2B cells and derivatives by using quantitative RT-PCR (Figure 3A). [score:3]
By suppressing FoxO1 and p27, miR-196a would thus stimulate cell cycle progression in NSCLC cells. [score:3]
Role of predicted target genes of miR-196a in NSCLC cells. [score:3]
Furthermore, we observed also that miR-196a is overexpressed in primary NSCLC samples [n=28; 12 squamous cell carcinomas (SCC), 8 carcinoids (CAR), 5 adenocarcinomas (ADC), 2 large cell carcinomas (LCC) and 1 adeno-squamous carcinoma (ADS)]. [score:3]
MiR-196a could stimulate proliferation/migration by directly targeting FoxO1, p27 and HOXA9 and thus plays an important role in mediating the effects exerted by aberrant activation of PI3K/AKT signaling. [score:3]
Figure 4 A. Relative mRNA expression of miR-196a by qRT-PCR in H460SCR, H460-shAKT1 and H460-shAKT2 cells. [score:3]
Similarly to AKT1 suppression, also the silencing of AKT2 in NCI-H460 cells produced a marked decrease in the levels of miR-196a as detected by quantitative RT-PCR (Figure 4A). [score:3]
Human pre-microRNA Expression Construct Lenti-miR-196a-1 (PMIRH196a1PA-1) and human miRZip-196a anti-miR-196a microRNA Construct (MZIP196a-PA-1) (System Biosciences, Mountain View, CA, USA) were used to generate lentiviral particles in HEK 293T packaging cells. [score:3]
B. Expression of miR-196a in human NSCLC cell lines by qRT-PCR. [score:3]
Using these criteria, and in consideration of previously published work [52, 60– 62], we selected the transcription factor FoxO1 and cyclin -dependent kinase inhibitor p27 as effectors of miR-196a in NSCLC cells. [score:3]
As shown in Figure 6C, miR-196a suppression caused an almost 2-fold reduction in the capability of NCI-H460 cells to migrate at 48h after wounding. [score:3]
The overexpression of miR-196a in NSCLC is a common event, and it is not extremely novel per se. [score:3]
Finally, the inhibition of HOXA9 by miR-196a may contribute to stimulate migration effects in NSCLC cells (Figure 9). [score:3]
A. Target prediction of miR-196a. [score:3]
Analysis of miR-196a expression in NSCLC-derived cell lines and primary tumors. [score:3]
Normal human lung tissues (n=6) were used as controls to obtain an average expression value of miR-196a in normal lung that has been arbitrarily established as 1 and marked with a thick black line. [score:3]
D. Left panel, Luciferase assay of plasmids 3′UTR-FoxO1-WT and 3′UTR-FoxO1-DEL transfected into HEK-293 cells with pre-miR-196a or a no -targeting scrambled (SCR) oligonucleotides; right panel, Luciferase assay of plasmids 3′UTR-CDKN1B-WT and 3′UTR-CDKN1B-DEL transfected into HEK-293 cells with pre-miR-196a oligonucleotide or a no -targeting scrambled oligonucleotide (SCR). [score:3]
Finally, suppression of miR-196a by use of antimiR-196a markedly reduced in vivo tumor expansion of NSCLC cells injected into immunodeficient mice (n=4/group) (Figure 6D), indicating that miR-196a plays a significant role in the malignant behavior of NSCLC cells. [score:3]
Subsequently, we analyzed the expression of miR-196a in NSCLC cell lines and primary tumors. [score:3]
In NCI-H460 cells inhibition of miR-196a by use of the specific antimiRNA markedly reduced the number of colonies/well (from 368±17.8 to 180±3.7). [score:3]
Expression of miR-196a in lung cancer-derived cell lines and primary tumors. [score:3]
These results suggested that all the AKT isoforms expressed in the lung are able to increase miR-196a levels in NSCLC cells. [score:3]
A. Relative mRNA expression of miR-196a by qRT-PCR in control BEAS-2B and derivatives. [score:3]
Silencing of AKT1 in NCI-H460, as assessed by immunoblot [48], resulted in a marked reduction of miR-196a levels as detected by quantitative RT-PCR (Figure 4A), indicating that AKT kinases play a significant role in the expression of miR-196a in NSCLC cells. [score:3]
A complete understanding of the role that miR-196 might play in cancer requires the identification of its targets. [score:3]
Finally, we searched for additional experimental evidence that FoxO1 and p27 mRNAs were targets of miR-196a by performing Luciferase assay. [score:2]
To confirm that binding to seeds in the 3′UTR of FoxO1 and p27 was critical for miR-196a activity, we deleted the seed sequences of miR-196a in both target genes (3′UTR-FoxO1-DEL and 3′UTR-CDKN1B-DEL) and performed Luciferase activity assay. [score:2]
These results were confirmed by wound assay of confluent monolayers of control NCI-H460, NCI-H460 transduced with a lentivirus expressing antimiR-196a, NCI-H460-shAKT1, NCI-H460-shAKT1 transduced with miR-196a. [score:2]
Primary human normal bronchial epithelial cells (NHBE) were used as control of normal lung and set arbitrarily as 1. Expression analysis of miR-196a by quantitative RT-PCR showed that the levels of miR-196a were significantly increased in all but two NSCLC-derived cell lines compared to NHBE used as control normal cells. [score:2]
C. MTT cell proliferation assay of NCI-H460-shAKT1 cells expressing miR-196a. [score:2]
Thus, we investigated whether HOXA9 expression was regulated by miR-196a in NSCLC cells. [score:2]
These contradictory results could be explained by the consideration that a correlation between mutated members of the PI3K/AKT pathway and miR-196a expression can be observed when simple systems such as cell lines are analyzed, but not when more complex and heterogeneous samples as tumors are considered. [score:2]
Among these, the behavior of miR-16-1*/miR-16-5p and miR-203 was concordant with their putative anti-oncogenic properties, whereas regulation of miR-196a was concordant with a supposed oncogenic effect. [score:2]
In particular, miR-196a, the DEM that showed the highest average fold change (>2) in all three derivatives of BEAS-cells (AKT1-E17K, BEAS-PIK3CA-E545K and BEAS-shPTEN), emerges as a critical player of PI3K signaling in lung cancer, regulating several oncogenic molecular networks. [score:2]
The full spectrum of miR-196 actions in the different types of cancer cells is largely unknown. [score:1]
These results indicate that miR-196a is able to promote anchorage -dependent and -independent proliferation of NSCLC cells. [score:1]
The region analyzed was from −1000 to +0 bp with regard to the annotated transcriptional start site of the miR-196a promoter, and employing Jaspar 2016 as the database for the analysis. [score:1]
MiR-196a regulates migration and tumorigenicity of NSCLC cells. [score:1]
Pro-tumorigenic activities exerted by miR-196a in NSCLC cells are partly mediated by FoxO1, p27 and HOXA9. [score:1]
Here we report that miR-196a is modulated by mutant PI3K, mutant AKT1 and by loss of PTEN, and represent a pivotal mediator of proliferation, migration/invasion and tumorigenicity elicited by aberrant activation of PI3K/AKT pathway. [score:1]
In addition, we demonstrated that one such miRNA, miR-196a, mediates some of the transforming activities of activated PI3K/AKT pathway in NSCLC cells. [score:1]
The DEMs identified within these functions were miR-16-1*/miR-16-5pand miR-203 for the function “Lung squamous cell carcinoma”, miR-19b for the function “Small cell lung cancer” and miR-16-5p and miR-196a for the function “Non small cell lung cancer”, indicating that these DEMs as the most relevant for lung cancer. [score:1]
As controls, 6 matched normal samples were analyzed and set arbitrarily as 1. As shown in Figure 3C, the average levels of miR-196a were considerably higher in NSCLCs than in normal lung tissues (on average 14-fold). [score:1]
C. of NCI-H460-SCR-EV, NCI-H460-shAKT1-EV, NCI-H460-shAKT1-miR-196a and NCI-H460-SCR-antimiR-196a cells. [score:1]
These findings are noteworthy, as they shed light on the role exerted by miRNAs in aberrant PI3K signaling in NSCLC and, at the same time, provide experimental evidence that miR-196a can stimulate anchorage -dependent and -independent proliferation and migration in NSCLC cells downstream PI3K, thus ameliorating the comprehension of the pathogenesis of this neoplasia. [score:1]
Subsequently, we investigated the relationship between miR-196a and its targets FoxO1 and p27. [score:1]
MiR-196a regulates anchorage -dependent and –independent growth of NSCLC cells. [score:1]
These plasmids were used to transfect HEK293 cells with siPORT (Ambion Life Technologies, Paisley, UK) in the presence of mature microRNA-196a to evaluate the true bind of this miRNA to its own site on 3′UTR region of predicted target genes. [score:1]
Among the DEMs that were common to BEAS-AKT1-E17K, BEAS-PIK3CA-E545K and BEAS-shPTEN cells miR-203, miR-196a and miR-187 showed the highest fold changes. [score:1]
To further investigate the relationship between the PI3K/AKT pathway and miR-196a expression, first we correlated the levels of miR-196a with the activation status of the PI3K/AKT pathway in 7 NSCLC cell lines, of which the activation status of the PI3K/AKT pathway was known [12]. [score:1]
We found that in the group of mutant samples, 19/32 (59.3%) showed high levels of miR-196a whereas in the group of wild type samples, 192/391 (49.1%) showed high levels of miR-196a. [score:1]
See Table 2. Table 2 Lung cancer cell lines p-AKT miR-196a FC A549 + 5.98 BEN - 0.11 H226 - 0.46 H292 + 14.31 H460 + 14.43 H522 - 57.60 H596 + 2.46 However, this correlation was not confirmed when we used in silico data downloaded from the public repository of The Cancer Genome Atlas (TCGA) consortium (http://cancergenome. [score:1]
Figure 3B shows the levels of miR-196a in 11 cell lines derived from human NSCLCs (A549, BEN, NCI-H226, NCI-H292, NCI-H460, NCI-H522, NCI-H596, NCI-H727, NCI-H838, NCI-H1299, NCI-H1975). [score:1]
Figure 7B shows the base-pairing of the seed sequence of miR-196a in the 3′UTR of FoxO1 and p27 encoding genes. [score:1]
In addition, miR-196a promoted anchorage-independent growth in vitro, as BEAS-SCR-EV cells generated 216±36.8 colonies/well, BEAS-E17K-EV generated 519±46.5 colonies/well and BEAS-E17K-antimiR-196a generated 393±24 colonies/well (Figure 5D; see Supplementary Figure S4 for representative images). [score:1]
B. Base-pairing between the seed sequence of miR-196a and the 3′UTR of FoxO1 and p27. [score:1]
Analysis of miR-196a promoter. [score:1]
Mo del explaining the relationship among PI3K, AKT1, miR-196a, FoxO1, p27 and HOXA9. [score:1]
In this case, we found that 2 out of 3 pAKT negative cell lines presented low levels of miR-196a whereas 4/4 pAKT positive cell lines presented high levels of miR-196a. [score:1]
To this aim, HEK-293 cells were co -transfected with a pre-miR-196a oligonucleotide or a scrambled oligonucleotide (SCR), together with the 3′-UTR of FoxO1 (Luc-3′UTRFoxO1) or of p27 (Luc-3′UTR-CDKN1B) fused to Luciferase (Figure 7D, left and right, respectively). [score:1]
Therefore, we performed a thorough analysis of statistically overrepresented MOTIF elements by Pscan (http://159.149.160.51/pscan/)[PSCAN], using RefSeq ID: NR_029582 as miR-196a identifier and Homo sapiens as source organism. [score:1]
See Table 2. Table 2 Lung cancer cell lines p-AKT miR-196a FC A549 + 5.98 BEN - 0.11 H226 - 0.46 H292 + 14.31 H460 + 14.43 H522 - 57.60 H596 + 2.46However, this correlation was not confirmed when we used in silico data downloaded from the public repository of The Cancer Genome Atlas (TCGA) consortium (http://cancergenome. [score:1]
This was strengthened also by our findings that this miR-196a stimulates proliferation in NSCLC cells (see above). [score:1]
On the contrary, the novelty of this study resides in positioning miR-196a downstream the PI3K/AKT pathway. [score:1]
For further studies we chose miR-196a on the basis of the following considerations. [score:1]
We found that the transfection of pre-miR-196a oligonucleotide, but not of the scrambled oligonucleotide, reduced the luciferase activity of approximately 20% for FoxO1 and 40% for p27. [score:1]
[1 to 20 of 112 sentences]
3
[+] score: 305
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-196a-1
qPCR analyses showed that the expression of p27 [kip1] mRNA in Hep-2 cells transfected with miR-196a inhibitor or mimics was upregulated or downregulated compared with cells transfected with control, and similar events occurred in TU212 cells (Fig.   3b). [score:10]
We also observed that p27 [kip1] expression is downregulated in laryngeal cancer tissues and cell lines and negatively correlated with miR-196a expression levels. [score:8]
The present study showed that miR-196a was upregulated in laryngeal cancer and promoted cell proliferation by downregulating p27kip1 in laryngeal cancer. [score:7]
Therefore, it is concluded that miR-196a was upregulated in laryngeal cancer and promoted cell proliferation by downregulating p27 [kip1] in laryngeal cancer. [score:7]
Western blot analysis showed that the expression of p27 [kip1] protein in Hep-2 and TU212 cells transfected with miR-196a inhibitor was upregulated compared with cells transfected with negative control (Fig.   4c). [score:7]
Prior to that, it has been reported that miR-196a is up-regulated in gastric cancer and promotes cell proliferation by downregulating p27 [kip1] [19]. [score:7]
These data suggested that miR-196a promotes laryngeal cell proliferation through downregulation of p27 [kip1] expression. [score:6]
We found that miR-196a was dramatically up-regulated in laryngeal cancer tissues and cells, which suggests that high expression of miR-196a might be involved in laryngeal carcinogenesis. [score:6]
miR-196a is also observed with up-regulated expression levels in laryngeal cancer. [score:6]
In addition to inhibiting cell proliferation, we found that miR-196a inhibitor has the effect of promoting apoptosis, in terms of Hep-2 and TU212 cells. [score:5]
Further analyses indicated that expression of miR-196a expression was negatively correlated with p27 [kip1] protein level in laryngeal cancer (Fig.   4c). [score:5]
Also, miR-196a inhibitor could suppress the laryngeal cancer growth in vivo or in vitro [9]. [score:5]
showed that overexpression of p27kip1 rescue decreased cell proliferation caused by miR-196a inhibitors. [score:5]
Our data showed that the miR-196a was significantly down-regulated in both Hep-2 and TU212 cell lines following transfection with miR-196a inhibitors when compared with the negative control and blank (Fig.   2a). [score:5]
However, the regulatory function that miR-196a plays in laryngeal carcinoma, although elucidating the biologic consequences of miRNA dysregulation and identifying the targets of miRNAs, is critical to understanding miRNA pathways and their underlying molecular mechanisms. [score:5]
The expression of miR-196a in cancer tissues was significantly higher than their matched normal tissue samples (p < 0.01), and was also significantly up-regulated in Hep-2 (p < 0.01), TU212 (p < 0.01), SNU899 (p < 0.01) laryngeal cancer cells lines as compared with the normal cell lines (Fig.   1a, b). [score:5]
Inverse relationship between the expression of p27 [kip1] and miR-196aTo assess the relationship between p27 [kip1] and miR-196a expression in laryngeal cancer, we examined p27 [kip1] and miR-196a by qPCR in 20 pairs of laryngeal cancer tissues. [score:5]
miRNA mimic and inhibitor transfection laryngeal cancer cells were transfected with miR-196a mimic, miR-196a inhibitor (Applied Biosystems), and Lipofectamine 2000 (Invitrogen) in accordance with the manufacturers’ instructions. [score:5]
A recent report on lung cancer revealed that inhibition of miR-196a could suppress cancer cell lines A549/DDP cell proliferation through the induction of cell apoptosis [27]. [score:5]
Further functional analysis of miR-196a demonstrated that the inhibition of miR-196a could inhibit laryngeal cell-cycle progression and proliferation in vitro. [score:5]
MiR-196a expression is upregulated in human laryngeal cancer tissues and cell lines. [score:5]
a The relative expression level of miR-196a in Hep-2 and TU212 cells, transfected with miR-196a negative control (miR-NC) or inhibitors, was tested by qPCR. [score:5]
In addition, further experiments showed that decreased cell proliferation caused by miR-196a inhibitors could be rescued by concomitant overexpression of p27 [kip1], which contributes to the increased understanding of the role of miR-196a in laryngeal cancers. [score:5]
It has been demonstrated that miR-196a is highly up-regulated in laryngeal cancer by miRNA profiling analysis. [score:4]
miR-196a directly targets p27 [kip1] in laryngeal cancer cell linesWe cloned the wild-type 3′-UTRs of p27 [kip1] gene and inserted it into the region immediately downstream of a luciferase reporter gene. [score:4]
We observed significant suppression of cell proliferation in Hep-2 (Fig.   2b) and TU212 cell lines that were treated with the miR-196a inhibitor compared with the control (Fig.   2c), respectively. [score:4]
Thus, there might be other target genes regulated by miR-196a involved in the proliferation of laryngeal cancer cells. [score:4]
In the present study, we conducted qPCR analysis of miR-196a expression in human laryngeal cancer and showed that miR-196a was overexpressed in tumor-derived samples and laryngeal cancer cell lines compared with matched normal controls. [score:4]
Shang Y Wang LQ Guo QY Shi TL MicroRNA-196a overexpression promotes cell proliferation and inhibits cell apoptosis through PTEN/Akt/FOXO1 pathwayInt J Clin Exp Pathol. [score:4]
By WST-8 assay, we observed that co-transfection of si-p27 [kip1] and miR-196a inhibitors could partially rescue miR-196a inhibitors–decreased proliferation in Hep-2 (Fig.   4a) and TU212 cells (Fig.   4b), respectively. [score:4]
and western blot confirmed that miR-196a may function as an oncogene by directly targeting p27 [kip1]. [score:4]
Recently, it has been reported that miR-196a promotes cancer cells proliferation by downregulating p27 [kip1] in gastric cancer [19]. [score:4]
Cell proliferation in laryngeal cancer-derived cells transfected inhibition of miR-196a might be result directly from cell apoptosis. [score:4]
In the present study, we conducted a qPCR analysis of miR-196a expression in human laryngeal cancer tissues and showed that miR-196a was overexpressed in tumor-derived samples and laryngeal cancer cell lines compared with matched normal controls. [score:4]
miR-196a directly targets p27 [kip1] in laryngeal cancer cell lines. [score:4]
Exogenous downregulation of miR-196a in laryngeal cancer cells. [score:4]
and western blot confirmed that miR-196a directly targeted p27kip1. [score:4]
Recently, it has been reported that miR-196a was dramatically up-regulated in laryngeal cancer. [score:4]
The p27 [kip1] -mediated repression in cell proliferation was reverted by exogenous miR-196a expression. [score:3]
To some extent, our observation was consistent with findings in gastric cancer cells, which showed that overexpression of miR-196a could promote gastric cell-cycle progression and proliferation in vitro and in vivo [19]. [score:3]
The results revealed that both Hep-2 and TU212 cell lines transfected with miR-196a inhibitors had an obvious cell-cycle arrest at the G0/G1phase (Fig.   2e). [score:3]
The HEp-2 and TU212 cells transiently transfected with miR -negative control (miR-NC), miR-196a mimics, miR-196a inhibitors, pEGFP-NC, and stably transfected with pEGFP-p27 [kip1] were harvested 48 h after transfection using trypsinization. [score:3]
A negative relation between miR-196a and p27kip1 expression in laryngeal cancer tissues were also noted by further analyses. [score:3]
A study reported by Sun et al. demonstrated that overexpression of miR-196a resulted in a marked increase in proliferation of gastric cancer [19]. [score:3]
HEK 293T cells were placed into 48-well plates and then cotransfected with miR-196a inhibitor (200 ng) and either luciferase reporter plasmids (200 ng) containing wild-type (WT) or mutant type (Mut) of p27 [kip1] 3′UTR. [score:3]
Saito et al. found that the inhibition of miR-196a hindered cancer cell proliferation in laryngeal cancer-derived cells [9], which is in keeping with our findings. [score:3]
Simultaneously, reports have demonstrated that miR-196a expression is significantly higher in various types of tumors than the controls such as gastric [19], osteosarcoma [20], breast [21], and pancreatic cancers [22, 23]. [score:3]
A negative relation between miR-196a and p27 [kip1] expression in laryngeal cancer tissues was noted by consecutive further analysis. [score:3]
Inverse relationship between the expression of p27 [kip1] and miR-196a. [score:3]
Silencing of p27kip1 rescue decreased cell proliferation caused by miR-196a inhibitor. [score:3]
After transfection with miR-196a inhibitors, Hep-2 and TU212 cells were co -transfected with si-p27 [kip1], respectively. [score:3]
Also, further studies regarding the relationship between miR-196a expression and tumor growth are also needed to develop a better understanding of miR-196a in the progression of laryngeal cancer. [score:3]
Subsequently, miR-196a inhibitor or miR-196a mimics were transfected with different luciferase 3′-UTR constructs into HEK293T cells. [score:3]
To test whether p27 [kip1] mRNA is the target for miR-196a, we mutated the predicted binding site of miR-196a in the 3′-UTR. [score:3]
Fig.  1Expression levels of miR-196a in laryngeal tissues and cell lines by real-time PCR analysis. [score:3]
MiR-196a has been identified as an oncogene and reported up-regulated in some tumors include laryngeal cancer [19– 21, 23, 26]. [score:3]
a, b siRNA of p27 [kip1] rescue decreased cell profileration caused by miR-196a inhibitors in Hep-2 (a) and TU212 (b) cell lines, respectively. [score:3]
These data suggested that the p27 [kip1] level was mostly opposite to miR-196a expression in laryngeal cancer. [score:3]
The reaction was performed in the following conditions: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, and 60 °C for 50 s. The relative quantification of miR-196a and p27 [kip1] were normalized to the expression of U6 and GAPDH using the 2 [−ΔΔCT] method, respectively. [score:3]
MiR-196a mimics, miRNA normal control (miR-nc), and miR-196a inhibitors were purchased from GenePharma (Shanghai, China). [score:3]
Among the three laryngeal cell lines, the miR-196a expression was the highest in Hep-2, followed by TU212 cell lines and therefore used for further study. [score:3]
The results obtained herein is consistent with the report by Saito et al. who found that miR-196a was highly expressed in the laryngeal cancer cell line JHU-011 and was also more apparent in laryngeal cancer tissues than normal controls [9]. [score:3]
To assess the relationship between p27 [kip1] and miR-196a expression in laryngeal cancer, we examined p27 [kip1] and miR-196a by qPCR in 20 pairs of laryngeal cancer tissues. [score:3]
We carried out further studies to detect the cell cycle in Hep-2 and TU212 cells transfected with miR-196a inhibitors. [score:3]
