sort by

202 publications mentioning hsa-mir-183 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-183. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 312
Furthermore, downregulation of miR-183 has been shown to be associated with metastasis in lung cancer, and its' ectopic expression inhibits the invasiveness of cancer cells [14], suggesting that miR-183 plays a role in carcinogenesis or the metastatic cascade, possibly having a tumour suppressor role. [score:10]
Overexpression of miR-183 in HeLa cells has also been shown to inhibit migration and invasion, however this was shown to be mediated through direct targeting of integrin β1 (ITGB1)[30], indicating that miR-183 is likely to have a number of mRNA targets through which it mediates biological effects in cancer cells. [score:10]
Interestingly, the expression of miR-182 which is co-ordinately expressed from the same genetic locus as miR-183 has been shown to be downregulated in ER positive tumors[13], this supports our finding of miR-183 dysregulation in association with ER status. [score:9]
Downregulation of VIL2 as a result of miR-183 overexpression was validated using RQ-PCR, indicating that regulation occurred at the mRNA level, this is in contrast to the findings of Wang et al[14] who found regulation of Ezrin to be at the posttranscriptional level in lung cancer. [score:8]
During the course of these experiments, the first functional study of miR-183 in malignancy was reported; Wang et al[14] identified miR-183 as a potential metastasis inhibitor in lung cancer and demonstrated that over expression of miR-183 inhibited migration of lung cancer cells. [score:7]
The cell lines were chosen on the basis of their ER, PR and HER2 /neu receptor status and the expression of miR-183 in breast cancer cell lines mirrored that of the clinical breast tumor samples, with the lowest expression in T47D cells which are ER+ve/PR+ve and HER2/ neu -ve, and the highest expression in SKBR-3 cells which are ER-ve/PR-ve and HER2/ neu +ve (figure 2). [score:7]
In the SKBR-3 cells which did not exhibit decreased migration, there appeared to be decreased membranous and cytoplasmic expression of Ezrin in the transfected cells (figure 6b), this suggests that the overexpression of miR-183 in these cells had disrupted Ezrin expression but this had not translated to a measurable functional effect. [score:7]
We demonstrate that miR-183 is dysregulated in breast cancer and expression correlates with estrogen receptor and HER2/neu receptor expression. [score:6]
It is likely that much of the migration inhibition induced by miR-183 in breast cancer cells is modulated via Ezrin downregulation. [score:6]
Specifically, the VIL2-coding protein Ezrin was confirmed as a target of miR-183 and downregulation of this protein was confirmed with immunocytochemistry. [score:6]
RQ-PCR verified that the mRNA level of VIl2, MYBL2 and CD68 could be downregulated by overexpression of miR-183 (figure 5b). [score:6]
Figure 6 VIL2 expression in breast cancer cells overexpressing miR-183. [score:5]
No miRBaseNo PictarNo Targetscan These genes could be either directly or indirectly affected by miR-183. [score:5]
All three of the algorithms used (miRBase, PicTar and TargetScan) predicted VIL2/Ezrin a member of the ezrin/radixin/moesin (ERM) family of proteins that mediate cytoskeletal-membrane interactions and cell signalling[39] to be a target of miR-183 via perfect complementarity at a binding site at position 366-373 of Ezrin 3'UTR. [score:5]
The fold change in gene expression in cells overexpressing miR-183 was calculated relative to the negative control cells using the comparative Ct method (figure 5a) and the percentage dysregulation was calculated using the equation : % downregulation = 100-100 × 2 [-ΔΔCt]. [score:5]
Figure 4Overexpression of miR-183 inhibits migration in T47D cells. [score:5]
No miRBaseNo PictarNo TargetscanThese genes could be either directly or indirectly affected by miR-183. [score:5]
Induced overexpression of miR-183 inhibited migration of breast cancer cells. [score:5]
The difference in effect noted between the cell lines is not completely surprising for a number of reasons; firstly T47D cells were shown to express the lowest endogenous levels of miR-183, thus the effect of overexpression in these cells would be expected to result in a more dramatic or measurable phenotypic effect than in cells where miR-183 is expressed at higher levels endogenously. [score:5]
Overexpression of miR-183 alters VIL2 protein expression in breast cancer cells. [score:5]
To further elucidate the mechanism by which miR-183 regulates metastasis we analysed the expression of 96 breast cancer related genes using a low density array and identified candidate genes which were dysregulated following transfection of T47D cells with miR-183 (table 2). [score:5]
There has been limited functional analysis of miR-183; it has been postulated that miR-183 may downregulate anti-apoptotic factors including forkhead transcription factor (FOX) proteins, suggesting a pro-apoptotic function for this miRNA[9, 29], however this was based on computational analysis and no experimental verification was provided. [score:4]
They reported miR-183 induced dysregulation of expression of genes involved in migration and invasion, including VIL2. [score:4]
Mature miR-183 was expressed in all the tumor samples and the expression of miR-183 was significantly lower in ER positive breast tumors compared to ER negative tumors with a fold change of 2.97 between the groups, p = 0.01, figure 1a. [score:4]
Figure 5Dysregulation of mRNAs following induced overexpression of miR-183. [score:4]
These findings indicate that miR-183 targets VIL2 and may play a central role in the regulation of migration and metastasis in breast cancer. [score:4]
As miR-183 was shown to be dysregulated in relation to ER and HER2/ neu status it is not unexpected that this miRNA would behave differently depending on the cell type and environment, particularly in relation to the expression of these receptors. [score:4]
This finding was substantiated by RQ-PCR of mRNA from cells overexpressing miR-183 which showed dysregulation of several migration and invasion related genes. [score:4]
Differential expression of miR-183 in breast cancer cell lines has been demonstrated by Sempere et al [25] using northern blotting, with decreased expression in basal-type compared to luminal-type cell lines. [score:4]
Conversely, miR-183 has been shown to be downregulated and inversely associated with metastasis in lung cancer[14]. [score:4]
Computational prediction algorithms were used to identify which of these miRNAs may be direct targets of miR-183 via complementary binding at the 3'UTR. [score:4]
Changes in gene expression in the presence of increased miR-183. [score:3]
Figure 1a: miR-183 expression is significantly higher in ER -negative tumors *p = 0.01, independent t-test. [score:3]
Quantitation of miR-183 by RQ-PCR in primary breast tumors revealed that miR-183 expression is significantly lower in ER and PR positive compared to ER and PR negative breast tumors, while miR-183 expression was significantly higher in HER2/ neu positive compared to HER2/ neu negative tumors. [score:3]
Figure 1b: miR-183 expression is signifcantly higher in PR -negative tumors *p = 0.03, independent t-test. [score:3]
The lowest endogenous expression of miR-183 was observed in T47D cells, which are ER and PR positive and HER2/ neu negative, making these cells a suitable in-vitro representation of the Luminal A subtype of breast cancer. [score:3]
MiR-183 is located on chromosome 7q32.3 and is part of a miRNA family comprised of three homologous miRNAs (miR-183, miR-182 and miR-96) that are co-ordinately expressed from this locus. [score:3]
Luminal A tumors exhibited the lowest expression of miR-183. [score:3]
A cohort of fresh frozen breast tumor (n = 70) and TAN (n = 9) specimens was used for analysis of miR-183 expression. [score:3]
This evidence indicates that the expression patterns of miR-183 are tissue specific, and that this miRNA may have divergent functions depending on the tissue or cell type. [score:3]
MiR-183 family members have been shown to be upregulated in leukaemia, hepatic and colorectal cancer [9- 12]. [score:3]
Interestingly, the immunocytochemical analysis of T47D cells for Ezrin expression following transfection with miR-183 demonstrated more membranous staining in the transfected cells, which is in keeping with less metastatic potential (figure 6a). [score:3]
RQ-PCR of mature miR-183 in these samples showed no significant difference in expression between tumor and tumor associated normal tissue (p = 0.35, paired t-test). [score:3]
We also found changes in Ezrin protein expression in breast cancer cells following transfection with miR-183. [score:3]
The expression of miR-183 was quantitated in 70 breast tumors, 9 of which had matched TAN tissue available. [score:3]
Figure 1c: miR-183 expression is significantly higher in HER2 /neu positive tumors *p = 0.029, independent t-test. [score:3]
The aims of this study were to further examine the expression and functional role of miR-183 in breast cancer. [score:3]
There was a positive correlation between miR-183 expression and tumor size but this did not reach statistical significance(R = 0.271, p = 0.076). [score:3]
The findings of this study support a role for miR-183 in breast cancer, particularly in the metastatic process, and identify this miRNA as a novel therapeutic target in breast cancer. [score:3]
Gain of function analysis was performed in breast cancer cells using pre-miR-183 and the effect of miR-183 overexpression on cell viability, proliferation, apoptosis and migration was examined. [score:3]
The elucidation of the functional role of miR-183 in breast cancer promises to provide an important avenue for further analysis in in-vivo systems with an aim to develop a new diagnostic and therapeutic target in the management of metastatic breast cancer. [score:3]
Figure 5b: RQ-PCR using conventional taqman assays verified downregulation of a selection of breast cancer associated genes following transfection of T47D cells with pre-miR-183. [score:3]
Figure 2 miR-183 expression in breast cancer cell lines. [score:3]
The expression of miR-183 is significantly lower in Luminal A tumors (mean RQ 76.26+/-13) than the other intrinsic subtypes, (p = 0.02, ANOVA, figure 1d). [score:3]
T47D cells were used in this experiment as they express he lowest levels of endogenous miR-183. [score:3]
The finding that miR-183 reduces migration in breast cancer cells indicates that this miRNA may play an important role in the suppression of metastases, as cell motility and migration are key steps in the metastatic cascade. [score:3]
With the criterion of dysregulation of > 50%, we identified 14 genes that were differentially expressed following transfection of pre-miR-183 compared to negative controls. [score:3]
MiR-183 expression in breast cancer cell lines. [score:2]
MiR-183 is located on chromosome 7q32 and is part of a miRNA family which are dysregulated in numerous cancers. [score:2]
The ApoGlow™ Adenylate Nucleotide Ratio Assay (Cambrex) was used to determine the effect of miR-183 overexpression on distinct mechanisms underlying alterations in cell viability. [score:2]
To further explore the role of miR-183 in breast cancer, we compared the expression levels of 94 breast cancer related genes in cells transfected with pre-miR-183 and pre-miR -negative control. [score:2]
Figure 5a: 14 genes were differentially expressed in T47D cells transfected with pre- miR-183 compared to negative control. [score:2]
Induced overexpression of miR-183 resulted in decreased migration of T47D cells in transwell assays, but there was no significant change in migration of SKBR3 or MDA-MB-231 cells (figure 4). [score:2]
The lowest expression of miR-183 is in T47D cells which are ER positive and HER2/neu receptor negativeAs miR-183 was dysregulated in breast tumors in association with clinico-pathological parameters ER, PR and HER2 /neu status, we further investigated the role of miR-183 in breast cancer via gain of function experiments. [score:2]
VIL2 was the only gene that was predicted to have a binding site for miR-183 in its 3'UTR by all three databases, indicating that VIL2 is likely to be directly affected by miR-183. [score:2]
MiR-183 expression was quantitated in primary breast tumours, tumour associated normal tissue and breast cancer cell lines using RQ-PCR. [score:2]
Figure 1d: miR-183 expression is significantly lower in Luminal A tumors compared to all other subtypes p = 0.02, ANOVA. [score:2]
The lowest expression of miR-183 is in T47D cells which are ER positive and HER2/neu receptor negative As miR-183 was dysregulated in breast tumors in association with clinico-pathological parameters ER, PR and HER2 /neu status, we further investigated the role of miR-183 in breast cancer via gain of function experiments. [score:2]
Conversely, miR-183 expression was higher in HER2 /neu receptor positive tumors compared to HER2 /neu receptor negative tumors (mean RQ 329.79+/-150 vs 93.33+/-15 p = 0.012, figure 1c). [score:2]
Customized Taqman Low Density Arrays (TLDA) were used to identify dysregulated genes in breast cancer cells transfected with pre-miR-183. [score:2]
This is the first report of miR-183 dysregulation in association with hormone and HER2/ neu receptor status in clinical breast tumour samples. [score:2]
The effect of miR-183 modulation on cellular functions which are frequently dysregulated in malignancy was assessed in T47D cells (ER [+], PR [+], HER2 /neu [-]), SKBR3 cells (ER [-], PR [-], HER2 /neu [+]), and MDA-MB-231(ER [-], PR [-], HER2 /neu [-]), cells which exhibit distinct hormone and HER2 /neu receptor profiles. [score:2]
MiR-183 expression in breast tumors. [score:2]
These results imply that there is an important regulatory role of miR-183 in breast cancer, centering on cell migration and metastatic potential. [score:2]
Figure 1 MiR-183 Expression in Primary Breast Tumors. [score:2]
There was no effect on apoptosis or proliferation, which refutes the hypothesis of miR-183 having a pro-apoptotic function. [score:1]
Functional analysis was then performed by transfection of miR-183 precursors into a breast cancer cell line with low endogenous miR-183 levels. [score:1]
In brief, cells were transfected with hsa-pre-miR-183 or pre-miR -negative control as described, seeded into 96 well plates at a density of 8 × 10 [3 ]cells per well and incubated for 72 hours. [score:1]
Two samples were run on each TLDA card; RNA extracted from cells that were hsa-pre-miR-183 transfected and cells that were pre-miR -negative control transfected. [score:1]
This was undertaken by quantitation of miR-183 in breast cancer specimens in relation to known clinicopathological parameters of breast cancer. [score:1]
To further assess the functional role of miR-183 in breast cancer, the effect of miR-183 overexpression on cell migration, proliferation and apoptosis were evaluated. [score:1]
In this study we investigated the expression pattern and functional role of miR-183 in breast cancer. [score:1]
There was no association of miR-183 with other clinicopathological parameters, including histological subtype (p = 0.669), nodal status (p = 0.271), tumor grade (p = 0.326). [score:1]
Quantification of migration through 8- m pore inserts by miR-183 transfected cells as a percentage of that achieved by control cells. [score:1]
There was positive staining of both pre-miR-183 transfected and negative control T47D cells however membranous staining of VIL2 appeared stronger in T47D cells transfected with pre-miR-183 (figure 6a). [score:1]
Cells were transfected with pre-miR-183 or pre-miR negative control, seeded onto chamber slides which were then fixed and stained with VIL2 antibody at 72 hours. [score:1]
To further investigate the nature of VIL2 as a potential miR-183 target, we evaluated the effect of increased miR-183 on VIL2 protein expression in T47D and SKBR3 cells which have distinct hormone and HER2 /neu receptor status profiles. [score:1]
The comparative Ct method of relative quantification using MRPL19 and PPIA as endogenous controls was used and relative quantification between hsa-pre-miR-183 transfected samples and negative controls was determined according to the 2−ΔΔ C [T ]method. [score:1]
This indicates that miR-183 affects VIL2 at both the mRNA and protein levels. [score:1]
Thus, it is important to functionally characterise miRNAs, such as miR-183 that are dysregulated in breast cancer and establish what effect this dysregulation may have on tumour behaviour. [score:1]
Mature miR-183 levels were quantitated in T47D cells following transfection with PremiR-183 precursor molecules. [score:1]
In the more aggressive SKBR-3 and MDA-MB-231 cells the migratory cell number was higher overall but there was no difference in migratory number between cells transfected with pre-miR-183 and negative controls. [score:1]
Migration of pre-miR-183 and pre-miR -negative control transfected cells in response to FBS enriched media was tracked using Transwell inserts. [score:1]
The efficiency of pre-miR-183 transfection was confirmed by quantitation of mature miR-183 levels in miRNA extracted from cells transfected with 20 nm pre-miR-183 and incubated to 48 and 72 hours. [score:1]
The highest mature miR-183 levels were seen at 72-hours, with a mean fold change of more than 6000-times that of the negative control (figure 3). [score:1]
Breast cancer cell lines were transfected with hsa-pre-miR-183 or negative control as described and seeded into chamber slides. [score:1]
Hsa-miR-183 pre-miR miRNA precursor (Ambion cat. [score:1]
T47D cells were chosen for this part of the experiment as they had shown the greatest phenotypic change in response to miR-183 modulation. [score:1]
There was no significant difference in ATP or ADP levels between miR-183 transfected cells and controls at 72 hours indicating no effect of miR-183 on cell proliferation, apoptosis or viability. [score:1]
The efficiency of overexpression of miR-183 was evaluated by RQ-PCR. [score:1]
MiR-183 is a member of a miRNA family comprised of three homologous miRNAs (miR-183, miR-182 and miR-96) that are clustered within 2-4 kb at chromosome 7q32. [score:1]
[1 to 20 of 101 sentences]
2
[+] score: 256
Other miRNAs from this paper: hsa-mir-96, mmu-mir-182, mmu-mir-183, hsa-mir-182, mmu-mir-96
Sylamer analysis of 912 miRNA target heptamers, including all conserved 8mer, 7mer-m8, 7mer-1A sites from TargetScan 6.2, revealed significant depletion of two miR-183 cluster target heptamers (GTGCCAA, TGCCAAA) in downregulated Tg [1MDW/1MDW] P5-OC 3′UTRs (Fig.   6A), complementing the TargetScan 6.2 -based hypergeometric analysis (Table  5, Fisher’s Exact Test P = 0.017). [score:12]
In miR-183C [GT/GT] 5wk-retina, our hypergeometric analysis demonstrates that combined loss of all miR-183 cluster miRNAs results not only in enrichment (Odds Ratio 1.65–1.70, FDR-adjusted P < 0.05, Table  5) of miR-183 cluster targets in miR-183C [GT/GT] upregulated genes (uncorrected P < 0.05, fold change >+ 1.05), but also the reciprocal depletion of miR-96 and miR-182 targets (Odds Ratio 0.52, 0.58, respectively, FDR-adjusted P < 0.05, Table  5) in miR-183C [GT/GT] downregulated genes (uncorrected P < 0.05, fold change <−1.05). [score:11]
The effects mediated by miRNAs on inner ear morphogenesis, neurosensory cell identity, function and homeostasis indicate that gene regulation through miRNAs are critical to the biology of the inner ear 1– 6. The polycistronic cluster of Mir96, Mir182 and Mir183 genes are abundantly expressed in afferent cochlear and vestibular neurons and their peripheral innervating targets: auditory and vestibular hair cells (HCs) 7– 9. From an evolutionary viewpoint, the miR-183 cluster of miRNA genes are syntenic, highly conserved and co-expressed in neurosensory organs of animals representing several taxonomic phyla, suggesting that the control of gene expression through by this miRNA cluster is highly coordinated and under extraordinary selective pressure [10]. [score:10]
Since Notch signaling is regulated by miRNAs in Drosophila [43], one testable hypothesis using Tg [1MDW/1MDW] is to ask whether SC miR-183 cluster expression affects Notch -mediated cell fate specification and/or homeostasis as the mechanism for how targeted misexpression of the HC specific miR-183 cluster may increase the propensity of SCs to transdifferentiate into HCs, an emerging paradigm for treating hearing loss 44– 46. [score:8]
In the P5-OC, the majority of changed genes (27/32) were downregulated (Fig.   5A, Table  2), whereas in P18-cochlea, the majority were upregulated (37/45), not counting Prm1 and miR-183 cluster miRNAs (Fig.   5B, Table  3). [score:7]
