sort by

141 publications mentioning mmu-mir-24-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-24-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 338
Other miRNAs from this paper: mmu-mir-24-2
Alternatively, miR-24 could downregulate Bim expression level to counteract the CHOP induced Bim upregulation. [score:9]
To determine that the regulation of miR-24 on Caspase expression is indeed through binding of its seed sequence to downstream targets, we designed additional controls where the seed sequence of miR-24 mimic and inhibitor were mutated. [score:8]
However, since a number of pro- or anti-apoptotic genes appeared not to be affected by miR-24 overexpression or inhibition (Figure S2, Fig. 4, and data not shown), it is likely that miR-24 represses cell death in diseased hearts through a distinct mechanism that is not part of the canonical apoptosis pathways. [score:7]
Indeed, when we transfected cells with miR-24 [mut] mimic and inhibitor, the alteration in proteins levels of Caspase12 and Bim with miR-24 mimic or inhibitor was diminished suggesting the effects caused by miR-24 mimic and inhibitor are specific (Fig. 2C). [score:7]
These data suggest that the inhibition of Caspase 12 protein levels by miR-24 is indirect, possibly through Bim or other direct target(s) in this pathway. [score:7]
miR-24 mimic (5′-UGGCUCAGUUCAGCAGGAACAG-3′), mimic control (5′-UUCUCCGAACGUGUCACGUTT-3′), miR24 [mut] mimic (5′-UGGCUCAGUUCAG UA AGAAC CG-3′), miR-24 inhibitor (5′-ACCGAGUCAAGUCGUCCUUGUC-3′), inhibitor control (5′-UCUACUCUUUCUAGGAGGUUGUGA-3′) and miR24 [mut] inhibitor (5′-ACCGAGUCAAGUC AU UCUUG GC-3′) were purchased from Dharmacon and Shanghai GenePharma Co. [score:7]
To confirm the observation we made using Fas and Camptothecin and further dissect the apoptotic pathways involving miR-24, we treated the miR-24 inhibitor (tested and validated in [35]) transfected cardiomyocytes with a series of Caspase inhibitors and assessed the degree of apoptosis inhibition. [score:7]
To test whether miR-24 regulates XBP1 splicing, we determined the expression of both forms of XBP1 in cells with miR-24 overexpression or knocking-down. [score:7]
In addition to its role in regulating apoptosis, miR-24 also functions in the excitation-contraction (E-C) coupling process by targeting the structural protein Junctophilin-2 expression in the cardiomyocytes. [score:6]
As an alternative method, we utilized the siRNA SmartPool (see method, a siRNA cocktail containing 3∼5 different siRNA sequences against one gene to minimize the off-target effect) to knock-down the Caspase genes individually to examine the effect on induced apoptosis by miR-24 inhibition. [score:6]
Consistent with the Fas data, inhibition of Caspase 8 using Z-IETD-FMK did not alleviate the increased apoptosis induced by miR-24 inhibition. [score:5]
This is consistent with our previous “over-rescue” observation that knocking down of Bim attenuated increased apoptosis caused by miR-24 inhibition to a level that is even lower than the basal level with control transfection [35], suggesting Bim has its independent role in regulating intrinsic apoptosis that is not controlled by miR-24. [score:5]
These data suggest that expression of miR-24 inhibited camptothecin -induced intrinsic apoptosis but not Fas -induced extrinsic apoptosis. [score:5]
miR-24 inhibits CHOP -induced Bim overexpression in ER mediated apoptosis pathway. [score:5]
First, we determined if altered expression of miR-24 affected the transcription and translation of ATF6 by qPCR and western blot. [score:5]
We rationalize that if the alteration in protein levels is indeed due to the changes of miR-24 activity, the effects we observed using miR-24 mimic or inhibitor would be abolished when using mutated forms of mimic or inhibitor. [score:5]
Transfection of cells with miR-24 mimic or inhibitor resulted in no significant change in the distribution of cytoplasmic versus nuclear level of ATF6, so do the miR24 [mut] mimic and inhibitor (Figure S2B). [score:5]
0085389.g004 Figure 4(A) Overexpression of miR-24 suppresses cytochrome C release from mitochondria to cytosol. [score:5]
Inhibiting all Caspases by Z-VAD-FMK completely rescued the apoptotic effects caused by miR-24 inhibition. [score:5]
Relative luciferase activity (RLA) in primary cardiomyoyctes expressing the luciferase reporter with Caspase 12 3′UTR and miR-24 mimic, inhibitor, and corresponding controls. [score:5]
We found overexpression or inhibition of miR-24 did not affect ATF6 mRNA or protein level (Figure S2A). [score:5]
We found that neither overexpression nor inhibition of miR-24 resulted in changes in mRNA level of Bax (Fig. 4B). [score:5]
Interestingly, inhibiting Caspase 9 or Caspase 12, both of which are involved in the intrinsic apoptosis, significantly decreased the percentage of apoptotic cells induced by miR-24 inhibition (Fig. 1C). [score:5]
To determine whether miR-24 regulates the mitochondrial apoptosis pathway, we first assessed the Cytochrome C release from mitochondria in primary Campothecin -treated cardiomyocytes transfected with miR-24 mimic, inhibitor, or controls. [score:4]
miR-24 is up-regulated upon cardiac stress in animal mo dels and in humans [41] and may be mediating a compensatory response under cardiac stress. [score:4]
Since increased Bim protein levels appeared to be a major mediator of apoptosis upon miR-24 inhibition in other cell types [35], [40], we tested whether CHOP could regulate Bim in murine cardiomyocytes. [score:4]
Compared to mock transfection, miR-24 expression significantly inhibited tunicamycin or thapsigargin induced apoptosis (Fig. 2A and B). [score:4]
Knocking-down Caspase 9 or Caspase 12, but not Caspase 8, resulted in a partial rescue of increased apoptosis caused by miR-24 inhibitor. [score:4]
We demonstrated that miR-24 level is acutely down-regulated upon cardiac injury, in vivo delivery of miR-24 confers protective effects in infarcted heart [35]. [score:4]
Meanwhile, knocking-down the final “executor Caspase” -Caspase 3 completely reversed the increased apoptosis by miR-24 inhibition (Fig. 1D). [score:4]
Our findings that miR-24 modulates intrinsic apoptosis in murine primary cardiomyocytes might open a new window for gaining additional insights into the role of miRNAs in regulating stress-related heart diseases. [score:4]
Figure S1 Caspase 12 is not a direct target of miR-24. [score:4]
Knocking down of ATF6, XBP1, CHOP, JNK and caspases had little effect on miR-24 expression, suggesting that miR-24 does not function downstream of these pathways (Fig 3B). [score:4]
miR-24 regulates mitochondrial apoptosis pathway by inhibiting Bax translocation from cytosol to mitochondria. [score:4]
However, we observed that knockdown of CHOP but not any other gene we tested above attenuated the increased apoptosis induced by miR-24 inhibitor (Fig. 3C). [score:4]
Anti-apoptotic effect of miR-24 overexpression is associated with decreased CHOP activity in the ER pathway. [score:3]
In contrast, manipulation of miR-24 resulted in limited changes in mRNA, protein expression levels and cellular localization of other Bcl-2 family members such as Bcl-2, indicating that Bcl-2 does not function in miR-24 mediated apoptosis (Fig4 E, F and data not shown). [score:3]
We therefore examined the expression levels and cellular localization of several key Bcl2 family members including Bcl2, Bax, Bak1 and Bclx in the cardiomyocytes with loss or gain of function of miR-24. [score:3]
Taken together, these findings reveal a function of miR-24 in repressing the mitochondrial apoptosis pathway by inhibiting Bax translocation to the mitochondria. [score:3]
In contrast, there was an increase in mitochondrial Bax upon miR-24 inhibition (Fig. 4C). [score:3]
Given the critical anti-apoptotic role of miR-24 in the ischemic heart, it is important to determine the mechanisms by which miR-24 inhibits apoptosis in cardiomyocytes. [score:3]
While in other cell types including endothelial cells, miR-24 has been shown to target anti-apoptotic genes to promote cell death. [score:3]
The induction of miR-24 level was confirmed and the specificity of the mimic/inhibitor was validated using luciferase sensor experiment as documented before [35]. [score:3]
To test whether miR-24 could attenuate ER stress -induced apoptosis, we expressed miR-24 in cardiomyocytes treated with tunicamycin or thapsigargin. [score:3]
Conversely, inhibition of miR-24 resulted in increased accumulation of Cytochrome C in the cytosol (Fig. 4A right panel). [score:3]
In order to test whether miR-24 modulates Bax translocation in the mitochondria -mediated apoptosis pathway, we separated the cytosolic and mitochondrial fraction of the primary cardiomyocytes and determined the protein levels in the corresponding fraction with altered expression of miR-24. [score:3]
Overexpression of miR-24 in the rat primary cardiomyocytes resulted in defective E-C coupling. [score:3]
We found that there appeared to be less Bax in the mitochondrial fraction upon miR-24 expression in primary cardiomyocytes. [score:3]
In contrary, accumulation of both forms of Caspase 12 was observed when miR-24 inhibitor was introduced into the cells. [score:3]
C in cytosol (C) or mitochondria (M) fractions of primary cardiomyocytes transfected with miR-24 mimic, inhibitor, or corresponding controls. [score:3]
Manipulation of miR-24 levels in cardiomyocytes did not alter mRNA or protein levels of CHOP or JNK or the phosphrolation of JNK (Figure S2D, E), suggesting CHOP and JNK are not directly regulated by miR-24. [score:3]
In addition, manipulating the expression level of miR-24 and/or its downstream effectors in injured/failing heart may lead to intervention of novel therapeutic strategies. [score:3]
Mouse cardiomyocytes with or without overexpression of miR-24 were cultured with thapsigargin or tunicamycin for six hours. [score:3]
We showed that miR-24 modulated intrinsic apoptosis by interacting with CHOP -mediated ER pathways and by inhibiting cytochrome C release, and Bax translocation from cytosol to mitochondria. [score:3]
These studies, in addition to ours, further confirm the endogenous expression of miR-24 in cardiomyocyte. [score:3]
Strikingly, we found reduced translocation of Cytochrome C from the mitochondria to the cytosol, the key event in mitochondria -mediated apoptosis, when miR-24 was overexpressed in cardiomyocytes (Fig. 4A left panel). [score:3]
By performing western blot, we found protein levels of both non-cleaved and cleaved forms of Caspase 12 were reduced when miR-24 was overexpressed (Fig. 2C). [score:3]
We detected no difference in either spliced form or unspliced form of XBP1 when miR-24 expression was altered (Figure S2C). [score:3]
Here we studied the molecular mechanisms by which miR-24 inhibits apoptosis in murine primary cardiomyocytes. [score:3]
Interestingly, overexpression of miR-24 in primary cardiomyocytes was able to induce hypertrophic growth [41]. [score:3]
In certain cell types, such as cardiomyocyte, neural retina and hematopoietic cells, miR-24 is believed to repress apoptosis by inhibiting various pro-apoptotic proteins. [score:3]
In this study, we demonstrated that Bim and its interacting partners, such as CHOP and Bax, are the major downstream mediators of miR-24 in inhibiting cardiomyocyte apoptosis. [score:3]
In a separate study, inhibition of miR-24 was found to be protective on the structural and functional integrity of the ion channel signaling in the hypertrophic aortic-constricted hearts. [score:3]
Therefore, we tested whether miR-24 had impact on the Caspase-12 expression level and processing. [score:3]
In the heart, miR-24 is also expressed in endothelial cells and cardiac fibroblasts. [score:3]
miR-24 inhibits the intrinsic apoptosis pathway. [score:3]
We first examined if manipulation of miR-24 would affect the transcription and translation of Bax. [score:3]
Co-transfection of miR-24 mimic or inhibitor with the luciferase reporter that contains the 3′UTR region of Caspase 12 did not result in a significant change in the luciferase activity when compared to the controls (Figure S1). [score:2]
We have not identified direct binding sites of miR-24 in the UTRs of these genes, thus additional targets of miR-24 might be involved in mediating its effects on Cytochrome C and Bax protein translocation that awaits further characterization. [score:2]
Our findings suggest that miR-24 regulation of intrinsic apoptosis pathways might contribute to its ability to modulate apoptosis and possibly hypertrophic growth. [score:2]
We and others have previously shown that miR-24 negatively regulates apoptosis in several different cell types including cardiomyocytes both in vitro and in vivo. [score:2]