The results of the cell cycle assay by flow cytometry indicated that miR-196a inhibitor could induce cell cycle progression of Hep-2 and TU212 cells arrest at the G1–S phase. [score:2]
Moreover, in order to investigate whether miR-196a regulated cell growth in laryngeal cancer cells by targeting p27kip1, rescue studies were performed in laryngeal cancer cells. [score:2]
b MiR-196a was also up-regulated in Hep-2, TUU212, and SNU899 laryngeal cell lines compared with normal cell line (b). [score:2]
To better understand the mechanism of miR-196a in laryngeal cancer, we performed luciferase reporter assay, real-time PCR, and western blot to confirm p27 [kip1] is the target of miR-196a in laryngeal cancer cells. [score:2]
showed that more apoptotic cells were present in both Hep-2 and TU212 cells after treatment with the miR-196a inhibitor as compared with the control (Fig.   2d). [score:2]
Herein, we raised the possibility that miR-196a might positively regulate laryngeal cell proliferation and thereby may serve as an aid for the diagnosis of laryngeal cancer. [score:2]
Since studies have shown that miR-196a contributes to the development and progression of cancers, it may be useful as a candidate biomarker for cancer diagnosis [9]. [score:2]
The results of a WST assay showed that viability and proliferation of Hep-2 and TU212 cells were significantly lower in cells transfected with miR-196a inhibitors than those in cells transfected with miR-NC. [score:2]
a MiR-196a expression was examined by qRT-PCR in 20 laryngeal tissues and in 20 adjacent noncancerous counterparts (NCs) MiR-196a was significantly higher in laryngeal tissues than their counterparts. [score:2]
These data showed that miR-196a could regulate p27 [kip1] at both mRNA and protein levels. [score:2]
To further examine whether the effect of miR-196a on proliferation of laryngeal cells reflected cell-cycle arrest, cell-cycle progression was analyzed by flow cytometric analysis. [score:1]
However, no information is available on the mechanism that altered miR-196a effect on the growth of laryngeal cancer cell. [score:1]
However, the functional mechanism of miR-196a in laryngeal cancer remains unclear. [score:1]
Fig.  2Effect of miR-196a on cell proliferation and apoptosis. [score:1]
c An inverse relationship between the expression of p27kip1 and miR-196a was detected Moreover, to investigate whether p27 [kip1] was involved in the miR-196a–induced increase in laryngeal cancer cell proliferation, we carried out rescue experiments. [score:1]
a The luciferase reporter plasmid containing wild-type or mutant p27 [kip1] 3′-UTR was cotransfected into HEK-293T cells with miR-196a mimic or mimic NC. [score:1]
miR-196a p27 [kip1] Laryngeal cancer Laryngeal squamous cell carcinoma (LSCC) is one of the most common cancers in incidence and mortality in the head and neck areas [1]. [score:1]
This study aims to explore the mechanism of miR-196a in laryngeal cancer. [score:1]
Based on our results and those of the previously cited studies, it appears that miR-196a could improve the viability and proliferation of laryngeal cancer cells (Hep-2 and TU212). [score:1]
Accumulating evidence has confirmed that miR-196a plays a critical role in tumorigenesis and tumor progression in a variety of cancers. [score:1]
Effect of miR-196a on cell proliferation and apoptosis in vitro. [score:1]
We found that miR-196a significantly decreased the relative activity of the luciferase reporter containing the wild-type 3′-UTR of p27 [kip1] mRNA (p < 0.01; Fig.   3a). [score:1]
This is the first report that investigates miR-196a function in laryngeal cancer apoptosis by testing p27 [kip1] expression. [score:1]
[1 to 20 of 87 sentences]
4
[+] score: 295
miR-196a inhibitor (hsa-miR-196a miRIDIAN Hairpin Inhibitor, IH-300529-06) and inhibitor negative control (control, miRIDIAN microRNA Inhibitor Negative Control no. [score:9]
The study showed that relative number of live cells or that of dead cells were significantly suppressed (control, 1±0.019; miR-196a inhibitor, 0.584±0.029; p = 0.0022) or enhanced (control, 1±0.025; miR-196a inhibitor, 1.692±0.059; p = 0.0015), respectively, in the miR-196a inhibitor treatment group compared with control group (Figure 7B). [score:8]
Deregulated expression of HOX genes including HOXB8, HOXC8, HOXD8 and HOXA7 in esophageal squamous cell carcinoma have been reported [72], [73], and miR-196a is significantly up-regulated in pancreatic [74], breast [75], and esophageal [68] cancer. [score:7]
The results showed that 5 miRNAs (miR-130b-5p (formerly designated as miR-130b*), miR-196a, miR-455-3p, miR-455-5p, and miR-801) or 2 miRNAs (miR-133b and miR-145) were significantly up-regulated or down-regulated, respectively in laryngeal cancers (Figure 1A). [score:7]
Significant suppression of the tumor volume was observed at 12 weeks after inoculation in the miR-196a inhibitor treatment group compared with control (control, 3397±2885%; miR-196a inhibitor, 226±476%; p = 0.0415) (Figures 8A and B). [score:6]
In cancer tissues, the expression level of miR-196a isomiRs is upregulated and the length spectrum of miR-196a isomiRs is peaked at those found at miRBase entry of miR-196a. [score:6]
Significant suppression of cell proliferation was observed by miR-196a inhibitor compared with control (miR-196a inhibitor, 22.67±3.06×10 [4]/ml; control, 44.33±6.66×10 [4]/ml; p = 0.0069) (Figure 7A). [score:6]
These data cumulatively suggest that expression of mature miR-196a is maintained low and with a truncated form in normal laryngeal tissues, and is up-regulated with a complete length in laryngeal cancers. [score:6]
JHU-011 cells derived from clinical laryngeal cancer were transfected with either miR-196a inhibitor or control, and after culture for 5 days the cells were subjected to both cell growth and survival analysis in the presence of miR-196a inhibitor. [score:5]
In vitro study revealed the significant growth suppression of JHU-011 cells by miR-196a inhibitor. [score:5]
Efficacy of treatment on both tumors and their locoregional lymph node metastasis was examined in each of the following 2 groups: Group 1, miR-196a inhibitor; Group 2, inhibitor negative control (control). [score:5]
Therefore, to examine whether inhibition of miR-196a expression could counteract the propagation of laryngeal cancer in vivo, orthotopic xenograft mo del in mice was employed. [score:5]
Another previous report proved that miR-196a promoted cell proliferation, anchorage-independent growth and suppressed apoptosis by targeting annexin A1 [68]. [score:5]
Significant tumor growth suppression by miR-196a inhibitor was observed at 12 weeks after inoculation. [score:5]
Suppression of cell growth by miR-196a inhibitor was also visualized by Hoechst 33258, a nuclear stain that emits blue fluorescence when bound to double-stranded DNA (Figure 7C). [score:5]
0071480.g007 Figure 7(A) Laryngeal cancer-derived JHU-011 cells were transfected with either miR-196a inhibitor or Inhibitor Negative Control (control) on day 0 and cell numbers were counted up to 5 days to evaluate the effect of miR-196a inhibition on the cell proliferation. [score:5]
Head and neck cancer growth suppression in an orthotopic murine mo del by miR-196a inhibition. [score:5]
Altogether, our results represent the first step toward a possible use of miR-196a as molecular marker for laryngeal cancer, and set the base for the future clinical employment of miR-196a inhibitor for the suppression of laryngeal cancer growth. [score:5]
Tumor Growth Suppression by miR-196a Inhibitor. [score:5]
Live cell fluorescence and dead cell fluorescence revealed significant suppression of relative live cell number (left panel), while miR-196a inhibition significantly increased relative dead cell number as compared to control (right panel). [score:4]
Significant up-regulation of miR-455-5p and miR-196a in multiple laryngeal cancer samples. [score:4]
Although further study is necessary to examine biological significance including the downstream targets of miR-196a in laryngeal cancer, there may be a mechanism through HOX gene deregulation to promote laryngeal cancer. [score:4]
miR-196a as the Most Advantageous Biomarker Up-regulated in Laryngeal Cancer. [score:4]
The results demonstrated above clearly indicate that miR-196a is up-regulated in laryngeal cancer cells to support their proliferation. [score:4]
For transfection assays, cells were transfected with either miR-196a inhibitor or inhibitor negative control using Lipofectamine™ 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. [score:4]
miR-196a showed most dramatic expression pattern in laryngeal cancer compared with other miRNAs differentially expressed in laryngeal cancer. [score:4]
Furthermore, expression levels of miR-196a and miR-455-5p were significantly higher in cancer tissues when compared with neighboring controls (miR-196a, p = 0.0460; miR-455-5p, p = 0.0286) (Figure 2A), while expression level of miR-133b was significantly lower in cancer samples compared with controls (p = 0.0274) (Figure 2B). [score:3]
Statistical analyses were performed using t-test to compare the therapeutic effect of miR-196a inhibitor against laryngeal cancer in vitro and in vivo. [score:3]
Next, to explore the physiological significance of miR-196a expression in laryngeal cancer, we first examined whether miR-196a is beneficial to the propagation of laryngeal cancer cells. [score:3]
Reduced proliferation and viability of laryngeal cancer cells by miR-196a inhibition. [score:3]
According to our deep sequencing data, mir-196a-1 precursor is as well responsible for expressing unannotated miR-196a-3p sequence that is slightly different from that of mir-196a-2 precursor origin. [score:3]
Effect of miR-196a Inhibition on Tumor Growth and Metastasis of Laryngeal Cancer Xenografts. [score:3]
Thus, to explore the possible heterogeneity in the expression profiles of miR-196a isomiRs between laryngeal cancer and non-cancer tissues, deep sequencing analysis of small RNA was conducted by using Applied Biosystems SOLiD system (Kamimoto T et al., manuscript submitted). [score:3]
The expression of miR-196a in cancers was significantly higher than their matched paired samples (p = 0.005) and was also evident in laryngeal cancer cell line JHU-011 cells (data not shown). [score:3]
Effect of miR-196a Inhibition on Laryngeal Cancer Cell Viability. [score:3]
Representative pictures of control group with metastatic tumor cells (left panels) together with the pictures of miR-196a inhibitor group without tumor cells (right panels) are shown. [score:3]
Furthermore, we found the expression of miR-196a was significantly higher in advanced cancer than early cancer (p = 0.0045; Figure 4B, left panel ), and also in early cancer than precancerous dysplasia (p = 0.0263; Figure 4B, Right panel ). [score:3]
Stable Detection of miR-196a Expression in Surgical Laryngeal Cancer Specimen. [score:3]
Thus, our laryngeal cancer xenograft data demonstrate, as a whole, that miR-196a is sufficient to strongly enhance laryngeal cancer growth (even if we are not providing the precise biological mechanisms behind this dramatic effect) and, consequently, that the inhibition of miR-196a is necessary, and in fact effective, to reduce the in vivo growth of this tumor. [score:3]
0071480.g008 Figure 8(A) Nude mice were injected with JHU-011 cells at the level of hyoid bone and then treated with miR-196a inhibitor or control. [score:3]
Significant expressional differences between matched pairs were reproduced in miR-133b, miR-455-5p, and miR-196a, among which miR-196a being the most promising cancer biomarker as validated by qRT-PCR analyses on additional 84 tissue samples. [score:3]
Together with the result that miR-196a is highly expressed in laryngeal cancer cell line JHU-011 cells (Figure 4A), these findings raised the possibility that cancer cells secrete miR-196a transferable or functional in stromal cells. [score:3]
In our study, miR-196a was detected both in cancer cells and cancer-related stroma as miR-21 expression in esophageal squamous cell carcinoma [78]. [score:3]
Deep sequencing analysis revealed both quantitative and qualitative deviation of miR-196a isomiR expression in laryngeal cancer. [score:3]
We believe that our positive data in this settlement are the most significant and interesting, as they show that miR-196a inhibition can reduce the growth of pre-established laryngeal cancer xenografts up to 12 weeks. [score:3]
Furthermore, suppression of locoregional metastasis was observed in the miR-196a treatment group while clear metastatic cancer cells were observed in the control (Figure 8D). [score:3]
We further assessed the impact of miR-196a inhibition in vitro and in vivo on the growth of HNSCC to evaluate the potential of miRNA as a novel therapeutic target for HNC. [score:3]
Therefore, to further explore the significance of miR-196a as a promising biomarker for laryngeal cancer, qRT-PCR analysis of miR-196a was performed on 84 histologically verified samples (15 noncancerous counterparts, 24 benign diseases, 18 dysplasias, 27 laryngeal cancers) and 7 HNSCC cell lines. [score:3]
Subsequently, we injected miR-196a inhibitor into pre-established JHU-011 xenografts. [score:3]
In situ hybridization confirmed laryngeal cancer-specific expression of miR-196a in both cancer and cancer stroma cells. [score:3]
miR-196a is located in HOX gene clusters [65] and this microRNA has been suggested to potentially target HOXB8, HOXC8, HOXD8 and HOXA7 [66]. [score:3]
Statistically significant differences of the expression levels of miR-196a, miR-455-5p, and miR-133b were observed between matched pairs. [score:3]
Representative mice were photographed on 9 weeks after inoculation of JHU-011 cells, showing the obvious treatment effect of miR-196a inhibitor. [score:3]
The result showed that the expression of miR-196a was evident in laryngeal cancer, but was under detection levels in the adjacent normal counterpart (Figure 6). [score:3]
It has been suggested that there are tissue -dependent preference of isomiR [76], and our data revealed that miR-196a isomiRs are differentially expressed between cancer and non-cancer samples in terms of both quantitative and qualitative manner. [score:3]
While squamous cell cancer cells (white arrowhead) with central necrosis (filled arrowhead) were observed in control (left panels), tumor cells were replaced with histiocytes after miR-196a inhibition (right panels). [score:3]
Interestingly, the expression of miR-196a was slightly detected in the stromal area next to cancer in the FFPE sample. [score:3]
In contrast, non-cancer tissues revealed low expression level of miR-196a in a form shorter than miRBase information. [score:3]
miR-196a Detection and Localization in Laryngeal Cancer by in situ HybridizationTo verify the expression of miR-196a in laryngeal cancer tissue, we conducted in situ hybridization for mature miR-196a on paraffin-embedded tissue slices of both advanced T3 laryngeal cancer and normal mucosa obtained from unaffected side of the same clinical specimen. [score:3]
On the other hand, cancer cells were replaced with histiocytes with no residual cancer cells in the miR-196a inhibitor treatment group (Figure 8C). [score:3]
Finally, inhibition of miR-196a counteracted cancer cell proliferation in both laryngeal cancer-derived cells and mouse xenograft mo del. [score:3]
To verify the expression of miR-196a in laryngeal cancer tissue, we conducted in situ hybridization for mature miR-196a on paraffin-embedded tissue slices of both advanced T3 laryngeal cancer and normal mucosa obtained from unaffected side of the same clinical specimen. [score:3]
Furthermore, expression level of miR-196a was clearly higher in cancer tissues compared with noncancerous other tissues (adjacent noncancerous counterparts and benign laryngeal tissues, p = 0.0003; dysplasias, p = 0.0040) (Figure 3A). [score:2]
Thus, of these 4 miRNAs, 3 miRNAs (i. e., miR-196a, miR-455-5p and miR-133b) showed significantly different expression levels in cancer tissues when compared with their matched control tissues and further quantification of miRNAs was performed using 48 laryngeal samples. [score:2]
Expression levels of miR-196a were significantly higher in cancer tissues when compared with either NCs and benign samples or precancerous dysplasia samples. [score:2]
0071480.g005 Figure 5(A) Expressions of miR-196a isomiRs were compared between 2 laryngeal cancer (T416 and T506; left panels) and 3 non-cancer (T421, T484 and T502; right panels) samples. [score:2]
The study showed that increasing tendency of miR-196a expression level was observed when cancer samples were compared with noncancerous counterparts, benign tissues, or dysplasias (Figure 4A). [score:2]
Notably, compared with pre-cancerous dysplasias, miR-196a expression was significantly higher in early T1a cancer in our study, suggesting the potential of miR-196a to be a very supportive or crucial tumor marker especially for early laryngeal cancer with frequent difficulty with pathological diagnosis [64]. [score:2]
Furthermore, significantly higher level of miR-196a expression was observed in early T1a cancer samples compared with precancerous dysplasia samples (right panel). [score:2]
Furthermore, the role of miR-196a as one of the regulators of the ETS transcription factor ERG known as an adverse prognostic factor for acute leukemia has been also reported [71]. [score:2]
In situ localization of miR-196a in laryngeal tissues. [score:1]
0071480.g006 Figure 6 In situ localization of miR-196a in laryngeal tissues. [score:1]
In the current release of miRBase, both miR-196a-5p and-3p arm sequences are annotated in mir-196a-2 precursor, while miR-196a-5p but not-3p sequence is annotated in mir-196a-1 precursor. [score:1]
There are two distinct genes for miR-196a, namely mir-196a-1 at chr17 and mir-196a-2 at chr12, and their transcribed mature miRNAs share the same 5′ arm sequence (miR-196a-5p, referred shortly as miR-196a) with their 3′ arm sequences slightly different. [score:1]
Furthermore, high levels of miR-196a activates the AKT signaling pathway and promotes cancer cell detachment, migration, invasion, but does not impact on proliferation or apoptosis in the colorectal cancer cell line [69]. [score:1]
After one week, tumors were measured in three dimensions using calipers, and then either miR-196a inhibitor or control combined with AteloGene™ (KOKEN, Tokyo, Japan) (1 nmol/200 µl) was injected into the subcutaneous spaces around the tumors. [score:1]
The repertoire of miR-196a isomiRs in laryngeal cancer and non-cancer tissues. [score:1]
0071480.g004 Figure 4(A) The significance of miR-196a as a promising biomarker for laryngeal cancer was confirmed by TaqMan® qRT-PCR using 84 tissue samples. [score:1]
+23) is in relative to the start site of the mature miR-196a miRBase entry as +0. [score:1]
Negative control without miR-196a-specific probe is shown (right panel). [score:1]
Our findings suggested that miR-196a could be a potential tumor marker in the FFPE tissue sample of laryngeal cancer. [score:1]
miR-196a Detection and Localization in Laryngeal Cancer by in situ Hybridization. [score:1]
By employing deep sequencing technique, the multiplicity and other frequent repertoire of isomiRs could be detected with miR-196a, including those are not annotated in the current release of miRBase. [score:1]
Mean relative fluorescence unit of live cells or dead cells treated with control was set at 1 and the effect of miR-196a inhibition was evaluated. [score:1]
There are 2 genomic loci that produce the same mature miR-196a-5p sequence, namely mir-196a-1 in chromosome 17 and mir-196a-2 in chromosome 12. [score:1]
Thus, qRT-PCR analysis was performed on residual 4 miRNAs (i. e., miR-130b-5p, miR-196a, miR-455-5p, and miR-133b). [score:1]
Short read alignments are shown against both mir-196a-1 precursor at chr17∶46709852-46709921[-] (GRCh37.p5 coordinates) (upper panels) and mir-196a-2 precursor at chr12∶54385522-54385631[+] (lower panels). [score:1]
Our study provided the possibilities that miR-196a might be very useful in diagnosing and treating laryngeal cancer. [score:1]
For in situ hybridization (ISH) of miR-196a, the 3′-DIG-labeled locked nucleic acid-incorporated miRNA probe (miRCURY LNA™ microRNA Detection Probe, Exiqon, Vedbaek, Denmark) was used in this study. [score:1]
Actually, our preliminary data revealed that miR-196a could be detected in a serum sample obtained from advanced cancer patients (data not shown). [score:1]
Heterogeneity of miR-196a isomiRs in Deep Sequencing Data. [score:1]
After proteinase K digestion, the sections were fixed in 4% paraformaldehyde, and the slides were then hybridized with 4 pmol Exiqon’s miRCURY LNA detection probe complementary to miR-196a in hybridization buffer (50% formamide, 5×SSC, 0.1% Tween, 9.2 mM citric acid (pH 6), 50 µg/ml heparin, and 500 µg/ml yeast RNA) overnight at 50°C. [score:1]
Boxed fields are presented with higher magnification in panel B. (B) miR-196a was detected both in cancer cells (right panel; filled arrowheads) and stroma (right panel; grey arrowheads), while not detected in normal squamous cell epithelium (left panel; white arrowheads). [score:1]
To determine whether miR-196a mediates tumorigenesis in laryngeal cancer, we first evaluated the miR-196a inhibition in JHU-011 cell line primary derived from laryngeal cancer. [score:1]
Together with these findings, miR-196a could be a favorable marker for laryngeal cancer. [score:1]
Qualitative Difference of miR-196a isomiRs Revealed by Deep Sequencing. [score:1]
Recently, it has been reported that miR-196a has a role in differentiation and proliferation of human adipose tissue-derived mesenchymal stem cells [70]. [score:1]
As mentioned in cardiac miRNAs in a recent report [79],miR-196a could be produced by stromal cells with a paracrine function. [score:1]
Future studies on the detection of miR-196a on a higher number of patients are warranted. [score:1]
miR-196a as a potential diagnostic marker for laryngeal cancer. [score:1]
0071480.g003 Figure 3(A) Expression levels of miR-455-5p and miR-196a were measured by TaqMan® qRT-PCR using 48 tissue samples. [score:1]
In situ Hybridization for miR-196a. [score:1]
Among a series of miR-196a isomiRs detected in each sample, the most abundant ones in cancer samples were nearly equal to the canonical sequence deposited in miRBase entry (MIMAT0000226, 5′- uagguaguuucauguuguuggg −3′), while those in non-cancer samples were shorter at both ends with 1–2 nucleotides (Figure 5B). [score:1]
[1 to 20 of 103 sentences]
5
[+] score: 288
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196b, hsa-mir-615
As expected, the expression of mHTT and Hip-1 was not altered by the overexpression of miR-196a since HTT is not the putative target of miR-196a based on targetscan database (http://www. [score:9]
