sort by

42 publications mentioning hsa-mir-147a

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-147a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 180
Moreover, luciferase validation experiments demonstrated that only 1 target out of 7 miR-147b targets was significantly down-regulated by miR-147a, NDUFA4, with an extensive 7 nt pairing to the 3′ portion of the miRNAs that could compensate for this single mismatch in the seed, as previously proposed for the let-7 site in lin-41 transcript [7]. [score:8]
The strong inhibitory action of miR-147a on cell proliferation was underlined by the down-regulation of pRB, cyclins (A and B) and cyclin -dependent kinase 6 (Cdk6) as well as a massive induction of the cyclin -dependent kinase inhibitor 1B (p27 Kip1) (Figure 5E). [score:8]
Table S4Full list of the predicted targets transcripts down-regulated following hsa-miR-210, hsa-miR-147a or hsa-miR-147b overexpression in A549 cells. [score:8]
Herein contradiction with this mo del, a very small percentage of miR-147b targets were also down-regulated by miR-147a in the microarray data. [score:6]
While it is well known that miR-210 expression is under the control of Hypoxia-Inducible Factor-1 alpha (HIF-1α) in virtually all cell lines tested, including A549 cells, the regulation of expression of hsa-miR-147a and hsa-miR-147b has not been well documented yet. [score:6]
B) Venn diagram summarizing the predicted common targets of miR-210 and miR-147 family members using the combination of transcriptomic data and different bioinformatics prediction tools: TargetScan and a search of a 6 nt complementary seed 2–7 sequences in 3′UTR. [score:5]
Taken together, these data indicated that mRNAs that are knocked down following transfection by miR-210 and miR-147b tend to overlap substantially (between 40 and 70% depending on the prediction tool) but are different from those down-regulated by miR-147a (Figure 3A and Figure S1B). [score:5]
Finally, MCM3, a miR-147a-only predicted target was found to be equally inhibited by the 3 miRNAs. [score:5]
B) Venn diagram summarizing the predictive common targets of miR-210 and miR-147 family members using different bioinformatics prediction tools: TargetScan, microCosm and a search of a 7 nt complementary seed 2–8 sequences in 3′UTR using our laboratory-made tool “MicroCible” [25] (http://www. [score:5]
Identification of miR-210, miR-147a and miR-147b Targets by mRNA Profiling of A549 Cells Overexpressing Pre-miRNAs. [score:5]
MCM3 was indeed validated as a bona fide miR-147a target by luciferase assay, but additional targets are probably involved in the observed phenotype. [score:4]
A) Direct targeting of the 15 candidate transcripts by miR-210, miR-147a and miR-47b was analyzed in vitro. [score:4]
An upregulation of miR-147a has been reported in several cancers [45], [46]. [score:4]
0044919.g004 Figure 4A) Direct targeting of the 15 candidate transcripts by miR-210, miR-147a and miR-47b was analyzed in vitro. [score:4]
Figure S3 Graphs adapted from our webtool miRontop (Le Brigand et al. 2010, Bioinformatics) showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of hsa-miR-210, hsa-miR-147a and hsa-miR-147b. [score:3]
Figure S2 Graphs adapted from our webtool miRontop (Le Brigand et al. 2010, Bioinformatics) showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of hsa-miR-210, hsa-miR-147a and hsa-miR-147b. [score:3]
A) In silico evaluation of the common predicted targets between hsa-miR-210, hsa-miR-147a and hsa-miR-147b using TargetScan or microCosm. [score:3]
Biological consequences of miR-210, miR-147a and miR-147b overexpression on A549 cells proliferation and viability. [score:3]
Enrichment of miR-210 and miR-147 family members-predicted targets in the different subsets of modulated transcripts following transfection by each miRNA candidate. [score:3]
0044919.g003 Figure 3) Graphs adapted from our webtool miRontop [33] showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of miR-210, miR-147a and miR-147b. [score:3]
Several canonical pathways associated to cell cycle (control of chromosomal replication, G [1]/S checkpoint regulation, G [2]/M DNA damage checkpoint regulation) were also significantly altered in miR-147a -transfected cells (Table S2). [score:3]