Therefore, when it comes to target miR-24 for therapeutic interventions, the cell type specific context has to be considered. [score:2]
Especially, we and others showed that miR-24 negatively regulates apoptosis in frogs and mice [33], [35]. [score:2]
Based on the data above, we conclude that miR-24 is involved in regulating ER -mediated apoptosis in cardiomyocytes. [score:2]
Knocking-down of Bim resulted in an increase in the amount of cytosolic Bax compared to mitochondrial Bax (Fig. 4D), suggesting that miR-24 regulates Bax translocation in part through Bim. [score:2]
miR-24 is one of the microRNAs that functions in multiple biological processes, including erythroid differentiation, DNA-repair process, cell cycle regulation and programmed cell death [29], [30], [31], [32], [33], [34]. [score:2]
Figure S2 miR-24 does not regulate ATF6, XBP1, CHOP and JNK in ER -mediated apoptosis pathway. [score:2]
During myocardial infarction, miR-24 regulates both vascularity and cardiac fibrosis. [score:2]
Thus, miR-24 may negatively regulate ER stress -mediated apoptosis in part by preventing the increase in Bim protein associated with CHOP activity. [score:2]
Here, we carefully examined the molecular/genetic pathways by which miR-24 regulates programmed cell death in primary cardiomycoytes. [score:2]
Furthermore, we performed luciferase assay to test if miR-24 directly regulates Caspase 12 through binding to its 3′UTR. [score:2]
In addition, it is still unclear how miR-24 and CHOP exert opposite effects on Bim protein level, and how miR-24 regulates the release of Cytochrome C and the translocation of Bax from cytosol to mitochondria. [score:2]
It is very interesting to note that the role of miR-24 in regulating apoptosis is context -dependent. [score:2]
Therefore, these data collectively suggest that miR-24 regulates intrinsic but not extrinsic apoptosis. [score:2]
miR-24 regulates mitochondria -mediated apoptosis pathway. [score:2]
In order to determine whether miR-24 exerts its effects on ER pathway by regulating UPR, we examined several key events in UPR in the presence and absence of miR-24. [score:2]
However the molecular pathway involving miR-24 is largely unknown. [score:1]
, Camptothecin (B) Quantification on AnnexinV [+]PI [–] cells treated with Fas or Camp with or without miR-24 mimic. [score:1]
After we determined the role of miR-24 in ER -mediated apoptosis, we next assessed its potential role in mitochondria -mediated apoptosis. [score:1]
Next, we examined how upstream factors in this pathway were affected by miR-24. [score:1]
However, how one function of miR-24 is executed in a fine manner without interfering with its other function is intriguing. [score:1]
Subsequently, we delivered miR-24 mimic using our established protocol and optimized dosage [35]. [score:1]
We then designed epistasis experiments to test the role of CHOP, JNK, ATF6 and XBP1 in miR-24 mediated apoptosis. [score:1]
Next we determined if miR-24 modulates the translocation of ATF6 from the cytosol to nucleus, as the nuclear localization of ATF6 is pre-requisite for the activation of downstream events. [score:1]
As with ATF6 and XBP1, we took similar approaches to determine if miR-24 is involved in these critical events. [score:1]
To determine in which apoptotic pathway miR-24 functions, we treated the cardiomyocytes with CD95/Fas or Campothecin to induce apoptosis by activating the extrinsic or intrinsic pathway, respectively. [score:1]
By performing a series of epistasis analyses, we found that miR-24 modulated intrinsic apoptotic pathway including both ER and mitochondria-involved apoptosis. [score:1]
Next, we want to identify the specific pathway(s) in ER -mediated apoptosis that involves miR-24. [score:1]
We found that introduction of miR-24 significantly attenuated the increased percentage of AnnexinV+PI- early apoptotic cells induced by camptothecin (18% to 12%, p<0.05), but not by Fas (18% to 17%, p>0.05) (Fig. 1A and B). [score:1]
Thus, this combinatorial effect of miR-24 in different cardiac cell types of the infarcted heart could contribute to the significant cardiac functional improvement upon introduction of miR-24 by either in vivo transfection or virus transduction. [score:1]
0085389.g001 Figure 1(A) FACS analysis on AnnexinV [+]PI [–] - apoptotic cells treated with Camp with (middle panel) or without miR-24 mimic (right panel). [score:1]
miR-24 modulates ER -mediated apoptosis pathway. [score:1]
0085389.g002 Figure 2(A) miR-24 attenuates thapsigargin and tunicamycin induced cell death through ER -mediated apoptosis pathway. [score:1]
miR-24 functions in the intrinsic apoptosis pathway. [score:1]
Interestingly, the increase in cytosolic accumulation of Bax is more pronounced with knocking-down of Bim compared to that of miR-24 mimic treatment. [score:1]
miR-24 modulates ER -mediated intrinsic apoptosis. [score:1]
[1 to 20 of 106 sentences]
2
[+] score: 304
ShRNA antagonist of miR-24 (miArrest miRNA inhibitor) or scrambled non -targeting shRNA was expressed in a lentiviral vector co -expressing mCherry and puromycin resistance (GeneCopoeia, Rockville, MD). [score:9]
Expression of MiR-24 target Trib3 inhibits hematopoietic development of ESCs. [score:7]
The distinct temporal effects of Smad1 on hematopoiesis are similar to what we observe with miR-24, which will inhibit hematopoiesis when expressed at the beginning of ESC differentiation, but increases hematopoiesis when expressed at d3 of differentiation. [score:7]
Identification of other targets of miR-24 that may be upregulated in EBs to block hematopoiesis is also critical. [score:6]
To test whether this overexpression of Trib3 contributes to the block in hematopoietic development observed in miR-24 KD EBs, we expressed Trib3 in wildtype ESCs at the onset of differentiation, and assayed HPC development 6d later. [score:6]
The inhibition of hematopoiesis is not as dramatic as what is observed with the antagonism of miR-24, however it suggests that Trib3 downregulation contributes to miR-24’s ability to promote early hematopoiesis. [score:6]
Expression of miR-24 target Trib3 impairs hematopoietic development of ESCs. [score:6]
Expression of a mature miR-142, but not miR-24 was able to rescue hemangioblast development in Dgcr1 knockdown embryos, however miR-142 was unable to rescue hemogenic endothelium development. [score:6]
To determine if miR-24 is required for the development of myeloid cells, we infected mouse ESCs with a lentivirus expressing an shRNA that binds and inhibits miR-24 (miArrest-24, Genecopoeia, Rockville, MD). [score:6]
Trib3 modulates BMP/ Smad signaling through inhibition of the E3 ubiquitin ligase Smurf1 [32], that negatively regulates Smad1 and Smad 5. MiR-24 targeting of Trib3 potentially links it to known pathways regulating embryonic hematopoiesis [33– 36]. [score:6]
We did not observe a significant effect of miR-24 knockdown on Tbx6 expression, though expression was variable within control and 24 KD clones. [score:6]
Trib3 is expressed highest in the non-mesoderm fraction, whereas miR-24 is more highly expressed in the T+ mesoderm fractions. [score:5]
A) Expression of miR-24 in undifferentiated RW4 clones infected with MiArrest-Scr (scrambled shRNA) or miArrest-24 (shRNA antagonizing miR-24) B) Average miR-24 expression in miArrest-Scr, and miArrest-24 infected ESC clones at the indicated days of differentiation (Removal of LIF). [score:5]
To support the conclusion that the hematopoietic defect is due specifically to knockdown of miR-24, we also generated miR-24 knockdown ESCs with an independent shRNA expressing lentiviral vector (miRZIP, Systems Biosciences, Mountain View, CA). [score:5]
Expression level of miR-24 was normalized to sno202 snRNA expression. [score:5]
S1 Fig A) Expression of miR-24 in undifferentiated RW4 clones infected with MiArrest-Scr (scrambled shRNA) or miArrest-24 (shRNA antagonizing miR-24) B) Average miR-24 expression in miArrest-Scr, and miArrest-24 infected ESC clones at the indicated days of differentiation (Removal of LIF). [score:5]
To determine if miR-24 targeting of Trib3 plays a role in the early hematopoiesis, we examined expression of Trib3 in d4 miR-24 KD EBs. [score:5]
Using two different lentiviral vectors delivering distinct shRNAs targeting miR-24, we observed that miR-24 is required for hematopoietic development from ESCs. [score:4]
When ESC lines were differentiated, we observed that, in contrast to wildtype and scrambled control shRNA expressing ESCs (Fig. 1A); the miR-24 knockdown clones did not generate EBs with hemoglobinized cells (Fig. 1B). [score:4]
Manipulating miR-24 or its downstream targets potentially could be used for directing the differentiation of nascent mesoderm produced from pluripotent stem cells. [score:4]
MiR-24 knockdown did not affect the expression of clustered miRNAs, miRs-23a and 27a (S1C Fig. ). [score:4]
Expression of the gene encoding miR-24–2 enhances hematopoietic development in EBs. [score:4]
Consistent with the EB results (Figs. 1C, 2B, 2C), there is a dramatic decrease in the expression of Gata1, Runx1, and Scl in the miR-24 KD BL-CFCs compared to control scrambled shRNA expressing clones (Fig. 6D). [score:4]
Expression of the gene encoding pre-miR-24–2 enhances hematopoietic development of d3 EB derived cells. [score:4]
To our surprise, hematopoiesis was dramatically inhibited in miR-24 knockdown (KD) EBs. [score:4]
The absence of hemoglobinized cells and greatly reduced expression of hematopoietic transcription factors Sfpi1 and Gata1 indicate that blood development is greatly impaired in EBs generated from miR-24 KD ESCs. [score:4]
To determine if miR-24 is required for proper monocyte and granulocyte development, we antagonized miR-24 in murine embryonic stem cells (ESCs) by infecting them with a lentivirus encoding an shRNA targeting miR-24. [score:4]
In addition, we interrogated Trib3 as a critical target for miR-24 to repress during the development of HPCs. [score:4]
Increased Trib3 in miR-24 KD ESCs may disrupt BMP signaling inhibiting development of HPCs. [score:4]
S3 Fig A) MiR-24 expression in undifferentiated miRZIP-miR-24 shRNA ESC clones (24–6, 24–7) compared to ESC clone (SCR-2) infected with miRZIP vector coding for a scrambled non -targeting shRNA. [score:4]
Previously, we demonstrated that enforced expression of miR-24 in hematopoietic progenitors promoted myeloid (monocytes and granulocytes) development [3]. [score:4]
Expression of endothelial genes Pecam1, and Cdh5 was unaffected in miR-24 KD BL-CFC suggesting a potential defect in the development of hemogenic endothelium from the BL-CFC, or a defect in the ability of hemogenic endothelium to produce HPCs. [score:4]
Previously; Trib3 was identified as a direct miR-24 target in vascular smooth muscle cells [31]. [score:4]
Mef2c expression does appear to be decreased if we just compare the miR-24 KD clones to the scrambled control clone. [score:3]
We recently identified miR-24 as a miRNA that regulates the development of adult hematopoietic progenitor cells [3]. [score:3]
However decreased expression of Twist1 in miR-24 KD EBs suggests that there is a reduction in lateral plate mesoderm. [score:3]
A similar defect in blood production in EBs was observed using this alternative method of targeting miR-24 (S3A, S3B Figs. ). [score:3]
1004959.g001 Fig 1ESC clones were generated from RW4 cells infected with either miArrest-24 (ShRNA targeting miR-24) or miArrest-SCR (Scrambled shRNA) lentivirus. [score:3]
However endothelial genes Cdh5 (Ve-Cadherin), and Pecam1 were expressed similarly between control and miR-24 KD cultures. [score:3]
Decreased expression of miR-24 may underestimate the reduction in miR-24 as we may detect miR-24 bound inactive to the shRNA. [score:3]
The mature miR-24 miRNAs (miRs-24–1, -24–2) produced from both clusters are identical in sequence whereas the mature miRs-23a/b and-27a/b differ by one nucleotide at the 3 prime ends (outside of the seed sequence which is responsible for target selection). [score:3]
A similar defect in HPC production was observed from ESCs with miR-24 targeted by the miRZIP lentiviral vector (S3C Fig. ). [score:3]
No significant differences (P>0.05) in the expression of these genes were observed when comparing the average values obtained from scrambled and miR-24 KD clones (Fig. 3A). [score:3]
Initially Pecam1 expression was decreased between miR-24 KD and control EBs at d4 (P<0.0002) (Fig. 4C). [score:3]
To determine if increased Trib3 contributes to the phenotype we retrovirally transduced differentiating wildtype ESCs with Trib3 retrovirus to mimic the overexpression seen in miR-24 KD ESCs cells. [score:3]
Consistent with it being a miR-24 target in EBs, Trib3 levels increase in d4 miR-24 KD EBs. [score:3]