The overexpression of miR-196a in HD-NPCs and HD-NCs can downregulate the expression of ANX1A (Fig 3D and 3E) to promote cell survival and reduced apoptosis (Fig 4). [score:8]
The expression level of CBP (B and D) and PGC1α (C and E) was illustrated by relative fold change on the expression level of miR-196a overexpressing cells to parent WT-NPCs or HD-NPCs, and WT-NCs or HD-NCs, respectively. [score:7]
ANX1A is targeted by miR-196a and suppresses apoptosis in cancer cells overexpressing miR-196a [37]. [score:7]
Although mHTT transgene might not be the target of miR-196a, the expression of endogenous HTT gene was also unaltered which suggested both endogenous HTT and mHTT genes were not affected by the overexpression of miR-196a (Fig 2B). [score:7]
Although dysregulation of ANXA1, a putative target of miR-196a, in HD has strongly suggested the role of miR-196a in regulating neural cell response to stress and pathogenic changes in cells such as the accumulation of mHTT aggregates, continued effort in identifying gene targets of miR-196a that were dynamically changed during HD progression will lead to insight on the role of miR-196a in HD pathogenesis. [score:7]
The expression level was illustrated by relative fold change on the expression level of miR-196a expressing cells to parent WT-NPCs or HD-NPCs, and WT-NCs or HD-NCs, respectively. [score:7]
Additionally, the expression of mHTT was not affected by the overexpression of miR-196a as expected, since HTT is not a putative target of miR-196a (Fig 2B). [score:7]
Upregulation of CBP and PGC-1α was observed in HD-NPCs (Fig 5B and 5C) and HD-NCs (Fig 5D and 5E) overexpressing miR-196a. [score:6]
The overexpression of miR-196a resulted in an upregulation of both CBP and PGC1α genes in HD-NPC and HD-NCs (Fig 5B–5E). [score:6]
Expression level of BDNF was not significant different in WT and HD-NPCs with miR-196a (Fig 3F) or without miR-196a (S2G Fig) overexpression suggested that miR-196a has no significant impact on BDNF functions in NPCs since BDNF is not highly expressed in NPCs compared to NCs. [score:6]
Although the HTT gene is not a putative target of miR-196a, miR-196a targets genes that are involved in neuronal differentiation, neurite outgrowth [34], cell death and survival that further suggested its role in HD pathogenesis [32, 34– 36]. [score:5]
Similar expression pattern for CBP and PGC-1α was also observed in WT-NCs except that PGC-1α was not significantly increased in WT-NCs expressing miR-196a (Fig 5E). [score:5]
0162788.g002 Fig 2(A) Expression of miR-196a in NPCs overexpressing miR-196a was illustrated by relative fold change to parent WT or HD NPCs. [score:5]
Our findings demonstrated the upregulation of miR-196a could be a compensatory response in HD to defend against cell cytotoxicity, apoptosis, transcriptional dysregulation, proteosome and mitochondrial dysfunctions that lead to neuronal cell death. [score:5]
On the contrary, overexpression of miR-196a in HD-NCs enhanced BDNF expression, which benefits neural cell survival (Fig 4D)[34]. [score:5]
ANX1A is a mediator of apoptosis and inhibitor of cell proliferation which has been reported in various cancer types [48, 49] and is a putative target of miR-196a [37]. [score:5]
However, the overexpression of miR-196a has no effect on the expression of mHTT (Fig 2D). [score:5]
Additionally, the basal expression of the Tet-On construct without doxycycline induction was sufficient to express miR-196a (Fig 2A and 2C) and improve properties of HD-NPCs and HD-NCs as shown in this study. [score:5]
In WT-NPCs, overexpression of miR-196a increased apoptosis (Fig 4C) while a significant reduction in cleaved caspase-3 positive cells was observed in HD-NPCs overexpressing miR-196a (Fig 4E). [score:5]
Overexpression of miR-196a in HD cells may elicit compensatory mechanism that ameliorates HD pathology while overexpression in WT cells may induce apoptosis similar to tumor formation defense mechanism since miR-196a has an anti-tumorigenic function. [score:5]
HIP-1 is a pro-apoptotic protein [47] that interacts with HTT, and its expression was also not affected by the overexpression of miR-196a in both NPCs and NCs (Fig 3B and 3C). [score:5]
The expression of mHTT was not different in HD-NPCs (Fig 2B) and HD neurons (Fig 2D) with or without overexpressing miR-196a (Fig 3A). [score:5]
Dyregulated genes in HD-NPCs and HD-NCs overexpressing miR-196a. [score:4]
However, the role of miR-196a in HD pathogenesis has not yet been fully understood while HTT is not the direct target of miR-196a. [score:4]
Moreover, miR-196a was also highly expressed during early cancer development and is a potential early cancer biomarker [19, 33]. [score:4]
Our results suggested that miR-196a might improve mitochondrial function by the upregulation of CBP and PGC-1α to promote oxidation phosphorylation and reduce oxidative stress, which was consistent with the amelioration of cytotoxicity by miR-196a. [score:4]
However, the overexpression of miR-196a in HD-NPCs showed a beneficial effect on cell cytotoxicity compared with HD-NPCs without overexpressing miR-196a (Fig 4B). [score:4]
Upregulation of miR-196a in HD-NHP brain, NPCs and NCs. [score:4]
miR-196a improved mitochondrial morphology and gene expression. [score:3]
Among these three candidates, overexpression of miR-196a ameliorates spinal and bulbar muscular atrophy (SBMA) [32] and HD [15] cellular and clinical phenotypes that suggested the therapeutic potential of miR-196a. [score:3]
No significant effect was observed on cytotoxicity in WT-NPCs with or without the overexpression of miR-196a (Fig 4B). [score:3]
Impact of overexpressing miR-196a in NPCs and NCs. [score:3]
Our results further suggested the overexpression of miR-196a did not affect NPC property and NC differentiation. [score:3]
When miR-196a was overexpressed in HD-NPCs, an increase in elongated thread of mitochondrion was observed which suggested the increase of mitochondrial fusion (Fig 5A, right panel). [score:3]
Interestingly, WT-NPCs seem to respond differently to the overexpression of miR-196a that resulted in cytotoxic effect instead of reduced apoptosis in HD-NPCs. [score:3]
Expression of miR-196a was determined by quantitative RT-PCR (qPCR) using has-miR-196a TaqMan probe (Applied Biosystems). [score:3]
Overexpressing miR-196a in monkey NPCs and NCs. [score:3]
There was no difference in the expression of miR-196a in shHD and HD-NPCs and were both significantly higher than WT-NPCs (S1B Fig). [score:3]
The difference in results may be due to the different between WT, NPC and NC in response to changes in miR-196a expression levels. [score:3]
WT-NCs vs HD-NCs with or without overexpressing miR-196a. [score:3]
Effect of miR-196a on gene expression in HD-NPCs and HD-NCs. [score:3]
To further determine the relationship between HTT and miR-196a, we analyzed miR-196a expression in HTT knocked down HD-NPCs (shHD) that was previously described [41] and compared it with WT-NPCs and HD-NPCs. [score:3]
Expression of miR-196a and mHTT in HD monkeys and humans brain. [score:3]
All NPCs with or without overexpressing miR-196a were in vitro differentiated into NCs [41]. [score:3]
Reduction of G6PD cytotoxicity was observed in miR-196a expressing HD-NPCs and HD-NCs (Fig 4B and 4D). [score:3]
Significant reduction in ANX1A was found in WT- and HD-NPCs and NCs overexpressing miR-196a (Fig 3D and 3E) that suggested the neuroprotective effect of miR-196a. [score:3]
Elevated expression levels of miR-196a in WT-NPCs and HD-NPCs did not affect the NPC property based on the immunostaining of NPC markers including Sox-2, Pax-6, Musashi-1 and Nestin (S1A Fig) and NC differentiation (Fig 2E). [score:3]
Establishment of HD-NPCs over expressing miR-196a. [score:3]
Our next step was to determine if overexpressing miR-196a affect neural differentiation. [score:3]
Overexpression of miR-196a reduced cleaved caspase-3 production in HD-196a NPCs suggested the anti-apoptotic effect of miR-196a [34] (Fig 4C). [score:3]
Clinical benefits of miR-196a have been reported in neurodegenerative disorder such as SBMA via targeted silencing of CUGBP, Elav-like family member 2 (CELF2) [32], and human immunodeficiency virus type 1(HIV-1) associated neurodegeneration by interfered HIV-1 trans-activator of transcription (Tat) protein [35]. [score:3]
Upregulation of miR-196a was also observed in undifferentiated pluripotent stem cells (PSCs), NPCs, and NCs derived from HD-NHPs when compared to the controls (Fig 1D). [score:3]
In HD-NPCs overexpressing miR-196a, mitotracker staining of mitochondria demonstrated the reduction of fragmentation in HD-NPCs. [score:3]
Based on miRNA array study on WT and HD monkey brains, miR-196a was one of the dysregulated miRNAs that was also found to be dysregulated in human HD brains [17]. [score:3]
Overall, we demonstrated the overexpression of miR-196a could ameliorate cytotoxicity and apoptosis in HD-NPCs and HD-NCs. [score:3]
The overexpression of miR-196a did not affect progenitor cell properties and neural differentiation capability in both WT- and HD-NPCs (S1 Fig). [score:3]
0162788.g001 Fig 1Expression of miR-196a and mHTT in HD monkeys and humans brain. [score:3]
Tet-on inducible system was initially designed to control miR-196a expression. [score:3]
Expression of miR-196a and mHTT transgene in HD1 and HD7-NHP striatum were measured by qPCR (Fig 1A and 1B) and both exhibited higher expression levels when compared to the WT-NHP (Fig 1A and 1B). [score:2]
Overexpression of miR-196a in both WT-NPCs and HD-NPCs significantly improve viability at similar levels that suggested improvement in NADH production as shown by MTT assay (Fig 4A). [score:2]
A lentiviral vector carried miR-196a under the control of Tet-On inducible system (Tet-hsa-miR-196a) with zeocin resistant gene regulated by human polyubiquitin promoter (Ubi-zeo) placed downstream of the Tet-hsa-miR-196a (pLV-miR-196a) was used in this study. [score:2]
We confirmed the overexpression of miR-196a in NCs derived from both WT-196a NPCs and HD-196a NPCs when compared to those derived from WT-NPCs and HD-NPCs (Fig 2C). [score:2]
Immunocytochemistry assay of WT and HD NPCs with or without overexpressing miR-196a and shHD. [score:2]
To further confirm if mitochondrial function was improved by miR-196a, the expression levels of genes that are related to mitochondrial functions and are dysregulated in HD were quantitatively measured. [score:2]
miR-196a expression was significantly increased in NPCs of WT-196a NPCs and HD-196a NPCs when compared to WT-NPCs and HD-NPCs, respectively (Fig 2A). [score:2]
Cytotoxicity in HD-NCs was significantly higher compared to WT-NCs and the overexpression of miR-196a ameliorated cytotoxicity in both WT-NCs and HD-NCs (Fig 4D). [score:2]
S1 Fig assay of WT and HD NPCs with or without overexpressing miR-196a and shHD. [score:2]
A positive result in MTT assay suggested miR-196a over expression enhanced cell survival and proliferation. [score:2]
These findings were consistent with miR-196a expression pattern in human HD striatum where miR-196a was significantly increased in Stage 1 and 3 (n = 4) HD patients when compared to the controls (n = 4) (Fig 1C). [score:2]
Although NPCs are less sensitive to HD toxicity compared to NCs, both HD-NPCs and HD-NCs exhibited reduced cytotoxicity when overexpressing miR-196a. [score:2]
Most importantly, these HD specific cellular phenotypes can be reversed by genetic and chemical treatment which suggested the potential of this progenitor cell mo del for studying the pathogenic role of miR-196a in HD [41]. [score:1]
Recently, bioinformatics analysis showed potential mechanism of miR-196a significantly altered ABC transporter, RIG-I like receptor pathway, immune system, tissue remo deling and cytoskeleton remo deling in HD rodent mo del [34]. [score:1]
Ameliorate cytotoxicity and apoptosis in NPCs and NCs by miR-196a. [score:1]
Three of the five miRNAs (miR-196a-5p, miR-196b-5p and miR-615-3p) have near zero levels in the control which suggested their potential as a biomarker for HD [17]. [score:1]
Effect of miR-196a on mitochondrial morphology and functions. [score:1]
This result suggested the role of miR-196a in mitochondrial functions. [score:1]
To further confirm if miR-196a improves apoptosis in NPCs, WT- and HD-NPCs were immunostained with antibody that specifically recognized cleaved caspase-3 followed by cell count analysis. [score:1]
miR-196a ameliorated cytotoxicity and apoptosis in NPCs and NCs. [score:1]
Overexpression of miR-196a in WT-NPCs and HD-NPCs was confirmed by quantitative measurement in WT-NPCs and HD-NPCs with (WT-196a NPCs and HD-196a NPCs) or without (WT-NPCs and HD-NPCs) introduced with miR-196a transgene by lentiviruses. [score:1]
The relation between miR-196a and Hox gene cluster further suggested its involvement in neuroprotective response in HD [17, 21]. [score:1]
Since the neuroprotective effect of miR-196a was clearly shown in HD-NPCs, our next step was to determine if a similar effect was found in neural cells. [score:1]
High titer LV-miR-196a was prepared by the co-transfection of 0.68 ug of pVSVG, 1.014 ug of Δ8.9, and 1.35 ug pLV-miR-196a into 293FT cell [7, 39]. [score:1]
Improvement in viability was demonstrated by MTT assay and reduced cytotoxicity by G6PD assay in miR-196s expressing NPCs and NCs further suggested the beneficial effect of miR-196a in ameliorating HD cellular defects (Fig 4) [34]. [score:1]
[1 to 20 of 84 sentences]
6
[+] score: 264
Other miRNAs from this paper: hsa-mir-196a-1
In conclusion, our results suggest that miR-196a is overexpressed in pancreatic cancer cell lines, and down-regulation of miR-196a by anti-miR-196a suppresses proliferation and migration of pancreatic cancer, partially by targeting NFKBIA. [score:10]
In this study, we demonstrate that miR-196a is overexpressed in pancreatic cancer cell lines and have investigated the effect of down-regulation of miR-196a on a pancreatic cancer cell line, PANC-1. We have elucidated that NFKBIA is a target of miR196a, and miR-196a plays an important role in the development and progression of pancreatic cancer likely by targeting NFKBIA. [score:9]
The percentage of cells at G [0]/G [1] phase at 72 h was increased from (56.07±7.93)% (anti-miR-NC) to (67.20±3.12)% (anti-miR-196a) (*, P<0.05), while there was no statistic significance in G [0]/G [1]between anti-miR-196a group and anti-miR-NC group at 24 h and 48 h. (C) Representative western blot analysis showed downregulation of Cyclin D1 and CDK4/6 expression after suppression of miR-196a in PANC-1 cells at 72 h. (D) Comparison of apoptosis among anti-miR-196a, anti-miR-NC and Blank. [score:8]
Moreover, NFKBIA increased after down-regulation of miR-196a in PANC-1 cells, and decreased after up-regulation of miR-196a in BxPC-3 cells (Figure 5B). [score:7]
Online search for miR-196a targeting genes by TargetScan, miRanda and PicTar revealed that NFKBIA, a proto-oncogene associated with migration and invasion, could be a potential target of miR196a (Figure 5A). [score:7]
With decreased migration potential after silencing miR-196a, elevated expression of E-cadherin and decreased expression of N-cadherin and Vimentin were observed, which implied that mesenchymal-epithelial transition contributed to suppression of PANC-1 cell migration after silencing miR-196a. [score:7]
Online search for miR-196a targeting genes by TargetScan, miRanda and PicTar revealed that NFKBIA could be a potential target of miR196a. [score:7]
Downregulation of miR-196a suppressed PANC-1 cell migration. [score:6]
It was revealed that anti-miR-196a was efficiently introduced into the cells (Figure 2A, Figure 2B) and down-regulated miR-196a expression level (Figure 2C). [score:6]
Downregulation of miR-196a inhibited proliferation of pancreatic cancer cell line PANC-1.. [score:6]
Downregulation of miR-196a suppresses PANC-1 cell migration. [score:6]
In our research, we elucidated that miR-196a was over-expressed in pancreatic cancer and its up-regulation was significantly associated with migration potential, which may promote pancreatic cancer progression and lead to poor prognosis. [score:6]
Taken together, the results indicate that knockdown of miR-196a suppresses cell proliferation, partly due to G [0]/G [1] arrest with Cyclin D1 and CDK4/6 expression decreased, but it is not associated with induction of apoptosis. [score:6]
The miR-196a target site-mutation NFKBIA 3′UTR luciferase reporter (NFKBIA-3′UTR mutation) construct was generated by employing direct-site mutagenesis using mutation primers which mutate the miR-196a binding site from ACTACCT to ATCGATC. [score:6]
Moreover, dual inhibition of NFKBIA and miR-196a promoted cells migration (Figure 6C, Figure 6D), which implied that inhibition of NFKBIA blocked the effect of anti-miR-196a on cell migration. [score:5]
It is reported that miR-196a is identified with increased expression to correctly differentiate pancreatic cancer from benign pancreatic tissue, and high expression of miR-196a is found to predict poor survival [6]. [score:5]
After silencing miR-196a, E-cadherin expression increased, as well as expression of N-cadherin and Vimentin decreased. [score:5]
Strikingly, with the reduction of PANC-1 cell migration after silencing miR-196a, increased expression of E-cadherin protein was observed, as well as decreased expression of N-cadherin and vimentin (Figure 4D). [score:5]
Furthermore, we demonstrated that miR-196a promoted pancreatic cancer proliferation through G [0]/G [1] arrest and decreased Cyclin D1 expression and CDK4/6 expression but not apoptosis. [score:5]
The inhibition of miR-196a in PANC-1 cells increased endogenous NFKBIA protein level, whereas overexpression of miR-196a in BxPC-3 cells attenuated endogenous NFKBIA protein level. [score:5]
Increased expression of E-cadherin was observed after silencing miR-196a, with expression of vimentin decreased (Figure 4C). [score:5]
As shown in Figure 1, miR-196a expression was much higher in pancreatic cancer cell lines compared with the immortalized pancreatic ductal epithelial cell line, especially in PANC-1. To further assess the biological role of miR-196a in pancreatic cancer, we chose PANC-1 for the follow experiments for its high expression of miR-196a and investigated the effect of targeted knockdown of miR-196a on cell proliferation and apoptosis. [score:5]
To detect the effect of down-regulation of miR-196a on cell cycle and apoptosis, flow cytometry analysis was performed. [score:4]
To explore the role of miR-196a in pancreatic cancer development, firstly we examined the expression of miR-196a in four pancreatic cancer cell lines (Capan-2, BxPC-3, PANC-1 and SW1990) and immortalized pancreatic ductal epithelial cell line H6C7 by miRNAs microarray and real-time RT-PCR. [score:4]
These results suggest that 3′UTR of NFKBIA is a direct target of miR-196a. [score:4]
As shown in Figure 5C, the luciferase activity in PANC-1 cells was decreased with WT construct by down-regulation of miR-196a level, which could be partly restored with mutant constructs. [score:4]
These findings prompted the hypothesis that NFKBIA might be a target gene of miR-196a. [score:3]
As shown before, expressions of Cyclin D1 and CDK4/6 decreased after silencing miR-196a. [score:3]
MicroRNA profiling studies indicate that miR-196a is over-expressed in several cancers, such as breast cancer [29], colorectal cancer [30], gastric cancer [31], and pancreatic cancer [6], [7]. [score:3]
PANC-1 cell was chosen because of its overexpression of miR-196a and imitation of pancreatic cancer biology better than other cell lines, especially in cell migration analysis [28]. [score:3]
It was interesting that decreased expressions of Cyclin D1 and CDK4/6 were observed after silencing miR-196a (Figure 3C). [score:3]
The possible miR-196a target genes by database analysis are summarized in Table S1. [score:3]
We next determined whether NFKBIA expression was negatively associated with miR-196a level in pancreatic cancer cell lines. [score:3]
MiR-196a directly targets NFKBIA gene. [score:3]
0087897.g004 Figure 4(A) Representative transwell assay indicated that the migration ability of PANC-1 cells was markedly reduced by down-regulation of miR-196a. [score:3]
Meanwhile, we wondered whether mesenchymal-epithelial transition (MET) contributed to suppression of PANC-1 cell migration after silencing miR-196a, we first observed the morphology of PANC-1 before and after transfection with anti-miR-196a. [score:3]
Furthermore, serum miR-196a expression level is found to have a potential value in predicting median survival time of pancreatic cancer patients. [score:3]
0087897.g005 Figure 5(A) NFKBIA is a potential target gene of miR-196a predicted by computational analysis. [score:3]
Table S1 Possible target genes of miR-196a. [score:3]
Moreover, miR-196a has been found to be overexpressed in pancreatic cancer, and significantly correlated with poor survival rate [8]. [score:3]
Furthermore, silencing NFKBIA promotes pancreatic cancer cells PANC-1 proliferation and migration, consistent with the results of ectopic miR-196a expression in the same cells. [score:3]
MiR-196a was significantly upregulated in pancreatic cancer cell lines. [score:3]
Emerging evidences imply that miR-196a contributes to tumor pathogenesis via the targeting of specific genes [36]- [39]. [score:3]
As proven in Figure 1, the expression of miR-196a was the highest in PANC-1 cells, and the lowest in BxPC-3 cells. [score:3]
NFKBIA is a target of miR-196a in pancreatic cancer. [score:3]
Meanwhile, dual inhibition of NFKBIA and miR-196a promoted cells proliferation. [score:3]
The hierarchical cluster revealed that miR-196a expressions in pancreatic cancer cell lines were much higher than that in H6C7 (Figure 1A). [score:3]
Moreover, inhibition of NFKBIA blocked the effect of anti-miR-196a on cell migration. [score:3]
Overexpression of miR-196a is associated with high-risk grade, metastasis and poor survival among gastrointestinal stromal tumors [32]. [score:3]
Meanwhile, as proven before, NFKBIA is a target of miR-196a, in order to abrogate the effect of anti-miR-196a, we co -transfected siNFKBIA and anti-miR-196a in PANC-1 cells. [score:3]
Meanwhile, It is reported that serum miR-196a expression levels in unresectable pancreatic cancer (stages III and IV) patients are significantly higher than those in resectable (stages I and II) patients [7]. [score:3]
To analyse the expression of miR-196a, qRT-PCR was performed in Four human pancreatic cancer cell lines (PANC-1, Capan-2, BxPC-3 and SW1990) and an immortalized pancreatic ductal epithelial cell line H6C7. [score:3]
It is implied that miR-196a may play a role in the development of human pancreatic cancer. [score:2]
Interestingly, an increasing number of reports indicate that miR-196a plays important roles in development and progression of cancer. [score:2]