The majority of downregulated genes observed by microarray (Table  2) at P5 are glial cell specific, supporting a significant influence of miR-183 cluster gene regulation on glial cell misexpression, most likely from Schwann cells that underlie the greater epithelial ridge (GER) and inner sulcus in the P5 OC microdissected tissue. [score:7]
This mammalian miRNA misexpression mo del demonstrates the potency of small non-protein coding miRNAs and should be useful in genomic/transcriptomic/proteomic studies to identify primary miR-183 cluster target genes and regulatory, structural and/or metabolic pathways affected by their dysregulation. [score:7]
Given that miR-183 cluster expression requires Atoh1 -mediated HC specification [9], the miR-183 cluster likely serves a crucial function in HC differentiation by downregulating Sox2, Notch1, and Hes1, thus contributing to Atoh1 specific HC fate determination. [score:6]
For each miR-183 cluster miRNA, we found enrichment (Odds Ratio 1.43–1.45, FDR-adjusted P < 0.05, Table  5) of evolutionarily conserved 3′UTR seed targets in P5 Tg [1MDW/1MDW] downregulated genes (uncorrected P < 0.05, fold change <−1.05). [score:6]
This transcriptome level microarray analysis validates the engineered intent of Tg [1MDW], i. e. miR-183 cluster SC misexpression to downregulate genes that are disproportionate with respect to miR-183 cluster 3′UTR-bearing seed sequences. [score:6]
miR-183 cluster mediated translational repression of select target genes. [score:5]
The presence of additional HCs in this mouse mo del of SC miR-183 cluster misexpression is consistent with previous studies in both zebrafish and chicken where overexpression of miR-183 cluster miRNAs increased inner ear HC numbers 11, 12. [score:5]
Based on these data, we hypothesized that the miR-183 cluster, if misexpressed in SCs, would, in the context of mutual exclusion, perturb SC gene expression. [score:5]
In WT OC, the cell-specific mutual exclusion of miR-183 cluster expression from their respective mRNA targets ensures that HCs enforce repression of genes both temporally and spatially, relative to those same genes in SCs. [score:5]
Taken together, the hypergeometric analysis of Tg [1MDW/1MDW] demonstrates that at P5 in the OC, miR-183 cluster target genes, defined by both miRNA and 3′UTR seed site evolutionary conservation, are reduced concomitantly with transgenic overexpression of miR-183, mir-96 and miR-182. [score:5]
The mutual exclusion hypothesis of miRNA function [16] predicts that miR-183 cluster misexpression in adjacent and lineage-related SCs should repress evolutionarily conserved target genes essential to SC identity/function. [score:5]
The mutual exclusion hypothesis of miRNA function [16] predicts that in Tg [1MDW/1MDW], miR-183 cluster misexpression, driven by the GFAP promoter in adjacent and lineage-related SCs (compare Fig.   1A,B) should repress evolutionarily conserved target genes that are simultaneously essential to SC function and incompatible for attaining and/or maintaining the HC fate. [score:5]
Overall, sensory HC degeneration in Tg [1MDW/1MDW] mice suggests a significant potency of these three miRNAs in effecting tissue homeostasis through GFAP promoter -driven miRNA-183 cluster misexpression and represents a novel biological reagent useful to identify molecular pathways and mRNAs targeted by the miR-183 cluster. [score:5]
So, while there is evidence for reciprocal effects on miR-183 cluster target sites, these mo dels do exhibit common gene expression changes, as well. [score:5]
To direct misexpression of miR-96, miR-182 and miR-183 in the SCs of the inner ear, we modified an established GFAP promoter -driven reporter construct (pGFA-nlac, Michael Brenner, UAB) by substituting the nLacZ gene with the miR-183 cluster coding sequences [23]. [score:4]
Phenotypic correlation of extra IHCs in SC-specific single-gene mutants are consistent with negative regulation of these predicted miR-183 cluster target genes. [score:4]
These extra IHCs phenocopy single-gene hypomorphic and null mutations in genes that specify SC identity and that are predicted targets of miR-183 cluster miRNAs (Fig.   2D) 25– 29, 36– 38. [score:4]
We confirmed transgenic SC miR-183 cluster expression directly by dual whole mount ISH/IHC using LNA-DIG labeled probes against miR-182 and an antibody against MYO6 (Fig.   1A–D). [score:4]
In this process, presumptive HCs upregulate the TF Atoh1, notch ligands Delta1 (Dll1) and Jagged 2 (Jag2), and the miR-183 cluster. [score:4]
Mutations in genes that are predicted targets of the miR-183 cluster phenocopy Tg [1MDW/1MDW] -mediated increases in IHCs. [score:4]
Rapid age-related demise of HCs, observed in this mo del both histologically (Figs  7, 8) and physiologically (Fig.   9), suggests a specific potency to dysregulation of miR-183 cluster target genes on postnatal OC homeostasis and function. [score:4]
To test this hypothesis, we engineered Tg(GFAP- Mir183,Mir96,Mir182) (Tg [1MDW]) mice to drive ectopic miR-183 cluster expression using the core human promoter of the glial fibrillary acidic protein (GFAP). [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (boxed probesets). [score:3]
Alternatively, the miRNA/mRNA interactions could include non-conserved and/or off-target effects of the miR-183 cluster. [score:3]
Taken together, these results confirm ectopic miR-183 cluster expression in OC SCs, spiral limbus cells and the Schwann cells that ensheathe neuronal processes projecting to and from the OC. [score:3]
MYO6 is a marker of HC differentiation, suggesting that miR-183 cluster misexpression and its cytoplasmic localization are positive effectors of HC identity. [score:3]
However, further evidence of transgenic SC miR-183 cluster expression was obtained through quantitative RT-PCR, which showed 2.9-, 2.7- and 2.2-fold higher levels of miR-182, miR-96 and miR-183, respectively, in Tg [1MDW/1MDW] versus WT P18-cochlear total RNA (Fig.   1E). [score:3]
This is likely due to G:U wobble base pairs at nucleotides 4 and 5 of miR-183 which, while thermodynamically favorable, can drastically reduce the efficacy of miRNA -mediated translational repression [30]. [score:3]
2009.01.003 19602392 9. Weston MD MicroRNA-183 family expression in hair cell development and requirement of microRNAs for hair cell maintenance and survivalDev. [score:3]
Name Use Sequence (5′-3′) Length Atoh1-U PCR CTGAAAACTGAGACAACCAAATGC 23 Atoh1-L PCR AAGGGTGCAGGGATATTTGTCA 21 Atoh1-Hex 5′ nuclease probe HEX™-TCCTAGCGCGCGGGAAGCC-BHQ-1® 19 Tg-U PCR AACAGCCAGATCACCTTTCACTGC 24 Tg-L PCR GCGCTCTTCCCACAGTTAACACAA 24 Tg-Fam 5′ nuclease probe 6-FAM™-AGGGATATCGGGCTTGAGGAGGTTT-BHQ-1® 25 While there appears to be compelling evidence for wider effects on conserved miRNA targets in P18-cochlea, the hypergeometric analysis did not reveal convincing miR-183 cluster effects in the P18-cochlea microarray data. [score:3]
The spatiotemporal expression pattern of Mir96, Mir182 and Mir183 in the developing vertebrate inner ear and the effects induced by modulating levels of these miRNAs on HC fate determination in zebrafish and chicken argue that these miRNAs collectively function, to some degree, in the transition from inner ear prosensory cells towards a HC fate 8, 9, 11, 12. [score:3]
Interestingly, this extra IHC patterning in Tg [1MDW/1MDW] phenocopies both hypomorphic and null mutants of genes (i. e. Jag1, Sox2, Hes1) that are: 1) markers of differentiated SCs and; 2) predicted targets of miR-183 cluster miRNAs (Fig.   2D) 25– 29. [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (Fig.   5A,B, boxed probesets), with fold changes + 5.67 (P18- Prm1) to + 16.97 (P18- Mir182). [score:3]
Importantly, this enrichment is consistent with repression of miR-183 cluster target genes at evolutionarily conserved sites in Tg [1MDW/1MDW] P5-OC. [score:3]
While it can’t be ruled out that integration of Tg [1MDW] may have disrupted an endogenous gene critical for hair cell survival, comparing Tg [1MDW/1MDW] whole transcriptome effects to those from previously published miR-183 cluster mouse loss-of-function mutants (Fig.   6, Table  5) revealed reciprocal effects on miR-183 cluster target sites. [score:3]
By E15.5, miR-183 cluster expression distinguishes differentiated cochlear HC, which suggests a role for these miRNAs in this cell type transition [9]. [score:3]
Unfortunately, we were unable to identify clear differences in miR-183 cluster expression in WT versus Tg [1MDW/1MDW] at earlier ages (i. e. P5 and P10, data not shown). [score:3]
Transgenic Tg [1MDW/1MDW] mice were developed to misexpress miR-183 cluster in OC SCs to further explore the role of these HC-specific miRNAs on OC cell differentiation. [score:3]
Name Use Sequence (5′-3′) Length Atoh1-U PCR CTGAAAACTGAGACAACCAAATGC 23 Atoh1-L PCR AAGGGTGCAGGGATATTTGTCA 21 Atoh1-Hex 5′ nuclease probe HEX™-TCCTAGCGCGCGGGAAGCC-BHQ-1® 19 Tg-U PCR AACAGCCAGATCACCTTTCACTGC 24 Tg-L PCR GCGCTCTTCCCACAGTTAACACAA 24 Tg-Fam 5′ nuclease probe 6-FAM™-AGGGATATCGGGCTTGAGGAGGTTT-BHQ-1® 25While there appears to be compelling evidence for wider effects on conserved miRNA targets in P18-cochlea, the hypergeometric analysis did not reveal convincing miR-183 cluster effects in the P18-cochlea microarray data. [score:3]
Taken together, these results suggest that Sox2, Notch1, and Hes1 are genuine miR-183 cluster targets. [score:3]
As expected, relative luciferase activity in cells co -transfected with miR-182 and reporter vector containing the Sox2 3′ UTR is reduced by nearly 20%, confirming previous findings that Sox2 is a miR-183 cluster target [9]. [score:3]
For P18-cochlea, Sylamer analysis showed no significant (conserved, non-conserved and/or off-target) effects attributable to miR-183 cluster (Fig.   6B). [score:3]
One possibility is that miR-183 cluster primary effects on gene expression observed at P5 are masked by increasing secondary effects at P18. [score:3]
Jag1, however, failed to validate as a target of any miR-183 cluster member with statistical significance. [score:3]
While the mechanism for the genesis of these extra IHCs is unknown, one possibility is that the transgenic miR-183 cluster expression promotes SC-to-HC transdifferentiation. [score:3]
Indeed, our dual luciferase assays validated Sox2, Notch1 and Hes1 3′UTRs as targets for post-transcriptional repression by miR-183 cluster members (Fig.   4). [score:2]
The miR-183/miR-96 PCR product was directionally cloned into the XmaI-EcoRV sites within the polycloning region of pIRES-hrGFPII (Stratagene) to create p183-X-E. The miR-182 PCR product was subsequently cloned into the EcoRV-NotI sites of p183-X-E to create p182-10. [score:2]
Line name FISH localization Intercross genotypes scoredMen delian ratio χ [2] P-valueTg genotype (log2 [−∆∆CT]) MGI submission # WT = 154 N/ATg [1MDW] Chr 9E3 Het = 240 0.017 5.9 ± 1.3 MGI:5436579 Homo = 113 10.6 ± 2.4 WT = 23 N/ATg [2MDW] Chr 16C1~3.1 Het = 36 0.40 7.5 ± 2.8 MGI:5436582 Homo = 25 15.6 ± 6.7 WT = 25 N/ATg [3MDW] Chr 16 A~B2 Het = 49 0.98 2.2 ± 0.3 MGI:5436584 Homo = 22 3.9 ± 0.7 FVB/NClr-Tg(GFAP- Mir183,Mir96,Mir182)1MDW miceSCs in the postnatal inner ear organ of Corti (OC) express endogenous GFAP and human GFAP-promoter driven GFP and LacZ reporters 21, 22. [score:2]
Indeed, the common HC phenotypes in regards to stereocilia defects, ABR threshold elevation and HC death, while more severe in Mir96 [+/ddl] heterozygotes, are similar and suggest a narrow range of tolerance for modulations in miR-183 cluster miRNA levels, and therefore the genes they regulate. [score:2]
HEK293 cells transfected with p182-10 verified expression and processing of significantly elevated levels of mature miR-183 cluster miRNAs using commercial miRNA PCR assays (Ambion, data not shown). [score:2]
Pierce ML MicroRNA-183 family conservation and ciliated neurosensory organ expressionEvol. [score:2]
To evaluate transcriptome effects directly attributable to the miR-183 cluster, we performed hypergeometric analyses using a non-redundant set of evolutionarily conserved miRNA/3′UTR seed sequences: 153 vertebrate miRNAs and 62,793 3′UTR seed sites (8mer, 7mer-m8, 7mer-1A, 3comp, TargetScan 6.2 [29]). [score:2]
Luciferase activity is significantly repressed in cells co -transfected with synthetic miR-96 or miR-183 and pmirGLO-Notch1 3′ UTR, suggesting that these miR-183 cluster members directly interact with and silence Notch1. [score:2]
To determine whether miR-183, miR-182, or miR-96 directly regulate select SC genes important to HC/SC differentiation (i. e. Jag1, Sox2, Hes1, Notch1) dual luciferase assays were performed. [score:2]
For those effects attributable to the miR-183 cluster in the vertebrate inner ear, these functional distinctions in miRNA regulation might be segregated temporally: in a switch-like manner in the case of HC cell fate assignment, then in a fine-tuning manner in the case of HC morpho-functional maturation and homeostasis. [score:2]
The results quantitate statistically significant (ΔCT values, 2 sample t-test, P < 0.001) increases in miR-182 (2.9 fold), miR-96 (2.7 fold) and miR-183 (2.2 fold) in Tg [1MDW/1MDW] cochlea at P18. [score:1]
These reciprocal effects are consistent with a reduction of miR-183 cluster miRNAs in sensory cells 2, 33 versus a gain of miR-183 cluster miRNAs in SCs (this study). [score:1]
Microarray analysis reveals miR-183 cluster-specific changes in P5-OC transcriptome. [score:1]
Relative expression levels of mature miR-96, miR-82, miR-183 were assayed using ABI Taqman assays according to the ΔΔCt method using snoRNA-202 (Supplementary Figure  S1) or snoRNA-135 as the normalization control. [score:1]
Li H Kloosterman W Fekete DM MicroRNA-183 family members regulate sensorineural fates in the inner earJ. [score:1]
Lumayag S Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degenerationProc. [score:1]
All highlighted plots are miR-183 cluster heptamers and include two (2) predicted to complement Mir96 [ddl] mutant miR-96. [score:1]
Histograms of mean relative luciferase activity in HEK293 cells co -transfected with a dual reporter vector (pmirGLO) containing cloned DNA sequences corresponding to the 3′ UTR of the indicated genes plus synthetic miRNA duplexes representing miR-96, miR-182, miR-183, or all three (ALL) normalized to scrambled siRNA control (CTRL). [score:1]
Each were co -transfected in HEK293 cultures with synthetic RNA duplexes representing miR-96, miR-182, or miR-183 alone or in combination. [score:1]
The miR-183, miR-96 and miR-182 levels were normalized to Sno135. [score:1]
HEK293 cells (~2 × 10 [5] cell/well; 24-well plate) were co -transfected using Lipofectamine 2000 (Invitrogen) with 200 ng reporter vector and 20 pmol synthetic RNA duplex representing scrambled control siRNA (Integrated DNA Technologies), miR-96, miR-182, or miR-183, or with 30 pmol combined miRNAs (10 pmol each). [score:1]
[1 to 20 of 71 sentences]
3
[+] score: 228
This study suggests that miR-183, up-regulated in HCC, represses the expression of the tumor-suppressor PDCD4 posttranscriptionally, and inhibits TGF-β1 -induced apoptosis in human HCC cells. [score:10]
However, we also observed that miR-183 up-regulation in #3, 6, 10, 14 and down-regulation in #8, 16 could not account for the expression levels of PDCD4. [score:9]
To eliminate the off-target effect of miR-183 on apoptosis, we used siRNA to down-regulate PDCD4 gene expression. [score:8]
Furthermore, PDCD4 mRNA levels were inversely correlated with miR-183 expression (Fig. 1C), suggesting that the decreased PDCD4 expression might result from a high expression of miR-183 in HCC. [score:7]
U indicates up-regulation of miR-183 in HCC tissues, and NU indicates down-regulation and no significant change of miR-183 in HCC tissues. [score:7]
Primers used: Forward: GCTG AAT TCG GAT GGA TGT AGA AAA TGA GCA GA; Reverse: CTG CTC GAG TCA GTA GCT CTC TGG TTT AAG A. The miRNAs, siRNAs and miRNA inhibitor were synthesized by GenePharma (Shanghai, China) (miR-183: 5'-UAU GGC ACU GGU AGA AUU CAC UG-3'/5'-GUG AAU UCU ACC AGU GCC AAA AU-3'; the si-PDCD4 target sequences were GUG UUG GCA GUA UCC UUA G [17]; miR-183 inhibitor: 5'-AGU GAA UUC UAC CAG UGC CAU A-3'). [score:6]
The results of qRT-PCR showed that PDCD4 was down-regulated in Huh7 cells transfected with miR-183, whereas the expression levels of other two genes had no significant change (Fig. 1A). [score:6]
We conclude that miR-183 can inhibit apoptosis in human HCC cells by repressing the PDCD4 expression, and miR-183 may play an important role in HCC development. [score:6]
The expression levels of miR-183 in tumor tissues were significantly higher than in adjacent normal tissues (P < 0.01, t = - 3.07), and the expression levels of PDCD4 mRNA in tumor tissues were significantly lower than in adjacent normal tissues (P < 0.01, t = 3.69) HepG2 and Huh7 cell lines were grown in Dulbecco's modified Eagle medium (DMEM) (GIBCO BRL, Grand Island, NY) containing 10% fetal bovine serum (FBS) with 100 μg/ml penicillin/streptomycin at 37°C with 5% CO [2]. [score:5]
Figure 3 miR-183 inhibits TGF-β1 -induced PDCD4 expression in Huh7 cells. [score:5]
As shown in Fig. 4C, the inhibition effect of miR-183 on apoptosis was rescued when PDCD4 expression vector was cotransfected. [score:5]
In the current study, we show that miR-183 expression is up-regulated in human HCC compared with matching adjacent nontumoral tissue. [score:5]
PDCD4 is a proapoptotic molecule involved in TGF-β1 -induced apoptosis in human HCC cells [19], and miR-183 can inhibit TGF-β1 induced PDCD4 expression in Huh7 cells (Fig. 3A, C). [score:5]
To identify the functions of miR-183 in HCC cells, we analyzed putative target genes by using the TargetScan http://www. [score:5]
Figure 1 miR-183 inhibits the mRNA and protein expression of PDCD4. [score:5]
Wild-type 3'-untranslated region (3'-UTR) of PDCD4 containing predicted miR-183 target sites were amplified by PCR from HepG2 cell genomic DNA. [score:5]
These results suggest that up-regulation of miR-183 may be involved in most of human HCC development. [score:5]
These data suggest miR-183 may repress the expression of PDCD4 at posttranscriptional level by targeting its 3'-UTRs. [score:5]
We also show that PDCD4 is negatively regulated by miR-183 at the posttranscriptional level, via a specific target site within the 3' [-]UTR. [score:4]
We found that miR-183 was up-regulated in HCC tumor tissues. [score:4]
To determine whether PDCD4 was direct targets of miR-183, the human PDCD4 wild-type-3'-UTR containing the miR-183 binding site was cloned into a modified pGL-3 control vector. [score:4]
miR-183 maybe play the role of oncogene, considering it is up-regulated in HCC. [score:4]
To finalize the function of miR-183 -targeting these genes in apoptosis regulation, rescue experiments were carried out. [score:4]
In other words, PDCD4 is a direct target gene of miR-183. [score:4]
miR-183 Is Upregulated in Human HCC. [score:4]
However, miR-183 was identified as a potential metastasis -inhibitor in lung cancer cells [23]. [score:3]
The results shown that miR-183 was significantly up-regulated (2 to 300 fold) in 68% of tumors (17 of 25 patients) compared to the matching adjacent nontumoral liver tissues (Table 1). [score:3]
miR-183 inhibits TGF-β1 -induced apoptosis in Huh7 cells. [score:3]
Expressions of miR-183 were examined further in an independent series of primary HCC tumors and adjacent nontumoral livers (The clinical parameter of the HCC patients was shown in Table 1) by using Real-time PCR method. [score:3]
NC RNA, miR-183, and miR-183 inhibitor were cotransfected with a modified pGL-3 control vector containing wild-type PDCD4 3'-UTR or mutant, respectively. [score:3]
The transfection mixtures contained 100 ng of firefly luciferase reporter plasmid and 5 pmol of miR-183 or 20 pmol of miR-183 inhibitor. [score:3]
Moreover, we demonstrated that miR-183 was resistant to TGF-β1 -induced apoptosis of Huh7 cells, via repression of PDCD4 expression. [score:3]
Programmed cell death 4 (PDCD4) was identified as the target gene of miR-183. [score:3]
Therefore, we validated that miR-183 could repress the expression of PDCD4 and analyzed its functions in human HCC cells. [score:3]
Here, we found that miR-183 was resistant to TGF-β1 -induced apoptosis in Huh7 cells, via repression of PDCD4 expression. [score:3]
miR-183 represses the expression of PDCD4. [score:3]
The corresponding results were observed when the expression of miR-183 was repressed by antisense RNA (Fig. 2C). [score:3]
At the same time, we found that there were no significant changes in miR-183 expression levels between control cells and Huh7 cells treated with TGF-β1 (Fig. 3B). [score:3]