The miR-24 shRNA clones had reduced expression of miR-24 that persisted for at least 6 days of EB differentiation as determined by quantitative reverse transcriptase PCR (Q-RT-PCR) (S1A, B Fig. ). [score:3]
Additionally Trib3 expression goes down with mesoderm commitment in wildtype EBs, as miR-24 levels go up. [score:3]
Trib3 is a validated target of miR-24 in vascular smooth muscle cells [31]. [score:3]
Endothelial cell development impaired in miR-24 knockdown embryoid bodies. [score:3]
Expression of transcription factors required for HPC production downstream of the hemangioblast, Scl, and Runx1, is greatly reduced by antagonizing miR-24. [score:3]
There was no difference in the production of BL-CFCs from scrambled and miR-24 shRNA expressing clones at d2.75 (Fig. 6A). [score:3]
For supplementary experiments miR-ZIP vectors to deliver an independent miR-24 targeting shRNA and scrambled shRNA were used (System Biosciences, Mountain View, CA). [score:3]
Consistent with this result, we observed significantly decreased expression of the transcription factors Scl and Runx1 between wildtype/ scrambled controls and miR-24 KD clones in d4 EBs with respective P values of less than 0.007, and 0.002, as well as at d6 with P values of less than 0.003, and 0.008 (Fig. 2B, C). [score:3]
ESC clones were generated from RW4 cells infected with either miArrest-24 (ShRNA targeting miR-24) or miArrest-SCR (Scrambled shRNA) lentivirus. [score:3]
The mirn23a gene codes for three miRNAs, miR-23a, miR-27a, and miR-24–2, which is expressed as a pri-miRNA from its own independent transcription unit. [score:3]
To determine if the BL-CFC colonies were identical between controls and miR-24 KD cultures, we examined gene expression in the BL-CFC colonies. [score:3]
No significant differences were observed in gene expression comparing scrambled shRNA clones to miR-24 shRNA clones. [score:3]
MiArrest-24 shRNA infection decreases the expression of miR-24 miRNA. [score:3]
MiR-24 was previously shown to target Trib3 in vascular smooth muscle cells [31]. [score:2]
MiR-24 antagonism did lead to a significant decrease in Twist expression at both d3 (P<0.002) and d4 (P< 10 [-8])(Fig. 3B). [score:2]
In the development of class 3 and 4 sprouts, we saw large variability between the two miR-24 KD clones examined (Fig. 4A). [score:2]
revealed that miR-24 is required early in development as we observed a reduction in the number of CD41+ HPCs developing within EBs when miR-24 is antagonized. [score:2]
These results identify miR-24, as a mammalian miRNA required for the development of blood from newly formed mesoderm. [score:2]
This suggested that blood was not being made and this was confirmed by a dramatic reduction in the expression of hematopoietic transcription factors Gata1 (P<0.0005) and Sfpi1 (P<0.0008) in miR-24 KD d6 EBs compared to wildtype and scrambled control derived EBs (Fig. 1C). [score:2]
In this report we examine the requirement for miR-24 in blood development from ESCs. [score:2]
Additionally, Trib3 has the opposite expression pattern in d4 fractionated EBs compared to miR-24(Fig. 8B). [score:2]
MiR-24 decreased in the T [+] (GFP [+])/Flk1 [+] cells, the least expression was observed in the double negative fraction. [score:2]
Our work with ESCs demonstrates a specific requirement for the miRNA, miR-24, in the development of hematopoietic progenitors cells (HPCs). [score:2]
We also assayed expression of cardiac muscle genes Nkx2.5, and Mef2c between control EBs (wildtype and Scrambled) and miR-24 KD clones. [score:2]
The phenotype we observed from miR-24 KD ESCs cells suggest an early requirement for miR-24 in embryonic hematopoiesis, potentially in the development or function of the hemangioblast. [score:2]
We observed that miR-24 was necessary for blood development [3]. [score:2]
These results appear consistent with what we have observed that miR-24 is not required for hemangioblast development, but is needed for subsequent hematopoietic differentiation. [score:2]
Consistent with Trib3 being a miR-24 target we observed a 2 to 3 fold increase in Trib3 mRNA in miR-24 KD EBs compared to controls (Fig. 8A, P<0.00002). [score:2]
For miR-24 knockdown studies, RW4 ESCs were plated at 100,000 cells per well of a 6 well plate 24h pre-infection. [score:2]
On average we observed less than 1 hematopoietic colony generated from 50 miR-24 knockdown EBs (S2 Fig. ). [score:2]
Forty d6 miR24 KD EBs and control-scrambled shRNA EBs were plated onto collagen-coated plates in media containing angiogenic cytokines. [score:1]
Representative image of sprouting from control and miR-24 KD EBs. [score:1]
MiR-24 is not required in EBs for cardiac muscle development. [score:1]
Data was averaged from results obtained from the differentiation of 3 scrambled clones, and 3 mir-24 KD clones. [score:1]
We performeds with parental RW4 cells, scrambled shRNA clones and miR-24 shRNA clones. [score:1]
However there was a slight decrease in the generation of class 4 sprouts between miR-24 KD and control ESC clones, which was statistically significant (P<0.002). [score:1]
MiR-24 is the first miRNA to be involved in this early step of differentiation of mammalian mesoderm to tissue that will give rise to HPCs. [score:1]
Q-RT-PCR was performed with RNA extracted from the isolated fractions to examine the relative levels of mature mirn23a/ mirn23b miRNAs: miR-24, mir-23a, miR23b, miR-27a, and miR-27b (Fig. 7B, 7C). [score:1]
The decrease in class 4 sprouts observed in miR-24 knockdown clones, 24–1, and 24–6B compared to RW4, and SCR shRNA control clones is significant with a P value <0.002. [score:1]
To determine if this requirement was early or late in embryonic hematopoiesis, we performed flow cytometry on cells derived from d6 EBs to determine if HPCs were being made in the absence of miR-24. [score:1]
To examine if early germ layer tissue was being formed from miR-24 KD ESCs, 2 scrambled control, and 2 miR-24 KD clones were differentiated and RNA harvested at d3 and d4. [score:1]
However the number of BL-CFCs obtained from the miR-24 KD cells was lower than the numbers observed with wildtype cells. [score:1]
However, since we see a dramatic impairment in HPC production, but little or no impairment of other mesoderm derived tissue the data demonstrates that miR-24 is not needed generally for differentiation. [score:1]
By flow cytometry, we did not observe a defect in mesoderm production, as lateral plate (FLK1+PDGFRα-) and paraxial mesoderm (FLK1-PDGFRα+) were observed in miR-24 KD EBs (Fig. 3C). [score:1]
MiR-24 is produced from two distinct mammalian genes mirn23a, and mirn23b. [score:1]
Absence of miR-24 does not result in a general differentiation defect. [score:1]
There were almost no HPCs derived from miR-24 KD clones (Figs. 2A, S4). [score:1]
The defect in hematopoiesis is not due to a general inability of the miR-24 ESCs to differentiate. [score:1]
Additionally, we observed that miR-24 is necessary and sufficient to generate this phenotype. [score:1]
Interestingly in their analysis miR-24 was enriched in the AGM HPCs, and was the third top ranked miRNA gene in the ChIP-seq analysis. [score:1]
Antagonizing miR-24 is ESCs with a distinct shRNA delivered by miRZIP vectors results in a hematopoietic defect. [score:1]
Data is average colony numbers obtained from 4 independent scrambled shRNA clones, and 3 miR-24 shRNA clones. [score:1]
Antagonizing miR-24 in ESCs does not affect generation of BL-CFCs, the in vitro equivalent of the hemangioblast, but does compromise the ability of those BL-CFCs to produced HPCs. [score:1]
from thes suggest that miR-24 is not required for the commitment of mesoderm to the hemangioblast, as we did not observe a requirement for miR-24 in BL-CFC generation. [score:1]
BL-CFCs develop from EBs with antagonized miR-24. [score:1]
MiR-24 is required for blood development from mouse embryonic stem cells. [score:1]
Perturbation of miR-24 does not effect generation of blast colony-forming cells. [score:1]
[1 to 20 of 103 sentences]
3
[+] score: 277
Other miRNAs from this paper: mmu-mir-24-2
More importantly, co-transfecting the MCF-7 cells with an ING5 overexpression plasmid and a miR-24 mimic significantly increased ING5 expression compared with cells transfected with the miR-24 mimic alone (Fig.   2g-h), suggesting that the expression of miR-24-resistant ING5 plasmid (ING5 ORF without the miR-24 -targeted 3’-UTR) was sufficient to rescue the suppression of ING5 by miR-24. [score:10]
To elucidate whether miR-24 could be a regulator of ING5 protein expression in breast cancer, we determined ING5 expression levels after the overexpression or the knockdown of miR-24 in human breast cancer MCF-7 and MDA-MB-231 cells. [score:9]
In contrast, overexpression or knockdown of miR-24 did not affect ING5 mRNA levels (Fig.   2f), implying that miR-24 controlled the expression of ING5 protein at the translational level. [score:8]
The overexpression of miR-24 was achieved by transfecting cells with a miR-24 mimic (pre-miR-24, a synthetic double-stranded RNA oligonucleotide mimicking the precursor of miR-24), whereas the knockdown of miR-24 was achieved by transfecting cells with a miR-24 inhibitor (anti-miR-24, a chemically modified antisense oligonucleotide designed to target mature miR-24). [score:8]
Thus, the promotion of cell proliferation and invasion, and the inhibition of cell apoptosis, by knockdown of ING5 were similar to the effects elicited by miR-24 overexpression, further indicating that miR-24 may stimulate cell proliferation and invasion and suppress cell apoptosis by silencing ING5. [score:8]
Furthermore, we provided evidence that induction of miR-24 expression could mimic ING5 suppression, stimulating the proliferation and invasion of breast cancer cells, and suppressing apoptosis. [score:7]
A mammalian expression plasmid designed to specifically express the open reading frame (ORF) of human ING5 without the miR-24 -targeted 3’-UTR was purchased from Invitrogen. [score:7]
g- h Western blot analysis of the expression levels of ING5 protein in MCF-7 cells co -transfected with pre-miR-control plus control plasmid, pre-miR-24 plus control plasmid, pre-miR-control plus an ING5 overexpressing plasmid, or pre-miR-24 plus an ING5 overexpressing plasmid. [score:7]
To investigate the biological consequences of the downregulation of ING5 expression caused by miR-24 in breast cancer, we analyzed the effects of miR-24 on cell proliferation, invasion and apoptosis after the overexpression or the knockdown of miR-24 in MCF-7 cells. [score:7]
Overexpression of miR-24 significantly suppressed the luciferase activity in MCF-7 cells, whereas inhibition of miR-24 had an opposite effect (Fig.   2i). [score:7]
These results revealed that miR-24 regulated the expression of ING5 protein at the translational level. [score:6]
In the present study, we performed a systematic analysis of ING5 expression in breast cancer and identified ING5 as a direct target of miR-24. [score:6]
To determine the molecular mechanism underlying ING5 downregulation in breast cancer, we used computational bioinformatics to predict those miRNAs that could target ING5 and identified miR-24. [score:6]
In this study, ING5 is downregulated in breast cancer and is negatively regulated by miR-24. [score:5]
Indeed, restoration of ING5 expression with a miR-24-resistant ING5 overexpression plasmid completely reversed miR-24 -induced cellular phenotypes and blocked xenografted tumor growth in vivo. [score:5]
MCF-7 cells were transfected with pre-miR-control or pre-miR-24, with anti-miR-control or anti-miR-24, or with pre-miR-control plus control plasmid, pre-miR-24 plus control plasmid, pre-miR-control plus an ING5 overexpressing plasmid, or pre-miR-24 plus an ING5 overexpressing plasmid. [score:5]
c- f qRT-PCR and western blot analysis in MCF-7 and MDA-MB-231 cells transfected with equal doses of scrambled negative control mimic (pre-miR-control), miR-24 mimic (pre-miR-24), scrambled negative control inhibitor (anti-miR-control) or miR-24 inhibitor (anti-miR-24). [score:5]
In addition, restoration of ING5 expression could reverse the miR-24 -induced cellular phenotypes, suggesting that targeting ING5 is a major mechanism by which miR-24 exerts its oncogenic function. [score:5]
The effect of miR-24 on the expression of ING5 mRNA and protein after inhibiting transcription with actinomycin D. (A) qRT-PCR analysis of ING5 and c-myc mRNA levels in MCF-7 cells treated with actinomycin D for 8 h. (B-D) qRT-PCR and western blot analysis of ING5 mRNA and protein levels in MCF-7 cells transfected with equal doses of pre-miR-control, pre-miR-24, anti-miR-control or anti-miR-24 followed by treatment with actinomycin D for 8 h. B: qRT-PCR analysis of the ING5 mRNAs levels; C: the representative image of western blot analysis of ING5 protein; D: the quantitative analysis of western blot. [score:5]