Expression of mmu-miR-147 has been shown to be induced upon Toll-like receptor (TLR) stimulation in murine macrophages and has been linked to the sensitivity of the inflammatory response, suggesting that it could be part of a negative feed-back loop of the TLR pathway [38]. [score:3]
Graphs adapted from our webtool miRontop [33] showing the significance of the enrichment (represented as –log10 (adjPVal) according to the fold enrichment in experiments of overexpression of miR-210, miR-147a and miR-147b. [score:3]
Figure S1Overlap between predicted targets of miR-210 and miR-147 family members. [score:3]
0044919.g001 Figure 1 In silico prediction of miR-210 and miR-147 family targets. [score:3]
Table S3 List of themes corresponding to “canonical pathways” annotations identified by Ingenuity Pathway Analysis in response to overexpression of hsa-miR-210, hsa-miR-147a or hsa-miR-147b. [score:3]
Note that an important percentage of genes knocked down by miR-210 were also knocked down by miR-147b but not by miR-147a. [score:3]
Global effect of miR-210 and miR-147 family members over -expression on transcriptome in the A549 cell line. [score:3]
Several cell-cycle-related genes, such as CDK6 or MCM3, represent putative miR-147a targets. [score:3]
Therefore, these experiments underlined the close proximity of miR-210 and miR-147b regarding apoptotic -mediated cellular effects while miR-147a appears as a potent inhibitor of cell proliferation and migration. [score:3]
In silico prediction of miR-210 and miR-147 family targets. [score:3]
A significant inhibition of cell proliferation by miR-147a was also observed in regular condition of growth on plastic (Figure 5B, left panel) while an opposite early transient stimulation by both miR-147b and miR-210 was noticed. [score:3]
Cellular Phenotypes Triggered by miR-147a, miR-147b and miR-210 Overexpression. [score:3]
Second, the 1 nt substitution observed between miR-147a and miR-147b, located in the seed at the 5 [th] base, corresponds to a change of U (in miR-147a) into a C (in miR-147b), indicating that all “seed -dependent” miR-147b targets would tolerate a GU wobble, as it has often been shown [6]. [score:3]
Importantly, we found a significant co-enrichment of miR-210 and miR-147b predicted targets using these tools in cells transfected by either of these 2 miRNAs while no significant link was found with miR-147a (Figure 3A and Figure S1B). [score:3]
By contrast, the impact of miR-147a was mainly at the level of cell division, since miR-147a overexpression led to a highly disproportionate number of modulated cell cycle genes (p<10 [−15], Table S1). [score:3]
In agreement with such a signature, miR-147a transfection led to a strong inhibitory action on cell proliferation and a G [0]/G [1] arrest in a pRB -dependent mechanism. [score:3]
Table S2 List of themes corresponding to “Molecular Function” annotations identified by Ingenuity Pathway Analysis in response to overexpression of hsa-miR-210, hsa-mir-147a or hsa-miR-147b. [score:3]
Distinct Regulation of miR-210 and miR-147 Family Members in A549 Cells. [score:2]
B) Venn diagram summarizing the predicted (using the microarray approach) and validated (after luciferase assay) common targets of miR-210 and miR-147 family members. [score:2]
Cell cycle analysis was then performed and indicated that miR-147a mediated cell cycle arrest in G1 phase while miR-210, and to a lesser extent miR-147b slightly increased the fraction of cells in the S/G2 phase (Figure 5C and 5D). [score:1]
Figure S4 Dose-response effect of miR-210, miR-147a and miR-147b on A459 cells viability. [score:1]
Molecular Characteristics and in silico Target Identification of miR-210 and miR-147 FamilyWhile hsa-miR-210 is the unique member of its family, hsa-miR-147b sequence is closely related to hsa-miR-147a and differs only with a 1 nt substitution in the seed sequence (Figure 1A). [score:1]
A549 cells were transfected with 10 nM pre-miR-210, pre-miR-147a, pre-miR-147b or pre-miR-Neg and analyzed for several proliferation (A-E) and viability (F-G) parameters. [score:1]
It remains that the human genome, as well as other primate sequences (Pan troglodytes, Pongo pygmaeus and Macaca mulatta) contain a predicted precursor hairpin for miR-147a. [score:1]
As shown in Figure 2B and 2C, the similarity between miR-210 and miR-147b -mediated transcriptomic changes was particularly underlined while most of miR-147a -mediated changes were specific. [score:1]