Motoyama et al. have found an overexpression of miR-183 in human colorectal cancer and Lin et al. have reported that the miR-183-96-182 cluster was frequently amplified in melanoma [21, 22]. [score:3]
Among the 25 HCC samples analyzed, microRNA-183 was significantly up-regulated (twofold to 367-fold) in 17 samples compared with the matching nontumoral liver tissues. [score:3]
To determine the clinical significance of miR-183 target genes, we examined PDCD4 mRNA levels in 25 pairs of matched HCC specimens by qRT-PCR. [score:3]
To identify the genuine targets, synthetic miR-183 and negative control RNA were transfected into hepatoma Huh7 cells. [score:3]
This method was used to screen the potential target genes of miR-183. [score:3]
Figure 2 miR-183 can act on the 3'-UTR of PDCD4 directly. [score:2]
The expression profiles of miR-183 were compared between HCC tissues and adjacent normal liver tissues using qRT-PCR method. [score:2]
These results support an essential role of miR-183 in HCC development. [score:2]
All these results reveal that PDCD4 is regulated by miR-183. [score:2]
Here, we found that PDCD4 was negatively regulated by miR-183 in HCC cells. [score:2]
In this study, we compared the miR-183 expression profile from HCC tumor tissues and adjacent normal liver tissues. [score:2]
Therefore, miR-183 may play an important role in HCC development. [score:2]
Western blot analysis also showed that miR-183 markedly reduced protein expression levels of PDCD4 compared with negative control RNA and mock transfected cells (Fig. 1B). [score:2]
also showed that miR-183 markedly reduced protein expression levels of PDCD4 compared with negative control RNA and mock transfected cells (Fig. 1B). [score:2]
These data suggest that miR-183 might play a critical role on PDCD4 regulation in over a half but not all of the HCC patients. [score:2]
These luciferase reporter vectors were cotransfected into HepG2 cells with negative control RNA or miR-183 respectively. [score:1]
Thus, it is likely that miR-183 acts as an oncogene in a variety of tumor types. [score:1]
Using bioinformatic analysis, we found that the putative miR-183 binding site of PDCD4 3'-UTR was conserved across various species (Fig. 2A). [score:1]
Finally, the functional effect of miR-183 in hepatoma cells was examined. [score:1]
Cells were transfected with NC RNA, siPDCD4, or miR-183 respectively, after 24 hours, TGF-β1 (5 ng/mL) was added. [score:1]
These data suggest that the effect of miR-183 as an oncogene is cell type dependent. [score:1]
Therefore, we wondered whether miR-183 could influence apoptosis of Huh7 cells. [score:1]
Interaction of miR-183 with the 3'-UTR of the PDCD4 mRNA. [score:1]
Huh7 cells were transfected with NC RNA, siPDCD4, or miR-183 respectively, after 24 hours, TGF-β1 (5 ng/mL) was added. [score:1]
Moreover, PDCD4 is a proapoptotic molecule involved in TGF-β1 -induced apoptosis in human HCC cells, we found that miR-183 transfectants were resistant to apoptosis induced by TGF-β1. [score:1]
At the same time, the effect of TGF-β1 on miR-183 was examined (B). [score:1]
This miRNA cluster including three miRNAs, i. e., miR-96, miR-182 and miR-183. [score:1]
The PDCD4 3'-UTR mutant is identical to the wild-type, except that it has four point substitutions (red) disrupting pairing to miR-183 seed. [score:1]
Sequence analysis suggested a likely interaction between the 3'-UTR of PDCD4 mRNA and miR-183. [score:1]
miR-183 is one member of miR-182-183 miRNA cluster located in the 7q31-34 locus [20]. [score:1]
These results indicated that miR-183 was resistant to TGF-β1 -induced apoptosis of Huh7 cells. [score:1]
Figure 4 miR-183 transfectants were resistant to apoptosis induced by TGF-β1. [score:1]
[1 to 20 of 70 sentences]
4
[+] score: 214
Mechanistically, we showed that AGGF1 blocked ERK1/2 activation, repressed expression of ZEB1, and induced expression of miR-183-5p, which then inhibited expression of CHOP, the key inducer of apoptosis. [score:9]
We have found that AGGF1 induces expression of miR-183-5p, which then reduces the CHOP expression by a post-transcriptional suppression mechanism through binding to the 3′-UTR of CHOP (Fig.   5). [score:7]
Because CHOP is the key regulator of ER stress and its expression is regulated by miR-183-5p, we assessed the direct role of miR-183-5p on ER stress -induced apoptosis. [score:6]
Fig. 5AGGF1 downregulates expression of CHOP via miR-183-5p. [score:6]
It is interesting to note that the Ago-miR-183-5p mimics and Antagomir-miR-183-5p inhibitor also have a major impact on cardiac hypertrophy and dysfunction upon pressure overload regardless of Aggf1 expression or AGGF1 protein treatment, respectively (Figs.   7 and 8). [score:5]
These data suggest that miR-183-5p negatively regulates the expression of CHOP by directly binding to the 3′-UTR of CHOP. [score:5]
MiR-183-5p mimics, Ncontrol miRNA mimics (Ncontrol), a miR-183-5p inhibitor, a miR-183-5p inhibitor control, and stabilized miRNAs (Ago-miR-183-5p and control Ago-miR-NC) were from Guangzhou RioboBio. [score:5]
d Real-time RT-PCR analysis for miR-183-5p expression in H9C2 cells after AGGF1 treatment with or without ZEB1 overexpression (n = 3/group, ** P < 0.01). [score:5]
The Antago-miR-183-5p inhibitor increased CHOP expression in TAC mice (Supplementary Fig.   10). [score:5]
AgomiR-183-5p (100 nmol/kg), AntagomiR-NC (100 nmol/kg), a miR-183-5p inhibitor (200 nmol/kg), and a miR-183-5p inhibitor control (200 nmol/kg) were administered by intramuscular injection into the left ventricle myocardium at multiple sites in 0.2 ml of saline 24 h prior to TAC. [score:5]
Fig. 6Mechanism for AGGF1 regulation of miR-183-5p expression. [score:4]
These data are consistent with our results that AGGF1 acts upstream of miR-183-5p in regulation of CHOP expression. [score:4]
On the basis of our mo del, AGGF1 knockdown reduces the level of miR-183-5p due to increased ZEB1; therefore, ZEB1 knockdown is expected to rescue the effect of AGGF1 knockdown. [score:4]
Together, all these data again indicate that miR-183-5p post-transcriptionally downregulates Chop. [score:4]
We further demonstrated that AGGF1 negatively regulates activation of ERK1/2, leading to a decreased level of transcriptional repressor ZEB1, resulting in increased expression of miR-183-5p (Fig.   6). [score:4]
The studies with the miR-183-5p inhibitor showed that AGGF1 acts upstream of miR-183-5p in regulating cardiac hypertrophy and heart failure (Fig.   8). [score:4]
More interestingly, AGGF1 treatment significantly rescued the loss of miR-183-5p expression caused by TAC (Fig.   5h). [score:3]
Fig. 8Ago-miR-183-5p inhibitor blocks therapeutic effect of AGGF1. [score:3]
h Real-time RT-PCR analysis for miR-183-5p expression in the hearts of TAC or Sham mice with or without AGGF1 treatment (left, n = 6/group, ** P < 0.01). [score:3]
Moreover, miR-183-5p also inhibited myocardial apoptosis, reduced cardiac hypertrophy and heart failure, and restored myocardial function (Fig.   7). [score:3]
Real-time RT-PCR analysis for miR-183-5p expression in H9C2 cells transfected with AGGF1-specific siRNA (siAGGF1) or siNC (right, n = 3/group, ** P < 0.01). [score:3]
After 24 h, we co -transfected 200 ng of either pMIR-CHOP-wt or pMIR-CHOP-mut together with 100 nM of miR-183-5p mimics or non-target miRNA mimics as well as 20 ng of the pRL-TK vector containing the renilla luciferase gene (Promega, Madison, WI, USA) using Lipofectamine 2000. [score:3]
was carried out by a Student’s two-tailed t-test In order to further confirm the above results, we assessed the levels of Chop mRNA using real-time RT-PCR analysis in H9C2 cells transfected with miR-183-5p mimics or non-target negative control (Ncontrol) miRNA mimics (Fig.   5d). [score:3]
c Luciferase activity of pMIR-CHOP-wt or mutant pMIR-CHOP-mut reporters in the presence of miR-183-5p mimics, a negative control miRNA mimics (Ncontrol), or a miR-183-5p specific inhibitor (n = 3/group, ** P < 0.01). [score:3]
Transfection of the miR-183-5p inhibitor increased luciferase activities from the WT reporter, whereas this effect was abolished in the case of the mutant reporter (Fig.   5c). [score:3]
Similarly, echocardiography showed that AGGF1 increased LVEF and LVFS in TAC mice, but the effect was abolished in the presence of the Antago-miR-183-5p inhibitor (Fig.   8b, c). [score:3]
To test the hypothesis that miR-183-5p is involved in AGGF1 -mediated treatment of hypertrophy and heart failure after TAC, we assessed the effect of AGGF1 protein treatment with or without an Antago-miR-183-5p inhibitor in mice after TAC. [score:3]
showed that the level of the CHOP protein was significantly decreased by miR-95-3p mimics and increased by miR-183-5p inhibitor (Fig.   5e). [score:3]
AGGF1 reduced the cross-sectional diameter of cardiomyocytes in TAC mice, but the reduction was abolished in the presence of the Antago-miR-183-5p inhibitor (Fig.   8f). [score:3]
Moreover, the miR-183-5p inhibitor significantly increased the level of Chop mRNA. [score:3]
Increased miR-183-5p expression will reduce the level of CHOP, which blocks ER stress -induced apoptosis and heart failure. [score:3]
We also examined the level of CHOP in TAC mice with or without Antago-miR-183-5p inhibitor. [score:3]
The quantitative RT-PCR analysis showed that reduced ERK1/2 expression by siRNA significantly increased the level of miR-183-5p (Supplementary Fig.   13). [score:3]
g Real-time RT-PCR analysis for miR-183-5p expression in H9C2 cells 48 h after AGGF1 treatment (left, n = 3/group, ** P < 0.01). [score:3]
To identify the molecular mechanism by which AGGF1 regulates the level of miR-183-5p, we analyzed the promoter/regulatory region of miR-183-5p and found that it contained two binding sites for a transcriptional repressor, Zinc Finger E-Box Binding Homeobox 1 (ZEB1) 47, 48. [score:3]
f Real-time RT-PCR analysis showing decreased miR-183-5p expression in TAC mice (n = 5/group, * P < 0.05) or in an ISO -induced H9C2 cell mo del for cardiac hypertrophy (n = 3/group, * P < 0.05). [score:3]
Quantitative RT-PCR analysis also showed that AGGF1 treatment increased the level of miR-183-5p, but overexpression of ZEB1 abolished the stimulatory effect of AGGF1 on the level of miR-183-5p (Fig.   6d). [score:3]
Real-time RT-PCR analysis for miR-183-5p expression in the hearts of WT (Aggf1 [+/+]) or Aggf1 [+/−] mice after TAC or sham surgeries (right, n = 6/group, * P < 0.05, ** P < 0.01). [score:3]
was carried out by a Student’s two-tailed t-test In order to further confirm the above results, we assessed the levels of Chop mRNA using real-time RT-PCR analysis in H9C2 cells transfected with miR-183-5p mimics or non-target negative control (Ncontrol) miRNA mimics (Fig.   5d). [score:3]
AGGF1 rescued the HW/BW ratio and the LW/BW ratio in TAC mice, but the effect was abolished in the presence of the Antago-miR-183-5p inhibitor (Fig.   8d, e). [score:3]
H&E staining showed that AGGF1 therapy reduced cardiac hypertrophy and heart failure in 6-week-old TAC mice, but the therapeutic effect was lost in the presence of the Antago-miR-183-5p inhibitor (Fig.   8a). [score:3]
b– g Ago-miR-183-5p inhibits cardiac hypertrophy and improves cardiac function. [score:3]
These data suggest that miR-183-5p inhibits cardiac hypertrophy and improves myocardial function. [score:3]
We then analyzed whether AGGF1 regulates the level of miR-183-5p. [score:2]
AGGF1 regulates ER stress signaling by a novel AGGF1-ERK-ZEB1-miR-183-CHOP signaling pathway. [score:2]
The miR-183-5p -binding site at the 3′-UTR of CHOP was mutated in the pMIR-CHOP-wt reporter using PCR -based site-directed mutagenesis as described previously [54], resulting in a mutant reporter, pMIR-CHOP-mut. [score:2]
Together, our data indicate that AGGF1 negatively regulates activation of ERK1/2, which leads to a reduced level of ZEB1, resulting in an increased level of miR-183-5p. [score:2]
These data suggest that ZEB1 acts downstream of AGGF1 in regulation of the level of miR-183-5p (Supplementary Fig.   12). [score:2]
It is important to note that miR-183-5p is the first microRNA identified for post-transcriptional regulation of CHOP. [score:2]
MiR-183-5p mimics inhibits cardiac hypertrophy. [score:2]
e for CHOP abundance in H9C2 cells with transfection of miR-183-5p mimics or a miR-183-5p -specific inhibitor compared with Ncontrol. [score:2]
Fig. 7AGGF1 regulates ER stress and hypertrophy upstream of miR-183-5p. [score:2]
MiR-183-5p inhibitor induces cardiac hypertrophy. [score:2]
The ER stress activator TM increased the abundance of CHOP, ERO1α, and DR5, which was suppressed by miR-183-5p compared with Ncontrol (Supplementary Fig.   15). [score:2]
d for the level of the CHOP mRNA in H9C2 cells with transfection of miR-183-5p mimics or a miR-183-5p-specific inhibitor compared with Ncontrol (n = 3/group, ** P < 0.01). [score:2]
b Schematic diagram showing the wild type (wt) pMIR-CHOP-wt or mutant pMIR-CHOP-mut reporter with the miR-183-5p -binding site mutated. [score:1]
The cross-sectional diameter of cardiomyocytes was decreased in the Ago-miR-183-5p treatment groups (Fig.   7g). [score:1]
The Ago-miR-183-5p mimics significantly reduced the level of CHOP (Supplementary Fig.   10). [score:1]
We examined the level of CHOP in TAC mice with or without Ago-miR-183-5p mimics. [score:1]
Therefore, miR-183-5p by itself may have an impact on cardiac pathology independent from AGGF1. [score:1]
a Bioinformatic analysis of the CHOP mRNA sequence identified a binding site for miR-183-5p at the 3′-UTR. [score:1]
Similarly, in H9C2 cells treated with ISO (a cell mo del for hypertrophy), the level of miR-183-5p was also significantly decreased (Fig.   5f). [score:1]
a ChIP–qPCR analysis for the interaction between ZEB1 and miR-183-5p promoter DNA (n = 4/group, ** P < 0.01). [score:1]
We constructed a miR-183-5p promoter/luciferase reporter gene (Fig.   6b). [score:1]
Because cardiac function was only partially rescued in Chop KO mice in a TAC mo del [24], whereas AGGF1 protein therapy almost completely restored myocardial function, the AGGF1-ERK-ZEB1-miR-183-CHOP signaling pathway may be one of several pathways by which AGGF1 restores myocardial function. [score:1]
H&E staining and echocardiography showed that there is an additive effect for Aggf1 haploinsufficiency and TAC in inducing cardiac hypertrophy and heart failure, which was rescued by Ago-miR-183-5p (Fig.   7b–g). [score:1]
The level of miR-183-5p was significantly decreased in TAC mice (Fig.   5f). [score:1]
We discovered a noncanonical signaling pathway, AGGF1-ERK-ZEB1-miR-183-5p-CHOP, that blocks ER stress -induced apoptosis and cardiac hypertrophy. [score:1]
All these data suggest that the therapeutic effect of AGGF1 protein is dependent on miR-183-5p and AGGF1 acts upstream of miR-183-5p. [score:1]
was carried out by a Student’s two-tailed t-test To establish the role of miR-183-5p in cardiac hypertrophy and heart failure and to explore the relationship between miR-183-5p and AGGF1 during the process, we performed TAC procedures for both WT and Aggf1 [+/−] mice, which were followed by intramuscular injection of Ago-miR-183-5p and control Ago-miR-NC. [score:1]
The finding that miR-183-5p can rescue the effect of Aggf1 haploinsufficiency suggests that Aggf1 acts upstream of miR-183-5p. [score:1]
Either in WT mice or in TAC mice, AGGF1 treatment increased the level of miR-183-5p (Fig.   5h). [score:1]
Furthermore, the level of miR-183-5p was significantly decreased in Aggf1 [+/−] mice with or without TAC (Fig.   5h). [score:1]
showed that miR-183-5p reduced the abundance of CHOP, ERO1α, cleaved PARP, and cleaved caspase-3 in the Veh-siNC group (Fig.   7a). [score:1]
This effect of miR-183-5p on ER stress -induced apoptosis was not affected by siAGGF1 (Fig.   7a, compare the Veh-siAGGF1 group to the Veh-siNC group). [score:1]
Consistent with this finding, ChIP analysis showed that the interaction between ZEB1 and miR-183-5p promoter DNA was reduced by AGGF1 because AGGF1 resulted in reduced ZEB1 levels (Fig.   6a). [score:1]
b Schematic diagram showing that the miR-183-5p promoter-luciferase reporter with two ZEB1 -binding motifs. [score:1]
Quantitative RT-PCR analysis also showed that siAGGF1 decreased the level of miR-183-5p, but siZEB1 abolished the effect of AGGF1 on the level of miR-183-5p. [score:1]
Therefore, our data identify a novel non-canonical CHOP pathway for ER stress signaling, i. e., AGGF1-ERK-ZEB1-miR-183-CHOP (Fig.   6i). [score:1]
Our luciferase assays showed that siAGGF1 decreased the luciferase activity from the miR-183-5p promoter luciferase reporter (pGL3-miR-183-5p), and siZEB1 abolished the effect of AGGF1 knockdown on the reporter in H9C2 cells (Supplementary Fig.   12). [score:1]
The analysis revealed a potential binding site for miR-183-5p at the 3′-UTR of CHOP (Fig.   5a). [score:1]
Ago-miR-183-5p decreased the HW/BW ratio (Fig.   7e) and the LW/BW ratio (Fig.   7f) in both Aggf1 [+/−] mice and WT mice after TAC. [score:1]
[1 to 20 of 82 sentences]
5
[+] score: 180
In combination with our previous studies, we propose that the down-regulation of specific miRNAs such as miR-183, perhaps through the inhibition of transcription activators, leads to the overexpression of some key genes connected in the “aggressive pathway” that is specifically up regulated in aggressive tumors. [score:9]
In order to verify miR-183 truly regulate its predicted target, we over-expressed this miRNAs using pre-miR miRNA precursors in HeLa and ZR-75-1 cell lines and measured the effect on the expression levels of the predicted target by RT-qPCR. [score:8]
All these results seemed to show that ETS2 is involved in the regulation of miR-183 and that its down-regulation in aggressive PRL tumors could explain, at least in part, the decrease of miR-183 expression. [score:7]
Among all of the transcription factors with potential involvement in the regulation of miR-183, only ETS2 expression correlates with miR-183 expression. [score:6]
Finally, chromatin immunoprecipitation experiments revealed that ETS2 directly regulates miR-183 expression by binding its regulatory regions (Figure 5C). [score:6]
Together, these data suggest a role for ETS2 down-regulation in the decreased miR-183 expression observed in the same tumors. [score:6]
The miR-183 was found to inhibit KIAA0101 expression by directly interacting with mRNA 3′-UTR as shown by luciferase-reporter assay. [score:5]
Figure 2 Expression of miR-183 and its predicted target KIAA0101 in human PRL tumors. [score:5]
We then tested the effect of overexpressing ETS2 in HeLa and ZR-75-1 cell lines on miR-183 and its target KIAA0101. [score:5]
Moreover, exogenous expression of ETS2 led to a decrease of KIAA0101 at the protein level potentially through the observed increase in expression of miR-183. [score:5]
As shown in Figure 5B, overexpression of ETS2 in both cell lines significantly increased miR-183 expression. [score:5]
Following the supplier’s instructions, the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) was used to measure the activity of miR-183 matching the target sequence in KIAA0101; sequences were cloned into the 3′-UTR of luciferase (sense, 5′-AAACTAGCGGCCGCTTTGATTATTGGAATG GTGCCATATTGT-3′; antisense, 3′-TTTGATCGCCGGCGAAACTAATAACCTTAC CACGGTATAACAGATC-5′), and with mismatch sequence within the seed (sense, 5′-AAACTAGCGGCCGCTTTGATTATTGGAATGGT AAATATTGT-3′; antisense, 3′-TTTGATCGCCGGCGAAACTAATAACCTTACCA TTTTATAACAGATC-5′). [score:5]
Relative expression of miR-183 and KIAA0101 target gene was assessed by RT-qPCR in aggressive (A; n = 8) and non-aggressive (NA; n = 18) human PRL tumors. [score:5]
Indeed, we demonstrate in this study that ETS2 activates miR-183 expression by directly binding its regulatory regions. [score:5]
It has been shown in several studies that overexpression of miR-183 in corresponding cell lines inhibits cell growth (47, 49, 51). [score:5]
Figure 5 The transcription factor ETS2 regulates miR-183 expression. [score:4]
Thus, we focused our attention on miR-183 that is down-regulated in aggressive vs. [score:4]
Using these criteria, we highlight that miR-183 is significantly down-regulated in aggressive vs. [score:4]
Post-transcriptional regulation of KIAA0101 expression by miR-183 was assessed in vitro by monitoring KIAA0101 mRNA and protein levels in HeLa and ZR-75-1 cell lines 48 h after transfection of pre-miRNA-183. [score:4]
In vitro, we show that miR-183 decreases the expression of KIAA0101 at both the mRNA and protein levels by directly binding to the 3′-UTR. [score:4]
To explain the decrease in miR-183 expression in aggressive PRL tumors, we first analyzed genetic alterations and DNA methylation in regulatory region but could not detect any differences between aggressive and non-aggressive tumors at this locus (data not shown). [score:4]