Aberrant expression of miR-24 has been found in multifarious cancer types and miR-24 has both tumor-suppressive and oncogenic properties depending on the cellular context. [score:5]
In parallel with the changes in the miR-24 levels, the expression of the ING5 protein was significantly reduced by the introduction of miR-24, whereas transfection with a miR-24 inhibitor significantly increased the ING5 protein levels in the MCF-7 and the MDA-MB-231 cells (Fig.   2d-e). [score:5]
MCF-7 cells were infected with a control lentivirus or a lentivirus to overexpress miR-24, or transfected with an ING5 overexpressing plasmid. [score:5]
To test this hypothesis, MCF-7 cells transfected with miR-24 mimic or inhibitor were treated with actinomycin D to inhibit transcription [18]. [score:5]
ING5 is a direct target of miR-24. [score:4]
Furthermore, we explored the molecular mechanisms accounting for the dysregulation of ING5 in breast cancer cells and identified an oncomiR, miR-24, as a direct upstream regulator of ING5. [score:4]
Furthermore, we showed that miR-24 promoted the proliferation and invasion of, but suppressed the apoptosis of, breast cancer cells in vitro and accelerated xenografted tumor growth in vivo, probably via negatively regulating ING5. [score:4]
In contrast, neither the overexpression nor the knockdown of miR-24 changed the luciferase activity of the mutant luciferase reporter (Fig.   2i). [score:4]
Fig. 2Prediction and validation of ING5 as a direct target of miR-24. [score:4]
Tumors from the miR-24 -overexpressing group showed a significant increase in the expression of miR-24 compared to tumors from the control group (Fig.   4c). [score:4]
In summary, these results suggest that miR-24 directly binds to the 3’-UTR of the ING5 transcript and mediates the post-transcriptional repression of ING5 expression. [score:4]
Overexpressing or knocking down miR-24 had no effect on the levels of already existed ING5 mRNAs after blocking the production of nascent mRNAs (Additional file 2: Figure S2B), but still significantly decreased the levels of ING5 protein (Additional file 2: Figure S2C-D). [score:4]
This study also showed for the first time that miR-24 accomplishes its oncogenic effects by negatively regulating ING5 expression in breast cancer. [score:4]
miR-24 decreases ING5 expression and promotes xenografted tumor growth in vivo. [score:3]
The ING5 3’-UTR harboring the wild type or mutant miR-24 target sequence was inserted downstream of the firefly luciferase gene in a reporter plasmid. [score:3]
b qRT-PCR analysis of the expression levels of miR-24 in the same 8 pairs of BC and NC tissue samples. [score:3]
Overexpression of miR-24 has been found in a variety of human cancers, including pancreatic cancer [11], non-small cell lung cancer [12], hepatocellular carcinoma [13] and gastric cancer [14]. [score:3]
In addition, H&E staining of the xenograft tissues showed more cell mitosis in tumors from the miR-24 -overexpressing group than in tumors from the control group (Fig.   4g). [score:3]
The recombinant plasmids were transfected into MCF-7 cells along with a miR-24 mimic, a miR-24 inhibitor or scrambled negative control RNAs. [score:3]
To further confirm that induction of exogeneous ING5 could rescue the suppression of ING5 by miR-24, we designed a HA-tagged ING5 plasmid and repeated the above co-transfection experiments. [score:3]
c qRT-PCR analysis of the expression levels of miR-24 in the tumors from the injected mice. [score:3]
C [T] values of miR-24 were normalized to U6 snRNA, and the relative levels of miR-24 were determined using the formula 2 [-ΔΔCT], in which ΔΔC [T] = (C [T miR-24] – C [T U6]) [target] - (C [T miR-24] – C [T U6]) [control]. [score:3]
Hence, it is quite possible that modulating miR-24 may increase ING5 expression and subsequently activate the anti-tumor effects of ING5. [score:3]
The cellular miR-24 levels increased by approximately 100-fold when the MCF-7 and the MDA-MB-231 cells were transfected with a miR-24 mimic, and these levels dropped to approximately 20% of the normal levels when the cells were treated with a miR-24 inhibitor (Fig.   2c). [score:3]
The human ING5 3’-UTR with a wild-type or a mutant miR-24 target sequence was inserted into the p-MIR-reporter plasmid (Ambion) to create p-MIR-luc-ING5 WT or p-MIR-luc-ING5 Mut, respectively. [score:3]
As expected, overexpression of miR-24 did not change the levels of HA polypeptide but significantly decreased the levels of total ING5 protein when co-transfecting the MCF-7 cells with an ING5-HA plasmid and a miR-24 mimic (Additional file 3: Figure S3A-B). [score:3]
Accordingly, immunohistochemical staining for ING5 revealed the presence of lower levels of ING5 in the group injected with miR-24 -overexpressing cells (Fig.   4h). [score:3]
Next, we performed a luciferase reporter assay to determine whether the negative regulatory effect that miR-24 exerted on ING5 expression was mediated specifically through the binding of miR-24 to the presumed site in the ING5 3’-UTR. [score:3]
The predicted interaction between miR-24 and the target sequence within the ING5 3’-UTR is illustrated in Fig.   2a. [score:3]
However, the latent molecular mechanisms through which miR-24 is involved in the development and progression of breast cancer remain to be fully elucidated. [score:2]
ING5 microRNA miR-24 Breast cancer Proliferation Invasion Apoptosis Cancer is a complicated genetic disease trigged by cells that have accumulated multiple mutations that finally bestow malignant characteristics. [score:2]
A significant increase in the size and weight of the tumors was observed in the miR-24 -overexpressing group compared to the control group (Fig.   4a-b). [score:2]
We then experimentally validated ING5 as a novel target of miR-24 by cell transfection and luciferase reporter assays. [score:2]
The MCF-7 cells transfected with the miR-24 mimic showed an increased proliferation rate, whereas the knockdown of miR-24 had the opposite effect on cell proliferation (Fig.   3a). [score:2]
Moreover, when compared to cells transfected with the miR-24 mimic, the cells transfected with the miR-24 mimic and the ING5 overexpression plasmid exhibited significantly lower proliferation and invasion rates and higher apoptotic percentage (Fig.   3a-e), suggesting that miR-24-resistant ING5 can attenuate the oncogenic effect of miR-24. [score:2]
Likewise, the percentage of apoptotic cells was significantly lower in the cells transfected with a miR-24 mimic, whereas the knockdown of miR-24 increased the percentage of apoptotic cells (Fig.   3b-c). [score:2]
Consequently, reduced ING5 protein levels were observed in the miR-24 -overexpressing group compared to the control group (Fig.   4d-e), whereas levels of ING5 mRNA remained unchanged (Fig.   4f). [score:2]
Taken together, these results portray a novel regulatory pathway employing miR-24 and ING5 to fine-tune the balance of breast cancer cells. [score:2]
Transfecting MCF-7 cells with a miR-24 mimic significantly increased the number of cells invading through a Matrigel-coated filter, whereas the knockdown of miR-24 reduced cell invasion (Fig.   3d-e). [score:2]
Moreover, miR-24 played a key role in breast cancer invasion and metastasis [17], suggesting the oncogenic role of miR-24 in breast cancer. [score:1]
miR-24 and ING5 have opposite effects on breast cancer cell proliferation, invasion and apoptosis. [score:1]
In the present study, we found that miR-24 levels were consistently higher in breast cancer tissues. [score:1]
Fig. 4Effects of miR-24 and ING5 on the growth of breast cancer cell xenografts in mice. [score:1]
These results revealed that miR-24-resistant ING5 plasmid can rescue the repression of endogenous ING5 by miR-24. [score:1]
Spearman correlation analysis showed that there was a trend of inverse correlation between the miR-24 levels and ING5 protein levels in paired breast cancer samples (Additional file 1: Figure S1). [score:1]
Fig. 3Effects of miR-24 on the proliferation, apoptosis and invasion of breast cancer cells. [score:1]
In the future, greater research emphasis is needed to characterize the feasibility of targeting miR-24 in cancer therapy and to develop simplified and cost-effective manipulation methods. [score:1]
The seed region of miR-24 and the seed-recognition site in the ING5 3’-UTR are indicated in red. [score:1]
qRT-PCR showed that the miR-24 levels were consistently higher in the cancer tissues (Fig.   2b). [score:1]
The tumor cell proliferation rate, as measured by the percentage of Ki-67 -positive tumor cells, was increased in tumors from the miR-24 -overexpressing group (Fig.   4i). [score:1]
For the quantification of miR-24 and U6 snRNA, 0.2 μg of total RNA obtained from cultured cells or tissues was reverse-transcribed to cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). [score:1]
Further research on miR-24 and ING5 may reveal a new avenue for treatment of breast cancer. [score:1]
These results are consistent with the findings of the in vitro assays and firmly validate the oncomiR role of miR-24 in breast tumorigenesis, probably via negatively regulating ING5. [score:1]
Subsequently, total RNA and protein were extracted from each xenograft and used to evaluate the expression levels of miR-24 and ING5. [score:1]
The sequence that interacts with the seed sequence of miR-24 was mutated (from CTGAGCC to GACTCGG). [score:1]
Among the candidate miRNAs, miR-24 was selected for further experimental verification because miR-24 is a well-known oncomiR that has been frequently associated with malignancies [16, 17]. [score:1]
Liu R, Zhang H, Wang X, Zhou L, Li H, Deng T, Qu Y, Duan J, Bai M, Ge S, et al. The miR-24-Bim pathway promotes tumor growth and angiogenesis in pancreatic carcinoma. [score:1]
We revealed that miR-24 had the opposite effects to those of ING5 on breast cancer cells and could accelerate xenografted tumor growth in vivo. [score:1]
miR-24 is one of the most well-known miRNAs correlated with tumorigenesis. [score:1]
The Spearman’s correlation scatter plot of the fold changes of miR-24 and ING5 protein levels in breast cancer tissue pairs. [score:1]
, transwell invasion and apoptosis assay were used to characterize the changes induced by overexpressing or knocking down miR-24 or ING5. [score:1]
As shown in this figure, there is one conserved miR-24 binding site in the 3’-UTR of the ING5 mRNA sequence. [score:1]
a Schematic description of the hypothetical duplex formed by the interactions between the binding site in the ING5 3’-UTR (top) and miR-24 (bottom). [score:1]
i The relative luciferase activities in MCF-7 cells transfected with wild-type or mutant ING5 luciferase plasmid and with equal doses of pre-miR-control, pre-miR-24, anti-miR-control or anti-miR-24. [score:1]
In breast cancer, it has been shown that miR-24 exhibited great capability for discriminating and monitoring between cancer patients and controls [25, 26]. [score:1]
c: qRT-PCR analysis of miR-24; d: representative image of western blot analysis of ING5 protein; e: quantitative analysis of western blot; f: qRT-PCR analysis of ING5 mRNA. [score:1]
[1 to 20 of 85 sentences]
4
[+] score: 265
The expression of all these genes was significantly downregulated with miR-24 overexpression, whereas inhibition of miR-24 markedly elevated the expression of all these genes (Figure 3A–C). [score:12]
Furthermore, the key osteogenic transcription factor Runx2 was also remarkably downregulated by miR-24 overexpression or upregulated by miR-24 inhibition (Figure 3D). [score:11]
Furthermore, matrix mineralization in BMSCs (Figure 2C) and MC3T3-E1 cells (Figure 2D) was also downregulated or increased by miR-24 overexpression or downregulation, respectively. [score:9]
Here, we demonstrated that miR-24 regulates osteoblast differentiation possibly through regulating Tcf-1. It has reported that Runx2 is a target gene of β-catenin/Tcf-1 as overexpression of Tcf-1 increases Runx2 promoter activity and Runx2 gene expression in mouse pluripotent mesenchymal and osteo-progenitor cells [22]. [score:9]
We demonstrate here that miR-24 regulates osteogenic differentiation through targeting and regulating the expression of Tcf-1. To gain insight into miR-24 in osteogenic differentiation, we first detected the expression profile of miR-24 during osteogenic differentiation by RT-qPCR. [score:9]
Overexpression of miR-24 suppresses fibrosis and the differentiation and migration of cardiac fibroblasts by regulating furin expression after myocardial infarction [38]. [score:8]
To further validate that miR-24 targeted miR-24 and regulated the expression of Tcf-1, we investigated the effect of ectopic miR-24 expression on Tcf-1 expression in BMSCs and MC3T3-E1 cells. [score:8]