Chemically synthesized miRNA duplexes pre-miR-210, pre-miR-147a and pre-miR-147b and control pre-miRNA (pre-miR-Neg # 1) were purchased from Ambion. [score:1]
On each panel, miR-210, miR-147a and miR-147b are highlighted as blue, green and red dots, respectively. [score:1]
A549 cells were co -transfected with pre-miR-210, pre-miR-147a, pre-miR-147b or pre-miR-Neg and different pSI-Check-2™ constructs containing the 3′UTR of interest described in Table S5. [score:1]
B) Effect of miR-210 and miR-147 family on A549 cell proliferation. [score:1]
A) Alignment of miR-210, miR-147a and miR-147b mature sequences. [score:1]
On each panel, hsa-miR-210, hsa-miR-147a and hsa-miR-147b are highlighted as blue, green and red dots, respectively. [score:1]
While these 2 species only share the same “minimal” seed sequence, hsa-miR-147b has a homolog, hsa-miR-147a, which differs only with a 1 nt substitution in the seed sequence. [score:1]
We could first show the strong similarity between miR-210 and miR-147b at a whole genome transcriptome level while it appeared that miR-147a -mediated changes were highly specific. [score:1]
Molecular Characteristics and in silico Target Identification of miR-210 and miR-147 Family. [score:1]
Interestingly, hsa-miR-147b has a close homolog, hsa-miR-147a which differs only by a 1 nt substitution in the seed sequence (UGUGUG). [score:1]
Some highly specific pathways could be associated with miR-147a, the most significant being associated with cell cycle and DNA repair (“Mismatch Repair in Eukaryotes”; “ATM Signaling”; “Role of CHK Proteins in Cell Cycle Checkpoint Control”). [score:1]
0044919.g005 Figure 5A549 cells were transfected with 10 nM pre-miR-210, pre-miR-147a, pre-miR-147b or pre-miR-Neg and analyzed for several proliferation (A-E) and viability (F-G) parameters. [score:1]
In contrast, a strong induction of miR-147b by TNFα and to a lesser extent by LPS was observed (Figure 6B), while no significant stimulation of miR-147a could be detected in these conditions (data not shown). [score:1]
As previously shown for miR-210, we also found a close association of miR-147a and miR-147b signatures with “Oxidative phosphorylation”, “Mitochondrial dysfunction” and “Death Receptor signalling” [26]. [score:1]
While hsa-miR-210 is the unique member of its family, hsa-miR-147b sequence is closely related to hsa-miR-147a and differs only with a 1 nt substitution in the seed sequence (Figure 1A). [score:1]
The 1nt-substitution in miR-147a seed is underlined. [score:1]
MiR-147b is located in exon 4 of the normal mucosa esophagus specific 1 (NMES1) transcript, downstream of the NMES1-coding sequence, and possesses the same mature sequence as mmu-miR-147, with a similar location on the mouse homologous gene. [score:1]
A549 cells were transfected with 10 nM, 1nM, 0,1nM or 0,01nM of hsa-pre-miR-210, hsa-pre-miR-147a, hsa-pre-miR-147b or pre-miR-Neg and analyzed for several viability parameters. [score:1]
A strong wound closure delay was observed following pre-miR-147a transfection while no significant effect could be detected with pre-miR-210 and pre-miR-147b. [score:1]
This validation set was based on different criteria, including the best p-values associated to transcripts modulation, the selection of transcripts that belong to the various categories visualized in the Venn diagram of Figure 3B and to annotations for gene ontology terms enriched in each experimental condition (provided by our bioinformatics tool miRontop): such as “mitochondria” and “apoptosis” for miR-210 and miR-147b and “cell cycle”for miR-147a. [score:1]
B) Heatmap comparing normalized log2 of the ratio between miR-210 or miR-147 family members and miR-Neg. [score:1]
[1 to 20 of 67 sentences]
2
[+] score: 39
Distinct groups of miRNAs regulated by IAV infection could be defined: (1) miRNAs (n = 39) whose expression correlated with hemagglutinin (HA) mRNA expression and represented the general response to IAV infection independent of host genetic background; (2) miRNAs (n = 20) whose expression correlated with HA mRNA expression but differed between the two strains; and (3) remarkably, miR-147-3p, miR-208b-3p, miR-3096a-5p, miR-3069b-3p, and the miR-467 family, whose abundance even in uninfected lungs differentiated nearly perfectly (area under the ROC curve > 0.99) between the two strains throughout the time course, suggesting a particularly strong association with the differential susceptibility of the two mouse strains. [score:10]