Interestingly, miR-183 has been found to be down-regulated in neuroblastoma (45), pancreatic cancer (46), lung cancer (47, 48), ovarian cancer (49), and osteosarcoma (50, 51) when compared to corresponding normal tissues. [score:3]
Finally, we assessed the correlation between the four miRNA expression and Ki-67 and p53 labeling in the 26 PRL tumors and it appeared that only miR-183 showed a significant inverse correlation with both cell cycle markers (miR-183:Ki-67 r = −0.58, p = 0.002; miR-183:p53 r = −0.59; p = 0.0014) (Table 3). [score:3]
miR-183 overexpression decreases cell proliferation. [score:3]
As shown in Figure 4A, miR-183 overexpression in HeLa and ZR-75-1 cell lines led to a significant slowdown in cell growth. [score:3]
Our integrative analysis has identified KIAA0101 as a new putative target for miR-183. [score:3]
Thus, we assessed the effect of miR-183 overexpression on HeLa and ZR-75-1 cell lines. [score:3]
We performed growth curves on three independent experiments overexpressing miR-183 in each cell line. [score:3]
The human pre-mRNA expression construct lenti-miR-183 (MI0000273) and scramble control hairpin in pCDH-CMV-MCS-EF1-copGFP (CD511B-1) were purchased from System Biosciences (SBI, Mountain View, CA, USA). [score:3]
Following miR-183 overexpression, we observed a strong decrease in KIAA0101 mRNA and protein levels in both cell lines (Figure 3A). [score:3]
Correlations between the expression of transcription factors and miRNA were calculated using Spearman test and only ETS2:miR183 (r = 0.43, p = 0.0167) showed significant correlation in the pituitary tumors studied, moreover, ETS2 showed a significant down-regulation at the mRNA level in the aggressive tumors compared to the non-aggressive ones (Figure 5A; Table S4 in). [score:3]
miR-183 regulates KIAA0101 by direct interaction with 3′-UTR. [score:3]
Computational analysis of miR-183 regulatory region using PROMO algorithm (33, 34) showed that 60 transcription factors could potentially regulate miR-183 (Table S4 in). [score:3]
Figure 4 miR-183 overexpression induces cell accumulation in S phase thus decreasing cell proliferation. [score:3]
Growth curves were performed by daily counting of viable pre-miR-183 transfected and scramble transfected cells expressing GFP protein using an LSRII FACS flow cytometer (BD Biosciences Europe, Erembodegem, Belgium). [score:3]
Consistent with these findings, we demonstrate that miR-183 -mediated KIAA0101 silencing decreases HeLa and ZR-75-1 proliferation by deregulating cell cycle progression. [score:2]
Moreover, the specificity of miR-183 binding was assessed using a mutation in the sequence of KIAA0101 that is bound by miR-183 seed (Figure 3B). [score:2]
MiR-183 expression is controlled by the transcription factor ETS2. [score:2]
Consequently, KIAA0101 expression was strongly decreased in both cell lines transfected with pre-miR-183 precursor compared to negative control. [score:2]
First, we confirmed that transfection of pre-miRNA-183 leads to a strong and significant overexpression of mature miR-183 using TaqMan microRNA Assay (Figure 3A). [score:2]
We then analyzed the deregulation of transcriptional activators of miR-183. [score:2]
Using Ingenuity Pathway Analysis Software on these 22 genes, we found that nine of these genes were linked to the “aggressive pathway” and were predicted to be regulated by four miRNAs (miR-183, miR-340*, miR98, and miR-744) (Table 3). [score:2]
KIAA0101 protein level decreased in both cell lines overexpressing miR-183 compared to negative control (scramble) transfected cells. [score:2]
Transfection of pre-miR-183 precursor led to a strong increase in miR-183 expression in HeLa and ZR-75-1 cell lines compared to negative control miRNA precursor transfection. [score:2]
The luciferase assay clearly showed that luciferase activity is decreased only when miR-183 is overexpressed in the presence of match sequence. [score:2]
Three pre-miRNA precursors were used: hsa-pre-miR-183 (PM10426), the positive control hsa-pre-miR-1 (AM17150), and the negative control pre-miR miRNA precursor negative control #1 (AM17110). [score:1]
These results strongly suggest the involvement of miR-183 loss in control of proliferation and thus in the progression toward aggressive phenotype. [score:1]
These data are consistent with our study corroborating the decrease in cell proliferation of HeLa and ZR-75-1 cells after transfection with miR-183. [score:1]
The analysis of these mechanisms in PRL tumors showed no significant differences between aggressive and non-aggressive tumors for miR183 miRNA analyzed (data not shown). [score:1]
Growth curves were performed by counting viable cells after miR-183 or scramble control transfection every day for 5 days. [score:1]
miR-183 appeared as a main miRNA involved in progression toward aggressiveness and malignancy. [score:1]
Cell cycle analysis was performed by propidium iodide staining of cells 120h after miR-183 or scramble control transfection. [score:1]
[1 to 20 of 52 sentences]
6
[+] score: 131
Other miRNAs from this paper: hsa-mir-96, hsa-mir-182
In this study, we found that the expression level of the miR-183/182/96 cluster was upregulated in breast cancer tissues and cell lines in comparison to the corresponding adjacent normal tissues and normal mammary cell lines, respectively, using qRT-PCR analysis. [score:6]
The results demonstrated that patients with higher miR-183, miR-182 and miR-96 expression levels had shorter mean OS and DFS than patients with lower expression levels (P = 0.000, 0.000 and 0.022 for OS, respectively and P = 0.000, 0.004 and 0.011 for DFS, respectively, Fig. 3A,B). [score:5]
These clinical samples were divided into low or high expression groups with a miR-183/182/96 expression cutoff score of 2. Chi-square tests were used to analyze the relationship between clinical pathological parameters and altered miR-183, miR-182, and miR-96 levels (Table 1). [score:5]
Further more, when the expression levels of all three members of the miR-183/182/96 cluster were high, OS and DFS were much shorter than when zero, one, or two members of the miR-183/182/96 cluster were highly expressed (all P for OS = 0.000 and all P for DFS = 0.004). [score:5]
We found that patients with higher miR-183/182/96 expression had shorter mean OS and DFS than patients with lower miR-183/182/96 expression. [score:5]
Upregulation of miR-183/182/96 was a frequent event in the breast cancer clinical specimens examined and could be related to breast cancer carcinogenesis. [score:4]
miR-183/182/96 cluster was upregulated in breast cancer cell lines and clinical specimens. [score:4]
These results indicated that upregulation of miR-183/182/96 was a frequent event in breast cancer clinical specimens and could be related to breast cancer carcinogenesis. [score:4]
miR-183/182/96 cluster was upregulated in breast cancer clinical specimens and cell lines. [score:4]
The expression level of the miR-183/182/96 cluster is high in breast cancer tissues and cell lines. [score:3]
These results demonstrated that miR-183/182/96 expression was significantly associated with patient OS and DFS. [score:3]
These results are consistent with a previous report that the miR-183/96/182 cluster is overexpressed in prostate tissue 26. miR-183, miR-182 and miR-96 have been proposed as oncogenes in glioma 22 and medulloblastoma 27. [score:3]
How to cite this article: Song, C. et al. High expression of microRNA-183/182/96 cluster as a prognostic biomarker for breast cancer. [score:3]
A high level of the miR-183/182/96 cluster was markedly correlated with shorter disease-free survival. [score:3]
We found that miR-183/182/96 was upregulated in human breast cancer cell lines compared to in HME cell lines (Fig. 1A). [score:3]
Subsequently, we examined miR-183/182/96 expression by ISH. [score:3]
Our findings improve our understanding of the expression level of the miR-183/182/96 cluster in breast cancer. [score:3]
qRT-PCR analysis was used to detect the expression of miR-183/182/96 in 12 different mammary cell lines, including human breast cancer cell lines (MDA-MB-435, MDA-MB-361, MDA-MB-231, BT-483, BT-474, BT-20, MCF-7, MDA-MB-468 and T-47D) and human mammary epithelial (HME) cell lines (BHL-100, 184A and MCF-10A). [score:3]
To further explore the prognostic significance of miR-183/182/96, we used Kaplan-Meier survival analysis to generate patient overall survival (OS) and disease-free survival (DFS) curves. [score:3]
Poor prognosis and clinical pathological parameters of breast cancer patients were closely related to high expression of the miR-183/182/96 cluster. [score:3]
The expression levels of the members of the miR-183/182/96 cluster were shown to be associated with significantly lower rates of event-free and overall survival in medulloblastoma 27. [score:3]
Then, we detected the expression of miR-183/182/96 in 41 pairs of breast cancer tissues and adjacent normal tissues (control tissues). [score:3]
Currently, little is known regarding the expression of the miR-183/182/96 cluster in most cancers. [score:3]
Clinicopathological variables and miR-183/182/96 expression in 131 breast cancer patients. [score:3]
Expression levels of miR-183/182/96 were detected in both breast cancer tissues and cell lines. [score:3]
We researched the potential clinicopathological implications of altered miR-183/182/96 expression. [score:3]
Pearson correction analysis was used to analyze the correlations between miR-183, miR-182 and miR-96 expression levels. [score:3]
Then, we explored the correlation between miR-183, miR-182 and miR-96 expression using Pearson correction analysis. [score:3]
The correlation coefficient between miR-183 and miR-182 was 0.728 (linear R [2] = 0.530), that between miR-183 and miR-96 was 0.524 (linear R [2] = 0.274), and that between miR-182 and miR-96 was 0.465 (linear R [2] = 0.217), respectively; indicating that the expression levels of miR-182 and miR-96 or miR-183 and miR-182 were more significantly related than those of miR-183 and miR-96 (2-tailed, Fig. 2A,B). [score:3]
We also found that the expression levels of miR-183 and miR-182 were more significantly related than those of miR-182 and miR-96 or miR-183 and miR-96. [score:3]
The miR-183/182/96 cluster regulates the proliferation of colon cancer cells 28. [score:2]
An increased level of the miR-183/182/96 cluster was correlated with both clinical stage and distant metastasis. [score:1]
miR-183 and miR-182 were positively correlated with local relapse (P = 0.025 and 0.028, respectively). [score:1]
Increased miR-183/182/96 level was correlated with poor prognosis. [score:1]
Increased miR-183/182/96 cluster level was correlated with clinical stage, local relapse and distant metastasis. [score:1]
Among 41 breast cancer patients, approximately 82.9% (p < 0.01, 34 of 41 patients), 82.9% (p < 0.01, 34 of 41 patients) and 87.8% (p < 0.01, 36 of 41 patients) of tumor samples showed significant increases in miR-183, miR-182 and miR-96 levels, respectively (Fig. 1B). [score:1]
These results demonstrate that miR-183/182/96 might play a crucial role in the occurrence and progression of breast cancer. [score:1]
Among 131 breast cancer patients, we found that miR-183, miR-182 and miR-96 levels were positively correlated with both TNM stage (P = 0.012, 0.018 and 0.020, respectively) and distant metastasis (P = 0.000, 0.001 and 0.033, respectively) (Table 1) but not with tumor size; LNMET (lymph node metastasis); age; menopause; or ER, PR or HER2 status. [score:1]
OS and DFS were shortest when the levels of all three members of the miR-183/182/96 cluster were high. [score:1]
The correlation coefficient between miR-183 and miR-182 was the highest. [score:1]
miR-183/182/96 miRCURYTM LNA custom detection probes (Exiqon, Vedbaek, Denmark) were used for in situ hybridization (ISH). [score:1]
The miR-183/182/96 cluster is a potential prognostic biomarker for breast cancer. [score:1]
Members of the miR-183/182/96 cluster have been reported as blood biomarkers of retinal toxicity 29. [score:1]
The miR-183/182/96 cluster may be used in the future as a novel breast cancer biomarker to guide tumor diagnosis, treatment and prognosis predication. [score:1]
Thus, it is highly likely that the miR-183/182/96 cluster has a close relationship with various clinical pathology indices. [score:1]
Increased miR-183/182/96 level was correlated with poor clinical outcomes. [score:1]
Increased miR-183/182/96 level was correlated with TNM stage, local relapse and distant metastasis. [score:1]
The expression of miR-183/182/96 was quantified by measuring cycle threshold (Ct) values and was normalized to U6-snRNA or β-actin (endogenous control for miRNA detection) using the 2 [−ΔΔdt] method. [score:1]
Thus, the miR-183/182/96 cluster has potential for use in the diagnosis and prognosis of and therapeutic decisions for breast cancer. [score:1]
The miR-183/182/96 cluster has potential for use as a novel prognostic biomarker for breast cancer. [score:1]
This finding coincided with the results that local relapse was positively correlated with miR-183 and miR-182, but not with miR-96. [score:1]
The results above revealed that miR-183/182/96 level was higher in breast cancer and was positively correlated with some clinical pathological parameters, indicating that miR-183/182/96 may be vital for the pathogenesis of breast cancer. [score:1]
We observed that both nuclear and cytoplasmic staining of miR-183/182/96 was more frequently observed in tumor cells than in normal mammary epithelial cells. [score:1]
Representative ISH images of miR-183/182/96 under a microscope are shown (Fig. 1C, 200×and 400×). [score:1]
High levels of the miR-183/182/96 cluster were markedly correlated with shorter overall survival. [score:1]
[1 to 20 of 55 sentences]
7
[+] score: 99
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
By target prediction and GO analysis, we found low levels of these miRNAs may ease post-transcriptional suppression of their up-regulated mRNA targets related to several neurodegenerative signaling pathway, including PI3K-Akt signaling pathway (hsa-miR-183 andhsa-miR-193b), mTOR signaling pathway (hsa-miR-193b and hsa-miR-3935), regulation of actin cytoskeleton (hsa-miR-193b and hsa-miR-3935), axon guidance (hsa-miR-193b and hsa-miR-3935), MAPK signaling pathway (hsa-miR-183 andhsa-miR-3935) and so on. [score:11]
Down-regulation of miR-183 promotes migration and invasion of osteosarcoma by targeting Ezrin. [score:6]
A functional network (Figure 4 and Supplementary Table 1 [miRNAs-pathways]), based on Gene Ontology and KEGG database, was constructed to visualize the connections of hsa-miR-183, hsa-miR-193b, hsa-miR-3935, and their predicted targets (hsa-miR-451, which target genes were less and failed to construct the pathway net, was rule out). [score:5]
miR-183 inhibits invasion of gastric cancer by targeting Ezrin. [score:5]
Combining the expression of these four miRNAs in PD, the results suggested that hsa-miRNA-183 might be a specific biomarker for SALS, whereas hsa-miR-451 and hsa-miR-3935 might be common biomarkers linked to neurodegenerative diseases, such as ALS and PD. [score:5]
miR-183 induces cell proliferation, migration, and invasion by regulating PDCD4 expression in the SW1990 pancreatic cancer cell line. [score:4]
We observed four down-regulated miRNAs in SALS contrasted with that in healthy controls and found that hsa-miRNA-183 might be a specific biomarker for SALS. [score:4]
SMN regulates axonal local translation via miR-183/mTOR pathway. [score:4]
Dysregulated miR-183 inhibits migration in breast cancer cells. [score:4]
Previous studies also found that survival motor neuron (SMN) gene regulates axonal local translation via miR-183/mTOR pathway, which contributed to spinal muscular atrophy pathology (Kye et al., 2014). [score:4]
The significant differences in the expression levels of four miRNAs (hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935) were confirmed between the SALS patients and HCs (Figure 2). [score:3]
The expression of hsa-miRNA-183 showed no difference between PD patients and HCs, but was significantly lower in SALS patients than that in PD patients. [score:3]
The differential expression of miR-183 was found in several cancers, including prostate cancer (Yuan et al., 2015), gastric cancer (Cao et al., 2014), breast cancer (Lowery et al., 2010), which may be involved in cell proliferation, migration and invasion (Zhu et al., 2012; Lu et al., 2015). [score:3]
These miRNAs, including hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935, were down regulated in SALS patients relative to healthy controls, with AUC values of 0.69, 0.62, 0.81, and 0.57, respectively. [score:2]
Seven miRNAs with significantly lower expression levels, including hsa-miR-3690, hsa-miR-124, hsa-miR-183, hsa-miR-3935, hsa-miR-451, hsa-miR-4538, and hsa-miR-4701, were identified in the SALS group compared with HCs (mean ratio = 0.35–0.43, p < 0.05, Table 2, Figure 1). [score:2]
Pleiotropic effects of miR-183~96~182 converge to regulate cell survival, proliferation and migration in medulloblastoma. [score:2]
In summary, our pilot study showed that peripheral blood leukocytes miR-183, miR-193b, miR-451, and miR-3935 are down regulated in SALS, which raises the potential clinical utility of leukocytes miRNA profiling in SALS diagnosis. [score:2]
Thus, dysregulation of miR-183 may be involved in progressive loss of motor neurons in ALS. [score:2]
In the present study, we observed significantly lower expression of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 in SALS patients compared with controls. [score:2]
Plasma miR-183 predicts recurrence and prognosis in patients with colorectal cancer. [score:1]
ROC curve analyses revealed that the plasma levels of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 were useful biomarkers for differentiating SALS and HCs, with AUC values of 0.763, 0.713, 0.820, and 0.590, respectively. [score:1]
The ROC curve analyses revealed that the levels of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 were useful biomarkers for the diagnosis of ALS, with AUC values of 0.763 [95%CI: 0.677–0.835], 0.713 [95%CI: 0.624–0.792], 0.820 [95%CI: 0.740–0.884], and 0.590 [95%CI: 0.497–0.679], respectively. [score:1]
The four miRNAs were combined as a panel of miRNAs by the logit mo del, which was used to construct the ROC curve as follow, logit (p = SALS) = 3.152 − 0.708 × hsa-miR-193b − 1.517 × hsa-miR-183 − 0.147 × has-miR-3935 − 3.331 × hsa-miR-451. [score:1]
[1 to 20 of 25 sentences]
8
[+] score: 97
Down-regulation of miR-34c and up-regulation of miR-183 and miR-210 were identified in cancer groups. [score:7]
Compared to normal control lung tissue, down-regulation of miR-34c and up-regulation of miR-183 and miR-210 were identified in caner groups (p < 0.05 for each). [score:6]
In detail, miR-183 knockdown of tumor cell lines caused deregulation of a miRNA network composed of miR-183-EGR1-PTEN in synovial sarcoma, rhabdomyosarcoma, and colon cancer [29], and the zinc finger transcription factor EGR-1 (early growth response-1), known as a gene essential for growth, proliferation, or differentiation [34], is a direct regulator of PTEN [35]. [score:5]
Xu et al. suggested that up-regulation of miR-183 in female lung adenocarcinoma was found to be associated with lymph node metastasis, advanced clinical stage, EGFR mutation, poor overall survival and progression-free survival [31]. [score:5]
We revealed that miR-183 showed significant higher expression in lung adenocarcinoma tissue than normal lung, and positive statistical results between expression level and poor differentiation, lymphovascular invasion. [score:5]
This study showed that miR-183 expression was significantly higher in adenocarcinoma with EGFR exon 19 mutation than in those without this mutation. [score:5]
We are cautiously optimistic that the development of miR-183 new target therapy might overcome TKI-resistant lung cancer. [score:4]
Expression levels of miR-183 were significantly higher in EGFR mutation groups than wild type group (p = 0.028; Fig.   2b). [score:4]
Moreover, expression level of miR-183 was significantly higher in EGFR mutation groups than wild type group (p = 0.028). [score:4]
We identified three microRNAs (miR-34c, miR-183, and miR-210) which showed significant altered expression in all groups of lung adenocarcinoma by microarray study. [score:3]
Expression levels of miR-34c, miR-183, and miR-210 were significantly different between normal control group and cancer groups (p = 0.034, <0.000, and 0.036, respectively; Fig.   2a). [score:3]
We identified three microRNAs (miR-34c, miR-183, and miR-210) which showed significantly altered expression in all groups of lung adenocarcinoma by microarray study. [score:3]