During adipocyte differentiation, miR-24 was found to be extensively downregulated, which regulated adipocyte differentiation by targeting fatty acid -binding protein 4 [39]. [score:7]
2.3. miR-24 Directly Targets the 3′-UTR of Tcf-1. 2.4. miR-24 Regulates Tcf-1 Expression in BMSCs and MC3T3-E1 Cells. [score:7]
However, miR-24 was also found to be a tumor suppressor gene that inhibited gastric cancer progression by decreasing the gene expression of regenerating islet-derived family, member four [32]. [score:7]
MiR-24 has been reported to be overexpressed in hepatocellular carcinoma and inhibition of miR-24 significantly represses cell proliferation, invasion, and migration by targeting sex-determining region Y-box 7 [31]. [score:7]
In conclusion, our data indicate that miR-24 acts as an important regulator of osteogenic differentiation by targeting and regulating Tcf-1. Our findings provide novel insight into miR-24, which may serve as an effective target in bone formation and regeneration. [score:7]
Duan Y. Hu L. Liu B. Yu B. Li J. Yan M. Yu Y. Li C. Su L. Zhu Z. Tumor suppressor mir-24 restrains gastric cancer progression by downregulating regiv Mol. [score:6]
The overexpression of miR-24 significantly decreased alkaline phosphatase (ALP) activity, whereas downregulation of miR-24 markedly enhanced ALP activity in BMSCs (Figure 2A) and MC3T3-E1 cells (Figure 2B) during osteogenic differentiation. [score:6]
To further verify that miR-24 regulated osteoblast differentiation through modulating Tcf-1 expression, we performed Tcf-1 siRNA experiments along with miR-24 inhibition. [score:6]
The results show that the silencing of Tcf-1 (Figure 6A) apparently abrogated the positive effect of anti-miR-24 on osteoblast differentiation in which the increased gene expression of the key osteogenic transcription factor Runx2 induced by anti-miR-24 was remarkably downregulated by Tcf-1 siRNA (Figure 6B). [score:6]
Inhibition of miR-24 Elevates the Expression of Osteogenic Differentiation Markers. [score:5]
The results show that miR-24 overexpression significantly decreased the protein expression of Tcf-1 in BMSCs and MC3T3-E1 cells (Figure 5C,D). [score:5]
Lal A. Pan Y. Navarro F. Dykxhoorn D. M. Moreau L. Meire E. Bentwich Z. Lieberman J. Chowdhury D. Mir-24 -mediated downregulation of H2AX suppresses DNA repair in terminally differentiated blood cells Nat. [score:5]
We further demonstrated that the silencing of Tcf-1 expression significantly abolished the positive effect of miR-24 inhibition on osteoblast differentiation. [score:5]
Kang M. Yan L. M. Li Y. M. Zhang W. Y. Wang H. Tang A. Z. Ou H. S. Inhibitory effect of microRNA-24 on fatty acid -binding protein expression on 3T3-L1 adipocyte differentiation Genet. [score:5]
We found that miR-24 was decreased during osteogenic differentiation and inhibition of miR-24 promoted osteogenic differentiation by increasing Tcf-1, an important target gene of the Wnt signaling pathway. [score:5]
RT-qPCR analysis of Tcf-1 mRNA expression in BMSCs (A) and MC3T3-E1 cells (B) transfected with miR-24 or anti-miR-24; Western blot analysis of Tcf-1 protein expression in MSCs (C) and MC3T3-E1 cells (D). [score:5]
The results showed that administration of miR-24 significantly downregulated luciferase activity in pGL3-Tcf-13'-UTR (wild type) transfected cells, whereas administration of anti-miR-24 markedly increased the luciferase activity (Figure 4B). [score:4]
The results show that miR-24 was downregulated during osteogenic differentiation in mouse bone mesenchymal stem cells (BMSCs) (Figure 1A) and mouse embryo osteoblast precursor (MC3T3-E1) cells (Figure 1B). [score:4]
Here, we demonstrate that miR-24 negatively regulates osteogenic differentiation by targeting Tcf-1. The direct interaction between miR-24 and Tcf-1 was detected by a dual luciferase reporter assay, which was further validated in a gain- or loss-of-function study in BMSCs and MC3T3-E1 cells. [score:4]
To further delineate the underlying molecular mechanism of miR-24 in regulating osteogenic differentiation, we predicted the putative target genes of miR-24 through bioinformatics analysis. [score:4]
Figure 4miR-24 directly targets the 3'-UTR of Tcf-1. (A) The 3'-UTR of Tcf-1 had the putative binding sites with miR-24; (B) The direct binding relationship between 3'-UTR of Tcf-1 and miR-24 was detected by a dual luciferase activity assay. [score:4]
In the present study, we have demonstrated that the expression levels of Tcf-1 and Runx2 are regulated by miR-24 in BMSCs and MC3T3-E1 cells. [score:4]
In contrast, anti-miR-24 markedly increased the protein expression of Tcf-1 (Figure 5C,D). [score:3]
In the present study, we explored the expression profile of miR-24 during osteogenic differentiation and investigated the effect of ectopic expression of miR-24 on osteogenic differentiation. [score:3]
Figure 1Detection of the expression of miR-24. [score:3]
Interestingly, miR-24 was also found to be differentially expressed during mesenchymal stem cell differentiation toward osteoblasts [40]. [score:3]
RT-qPCR analysis showed that the mRNA expression level of Tcf-1 was not affected by miR-24 or anti-miR-24 in BMSCs (Figure 5A) and MC3T3-E1 cells (Figure 5B). [score:3]
day 0. RT-qPCR analysis of miR-24 expression in miR-24 or anti-miR-24 transfected BMSCs (C) and MC3T3-E1cells (D). [score:3]
RT-qPCR was performed to detect the expression level of miR-24 during osteogenic differentiation in BMSCs (A) and MC3T3-E1 cells (B). [score:3]
A total of 0.5 μg pGL3-Tcf-1 3'-UTR plasmids were co -transfected with 20 nM miR-24 or the miR-24 inhibitor into MC3T3-E1 cells using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. [score:3]
Briefly, cells were treated with 20 nM miR-24 precursor (miR-24) or miR-24 inhibitor (anti-miR-24) for 48 h and then cultured in differentiation medium for the induction of osteogenic differentiation for 3, 7 and 9 days. [score:3]
Conversely, ectopic expression of miR-24 had no apparent effect on luciferase activity in pGL3-Tcf-13'-UTR (mutated type) transfected cells. [score:3]
Silencing of Tcf-1 Abolishes the Positive Effect of miR-24 Inhibition on Osteoblast Differentiation. [score:3]
To gain insight into miR-24 in osteogenic differentiation, we first detected the expression profile of miR-24 during osteogenic differentiation by RT-qPCR. [score:3]
It has been recently reported that miR-24 and miR-27a are suppressors of embryonic stem cell differentiation [36]. [score:3]
Figure 3Effect of miR-24 gain or loss on the mRNA expression of osteogenesis-related genes. [score:3]
Figure 6Tcf-1 knockdown abrogated the effect of anti-miR-24 on osteoblast differentiation. [score:2]
However, the precise role and the underlying mechanism of miR-24 in regulating osteogenic differentiation have remained unexplored. [score:2]
Sun Q. Zhang Y. Yang G. Chen X. Cao G. Wang J. Sun Y. Zhang P. Fan M. Shao N. Transforming growth factor-β-regulated mir-24 promotes skeletal muscle differentiation Nucleic Acids Res. [score:2]
Increasing study has suggested that miR-24 is extensively involved in regulating cell differentiation such as epidermal differentiation [24], blood cell differentiation [25], and skeletal muscle differentiation [26]. [score:2]
Naqvi A. R. Fordham J. B. Nares S. Mir-24, mir-30b, and mir-142-3p regulate phagocytosis in myeloid inflammatory cells J. Immunol. [score:2]
Philipot D. Guerit D. Platano D. Chuchana P. Olivotto E. Espinoza F. Dorandeu A. Pers Y. M. Piette J. Borzi R. M. P16INK4a and its regulator mir-24 link senescence and chondrocyte terminal differentiation -associated matrix remo deling in osteoarthritis Arthritis Res. [score:2]
Fiedler J. Stohr A. Gupta S. K. Hartmann D. Holzmann A. Just A. Hansen A. Hilfiker-Kleiner D. Eschenhagen T. Thum T. Functional microrna library screening identifies the hypoxamir mir-24 as a potent regulator of smooth muscle cell proliferation and vascularization Antioxid. [score:2]
However, the role and the underlying mechanism of miR-24 in regulating osteogenic differentiation remain poorly understood. [score:2]
In the present work, we have delineated that miR-24 is a negative regulator of osteogenic differentiation. [score:2]
Ma Y. She X. G. Ming Y. Z. Wan Q. Q. Mir-24 promotes the proliferation and invasion of HCC cells by targeting SOX7 Tumour Biol. [score:2]
Moreover, miR-24 also has a role in regulating cardiomyocyte apoptosis [33], smooth muscle cell proliferation [34], and phagocytosis by myeloid inflammatory cells [35]. [score:2]
Tcf-1 as a putative target gene of miR-24 was screened by bioinformatics analysis and validated by a dual luciferase reporter assay. [score:2]
The wild type or mutated 3'-UTR of Tcf-1containing the putative binding sites for miR-24 in pGL3 luciferase reporters was transfected into MC3T3-E1cells cells with miR-24 or anti-miR-24. [score:1]
The cDNA fragment of 3'-UTR of Tcf-1 containing the putative binding sites of miR-24 was amplified and then subcloned into pGL3 luciferase promoter vector (Promega, Madison, WI, USA). [score:1]
Cells were transfected with miR-24 or anti-miR-24 (day 0) for 48 h and then cultured in differentiation medium for the induction of osteogenic differentiation. [score:1]
Intriguingly, we found that Tcf-1, a key transcription factor downstream of Wnt/β-catenin, contained the putative binding sites for miR-24 in the 3'-UTR (Figure 4A). [score:1]
However, further studies are warranted to validate the exact role of miR-24 in animal mo dels in vivo. [score:1]
Cells were transfected with 20 nM miR-24 or anti-miR-24 for 48 h. miR-NC or anti-miR-NC was used as the control for miR-24 or anti-miR-24, respectively. [score:1]
Wang J. Huang W. Xu R. Nie Y. Cao X. Meng J. Xu X. Hu S. Zheng Z. Microrna-24 regulates cardiac fibrosis after myocardial infarction J. Cell Mol. [score:1]
2.1. miR-24 Is Involved in Osteogenic Differentiation. [score:1]
Furthermore, the increased ALP activity (Figure 6C) and matrix mineralization (Figure 6D) induced by anti-miR-24 were also significantly decreased by Tcf-1 siRNA. [score:1]
To confirm this direct relationship between Tcf-1 and miR-24, a dual luciferase reporter assay was performed. [score:1]
Philipot et al. reported that miR-24 mediated chondrocyte terminal differentiation in osteoarthritis [37]. [score:1]
Figure 2Effect of miR-24 gain or loss on osteogenic differentiation. [score:1]
Several reports have also revealed a critical role of miR-24 in cell differentiation. [score:1]
Cells transfected with miR-24 or anti-miR-24 (day 0) for 48 h and then cultured in differentiation medium for induction of osteogenic differentiation. [score:1]
The data imply a potential role of miR-24 in osteogenic differentiation. [score:1]
[1 to 20 of 70 sentences]
5
[+] score: 245
We examined the expression of the eight most significantly upregulated miR-24 target mRNAs (from microarray) at baseline and three different time points during PPE -induced AAA development. [score:9]
Neither Chi3l1 nor miR-24 expression was significantly altered with IL-4 treatment, although there was a trend towards downregulation of Chi3l1 and upregulation of miR-24 in RAW 264.7 cells (Supplementary Fig. 5D,E). [score:9]
miR-24 remained significantly downregulated at three time points (days 7, 14 and 28; Fig. 1d), while miR-23b and miR-27b were downregulated only at day 7, supporting independent release of individual miRNAs from the cluster-transcript. [score:7]
Of all the downregulated individual miRNAs, miR-24 had the most significant negative correlation with upregulated genes (Fig. 1c) 11. [score:7]
Macrophage miR-24 expression was modulated through transfection with either an antagomiR (anti-24) to inhibit or a pre-miR (pre-24) to overexpress miR-24 (versus scrambled-miR control; scr-miR). [score:7]
All were upregulated exclusively at day 7, leaving Chi3l1 as the most compelling miR-24 target during murine AAA development. [score:7]
miR-24 downregulation was pro-inflammatory in macrophages, augmenting expression of mediators Tnf-α and Ccl2/Mcp-1 (Fig. 2h). [score:6]
miR-24 overexpression blocked Chi3l1 induction in vivo, limiting AAA expansion, while anti-miR-24 led to higher Chi3l1 expression and development of larger, rupture-prone aneurysms. [score:6]
Successful miR-24 inhibition and overexpression in vivo were confirmed by qRT–PCR (Supplementary Fig. 7C). [score:5]
Chi3l1 expression was again negatively correlated (increased) with miR-24 expression (Fig. 2c). [score:5]
Overexpressing miR-24 substantially attenuated increases in AAD, while further inhibition with anti-24 augmented AAD expansion (Fig. 4b and Supplementary Table 4). [score:5]
Chi3l1, which belongs to the chitinase-like protein family and is a potential chronic inflammatory disease biomarker 14, was the only top miR-24 target gene substantially altered at all time points, and showing a complimentary negatively correlated trend versus miR-24 (Fig. 1g,h). [score:5]