Before infection, host susceptibility was particularly associated with consistently higher expression of miR-208b-3p, miR-3096b-3p, and the miR-467 family and lower expression of miR-3096a-5p and the potentially anti-inflammatory miR-147-3p. [score:5]
miR-147-3p constituted an exception in that it was markedly overexpressed in C57BL/6J mice within the first 24 hpi and had a similar expression level as DBA/2J at 48 hpi. [score:5]
Most of these highly strain-specifically expressed miRNAs (except miR-147-3p and miR-3069a-5p) were expressed more highly in the DBA/2J strain. [score:5]
Taken together, the above results suggest (1) that the selective expression of several IAV-regulated miRNAs, including miR-147-3p, miR-208b-3p, miR-3096a-5p, miR-3069b-3p, and the miR-467 family, in uninfected and incipiently infected DBA/2J lungs was specifically associated with higher susceptibility of this mouse strain to IAV infection at later time points and (2) that it accurately predicted this higher susceptibility. [score:4]
In total, there were eight differentially expressed miRNAs with AUCs > 0.99 (miR-147-3p, miR-208b-3p, miR-467a-5p, miR-467c-5p, miR-467d-5p, miR-467e-5p, miR-3096a-5p, and miR-3096b-3p) whose abundance changed significantly during infection. [score:3]
Indeed, changes in expression of several of these 20 miRNAs (miR-147-3p, miR-155-3p, miR-223-3p, as well as the miR-34 and miR-449 families) correlate with IAV virulence (14, 15, 17, 64). [score:3]
miR-147-3p has been reported to negatively regulate TLR signaling in murine macrophages (69). [score:2]
Also, miR-147-3p can dampen TLR-signaling in murine macrophages (69). [score:1]
Using the ViTa Database, the human homologs of miR-135b-5p, miR-147-3p, miR-31-5p, miR-379-5p, miR-7a-5p, as well as the miR-449 (-5p) and miR-34 (-5p) families, were predicted to bind to viral RNA segments of influenza A/Puerto Rico/8/34/Mount Sinai (H1N1). [score:1]
[1 to 20 of 10 sentences]
3
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Relative expression of candidate circulatory miRNAs in blood plasma of hypersitimulated heifers across different days during estrous (a- f) Expression of miR-221, miR-103, let-7g, miR-134, miR-147 and miR-127-3p was determined by RT-qPCR and each miRNA expression level was normalized using global normalization method. [score:7]
As shown in Fig.   4 expression analysis of candidate miRNAs (miR-221, miR-103, let-7 g, miR-134, miR-147 and miR-127-3p) using qRT-PCR revealed the presence of temporal changes in the pattern of expression depending on the time during the estrous cycle as shown in Fig.   4. While four of the candidates namely. [score:5]
For instance, miR-221, miR-103, miR-134 and miR-127-3p show significantly higher expression at day 7 of estrous cycle compared to day 0 or day 3. In contrast, miR-147 has significantly lower expression at day 7 of estrous. [score:4]
Unst)  Pathways in cancer miR-125b, −153, −410, −494 9.51E-12 DCC, GRB2, SMAD2, SOS1, E2F3  MAPK signaling pathway mir-125b, −153, −494 2.94E-11 MEF2C, MAPKAPK2, MAP3K1, TGFB2, FGFR2  Wnt signaling pathway miR-147, −153, −410, −494 2.76E-08 LRP6, WNT5A, DVL3, DKK2, PLCB1, ANGL2  ErbB signaling pathway miR-125b, −410 3.19E-07 ERBB4, SOS1, MAPK1, NRG3, GAB1, MAP2K7  Colorectal cancer miR-125b, −410, −153, −494 4.48E-07 DCC, BCL2, SMAD4, RAF1, SMAD2, PIK3R3  Axon guidance miR-147, −153, −410, −494 7.23E-07 PLXNA2, ROCK2, EFNA3, NFAT5, MAPK1  Neurotrophin signaling pathway miR-125b, −134, −147, −494 1.82E-06 NTF3, MAP3K1, SOS1, SORT1, BCL2  Melanogenesis miR-134, −99a-3p 4.52E-06 MAPK1, WNT5A, KRAS, GNAI3, CREB1  Melanoma miR-125b, −494 1.70E-05 E2F2, FGFR1, IGF1R, FGF7, RAF1  Prostate cancer miR-125b, −147, −153, −410, −494 1.82E-05 FGFR2,, IGF1R, MAPK1, IGF1, BCL2 In order to explore the temporal changes in the expression of circulatory miRNA especially in blood plasma of hyperstimulated heifers, the expression of candidate miRNAs was investigated at different days during the estrous cycle (Days 0, 3 and 7). [score:3]
miR-221, miR-103, miR-134 and miR-127-3p showed a significant increase in abundance at day 7 of the estrous cycle compared to days 0 and 3, miR-147 showed a decreasing pattern from day 0 to day 7. No significant difference in the expression of let-7 g miRNA has been observed between the days during estrous cycle. [score:2]