To investigate the potential biologic roles of three miRNAs, we further subclassified lung adenocarcinomas into “high” and “low” groups in the expression of miR-34c, miR-183, miR-210, based on the mean of expression after normalization [8], and performed survival analysis by univariate Kaplan-Meier method. [score:3]
Expression levels of miR-34c, miR-183, and miR-210 were significantly different between normal control group and cancer groups (p = 0.034, <0.000, and 0.036, respectively). [score:3]
Here, we show that miR-34c may act as a potential tumor suppressor gene and miR-183 and miR-210 have a potential oncogenic role in pulmonary adenocarcinoma. [score:3]
As far as we know, it is the first paper to identify that overexpression of miR-183 is significantly associated with EGFR exon 19 mutated lung adenocarcinoma. [score:3]
Three miRNAs, miR-34c, miR-183, and miR-210, which with showed statistical differences in their expression among three groups, were selected. [score:3]
The chi-square test was used to assess miR-34c, miR-183, miR-210 expression with respect to clinicopathological parameters. [score:3]
Increased expression of miR-183 was positively associated with lymphovascular invasion (p = 0.037). [score:3]
miR-183 belongs to one of the unique miRNAs in lung adenocarcinoma [28], and it has a potential oncogenic role in conjuction with two tumor suppressor genes, EGR1 and PTEN [29]. [score:3]
In patients with lung cancer, overexpression of miR-183 is associated with poor overall survival [30]. [score:3]
Tumor differentiation was significantly associated with miR-34c, miR-183, and miR-210 expression levels (p = 0.037, 0.029, and 0.003, respectively). [score:3]
Increased expression of miR-183 was also positively associated with lymphovascular invasion (p = 0.037). [score:3]
Herein, we identified that miR-34c, miR-183, and miR-210 showed significantly altered expression in some lung adenocarcinomas. [score:3]
In conclusion, we show that miR-34c may act as a potential tumor suppressor gene and miR-183 and miR-210 have a potential oncogenic role, using FFPE samples with various histopathologic parameters. [score:3]
We assume that miR-183 could play an oncogenic role in conjunction with EGFR amplification, PTEN loss, and AKT activation. [score:1]
miRNA miR-34c miR-183 miR-210 NSCLC Epidermal growth factor receptor Lung cancer is the major leading cause of cancer mortality [1], and non-small cell lung cancer (NSCLC) occupies about 80 % of lung cancer. [score:1]
In addition to previously published papers, it is certain that miR-183 plays a potential oncogenic role in lung adenocarcinomas. [score:1]
It is reasonable to infer that miR-183 contributes tumorigenesis and tumor progression, especially lymphovascular infiltration, based on these findings. [score:1]
[1 to 20 of 29 sentences]
9
[+] score: 81
To further investigate how the miR-183 family targeted genes are expressed in the inner ear (CVG) development in humans, we computationally predicted miR-183 family targeted genes using TargetScanHuman (release 7.1). [score:8]
We found that in human CVG, the miRNA-183 family was differentially expressed at stage 13 (E11), but only miR-182-5p was expressed at stage 14 (E11.5), and the miRNA family was not differentially expressed at stage 15 (E12). [score:7]
Sacheli et al. noted the earliest expression of miR-183 and miR-182 in the mouse otic vesicle at embryonic day 9. (E9.5), expression of all three miRNAs in OV, CVG, and neural tube at E11.5, and limited expression was observed at E14.5 [51]. [score:7]
A previous study in the mouse inner ear has shown that progressive reduction of miR-183 expression after Pax2-Cre conditional Dicer knockout (KO) results in progressive loss of neurosensory gene expression, arrested neurosensory development and loss of CVGs with an associated disruption of morphogenesis [4]. [score:7]
To investigate how the miR-183 family targets gene expression in human inner ear development, we performed computational target prediction for the miR-183 family (miRNA-96-5p, miR-182-5p, and miR-183-5p). [score:6]
Among our predicted miR-183 family targeted genes that are related to human inner ear (CVG) development (Table 5), it is worthwhile to mention TBX1 (T-box domain 1), as a previous study has confirmed tbx-1 as one of target genes for the conserved miR-183 family in a mouse mo del [62]. [score:6]
Complete set of predicted miR-183 family targeted genes using TargetScanHuman (release 7.1). [score:5]
The trend was not seen at Stage 14, where the only member of the miR-183 family that was upregulated was miR-182 (p = 0.004; with FDR correction p = 0.27) (indicated with a green circle in Fig 2). [score:4]
Weston et al. found that expression of the triad of miR-96, miR182, and miR-183 during development is relatively restricted to mouse inner ear compared to brain, heart, and whole embryo [3]. [score:3]
Our observations coupled with the findings in mice suggest that Dicer pathway interactions with the miR-183 family play an essential role in the regulation of early mice inner ear development. [score:3]
Therefore, we speculate that the transcriptional regulation of TBX1 in human may be influenced by the miR-183 family, providing a crucial function in developmental signaling pathways in the human inner ear. [score:3]
Note that at the Carnegie developmental stage 13, members of the miR-183 family (miR-96, miR-182, and miR-183) were highly expressed in CVG and OV as compared with NC (for CVG vs NC comparison, p = 0.0009, 0.003, and 0.0045; with FDR correction, p = 0.27, 0.40, and 0.41, respectively). [score:3]
The differential expression of miR-183 family members (miR-96-5p, miR-182-5p, and miR-183-5p) in human CVG cell types at stage 13 correlates well with prior studies in mice. [score:3]
Also, note that expression of the entire miR-183 family was the highest in CVG tissue at stage 13 (see red circles on Fig 2). [score:3]
Computational prediction of the miR-183 family targeted genes. [score:3]
We demonstrated in human embryonic tissues that members of the miR-183 family are differentially expressed in the cochleovestibular ganglion (CVG) at embryonic stage 13 in the human inner ear as compared to nearby neural crest (NC) and otic vesicle (OV) tissues. [score:2]
Predicted target genes for the MiR-183 family using TagetScanHuman and a Deafness Variation Database (version 8.0). [score:2]
Regardless, our findings suggest that the miR-183 family is important in human as well as murine inner ear development. [score:2]
In addition, the miR-183 family (miR-96, miR-182, and miR-183) is differentially expressed in the mouse inner ear as compared to other organs [3, 11]. [score:2]
At stage 15, no members of the miR-183 family were observed. [score:1]
MicroRNA from the miR-183 family is circled in red (stage 13) or green (stage 14). [score:1]
[1 to 20 of 21 sentences]
10
[+] score: 71
Their respective sequences are: miRCURY LNA™ miRNA Inhibitor Negative Control A: GTGTAACACGTCTATACGCCCA; miRCURY LNA™ miR-183 inhibitor: AGTGAATTCTACCAGTGCCAT; miRCURY LNA™ miR-96 inhibitor: GCAAAAATGTGCTAGTGCCAA; miRCURY LNA™ miR-182 inhibitor: TGTGAGTTCTACCATTGCCAA. [score:9]
The expression levels of the miR-183 family are upregulated in most cancer types (30). [score:6]
Compared with EV, overexpression of GSK3β inhibited the expression of miR-96, miR-182 and miR-183 by 2-fold (P < 0.05) (Figure 2D). [score:6]
To investigate the effects of suppression of miR-183-96-182 cluster on gastric cancer cell phenotype, we transfected a miRCURY LNA™ miRNA Inhibitor Negative Control or a mix of miRCURY LNA™ inhibitors for miR-183, miR-96 and miR-182 into AGS cells. [score:5]
Our results showed that both the primary and mature miR-96, miR-182, miR-183 expression levels were significantly upregulated in gastric cancer tissues compared with the adjacent normal control gastric tissues. [score:5]
Li et al. (32) reported that miR-96, miR-182 and miR-183 were all upregulated in intestinal-type gastric cancers. [score:4]
Since GSK3β inhibits the expression of miR-96, miR-182 and miR-183 in human gastric epithelial AGS cells, we measured the protein levels of GSK3β and β-Catenin by western blot and miR levels of miR-96, miR-182 and miR-183 by quantitative RT-PCR (qRT-PCR) in eight gastric cancer and matched normal gastric tissue samples. [score:3]
The miR array data revealed that they were increased 6-, 5- or 3-fold, respectively (Table 1 and Figure 2C), suggesting that GSK3β may suppress the generation of miR-96, miR-182 and miR-183. [score:3]
Figure 3. Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and pri-miR-183 in human gastric cancer. [score:3]
Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster in human gastric cancer. [score:3]
Overexpression of β-Catenin increased the levels of primary and mature miR-96, miR-182 and miR-183 by 5-fold (Figure 6A and B). [score:3]
For instance, miR-183 promotes cell growth and motility in prostate cancer cells by targeting Dkk-3 and SMAD4 (27). [score:3]
Figure 6. β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
But the expression levels of miR-183 family in gastric cancer are controversial. [score:3]
β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
Surprisingly, the primary miR-183-96-182 cluster (pri-miR-183) levels were higher in gastric cancer tissues than that in the matched normal tissues, indicating that GSK3β regulates the production of miR-96, miR-182 and miR-183 through β-Catenin at the transcription level. [score:2]
On the other hand, knockdown of β-Catenin by specific siRNA decreased the primary and mature miR-96, miR-182 and miR-183 levels by 3-fold (Figure 6C and D). [score:2]
Of the miRs that were increased the most by GSK3β KO, miR-96, miR-182 and miR-183 are all from the same miR gene cluster. [score:1]
The products of miR-183-96-182 cluster gene, miR-183, miR-96 and miR-182, play important roles in a variety of cancers. [score:1]
The gene encoding miR-96, miR-182 and miR-183 locates to human chromosome 7q32.2. [score:1]
The levels of miR-96, miR-182 and miR-183 in gastric cancer were increased by 2-fold (Figure 3C). [score:1]
We measured pri-miR-183 and mature miR-96, miR-182, miR-183 expression levels in gastric cancer and matched normal gastric tissue by qRT-PCR. [score:1]
[1 to 20 of 22 sentences]
11
[+] score: 62
The transcription of the miR-183 cluster is upregulated by transcription factors, such as β-catenin/TCF/LEF and TGF-β, and is downregulated by GATA-3, ZEB1 and DNA methylation [76, 77, 78, 79]. [score:7]
These findings suggest that the three miRNA clusters, namely two miR-200 clusters and one miR-183 cluster, coordinately upregulate the expression of Bmi1 to enhance the stem cell self-renewal abilities in both breast CSCs and normal mammary stem/progenitor cells. [score:6]
Chen C. Xiang H. Peng Y. L. Peng J. Jiang S. W. Mature miR-183, negatively regulated by transcription factor GATA3, promotes 3T3-L1 adipogenesis through inhibition of the canonical Wnt/β-catenin signaling pathway by targeting LRP6 Cell. [score:6]
However, the miR-183 cluster miRNAs are downregulated in the human breast CSCs, suggesting that suppression of the miR-183 cluster is required for the maintenance of CSC properties. [score:6]
The fact that common targets of miR-183 cluster miRNAs include SNAI2, SMAD4, β-catenin and Bmi1 suggests that the downregulation of miR-183 cluster in breast CSCs is associated with activation of EMT, self-renewal and Wnt signaling [67, 74, 76]. [score:6]
The miR-183 cluster miRNAs are frequently upregulated in a variety of non-sensory diseases, including cancer. [score:6]
Among them, miR-200b, miR-200c, miR-141, and miR-183 are specifically downregulated in the human breast CSCs and normal mammary stem/progenitor cells [24], suggesting that miRNAs are important regulators of self-renewal abilities in breast CSCs and normal mammary stem/progenitor cells (Figure 3). [score:5]
The expression of Bmi1 is regulated by miRNAs, such as miR-128, miR-200b/c, miR-141, miR-15, miR-16, miR-203, miR-183, miR-194, and miR-218 [24, 67, 121, 122, 123, 124, 125]. [score:4]
Leung W. K. He M. Chan A. W. Law P. T. Wong N. Wnt/β-Catenin activates miR-183/96/182 expression in hepatocellular carcinoma that promotes cell invasion Cancer Lett. [score:3]
In addition, secondary transcription start sites are identified, suggesting that the independent regulation for each miRNA exists in the miR-183 cluster. [score:2]
There are several CpG islands before the miR-183 transcription start site (3.5, 8 and 10 kb) that are epigenetically regulated by DNA methylation. [score:2]
Pierce M. L. Weston M. D. Fritzsch B. Gabel H. W. Ruvkun G. Soukup G. A. MicroRNA-183 family conservation and ciliated neurosensory organ expression Evol. [score:2]
The miR-183 cluster is highly and wi dely conserved in protostomes and deuterostomes [74, 75]. [score:1]
Donatelli S. S. Zhou J. M. Gilvary D. L. Eksioglu E. A. Chen X. Cress W. D. Haura E. B. Schabath M. B. Coppola D. Wei S. TGF-β-inducible microRNA-183 silences tumor -associated natural killer cells Proc. [score:1]
The roles of miR-200 family miRNAs in breast CSCs are described in more detail later in Section 4. The miR-183 cluster, which is comprised of miRNA-183, -96 and -182, is a miRNA family with sequence homology (Figure 1). [score:1]
Dambal S. Shah M. Mihelich B. Nonn L. The microRNA-183 cluster: The family that plays together stays together Nucleic Acids Res. [score:1]
The tricistronic miR-183 cluster is located on mouse chromosome 6 and human chromosome 7, whose length of transcript is 19121 bp [57]. [score:1]
Although the chromosomal order of miR-183, -96, -182 is conserved in deuterostomes, their location and the intergenic spacing between the miRNA genes vary between species. [score:1]
3.2. miR-183 Cluster. [score:1]
[1 to 20 of 19 sentences]
12
[+] score: 44
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic lung and human lung cancer therefore demonstrating clinical relevance of this particular disease mo del. [score:6]
Moreover, miR-96, miR-183, miR-322 were significantly up-regulated in male c-Raf mice. [score:4]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic mouse lung and human lung cancer thus further validating this mo del as relevant for human lung cancer (Figure 7). [score:4]
The gender bias for miR-183 and miR-322 was not confirmed, but the two miRs were up-regulated in all transgenic animals. [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
Note, miR-182 is expressed as a cluster with miR-96 and miR-183 and share similar sequences. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
We also analyzed miR-182, whose gene is in proximity to that of miR-96 and miR-183, and miR-146a which differs from miR-146b by only two bases (Table 2). [score:1]
Importantly, miR-183 and miR-96 belong to the same locus, located on chromosome 6 and 7 in mouse and human, respectively. [score:1]
[1 to 20 of 15 sentences]
13
[+] score: 40
miR-183 was downregulated in the cochlea of acoustically-overexposed rats, and then, computational analyses predicted that this downregulation could be potentially associated with cell death and apoptotic functions [83]. [score:7]
Age-related hearing loss was associated with the downregulation of miR-183 at three months of age in C57BL/6J mice and at nine months in CBA/J mice [82]. [score:4]
The discrepancies in the onset of downregulation of miR-183 can partly be attributed to the different genetic backgrounds of these mouse mo dels. [score:4]
Acoustic trauma caused downregulation of miR-183 approximately three-fold in rat inner ear [83]. [score:4]
Notably, miR-183 and miR-96 were upregulated during adult stages, while miR-182 was not [78]. [score:4]
miR-183, miR-182 and miR-96 are expressed from the cluster as a polycistronic unit in the mouse inner ear [78]. [score:3]
Morpholinos targeted towards either miR-182/miR-183, miR-96 or miR-183/182/96 all decreased hair cell numbers in the zebrafish inner ear [77]. [score:3]
This cluster showed strong expression of mature miR-183, miR-182 and miR-96 in the hair cells of both mouse cochlea and vestibule at P0, but the levels of pri-miR-183/96 [78] and miR-183 [88] varied between the hair cells in the apex and base of the cochlea. [score:3]
Inhibition of miR-183 in zebrafish using morpholinos decreased the number of hair cells in sensory macula in both the inner ear and neuromasts [77]. [score:3]
In mouse, the levels of miR-183, miR-182 and miR-96 changed over developmental time between P0 and P100. [score:2]
miR-183 controls the differentiation of hair cells [77], while mutations in the miR-96 seed region are associated with hearing disorders [89]. [score:2]
One of the most wi dely studied miRNA groups is the miR-183/182/96 cluster [73, 74, 77, 78]. [score:1]
[1 to 20 of 12 sentences]
14
[+] score: 39
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro DecidualizationInterestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:7]
miR-182 and miR-96 share an identical seed, while miR-183 only differ from the others in one nucleotide at position 2. The pathways regulated by the potential targets of these miRNAs are the axon guidance and cytoskeleton regulation. [score:5]
The molecular pathways potentially regulated by the mir-181, miR-200 and miR-183 families with the potential target genes are listed below the histograms. [score:4]
Interestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:4]
Noteworthily, some of the differentially expressed miRNAs identified in our study during decidualization have been found to be misregulated in endometriosis (e. g., miR-9, miR-135b and miR-141) [56], [17], [43], preeclampsia (e. g., miR-155, miR-183 and miR-181b) [18], [19], [57] or endometrial cancer (e. g., the miR-200 family and miR-96) [54], [58], [59]. [score:4]
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro Decidualization. [score:4]
Three additional miRNAs (miR-96, miR-183 and miR-182), clustered together at the same locus (chromosome 7), were significantly down-regulated during decidualization (Figure 1D). [score:4]
B, miR-181 C, miR-200 and D, miR-183 family members’ expression in the E+P decidualized hESCs for 9 days if compared to the non decidualized control hESCs. [score:2]
Another interesting finding is that all the members of three different miRNAs families (miR-181, miR-200 and miR-183) have been identified to be similarly regulated. [score:2]
miR-181, miR-183 and miR-200 miRNAs families members are similarly regulated during in vitro decidualization. [score:2]
The other miRNA family includes miR-96, miR-182 and miR-183 with potential molecular pathways implicated in actin cytoskeleton reorganization, such as RAC1 and ITGß1, and both genes are implicated in endometrial decidualization [39], [53]. [score:1]
[1 to 20 of 11 sentences]
15
[+] score: 37
hsa-miR-182, hsa-miR-183 and hsa-miR-224 are upregulated and hsa-miR-1, hsa-miR-101, hsa-miR-143, hsa-miR-145, hsa-miR-127 and hsa-miR-29c are downregulated in bladder urothelial carcinoma compared to matched histologically normal urothelium [27]. [score:6]
The hsa-miR-183, hsa-miR-200b∼429, hsa-miR-200c∼141 and hsa-miR-17∼92 clusters were significantly upregulated. [score:4]
The upregulation of hsa-miR-182 and hsa-miR-183 and the downregulation of hsa-miR-143 were found in bladder urothelial carcinoma compared to matched histologically normal urothelium in our Real-Time qPCR evaluation. [score:4]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium. [score:4]
hsa-miR-182, hsa-miR-183 and hsa-miR-200a were overexpressed hsa-miR-143 and hsa-miR-195 were underexpressed in bladder urothelial carcinoma compared to matched histologically normal urothelium (p<0.001 for each miRNA) (Table S3). [score:4]
This cluster consists of hsa-miR-96, hsa-miR-182 and hsa-miR-183 and is located on chromosome 7. These three miRNAs are upregulated in prostate carcinoma [18]. [score:4]
Three overexpressed (hsa-miR-182, hsa-miR-183 and hsa-miR-200a) and two underexpressed miRNAs (hsa-miR-143 and hsa-miR-195) were evaluated in all of the patients included in this study. [score:3]
We found that the hsa-miR-183 cluster was overexpressed in bladder cancer. [score:3]
For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
0018286.g001 Figure 1For the comparison between deep sequencing data and Real-Time qPCR results, hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 determined to be differentially expressed in bladder urothelial carcinoma compared to matched histologically normal urothelium in nine patients by deep sequencing were validated using Real-Time qPCR. [score:2]
In this study, Real-Time qPCR was performed to evaluate the expression patterns of hsa-miR-182, hsa-miR-183, hsa-miR-200a, hsa-miR-143 and hsa-miR-195 in a total of fifty-one bladder urothelial carcinoma patients. [score:1]