Again, miR-24 was the only member of the miR-23b-24-27b cluster to be significantly downregulated at all three time points (days 7, 14 and 28) during aneurysm development (Fig. 2b). [score:5]
We explored the regulatory role of miR-24 on inflammation and CHI3L1 expression in HEK293 and aneurysm-related cell types in vitro. [score:4]
Inflammatory stimuli downregulated miR-24 in macrophages and vascular SMCs at least partly via NF-κB. [score:4]
Anti-miR-24 transfection primarily augmented the degree of inflammatory and apoptosis-related responses rather than activating/repressing alternative pathways, suggesting that the observed miR-24 downregulation with aneurysm is pathologic rather than homeostatic. [score:4]
Furin, a proprotein convertase, has been shown to be a direct target of miR-24 in cardiac fibroblasts 19. [score:4]
In vivo (mouse), in vitro (cell culture) and ex vivo (human tissue and plasma), we identified miR-24 as a key regulator of AAA initiation and propagation, which acts in part by targeting CHI3L1 (Supplementary Fig. 9). [score:4]
As in our animal mo dels, miR-24 was significantly downregulated (−1.9±0.09-fold) in human AAA tissue (versus control). [score:4]
miR-24 and its target Chi3l1 regulate inflammation. [score:4]
Direct targeting of the CHI3L1–3′UTR by miR-24 was confirmed by transfecting HEK293 cells (ATCC) with Switchgear GoClone luciferase constructs. [score:4]
Pre-miR-24 inhibits AAA development in mouse mo dels. [score:4]
We show that both CHI3L1 treatment and miR-24 inhibition activate JNK/ERK in SMC in vitro, while pre-miR-24 decreases phospho-JNK/ERK, suggesting additional mechanistic links between miR-24/CHI3L1 regulation and AAA. [score:4]
Regulation of miR-24 through NF-κB in vitroTransfection of IL-6 -treated peritoneal mouse macrophages and RAW 264.7 cells was performed using Lipofectamine RNAiMAX (Invitrogen) reagent, and siRNA targeting either Rela (p65) or Nfkb1 (p50) subunits of the transcription factor NF-κB (Ambion). [score:4]
In both macrophage lines, anti-24 augmented the IL-6 -induced Chi3l1 increase, whereas pre-24 countered IL-6, driving Chi3l1 expression below scr-miR -treated baseline, further confirming miR-24 regulation (Fig. 2g and Supplementary Fig. 3A). [score:4]
e. m. (c) Cytokine expression in IL-6-stimulated, miR-24-modulated and si Chi3l1 -transfected hASMC. [score:3]
miR-24 expression was also visualized in the aneurysm intimal–medial region. [score:3]
In our study, plasma and tissue levels of miR-24 were significantly decreased in AAA patients, but unlike CHI3L1 these were not clear disease-severity indicators. [score:3]
IL-6 stimulation decreased miR-24 (Fig. 2i) and increased CHI3L1 expression (Fig. 3a). [score:3]
miR-24 expression and downstream effects in angiotensin II -induced AAAs and in vitro. [score:3]
miR-24 modulation inversely altered both Chi3l1 expression and Chi3l1 protein levels in peritoneal macrophages and RAW 264.7 cells. [score:3]
Further experiments on macrophage polarization, utilizing recombinant IL-4 and IL-6 stimulation of murine peritoneal macrophages, revealed that miR-24 modulation predominantly affects M1 prototypical macrophage markers, such as Il12 and Nos1 (Supplementary Fig. 5F,G), but not those of the M2 subtype, as no substantial change was observed in the expression of Il10 and Arg1 (Supplementary Figs 5H and 6A). [score:3]
Of these genes, 63 were predicted targets of miR-24 alone (Supplementary Fig. 1D). [score:3]
CHI3L1 appears to be a crucial regulator of transmural vascular inflammation in AAA and its regulation by miR-24 suggests potential therapeutic approaches. [score:3]
miR-24 expression and Chi3l1 in human AAA. [score:3]
In situ hybridization (ISH) showed diminished miR-24 expression throughout the aneurysmal aortic wall of PPE mice (versus sham and untreated controls; Fig. 1f). [score:3]
These results suggest that IL-6 (abundant in developing AAA) decreases miR-24-1 expression in macrophages, leading to a rise in Chi3l1. [score:3]
CHI3L1 (a 18-glycosyl hydrolase family member) 14 is a predicted target of miR-24 involved in acute and chronic inflammation 35 36. [score:3]
Analysis suggested Chi3l1 as an intriguing miR-24 target. [score:3]
First, via HEK293 transfection, direct suppression of CHI3L1 transcription through 3′UTR binding of miR-24 was confirmed by luciferase assay (Supplementary Fig. 2E). [score:3]
miR-24 target-genes in AAA mo dels. [score:3]
Modulation of miR-24 expression did not affect blood pressure in transduced mice (Supplementary Table 6). [score:3]
Relative expression of miR-24-1 and miR-24-2 clusters were obtained by TaqMan for pri-miR-24-1 (5′-CUCCGGUGCCUACUGAGC UGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG-3′) and pri-miR-24-2 (5′-GCCUCUCUCCGGGCUCCGCCUCCCGUGCCUACUGAGCUGAAACAG UUGAUUCCAGUGCACUGGCUCAGUUCAGCAGGAACAGGAGUCCAGCCCCCUAGGAGCUGGCA-3′; both from Applied Biosystems). [score:3]
miR-24 modulation effects on gene expression in murine AAA. [score:3]
As in macrophages, miR-24 modulation in SMCs altered CHI3L1 expression (Fig. 3a). [score:3]
How to cite this article: Maegdefessel, L. et al. miR-24 limits aortic vascular inflammation and murine abdominal aneurysm development. [score:2]
We detected decreased plasma miR-24 expression in patients with small (45–67 mm; n=54) and large AAA (69–150 mm; n=51; Fig. 6e) compared with both controls and PVOD patients. [score:2]
Death from aortic rupture occurred significantly more often in anti-24 -treated mice (58%), compared with scr-miR- (36%) and pre-24 -transfected (12%) through day 28. miR-24 expression in anti-/pre-24-transduced mice was less altered than in the PPE mo del (Supplementary Fig. 8A). [score:2]
Overexpression of miR-24 in peritoneal macrophages and RAW 264.7 increased apoptosis (Annexin V+ and caspase 3/7 assays) beyond that seen with IL-6 stimulation alone, while anti-24 abrogated the pro-apoptotic effects of IL-6 (Fig. 3d,e). [score:2]
Regulation of miR-24 through NF-κB in vitro. [score:2]
IL-6 treatment decreased miR-24 expression compared with control cells at two time points (Fig. 2e). [score:2]
Regulation and modulation of miR-24 in vitro. [score:2]
Further, anti-24 increased (while pre-24 decreased) phospho-Akt levels, partly explaining miR-24 -based macrophage apoptosis regulation (Supplementary Fig. 5A,B). [score:2]
The IL-6 -induced decrease in miR-24 was essentially eliminated in macrophages by prior siRNA -mediated knockdown (>75%) of either RelA (p65) or Nfkb1 (p50), key components of NF-κB (Fig. 3h). [score:2]
We utilized human immunodeficiency virus type 1-derived lentivirus to modulate miR-24 during murine AAA development. [score:2]
The pre-miR-24 (PMIRH24) sequence was: 5′-AATTCGCCCTTGATGGGATTTGCTTCCTGTCACAAATCACATTGCCAGGGATTTCCAACCGACCCTGAGCTCTGCCACCGAGGATGCTGCCCGGGGACGGGGTGGCAGAGAGGCCCCGAAGCCTGTGCCTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAAGTCGTGTTCACAGTGGCTAAGTTCCGCCCCCCAGGCCCTCACCTCCTCTGGCCTTGCCGCCTGTCCCCTGCTGCCGCCTGTCTGCCTGCCATCCTGCTGCCTGGCCTCCCTGGGCTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTACACTGGCTCAGTTCAGCAGGAACAGGGGTCAAGCCCCCTTGGAGCCTGCAGCCCCTGCCTTCCCTGGGTGGGCTGATGCTTGGAGCAGAGATGAGGACTCAGAATCAGACCTGTGTCTGGAGGAGGGATGTGGTGGGTGGGGTTGGCTGGGCCCAAATGTGTGCTGCAGGCCCTGATCCCCAACTCTGCAACTGGGGACCCCTGCATGGCCACAGCTCAGGCTGGGCTGTGGTGCCAGCATAGATAGCGGCCGC-3′. [score:1]
miR-24 modulation in vivo. [score:1]
There were no differences in miR-24 levels between patients with small (52–67 mm; n=12) and large AAA (69–115 mm, n=10), although there was a trend towards lower miR-24 with larger AAA. [score:1]
ISH for miR-24 was performed by using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon), and 5′-DIG- and 3′-DIG -labelled probes for mmu-miR-24 according to the manufacturer’s protocol. [score:1]
miR-24- Chi3l1 interactions controlled inflammatory activity within the dilated aortic wall, effects abrogated by pre-miR-24 transfection. [score:1]
Effects of miR-24 modulation in vivo. [score:1]
In situ hybridization ISH for miR-24 was performed by using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon), and 5′-DIG- and 3′-DIG -labelled probes for mmu-miR-24 according to the manufacturer’s protocol. [score:1]
Microarray studies examining miR-24-modulated aortic tissue confirmed that pre-miR-24 transfection led to AAA -associated-pathway reductions, including immune response and cytokine activity. [score:1]
Notably, miR-24 was one of the circulating miRNAs biomarkers in the cited study, suggesting that it might also detect patients at increased risk of future myocardial infarction. [score:1]
Pri-miR-23b, -27b and -24-1 may be transcribed independently from the cluster gene in mice, although pre-miR-23b may be co-transcribed with pre-miR-27b and pre-miR-24-1 (ref. [score:1]
Final analysis groups included two different sets consisting of 7-day PPE -treated versus sham-saline -treated aortae (five arrays each) and 7-day PPE -treated-miR-24-modulated aortae versus controls (sham-operated saline -treated (four arrays), scr-miR-PPE -treated (five arrays), pre-miR-24-PPE -treated (three arrays) and anti-miR-24-PPE -treated (six arrays)). [score:1]
More intriguing, miR-24 could perhaps be used prospectively to detect patients at high risk for rapid AAA growth/rupture. [score:1]
As observed in vivo, decreases in macrophage miR-24 with IL-6 stimulation were due to reductions in pri-miR-24-1 (Fig. 2f). [score:1]
We also investigated changes in circulating miR-24 plasma expression and Chi3l1 protein levels in our two murine AAA mo dels, and discovered that plasma miR-24 was significantly repressed in mice with aneurysms (Supplementary Fig. 8C). [score:1]
The anti-miR-24 (MZIP-24) sequence was: 5′-GATCCGTGGCTCAATTCAGCAGGCACCGCTTCCTGTCAGCTGTTCCTGCTGAACTGAGCCATTTTTGAATT-3′. [score:1]
The sequence of the LNA miR-24 control probe was: 5′-DIG/CTGTTCCTGCTGAACTGAGCCA/DIG-3′. [score:1]
One is intronic (mouse-chr13; human-chr9: miR-23b, miR-27b and miR-24-1) and the second is intergenic (mouse-chr8; human-chr19: miR-23a, miR-27a and miR-24-2) 12. [score:1]
Because, furin has previously been shown to indirectly regulate matrix metalloproteinases-2 and -9, and to control latent transforming growth factor beta (TGF-β) activation processing (key players in AAA pathobiology) 20 21, we evaluated whether miR-24 modulation in vitro would alter furin in human aortic SMCs. [score:1]
Further, qRT–PCR from days 3 and 7 showed that pri-miR-24-1 (not pri-miR-24-2) was substantially decreased in aneurysmal tissue (versus sham; Fig. 1e). [score:1]
miR-24 modulation had minimal impact on Chi3l1 in the suprarenal (non-aneurysmal) abdominal aorta, suggesting uptake of miRNA modulators only at the site of injury (Supplementary Fig. 7D). [score:1]
Confocal microscopy of double-immunofluorescence-stained aortas with anti-F4/80 and -Chi3l1 confirmed altered levels of both with miR-24 modulation and co-localization within PPE -induced AAAs (Fig. 5e). [score:1]
miR-24 modulation in ANGII -induced AAA and levels in human AAA. [score:1]
However, a combination of both CHI3L1 and miR-24 could potentially be utilized in patients for AAA detection and rupture risk stratification. [score:1]
Larger patient cohorts are needed to validate miR-24 or CHI3L1 as diagnostic biomarkers for AAA. [score:1]
As in aortic tissue, miR-24 plasma levels were indistinguishable between patients with small or large AAAs. [score:1]
We next examined the effects of miR-24 and Chi3l1 on macrophage survival. [score:1]
Transfection of all different cell types was performed using Lipofectamine RNAiMAX (Invitrogen) reagent, mixed with anti-hsa-miR-24, pre-hsa-miR-24 or scrambled controls (Ambion). [score:1]
The miR-24-1 pre-miR and miR-ZIP-anti-24 (System Biosciences) were cloned into a human immunodeficiency virus lentiviral vector containing a copGFP reporter with the miRNA precursor under constitutive CMV promoter control. [score:1]
Appropriately, similar effects on JNK and ERK phosphorylation were also observed after miR-24 modulation (Supplementary Fig. 4C,D). [score:1]
miR-24 and CHI3L1 are novel AAA biomarkers. [score:1]
Mature miR-24 sequences are indistinguishable by quantitative reverse transcription PCR (qRT–PCR). [score:1]
ISH was performed as described above utilizing the miRCURY LNA microRNA ISH Optimization Kit (Exiqon) and 5′-DIG- and 3′-DIG -labelled probes for mmu-miR-24. [score:1]
Interestingly, IL-6 markedly increases miR-24 degradation/processing, an effect that appears to be transcription -dependent (Supplementary Fig. 6H). [score:1]
ISH for miR-24 and immunohistochemistry (IHC) using anti-F4/80 (a macrophage inflammatory marker) revealed that miR-24 co-localized with activated macrophages in aneurysmal aortic mouse tissue (post-PPE day 7; Fig. 2d). [score:1]