Data are presented as raw Ct value and Ct value of more than 35 was considered as undetected Here we have tried to detect candidate miRNAs, which were enriched (miR-221, miR-103 & let-7 g) or suppressed (miR-134, miR-147 & miR-127-3p) in blood plasma samples of hyperstimulated animals compared to the unstimulated ones. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 14
The overexpression of miR-601 initially detected as well as the down-regulation of miR-147 initially observed were not validated. [score:6]
In addition, 10 miRNAs; miR-720, miR-891a, miR-522, miR-518c, miR-3665, miR-3620, miR-382, miR-452, miR-122 and miR-147 were found down-regulated in the patient group, indicating tumor suppressor properties. [score:6]
Finally, ten miRNAs were found overexpressed in the control group when compared to the patients group (relapsed or in Complete Remission (CR)); miR-720 (I), miR-891a (J), miR-522 (K), miR-518c (L), miR-3665 (M), miR-891a (N), miR-382 (O), miR-452 (P), miR-122 (Q), miR-147 (R). [score:2]
[1 to 20 of 3 sentences]
5
[+] score: 12
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
In SC fat, expression of miR-27a, miR-30e, miR-140, miR-155, miR-210 was significantly higher and expression of miR-147 and miR-197 was lower in NGT as compared to the T2D group 10.1371/journal. [score:4]
Our data suggest that expression of miR-17-5p, miR-132, miR-134, miR-181a, miR-27a, miR-30e, miR-140, miR-147, miR-155, miR-197, and miR-210 play a role in the link between adipose tissue dysfunction and the development of obesity associated disorders including type 2 diabetes. [score:4]
[1 to 20 of 3 sentences]
6
[+] score: 12
miRNA Target Genes Pathways miR-128 ABCB9, BTG1, DSCR1, RASD1 ABC transporters General miR-136 GRN, PPP1R9B miR-147 HOXA1, PTGFRN miR-148 EGR3, SCN3A miR-181b IGF1R, NKX6-1 Adherens junction, Maturity onset diabetes of the, Focal adhesion, **Long term depression miR-196a ABCB9, CPB2, IRS1, MAPK10 ABC transporters General, Complement and coagulation cas, Adipocytokine signaling pathwa, Insulin signaling pathway, Type II diabetes mellitus, Fc epsilon RI signaling pathwa, Focal adhesion, **GnRH signaling pathway, **MAPK signaling pathway, Toll like receptor signaling p, Wnt signaling pathway miR-203 SARA1 miR-20 BTG1, SARA1, YWHAB Cell cycle miR-21 TPM1 mir-216 GNAZ **Long term depression miR-217 RHOA Adherens junction, Axon guidance, Focal adhesion, Leukocyte transendothelial mig, Regulation of actin cytoskelet, TGF beta signaling pathway, T cell receptor signaling path, Tight junction, Wnt signaling pathway miR-31 ATP2B2, DNM1L, EGR3, PPP1R9B, YWHAB **Calcium signaling pathway, Cell cycle miR-7 SLC23A2 miR-7b HRH3, NCDN, SLC23A2 **Neuroactive ligand receptor in b: miRNAs and their targets (from TargetScan and miRanda). [score:8]
We predict that several of the differentially regulated genes are miRNA targets and miR-21, miR-31, miR-128, miR-147 and miR-217 may be the important players in such interaction. [score:4]
[1 to 20 of 2 sentences]
7
[+] score: 12
While upregulated miR-147 was identified in activated macrophages after multiple TLRs' stimulation, its expression is probably capable of downregulating excessive inflammatory responses [48]. [score:9]
On the other hand, we identified 4 miRNAs (miR-99b, miR-135a, miR-147, and miR-214) that were downregulated in 24 h tDCs when compared to 24 h aDCs. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 11
The miR-147a -based positive feedback mechanism controlling the downregulation of the dominant -negative isoform of HIF-3 could also be an important part of this regulation. [score:5]
Moreover, miR-147a is hypoxia -induced and targets HIF-3, a dominant -negative regulator of HIF-1, and thus miR-147a in turn stabilizes and accumulates HIF-1 [133]. [score:4]
Recently, another very interesting example of a positive feedback loop indirectly controlling HIF-1 was proposed for miR-147a in human cervical cancer (HeLa) cells, where miR-147 reduced the levels of a dominant -negative isoform of HIF-3 [133]. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 10
There are upregulation of miR-155, miR-146, miR-132, miR-147, miR-9, miR-21, miR-223, miR-125b, miR-27b, let-7e and down-regulation of miR-125, let-7i, miR-98 following TLR4 stimulation [22, 23, 28– 35]. [score:7]