[1 to 20 of 11 sentences]
16
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
In an effort to determine whether the miRNA-183 cluster is further involved in deafness, predicted target genes of the miR-183 miRNA, expressed in the inner ear, were screened in 150 Americans with autosomal dominant NSHL and 576 Iranians with autosomal recessive NSHL (Hildebrand et al., 2010). [score:5]
Expression patterns of miR-96, miR-182 and miR-183 in the development inner ear. [score:4]
Several studies defined targets for members of the miR-183 triad. [score:3]
It appears that mutations affecting gene regulation of the miR-183 family are not typical causes of a deafness phenotype. [score:3]
MicroRNA-183 family expression in hair cell development and requirement of microRNAs for hair cell maintenance and survival. [score:3]
The miR-183/Taok1 target pair is implicated in cochlear responses to acoustic trauma. [score:3]
MiR-183 family regulates chloride intracellular channel 5 expression in inner ear hair cells. [score:3]
miRNA Gene target Experimental system used Reference miR-183 TAO kinase 1 (Taok1) Rat cochlear organotypic cultures transfected with antisense morpholinos. [score:3]
A study demonstrating the role of the miR-183 family in zebrafish by reducing and increasing levels of miRNAs by morpholino (MO) or miRNA injection, respectively, revealed that the miR-183 cluster is crucial for inner ear hair cell and neuronal development (Li et al., 2010). [score:2]
MicroRNA-183 family members regulate sensorineural fates in the inner ear. [score:1]
Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degeneration. [score:1]
This conserved miRNA triad, composed of miR-183, miR-182, and miR-96, is transcribed in one polycistronic transcript. [score:1]
[1 to 20 of 12 sentences]
17
[+] score: 32
The reason is miR-183 is overexpressed in SS and it targets two important tumor suppressor genes, EGR1 and PTEN, leading to their repression and increase cell proliferation. [score:7]
Down-regulation of miR-183 promotes migration and invasion of osteosarcoma by targeting Ezrin. [score:6]
miR-183 overexpression leads to repression of EGR1 which is a known tumor suppressor and a transcription factor (Sarver et al., 2010a). [score:5]
Another miRNA, miR-183 targets Ezrin that leads to suppression of migration and invasion in osteosarcoma cells. [score:5]
MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. [score:3]
Thus, miR-183 levels play a crucial role in balancing the levels of two major tumor suppressor genes. [score:3]
miR-183 is another non-myomiR miRNA that plays an oncogenic role in RMS (Sarver et al., 2010a). [score:1]
Our group revealed that miR-183 is a potential oncomiR in SS (Sarver et al., 2010a). [score:1]
Further, it has been shown that miR-183 correlates with pulmonary metastasis and local recurrence of osteosarcoma, suggesting its crucial role in metastasis (Zhu et al., 2012). [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 31
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
miRNA expression in the zebrafish inner ear was first demonstrated by mir-200a and mir-183 expression in the sensory epithelia (Wienholds et al, 2005). [score:5]
In order to address the essential question of the effect of miRNAs throughout development, a study was conducted examining the expression pattern of the mir-183, mir-182 and mir-96 cluster (Sacheli et al, 2009). [score:4]
These analyses revealed that the conserved cluster of mir-183, mir-182 and mir-96 have a restricted expression to the mouse inner ear, as compared to brain, heart and whole embryo expression. [score:4]
By P0, miR-183, miR-182 and miR-96 were strongly expressed in hair cells of the cochlea and the vestibular system, and in the spiral ganglia. [score:3]
In situ hybridization revealed the unique expression pattern of mir-182, mir-183 and mir-96 in inner and outer hair cells of the cochlea, hair cells of the vestibular organs and spiral and vestibular ganglia. [score:3]
However, the expression of miR-183 and miR-182 continued in the hair cells, but ceased to be present in hair cells from P11-15, and was only found in the spiral limbus and the inner sulcus. [score:3]
A conserved miRNA cluster, which includes miR-183, miR-182 and miR-96, was shown to be expressed in the zebrafish in the hair cells, otic neurons and other primary sensory cells. [score:3]
Since this report, several studies have focused on the mir-96, mir-182 and mir-183 genes as a source for more deafness mutations. [score:2]
In a different mo del system, zebrafish were used to understand the role of the miR-96, miR-182 and miR-183 cluster in inner ear development (Li et al, 2010). [score:2]
miR-183 was completely depleted in the hair cells of the mutant mice, but not in spiral ganglia. [score:1]
miR-183 and miR-182, but not miR-96, were detected in the otic vesicle in the embryonic early inner ear. [score:1]
[1 to 20 of 11 sentences]
19
[+] score: 30
The miR-182 forms a part of miR-183/96/182 cluster, whose expression is considerably enriched in the pineal gland and up-regulated by light [23], [24]. [score:6]
The expression of miR-183/96/182 cluster is considerably enriched in the pineal gland and up-regulated by light [23], [24]. [score:6]
The expression analysis of the known miR genes showed that miR-183/96/182 cluster is highly up-regulated, along with miR-726. [score:6]
The results from both the expression analyses showed that the miR-183/96/182 cluster is highly up-regulated, along with miR-726. [score:6]
The expression of miR-183/96/182 cluster is considerably enriched in the pineal gland and up-regulated by light. [score:6]
[1 to 20 of 5 sentences]
20
[+] score: 30
In Fig.   1b, four miRs finally selected for experimental validation (hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375) were in the opposite direction from the origin compared to CAKUT samples in Fig.   1a suggesting that these miRs might be responsible for the downregulation in the CAKUT gene expression data. [score:6]
The hsa-miR-200a, hsa-miR-183 and hsa-miR-375 were expressed in both patient’s and control’s tissue, but statistically significant difference in relative expression was not observed (Fig.   2; Table  2). [score:5]
These could be the reasons for hsa-miR-183, hsa-miR-200a and hsa-miR-375 expression deviations from results of the CIA. [score:3]
Fig.  2Difference in relative expression of hsa-miR-144, hsa-miR-183, hsa-miR-200a, and hsa-miR-375 between CAKUT patients (n = 36) and controls (n = 9). [score:3]
The hsa-miR-200a, hsa-miR-183 and hsa-miR-375 weren’t differentially expressed in CAKUT. [score:3]
Predicted miRs were experimentally validated to be expressed in ureter tissue: hsa-miR-144, hsa-miR-375, hsa-miR-183 and hsa-miR-200a. [score:3]
We received a notably reduced list containing 7 miRs (hsa-miR-144, hsa-miR-101, hsa-miR-375, hsa-miR-200a, hsa-miR-183, hsa-miR-495, hsa-miR-222) with a potential role in CAKUT development. [score:2]
Therefore, by the observation of the plots, miRs hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375 are potentially associated with CAKUT according to their positionTo systematically identify miRs specifically associated with CAKUT, a supervised analysis was conducted by combining CIA and BGA. [score:1]
Therefore, by the observation of the plots, miRs hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375 are potentially associated with CAKUT according to their position To systematically identify miRs specifically associated with CAKUT, a supervised analysis was conducted by combining CIA and BGA. [score:1]
The chosen mature forms for validation were: hsa-miR-144-3p, hsa-miR-200a-3p, hsa-miR-375-3p and hsa-miR-183-5p. [score:1]
According to the CIA average ranking, we have chosen the better ranked miRs from communities 4 and 1 (hsa-miR-144 and hsa-miR-183 respectively) for experimental validation in this study (Table  1). [score:1]
This was the first ex vivo human study that investigated the expression of miRs: hsa-miR-144, hsa-miR-200a, hsa-miR-375 and hsa-miR-183 in human CAKUT. [score:1]
[1 to 20 of 12 sentences]
21
[+] score: 28
The final stable reporter cell line was designed to identify small compounds (e. g. HDAC inhibitor Panobinostat) that inhibit miR-182 (and/or miR-183) generation or function, thereby resulting in the activation of the luciferases (both firefly and Renilla). [score:5]
We used a miR-182 (or miR-183) inhibitor (miRIDIAN microRNA hairpin inhibitor, Thermo Fisher Scientific) as a positive control and non-specific miRNA (miRIDIAN microRNA Negative Control, Thermo Fisher Scientific) as a negative control. [score:5]
Starting from these two vectors, we built a dual reporter construct with the miR-182 (or miR-183) target sequence (Figure 1 and Supplementary Figure 1), so that the presence of mature miR-182 or miR-183 would lead to a decrease in luciferase (both firefly and Renilla) signal, enabling the detection of putative miR-182 (or miR-183) levels. [score:3]
In order to maintain minimal basal levels of luciferase activities, we transduced these stable cell lines with lentiviral particles containing miR-182 (or miR-183) shMIMIC microRNAs (Thermo Fisher Scientific), and in so doing established cell lines that constitutively expressed these miRNAs via the selective pressure of puromycin. [score:3]
We then examined whether these stable transfectants (miR-182 or miR-183 target sequence in pmirGLO/psiCHECK1 plus lentiviral particles containing miR-182 or miR-183 shMIMIC) were usable for high-throughput screens. [score:3]
The final stable reporter cell line was designed to identify small compounds that inhibit miR-182 (and/or miR-183) generation or function, thereby resulting in the activation of the luciferases (both firefly and Renilla). [score:3]
As shown in Supplementary Figure 2(c), the basal level of luciferase activities (both firefly and Renilla) are very low in comparison to negative controls in Supplementary Figure 2(a) and (b) and the activation by the miR-182 (or miR-183) inhibitors were substantial. [score:3]
The established stable transfectants responded well to both miR-182 or miR-183 mimics (i. e. the transfection of these mimics caused the depression of both firefly and Renilla luciferase acitivities in each cell line (Supplementary Figure 2b)). [score:1]
Of note, the endogenous levels of both miR-182 and miR-183 are quite low in SHSY5Y cells and thus the basal levels of luciferase activities are quite high (Supplementary Figure 2a and b). [score:1]
We confirmed that the presence of mature miR-182 or miR-183 would lead to a decrease in luciferase (both firefly and Renilla) signal, enabling the detection of putative miR-182 (or miR-183) levels (Supplementary Figure 2). [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 28
Expression level of miR-183 was demonstrated to reversely correlate with the metastatic potential of lung cancer cells by targeting VIL2-coding protein ezrin and regulating the expression of other genes involved in migration and invasion. [score:8]
Notably, miR-183 was associated to lymph node metastasis, invasion of the lung membrane, and advanced clinical stage of NSCLC, while overexpression of miR-182 was positively related to invasion of the lung membrane and tumor size >3 cm in NSCLC [79]. [score:3]
By profiling of primary breast tumors, tumor associated normal tissue and breast cancer cell lines using RQ-PCR, as well as functional assays, it was demonstrated that miR-183 targets ezrin and may play a central role in the regulation of migration and metastasis in breast cancer [64]. [score:3]
Sarver and collaborators found that the expression levels of miR-183, as well as miR-96 and miR-182, were higher in A549 and 95D metastatic lung cancer cells than in H1299 and 95C non-metastatic cells, respectively, suggesting that the miR-183 family might participate in tumor metastasis [78]. [score:3]
Using microarray expression profile to analyze 96 cancer-related miRNAs, Hu and coworkers were able to identify ten miRNAs (miR-200a, miR-9, miR-10b, miR-183, miR-204, miR-24, miR-181a, miR-193b, miR-146b and miR-10a) related to cervical cancer survival. [score:3]
Overexpression of miR-182 and miR-183 in NSCLC tumors was strongly associated with metastasis. [score:3]
Moreover, members of the miR-183 family were highly expressed in lung cancer primary tissues and sera. [score:3]
miR-183 was identified as a negative regulator of lung cancer metastasis from screening with a miRNA array. [score:2]
[1 to 20 of 8 sentences]
23
[+] score: 27
Two miRNAs (miR-9-5p and miR-183-5p) were regulated by O [3], and these were shown to target the NF-kB protein and mRNA experimentally (Western blot and qRT-PCR) [46] and by in silico analysis (TargetScan). [score:6]
Two miRNAs (miR-9-5p and miR-183-5p) were significantly changed by O [3], and these were shown to target the NF-kB mRNA experimentally [46] and by in silico analysis (TargetScan), respectively. [score:5]
This mRNA is targeted by miR-9-5p [47], miR-21-5p, miR-16-5p (TargetScan), miR-183-5p [47], miR-486b-5p [82], and miR-153-3p [47]. [score:5]
miR-183-5p, which was upregulated, probably has the opposite effect. [score:4]
miR-183-5p that was upregulated may have the opposite effect on NF-kB. [score:4]
FOXO1 is targeted by a multitude of miRNAs that are changed in our study miR-9-5p, miR-21-5p, miR-16-5p, miR-183-5p [47], miR-486b-5p, and miR-153-3p. [score:3]
[1 to 20 of 6 sentences]
24
[+] score: 26
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-96, hsa-mir-182, hsa-mir-210
The inhibitions (%) of miRNA expressions were shown in Table 2. The expression levels of miR-96, miR-182, and miR-183 could not be suppressed by miRM-210. [score:9]
Either individually or as a cluster, the expression levels of miR-96, miR-182, and miR-183 have been shown to be up-regulated in several cancers, including prostate cancer, breast cancer, lung cancer, medulloblastoma, bladder cancer and etc. [score:6]
Inhibitions (%) [a] Cell lines miRNA- mowers miR-96 miR-182 miR-183 miR-210 T24 miRM- 183/96/182 49.33±2.46 47.34±4.23 52.67±5.11 −3.42±4.23 T24 miRM-210 2.42±3.85 −2.13±3.51 3.19±4.25 69.67±3.58 UM- UC-3 miRM- 183/96/182 46.33±3.57 46.13±3.41 51.37±3.89 2.55±3.52 UM- UC-3 miRM-210 1.78±3.31 2.33±3.03 −2.39±2.63 70.65±4. [score:3]
It has been demonstrated in the previous work that knockdown of the miR-183/96/182 cluster resulted in enrichment of apoptosis pathways and dysregulation of the PI3K/AKT/mTOR pathway [26]. [score:3]
These results suggested that miR-183/96/182 cluster and miR-210 play important roles in the regulation of biological behaviors of bladder cancer cells. [score:2]
miR-183/96/182 cluster and miR-210 are shown to play oncogenic roles in bladder cancer. [score:1]
Bulged miRNA binding sites for the miR-96, miR-182, miR-183, and miR-210 and the linkers between them were designed and chemically synthesized. [score:1]
Sarver et al. found that miR-183 functioned as an oncogene by increasing cancer cells migration [30]. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 25
Although some miRNAs are identified as common deregulated species in gender-specific diseases, such as deregulated miR-182 and miR-183, these miRNAs always exhibit different levels of up- or down-regulated expression (S2 Table). [score:10]
Some miRNAs were collected to understand the isomiR expression in LUSC, including down-regulated miRNAs (miR-451 and miR-30a) and up-regulated miRNAs (miR-205, miR-210, miR-183, and miR-9). [score:9]
However, not all of these miRNA loci showed diverged isomiR expression across different groups (such as miR-183 and miR-221, Fig 4). [score:3]
For example, miR-182 and miR-183 are identified as oncogenic miRNAs and contribute to early breast cancer development [46]. [score:2]
For example, in the miR-183 locus, the rate of the most dominant and secondary dominant isomiRs was similar across different groups, but other rates showed significant difference (P = 0.0018 and P < 0.0001, respectively, Fig 4). [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 25
Two of them, miR-133b and miR-145 were down-regulated and the remaining four, miR-31, miR-96, miR-135b and miR-183, were up-regulated, suggesting that they may potentially act as tumor suppressor genes or oncogenes, respectively. [score:9]
For the up-regulated miRNAs, miR-135b, miR-31, miR-96 and miR-183, it may be expected that gene targets belong to the class of tumor suppressor genes. [score:8]
Among the differentially expressed miRNAs, miR-31, miR-96, miR-133b, miR-135b, miR-145 and miR-183 as the most consistently deregulated in CRC. [score:4]
Other members of this family, including FOXF2, FOXK2, FOXO1A, FOXO3A and FOXQ1, were also found as putative targets of miR-182, miR-183 and miR-96. [score:3]
miR-96, miR-182 and miR-183 are located in the same chromosomal region, 7q32.2. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 24
Moreover, cellular migration is mitigated by the knockdown of miR-183; therefore, it could serve as a therapeutic target in the treatment of rhabdomyosarcoma. [score:4]
The knockdown of miR-183 results in the enhanced expression of EGR1 and PTEN mRNAs as well as protein levels. [score:4]
As with synovial sarcoma, miR-183 is also overexpressed in rhabdomyosarcoma [51]. [score:3]
miR-183, located on chromosome 7, is overexpressed in synovial sarcoma as well as in rhabdomyosarcoma and colon cancer [51, 52]. [score:3]
Sarver A. L. Li L. Subramanian S. MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migrationCancer Res. [score:3]
In clinical practice, the targeting of miR-183 may result in enhanced EGR1 and PTEN-levels, thus reducing cellular migration and invasion. [score:3]
Additionally, the knockdown of miR-183 is associated with decreased tumour cell migration [51]. [score:2]
Pierce M. L. Weston M. D. Fritzsch B. Gabel H. W. Ruvkun G. Soukup G. A. MicroRNA-183 family conservation and ciliated neurosensory organ expressionEvol. [score:2]
[1 to 20 of 8 sentences]
28
[+] score: 24
The study revealed that 10 dysregulated miRNA signature among which hsa-miR-1271-5p and hsa-miR-574-3p were down-regulated; and hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-182-3p, hsa-miR-141-5p, hsa-miR-15b-5p, hsa-miR-130b-5p, and hsa-miR-135b-3p were overexpressed in ovarian cancer tissues. [score:7]
A recent study by sequencing small RNAs from isogenic p21+/+ and p21−/− cells demonstrated that the several miRNA clusters, miR-200b-200a-429, miR-200c-141 and miR-183-96-182 were down-regulated in p21 -deficient cells, if adding antagonizing miR-200 and miR-183-96-182 cluster miRNAs in p21+/+ cells, it increased invasion and elevated the levels of VIM, ZEB1 and SLUG mRNAs, which are common targets of miR-183 and miR-96. [score:6]
miR-183 is confirmed to have negative regulatory effects on Tiam1 expression, which contributes to the invasive, migratory, and viability properties of OC cells [24]. [score:4]
In contrast, other miRNAs such as miR-182-5p, miR-183-5p, miR-96-5p, miR-15b-5p, miR-182-3p, miR-141-5p, miR-130b-5p, and miR-135b-3p had a significantly higher expression level in ovarian cancer tissue sample group (C group) than in the normal group (P values are presented in Table 2). [score:3]
The seven dysregulated miRNAs including hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-1271-5p, hsa-miR-182-3p, hsa-miR-1468-5p, and hsa-miR-135b-3p (Table S1 in file S1) were confirmed by the AUC of ROC curve (AUC = 0.965) with 97% sensitivity and 85% specificity (Figure S5 in file S1). [score:2]
Among these miRNAs, miR-96, miR-182 and miR-183 are clustered at one locus of the chromosome 7 [17] and miR-141-5p belongs to the miR-200 family, which is clustered on the chromosomes 12. [score:1]
6 out of these 7 miRNAs (hsa-miR-182-5p, hsa-miR-183-5p, hsa-miR-96-5p, hsa-miR-1271-5p, hsa-miR-182-3p, and hsa-miR-135b-3p) are in the 10-miRNAs signature. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 22
Moreover, miR-183 directly targets isocitrate dehydrogenase 2 (IDH2) and down-regulates its expression in glioblastomas. [score:9]
Overexpression of miR-183 or inhibition of IDH2 can contribute to the up-regulation of HIF-1α and its downstream molecule GLUT1 so as to facilitate glucose uptake and glycolysis process in tumor cells [89]. [score:8]
Meanwhile, the expression levels or activities of p53 and HIF-1 are also under the direct or indirect control of several microRNAs, such as miR-183, miR-28-5p, and miR-99a, through the acetylation and deacetylation modification. [score:5]
[1 to 20 of 3 sentences]
30
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Unlike other miRNAs in DHT -treated PCOS rats, miR-183 was found to be highly expressed in granulosa cells of control ovaries but was down-regulated by 10-fold in the PCOS counterpart. [score:6]