MiR-196a is overexpressed in pancreatic cancer cell lines. [score:2]
Expression of miR-196a was (706.4±9.4)-fold in PANC-1 cells, (310.1±7.5)-fold in SW1990 cells, (7.6±1.1)-fold in BxPC-3 cells and (204.9±4.8)-fold in Capan-2 cells, compared with H6C7 (*, P<0.05). [score:2]
MiR-196a expression was significantly higher in pancreatic cancer cell lines in microarray. [score:2]
Transwell assay revealed that the migration ability of PANC-1 cells was markedly reduced by down-regulation of miR-196a, approximately 28% compared with control (P<0.05) (Figure 4A, Figure 4B). [score:2]
Expression of miR-196a was (706.4±9.4)-fold in PANC-1 cells, (310.1±7.5)-fold in SW1990 cells, (7.6±1.1)-fold in BxPC-3 cells and (204.9±4.8)-fold in Capan-2 cells, compared with H6C7 (P<0.05) (Figure 1B). [score:2]
The expression of miR-196a and its control U6 were detected using TaqMan miRNA assay system (Applied Biosystems, Foster City, CA, USA). [score:2]
MiR-196a was overexpressed in pancreatic cancer cell lines. [score:2]
Meanwhile, there was no significant difference of apoptosis among Blank, miR-NC and anti-miR-196a group in PANC-1 cells (Figure 3D). [score:1]
Our data showed that miR-196a contributed to proliferative and migratory potential of pancreatic cancer, which promoted our investigation on target genes associated with proliferation and migration. [score:1]
Also, si-NFKBIA transfected PANC-1 cells, si-NC transfected PANC-1 cells, si-NFKBIA+anti-miR-196a transfected PANC-1 cells and si-NC+anti-NC PANC-1 cells were harvested and dissociated into single cell suspension, 2×10 [3] cells were seeded in 96-well plate per well. [score:1]
For apoptosis analysis, anti-miR-196a -transfected PANC-1cells were also harvested at different hours (24 h, 48 h, 72 h) after transfection, stained with FITC-Annexin V and Propidium iodide (PI) and then analysed using a flow cytometer (BD Pharmingen, San Diego, CA). [score:1]
For cell cycle analysis, anti-miR-196a -transfected PANC-1cells were harvested at different hours (24 h, 48 h, 72 h) after transfection, and were trypsinized and fixed with ice-cold 70% ethanol for 18 h at 4°C. [score:1]
0087897.g006 Figure 6(A) Growth curve among si-NFKBIA, si-NFKBIA+anti-miR-196a and their appropriate controls. [score:1]
There was of no statistic significance between si-NFKBIA and si-NFKBIA+anti-miR-196a (P>0.05) (Figure 6A). [score:1]
In blank and anti-miR-NC group, some cells were partly spindle shape, whereas, anti-miR-196a cells were tightly bound, polygon cells with an epithelial phenotype. [score:1]
These results indicate that miR-196a indeed contributes to the migratory phenotype of pancreatic cancer cells, partly through MET. [score:1]
Two pairs of synthetic, chemically modified short single- or double-stranded RNA oligonucleotides: anti-miR-196a and its appropriate negative control (anti-miR-NC), miR-196a micmics and its appropriate negative control (miR-NC) were purchased from GenePharma (Shanghai, P. R. China). [score:1]
Effect of miR-196a on proliferation and apoptosis of PANC-1 cells. [score:1]
0087897.g003 Figure 3Repression of miR-196a increased G [0]/G [1] phase but had no effect on apoptosis of PANC-1 cells. [score:1]
Repression of miR-196a increased G [0]/G [1] phase but had no effect on apoptosis of PANC-1 cells. [score:1]
0087897.g002 Figure 2(A) Transfection of anti-miR-196a and anti-miR-NC in PANC-1. (B) Comparision of transfection rate between anti-miR-196a and anti-miR-NC in PANC-1. The transfection rate of anti-miR-196a was (88.76±2.25)%, while the transfection rate of anti-miR-NC was (91.09±1.77)% (P>0.05). [score:1]
Observation of morphology of Blank, anti-miR-NC and anti-miR-196a group was performed by microscope. [score:1]
[1 to 20 of 76 sentences]
7
[+] score: 261
Other miRNAs from this paper: hsa-mir-196a-1, mmu-mir-196a-1, mmu-mir-196a-2
Characteristically, a number of Hox genes are regulated by miRNAs [14], [27]– [29] and the Hoxc8 expression can be down-regulated by evolutionally conserved miR-196a via translational inhibition during vertebrate development [28]. [score:10]
The ASO against miR-196a suppressed the expression of Ucp1 (Figure 4G and 4H) and other brown-fat genes (Figure 4H), but not the leptin expression, indicating that miR-196a is necessary for the brown fat gene expression. [score:9]
The miR-196a expression was suppressed in the transfected cells (Figure 4E) and the Hoxc8 expression was recovered in the transfected adipocytes (Figure 4F), indicating that Hoxc8 suppression was mediated by miR-196a. [score:9]
After the adipogenic induction, the protein expression of Hoxc8 was suppressed in the Hoxc8-wt3′UTR-transduced cells than in Hoxc8-ΔmiR-196-BS- or Hoxc8-transduced cells (Figure S6B), suggesting that the suppression of Hoxc8 was dependent on the miR-196a -binding site in the Hoxc8 3′UTR. [score:7]
miR-196a Regulates Hoxc8 Expression in Brown Adipogenesis of WAT-Progenitor CellsWe next sought to identify the mechanism underlying the down-regulation of Hoxc8 during brown adipogenesis. [score:7]
The target gene of miR-196a is white-fat gene Hoxc8, which directly represses the expression of C/EBPβ, a master regulator of brown adipogenesis. [score:7]
Thus, the upregulation of miR-196a is required for the induction of brown fat gene expression during the differentiation of WAT-progenitor cells. [score:6]
In summary, during the brown adipogenesis induced by cold exposure or β3-adrenergic stimulations, miR-196a is induced in WAT-progenitor cells and suppresses Hoxc8, which targets C/EBPβ, an essential regulator of brown adipogenesis. [score:6]
Taken together, miR-196a is upregulated in the WAT-progenitor cells during the inducible brown adipogenesis in mice and is required for the induction of brown fat gene expression. [score:6]
Mechanistically, we observe that miR-196a acts by inhibiting the expression of the homeotic gene Hoxc8, a repressor of brown adipogenesis. [score:5]
The SVF cells isolated from the miR-196a mice were EGFP -negative immediately upon isolation, but they became EGFP -positive while they were kept in culture (Figure S8A) and expressed miR-196a (Figure S8B), resulting in Hoxc8 suppression (Figure S8C and S8D). [score:5]
miR-196a Induces Brown-Fat Genes Through Hoxc8 SuppressionWe next asked whether Hoxc8 was an essential target of miR-196a for the induction of brown-fat genes. [score:5]
The miR-196a expression is required for the brown-fat gene expression and sufficient to induce metabolically functional brown adipocyte-like cells in WAT in mice. [score:5]
Our findings imply the therapeutic potential of targeting the miR-196a- Hoxc8- C/EBPβ signaling pathway that induces metabolically functional brown adipocytes in WAT to treat obesity and its associated diseases. [score:5]
miR-196a Regulates Hoxc8 Expression in Brown Adipogenesis of WAT-Progenitor Cells. [score:4]
miR-196a is upregulated in WAT-progenitor cells during brown adipogenesis induced by cold or β-adrenergic stimulations. [score:4]
The brown fat gene expression was specifically high in the Hoxc8-wt3′UTR-tranduced cells (Figure S6C), indicating that the induction of brown-fat genes was regulated in a manner dependent on the miR-196a -binding site of Hoxc8 mRNA. [score:4]
These results suggest that miR-196a regulates brown-fat genes through suppression of Hoxc8. [score:4]
More detailed analyses showed that miR-196a was induced by forskolin, an adenylyl cyclase activator, implying the significant role of cyclic AMP pathway to regulate miR-196a expression (Figure S4B). [score:4]
Our findings suggest that the miR-196a- Hoxc8- C/EBPβ pathway may constitute a promising strategy for addressing the social and health problems caused by obesity and its associated diseases. [score:3]
The concept that miR-196a induces brown adipogenesis through the suppression of Hoxc8, which might function as a gatekeeper of brown adipogenesis in WAT, facilitated us to investigate the target gene of Hoxc8 transcription factor. [score:3]
For acute cold-exposure studies, 3- to 4-mo-old male mice were housed at 4°C for 5 h. For β3-adrenaline receptor stimulation, CL-316,243 (Sigma), at 0.5 mg/kg, was injected intraperitoneally once daily for 7 d. Transgenic mice with fat-specific forced expression of miR-196a were generated using a transgene encoding miR-196a driven by the enhancer/promoter of the aP2 gene [30], and littermates were used as the wild-type controls. [score:3]
Thus, miR-196a expression is induced in the SVF cells in mice exposed to β3-adrenergic stimulation or cold exposure. [score:3]
Antisense oligonucleotide against miR-196a (Anti-miR miRNA inhibitor, AM10068, Ambion) was transfected according to the manufacturer's instruction. [score:3]
miR-196a is required for the brown fat gene expression and is sufficient to induce metabolically functional brown adipocyte-like cells in mice. [score:3]
The endogenous expression of Hoxc8 and miR-196a was much lower in iBAT than in ingWAT and epiWAT. [score:3]
We show that forced expression of miR-196a in mouse adipose tissue increases BAT content and energy expenditure, thereby rendering the animals resistant to obesity and diabetes. [score:3]
miR-196a is induced in SVF cells during brown adipogenesis and is required for UCP1 expression. [score:3]
Figure S8Gene expression analysis in the WAT-progenitor cells derived from the miR-196a mice. [score:3]
The miR-196a expression levels were comparable among the different fat depots in the miR-196a mice (Figures 5C and S10). [score:3]
Based on the finding that the miR-196a expression is induced during the brown adipogenesis in WAT in mice, we next investigated whether the miR-196a induction is required for the induction of brown adipogenesis and Hoxc8 suppression. [score:3]
miR-196a post-transcriptionally suppress Hoxc8, which is one of the white-fat genes. [score:3]
The SVF cells isolated from the miR-196a mice expressed brown-fat genes more highly than the cells from wild-type (WT) mice after differentiation in vitro (Figure S8F), indicating that miR-196a promotes brown adipocyte differentiation of the WAT-progenitor cells. [score:3]
We next asked whether Hoxc8 was an essential target of miR-196a for the induction of brown-fat genes. [score:3]
Figure S3 The expression of miR-196a and Hoxc8 in SVF and adipocyte fraction. [score:3]
It is known that different WAT depots respond to brown fat-inducing stimulations to different extents [31], and we therefore addressed the responses to the miR-196a expression in different fat depots. [score:3]
We elucidated that miR-196a is induced in the WAT-progenitor cells after the induction of brown adipogenesis, is required for the induction of brown fat gene expression, and is sufficient to induce the metabolically functional brown adipocyte-like cells in WAT. [score:3]
We find that the expression levels of a microRNA, miR-196a, positively correlate with the conversion of WAT to BAT under cold exposure conditions. [score:3]
The miR-196a expression is induced in the WAT-progenitor cells in mice exposed to cold or β3-adrenergic stimulation. [score:3]
The miR-196a expression level was significantly lower in iBAT than WAT (Figure S4C) and was not altered during the differentiation of the iBAT-SVF cells (Figure S4D), suggesting that miR-196a might not be involved in conventional brown adipogenesis in iBAT. [score:3]
The induction of miR-196a is required for the brown fat gene expression and is sufficient to generate the metabolically functional brown adipocyte-like cells in WAT in mice. [score:3]
As a result, miR-196a enhanced the brown fat gene expression during differentiation, indicating the cell-autonomous function of miR-196a (Figure S9). [score:3]
miR-196a has been implicated in the in vitro osteoblast differentiation of human fat progenitor cells, where miR-196a suppresses Hoxc8 [47], but the in vivo relevance remains unknown. [score:3]
Figure S10 The miR-196a expression levels in tissues of the miR-196a mice. [score:3]
For lentivirus -mediated shRNA expression, pLenti6-miR-196a, -shHoxc8, and -shLacZ were generated from pcDNA6.2 constructs by Gateway reactions. [score:3]
The forced expression of miR-196a in mice did not yield appreciable effects in iBAT. [score:3]
Thus, the miR-196a- Hoxc8- C/EBPβ pathway underlies the brown adipogenesis in WAT (Figure 8) and might be a therapeutic target for the treatment of obesity and type 2 diabetes. [score:3]
In vitro, the miR-196a expression is induced during the differentiation of WAT-progenitor cells derived from both mice (Figure 4D) and humans (Figures S4A). [score:3]
To ask whether the miR-196a function is cell-autonomous, the human WAT-progenitor cells were transduced with lentivirus expressing miR-196a. [score:3]
We created transgenic mice in which miR-196a and EGFP were expressed under the control of the aP2 promoter/enhancer, which is exclusively active in adipose tissues [30]. [score:3]
miR-196a Induces Brown-Fat Genes Through Hoxc8 Suppression. [score:3]
We found that the miR-196a expression was induced in WAT depots of mice exposed to cold environment or β3-adrenergic stimulations (Figure 4A). [score:3]
The target gene of miR-196a is Hoxc8, which is categorized as a white-fat gene with a previously undermined role in adipogenesis. [score:3]
We found that miR-196a suppresses Hoxc8, thereby derepressing C/EBPβ, which leads to the activation of the brown fat gene program. [score:3]
Figure S4The expression analysis for miR-196a. [score:3]
A schematic of miR-196a-regulated brown adipogenesis of WAT-progenitor cells. [score:2]
Based on the hypothesis that Hoxc8 might be regulated by miR-196a, we investigated the miR-196a expression during the brown adipogenesis in mice. [score:2]
To interrogate the mechanism behind the obesity resistance of the miR-196a mice, indirect calorimetry was performed. [score:2]
The miR-196a binding site (CCCAACAACTGAGACTGCCTA) was deleted to generate Hoxc8-ΔmiR-196a-BS. [score:1]
The core body temperature was higher in the miR-196a mice than in the WT mice (Figure 6F). [score:1]
The in situ hybridization analysis of miR-196a showed the induction of miR-196a in WAT after CL-316,243 administration (Figure 4C). [score:1]
More specifically, miR-196a was more highly induced in the SVF cells (Figure 4B) than in mature adipocytes (Figure S3). [score:1]
1001314.g008 Figure 8Cold temperatures or β3-adrenergic stimulations induce miR-196a in the WAT-resident progenitor cells in mice. [score:1]
To address the necessity of miR-196a in the brown adipogenesis, antisense oligonucleotide (ASO) against mR-196a was transfected to the mouse SVF cells. [score:1]
These results imply that miR-196a prevented the mice from developing insulin resistance, the premorbid condition of type 2 diabetes. [score:1]
1001314.g006 Figure 6(A) The appearance of the WT and miR-196a mice fed a high-fat diet for 16 wk. [score:1]
The transgenic mice (hereafter, the miR-196a mice) were born in a Men delian ratio and were viable. [score:1]
Cold temperatures or β3-adrenergic stimulations induce miR-196a in the WAT-resident progenitor cells in mice. [score:1]
In this work, we elucidated that miR-196a induces functional brown adipocytes in WAT in mice. [score:1]
The sections were hybridized with 3′-digoxygenated probes (18 pmol/ml, miR-196a-AS-LNA1: cCcaAcaAcaTgaAacTacCta, Control (Ctrl)-LNA1: cGacTacAcaAatCagCgaTtt, capitals denote LNA) in Probe Diluent-1 (Genostaff) at 50°C for 16 h and washed in 5× HybriWash (Genostaff) at 50°C for 20 min, 50% formamide in 2× HybriWash at 50°C for 20 min, twice in 2× HybriWash at 50°C for 20 min, and twice in 0.2× HybriWash at 50°C for 20 min. [score:1]
The miR-196a complementary site was deleted to generate pCX4-HOXC8-ΔmiR-196-BS (binding site). [score:1]
Thus, miR-196a induces the brown adipocyte-like cells with characteristic appearance and gene expression profile of brown adipocytes in WAT. [score:1]
The sections were probed with a miR-196a-antisense (AS) probe or control (Ctrl) probe. [score:1]
miR-196a induces brown adipocyte-like cells in WAT. [score:1]
Figure S11The weight reduction in the miR-196a mice is attributable to a reduced fat accumulation. [score:1]
Figure S12Oxygen consumption rates and energy expenditure in the WT and miR-196a mice fed a high-fat diet. [score:1]
In the glucose tolerance tests, the miR-196a mice showed lower blood glucose (Figure 6G) and insulin levels (Figure 6H). [score:1]
The miR-196a Show Resistance to Obesity and Improved Glucose Metabolism. [score:1]
These findings suggest that miR-196a boosted the cellular energy combustion through the induction of brown adipocyte-like cells. [score:1]
We cloned the wild-type (Hoxc8-wt3′UTR) and miR-196a -binding site- deleted (Hoxc8-ΔmiR-196-BS) Hoxc8-3′UTR into a pCX4 retroviral vector and transduced these constructs into human WAT-progenitor cells (Figure S6A). [score:1]
1001314.g005 Figure 5 Based on the finding that miR-196a is capable of inducing the brown adipocyte-like cells, we next addressed whether they were metabolically functional. [score:1]
The WT mice exhibit more severe fatty livers than the miR-196a mice. [score:1]
There are two genes encoding miR-196a (miR-196a-1 and miR-196a-2) located within the Hox gene clusters [28]. [score:1]
The weight of the inguinal fat, epididymal WAT and liver is significantly lower in the miR-196a mice than in the WT mice. [score:1]
We next analyzed impacts of miR-196a on glucose metabolism in the miR-196a mice. [score:1]
The miR-196a mice show resistance to obesity and improved glucose metabolism. [score:1]
Taken together, these findings suggest that the miR-196a -induced brown adipocyte-like cells are metabolically functional and have favorable impacts on glucose metabolism in mice. [score:1]
The qRT-PCR analysis of miR-196a in tissues of the miR-196a mice. [score:1]
Our observations indicate that miR-196a has only a modest, if any, effect on iBAT. [score:1]
miR-196a Induces Brown Adipocyte-Like Cells in WAT. [score:1]
We here show that single miRNA miR-196a is capable of recruiting the metabolically functional brown adipocytes in WAT in mice. [score:1]
Based on the finding that miR-196a is required for the inducible brown adipogenesis, we next addressed whether miR-196a is capable of inducing brown adipogenesis in mice. [score:1]
In the iBAT, no appreciable influence of miR-196a was observed (Figure 5D and 5E). [score:1]
[1 to 20 of 93 sentences]
8
[+] score: 161
As expected, in untreated SCC cell lines, miR-196 was up-regulated and miR-10b was downregulated when expression levels were compared to untreated keratinocytes (data not shown). [score:8]
Gene expression profiles upon overexpression of miR-10b and miR-196a do not show regulation of known targets. [score:8]
TP73, up-regulated in cells overexpressing miR-196a, transcriptionally activates target genes leading to apoptosis and growth arrest [54]. [score:8]
From this analysis it became clear that the effect of the overexpression of miR-10b in SCC25 and FaDu, and miR-196a in keratinocytes do not act upon a large number of cellular processes but may rather target a small set of genes, some of which directly or indirectly involved in the progression of cell cycle. [score:7]
For up-regulation, the Ambion Pre-miR miRNA Precursor Molecule (hsa-miR-10b and hsa-miR-196a) was used, with Ambion’s Pre-miR negative control #1. Successful up-regulation was achieved with 50 nM of final Pre-miR miRNA Precursor concentration. [score:7]
Given the fact that miR-196a was found to be overexpressed in HNSCC samples, the inhibitory effect of miR-196a overexpression on proliferation of normal keratinocyes cannot easily put into context. [score:7]
Assessment of Ki-67 antigen expression, a cell proliferation marker, revealed that keratinocytes over -expressing miR-196a were mostly quiescent, as defined by a lack of Ki-67 antigen expression. [score:7]
A total of 353 annotated genes were downregulated (at 1.5 fold-change) following miR-196a over -expression in keratinocytes (Additional file 5). [score:6]
While keeping these drawbacks in mind, global gene expression profiling using DNA microarrays was performed in this study to identify deregulated cellular processes upon the overexpression of miR-10b and miR-196a in each cell mo del. [score:6]
Thus, the expression patterns of these three genes, following over -expression of miR-196a, would be in agreement with the observed arrest of the cell cycle. [score:5]
To gain insights into the potential mechanisms affected by the overexpression of the miR-10b and miR-196a in cells, deregulated genes were mapped to regulatory networks using Ingenuity Pathway Analysis (IPA Ingenuity Systems, http://www. [score:5]
Figure 6 Western blot analysis of ANXA1 expression in keratinocytes upon overexpression of miR-196a. [score:5]
MiR-196a/b was over-expressed and miR-10b was down-regulated in the OSCC samples compared with tumor-free surgical margins (Table  2). [score:5]
Schimanski and collaborators [43] demonstrated that HOX genes are targeted by miR-196, and HOX transcripts were also experimentally validated as miR-10 targets [44, 45]. [score:5]
A: Expression of miR-10b in the cell lines SCC25, SCC9 and FaDu following transfection with the specific miRNA precursor molecule; B: Expression of of miR-196a in normal keratinocytes following transfection with the specific miRNA precursor molecule. [score:5]
Click here for file Differentially expressed genes between keratinocytes overexpressing miR-196a and transfection controls. [score:5]
Differentially expressed genes between keratinocytes overexpressing miR-196a and transfection controls. [score:5]
We also show that miR-196a and miR-10b, not previously associated with HNSCC, may play an oncogenic role in this disease through the deregulation of cell proliferation. [score:4]
HOX-cluster embedded miR-196a/b and miR-10b were up- and down-regulated, respectively, in tumor samples. [score:4]
Figure 7 Pathway analysis of deregulated genes upon miR-196a overexpression in keratinocytes. [score:4]
Total protein extracts from cells overexpressing miR-196a (miR-196a) and negative controls (scramble) were analyzed by western blot for ANXA1. [score:3]
Efforts to understand the global effects of miR-196a, which might be cell-type dependent, are essential considering that it has been recently addressed as a potential therapeutic target [41]. [score:3]
The same was true for the miR-196a gene targets ANXA1, HOXA7, HOXB8, HOXC8, HOXD8, KRT5 and S100A9[42, 50, 51] (Additional file 5). [score:3]
These results suggest that, at least at the mRNA levels these genes are not targeted by miR-196a in the cells used here. [score:3]
One hypothesis could be that miR-196a overexpression in HNSCC could also be the consequence of uncontrolled proliferation, as a means to counteract it, rather than the cause of its perturbation. [score:3]