[1 to 20 of 89 sentences]
6
[+] score: 231
Other miRNAs from this paper: mmu-mir-24-2
As is shown in Figure 6F and 6G, CD31 expression was reduced in Bim-overexpression group; whereas overexpressed miR-24 increased CD31 expression. [score:9]
Overexpressed miR-24 strongly enhances while transfection of miR-24 inhibitors suppresses cell proliferation (Figure 3D). [score:7]
Overexpression of miR-24 by mimics lead to a sharp reduction of Bim, while the inhibition of miR-24 slightly enhances Bim expression (Figure 2E). [score:7]
As is shown in Figure 5H and 5I, ratio of cell apoptosis clearly increased without FBS compared with control, and the apoptosis was inhibited in miR-24 overexpressed cells while was significantly enhanced in miR-24 down-regulated cells. [score:7]
The following experiments demonstrated that miR-24 directly targets Bim in both PaC cells and vascular cells, inhibiting cell apoptosis and promoting cell proliferation. [score:6]
It is observed that the tumor sizes and weights are obviously increased in miR-24 -overexpressing group compared with control, while the tumor growth is strongly inhibited in Bim -overexpressing group (Figure 6A and 6B). [score:6]
In the present study, we found that miR-24 showed higher expression while Bim was significantly down-regulated in pancreatic tumor tissues. [score:6]
Cells were seeded in a 6-well plate, and transfection was conducted after 24 h. The miR-24 overexpressing lentivirus, Bim overexpressing lentivirus and the control lentivirus were bought from GenePharma (Shanghai, China), and 10 [6] lentivirus were added into every single well with gentle mixing. [score:5]
miR-24 suppresses Bim expression in PANC1 cells. [score:5]
Overexpression of miR-24 in PaC cells depressed Bim expression, thus accelerating cell proliferation, increasing the ratio of cells in S phase, and reduced cell apoptosis. [score:5]
To study the biological role miR-24 in PaC cells, miR-24 mimics or inhibitors were used to interfere the expression of miR-24. [score:5]
Among the miRNAs, we found that miR-24, which is a predicted upstream regulator of Bim, was up-regulated in the serum of PaC patients (Supplementary Table 1). [score:5]
The target 1 B. and target 2 C. of miR-24 were detected respectively (n = 3). [score:5]
PANC1 cells treated with control lentivirus or miR-24 overexpressing lentivirus or Bim overexpressing lentivirus were injected subcutaneously into nude mice (1×10 [7] cells for one mouse). [score:5]
B. Weight of tumors excised from mice implanted with control PANC1 cells, miR-24 -overexpressing PANC1 cells and Bim -overexpressing PANC1 cells. [score:5]
Cell proliferation was valued by Edu/Dapi ration using immunofluorescence assays, and the cell growth rate increased by 80% with miR-24 mediated Bim inhibition; while cell growth rate was reduced by nearly 50% in miR-24 down-regulated cells compared with the control (Figure 5F and 5G). [score:4]
miR-24 regulates Bim expression in PANC1 cells. [score:4]
The tumor-implanted experiment offers a strong confirmation that miR-24-Bim pathway effectively regulates tumor growth in PaC, and implies that inhibition of miR-24 is a potential novel method for anti-PaC tumor. [score:4]
We have previously reported the serum miRNA profile of PaC, and miR-24, which is among the predicted Bim-related miRNAs, was found to be up-regulated [10]. [score:4]
The cell ratios in S phase were clearly higher, while cell ratios in G1 phase were relatively decreased when miR-24 was up-regulated (Figure 3A, 3B and 3C). [score:4]
Bim-related miR-24 is up-regulated in both PaC tissues and serum. [score:4]
It has been reported that miR-24 is up-regulated in non-small cell lung cancer and leukemia and promotes the survival and proliferation of cancer cells [11, 12], and latest study reported that miR-24 was also involved in mesothelial cell integration of PaC [13]. [score:4]
We finally used tumor mo del mice to obtain the direct evidence that miR-24 promotes while Bim inhibits pancreatic tumor growth. [score:4]
As is reported previously, miR-24 promotes cell proliferation in non-small cell lung cancer [31]; the high expression of miR-24 is associated with risk of relapse and poor survival in acute leukemia [12]; and the dysregulation of plasma miR-24 is also treated as clinical biomarker in nasopharyngeal carcinoma [32]. [score:4]
To find out the role of miR-24 in angiogenesis of pancreatic tumors, we checked vascular ring formation of HUVEC cells with the overexpression or knockdown of miR-24. [score:4]
PANC1 cells were co -transfected with firefly luciferase reporters containing either WT or mutant Bim 3′UTR with miR-24 mimics, inhibitors and the corresponding normal control. [score:3]
This result suggests that miR-24 promotes while Bim inhibits angiogenesis of PaC in vivo. [score:3]
miR-24 promotes cell growth while inhibits apoptosis of PANC1 cells. [score:3]
HUVEC cells were transfected with miR-24 mimics or inhibitors, and the medium was removed and fresh FBS-free RPMI-1640 was added to promote apoptosis. [score:3]
We further determined the miR-24 levels in PaC tumor tissues, and miR-24 expression is significantly increased. [score:3]
And the co-transfection of miR-24 inhibitors and the plasmid with the WT Bim 3′UTR resulted in a relative increase in the luciferase signal (Figure 2B and 2C). [score:3]
As is shown in Figure 5A and 5B, Bim protein levels were reduced in HUVEC cells transfected with miR-24 mimics, while were enhanced by miR-24 inhibitors. [score:3]
Part of the wild type and mutated 3′UTR of Bim, containing the predicted miR-24 targeting regions, was synthesized and inserted into a p-MIR-report plasmid (Genescript, Nanjing, China). [score:3]
High expression of miR-24 in vascular cells may be secreted from PaC cancer cells, though it needs further evidence. [score:3]
The subsequent bioinformatics analysis and luciferase assay demonstrated that Bim is a direct target of miR-24. [score:3]
B. Relative levels of miR-24 in HUVEC cells treated with miR-24 mimics or inhibitors (n = 5). [score:3]
It is clear shown that overexpressed miR-24 promotes tube formation in HUVEC cells compared with control; whereas the tube formation was blocked as a result of miR-24 knockdown (Figure 5D and 5E). [score:3]
miR-24 promotes cell proliferation while inhibits cell apoptosis of PANC1 cells. [score:3]
miR-24 raised by 4 folds and Bim raised by 3 folds in the corresponding overexpressing groups (Figure 6C, 6D and 6E). [score:3]
Figure 2 A. Relative levels of miR-24 in PANC1 cells transfected with mimics or inhibitors (n = 3). [score:3]
HUVEC cells were firstly transfected with miR-24 mimics or inhibitors, and subsequently, cells were resuspended in FBS-free 1640 medium and seeded in each well at a concentration of 1 × 10 [5] cells/well. [score:3]
As is expected, ratio of cell apoptosis significantly increased in FBS-free medium, and cell apoptosis was inhibited with the transfection of miR-24 mimics (Figure 3E). [score:3]
E. miR-24 suppresses cell apoptosis (n = 5). [score:3]
The expression patterns of Bim and miR-24 in PaC tissues. [score:3]
As is shown in Figure 2B and 2C, the relative luciferase activity was clearly inhibited when miR-24 mimics were co -transfected with the luciferase reporters containing one of the two predicted binding regions of the wild type (WT) 3′UTR of bim. [score:3]
These data demonstrated that miR-24 regulates Bim protein levels by directly binding two separated regions in Bim 3′UTR. [score:3]
To conclude, the miR-24-Bim pathway contributes to the complex network that activates pancreatic tumor growth and angiogenesis, and gives novel potential target for further therapy of PaC. [score:3]
A. Relative levels of miR-24 in PANC1 cells transfected with mimics or inhibitors (n = 3). [score:3]
B. and C. Direct recognition of Bim 3′UTR by miR-24. [score:2]
As is predicted, miR-24 directly binds two regions in 3′UTR of Bim mRNA (Figure 1E and 1F). [score:2]
In vascular endothelial cells, cell growth, apoptosis and ring formation were also proved to be regulated by miR-24 and Bim. [score:2]
These data demonstrated that the miR-24-Bim pathway play a key role in regulating angiogenesis in PaC. [score:2]
The miR-24-Bim pathway regulates angiogenesis. [score:2]
miR-24 and Bim regulate tumor growth of PaC in vivo. [score:2]
Concerning that Bim mRNA is consistent in PaC, miR-24 may be the main upstream regulator of Bim. [score:2]
It has been made clear that miR-24 plays an important role in regulating cell growth, apoptosis and cell cycle in PaC cell line. [score:2]
It would therefore be of great interest to extend miR-24 to clinical research for the therapy of PaC as well as the other cancers. [score:1]
E. The two predicted binding sites of miR-24 in the 3′UTR of Bim. [score:1]
Based on these reports, we believe that miR-24 is a common oncogene among various types of cancer. [score:1]
D. miR-24 promotes cell proliferation of PANC1 cells (n = 5). [score:1]
The PANC1 cells were treated with lentivirus particles to rapidly produce high intracellular levels of mature miR-24 or Bim, and cells were harvested and injected subcutaneously in the armpit of mice. [score:1]
The expression of miR-24 and Bim in tumors was measured respectively. [score:1]
A. and B. miR-24 increases cell ratio in S phase. [score:1]
Therefore, the miR-24-Bim pathway is essential for tumor growth in both cancer cell proliferation and tumor angiogenesis. [score:1]
It is also clear that miR-24 does not affect Bim mRNA levels in PANC1 cells (Figure 2D). [score:1]
Role of miR-24-Bim pathway in angiogenesis. [score:1]
Figure 6Effects of miR-24-Bim pathway on tumor growth in vivo A. Morphology of the tumors from tumor-implanted nude mice (n = 6). [score:1]
The miR-24 expression was measured by RT-qPCR, and it showed great increase in PaC tissues (Figure 1G). [score:1]
G. Quantitative RT-PCR analysis of miR-24 levels in PaC tissues (n = 6). [score:1]
Thus miR-24 was selected for further experimental verification. [score:1]
Figure 3 A. and B. miR-24 increases cell ratio in S phase. [score:1]
F. Schematic description of the base-pairing interaction between miR-24 and Bim mRNA. [score:1]
To access the role of miR-24 and Bim in angiogenesis of PaC, IHC was performed using anti-CD31 antibody. [score:1]
Effects of miR-24-Bim pathway on tumor growth in vivo. [score:1]
[1 to 20 of 74 sentences]
7
[+] score: 227
Both ANF and BNP were up-regulated 24 hrs after MI, while the up-regulation of ANF and BNP was attenuated in miR-24 transgenic hearts (Fig. 4J), which is similar to miR-24 mimic -treated hearts [24] (Fig. S4). [score:7]
In the transgenic hearts, miR-24 had an even overexpression level, while in mimic -injected hearts, miR-24 had a concentrated overexpression in the injected area but an almost undetectable overexpression in the distant area (Fig. S1). [score:7]
As an important control experiment, we first determined if the inhibition of apoptosis by miR-24 expression in cardiomyocytes affected the degree of myocardial damage. [score:5]
For detailed analysis, we chose the line with a sixfold greater expression of miR-24, an overexpression level not too high to overload the microRNA machinery within the heart. [score:5]
Overexpression of miR-24 led to a decrease in infarct size but no change in AAR (Fig. 4I), suggesting that miR-24 expression reduced cardiac damage shortly after MI. [score:5]
Expression of mature miR-24 was quantified by qPCR, which revealed that the transgenic mice had significantly higher levels of miR-24 expression than their control littermates (Fig. 1A). [score:5]
We have previously demonstrated that miR-24 inhibits cardiomyocytes apoptosis by targeting the pro-apoptotic Bcl2 family protein Bim [24]. [score:5]
We reasoned that if miR-24 prevents the cardiomyocytes from dying, its overexpression in cardiomyocytes themselves would translate into preservation of heart function. [score:5]
Additional pro-survival roles of miR-24 in cardiac fibrosis were identified by Wang and colleagues, who found that overexpression of miR-24 in the MI heart by lentivirus -mediated transduction reduced fibrosis and improved heart function, confirming the beneficial role of miR-24 when expressed under acute injury [29]. [score:5]
Both overexpression and inhibition of miR-24 have been reported to protect heart function upon injury [24, 29], [30, 31]. [score:5]
However, all of the in vivo studies so far used non-genetic approaches, such as viruses and synthetic oligonucleotides, to overexpress or inhibit miR-24. [score:5]
However, the increases in the expression levels of the ER-specific caspase, Caspase 12 and the mitochondria -mediated apoptotic caspase, Caspase 9, were significantly attenuated in infarcted mouse hearts with miR-24 overexpression (Fig. 5 right). [score:5]