It has been showed the expression of miR-155, miR-146, miR-147, miR-9 increased through TLR2 -dependent induction [22, 23, 28]. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 10
Other miRNAs from this paper: hsa-mir-126, hsa-mir-147b
Interestingly, inhibition of miR-147 significantly increased cytokine expression after TLR stimulation [53]. [score:5]
Although miR-147 has been identified as an anti-inflammatory miR in macrophages, there is no information available regarding its target and function in human vascular endothelial cells. [score:3]
miR-147, the murine homologue of human miR-147b, was induced by different TLR agonists, especially TLR4 which is the major receptor for LPS, and acted as a negative regulator of LPS-elicited signaling events in murine macrophages. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 10
Other miRNAs from this paper: mmu-mir-147, hsa-mir-147b
Zhang and colleagues reported that miR-147 inhibited breast cancer migration and proliferation by targeting the Akt/mTOR pathway [12]. [score:5]
Although the above data indicated that miR-147 participates in tumorigenesis, however, the role of miR-147b was largely unexplored, here we report for the first time that miR-147b was dysregulated during HCC pathogenesis and positively regulated HCC tumor cell proliferation. [score:3]
As another member of the same cluster to miR-147b, miR-147 was reported to involved in several tumor progresses, Lee et al find that miR-147b induced MET and cell cycle arrest in both colon and lung cancer cells [10]. [score:1]
Low serum level of miR-147 is correlated with tumor metastasis, LNM, and tumor size [11]. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 9
However the paucity of SNPs around the miRNA and within the AA467197/ NMES1 gene (7 SNPs within 2 kb), where Mir147 resided, suggested that there may be no expression difference between 129 and B6. [score:3]
Mir147 is expressed in the spleen but not in normal colon and is involved with TLR4-stimulated macrophage production of TNFα and IL6 [49]. [score:2]
The regulation of miR-147B is distinct from Mir147 suggesting a different function in humans [50]. [score:2]
miR-147B is the human ortholog of Mir147. [score:1]
There were 2 validated miRNAs in the MGI databases that mapped within Gdac1; Mir674 [1a] (117 mbp) and Mir147 [111a] (122.4 mbp). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 8
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
After trimming, it was found that, except for gga-miR-147, 28 other differentially expressed miRNAs have 162 targeted genes, which were also differentially expressed in pulmonary arteries by the RNA-sequencing method. [score:7]
To validate the present results of miRNA-sequencing, miR-30E-3P, miR-187-3P, miR-1662, and miR-147 these four miRNAs were selected from all miRNAs identified in this study for qRT-PCR validation. [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 7
They identified 13 miRNAs that were differentially expressed in OSCC when compared to healthy controls and, among them, 11 miRNAs were down-regulated (miRNA-136, miRNA-147, miRNA-1250, miRNA-148a, miRNA-632, miRNA-646, miRNA-668, miRNA-877, miRNA-503, miRNA-220a, miRNA-323-5p), and two miRNAs were over-expressed (miRNA-24, miRNA-27b). [score:7]
[1 to 20 of 1 sentences]
15
[+] score: 7
Other miRNAs from this paper: mmu-mir-147, hsa-mir-147b
Importantly, the part of our candidate hairpin that aligned with miR-147 was within a 26 nt region predicted to contain a mature miRNA by our method. [score:1]
Mouse miR-147 had not been deposited in miRBase because it did not have a sufficiently good match to the mouse genome assembly. [score:1]
Further analysis of the candidate that only had BLAST hits in chicken revealed that it was highly similar to mouse miRNA miR-147 cloned by Lagos-Quintana et al. [9]: 19/21 bases from the clone match. [score:1]
Our novel human and mouse candidates are also similar to hsa-mir-147 (81% identity over 72 bases, although BLAST only found a 26-base HSP), but more similar to gga-mir-147-1/2 (87–89% identity over 70 bases). [score:1]
The chicken miRNAs gga-mir-147-1 and gga-mir-147-2, which have not been experimentally validated, were annotated based on similarity (76% identity over 72 bases) to hsa-mir-147. [score:1]
Experimental validation is required to show whether the mir-147 entries in miRBase, as well as our novel human and mouse candidates, represent true pre-miRNAs. [score:1]