MiR-196a/b and miR-10b are embedded within homeobox (HOX) clusters of developmental regulators [42]. [score:3]
Figure 3 Expression of miR-10b in the cell lines SCC25, SCC9 and FaDu, and of miR-196a in normal keratinocytes following transfection with the specific miRNA precursor molecules. [score:3]
A: MiR-196a, miR-10b expression in thirty-nine paired tissue samples (fold-change between cancer and adjacent normal mucosa) of primary HNSCC. [score:3]
A significantly lower number of Ki67 -positive cells were observed upon over -expression of the miR-196a (*p < 0.05). [score:3]
Our results demostrate that ANXA1 is not targeted by miR-196a under the conditions studied here (Figure  6). [score:3]
Shown is the most significant interaction network based on deregulated genes in miR-196a overexpressing keratinocytes, calculated by IPA. [score:2]
Deregulation of homeobox cluster-encoded miRNAs miR-196a/b and miR-10b. [score:2]
When compared to transfection controls, cell proliferation was reduced approximately 5 fold in keratinocytes over -expressing miR-196a (Figure  4). [score:2]
Besides presenting data matching to current knowledge, in this study we show that two miRNAs, miR-196a and miR-10b, play distinct roles in the regulation of cell proliferation within a HNSCC background. [score:2]
We also performed functional assays for two differentially expressed miRNAs, miR-196 and miR-10b, since neither have been previously associated with HNSCC. [score:2]
Since tumor cells evade programmed cell death and sustain proliferative status [47], we tested whether miR-10b and/or miR-196a could play a role in this scenario. [score:1]
Precursor molecules of miR-10b were transfected into SCC25 and SCC9 (tongue squamous cell carcinoma-derived cell lines) and FaDu (a cell line derived from hypopharyngeal squamous cell carcinoma), while miR-196a precursor molecules were transfected into human keratinocytes derived from normal oral epithelium. [score:1]
We demonstrate that miR-10b and miR-196a interfere in cell proliferation through distinct processes and in a cell-type dependent manner. [score:1]
MiR10b and miR196a lead to cell cycle arrest through different mechanisms. [score:1]
Gain-of-function of miR-10b and miR-196a lead to impaired cell proliferation. [score:1]
[1 to 20 of 40 sentences]
9
[+] score: 152
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196b
On this basis, 31 (31.00%) cases were both low expression of miR-196a and miR-196b, 40 (40.00%) cases were both high expression of miR-196a and miR-196b, 12 (12.00%) cases were miR-196a-low and miR-196b -high expression, and 20 (20.00%) cases were miR-196a -high and miR-196b-low expression. [score:9]
Functionally, miR-196a has been found to promote cancer cell proliferation, detachment, migration, invasion of colorectal cancer and non-small cell lung cancer cell lines [20]; It can be used to correctly differentiate pancreatic cancer from benign pancreatic tissue, and high expression of miR-196a is found to predict poor survival [21]; Strong expression of miR-196a is also associated with a poor prognosis in patients with glioblastoma [22]; High miR-196a levels in gastric cancer patients’ sera may associate with the disease state and relapse potential [23]. [score:7]
Cox proportional hazard mo del confirmed that miR-196a expression (for OS: RR 6.28, 95% CI, 1.62–13.39, p = 0.01; for DFS: RR 6.95, 95% CI, 1.63–14.61, p = 0.01), miR-196b expression (for OS: RR 6.33, 95% CI, 1.61–13.48, p = 0.01; for DFS: RR 6.98, 95% CI, 1.65–14.82, p = 0.01) and miR-196a/ miR-196b expression (for OS: RR 9.89, 95% CI, 2.66–20.98, p = 0.001; for DFS: RR 10.09, 95% CI, 2.82–21.99, p = 0.001) were all independent prognostic factors of unfavorable survival in human osteosarcoma (Table 2). [score:7]
According to the results of Kaplan-Meier method and log-rank test, the patients with high miR-196a expression and high miR-196b expression both had shorter OS (both p < 0.001, Figure 2A,C) and DFS (both p < 0.001, Figure 2B,D) than those with high expressions. [score:7]
The upregulation of miR-196a was observed in glioblastoma, esophageal cancer, non-small cell lung cancer, pancreatic cancer, gastric cancer, colorectal adenocarcinoma and endometrial cancer, but it is downregulated in breast cancer and melanoma [19– 25]. [score:7]
Expression levels of miR-196a and miR-196b in osteosarcoma tissues were both significantly higher than those in noncancerous bone tissues (both p < 0.001), in line with which, the serum levels of the two miRNAs were also markedly upregulated in patients with osteosarcomas compared with healthy controls (both p < 0.001). [score:5]
We found that miR-196a and miR-196b expression were both upregulated in osteosarcoma tissues compared to the corresponding noncancerous bone tissues. [score:5]
Moreover, high serum miR-196a, high serum miR-196b and conjoined expression of miR-196a/ miR-196b were all independent prognostic factors for OS (overall survival) and DFS (disease-free survival) of osteosarcoma patients. [score:5]
We also confirmed the significant association of miR-196a overexpression with aggressive tumor progression and poor prognosis of patients with this disease. [score:5]
In contrast, miR-196a can suppress invasion and metastasis of breast cancer cells [24], and also inhibit the invasive behavior of melanoma cells [25]. [score:5]
As shown in Table 1, the upregulation of miR-196a and miR-196b both more frequently occurred in osteosarcoma patients with high tumor grade (p = 0.008 and 0.01, respectively), positive metastasis (p = 0.001 and 0.006, respectively) and recurrence (p = 0.001 and 0.006, respectively). [score:4]
Mueller D. W. Bosserhoff A. K. MicroRNA miR-196a controls melanoma -associated genes by regulating HOX-C8 expressionInt. [score:4]
Our present data indicate the involvement of miR-196a and miR-196b upregulation in the pathogenesis of osteosarcoma. [score:4]
In the current study, our data showed the upregulation of miR-196a in both osteosarcoma tissues and patients’ sera, which was similar with the reports of Namløs et al. [16] on osteosarcoma cell lines. [score:4]
Of note, the combined upregulation of miR-196a and miR-196b was also significantly associated with high tumor grade (p < 0.001), the presence of metastasis (p < 0.001) and recurrence (p < 0.001) of patients with osteosarcomas. [score:4]
Guan Y. Mizoguchi M. Yoshimoto K. Hata N. Shono T. Suzuki S. O. Araki Y. Kuga D. Nakamizo A. Amano T. miRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significanceClin. [score:4]
Of note, the OS and DFS of patients with combined miR-196a and miR-196b upregulation (miR-196a -high/ miR-196b -high) were the shortest (both p < 0.001, Figure 2E,F) when compared with patients in other three groups (miR-196a-low/ miR-196b -high, miR-196a -high/ miR-196b-low, miR-196a-low/ miR-196b-low). [score:3]
As another member of the miR-196 cluster, the expression patterns and the roles of miR-196b have been demonstrated to be very controversial across various cancer types. [score:3]
The correlation of miR-196a or miR-196b expression between osteosarcoma tissues and serum tissues was determined by Spearman Correlation analysis. [score:3]
Expression levels of miR-196a and miR-196b in osteosarcoma and corresponding noncancerous bone biopsy samples, as well as in patients’ sera and healthy controls were detected by qRT-PCR and normalized to RNU6B (U6 snRNA). [score:3]
More interestingly, the expression levels of miR-196a and miR-196b in osteosarcoma tissues were both significantly correlated with those in patients’ sera (for miR-196a: Spearman’s correlation: r = 0.62, p = 0.01, Figure 1E; for miR-196b: Spearman’s correlation: r = 0.68, p = 0.001, Figure 1F). [score:3]
RNU6 (Applied Biosystems) was used as the endogenous control for the expression of miR-196a and miR-196b. [score:3]
miR-196a is located in HOX gene clusters and potentially targets HOXB8, HOXC8, HOXD8 and HOXA7, which have been proved to play important roles in oncogenesis [18]. [score:3]
Multivariate analysis revealed that the miR-196a/ miR-196b co -expression profiles was an independent prognostic indicator for osteosarcoma. [score:3]
Quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis was performed to detect the expression levels of miR-196a and miR-196b in osteosarcoma tissues and patients’ sera. [score:3]
In the current study, we analyzed the expression of two miRNAs, miR-196a and miR-196b, in osteosarcoma tissue and serum samples for the association with clinicopathological and survival data from patients. [score:3]
Human miR-196 cluster consists three different members including miR-196a-1, miR-196a-2, and miR-196b, and appears to be expressed from intergenic regions in HOX (homeobox) gene clusters, which have been recognized as major transcription factors involved in embryogenesis, organogenesis and oncogenesis [13]. [score:3]
The advantages of miR-196a/ miR-196b co -expression to individual miR-196a or miR-196b in predicting the outcome of osteosarcoma has been shown in our result. [score:3]
In order to evaluate the associations of serum levels of miR-196a and miR-196b with the clinicopathological features of osteosarcoma patients, the median values of miR-196a (4.86) and miR-196b (5.48) expression in sera of 100 osteosarcoma patients were used as the cutoff points to divide these patients into miR-196a-low (n = 43), miR-196a -high (n = 57), miR-196b-low (n = 48) and miR-196b -high (n = 52) expression groups. [score:3]
Significant difference of prognosis was found among four different statuses of miR-196a/ miR-196b co -expression. [score:3]
More interestingly, we here also analyzed the association of miR-196a/ miR-196b conjoined expression with the prognosis of osteosarcoma. [score:3]
Liu C. J. Tsai M. M. Tu H. F. Lui M. T. Cheng H. W. Lin S. C. miR-196a overexpression and miR-196a2 gene polymorphism are prognostic predictors of oral carcinomasAnn. [score:3]
As the results, the expression levels of miR-196a and miR-196b in osteosarcoma tissues were both significantly higher than those in noncancerous bone tissues (both p < 0.001, Figure 1A,B). [score:3]
Peng S. Kuang Z. Sheng C. Zhang Y. Xu H. Cheng Q. Association of microRNA-196a-2 gene polymorphism with gastric cancer risk in a Chinese populationDig. [score:1]
The subjects with miR-196a -high/ miR-196b -high had the worst OS and DFS, while the miR-196a-low/ miR-196b-low had the best. [score:1]
Moreover, we found that higher serum levels of miR-196a and miR-196b were associated with short OS and short DFS of osteosarcoma patients. [score:1]
The miR-196a-1 gene is located on chromosome 17 (17q21.32) at a site between HOXB9 and HOXB10 genes, the miR-196a-2 gene is located at a region between HOXC10 and HOXC9 on chromosome 12 (12q13.13), and the miR-196b gene is located in a highly evolutionarily conserved region between HOXA9 and HOXA10 genes, on chromosome 7 (7p15.2) in human beings and chromosome 6 (6qB3) in mice [14]. [score:1]
miR-196a-1 and miR-196a-2 genes transcribe the same functional mature miRNA sequence, whereas miR-196b gene produces a small RNA, which differs from the sequence of miR-196a by one nucleotide [14]. [score:1]
Both miR-196a and miR-196b have been demonstrated to play a crucial role in normal cell differentiation, proliferation, and in tumorgenesis of various cancer types [15]. [score:1]
In the current study, the findings of miR-196b were very similar to miR-196a, suggesting that it might be also involved in malignant progression of osteosarcoma. [score:1]
Serum Levels of miR-196a and miR-196b Predicts Prognosis in Patients with Osteosarcoma. [score:1]
These findings indicate that miR-196a may exert opposite effects in different tumors. [score:1]
Serum Levels of miR-196a and miR-196b Associate with Clinicopathological Features of Human Osteosarcoma. [score:1]
Furthermore, the univariate and multivariate analyses showed that serum levels of miR-196a and miR-196b, and their combined serum levels were all independent predictors of OS and DFS of osteosarcoma patients. [score:1]
The statistical significance of the correlation of miR-196a and miR-196b expression with various clinicopathological parameters was evaluated by Fisher’s exact test or x2 test. [score:1]
More importantly, the altered levels of circulating miR-196a and miR-196b might have great potential to serve as novel and non-invasive prognostic factors for this malignancy. [score:1]
Accumulating studies have demonstrated that miR-196a may be implicated in malignancy, but its role may differ among various cancer types. [score:1]
Then, the elevation of serum miR-196a and miR-196b levels both more frequently occurred in osteosarcoma patients with high tumor grade (p = 0.008 and 0.01, respectively), positive metastasis (p = 0.001 and 0.006, respectively) and recurrence (p = 0.001 and 0.006, respectively). [score:1]
[1 to 20 of 48 sentences]
10
[+] score: 151
Three of the miRNAs, miR-196a-5p (mean control expression = 1.47; mean HD expression = 27.49), miR-196b-5p (mean control expression = 2.49; mean HD expression = 11.01) and miR-615-3p (mean control expression = 1.09, mean HD expression = 6.66), had near zero expression levels in all nine control samples. [score:15]
Four (miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p) of the five differentially expressed miRNAs are related to Hox cluster genes as follows: (1) these four are located in intergenic regions of the Hox clusters, (2) eleven Hox genes are validated targets of these four miRNAs, (3) Hox genes adjoining differentially expressed miRNAs are differentially expressed and (4) multiple Hox cluster genes are differentially expressed in HD versus control brains (Table 4 ). [score:11]
Recently, a study by Cheng et al. [13] found increased miR-196a expression suppressed mutant HTT expression in both HD neuronal cell mo dels and HD transgenic mouse mo dels. [score:7]
miR-10b-5p, miR-1247-5p, miR-196a-5p, miR-196b-5p, and miR-615-3p were identified as differentially expressed in Huntington's disease prefrontal cortex compared to non-neurological disease controls by Illumina miRNA-sequencing. [score:6]
1004188.g001 Figure 1 miR-10b-5p, miR-1247-5p, miR-196a-5p, miR-196b-5p, and miR-615-3p were identified as differentially expressed in Huntington's disease prefrontal cortex compared to non-neurological disease controls by Illumina miRNA-sequencing. [score:6]
Five of these, miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p and miR-1247-5p, were up-regulated in HD at genome-wide significance (FDR q-value<0.05), and three of these five, miR-196a-5p, miR-196b-5p and miR-615-3p, were expressed at near zero levels in the control brains. [score:6]
Together, these findings suggest a neuroprotective role for miR-196a and its targets and possible therapeutic implications across multiple polyglutamine-expansion neurodegenerative diseases. [score:5]
22 differential expressed targets of miR-10b-5p, miR-196a, miR-196b, miR-1247 and miR-615-3p. [score:5]
miR-196a-5p, miR-196b-5p and miR-615-3p were essentially not expressed in control samples, while the mean HD expression was 27.49, 11.01 and 6.66 respectively. [score:5]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p expression is related to Hox cluster gene expression. [score:5]
Information on experimentally validated miRNA targets of miR-10b-5p, miR-196a-5p and miR-615-3p were extracted from the miRWalk “Validated Targets” module [30]. [score:5]
Four of the five up-regulated miRNAs showed association to clinical features of HD (CAG repeat size, age of motor onset and age at death for miR-10b-5p; CAG repeat size and age at onset for miR-196a-5p, age at onset for miR-196b-5p and age at death for miR-615-3p). [score:4]
HOXB9 (FDR-adjusted q-value = 3.22e-03) immediately downstream of miR-196a-1 and HOXC10 (FDR-adjusted q-value = 4.14e-02) immediately upstream of miR-196a-2 were also up-regulated. [score:4]
Using pathway analysis, we showed that miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p targeted genes are predicted to be involved in apoptosis as well as nervous system development and function. [score:4]
After correcting for multiple comparisons, targets of miR-10b-5p, miR-196a, miR-196b and miR-615-3p shared significant overlap in 33 biological functions; the top three functional categories were “ Cell Death and Survival,” (Benjamini-Hochberg adjusted p-value, range = 3.5e-07–1.5e-04), “ Nervous System Development and Function” (range = 1.5e-07–1.5e-03) and “ Cellular Assembly and Organization” (range = 2.5e-05–1.7e-03). [score:4]
Seed sequences differ for miR-10b-5p (ACCCUGU), miR-615-3p (CCGAGCC) and miR-1247-5p (CCCGUCC) suggesting these miRNA have different targets, while miR-196a-5p and miR-196b-5p share a seed sequence (AGGUAGU) and only differ by a single base difference in mature miRNA sequence. [score:3]
miR-196a and miR-196b shared 28 targets. [score:3]
Among the twelve HD samples, the levels of four out of the five significantly differentially expressed miRNAs (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p) were strongly correlated with each other, (Spearman r range 0.71–0.88; p range 0.0002–0.01). [score:3]
Differentially expressed miRNA data trended as non-normally distributed in HD (miR-10b-5p, p = 0.04; miR-196a-5p, p = 0.05; miR-615-3p, p = 0.06), but not in controls (miR-10b-5p, p = 0.71; miR-196a-5p and miR-615-3p were essential zero). [score:3]
miR-196a-5p and miR-10b-5p were among the 56 miRNAs found to be elevated in response to mutant HTT over -expression in undifferentiated NT2 cells [36]. [score:3]
These findings suggest increased expression of miR-196a may be an adaptive response, promoting neuronal survival and may have therapeutic implications for HD. [score:3]
Targets for miR-196a-1 and miR-196a-2 were merged for analysis. [score:3]
Four out of five miRNA (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p) were confirmed as significantly increased in expression in HD (Table S4). [score:3]
mRNA targets of miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p may have similar functions. [score:3]
Miyazaki et al. [35] studied miR-196a in spinal and bulbar muscular atrophy (SBMA), a neurodegenerative disease caused by a similar polyglutamine repeat expansion in the androgen receptor (AR) gene. [score:3]
Expression of miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p are correlated. [score:3]
They found increased miR-196a expression via adeno -associated virus vector -mediated delivery reduced AR mRNA levels leading to improved neurological function in transgenic SBMA mouse mo dels. [score:3]
The essentially null level of expression in controls prevented meaningful assessment of the relationship of miR-196a-5p, miR-196b-5p and miR-615-3p with clinical variables, in particular age at death, or sample variables, post-mortem interval (PMI), or RIN/RQN. [score:3]
miRWalk targets of miR-196a, miR-196b and miR-1247 were not strand specific. [score:3]
The miRWalk database contained 84 unique targets for miR-10b-5p, 80 for miR-196a, 40 for miR-196b, two for miR-1247 and twelve for miR-615-3p. [score:3]
miR-10b-5p shared eleven targets with miR-196a-5p (HOXB8, COX8A, HOXA10, NPC1, FLT3, AKT1, NPM1, DROSHA, AGO2, NFYC, PAX7), and one with miR-615-3p (MAPK8). [score:3]
Due to the near zero level of expression in controls, it was not possible to assess the relationship of miR-196a-5p, mir-196b-5p and miR-615-3p to age at death, but miR-10b-5p was not correlated with age at death in controls. [score:3]
Packer et al. [11], studying an array of 365 mature miRNAs, had previously reported miR-196a-5p to be significantly increased by nearly six-fold in Brodmann Area 4 of HD grade 1 brains. [score:1]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-5p are related to HD pathogenesis. [score:1]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p have overlapping biological functions. [score:1]
miR-10b-5p, miR-196a-5p, miR-196b-5p and miR-615-3p implicate Hox cluster genes. [score:1]
CAG repeat size and age at onset were found to be independently, negatively related to miR-196a-5p (CAG, β = −0.15, p-value = 1.7e-02; onset, β = −0.07, p-value = 1.4e-03). [score:1]
Because the values of miR-615-3p and miR-196a-5p were essentially zero in the control samples, correlations among the miRNAs were not performed for controls. [score:1]
One of the miRNAs, miR-196a-5p was previously implicated in enhancing the survival of brain cells in HD. [score:1]
Because of gene duplication, miR-196a is derived from both the HOXB and HOXC clusters; miR-10b is located in the HOXD cluster and miR-615 is found in the HOXC cluster [31], [32]. [score:1]
[1 to 20 of 40 sentences]
11
[+] score: 80
A previous study identified that miR-196a inhibited HCV expression in the HCV replicon cell line and J6/JFH1 HCV cell culture system, in addition to targeting the HCV genome and the 3′-untranslated region of Bach1 mRNA (13). [score:9]
Among these miRNAs, miR-29a, miR146a, miR-149, miR-221 and miR-222 were identified to be upregulated, while miR-196a was downregulated by the overexpression of the HCV core protein (Table I). [score:9]
It was suggested that upregulation of miR-196a may be used in a novel strategy to prevent or treat HCV infection, and miR-196a may be valuable in the diagnosis and management of this disease (13). [score:6]
The present study confirmed that HCV core protein significantly downregulated miR-196a expression in HepG2 cells. [score:6]
miR-196a was significantly downregulated in HepG2-HCV cells as compared with that in the HepG2-control following efficient expression of the HCV core protein at 48 h (Fig. 2). [score:5]
miR-196a is significantly downregulated in the Ad-HCV infection group. [score:4]
The present study suggested serum miR-196a as a novel biomarker for CHC while profiling miRNAs in HCV core protein -overexpressing HepG2 cells. [score:3]
To investigate whether the miR-196a expression levels were affected by HCV core overexpression, HepG2 cells were infected with Ad-HCV core. [score:3]
Differences in miR-196a concentration between the two groups were expressed as fold changes. [score:3]
Furthermore, the clinical implications of aberrant miR-196a expression and the use of circulating miR-196 in the diagnosis and management of CHC was validated by the fact that serum miR-196a levels were significantly reduced in patients with CHC. [score:3]
RT-qPCR was conducted in order to determine the expression levels of miR-196a. [score:3]
This suggested a significant role for miR-196a in the modulation of HCV expression and the therapeutic response of antiviral agents in human hepatocytes. [score:3]
However, no correlations were observed between the expression levels of miR-196a, HCV viral load and ALT status. [score:3]
miR-196 has been previously demonstrated to have critical roles in normal development (20– 22) and in the pathogenesis of human malignancy (23– 26), immunology, inflammation and virus defense (12, 27, 28), which has led to various studies attempting to decode its functions. [score:2]