Thus, it is possible that the down-regulation of miRNAs (rno-miR-770, rno-miR-466c, rno-miR-31, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184) observed in this study could be associated with promoted thecal hyperandrogenesis [37, 38]. [score:4]
MiRNAs found to be primarily down-regulated in DHT -treated rats includes rno-miR-770, rno-miR-466c, rno-miR-21, rno-miR-31, rno-miR-182, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184. [score:4]
Among the fourteen miRNAs mapped to the ingenuity databases, twelve (rno-let-7d, rno-miR-132, rno-miR-182, rno-miR-183, rno-miR-184, rno-miR-21, rno-miR-221, rno-miR-24, rno-miR-25, rno-miR-26b, rno-miR-31 and rno-miR-96) had 171 experimentally validated targets. [score:3]
Whereas rno-miR-24 and rno-miR-183 were highly expressed in the theca and, to a lesser extent, in the granulosa cells of the cystic follicles (Figure  5), Rno-miR-31 and rno-miR-96 were present in the cumulus granulosa cells. [score:3]
These included rno-miR-24, rno-miR-31, rno-miR-96, rno-miR-183, rno-miR-222, rno-miR-489, U6 snRNA (positive control) and scrambled miRNA (negative control). [score:1]
[1 to 20 of 6 sentences]
31
[+] score: 20
The significance of the differences in the expression was confirmed for six of the miRNAs, including two down-regulated miRNAs namely miR-181d-5p and miR-206 and four up-regulated miRNA namely miR-1233-3p, miR-183-5p, miR-421 and miR-625-5p) (P < 0.05) (Fig.   3). [score:9]
In detail, we selected two miRNAs with high fold changes among the up-regulated (miR-625-5p and miR-183-5p) and four miRNAs with high fold changes among the down-regulated ones (miR-181d-5p, miR-206, miR-142-5p and miR-339-5p). [score:7]
The RT-qPCR showed the same direction of expression changes as the microarray analysis for six miRNAs namely miR-181d-5p, miR-1233-3p, miR-183-5p, miR-206, miR-421 and miR-625-5p. [score:4]
[1 to 20 of 3 sentences]
32
[+] score: 20
Some genes are shared predicted targets of different miRNAs: the PDCD4 gene, a tumor suppressor gene, appears to be the target of miR-21, miR-182 and miR-183, all up- regulated in the T vs N comparison. [score:8]
Interestingly, miR-139-5p, the most down-regulated in the T vs N comparison, has very recently been identified as a member of a signature predictive of the clinical aggressiveness of stage II CRC [29]; in addition, miR-224, the most up-regulated together with miR-183 in the same comparison, has been identified for its ability to distinguish CRC by means of proficient or deficient DNA mismatch repair machinery [30]. [score:7]
For instance, focusing on T vs N up-regulated DEMs, miR-182 is involved together with miR-21, miR-18a, miR-1246 and miR-183 in the modulation of cancer-related pathways, and with miR-150 and miR-183 in the reprogramming of energy metabolism (purine and selenoaminoacid metabolism), in which various down-modulated DEGs were found, including ENTPD5 (Figure  2 and Additional file 1: Table S4). [score:4]
Relevant examples are miR-143, miR-145, miR-125b and miR-21 (associated with cell growth and survival), the miR-17-92 cluster, miR-20 and miR-100 (involved in uncontrolled cellular proliferation), the miR-183 cluster and miR-31 (implicated in cell migration), and miR-150 (potential biomarker of prognosis and therapeutic outcome in CRC). [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
They found that the most significantly upregulated and downregulated miRNAs in scrapie-infected mice were, mmu-miRNA-3473e (9.48 log [2]) and mmu-miRNA-141-5p (-7.33 log [2]) in the 139A group, mmu-miRNA-3473e (13.18 log [2]) and mmu-miRNA-200a-5p (-7.08 log [2]) in the ME7 group, and mmu miRNA-3473e (14.15 log [2]) and mmu-miRNA-183-3p (-10.15 log [2]) in the S15 group (Gao et al., 2017). [score:7]
During clinical stage of prion disease, all members of the miRNA-200 family (such as miRNA-200a-3p, miRNA-200b-3p, miRNA-200c-3p), miRNA-141-3p, miRNA-429-3p, and 182 cluster miRNAs (miRNA-182-5p and miRNA-183-5p) were downregulated (Boese et al., 2016). [score:6]
During clinical phase of prion disease all the members of the miRNA-200 family (miRNA-200a-3p, miRNA-200b-3p, and miRNA-200c-3p), miRNA-141-3p, and miRNA-429-3p and the 182 cluster (miRNA-182-5p and miRNA-183-5p) are downregulated (Boese et al., 2016). [score:6]
[1 to 20 of 3 sentences]
34
[+] score: 19
Of interest was the expression profile of the miR-96, miR-182 and miR-183 clusters as well as miR-135b, which were up-regulated in embryonic stem cells and whose expression decreased following differentiation. [score:8]
miR-96, miR-182, miR-182* and miR-183 were all up-regulated; expression was highly correlated and mapped to the same region of chromosome 7. Additionally, 22 miRNAs showed decreased expression in colon tumors. [score:8]
Tumor specimens showed highly significant and large fold change differential expression of the levels of 39 miRNAs including miR-135b, miR-96, miR-182, miR-183, miR-1, and miR-133a, relative to normal colon tissue. [score:3]
[1 to 20 of 3 sentences]
35
[+] score: 19
A recent study revealed that suppressing miR-182 and miR-183 in vitro led to upregulation of their four target genes, which in turn resulted in upregulation of E-cadherin expression. [score:13]
Another pair of oncogenic gene regulators, miR-182 and miR-183, are overexpressed in ductal carcinoma in situ (DCIS) and lead to increased expression of chromobox homolog 7 (CBX7), DOK4, NMT2, and EGR1 [124]. [score:6]
[1 to 20 of 2 sentences]
36
[+] score: 19
miR-21, miR519d, miR-183, miR-197, and miR-493-5p were identified as most prominently up-regulated, miR-145 and miR-497 as most prominently down-regulated in male breast cancer. [score:7]
However, the identification of target genes specific for miR-519d is especially challenging because it shares target sequence specificity with miR-17-5p, miR-20 A and B, as well as miR-106 A and B. Other microRNAs overexpressed more than twofold in human male breast cancer, but not yet described in female breast cancer are miR-183, miR-197, miR-493-5p, and 519d. [score:7]
Up-regulation of miR-519d, miR-183, miR197, and miR-493-5p (more than twofold in comparison to gynecomastia, see Table 2) has not been reported so far in female breast cancer. [score:4]
miR-183 is destabilizing a ubiquitine-ligase (βTrCP1, ref. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 18
ZEB1 can inhibit expression of miR-200c, miR-203 and miR-183, which in turn were shown to target BMI1, a known factor for stem cell renewal. [score:7]
ZEB1 expression results in downregulation of the miR-200 family, miR-203 and miR-183. [score:6]
MiR-200c, miR-203 and miR-183 cooperatively inhibit BMI1 expression. [score:5]
[1 to 20 of 3 sentences]
38
[+] score: 18
miRNA-31 downregulation conferred resistance to radiotherapy and chemotherapy in several types of cancers [37], [38], and downregulation of miRNA-30a [39], miRNA-203 [40], miRNA-183 [41], miRNA-130a [42], miRNA-24 [43] and miRNA-23a [43], and upregulation of miRNA-193b [44] increased tumor cells resistant to chemotherapy. [score:10]
Our results showed that miRNA-23a, miRNA-203, miRNA-31, miRNA-30a, miRNA-183, miRNA-130a, and miRNA-24 were downregulated, and miRNA-193b upregulated in the radioresistant NPC cells, suggesting that deregulation of these miRNAs might be involved in the NPC radioresistance. [score:8]
[1 to 20 of 2 sentences]
39
[+] score: 17
On the other hand, microRNAs might function as oncogenes by suppressing apoptosis, i. e. miR-24, which inhibits apoptosis and represses Bim in mouse cardiomyocytes [52]; miR-886-5p, which inhibits apoptosis by down -regulating Bax expression in human cervical carcinoma cells [53], and miR-183, which inhibits TGF-β1 -induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells [54]. [score:17]
[1 to 20 of 1 sentences]
40
[+] score: 16
Among the top differentially expressed miRNAs, miR-183 and miR-182 are most up-regulated in cancer samples (highest fold change) while miR-1247 and miR-199b-5p were most down-regulated in cancer samples compared to normal samples (Table  1). [score:8]
77 × 10 [−05] miR-542-5p −3.591.58 × 10 [−05] miR-758 −2.578.54 × 10 [−06] miR-377 −2.531.07 × 10 [−05] miR-337-5p −2.196.91 × 10 [−05] In the former studies, four miRNAs (miR-182, miR-183, miR-200a and miR-200c) were found to be up-regulated in four of the six surveys. [score:4]
77 × 10 [−05] miR-542-5p −3.591.58 × 10 [−05] miR-758 −2.578.54 × 10 [−06] miR-377 −2.531.07 × 10 [−05] miR-337-5p −2.196.91 × 10 [−05] In the former studies, four miRNAs (miR-182, miR-183, miR-200a and miR-200c) were found to be up-regulated in four of the six surveys. [score:4]
[1 to 20 of 3 sentences]
41
[+] score: 16
In the results of the splenocytes from the MRL/lpr mice, ASC treatment did not change the miR expression significantly, but cyclophosphamide treatment decreased the expression of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p significantly compared with the saline-treatment. [score:4]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in C3. [score:3]
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p 5p in the Y group were significantly lower than in the C group (Supplementary Fig. 3). [score:3]
[1 to 20 of 5 sentences]
42
[+] score: 15
Examples of interesting miRNA-target gene pairs that showed this pattern were: expression of miR-205 was 3.11-fold and its target gene ADAMTS9 expression was 0.87-fold; miR-124 was 3.79-fold and its target gene SUCLG2 was 0.42-fold; and expression of miR-183 was 3.01-fold while its target FOXP1 was 0.76-fold. [score:15]
[1 to 20 of 1 sentences]
43
[+] score: 15
- In, up-regulation is shown for miR-19a (position 5), miR-183 (position 9), and miR-141 (position 10); we also observe that miR-182 (position 3) is likely to be a true positive. [score:4]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
hsa-let-7a hsa-miR-296 hsa-miR-125b hsa-miR-183 hsa-miR-19b hsa-miR-30b hsa-miR-30c hsa-miR-30a-5p hsa-miR-30d hsa-miR-27a hsa-miR-103 hsa-miR-107 hsa-miR-92 hsa-miR-10a hsa-miR-326 Table 3 shows an overview of predictions on 39,215 3'UTR sequences in human genome and on 15 other genomes. [score:1]
[1 to 20 of 6 sentences]
44
[+] score: 14
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-96, hsa-mir-182, hsa-mir-125b-1, hsa-mir-125b-2
Additionally, ATO down-regulated the expression of miR-96 and miR-183 in addition to miR-182, and all three miRNAs are located on the same gene cluster. [score:6]
Additionally, ATO suppressed the expression of not only miR-182-5p but also miR-96-5p and miR-183-5p, which are derived from the same transcript as miR-182-5p (Figure 3C). [score:5]
Interestingly, the TGF-β signaling pathway, which transactivates the miR-96/miR-182/miR-183 gene cluster [72], compromised the effects of ATO -mediated suppression of miR-182-5p. [score:3]
[1 to 20 of 3 sentences]
45
[+] score: 14
For example, miR-129 was the most commonly up-regulated and its up-regulation was associated with poor outcome [19]; the expression of miR-96 and miR-183 in urine was significantly correlated with tumor stage and grade, and their expressions were significantly decreased after radical surgery [20]; miR-133b and miR-518c were also strongly up-regulated in bladder cancer tissues [19]. [score:14]
[1 to 20 of 1 sentences]
46
[+] score: 14
It has been reported that miR-183 can reduce ITGB1 and inhibit the metastatic potential of HeLa cells 22. miR-124 was also reported to inhibit metastasis of oral squamous cell carcinoma 29 and malignant glioma cells 19 by the downregulation of ITGB1 expression. [score:10]
Bioinformatics analyses revealed that miR-29, miR-124, miR-183 and miR-506 might regulate the expression of ITGB1. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 14
A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overlap in their predicted target genes; B) miR-25 and miR-183, two miRNAs with a single nucleotide difference within their respective seed regions have only 18% overlap in their predicted target genes; C) The overlap of predicted targets for all 249 pairs of conserved miRNAs grouped by the number of mismatches in their respective seed regions. [score:7]
0115241.g001 Figure 1 A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overlap in their predicted target genes; B) miR-25 and miR-183, two miRNAs with a single nucleotide difference within their respective seed regions have only 18% overlap in their predicted target genes; C) The overlap of predicted targets for all 249 pairs of conserved miRNAs grouped by the number of mismatches in their respective seed regions. [score:7]
[1 to 20 of 2 sentences]
48
[+] score: 13
Notably, SNAI2/Slug, an important EMT gene, is upregulated in 2102Ep cells, while its previously validated miRNAs, miR-182 and miR-183, are downregulated. [score:7]
Conversely, an inhibitor of EMT, miR-183, is downregulated. [score:6]
[1 to 20 of 2 sentences]
49
[+] score: 13
In recent years, more and more miRNAs have been recently identified and play important roles in post-transcriptional regulation of gene expression in the endometrium, such as miR-183 regulate ITGB1P expression and promote invasion of ESC cells [66]. [score:7]
MiR-183 Regulates ITGB1P Expression and Promotes Invasion of Endometrial Stromal Cells. [score:3]
Functional studies indicated that miR-183 might contribute to human endometrial stromal cell apoptosis and impose a negative regulatory impact on cell invasiveness in humans [67]. [score:2]
Together with its family members (miR-96 and miR-183), miR-182 was described in mouse neurosensory cells, specifically in the retina, inner ear, and dorsal root ganglia [12– 14]. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 13
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
The human and mouse FGF9 3’ UTR are highly conserved and are similarly regulated by miR-140, miR-182, miR-183, miR-328. [score:2]
[1 to 20 of 4 sentences]
51
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-183, another member of miR-183~182 cluster, was also upregulated by HDI. [score:4]
Because the precursors of miR-96, miR-182, and miR-183 are transcribed as a single transcript, these findings further support the contention that HDI modulate miRNA expression through regulation of their primary transcript (16). [score:4]
In B cells stimulated with LPS plus IL-4, miR-182, miR-96, and miR-183 were all highly expressed. [score:3]
miR-182 is a member of the miR-183~182 cluster which includes miR-96, miR-182, and miR-183. [score:1]
miR-182, miR-96, and miR-183 belong to a polycistronic miRNA cluster that is located within a 4-kb area on mouse chromosome 6q. [score:1]
[1 to 20 of 5 sentences]
52
[+] score: 13
identified 19 miRNAs differentially expressed, including overexpression of miR-183 in CSCs and miR-7 in bulk cell exosomes that were previously described in human renal cancer [27]. [score:5]
Grange et al. described previously that CSCs exosomes prepare the premetastatic niche in renal cancer, by overexpression, among others of miR-183 [27], that was also differentially expressed in PCa CSCs exosomes. [score:5]
Six of them were overexpressed in CSCs exosomes: hsa-miR-7641, hsa-miR-148a, hsa-miR-1307-3p, hsa-miR-183, hsa-miR-139 and hsa-miR-1307-5p. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 12
This included the upregulation of a number of miRNAs (e. g., miR-21, miR-31, miR-96 and miR-135b, miR-182, miR-183) (14– 19, 29– 34) and downregulation of miRNAs (e. g., 133a and mir-1) (31) which were previously noted. [score:7]
were used to detect these targets of miR-182 and miR-183. [score:3]
RANOVA analysis of only miR-182 and its cluster partner, miR-183 demonstrated a significant race:tumor interaction term (p<0.05, Table III). [score:1]
The miRNAs which exhibited statistical significance as determined by RANOVA analysis were mir-182 and miR-183 (Fig. 1). [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 12
Stress also downregulated miRNAs that possess potential roles in the pathogenesis of psychiatric diseases, such as miR-96 [51], miR-182 and miR-183 [52]. [score:6]
The qRT-PCR confirmed changes of the selected miRNAs (Figure  4B), decreased expression of miR-96, miR-141, miR-182, miR-183, miR-200a, miR-200b, miR-429 and miR-451 in F2-SSS compared to F0-S animals, whereas miR-23b and miR-200c showed increased expression levels. [score:4]
In order to validate miRNAs, we performed quantitative real time PCR (qRT-PCR) analysis of these differentially regulated miRNAs (n = 3 per group for F0, F1 and F2 generations, three replicates per sample): miR-23b, miR-96, miR-141, miR-181a, miR-182, miR-183, miR-200a, miR-200b, miR-200c, miR429 and miR-451. [score:2]
[1 to 20 of 3 sentences]
55
[+] score: 12
Our results in the two cell lines agree with previously published data on the upregulation of MIR93, MIR95, MIR135B, MIR181C, MIR181D, MIR182, MIR183, MIR190, MIR196B and MIR203, and downregulation of MIR20A and MIR29C in pancreatic intraepithelial neoplasms (PanIns) or pancreatic adenocarcinomas (PDACs) as compared to normal pancreatic tissue [34- 36]. [score:6]
MIR135B, MIR182 and MIR183 are overexpressed in a wide range of other cancer types such as bladder, colon, prostate cancer and glioma [37- 41]. [score:3]
Differential miRNA expression levels included higher levels of MIR767, MIR135B, MIR1269, MIR182, MIR183, and MIR203 and lower levels of MIR494, MIR424, MIR381, MIR452, and MIR155 in PANC-1 cells. [score:3]
[1 to 20 of 3 sentences]
56
[+] score: 12
Thus, miR-182 and miR-183 are overexpressed and miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in both cell lines containing integrated HPV16 or HPV18 DNA [30]. [score:5]
HPV18 positive HeLa cell line has overexpression of miR-182 and miR-183, while miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in this cell line as compared with normal cervical tissue. [score:4]
HPV16 positive SiHa and CaSki cell lines have shown an overexpression of miR-182, miR-183, and miR-210. [score:3]
[1 to 20 of 3 sentences]
57
[+] score: 12
The vestibular up-regulated miRNAs include all the members of the miR-183/96/182 cluster previously demonstrated to be specifically expressed in the mammalian inner ear hair cells and ganglia [11], [12], [31]. [score:6]
These include the mir-183/96/182 cluster that had a higher expression in the vestibule (fold change of 1.4–1.5) as well as two members of each of the mir-17/92 and mir-106a/363 clusters, which had a higher expression in the cochlea. [score:5]
To date, the only miRNAs identified demonstrating inner ear hair cell specificity are part of the miR-183/96/182 family [31]. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 11
Several of the miRNAs previously noted to be highly expressed in developing retina were up-regulated in ESMV -treated Müller cells, including miR-1, miR-96, miR-182 and miR-183. [score:6]
In addition, we observed the up-regulation of endogenous human miR-1, miR-96, miR-182, and miR-183, the appearance of which marked progression through early retinal development [45], supporting the notion that ESMV treatment shifts Müller cell differentiation towards an early retinal progenitor stage. [score:5]
[1 to 20 of 2 sentences]
59
[+] score: 11
In vitro experiments showed that both mutations impaired, but did not abrogate, the processing of miR-96 to its mature form, although an additional indirect effect on the expression of miR-182 and miR-183 due to the miR-96 mutations cannot be excluded. [score:6]
miR-96, together with miR-182 and miR-183, is transcribed as a single polycistronic transcript and is reported to be expressed in the inner ear. [score:3]
For this reason, the authors also carried out a mutation screening of miR-182 and miR-183 in the same cohort of patients, tested for miR-96. [score:2]
[1 to 20 of 3 sentences]
60
[+] score: 11
Another example is an upregulated expression of miR-183 in prostate cancer cells and that inhibiting it may benefit the prostate cancer treatment [13]. [score:8]
Ueno K microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancerBr. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 11
For instance, both miR-183-5p and miR-34a-5p were predicted as commonly targeting BACH2, BCL6, and FOXP1. [score:3]
In particular, the target sites of miR-148a-3p and miR-183-5p in the 3′UTR of BACH2 are both highly conserved among vertebrates. [score:3]
In addition, using luciferase reporter assays, we found that miR-183-5p and -365a-3p did not affect BACH2 and FOXP1 3′UTR, respectively, whereas modulation of these miRNAs influenced the expression of BACH2 and FOXP1. [score:2]
Notably, mutating the miR-34a-5p and miR-183-5p cognate sequences in BCL6 3′UTR completely de-repressed the luciferase activity (Fig. 5A). [score:1]
Mutating the miR-148a-3p and miR-34a-5p, but not miR-183-5p, binding sites in BACH2 3′UTR partially attenuated the repression of luciferase activity (Fig. 5B). [score:1]