This region was subsequently deposited in miRBase as hsa-mir-147 based on the evidence from the mouse clone. [score:1]
[1 to 20 of 7 sentences]
16
[+] score: 7
Similarly now, several miRs had been associated with various infections, and macrophage inflammatory response to infection involves the upregulation of numerous miRNAs, such as miR-155, miR-146, miR-147, miR-21, and miR-9. miR-155 upregulation indicate an active immune response involving activation of macrophages and proliferation and differentiation of T cell and B cell (Tsitsiou and Lindsay, 2009) post-infection conferring protection against the parasite. [score:7]
[1 to 20 of 1 sentences]
17
[+] score: 7
In contrast, the ViTa algorithm found that more of these miRNAs could potentially target the genome, adding bta-miR-205, bta-miR-26b, bta-let-7 g, bta-miR-34a, bta-miR-144, bta-miR-181b, and bta-miR-147 to the list. [score:3]
The non-clustered miRNAs included: let-7 g, bta-miR-26b, bta-miR-150, bta-miR-34a, bta-miR-146a, bta-miR-147, bta-miR-205, bta-miR-455-3p, bta-miR-1224, bta-miR-1281, and bta-miR-31. [score:1]
Nine of the miRNAs (bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, bta-miR-31, bta-miR-150, and bta-miR-147), have been ascribed immune modulatory functions (Fig.   6b, blue circle). [score:1]
The remaining 8 miRNAs are encoded within intronic regions: bta-miR-26b, bta-miR-455-3p, bta-miR-23b-5p, bta-let-7 g, bta-miR-22-5p, bta-miR-147, bta-miR-369-3p, and bta-miR-1224. [score:1]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 7
Predicted targets for miR-147 include a panel of potential candidates involved in angiogenesis-signaling as Mitogen-activated protein kinase 1 (MAPK1), GTPase NRas (NRAS), Rho GTPase-activating protein 1 (ARHGAP) as well as members of Protein kinase B (AKT) and Protein kinases C family (PRKCA, PRKCB, SDK1). [score:3]
As suggested by others miR-147 -family might overcome the cisplatin resistance -associated targets via VEGFA-signaling [81]. [score:3]
MiR-3073a-3p and miR-96-5p also showed an increase in the subG0/G1 population of drug-resistant A2780-cis almost comparable to the apoptosis rate caused by miR147-5p. [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 6
The TaqMan® microRNA assay (Applied Biosystems) was used to quantitate miR-24 and miR-221 expression in young and old participants and normalized to miR-147 expression. [score:4]
miRNAs were normalized to the average of three different miRNAs miR-147, miR-574-3p and miR-1469. [score:1]
For duplicate wells, a total of 100 ng of RNA was used for miR-24 and miR-147 and 200 ng of RNA for miR-221. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 6
Nevertheless, taking into account only those that were expressed the most upon induction (over 1/100 of average housekeeping genes), we identified miR-187, miR-155, miR-146a, let-7e, miR-29b, miR-34, miR-214, and miR-147 as being substantially upregulated following H. pylori infection. [score:6]
[1 to 20 of 1 sentences]
21
[+] score: 5
Profiling studies of PRRSV-infected porcine alveolar macrophages revealed altered expression of 40 miRNAs, including miR-30a-3p, miR-132, miR-27b*, miR-29b, miR-146a, and miR-9-2, of which miR-147 could be shown to inhibit virus replication (172). [score:5]
[1 to 20 of 1 sentences]
22
[+] score: 5
Other miRNAs from this paper: mmu-mir-147, hsa-mir-147b
IL-10 inhibits LPS -induced expression of miR-147 in murine macrophages. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
We found that compared to medium, moDCs stimulated with B0213 showed significantly increased expression of hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-147a, hsa-miR-155-5p, hsa-miR-503-3p, and hsa-miR-99b-5p and a decreased expression hsa-miR-222-3p (Fig.   3c). [score:4]
[1 to 20 of 1 sentences]
24
[+] score: 4
In association to miR-124 and miR-147, miR-193a-3p has been shown to coregulate and inhibit G1/S transition and proliferation in breast cancer and glioblastoma cell lines [26]. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
MiR-155-5p, miR-142-5p, miR-142-3p, miR-132-3p and miR-147-3p amongst others were up-regulated during Cm infection of the murine cervix in response to an attenuated strain of Cm, relative to a virulent strain of Cm [16]. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 4