Although the present study had a small sample size, it provided the first clinical evidence of the use of circulating miR-196a as a biomarker of CHC, to the best of our knowledge. [score:1]
Analysis of the ROC curves for serum miR-196a demonstrated an AUC (area under the ROC curve) of 0.849 (95%CI: 0.756–0.941; P<0.001) with 81.8% sensitivity and 76.7% specificity in discriminating chronic HCV infection from healthy controls at a cut-off value of 6.115×10 [‒5] (Fig. 4). [score:1]
This suggested diagnostic value of circulating miR-196a in CHC. [score:1]
Relative miR-196a production, reported as 2 [‒∆∆Ct] (Ct represents the threshold cycle), was determined by the ∆Ct method. [score:1]
However, the clinical implications of aberrant miR-196a expression and the value of circulating miR-196a in the diagnosis and management of chronic HCV infection require further investigation. [score:1]
In order to investigate the clinical implications of aberrant miR-196a expression and the use of circulating miR-196 in the diagnosis and management of CHC, sera from 43 patients with CHC and 22 healthy volunteers were collected for biomarker validation. [score:1]
ROC analysis identified that miR-196a may be a sensitive, specific and practical clinical diagnostic biomarker for CHC. [score:1]
A previous study observed complementation between miR-196a and the nonstructural (NS) 5A coding region of the HCV JFH1 genome; in addition, IFN-β treatment led to significant miR-196 induction in the Huh-7 human hepatoma cell line and in primary murine hepatocytes (12). [score:1]
Finally, serum miR-196a levels were identified to be diagnostically valuable for CHC by producing an AUC of 0.849 (95%CI: 0.756–0.941; P<0.001) with 81.8% sensitivity and 76.7% specificity in discriminating CHC from healthy controls at a cut-off value of 6.115×10 [‒5]. [score:1]
Nor was a correlation observed between miR-196a and HCV -RNA (Fig. 3D). [score:1]
In conclusion, circulating miR-196a was significantly reduced in patients with CHC, potentially via reduced release of miR-196a from HCV-infected hepatocytes. [score:1]
These results indicated the potential for use of circulating miR-196a as a sensitive and informative biomarker for CHC. [score:1]
Serum miR-196a is significantly reduced in patients with CHC and is diagnostically valuable for CHC. [score:1]
Thus, miR-196a may represent an important factor in the pathogenesis of HCV infection. [score:1]
Therefore, it will be valuable to investigate combined miR-196a and HCV -RNA detection in the assessment of disease severity and progression risk during CHC. [score:1]
Thus it would be beneficial to monitor the dynamic alterations in plasma miR-196a levels during IFN treatment for CHC. [score:1]
The observation that the serum miR-196a was relatively low in patients with CHC, but may be easily detected in serum from healthy controls demonstrated for the first time that monitoring of circulating miR-196a may also be applied in clinical CHC diagnosis. [score:1]
Thus, the presence of reduced circulating miR-196a may be a novel sensitive and specific biomarker for early detection of CHC in humans. [score:1]
[1 to 20 of 32 sentences]
12
[+] score: 50
In order to confirm the results of the microarray analysis, we conducted a northern blot analysis to detect the expression levels of 8 representative differentially expressed miRNAs identified using the microarray, including 4 upregulated miRNAs (miR-196a, miR-193b, miR-383 and miR-143) and 4 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b and miR-590). [score:11]
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
A northern blot analysis was conducted to confirm that miR-196a and miR-490-5p were indeed differentially expressed in all 3 samples, which is consistent with the microarray results, whereas miR-193b and miR-383 were found to be upregulated in only 2 samples, and miR-1307 was downregulated in only 1 sample. [score:9]
However, only 5 miRNAs [miR-196a, miR-193b, miR-383 (upregulated), miR-490-5p and miR-1307 (downregulated)] produced northern blot analysis signals. [score:7]
The results from northern blot analysis also revealed that miR-196a was overexpressed in all the 3 samples, whereas miR-193b and miR-383 were overexpressed in only samples 1 and 3 between the undifferentiated hADSCs and the hADSCs which were subjected to chondrogenic differentiation. [score:5]
Since we confirmed that miR-196a and miR-490-5p were overexpressed and downregualted, respectively, in all 3 samples, we conducted functional analysis to detect the role of the 2 miRNAs in the chondrogenic differentiation of hADSCs. [score:3]
Since miR-196a and miR-490-5p were significantly differentially expressed in all 3 samples, we conducted a functional analysis. [score:3]
However, we only found that miR-490-5p, but not miR-196a (data not shown), had an obvious effect on chondrogenic differentiation. [score:1]
The probe sequences were as follows: miR-196a antisense, 5′-CCCAACAACATGAAACTACCTA-3′; miR-193b antisense, 5′-AGCGGGACTTTGAGGGCCAGTT-3′; miR-383 antisense, 5′-AGCCACAATCACCTTCTGATCT-3′; miR-490-5p antisense, 5′-ACCCACCTGGAGATCCATGG-3′; miR-1307 antisense, 5′-AGCCGGTCGAGGTCCGGTCGA-3′; and U6 antisense, 5′-GCCATGCTAATCTTCTCTGTATC-3′. [score:1]
However, we found that miR-490-5p, but not miR-196a (data not shown), had an obvious effect on chondrogenic differentiation. [score:1]
[1 to 20 of 10 sentences]
13
[+] score: 41
Table 1 miRNAs and the related immune responses and signaling pathways during hepatitis C virus infection miRNAs Related pathways Immune responses and roles miR-122Stabilize the HCV RNA genome and stimulate virus replicationPredict response to therapy with IFNImpede HCV entry into hepatocytes[14– 22] miR-155Wnt signalingTim-3 signalingEnhance the development of inflammatory T-cellsPromote autoimmune inflammationRegulate IFNr production from NK cellsIncrease β-catenin nuclear localization in Huh7 cells[23– 27] miR-146 TLR signalingRegulate the inflammatory and immune responsesCorrelate with cholesterol metabolism[28] miR-130aInhibit IFITM1 and the subsequent innate immune responsePlay dual roles in HCV replication by shaping the host innate immune response[29, 30] miR-21TLR signalingTGF-β1/SMADs signalingRepress the expression of type I IFN and the subsequent anti-viral responseTarget SMAD7Stimulate the proliferation of hepatocellular carcinoma cells[18, 31, 32] miR-181a MAPK/ERK signalingDecrease DUSP 6 expression and CD4 [+] T cell dysfunction[34] miR-27Inhibit virus infection and promotes lipid storageEnable the virus to escape immune surveillance[35, 47] miR-196 Suppress Bach1 expression, stimulates HMOX1 expression, and inhibits HCV gene expression. [score:24]
By directly binding the 3′-UTR of Bach1 mRNA, miR-196 suppresses Bach1 expression, stimulates HMOX1 expression, and inhibits HCV gene expression [36]. [score:12]
Of note, miR-196a expression can be stimulated in hepatocellular carcinoma cells by exposure to IFNβ [38]. [score:3]
Surveys showed that circulating miR-196a is significantly lower in patients with chronic hepatitis C, regardless of HCV viral load or alanine aminotransferase levels. [score:1]
This result was attributed to the reduced release of miR-196a from HCV-infected hepatocytes, highlighting miR-196a as a potential biomarker for early diagnosis of chronic hepatitis C [37]. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 39
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196b
The results (Figure 5B) indicate that miR-196a induced potent inhibition of the expression of the target reporter gene, whereas miR-196b conferred moderate levels of suppression against target reporter gene expression, thus suggesting different levels of recognition against HOXB8 between miR-196a and miR-196b. [score:13]
The resultant reporter gene was cotransfected with either synthetic miR-196a or miR-196b duplex into HeLa cells, and the expression levels of the reporter gene then examined. [score:3]
Different effects of miR-196a and miR-196b on recognition of target HOXB8. [score:3]
Different effects of miR-196a and miR-196b on recognition of target HOXB8 From the data of the mismatched siPrnp duplexes (Figures 2 and supplementary Figures s2 and s3) and shPrnp RNAs (Figure 3), it appears that the base substitutions conferring marked improvement are largely present in the region of siRNAs corresponding to the seed region of microRNA. [score:3]
Consequently, the evidence suggests that the mismatches in miR-196a and miR-196b probably influence the recognition of their target HOXB8 mRNA. [score:3]
We examined whether the mismatches in miR-196a and miR-196b participate in the recognition of their target, HOXB8. [score:3]
In the case of miR-196a and miR-196b presented in this study, the miRNAs appear to induce different levels of suppression against HOXB8 RNA. [score:3]
Different knockdown potencies against HOXB8 between miR-196a and miR-196b. [score:2]
0002248.g005 Figure 5Different knockdown potencies against HOXB8 between miR-196a and miR-196b. [score:2]
The miR-196a and miR-196b duplexes were chemically synthesized, as described previously [31]. [score:1]
The HOXB8 mRNA sequence, which is nearly complementary to miR-196a, together with mature miR-196a and miR-196b are aligned. [score:1]
From a previous study [31] and an miRNA database, we focused on miR-196a and miR-196b, both of which are nearly complementary to part of the 3′-UTR sequence of HOXB8 mRNA. [score:1]
Note that one and two mismatches are present in the predicted base-pairing of HOXB8 with miR-196a and miR-196b, respectively (Figure 5A). [score:1]
[1 to 20 of 13 sentences]
15
[+] score: 32
miR-21 Most common oncomiR in a wide range of cancers, acting as an anti-apoptotic factor targeting a network of p53, transforming growth factor beta (TGF-β), and mitochondrial apoptosis tumor suppressor genes miR-10b Commonly upregulated miRNA in glioblastoma, located in HOX cluster miR-128 miRNA associated with glioma stem cell properties and neuronal differentiation via Bmi-1 and epidermal growth factor receptor (EGFR)/platelet-derived growth factor (PDGF)/AKT signaling pathways miR-34b One of the most elucidated tumor suppressor miRNAs, considered a key regulator of tumor suppressor pathways; one of the promising targets for miRNA replacement therapy miR-196 Extremely highly expressed miRNA in glioblastoma showing significant association with overall survival Based on molecular pathological perspectives, GBM is a heterogeneous tumor. [score:16]
We recently revealed that expressions of miR-196a and miR-196b are extremely high compared with other overexpressed miRNAs in GBM (Guan et al., 2010). [score:4]
Our previous study using the array identified 16 miRNAs for which expression was significantly altered in GBM (WHO grade 4) compared with anaplastic astrocytoma (WHO grade 3), and demonstrated that overexpression of miR-196a/b correlates with shorter overall survival (Guan et al., 2010). [score:4]
Overexpression of miR-196 has also been identified in several other cancers (Gaur et al., 2007), and Bloomston et al. (2007) reported a correlation between miR-196a-2 and shorter overall survival in patients with pancreatic cancer. [score:3]
MiRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significance. [score:3]
Furthermore, we identified a significant association between high expression of miR-196a/b and shorter overall survival among GBM patients, so both of these miRNAs are considered to be associated with the malignant transformation of gliomas (Guan et al., 2010). [score:2]
[1 to 20 of 6 sentences]
16
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Mu Y. P. Tang S. Sun W. J. Gao W. M. Wang M. Su X. L. Association of miR-193b down-regulation and miR-196a up-regulation with clinicopathological features and prognosis in gastric cancer Asian Pac. [score:7]
Li H. L. Xie S. P. Yang Y. L. Cheng Y. X. Zhang Y. Wang J. Wang Y. Liu D. L. Chen Z. F. Zhou Y. N. Clinical significance of upregulation of miR-196a-5p in gastric cancer and enriched KEGG pathway analysis of target genes Asian Pac. [score:6]
Tsai et al. [59], through AMOs, used anti-miR-196a/-196b oligonucleotides or the over -expression of RDX, which may serve a therapeutic purpose to inhibit GC metastasis. [score:5]
Elevated miR-196a/-196b expression results in decreasing target RDX protein in GC cells and vice versa. [score:5]
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
Moreover, high expression of miR-196a/-196b promotes GC cell migration and invasion. [score:3]
Tsai M. M. Wang C. S. Tsai C. Y. Chen C. Y. Chi H. C. Tseng Y. H. Chung P. J. Lin Y. H. Chung I. H. Lin K. H. MicroRNA-196a/-196b promote cell metastasis via negative regulation of radixin in human gastric cancer Cancer Lett. [score:1]
[1 to 20 of 7 sentences]
17
[+] score: 31
The hox gene cluster in Drosophila contains high-ranking predicted targets (Enright et al. 2003) of miR-10 and miR-iab-4, and the hox gene cluster in mammals contains high-ranking targets of miR-196. [score:5]
Over 40 genes contain sites that have near perfect complementarity to a miRNA (S >120), and these target genes may be cleaved rather than translationally repressed as in the case of miR-196 and Hox-B8. [score:5]
We predicted miR-iab-4–3p to target abd-B in Drosophila, a gene related to the ancestral hox-7 cluster, the ancestral parent of many of the predicted targets of miR-196. [score:5]
Many Hox genes are conserved as targets, including the miR-196 targets, Hox-A4:miR-34a, Hox-C9:let-7b (near prefect complementary match), and Hox-B5:miR-27b. [score:5]
What do our results imply regarding the mechanism of action?In analogy to plant miRNAs that have near perfect sequence complementarity and facilitate mRNA degradation, our predicted targets with near perfect complementarity between miRNA and mRNA plausibly are involved in mRNA cleavage (e. g., miR-196 and miR-138; see ). [score:3]
In analogy to plant miRNAs that have near perfect sequence complementarity and facilitate mRNA degradation, our predicted targets with near perfect complementarity between miRNA and mRNA plausibly are involved in mRNA cleavage (e. g., miR-196 and miR-138; see ). [score:3]
Recent examples of cleavage of target messages are, in mouse, mir-196 guiding cleavage of Hox-B8 transcripts (Yekta et al. 2004) and, in Epstein Barr virus, miR-BART2, a virus-encoded miRNA, guiding the cleavage of transcripts for virus DNA polymerase (gene BALF5) (Pfeffer et al. 2004). [score:3]
In mouse, miR-181a modulates hematopoietic differentiation (Chen et al. 2004), and miR-196 directs the cleavage of Hox-B8 transcripts (Yekta et al. 2004). [score:2]
[1 to 20 of 8 sentences]
18
[+] score: 29
Another target of miR196a, Annexin A1 (ANXA1), has also been implicated in glioblastoma as a mediator of apoptosis and an inhibitor of cell proliferation [32]. [score:5]
We have already reported a significant association between high expression of miR-196 and shorter overall survival among glioblastoma patients [19]. [score:3]
Overexpression of miR-196 has also recently been identified in several cancers [27]. [score:3]
Previous study, which evaluated miRNA expression in human cancer cell lines, also showed overexpression of miR-196 in glioblastoma cell lines [27]. [score:3]
The function of miR-196 is, however, more complicated, since the targets of miRNA usually number more than one hundred. [score:3]
Furthermore, we clearly demonstrated that overexpression of miR-196a or -196b is correlated with shorter overall survival among patients with malignant glioma [19]. [score:3]
Expression of miR-196a and miR-196b is extremely high compared with other overexpressed miRNAs in glioblastoma, so both of these two miRNAs are considered to be associated with the malignant transformation of gliomas [19]. [score:3]
Our data also showed correlations between overexpression of miR-196 and shorter overall survival with malignant gliomas [19]. [score:3]
Three miR-196 genes have been identified; miR-196a-1 located on chromosome 17 (17q21.32) at HOXB cluster, miR-196a-2 located on chromosome12 (12q13.13) at HOXC cluster, and miR-196b is located on chromosome 7 (7p15.2) at HOXA cluster. [score:1]
4. miR-196. [score:1]
Bloomston et al. first reported the clinical implications of miR-196a-2 in patients with pancreatic cancer [28]. [score:1]
[1 to 20 of 11 sentences]
19
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Our analysis indicates that, about 3594 genes could be targeted by the eleven up-regulated miRNAs (bta-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-4286, miR-885, miR-196a, miR-23b-3p, bta-miR-199c and miR-3431) whereas 1163 genes could be targeted by the three down-regulated miRNAs (bta-miR-335, miR-200a and bta-miR-2299-5p) in linseed oil -treated cows. [score:11]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
miR-196 has a higher expression in visceral than subcutaneous fat in beef cattle, showing tissue specificity, which could be associated with adipogenesis [29]. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 20
For instance, miR-335-5p (targeting Wnt inhibitor DDK1) [33], miR-196a (targeting the chondrogenic transcription factor HOXC8) [34], miR-29b (targeting inhibitors of osteoblast differentiation TGF-β3, activin receptor type-2A and beta-catenin-interacting protein 1) [35] and miR-21 (targeting the inhibitory Smad7) [36], may promote osteogenesis by down -regulating the translation of inhibitors for osteogenesis and the bone formation process. [score:20]
[1 to 20 of 1 sentences]
21
[+] score: 19
miR-196a represses the expression Hoxc8, homeobox c8, which is highly expressed in white fat cells and inhibits brown fat differentiation. [score:7]
Expression of miR-196a is induced in subQ WAT following cold or β3-agonist stimulation and is required for Ucp1 expression (75). [score:5]
Thus, miR-196a regulates the expression of CEBPβ through Hoxc8 (Figure 2). [score:4]
Adipose-specific expression of miR-196a results in enhanced browning of WAT and protects mice from HFD -induced obesity and insulin resistance. [score:3]
[1 to 20 of 4 sentences]
22
[+] score: 19
” iSimp tags the following syntactic constructs: (i) A conjunction in the form of a list of elements (“miR-21, miR-210, miR-155, and miR-196a”), (ii)  A conjunction (“proven or predicted”), (iii)  The appositive construct involving the two noun phrases “four miRNAs” and “miR-21, miR-210, miR-155, and miR-196a”, (iv)  The reduced relative clause “all implicated in the development of pancreatic cancer with either proven or predicted target genes”, which modifies the noun phrase “four miRNAs” (v) Another reduced relative clause “involved in critical cancer -associated cellular pathways”, which modifies the noun phrase “target genes” Using constructs (i) and (iii) we can replace “four miRNAs” by “miR-21” in the construct (iv) and thus generate “miR-21 is implicated in the development of pancreatic cancer …”. [score:7]
” iSimp tags the following syntactic constructs: (i) A conjunction in the form of a list of elements (“miR-21, miR-210, miR-155, and miR-196a”), (ii)  A conjunction (“proven or predicted”), (iii)  The appositive construct involving the two noun phrases “four miRNAs” and “miR-21, miR-210, miR-155, and miR-196a”, (iv)  The reduced relative clause “all implicated in the development of pancreatic cancer with either proven or predicted target genes”, which modifies the noun phrase “four miRNAs” (v) Another reduced relative clause “involved in critical cancer -associated cellular pathways”, which modifies the noun phrase “target genes” Using constructs (i) and (iii) we can replace “four miRNAs” by “miR-21” in the construct (iv) and thus generate “miR-21 is implicated in the development of pancreatic cancer …”. [score:7]
For example, consider the following sentence: We have profiled four miRNAs, miR-21, miR-210, miR-155, and miR-196a, all implicated in the development of pancreatic cancer with either proven or predicted target genes involved in critical cancer -associated cellular pathways. [score:4]
Additional simplifications are also generated for the remaining elements of the list (miR-210, miR-155, or miR-196a). [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 18
This is particularly intriguing given that HOXA9 is the main HOX gene that directs tubal formation during müllerian development (Figure 3C), that it is expressed in mouse and human adult oviduct tissue [32], and that hsa-miR-196 can directly inhibit the expression of HOXA9 in tumors [33]. [score:10]
The action of miR-196 mimic produced no significant changes in expression of the predicted target genes studied48 and 72 hours after transfection (Figure 4B). [score:5]
Interestingly, the hsa-miR-196 sequence is located on chromosome 7, and is encoded on an intron of the HOXA9 gene (Figure 3B). [score:1]
Trophoblast cell lines transfection with miR-196 and miR223. [score:1]
We first validated the miRNAs found in the microarray analysis by performing real time PCR on hsa-miR-196 and hsa-miR-223 in the same samples used for the microarray experiments (Figure S1). [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 17
Several of these IFN -induced miRNAs (miR-1, miR-30, miR-128, miR-196, miR-296) are expressed in peripheral blood mononuclear cells (PBMCs) from healthy individuals and from chronic HCV-infected patients, and their expression is upregulated by IFN treatment to varying degrees [22]. [score:8]
We found that while expression of F705-STAT3 also blocked the IFN induction of miR-351 and miR-296, it had no effect on IFN -induced miR-196a expression. [score:5]
In addition, since miR-196a, miR-296 and miR-351 were found to be IFN -induced miRNAs [16], we explored the role of STAT3 in their IFN -induced expression. [score:3]
For example, miR-196 and miR-448 are induced by IFN in Huh7 hepatoma cells, and synthetic mimetics of these miRNAs attenuate HCV replication in vitro [16]. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 16
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
However, the differences in the expression profiles of miR-29a, miR-181a, miR-196a and miR-374a may be due to the presence of normal mammary stromal cells in the examined tumour samples, what is sometimes difficult to avoid. [score:3]
[1 to 20 of 2 sentences]
26
[+] score: 16
MiR-338 is the most up-regulated miRNAs with brain-specific functions, while among the down-regulated miRNAs, miR-196a is transcribed from intergenic regions within Hox genes clusters in vertebrates. [score:7]
Intriguingly, LHX2, which is crucial for the proper development of cerebral cortex in mouse embryo is a miR-196a target gene, and results overexpressed in DNMT3B -deficient cells (Gatto et al., 2010). [score:6]
As for the Hox genes, miR-196a acts as regulators of the nervous system development in embryos (Kosik, 2006). [score:3]