Likewise, disruption of the miR-183-5p, miR-34a-5p, or miR-148a-3p site, but not the miR-365a-3p site, attenuated the repression of FOXP1 3′UTR–mediated luciferase activity (Fig. 5C). [score:1]
[1 to 20 of 6 sentences]
62
[+] score: 11
Here we included the two miRNAs that were the most up-regulated in our previous study (mir-182 and mir-183) and one of the downregulated miRNAs (mir-214). [score:7]
The ability of mir-182 and mir-183 to promote FOXO1 repression may play a key role in the development of EAC by enabling tumors to bypass the cell cycle and apoptosis [32]. [score:2]
For example, the expression of mir-182 and mir-183 were statistically significantly higher in cancer samples compared to normal endometrium. [score:2]
[1 to 20 of 3 sentences]
63
[+] score: 10
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
Xu F. Zhang H. Su Y. Kong J. Yu H. Qian B. Up-regulation of microRNA-183-3p is a potent prognostic marker for lung adenocarcinoma of female non-smokers Clin. [score:4]
[1 to 20 of 2 sentences]
64
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Several miRNAs, such as miR-96, miR-124a, miR-181a, miR-181b, miR-182, miR-183, miR-184, and miR-204 are expressed in eye of zebrafish embryo (Cavodeassi et al. 2005). [score:3]
In rat pineal gland, expression of several dominant miRNAs such as miR-96, miR-124, miR-125b, miR-127, miR-182, and miR-183 has been found (Clokie et al. 2012). [score:3]
Although majority of miRNAs identified by the authors had similar expression during the day and night, the 2-fold increase in miR-96, miR-182, and miR-183 during the day when compared with the night was found. [score:2]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
Soares et al. (2009) let-7b, miR-9, miR-30a, miR-92b,miR-96 miR-124, miR-181a,b, miR-182, miR-183, miR-184, and mir-204 Zebrafish ISH ? [score:1]
[1 to 20 of 5 sentences]
65
[+] score: 10
miR-96, miR-182, and miR-183 are downregulated and miR-1, miR-133, and miR-142 are upregulated consistently in multiple mouse mo dels of retinitis pigmentosa, suggesting that this may be a miRNA signature of retinal degeneration [39, 40]. [score:7]
A sensory organ-specific miRNA cluster comprised of miR-96, miR-182, and miR-183, expressed in photoreceptors and bipolar cells, was also identified [38]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 9
Since, among these differentially expressed miRNAs, miR-183, miR-215, and miR-363 were found downregulated in both the ectopic and eutopic tissues, the authors selected miR-183 for validation of further functional studies. [score:6]
In our study we could not confirm differential expression of miR-183. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 9
However, the lowest testing concentration of TCDD (5 × 10 [−11] M) showed no effect on hsa-miR-608 expression (Fig.   2B, p = 1.000) and there was no change in the expression of the human-specific miR, hsa-miR-183-5p, upon TCDD treatment (data not shown). [score:5]
To our knowledge, dioxin -induced alterations in the expression of hsa-miR-608 or hsa-miR-183-5p have not been documented in human-derived neuronal systems. [score:3]
According to previously published studies, 13 of these 53 miRs are related to the nervous system, including the primate specific hsa-miR-608 and human specific hsa-miR-183-5p (Table. [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 9
For example, miR-192-5p+1 was 22-fold more highly expressed in human beta cells than in MIN6, miR-10a-5p+1 was 23-fold more highly expressed in human islets than in MIN6, and miR-183-5p+1 was nearly 3-fold more highly expressed in MIN6 than in human beta cells or islets (Fig. 3B). [score:7]
Strikingly, three of the 10 candidate miRNA regulatory hubs in the T2D gene network were 5′-shifted isomiRs: miR-375+1, miR-375-1, and miR-183-5p+1 (Fig. 4A). [score:2]
[1 to 20 of 2 sentences]
69
[+] score: 9
Vosa et al. performed a meta-analysis of 20 published miRNA expression profiling studies in lung cancer and identified a meta-signature of seven up-regulated (mir-21, mir-210, mir-182, mir-31, mir-200b, mir-205, and mir-183) and eight down-regulated (mir-126-3p, mir-30a, mir-30d, mir-486-5p, mir-451a, mir-126-5p, mir-143, and mir-145) miRNAs (Vosa et al., 2013). [score:9]
[1 to 20 of 1 sentences]
70
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway [51]. [score:5]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 8
The most significantly deregulated miRNAs were miR-31, miR-96, miR-135b, miR-183 (up-regulated in tumors and CRC cell-lines) and miR-133b, miR-145 (downregulated). [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 8
Similarly, the miRNAs down-regulated in 10-87 HP cells and 10-87 T cells, such as miR-31, miR-200c, miR-218, and miR-183, were also found to be down-regulated in A4497 VERO cells and SF-VERO cells. [score:7]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 8
Among the up-regulated miRNAs that appear in the vast majority of tumours analysed, we found an oncogenic cluster that was over-expressed in 14 tumours, formed by miR-182, miR-96 and miR183, and miR-4746 that was over-expressed in all the tumours analysed (Fig. 3). [score:8]
[1 to 20 of 1 sentences]
74
[+] score: 8
At the same time point (6-hour), miR-15a*, miR-1825, miR-183*, miR-34b, miR-494, and miR-574-5p were found to be down-regulated (>1.5-fold, p<0.05) in H1N1 infected cells. [score:4]
For H1N1 infected cells, at 18 and 24-hour post-infection, miR-188-5p, miR-1260, miR-1274a, miR-1274b, miR141, miR183*, miR-18b, miR-19a, miR21*, miR-301a, miR-572, miR-720, and miR-939 were found to be up-regulated (>1.5-fold, p<0.05) (Table 1). [score:4]
[1 to 20 of 2 sentences]
75
[+] score: 8
For example, the up-regulation of miRNA hsa-mir-183 (1st in the prediction list), hsa-mir-215(2nd in the prediction list), hsa-mir-9 (3rd in the prediction list), hsa-mir-34a (5th in the prediction list) and down-regulation of hsa-mir-30b (4th in the prediction list) are all related to the development of lymphoma. [score:8]
[1 to 20 of 1 sentences]
76
[+] score: 8
Of note, there seems to be two groups of normal samples (group “N” and part of group 1) that differ in in their miR-192 and miR-183 expression levels. [score:3]
Our in silico analysis unveiled a novel ccRCC-specific 5-miRNA (miR-10b, miR-21, miR-143, miR-183, and miR-192) signature able, when combined with information from conventional TNM staging and the age of the patient, to prognosticate ccRCC outcome more accurately than known ccRCC miRNA signatures or TNM staging alone. [score:1]
miR-21, miR-10b, miR-143, miR-183, and miR-192 define a prognosis signature in ccRCC. [score:1]
A clustering procedure revealed the presence of 5 distinct miRNA clusters, which were best represented by miR-21, miR-146b-3p/5p, and miR-155 for cluster 1, miR-1 and miR-143 for cluster 2, miR-10b for cluster 3, mir-194-3p and miR-192-3p/5p for cluster 4, and miR-182, miR-183, and miR-221 for cluster 5 (Fig. 1). [score:1]
All of them have been reported to play a role in cell proliferation or metastasis but miR-192 and miR-183 have never been included in a miRNA signature for ccRCC. [score:1]
That is miR-21, miR-10b, miR-143, miR-183, and miR-192, which will be further referred to as the “top miRs” signature. [score:1]
[1 to 20 of 6 sentences]
77
[+] score: 8
Low expression of miR-183 can increase the expression of KIAA0101 to accelerate S phase progression, thereby promoting cell invasion and proliferation. [score:5]
In PRL adenomas, the expression of miR-183 is lower in invasive adenomas than in noninvasive adenomas. [score:3]
[1 to 20 of 2 sentences]
78
[+] score: 8
Li P. Sheng C. Huang L. Zhang H. Cheng Z. Zhu Q. miR-183/-96/-182 cluster is up-regulated in most breast cancers and increases cell proliferation and migration Breast Cancer Res. [score:4]
Leung W. K. He M. Chan A. W. Law P. T. Wong N. Wnt/β-Catenin activates miR-183/96/182 expression in hepatocellular carcinoma that promotes cell invasion Cancer Lett. [score:3]
A notable example is the microRNA cluster composed by miR-96/miR-182/miR-183, which in a murine mo del exhibits diurnal variation and is implicated in melatonin production in the pineal gland [112]. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 8
To further validate our findings and in order to translate our results in a clinical setting, we next verified the expression of 8 selected miRNAs (miR-146b-5p, miR-183-5p, miR-132-3p, miR-29a-3p, miR-15-5p, miR-21-5p, miR-29b-3p, miR-203a-3p) in colorectal cancer patient and healthy donor sera. [score:5]
Moreover, among the amplified miRNAs, we found that miR-183-5p, miR-132-3p, miR-21-5p, miR-29b-3p, miR-203a-3p were significantly overexpressed in CRC patients compared to healthy donor sera. [score:2]
miRNA ID Accession Number Sequence HSA-miR-15a-5p MIMAT0000068 UAGCAGCACAUAAUGGUUUGUG HSA-miR-132-3p MIMAT0000426 UAACAGUCUACAGCCAUGGUCG HSA-miR-29a-3p MIMAT0000086 UAGCACCAUCUGAAAUCGGUUA HSA-miR-146b-5p MIMAT0002809 UGAGAACUGAAUUCCAUAGGCU HSA-miR-183-5p MIMAT0000261 UAUGGCACUGGUAGAAUUCACU HSA-miR-21-5p MIMAT0000076 UAGCUUAUCAGACUGAUGUUGA HSA-miR-29b-3p MIMAT0000100 UAGCACCAUUUGAAAUCAGUGUU HSA-miR-203a-3p MIMAT0000264 GUGAAAUGUUUAGGACCACUAG HSA-miR-16-5p MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG Cel-miR-39-3p MIMAT0000010 UCACCGGGUGUAAAUCAGCUUG RNA was isolated from EXPEL-extruded fluids and human sera using miRNeasy Serum/Plasmakit (Cat. [score:1]
[1 to 20 of 3 sentences]
80
[+] score: 8
In our study we detected upregulation of ssc-miR-183 in HG-IEN; similarly elevated levels of mir-183 is associated with human colorectal carcinogenesis [23, 24]. [score:4]
Ten differentially expressed miRNAs were validated by qRT-PCR: ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-155-5p, ssc-miR-181b, ssc-miR-183, ssc-miR-191 and ssc-miR-196a. [score:3]
In summary, we have detected several miRNAs (ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-183 and ssc-miR-196a) associated with early-stage colorectal neoplasia in APC [1311] pigs. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 8
Twelve miRNAs (hsa-miR-130b, hsa-miR-203, hsa-miR-1974, hsa-miR-592, hsa-miR-200a, hsa-miR-429, hsa-miR-183, hsa-miR-182, hsa-miR-1290, hsa-miR-141, hsa-miR-135b, and hsa-miR-96) were overexpressed, whereas 84 miRNAs (hsa-miR-1, hsa-miR-145, hsa-miR-145*, and so on) were downexpressed in tumor tissues compared with those in normal tissues. [score:4]
For example, E Bandrés et al. reported that miR-31, miR-96, miR-133b, miR-135b, miR-145, and miR-183 are the most significantly deregulated miRNAs and the expression level of miR-31 was correlated with the stage of CRC tumor [2]. [score:4]
[1 to 20 of 2 sentences]
82
[+] score: 8
Notably however, gga-mir-183 which targets EZR mRNA (which did not change), was decreased and EZR (important in metastasis) protein increased; i. e. we suggest that one reason for the increase in EZR protein is decreased gga-mir-183 translation -inhibition. [score:7]
Of these, nine (gga-mir-1b, gga-mir-7, gga-mir-7b, gga-mir-10b, gga-mir-31, gga-mir-130b, gga-mir-204, gga-mir-215, gga-mir-489) are increased, and five (gga-mir-223, gga-mir-124b, gga-mir-140, gga-mir-183, gga-mir-222a) are decreased in CD30 [hi] cells. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 8
Other miRNAs from this paper: hsa-mir-21
TGF-β induced miR-21 expression in fibroblasts and mir-183 downregulated PDCD4 and inhibited TGF-β–induced apoptosis in human hepatocellular carcinoma cells [41], [42]. [score:8]
[1 to 20 of 1 sentences]
84
[+] score: 7
However, miR-183 did not show any significant correlation with the expression of PDCD4 in either of the two breast cancer cell lines (Fig. 5A), which is in contradiction with previous report [53]. [score:3]
Two miRNAs (miR-21 and miR-183), have complementary sites for the 3′-UTR of PDCD4 and are considered to be possible suppressors of this gene [51], [52]. [score:2]
This suggests that miR-21 (rather than the miR-183) is responsible for regulation of PDCD4. [score:2]
[1 to 20 of 3 sentences]
85
[+] score: 7
Eight miRNAs (miR-183, miR-193a-5p, miR-222, miR-516b, miR-524-5p, miR-601, and miR-629, 99b) were upregulated and five miRNAs (miR-124, miR-32, miR-574-5p, miR-744, and miR-96) were downregulated. [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
Seven upregulated (miR-21, miR-210, miR-182, miR-31, miR-200b, miR-205 and miR-183) and eight downregulated (miR-126-3p, miR-30a, miR-30d, miR-486-5p, miR-451a, miR-126-5p, miR-143 and miR-145) miRNAs were identified [34]. [score:7]
[1 to 20 of 1 sentences]
87
[+] score: 7
Especially, all of miR-302b, miR-182, miR-183, miR-93 and miR-99b, which were from rpESCs enriched miRNAs cluster (Fig. 3D), were also highly expressed in IVF3.2 and IVF3.3 (counts TPM>10000). [score:3]
We also analyzed miRNA cluster expression patterns and the results revealed that miRNAs from miR-302 cluster, miR-182/miR-183/miR-96 cluster and miR-143/miR-145 cluster were the most rpESCs enriched miRNAs. [score:3]
Consisting with Laurent and colleagues' reports [14], miR-183–182 cluster, miR-103, miR-21 and miR-378, which were reported to be related to many type carcinomas [33]– [36], were also enriched in both types of rhesus monkey ESCs. [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 7
We found 8 expressed miRNAs (miR-593, miR-129-1, miR-335, miR-182, miR-96, miR-183, miR-29a, miR-29b-1) reside on 7q32, some of which have been investigated, either as oncogenes or tumor suppressor genes [13- 15]. [score:3]
We found 8 expressed miRNAs (miR-593, miR-129-1, miR-335, miR-182, miR-96, miR-183, miR-29a, miR-29b-1) resided on chromosome 7q32, a hot spot that frequently gained in astrocytoma(Figure 1A). [score:3]
There are 8 miRNAs(miR-593, miR-129-1, miR-335, miR-182, miR-96, miR-183, miR-29a, miR-29b-1) resided on this genomic locus, some of which have been investigated, either as oncogenes or tumor suppressor genes [13- 15]. [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 7
We observed that hsa-miR-153-3p was 13.36 (log FC = 6.68)-fold more abundant in patients with LN class IV than in controls and therefore, through its interaction with the transcription factor fox01, it could be decreasing the expression of hsa-miR-183-5p, which was found to be 6.88 (log FC = 3.44) times less abundant in patients with class LN-IV than in controls, and promoting in the same way an increase in the abundance of miR-145-5p, which we found 6.36(log FC = 3.18) times more in patients with class LN-IV than in controls. [score:3]
8 of these miRNAs have been previously associated with the regulation of SLE (hsa-miR-361-3p [26], hsa-miR-145-5p [27], hsa-miR-410-3p [28], hsa-miR-125 [29], hsa-miR-199a-5p [26], hsa-miR-550b-2-5p [5], hsa-miR-106a-5p [30], and hsa-miR-183-5p [31]). [score:2]
Among the miRNAs associated with positive regulation of the EEF2 gene that showed a significant change in their abundance in plasma samples of patients with lupus nephritis class IV were: hsa-miR-584-5p [48], hsa-miR-589-3p [49], hsa-miR-145-5p [48], hsa-miR-183-5p [48], Hsa-miR-125b-5p [35] and hsa-miR-106a-5p [50]. [score:2]
[1 to 20 of 3 sentences]
90
[+] score: 7
Of these 16 miRNAs, 9 were downregulated (let-7d, miR-106b, miR-122a, miR-141, miR-183, miR-195, miR-200a, miR-335, mir424) and 7 were upregulated (miR-100, miR-199a, miR-296, miR-29a, miR-29c, miR-99a, mir-494). [score:7]
[1 to 20 of 1 sentences]
91
[+] score: 7
Normalization of exosomal samples was conducted against an average of the expression of miR-452–5p and miR-183–5p. [score:3]
These two miRNAs were chosen as endogenous exosomal miRNAs for normalization since they were among the most frequently sequenced exosomal miRNAs in HeLa cells (> 1,000 RPM in each sample) and showed virtually no regulation in exosomes upon silencing of HPV18 E6/E7 versus control treatment based on the deep sequencing data (miR-452–5p: FC [mean] = 0.99, miR-183–5p: FC [mean] = 1.04). [score:2]
Therefore, two miRNAs, miR-452–5p and miR-183–5p, were chosen as stable endogenous exosomal miRNA controls based on the small RNA deep sequencing data (in analogy to refs. [score:1]
Both miRNAs were frequently sequenced (> 1,000 RPM in each sample) and showed virtually no alterations of their exosomal concentrations upon E6/E7 silencing versus control treatment (miR-452–5p: FC [mean] = 0.99, miR-183–5p: FC [mean] = 1.04). [score:1]
[1 to 20 of 4 sentences]
92
[+] score: 7
Other miRNAs from this paper: hsa-mir-96, hsa-mir-192, hsa-mir-182
Low miR-183 expression was observed in lung cancer [28]. [score:3]
Overexpression of the miR-182/miR-183/miR-96 cluster was associated with activation of Wnt/β-catenin signaling in medulloblastoma [44]. [score:3]
MiR-182, a member of the miR-183 cluster, is located on human chromosome 7q32. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 7
Schaefer et al. [8] validated that ten microRNAs (hsa-miR-16, hsa-miR-31, hsa-miR-125b, hsa-miR-145, hsa-miR-149, hsa-miR-181b, hsa-miR-184, hsa-miR-205, hsa-miR-221, hsa-miR-222) were downregulated and five miRNAs (hsa-miR-96, hsa-miR-182, hsa-miR-182, hsa-miR-183, hsa-375) were upregulated in prostate cancer. [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
Several such miRNAs have been identified in colorectal cancer, including the upregulated miR-31, miR-96, miR-135b, and miR-183 and the downregulated miR-133b and miR-145 [19]. [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
By considering the fold-change threshold and percentage of incidence, among the 95 screened miRNAs which have functional significance with regard to potential roles in cancer, cell development and apoptosis, ten miRNAs (miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-150, miR-136, miR-200c and miR-141) were identified which may play a putative role in cancer development, metastasis and have potential as biomarkers for the detection of NPC. [score:3]
The incidence of up and down regulation of these ten miRNAs, including miR-205 (94.1%), miR-196a (88.2%), miR-149 (82.4%), miR-183 (64.7%), miR-224 (58.8%), miR-210 (58.8%), miR-136 (47.1%), miR-200c (64.7%), miR-141 (52.9%) and miR-150 (82.4%) between non-NPC controls and NPC patients ranges from about 47% to 94% incidence rate. [score:2]
Among these 10 miRNAs candidates, 6 (miR-196a, miR-183, miR-224, miR-136, miR-200c and miR-150) and 3 (miR-136, mi141 and 150) miRNAs have no data reported in HNSCC and ESCC, respectively. [score:1]
They were miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-136, miR-200c, miR-141 and miR-150. [score:1]
[1 to 20 of 4 sentences]
96
[+] score: 7
We chose one micro RNA (miR183) for which transcription was reported to be upregulated in BC, four micro RNAs (miR100, 200A, 203, 205), for which contradictory data were reported, and two micro RNAs (miR143, 199A) published as downregulated in BC. [score:7]
[1 to 20 of 1 sentences]
97
[+] score: 7
The authors observed up-regulation of mmu-miR-199a-3p and mmu-miR-183-5p. [score:4]
Interestingly, among the predicted target genes of mmu-miR-199a-3p and mmu-miR-183-5p, the significantly enriched gene ontology terms were the apoptosis process, immune response, inflammatory response, innate immune response, anti-apoptosis, cytokine production, and cytokine -mediated signalling pathway [37]. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 6
Although microarray assay did not identify the change of miR-96 expression level in lpr mice, Real-time RT-PCR analysis clearly showed that miR-96 was markedly upregulated similar to two other members (miR-182 and miR-183) in the cluster (Fig. 2A). [score:5]
A report has shown that miR-96 is clustered with miR-182 and miR-183 in mouse chromosome 6 and is likely generated from the same transcript [17]. [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 6
Our data adds support for an islet-enriched expression pattern of six miRNAs previously highlighted by microarray studies (miR-184, miR-183-5p, miR-7-5p, miR-127-3p, miR-375, and miR-493-5p) [17], [20]. [score:3]
For other miRNA transcripts, such as miR-409-5p and miR-183-5p, the high degree of islet-specificity may point to novel roles in the development and maintenance of islet cellular phenotype. [score:2]
For example, mir-182 and mir-183 (both amongst the most islet-specific transcripts) originate from the same cluster on chromosome 7q32.2, whilst mir-136 and mir-127 map together on chromosome 14q32.2. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 6
Other miRNAs from this paper: mmu-mir-182, mmu-mir-183, hsa-mir-182
Other compounds such as histone deacetylase inhibitors and synthetic retinoids, which increase SUMOylation by inhibiting the regulatory miRNAs miR-182 and miR-183, have demonstrated protection of cortical neurons in vitro (11). [score:6]
[1 to 20 of 1 sentences]