Let-7a and miR-147 are directly induced upon LPS stimulation due to NF κB binding sites in their promoter regions, which induces the expression of proinflammatory cytokines including TNF- α and IL-6 [29, 75]. [score:4]
[1 to 20 of 1 sentences]
27
[+] score: 3
Candidates for this approach are those miRNAs that are overexpressed during TB infection, including let-7e, miR-29a, miR-886-5p, miR-147, or miR-3179. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
Finally, specific miRNAs (miR-155, miR-21, miR-146a, miR-132, miR-9, and miR-147) target ILR and TLR signaling proteins (21– 23). [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
MiR-21 and miR-147, which are induced later, are involved in the activation of the inflammatory response, inhibiting the synthesis of miR-155 and proinflammatory cytokines [22]. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 2
There could potentially also be a microRNA and a lincRNA gene in the region since the human MIR147A and LINC01613 overlap gaps in the dog genome assembly (CanFam 2.0 and CanFam 3.1). [score:1]
The top haplotype spans a region containing CDK5RAP2, MEGF9 and potentially also MIR147A and LINC01613. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 2
Mmu-miR-147, a functional homologue of human miR-147b, is induced by multiple toll-like-receptor (TLR) signals and negatively regulates inflammation in murine macrophages [26]. [score:2]
[1 to 20 of 1 sentences]
33
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
With regard to coronary artery disease (CAD), in the peripheral blood mononuclear cell (PBMC) of patients with stable and unstable angina pectoris, miR-147 was reportedly decreased 4-fold when compared to a control group. [score:2]
[1 to 20 of 1 sentences]
34
[+] score: 2
-26.6 K-RAS 4946 hsa-miR-147. [score:1]
-23.4 K-RAS 3137 hsa-miR-147. [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 2
The induction of members of the miR-21, miR-29, and miR-146 families was in line with earlier microarray studies, which reported these along with some other miRNAs, like miR-9, miR-132, miR-147, and miR-155 as infection-inducible [13, 26, 43, 44]. [score:1]
For instance, lipopolysaccharide (LPS) stimulation of TLR4 and downstream NFκB activity induced miR-146, miR-147, and miR-155 [11- 13]. [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 1
Particularly interesting were miR-124 and miR-9, that showed the highest hStau1 vs TAP ratio, using as a control miR-147a, that was not present among those detected in the initial screening (Fig. 3C). [score:1]
[1 to 20 of 1 sentences]
37
[+] score: 1
MiR-147, was induced upon stimulation of multiple TLRs and functioned as a negative regulator of TLR -associated signaling events in murine macrophages [57]. [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
Surprisingly most of the 23 novel miRs were found to be associated with several cancer pathways such as Pancreatic Cancer (hsa-miR-200c [41], hsa-miR-141 [42]), Lung Cancer (hsa-miR-200c [43], hsa-miR-143 [44]), Colorectal Cancer (hsa-miR-200c [45], hsa-miR-338-3p [46]), Bladder Cancer (hsa-miR-200b, hsa-miR-200a, hsa-miR-141, hsa-miR-17, hsa-miR-27b) [47]- [49], Breast Cancer (hsa-miR-200b [50], hsa-miR-147 [51]), Esophageal Cancer (hsa-miR-200a, hsa-miR-141, hsa-miR-143, hsa-miR-15a) [52], [53], Prostate Cancer (hsa-miR-19a) [54], Oral Carcinoma (hsa-148b) [55], Cervical Cancer (hsa-miR-15a) [56], Gastric Cancer (hsa-miR-192) [57] etc. [score:1]
[1 to 20 of 1 sentences]
39
[+] score: 1
Other miRNAs from this paper: hsa-let-7e, hsa-mir-187, hsa-mir-125a, hsa-mir-99b, hsa-mir-147b
When applying SVM classifier on the set TE-C, 28 out of the 30 human pre-miRNAs are correctly recognized (the missed ones are "hsa-mir-147" and " hsa-mir-187") and 881 out of the 1000 pseudo-miRNAs are detected as negative, which gives a sensitivity of 93.3% and specificity of 88.1% (Table 1). [score:1]
[1 to 20 of 1 sentences]
40
[+] score: 1
These include let-7, miR-9, miR-21, miR-125, miR-146a, miR-147, and miR-155. [score:1]
[1 to 20 of 1 sentences]
41
[+] score: 1
These TLRs participate in macrophage activation and have been shown to induce miR-155, miR-146, miR-147, miR-9, and miR-21 (79, 80). [score:1]
[1 to 20 of 1 sentences]
42
[+] score: 1
Figures Array data was validated by by qRT-PCR for 10 miRNAs (mir-1, miR-10b, miR-135b, miR-147, miR-31, miR-33, miR-503, miR-552, miR-592, miR-622). [score:1]
[1 to 20 of 1 sentences]