[1 to 20 of 3 sentences]
27
[+] score: 15
One functional network connected up-regulation of the differentiation inhibitor ID2 mRNA to down-regulation of the hematopoiesis- or cell cycle regulating miR-125b-5p, miR-181a-5p, miR-196a-5p, miR-24-3p and miR-320d in adult PreBII large cells. [score:10]
0070721.g007 Figure 7 Note connection of miR-125b-5p to ID2 and involvement of the hematopoiesis related miR-181a-5p and miR-196a-5p, and the cell cycle regulating miR-24-3p. [score:2]
Note connection of miR-125b-5p to ID2 and involvement of the hematopoiesis related miR-181a-5p and miR-196a-5p, and the cell cycle regulating miR-24-3p. [score:2]
Notably, the network also included the hematopoiesis associated miR-181a-5p [17] and miR-196a-5p [33], and the cell cycle associated miR-24-3p [34] and finally miR-320d. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 15
There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development. [score:5]
Non-coding RNAs known to be involved in regulation of HOX gene expression [16, 17], include the highly conserved microRNAs [18], such as miR-196[19] and miR-10[20]. [score:4]
In silico analysis as well in vitro and in vivo experiments have shown that the miRNAs miR-10 and miR-196 target several HOX genes, such as HOXA5/7/9, HOXB1/6/7/8, HOXC8, HOXD8, HOXA1/3/7, HOXB3 and HOXD10 [18- 20, 50, 51]. [score:3]
Using the tammar as a reference and searching the microRNA database we were able to identify four known HOX microRNAs (miR-196a miR-196b miR-10a and miR-10b), and most significantly, we uncovered one new potential microRNA, meu-miR-6313 in the tammar which was expressed in testis and fibroblasts. [score:3]
[1 to 20 of 4 sentences]
29
[+] score: 15
In BRCA, the study of Han et al. identified UBE2C as a direct and functional target of miR-196a which can upregulate the expression of UBE2C [54]. [score:9]
Meanwhile, we obtained a list of miRNAs including miR-671, miR-615, miR-20a, miR-17 and miR-196a through the gene-miRNA targets function of miRWalk 2.0, which were predicted to regulate the expression of UBE2C. [score:6]
[1 to 20 of 2 sentences]
30
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Also, miR-196 suppresses the anti-viral effect on HCV by suppressing HMOX1 and miR-279 inhibits HCV replication through regulation of lipid metabolism [43]. [score:8]
miR-196 and miR-448 are also capable of directly binding to and interacting with the HCV RNA genome and exerting inhibitory effects on HCV replication [60]. [score:4]
Conversely, miR-199a, Let-7b, miR-448 and miR-196 are all implicated in suppressing HCV RNA replication [58– 60]. [score:3]
[1 to 20 of 3 sentences]
31
[+] score: 15
Further studies need to be performed on a larger cohort to establish that miR-196a is a potential therapeutic target and can impact multiple downstream targets in canine osteosarcoma. [score:5]
They observed that miR-196a is downregulated in many of the canine osteosarcoma tumors compared to the normal bone, which is in contradiction with some earlier studies [66, 81]. [score:3]
Pazzaglia L. Leonardi L. Conti A. Novello C. Quattrini I. Montanini L. Roperto F. del Piero F. di Guardo G. Piro F. miR-196a expression in human and canine osteosarcomas: A comparative study Res. [score:3]
A recent study investigated the role of miR-196a and its target Annexin V in human (143B, MG63) and canine (DAN) osteosarcoma cell lines to identify potential targets for new therapeutic agents in both the species [80]. [score:3]
Zhang W. Zhang C. Chen H. Li L. Tu Y. Liu C. Shi S. Zen K. Liu Z. Evaluation of microRNAs miR-196a, miR-30a-5P, and miR-490 as biomarkers of disease activity among patients with FSGS Clin. [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 14
To link a novel mechanism by which expression is potentially dysregulated in CD, Brest et al. analyzed the expression and localization of and miR-196 in the colonic mucosa (93). [score:6]
Expression of within the colonic epithelium is high under normal conditions, but is reduced during inflammation while epithelial miR-196 expression increases. [score:5]
As a result, binding of regulatory miR-196 is significantly impaired. [score:2]
In those patients with CD possessing the risk allele, no similar reduction of occurred during active inflammation, presumably due to inability of miR-196 to bind transcript. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 13
Yong Li and coworkers found that miR-196 inhibited the expression of HOXC8 transcription factor, which suppressed cell migration and metastasis. [score:7]
Instead, they detected a correlation between the ratio of miR-196 to HOXC8 expression and the migratory behavior of breast cancer cell lines, as well as the metastatic status of clinical samples [70]. [score:3]
Importantly, unlike other metastasis -associated miRNAs that have been described, the expression of miR-196 was not correlated with breast cancer cell migration or the metastatic status of clinical breast tumor specimens. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 13
miR-196a, miR-486-5p, miR-664-star, and miR-378-star were upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in old versus young hMSCs. [score:7]
Notably, miR-196a, miR-486-5p, miR-664-star, and miR-378-star were all significantly upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in the hMSCs from old subjects compared with young subjects (Fig. 2B). [score:6]
[1 to 20 of 2 sentences]
35
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
They also demonstrated that serum miR-196a expression levels were significantly higher in unresectable PDAC (stages III and IV) patients than in resectable (stages I and II) patients, and indicated the potential of serum miR-196a expression levels in predicting the prognosis in patients with PDAC [62]. [score:5]
They reported that serum miR-196a expression levels were significantly higher in unresectable PDAC (stages III and IV) patients than in resectable (stages I and II) patients, and had the potential to predict the median survival time of PDAC patients [62]. [score:3]
They showed that miR-21 had the ability to distinguish PDAC patients from CP and healthy subjects, while miR-196a differentiated sera from patients with diseased pancreases (PDAC/CP) from those with normal pancreases. [score:3]
Kong X. Du Y. Wang G. Gao J. Gong Y. Li L. Zhang Z. Zhu J. Jing Q. Qin Y. Detection of differentially expressed microRNAs in serum of pancreatic ductal adenocarcinoma patients: MiR-196a could be a potential marker for poor prognosis Dig. [score:2]
[1 to 20 of 4 sentences]
36
[+] score: 13
Interestingly, miR-10a and miR-196a target homeobox (HOX) genes, which are a family of transcription factors that control developmental processes [38]. [score:4]
Several miRNAs, namely miR-148a, miR-302b, miR-10a, miR-196a and miR-132 were up-regulated in CINI samples. [score:4]
Five miRNAs displayed relative increased expression in the transition from normal cervix to atypical dysplasia to cancer, these were miR-148a, miR-302b, miR-10a, miR-196a and miR-132 (Figure 4 D). [score:3]
Finally, miR-196a is located in the rare folate sensitive fragile site FRA12A, the other two miRNAs that belong to this group are miR-148a and miR-302b. [score:1]
For example, miR-142-5p is located in FRA17B, while miR-196a and miR-29a are located in FRA12A and FRA7H, respectively. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 12
Five miRNAs targeted the replication stage only, as their overexpression significantly enhanced (miR-151-5p) or diminished (miR-130a, miR-196a, miR-148a, and miR-30a-5p) HCV RNA replication but not IRES -mediated translation in the replicon assays (Fig.   3c). [score:6]
Cellular miRNAs, such as miR-122 and miR-196a represent important HCV host dependencies through their actions either directly on the viral genome or indirectly on virus -associated host factors to modulate viral infection [14]. [score:3]
This approach identified 10 miRNAs that enhance HCV infection and 21 with antiviral effects, and includes previously known HCV -associated miRNAs such as miR-122 and miR-196a (Fig.   1f). [score:1]
We showed that unlike miR-122 and miR-196a, which predominantly act on the early stages of HCV infection, miR-17-5p or miR-25 had no effect on HCVsc infection (Fig.   3d), validating their roles in the late stages only. [score:1]
Among them, three are proviral miRNAs (miR-122, miR-151-5p, and miR-17-5p), and nine others, including let-7a, let-7b, miR-130a, miR-148a, miR-181a, miR-196a, miR-30a-5p, miR-99b, and miR-25, are antiviral factors (Fig.   2c). [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 12
In addition, increased miRNA196 expression improves the survival and prognosis for patients diagnosed with leukemia [50]. [score:3]
Previous studies have shown that miRNA196 is associated with transcription factors and affects cancer development and progression [48], [49]. [score:2]
And with miR196a rs11614913 was not associated with HCC, but carried CC genotype significantly enhanced the influences caused by rs4938723 in women population [51]. [score:1]
[2] = 3.620 (3 d. f. ) p = 0.306 miRNA196 rs11614913 TT and non-alcohol intake 64 (18.99) 38 (20.21) Reference Reference CT or CC and non-alcohol intake 137 (40.65) 82 (43.62)1.01 (0.62–1.64, p = 0.974)0.95 (0.58–1.57, p = 0.854) CT or CC and consumer 36 (10.68) 28 (14.89)1.31 (0.69–2.48, p = 0.406)1.05 (0.53–2.10, p = 0.884) CT or CC and alcohol intake 100 (29.67) 40 (21.28)0.67 (0.39–1.16, p = 0.154)0.53 (0.29–0. [score:1]
Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and real-time PCR were used to analyze miRNA146a (rs2910164), miRNA149 (rs2292832), miRNA196 (rs11614913), and miRNA499 (rs3746444) genetic polymorphisms between the control group and the case group. [score:1]
41, p = 0.767) miRNA196 rs11614913 TT 100 (29.67) 66 (35.11) Reference Reference CT 167 (49.55) 81 (43.09)0.74 (0.49–1.11, p = 0.140)0.70 (0.46–1.06, p = 0.090) CC 70 (20.77) 41 (21.81)0.89 (0.54–1.46, p = 0.637)0.93 (0.56–1.54, p = 0.785) CT/CC 237 (70.33) 122 (64.89)0.78 (0.53–1.14, p = 0.200)0.90 (0.64–1. [score:1]
[2] = 4.689 (3 d. f. ), p = 0.1960 miRNA196 rs11614913 TT and non-smoker 74 (21.96) 34 (18.09) Reference Reference CT or CC and non-smoker 151 (44.81) 74 (39.36)1.07 (0.65–1.75, p = 0.797)0.99 (0.59–1.66, p = 0.962) CT or CC and smoker 26 (7.72) 32 (17.02)2.68 (1.39–5.17, p = 0.003) * 2.69 (1.34–5.41, p = 0.005) * CT or CC and smoker 86 (25.52) 48 (25.53)1.22 (0.71–2.08, p = 0.479)1.21 (0.68–2. [score:1]
The distribution of miRNA gene polymorphisms is described in Table 2. In our recruited control group, the frequencies of miRNA146a rs2910164 (χ [2] value: 1.92), miRNA196 rs11614913 (χ [2] value: 0.0005), and miRNA499 rs3746444 (χ [2] value: 0.98) were in Hardy-Weinberg equilibrium, respectively, except for miRNA149 rs2292832 (χ [2] value: 59.86). [score:1]
Nonetheless, the results obtained in this research do not provide sufficient evidence of a relationship between miR196 and hepatocellular carcinoma. [score:1]
[1 to 20 of 9 sentences]
39
[+] score: 12
To exemplify how lncRNAs could participate in the miRNA-mRNA interaction network, we have considered an example of hsa-mir-196a, which is experimentally known to target ENST0000040584, ENST00000242159, ENST00000313173 mRNA transcripts, encoded by the HOX cluster genes HOXC8, HOXA7 and HOXD8 [49], We noticed that the hsa-mir-196a could also target lncRNAs ENST00000519935, ENST00000523790, and ENST00000489695 (Figure 4B2). [score:4]
The mir-196 miRNAs are known to directly cleave HOX mRNAs and modulates development of axial patterning [49], [50]. [score:3]
Thus lncRNAs could potentially modulate the pathogenesis of the disease by modulating the key partner, mir-196a. [score:3]
The human miRNA hsa-mir-196a has been previously shown to be associated with the pathogenesis of cancers including colorectal cancer cells and has been shown to induce a pro-oncogenic behavior in human cancer cells [51]. [score:1]
B1: An interesting example from the network highlighted in orange showing interactions between of network highlighting miRNA: (a) hsa-mir-9; lncRNA: (d) ENST00000500197.2, (e) ENST00000509783.1, (f) ENST00000511014.1, (h) ENST00000505030.1, (i) ENST00000504246.1; mRNA: (b) ENST00000384838.1, (c) ENST00000262095.2, (g) ENST00000491143.1, (j) ENST00000226574 B2: Another interesting example from the network highlighted in blue showing interactions between miRNA: (1) hsa-miR-196a, (5) hsa-miR-196b*, (13)hsa- miR-196b; lncRNA: (4) ENST00000523790.1; (6) ENST00000489695.1, (12) ENST00000519935.1; mRNA: (2) ENST00000354032.4, (3) ENST00000384852.1, (7) ENST00000313173, (8) ENST0000024215, (9) ENST00000040584, (10) ENST00000304786.7, (11) ENST00000366839.4. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 12
The levels of miR-196-5p and klotho in the serum and renal tubular epithelial cells of the DN mice were detected with real-time PCR and a. The results showed that the expression of miR-196-5p was up-regulated, whereas that of klotho was down-regulated. [score:9]
Atrasentan reversed the alterations in the expression of miR-196-5p and klotho (Fig. 1D,E). [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 12
Wang K MiR-196a binding-site SNP regulates RAP1A expression contributing to esophageal squamous cell carcinoma risk and metastasisCarcinogenesis. [score:3]
By considering the fold-change threshold and percentage of incidence, among the 95 screened miRNAs which have functional significance with regard to potential roles in cancer, cell development and apoptosis, ten miRNAs (miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-150, miR-136, miR-200c and miR-141) were identified which may play a putative role in cancer development, metastasis and have potential as biomarkers for the detection of NPC. [score:3]
The incidence of up and down regulation of these ten miRNAs, including miR-205 (94.1%), miR-196a (88.2%), miR-149 (82.4%), miR-183 (64.7%), miR-224 (58.8%), miR-210 (58.8%), miR-136 (47.1%), miR-200c (64.7%), miR-141 (52.9%) and miR-150 (82.4%) between non-NPC controls and NPC patients ranges from about 47% to 94% incidence rate. [score:2]
Tsai MM MicroRNA-196a/-196b promote cell metastasis via negative regulation of radixin in human gastric cancerCancer Lett. [score:1]
Among these 10 miRNAs candidates, 6 (miR-196a, miR-183, miR-224, miR-136, miR-200c and miR-150) and 3 (miR-136, mi141 and 150) miRNAs have no data reported in HNSCC and ESCC, respectively. [score:1]
They were miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-136, miR-200c, miR-141 and miR-150. [score:1]
Schimanski CC High miR-196a levels promote the oncogenic phenotype of colorectal cancer cellsWorld J. Gastroenterol. [score:1]
[1 to 20 of 7 sentences]
42
[+] score: 11
With respect to ANXA1, it is a target of HSA-miR196a [24] and the expression of hsa-miR-196a is inversely correlated with ANXA1 expression in esophageal, breast and endometrial cancer cell lines. [score:7]
MiR-196a specifically targeted ANXA1 and promoted cell proliferation and anchorage -dependent growth and suppressed apoptosis. [score:4]
[1 to 20 of 2 sentences]
43
[+] score: 11
MicroRNA-196a regulates bovine newborn ovary homeobox gene (NOBOX) expression during early embryogenesis. [score:3]
In bovine, miR-196a is believed to regulate newborn ovary homeobox gene (NOBOX), a transcription factor, implicated in the early bovine embryo development (Tripurani et al., 2011). [score:3]
Evidence across species suggests that the miR-196 plays a key role in regulating HOX genes which encode transcription factors vital to embryonic development (Chen et al., 2011). [score:3]
HOX genes have complementary binding sites to miR-196a2, where it was shown that miR-196 binds with high complementarity to HOXB8 to cleave the mRNA (Yekta et al., 2004). [score:1]
MicroRNA-196: critical roles and clinical applications in development and cancer. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 11
Iron storage may also be indirectly affected by miRNA as both miR-196 and miR-let-7d target the heme-regulated transcriptional repressor Bach1 resulting in a de-repression of Bach1 targets such as HMOX1 and ferritin [43, 45]. [score:7]
miRNA Target mRNA Reference(s) miR-Let-7d DMT (∆IRE), BACH1Andolfo et al. (2010) [42], Hou et al. (2012) [43] miR-122 HFE, HJVCastoldi et al. (2009) [44] miR-196 BACH1Hou et al. (2010) [45] miR-200b FTHShpyleva et al. (2009) [46] miR-210 ISCU, TFRChan et al. (2009) [47], Yoshioka et al. (2012) [48] miR-214 LactoferrinLiao et al. (2010) [49] miR-320 TFRSchaar et al. (2009) [50] miR-485-3p FPNSangokoya et al. (2013) [51] miR-584 Lactoferrin ReceptorLiao et al. (2010) [52] Whereas hepcidin is considered to be the primary means of regulating systemic iron homeostasis, a family of cytosolic RNA binding proteins known as Iron Regulatory Proteins (IRP) is considered to be the global regulators of cellular iron homeostasis. [score:4]
[1 to 20 of 2 sentences]
45
[+] score: 11
The top most highly expressed miRNAs in ERBB2 overexpressing cell lines included hsa-let-7b, hsa-miR-640, hsa-miR-200c, hsa-miR-378, hsa-miR-141, hsa-miR-196a, hsa-miR-29c, and hsa-miR-18a*, whereas hsa-miR-501-5p, hsa-miR-202, hsa-miR-760, and hsa-miR-626 were more highly expressed in luminal cell lines lacking ERBB2 overexpression (fold change ≥ 1.5) (see Table S8 in Additional file 1). [score:9]
Another group of 17 miRNAs (hsa-miR-575, hsa-miR-155, hsa-miR-26b, hsa-miR-200a, hsa-miR-200b, hsa-miR-141, hsa-miR-200c, hsa-miR-190b, hsa-miR-492, hsa-miR-640, hsa-miR-196a, hsa-miR-29c, hsa-miR-93, hsa-miR-193a-3p, hsa-miR-191, hsa-miR-26a, hsa-miR-182) showed significantly higher expression in the major cluster compared with the other miRNAs (fold change ≥ 1.5) (Figure 2, bottom red box). [score:2]
[1 to 20 of 2 sentences]
46
[+] score: 11
MicroRNA-196a targets annexin A1: a microRNA -mediated mechanism of annexin A1 downregulation in cancers. [score:5]
miR-196 family genes (miR-196a and miR-196b) are located within the HOX gene cluster and are often overexpressed in tumors, which is indicative of their oncogenic functions (Luthra et al., 2008; Maru et al., 2009; Popovic et al., 2009; Guan et al., 2010). [score:3]
MiRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significance. [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 11
A recent study revealed that a synonymous SNP in IRGM alters a binding site for miR-196 and caused deregulation of IRGM -dependent xenophagy in Crohn’s disease [16]. [score:4]
Brest P. Lapaquette P. Souidi M. Lebrigand K. Cesaro A. Vouret-Craviari V. Mari B. Barbry P. Mosnier J. F. Hebuterne X. A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM -dependent xenophagy in Crohn's disease Nat. [score:4]
One is that a synonymous mutation (c. 313C>T) in IRGM removed the miR-196 regulation, which resulted in decreased IRGM wild type variant (c. 313C) but not the mutant allele (c. 313T). [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 11
Remarkably, both hsa-miR-196a-5p and hsa-196b-5p are downregulated in active UC vs. [score:4]
Brest et al. demonstrated an upregulation of hsa-miR-196a/b-5p in the inflamed mucosa of CD patients [11]. [score:4]
Therefore, expression of miR-196a/b-5p might be useful to differentiate UC from CDc. [score:3]
[1 to 20 of 3 sentences]
49
[+] score: 11
Of the 31 PD-miRNAs, 7 miRNAs (hsa-mir-202, hsa-mir-196a-2, hsa-mir-423, hsa-mir-943, hsa-mir-520h, hsa-mir-1908 and hsa-mir-647) were identified in prior studies as being differentially expressed in human diseases representing a significant increase above expectation (1.1 out of 31) for disease -associated miRNAs (95% C. I. = 1.08 – 1.11; p = 2.2 × 10 [−16]) (Figure  5B). [score:7]
Overall, we identify 7 PD-miRNAs that are currently implicated as cancer biomarkers or diagnostics: hsa-mir-202, hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-647, hsa-mir-943, and hsa-mir-1908. [score:1]
Similarly, the other 6 PD-miRNAs identified (hsa-mir-423, hsa-mir-196a-2, hsa-mir-520h, hsa-mir-1908, hsa-mir-647 and hsa-mir-943) have also been implicated in cancer susceptibility in human populations [56]. [score:1]
The hsa-mir-196a-2 T-allele at SNP rs11614913 has been significantly associated with increased risk for esophageal cancer in non-smoking European males [48] but decreased risk for breast, lung and gastric cancers in Chinese populations [48]. [score:1]
Second, the hsa-mir-196a-2 SNP rs11614913 CC genotype has been significantly associated with increased risk for breast, lung and gastric cancers in Chinese populations; conversely, the homozygous TT genotype has been significantly associated with esophageal cancer in non-smoking European males [48]. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 10
In contrast, miR-196a/b/c, miR-224 and miR-324-3p were found to be downregulated, hence their low expression may also be indicative of recovery. [score:6]
From the first group, miR-196a/b/c, -224 and -324-3p were found to demonstrate significant downregulation in recovery phase (p value <0.05) with R values 0.92, 0.93, 0.92, 0.90 and 0.90 respectively (Figure 2B ). [score:4]
[1 to 20 of 2 sentences]
51
[+] score: 10
It seems that titanium implants induced the upregulation of miR-196a, which repressed the transcriptional activity of HOMEOBOX C8 (HOXC8) and inhibited cell proliferation, promoting the osteogenic differentiation of DPSCs. [score:6]
Cell type microRNA mRNA target Differentiation DPSCs miR-135 Nd MyogenicLi et al., 2015 miR-143 DPSCs miR-720 DNMT3a, NANOG OsteogenicHara et al., 2013 PDLSCs miR-21 PLAP-1 OsteogenicLi et al., 2012 miR-101 DPCs miR-424 VEGF, KDR Angiogenic (endothelial cells)Liu et al., 2014 DPSCs miR-196 HOX C8 OsteogenicGardin et al., 2016 DPSCs miR-218 RUNX2 OsteogenicGay et al., 2014 GMSCs PDLSCs DPSCs miR-816-3a WNT5A, EGRF Control of cell fateVasanthan et al., 2015 miR-7-5p DPSCs miR-32 DSPP OdontoblasticWang et al., 2011 miR-586 miR-885-5 WNT5A, WNT FAMILY MEMBER 5A; EGRF, EPIDERMAL GROWTH FACTOR RECEPTOR; DSPP, DENTIN-SIALOPHOSPHOPROTEIN; DNMT3A, DNA METHYLTRANSFERASE 3A; NANOG, NANOG HOMEOBOX; PLAP-1, PERIODONTAL LIGAMENT-ASSOCIATED PROTEIN 1; VEGF, VASCULAR ENDOTHELIAL GROWTH FACTOR; KDR, VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-2/KINASE INSERT DOMAIN RECEPTOR; and RUNX2, RUNT-RELATED TRANSCRIPTION FACTOR2. [score:3]
Non-washed resorbable blasting media (NWRBM) on titanium surfaces could enhance osteogenic properties of MSCs through increase of miRNA-196a and VCAM1. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 10
It has also been reported that high expression of miR-196 and miR10b in GBM patients correlates with a poor prognosis [10], and that down-regulation of miR-128 leads to reduction in the self-renewal ability of glioma stem cells by inhibiting Bmi1 gene expression. [score:10]
[1 to 20 of 1 sentences]
53
[+] score: 10
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 10
Subsequently, it has been demonstrated that miR-15, miR-16, miR-26, miR-196a-2, and let-7a, which target both the HMGA genes, are drastically downregulated in a panel of 41 human PAs of different histotypes, and their expression is inversely correlated with the HMGA expression. [score:10]
[1 to 20 of 1 sentences]
55
[+] score: 10
Interestingly, several miRNAs were significantly upregulated (miR-196a and miR-200a), or downregulated (miR-7, miR-124 and miR-497) among which miR-124 was the most significantly downregulated miRNA (Figure 1A). [score:10]
[1 to 20 of 1 sentences]
56
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-30a, hsa-mir-32, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-30d, hsa-let-7g, hsa-let-7i, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-149, hsa-mir-200c, hsa-mir-425, hsa-mir-505, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-625, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-3146, hsa-mir-548v, hsa-mir-3174, hsa-mir-548w, hsa-mir-3192, hsa-mir-548x, hsa-mir-3605, hsa-mir-3662, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-664b, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The principal finding was of greatly increased expression of members of the let-7 family of miRNAs, and increased expression (above a GFOLD threshold of 2.0) of several other miRNAs including hsa-miR-196a, hsa-miR-30a/d, hsa-miR-191 and hsa-miR-200c following silencing of L1 expression. [score:7]
In addition to the let-7 family members, large changes were also seen in the expression of miR-196a, miR-30d, miR-103, miR-425, miR-191 and miR-200c (Figure 2D). [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 10
MiRNA-196 and miRNA-448 were found to be up-regulated in HCV infected individuals, target the coding region (CORE and NS5A) of HCV genomic RNA. [score:6]
MiRNA-122, miRNA-199a, miRNA-196, miRNA-448, and let-7b was found to be expressed during hepatitis C infection and regulate the pathogenicity. [score:4]
[1 to 20 of 2 sentences]
58
[+] score: 10
In addition to miR-29, several other miRNAs are known to negatively regulate collagen expression, such as let-7a and miRNA-196a, both down-regulated in SSc [28, 29]. [score:7]
In the skin, the expression of miRNA-7 and miRNA-196a in serum have been shown to inversely correlate with the duration of SSc [28, 60]. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 10
In esophageal cancers cell line KYSE150, as shown in the up panel of Figure 2A, over -expression of MIR30e, MIR363, MIR498, MIR196, MIR422, MIR337 or MIR202 remarkably increase the LC3-I to LC3-II conversion whereas miR-20b modestly decrease. [score:3]
In another esophageal cancers cell line TE3, transfection of MIR20b, MIR363, MIR498 or MIR196 affected the autophagy when monitoring both LC3 and p62 (down panel of Figure 2A and Figure 2B). [score:1]
The cleaved PARP were modestly but significantly increased when transfection of MIR20b, MIR30e, MIR498 or MIR196 in both cell lines (Figure 2B). [score:1]
Follow-up experiments indicated transfection of MIR20b, MIR30e, MIR498 and MIR196 affected the apoptotic pathway in esophageal cancers cells. [score:1]
Interestingly, three out of the four apoptotic related miRNAs (MIR20b, MIR498 and MIR196), can modulate both autophagy and apoptosis processes. [score:1]
Collectively, above results suggested that the four predicted miRNAs, MIR20b, MIR30e, MIR498 and MIR196 may be involved in the apoptotic pathway in esophageal cancers cells. [score:1]
The results indicated at least 3 miRNAs (MIR20b, MIR498 and MIR196) were involved in cell death in two esophageal cancers cell lines. [score:1]
In addition to LC3, the sequestosome 1(SQSTM1/P62) protein were accumulated when MIR30e, MIR363, MIR498 or MIR196 were transfected whereas MIR20b significantly decreased (up panel of Figure 2B). [score:1]
[1 to 20 of 8 sentences]
60
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
It should be noted that when the role of miR 196a in the pathogenesis and prediction of patients with NSCLC outcome was recently confirmed, it was found that miR-196a is significantly upregulated in NSCLC tissues, and that it is involved in NSCLC cell proliferation, migration and invasion, mainly via the downregulation of HOXA5. [score:7]
Higher expression of miR-196a in NSCLC tissues was also associated with higher clinical stages and lymph-node metastases [195]. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 9
In NSCLC tissues, many onco-miRs/tumor suppressor-target or tumor suppressor-miRs/onco-target pathways have been demonstrated to participate in the tumorigenesis of lung cancer, including miR7/BCL2 axis, miR-99b/FGFR3 axis, miR-101/EZH2 axis, miR-192/RB1 axis and miR-196/HOXA5 axis [26- 30]. [score:9]
[1 to 20 of 1 sentences]
62
[+] score: 9
Figure 3. Increased expression of miR-196a in human gastric cancer tissues. [score:3]
Among them, the miR-196a is significantly overexpressed in the tumour samples. [score:3]
We have identified a particular miRNA family dysregulated in gastric cancers- miR-196a and miR-196b (Fig. 3), and subsequent experimental analysis demonstrated the epigenetic and transcriptional modulations of miR-196 s in human gastric cancers (Refs 62, 63, 64). [score:2]
Several miRNAs circulating in blood of gastric cancer patients can be applied as diagnosis biomarkers, including let-7a, miR-1, miR-17-5p, miR-21, miR-20a, miR-27a, miR-34, miR-106a/b, miR-196a, miR-199a-3p, miR-218, miR-221, miR-223, miR-370, miR-376c, miR-378, miR-421, miR-423-5p, miR-451 and miR-486 (Refs 64, 76, 111, 112, 113, 114, 115, 116, 117). [score:1]
[1 to 20 of 4 sentences]
63
[+] score: 9
Considering that cellular miRNAs, such as miR-199a [50], could target the HCV genome and inhibit viral replication and that interferon could modulate expression of certain miRNAs that may either target the HCV RNA genome (eg, as miR-196 or miR-448) [51] or markedly enhance its replication (eg, miR-122) [42], it will be important to determine whether the HCV core and E2 proteins interferes with the host RNA silencing processes during the natural course of an HCV infection. [score:9]
[1 to 20 of 1 sentences]
64
[+] score: 9
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196b
A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM -dependent xenophagy in Crohn’s disease. [score:4]
miR-196 was found overexpressed in inflamed ileum and colon of patients, independently of the protective or risk irgm haplotype. [score:3]
Furthermore, the transfection of HEK293T cells with miR-196 resulted in a decreased autophagy flux, indicating that miR-196 acts as a negative regulator of autophagy via IRGM upon AIEC infection. [score:2]
[1 to 20 of 3 sentences]
65
[+] score: 9
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
[1 to 20 of 1 sentences]
66
[+] score: 9
The human IFNβ was reported to induce the expression of cellular miRNAs miR-196, miR-296, miR-351, miR-431, and miR-448, which displayed seed-sequence complementarity with HCV RNA genome and downregulated virus replication; conversely, the IFNβ was shown to downregulate the HCV cofactor miR-122, thereby causing a reduction in HCV replication [209]. [score:9]
[1 to 20 of 1 sentences]
67
[+] score: 9
We and others have recently found that a number of microRNAs (miRNAs), miRNA-196, miR-155 and let-7 miRNA family members, interact with the binding sites in the 3’-UTR of Bach1 mRNA, which results in down-regulation of Bach1 protein expression and up-regulation of the HMOX1 gene in human hepatocytes [29, 30, 31, 32]. [score:9]
[1 to 20 of 1 sentences]
68
[+] score: 9
Both oncogenic miRNAs and tumor suppressive miRNAs have been demonstrated and described in colon carcinogenesis and progression, such as upregulated miR-135, miR-21, miR-17-92, and miR-196a, and downregulated miR-34, miR-195, and miR-365 [9]– [13]. [score:9]
[1 to 20 of 1 sentences]
69
[+] score: 9
Interestingly, some miRNAs which were upregulated in tDCs (miR-23b, miR-27b, miR-10a, and miR-30a) are described as negative regulators of TGF- β signaling pathway [43], while miR-196, which is in our study downregulated in tDCs, is negatively regulated by TGF- β [44]. [score:9]
[1 to 20 of 1 sentences]
70
[+] score: 8
Increased expression of miR-196a has also been shown to decrease proliferation of adipose-derived stem cells and enhance their osteogenic potential without affecting adipogenesis [83]. [score:3]
It will be important to establish how altered expression of miR-196 affects the chondrogenic potential of precursor stem cells in vitro. [score:3]
In fact, miR-196 sub-types (including both miR-196a and miR-196b, which are almost identical in sequence but located on different chromosomes) have been reported to regulate skeletal patterning in zebrafish, chicken and salamander [75]– [77]. [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 8
miRNA Target Genes Pathways miR-128 ABCB9, BTG1, DSCR1, RASD1 ABC transporters General miR-136 GRN, PPP1R9B miR-147 HOXA1, PTGFRN miR-148 EGR3, SCN3A miR-181b IGF1R, NKX6-1 Adherens junction, Maturity onset diabetes of the, Focal adhesion, **Long term depression miR-196a ABCB9, CPB2, IRS1, MAPK10 ABC transporters General, Complement and coagulation cas, Adipocytokine signaling pathwa, Insulin signaling pathway, Type II diabetes mellitus, Fc epsilon RI signaling pathwa, Focal adhesion, **GnRH signaling pathway, **MAPK signaling pathway, Toll like receptor signaling p, Wnt signaling pathway miR-203 SARA1 miR-20 BTG1, SARA1, YWHAB Cell cycle miR-21 TPM1 mir-216 GNAZ **Long term depression miR-217 RHOA Adherens junction, Axon guidance, Focal adhesion, Leukocyte transendothelial mig, Regulation of actin cytoskelet, TGF beta signaling pathway, T cell receptor signaling path, Tight junction, Wnt signaling pathway miR-31 ATP2B2, DNM1L, EGR3, PPP1R9B, YWHAB **Calcium signaling pathway, Cell cycle miR-7 SLC23A2 miR-7b HRH3, NCDN, SLC23A2 **Neuroactive ligand receptor in b: miRNAs and their targets (from TargetScan and miRanda). [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 8
Hoss and colleagues [9] related five upregulated miRNAs (miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p and miR-1247-5p) located in the HOX gene cluster to HD pathogenesis. [score:4]
Our analysis confirms the upregulation of miR-10b-5p, miR-196a-5p, miR-196b-5p, miR-615-3p and miR-1247-5p in HD. [score:4]
[1 to 20 of 2 sentences]
73
[+] score: 8
Interestingly, a stimulating HMGA2 influence on the expression of its sister protein HMGA1 was found in rat epithelial thyroid cells [79], thus constituting a feedback loop by the stimulation of its suppressor, the miRNA-196a-2 [66] (Figures 3 and 10). [score:5]
Among these miRNAs is the miR-196a-2, which in turn is predicted to target its sister gene HMGA2 [66] (Figures 2 and 10). [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 8
The top downregulated lung TIC -associated miRNAs include miR-23a, miR-130a, let-7 family, miR-513a-5p, miR-125b and miR-29a, whereas the top upregulated miRNAs include miR-1290, miR-130b, miR-1246, miR-630, miR-196a/b, miR-9/9* and miR-17∼92 cluster and its miR-106b∼25 analogues. [score:7]
Taqman miRNA probes were as follow: hsa-miR-1246 (462575_mat), hsa-miR-1290 (002863), hsa-miR-130a (000454), hsa-miR-130b (000456), hsa-miR-196a (241070_mat), hsa-miR-196b (002215), hsa-miR-630 (001563), hsa-let-7b-5p (002619), hsa-let-7c (000379), hsa-let-7d-5p (002283), hsa-let-7i (002221), hsa-miR-106b (000442), hsa-miR-125b (000449), hsa-miR-23a (000399), hsa-miR-25 (000403), hsa-miR-320c (241053_mat), hsa-miR-3667-5p (462350_mat), hsa-513-5p (002090), hsa-miR-9* (002231). [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 7
The up-regulated miRNAs include let-7a and miR-99a and the down-regulated include miR-196a, miR-470, miR-21*, miR-208a, miR-683, miR-184, miR-693-3p, miR-202-3p, miR-429, miR-878-3p and miR-327. [score:7]
[1 to 20 of 1 sentences]
76
[+] score: 7
Therefore, elevation of the expression of miR-196 in human cells may correlate with several phenotypes observed during developmental stages. [score:4]
MiR-196 is a negative regulator of several HOX genes. [score:1]
MiR-196 recognizes HOX mRNA with a nearly perfect match and cleaves the HOXB8 mRNA directly [23]. [score:1]
According to miR-4299 and miR-196b values, the median OS were 18.7 (miR-4299, CI 17.4–20.0) and 18.0 (miR-196a, CI 15.1–20.9). [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 7
Five years later, Brest et al. (2011) identified the very first case of a human GWAS signal that may be explained by polymorphic miRNA targeting—a synonymous variant that alters a miR-196 target site and influences risk for Crohn’s disease [Georges 2011]. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
The miRNAs identified in this study that were up-regulated by hypoxia (miR-210, miR-29b) in young MSC and down-regulated (miR-196a, miR-148b) in aged MSC were shown to be involved in promoting osteocytes lineage differentiation. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
MiR-196a promotes pancreatic cancer progression by targeting nuclear factor kappa-B -inhibitor alpha. [score:4]
Various miRNAs, such as miR-200 (Yu et al., 2010), miR-146a (Li et al., 2010), miR-486 (Mees et al., 2009) and the let-7 family (Li et al., 2009b) have been confirmed to be tumor suppressors; meanwhile, pancreatic cancer malignancy was found positively associated with miR-196a (Huang et al., 2014), miR-212 (Ma et al., 2014) and miR-31 (Laurila et al., 2012). [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 7
In addition, miR-196a and miR-196b expression was associated with an immature (IMM) immunophenotype and expression of CD34 and CD33, with both targeting ETS transcription factor ERG in T-ALL patients [36]. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Consistent with those data, in our study, curcumin upregulated miR-103, miR-22, and miR-23b and downregulated miR-195, miR-15b, miR-196, and miR-92. [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
Furthermore, the upregulated miRNAs included miR-9/miR-9*, miR-21*, miR-31/miR-31*, miR-196a/miR-196b, miR-374a and members of the miR-29 and miR-130/301 families. [score:4]
Furthermore, the overexpressed miRNAs included miR-7, miR-9/miR-9*, miR-21*, miR-31/miR-31*, miR-181, miR-196a/miR-196b, miR-503 and members of the miR-29 and miR-130/301 families (Table 1). [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 7
However, previous studies on hMSCs-Ad undergoing adipogenesis reported that miR-21 13, miR-22 14, miR-196 15, miR-27b 20, and miR-138 31 were either upregulated or downregulated, and miR-148a was not reported in hMSCs-Ad. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
miR-10b-5p, miR-196a-5p, and miR-31-5p are upregulated in tumor tissues regardless of smoking habit, whereas miR-637 is upregulated exclusively in smokers, which may refine the diagnosis for this risk group [71]. [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
Among these, miR-196a/−196b were identified as two of the most significantly upregulated miRNAs in associated with promotion of tumor metastasis via downregulation of radixin, supporting their function as prometastatic oncomiRs [6]. [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
Among those, increased expression of miR-21, miR-155, miR-196a-2, miR-203, miR-210, and miR-222 are associated with poor prognosis. [score:3]
Kong X. Du Y. Wang G. Gao J. Gong Y. Li L. Zhang Z. Zhu J. Jing Q. Qin Y. Detection of differentially expressed microRNAs in serum of pancreatic ductal adenocarcinoma patients: miR-196a could be a potential marker for poor prognosis Dig. [score:3]
Serum miR-196a can distinguish resectable from unresectable PDA and predict overall survival [117]. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 7
Low expression of miR-15a, miR-16, miR-26a, and miR-196a in PAs could increase the expression of their target genes HMGA1 and HMGA2. [score:7]
[1 to 20 of 1 sentences]
88
[+] score: 7
Finally, we found higher expression of ssc-miR-196a in HG-IEN; human miR-196a contributes to cell growth promotion, migration and invasion of colorectal cancer cells [25– 27]. [score:3]
Ten differentially expressed miRNAs were validated by qRT-PCR: ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-155-5p, ssc-miR-181b, ssc-miR-183, ssc-miR-191 and ssc-miR-196a. [score:3]
In summary, we have detected several miRNAs (ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-183 and ssc-miR-196a) associated with early-stage colorectal neoplasia in APC [1311] pigs. [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 7
83 (0.13) −0.07 (1.0) hsa-miR-551b-3p ND ND ND hsa-miR-3065-5p −1.4 (0.03) −2.2 (0.002) −0.74 (1.0) hsa-miR-196a-5p 0.23 (1.0) 0.07 (1.0) −0.31 (1.0) BE, Barrett's esophagus; GERD, Gastroesophageal reflux disease; EE refers to those GERD patients with erosive esophagitis; NERD (Non-erosive reflux disease) refers to those GERD patients without erosive disease; NGS, next generation sequencing; negative numbers indicate downregulation in BE compared to GERD; 1 Fold changes by RT-PCR calculated by ΔΔCt method; 2 p-value was adjusted for false discovery rate of 5% and reported in parentheses; miRs-4253, -4776-3p, -548n and -675-3p were also significantly different but with reads <25 in each group and were not included for RT-PCR validation; ND, not detected. [score:7]
[1 to 20 of 1 sentences]
90
[+] score: 7
High expression of miR-196a-2, which was seen in 75% of tumors, resulted in 2-year survival of 17% compared with 64% for low expression (P = 0.009), whereas median survival in patients with high expression of miR-219 was 13.6 months, compared with 23.8 months for those with low expression, with 2-year survivals of 25% and 49%, respectively (P = 0.07). [score:7]
[1 to 20 of 1 sentences]
91
[+] score: 6
Strikingly, many of these synergistically regulated miRNAs were also found to be regulated in hESCs derived DE [18] such as mir-196a, mir-196b, and miR-24-2*, suggesting that the roles of miRNAs on DE differentiation might be conserved between human and mouse. [score:3]
We compared our results with previously published miRNAs data about human DE differentiation [18], [19], and found that there are many miRNAs over-lapping between mouse and human data, such as mir-196a/b, let-7e and so on, suggesting the molecular conservativeness between human and mouse DE differentiation in terms of miRNA expression. [score:2]
Red: mir-338-5p binding site; Yellow: mir-181c binding site; Blue: mir-196 a/mir-196b binding site. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 6
Moreover, IFNα/β up-regulates several cellular miRNAs (mir-196, mir-296, mir-351, mir-431, mir-1, mir-30 and mir-128 and mir-448) with putative recognition sites within HCV genome [17]. [score:4]
MiR-196, miR-296-5p, miR-431 and miR-448 are all induced by IFN α/β and contain putative recognition sites within HCV genome [17]. [score:1]
Mir-196, mir-296, mir-351, mir-431 and mir-448 were indeed able to substantially attenuate viral replication [17]. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 6
To further assess the alterations of mitochondria-related miRNAs in obesity, we examined the expression levels of miR-126a-3p, miR-141-3p, miR-196a-5p, miR-210-3p, miR-378a-3p, miR-484 and miR-499a-5p in mice livers. [score:3]
As shown in Fig. 2G, the expression of mitochondria-related miR-141-3p was strikingly increased and miR-196a-5p, miR-210-3p, miR-378a-3p were reduced in the HFD mice. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 6
In vitro studies have shown that the liver-specific miR-122 is required for HCV RNA replication [14], whereas IFN -induced miRNAs miR-196 and miR-448 directly target HCV genomic RNA for inhibition of viral replication [15]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
Several brain enriched miRNAs (miR-128 and miR-132) and other miRNAs (e. g. miR-196, miR-222, and miR-9*, miR-7, miR-130b and miR-126-5p) that were previously shown to be associated with neurodegenerative diseases were downregulated in JEV-infected microglial cells at 48 h pi (Table S3). [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
To reduce the effect of other miRs on hRluc expression, a small region in BACH1 3′UTR containing putative target sites for miR-142, miR-196, miR-292 and Let-7 was deleted using a specific set of primers (Supplementary Table 1) and Quickchange mutagenesis kit (Agilent Technologies Inc. [score:4]
org), we found that the 3′UTR of BACH1 contains three binding sites for miR-K12-11 and at least four more binding sites for other human miRs, as follows: miR-142, miR-196, miR-292 and Let-7. By site-directed mutagenesis, we removed the binding sites for the other miRs (BACH1-3′UTR-Δ [Other]) and transfected Jurkat cells with this modified plasmid vector. [score:2]
[1 to 20 of 2 sentences]
97
[+] score: 6
Guerriero I Analysis of miRNA profiles identified miR-196a as a crucial mediator of aberrant PI3K/AKT signaling in lung cancer cellsOncotarget 2016 84. [score:3]
For example, one novel 5-miRNAs module, namely miR-196a-5p, -196b-5p, -365a-3p, -378a-5p and -30b-5p, has been identified to regulate cell cycle and MAPK/Wnt singling pathways in kidney and uterine cancers in our study. [score:2]
Schimanski CC High miR-196a levels promote the oncogenic phenotype of colorectal cancer cellsWorld J. Gastroenterol. [score:1]
[1 to 20 of 3 sentences]
98
[+] score: 6
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196b
For example, Crohn’s disease is caused by synonymous variant rs10065172 within the IRGM coding region, which alters a miR-196 binding site [12]. [score:3]
In contrast with previous observations, the differential RSCU only shows large changes in the case of cervical and vulvar cancer (rs2069763), schizophrenia (rs6277), in agreement with the bicodon analysis, and Crohn’s disease (rs10065172), where a large change in the pause propensity is not expected because, in this case, the sSNP is related to alterations in the miR-196 binding site [12]. [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 6
The incubation of NHDF cell cultures for 2 hours with a biological drug leads to changes in the expression of 12 miRNAs (hsa-miR-1231, hsa-miR-1275, hsa-miR-143, hsa-miR-16, hsa-miR-1909, hsa-miR-196a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-3162, hsa-miR-34a, hsa-miR-382, and hsa-miR-939), regulating the expression of the analysed transcripts. [score:6]
[1 to 20 of 1 sentences]
100
[+] score: 6
Based on real-time polymerase chain reaction (PCR), the analysis of miRNA arrays using pooled RNA samples from five gastric cancer patients indicates that the expression of miRNA-107, miRNA-21, miRNA-196a, miRNA-26b, miRNA-9, miRNA-142-3p, miRNA-30b, miRNA-150, miRNA-191, and miRNA-17 was found to be upregulated [14]. [score:6]
[1 to 20 of 1 sentences]