Fig. 4Myh6-miR-24 transgenic mice exhibit reduced scar size, lowered stress marker expression and partial restoration of dysregulated miRNAs. [score:4]
To determine the role of miR-24 in the heart more precisely, we turned to genetic approach to specifically overexpress miR-24 in the cardiomyocytes, and demonstrated that miR-24 could directly prevent cardiomyocytes from undergoing apoptosis. [score:4]
Therefore, we tested if miR-24 regulated the same apoptosis pathway in our transgenic mo del where miR-24 is intrinsically overexpressed in cardiomyocytes. [score:4]
Thus, we conclude that miR-24 inhibits Bim and regulates the intrinsic apoptosis in cardiomyocytes. [score:4]
It is also interesting to note that miR-24 targets different apoptotic pathway components when positively or negatively regulating cell death. [score:4]
Consistent with its expression in the adult cardiomyocyte, our study using a cardiac-specific transgenic mo del demonstrates that miR-24 could directly promote cardiomyocytes survival cell autonomously. [score:4]
Fig. 5 miR-24 regulates the intrinsic apoptosis pathways by suppressing the pro-apoptotic protein Bim. [score:4]
In a mouse hypertrophy mo del where the aorta was constricted artificially, suppression of miR-24 protected the heart from transitioning from compensated hypertrophy to decompensated hypertrophy through regulation of L-type Ca [2+] channel-ryanodine receptor signalling [31]. [score:4]
In addition, characterization of co-regulators that restrict miR-24 to specific sets of targets in various tissues and cell types will undoubtedly help define the regulatory network of miR-24. [score:3]
In situ hybridization using miR-24 LNA probe and qPCR further demonstrated that expression of miR-24 in myocardium was sharply reduced upon MI, but restored with miR-24 mimic injection [24]. [score:3]
Identification of the context -dependent downstream targets is also necessary to fully understand miR-24's cell type-specific roles. [score:3]
Functional studies, gene expression and immunohistochemistry (IHC) were analysed in pairs of Myh6-miR-24 (TG) and littermate non-transgenic (WT) male mice. [score:3]
These data indicate that cardiac miR-24 overexpression did not interfere with normal cardiac function and structure under normal physiological conditions. [score:3]
Three independent transgenic lines were established and one line with a sixfold overexpression of miR-24 was extensively studied. [score:3]
For example, pro-apoptotic genes such as FAF-1 [39], Caspase9 [24, 41], Bim [24] and Apaf-1 [41] were reported to mediate miR-24's anti-apoptotic function, while PAK4 and BAD [30] were the targets that mediate miR-24's pro-apoptotic role. [score:3]
For example, miR-24 promotes apoptosis in human umbilical vein endothelial cells [30] and certain human cancer cell lines [37], while it inhibits apoptosis in other human cancer cell lines [38, 39], rodent cardiomyocytes (mouse [24] and rat [40]), frog retinal cells [41] and mouse haematopoietic cells [42]. [score:3]
It has been shown that miR-24 inhibits apoptosis in cardiomyocytes, and that introduction of miR-24 into the heart significantly attenuates cardiac dysfunction [24]. [score:3]
Our previous study using viral delivery of miR-24 mimics has shown that miR-24 inhibits cardiomyocytes apoptosis both in vitro and in vivo [24]. [score:3]
Furthermore, the difference in SV became more significant between two groups (Fig. S2C), suggesting that functional protection by overexpression of miR-24 in cardiomyocytes lasted for at least 4 weeks. [score:3]
In fact, we have shown in the past that miR-24 is also expressed in CFs but not in endothelial cells [24]. [score:3]
We performed qPCR to detecct the expression levels of ANF, BNP and several stress-responsive miRNAs (miR-29, miR-195 and miR-208) in Myh6-miR-24 transgenic and control hearts. [score:3]
This raises an interesting question about which cell type(s) is(are) the primary target of miR-24's protective functions in the heart, particularly under acute injury. [score:3]
It is possible that the contradictory results may be because of the different types of viruses or synthetic oligos delivered into the hearts that may restrict miR-24 expression primarily in one cell type than the other. [score:3]
In addition, cardiac overexpression of miR-24 resulted in scar size reduction and heart function improvement. [score:3]
However, the overall beneficial role of miR-24 in infarcted hearts is mild, and in most cases expression of miR-24 solely in cardiomyocytes is not able to revert the damaged myocardium close to normal. [score:3]
miR-24 modulates intrinsic apoptosis by suppressing Bim in a cell autonomous manner. [score:3]
Similarly, miR-29, miR-195 and miR-208 were dramatically reduced upon MI, but were partially restored by overexpression of miR-24 in cardiomyocytes (Fig. 4K). [score:3]
In this article, we generated a cardiac-specific transgenic mouse mo del of miR-24, in which we utilized the Myh6 promoter to drive the expression of miR-24 in cardiomyocytes in the heart. [score:3]
In addition, we quantified the length of LV anterior wall and LV posterior wall to determine if overexpression of miR-24 in cardiomyocytes could lead to wall thickening or thinning, and did not identify such events (Fig. 1H, top). [score:3]
We report here that Myh6 promoter -driven miR-24 expression was sufficient to promote cardiomyocyte survival post-acute injuries. [score:3]
Delivery of miRNAs using synthetic mimics, however, is more feasible for potential clinical application, while cautions have to be exercised considering the possible side effects of drastic miR-24 overexpression in the injection area. [score:3]
Fig. 1Myh6-miR-24 transgenic mice exhibit elevated miR-24 expression, with no morphological or functional alteration under normal physiological conditions. [score:3]
Next, we asked if expression of miR-24 in cardiomyocytes would lead to any changes in heart function. [score:3]
Taken all together, we provide evidence that miR-24 improves LV function after MI by autonomous inhibition of cardiac cell death. [score:3]
We first determined if a moderate overexpression of miR-24 in adult cardiomyocytes could result in any morphological alteration in the heart. [score:3]
Importantly, although significant advances have been made in understanding the role of miR-24, there had been no simple genetic mo del to precisely and directly test the cardiomyocyte-specific role of miR-24 in the heart. [score:2]
miR-24 mimic injection resulted in a (locally) higher overexpression compared to the transgenic mo del, which might explain the stronger rescue in myocyte death. [score:2]
Compared to miR-24 expression using synthetic mimics, the anti-apoptotic effects were milder in our transgenic mouse mo del (50–60% reduction versus 20–30% reduction in % of apoptotic cardiomyocytes), suggesting that non-autonomous function of miR-24 when delivered into other cells (e. g. CFs) may help promote the survival of cardiomyocytes upon injury. [score:2]
Like other microRNAs, miR-24 regulates a wide range of biological processes, and could exert seemingly opposite effects on different cell types. [score:2]
To elucidate miR-24's regulatory roles, it is important to ascertain its functions under different cellular environmental conditions. [score:2]
The function of miR-24 in the heart is a good example of the potential complexity of a single miRNA's regulatory role. [score:2]
Nevertheless, our data support the notion that miR-24 exerts at least part of its in vivo anti-apoptotic function directly on cardiomyocytes. [score:2]
To investigate whether miR-24 exerts its effects primarily in the cardiomyocytes to promote cell survival, we genetically targeted miR-24 under control of the cardiac-specific Myh6 promoter, which is predominantly activated after embryonic cardiac development [35]. [score:2]
At the molecular level, miR-24 transgenic mice exhibited a lower level of stress markers such as atrial natriuretic factor (ANF) and brain natriuretic peptide (BNP), with partially restored levels of dysregulated miRNAs. [score:2]
To follow-up, we wanted to determine if the anti-apoptotic role of miR-24 is exerted directly on cardiomyocytes or through other cell types. [score:2]
Transgenic mice were produced by microinjection of the Myh6-miR-24 construct into fertilized mouse embryos (C57BL/6 background). [score:1]
On the other hand, pro-apoptotic roles of miR-24 were also reported. [score:1]
miR-24 promotes the survival of cardiomyocytes cell autonomously upon injury. [score:1]
Fig. 2Myh6-miR-24 transgenic mice exhibit reduced cardiomyocyte apoptosis upon myocardial infarction. [score:1]
Generation of Myh6-miR-24 transgenic mice. [score:1]
miR-24 transgenic mice exhibited no significant difference from their littermates under normal physiological conditions. [score:1]
On the one hand, miR-24 has been reported to be pro-survival. [score:1]
It will also be interesting to consider the difference in the timing of functional improvement between miR-24 -mediated approach and reprogramming factors -mediated approach. [score:1]
One injection with a full dosage (40 ng of miR-24 mimic or 40 ng of control mimic, ordered from Shanghai GenePharma Co. [score:1]
All mice showed initial reduction in LV function (FS and EF) after coronary artery ligation, confirming successful induction of MI, while the miR-24 transgenic mice showed alleviated reduction in all parameters (Fig. 3A and B, Fig. S2A and B). [score:1]
However, after MI there was a significant induction of Caspase 3 activity, which was less prominent in miR-24 transgenic hearts (Fig. 5 right). [score:1]
miR-24 was also found to promote CPC's functional engraftment in a study led by Hu et al., where miR-24 was used as part of an anti-apoptotic cocktail to promote the survival of stem cell-derived CPCs for transplantation into MI hearts [28]. [score:1]
Previous studies revealed critical roles of miR-24 in promoting cell survival, especially in murine cardiomyocytes, suggesting a potential therapeutic application [24]. [score:1]
Improved heart function in infarcted Myh6-miR-24 transgenic mice. [score:1]
Reduced scar size in infarcted Myh6-miR-24 transgenic mice. [score:1]
In addition, our data also suggest that miR-24 could have a cell non-autonomous effect when delivered into other cardiac cell types to promote the survival of the cardiomyocytes upon injury. [score:1]
On the basis of the observation that cardiomyocyte death was attenuated and cardiac function was improved in Myh6-miR-24 transgenic mice, we tested if these would be correlated with reduction in scar size. [score:1]
miR-24 mice showed partial restoration of these miRNAs. [score:1]
In vivo delivery of miR-24 mimic With the chest open, oligos stabilized with 2′-O-methyl modification pre -treated with 20 μl of lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) were injected into the myocardium through an insulin syringe with incorporated 29G needle (BD Biosciences, San Jose, CA, USA) into the myocardium. [score:1]
Fig. 3Myh6-miR-24 transgenic mice exhibit improved heart function upon myocardial infarction. [score:1]
In summary, characterizing how miR-24 promotes cell survival in the heart is a necessary next step for designing therapeutic strategies for cardiovascular diseases. [score:1]
To generate the Myh6-miR-24 mice, a cDNA construct containing a 400-bp mouse genomic region encompassing the miR-24-2 locus was cloned downstream of the mouse cardiac myosin heavy chain (α MHC/ Myh6) promoter. [score:1]
It will be interesting to determine if a similar or opposite effect can be observed in endothelial specific miR-24 transgenics (e. g. Tie1-miR-24 or VE-cadherin-miR-24) and/or fibroblast specific miR-24 transgenics (e. g. Fsp1-miR-24 or Periostin-miR-24 or Tcf21-miR-24). [score:1]
miR-24 tg mice showed reduced infarct size. [score:1]
miR-24 mice showed lowered levels of stress markers. [score:1]
We combined Caspase 3 labelling with the cardiomyocyte marker α-Actinin on infarcted mouse hearts from Myh6-miR-24 transgenic, wild-type littermate controls and mice treated with miR-24 mimics (Fig. 2A–C'). [score:1]
Therefore, it will be interesting to test the pro-survival role of miR-24 in other cell types to device potential microRNA-therapy in additional tissues or organs. [score:1]
Although statistically significant, the increase in each function parameter was not as dramatic as from the previous study where miR-24 mimics were delivered virally (Fig. S3), suggesting additional beneficial effects might be executed through other cell types than cardiomyocytes. [score:1]
In vivo delivery of miR-24 mimic. [score:1]
It has been demonstrated that miR-24 plays a role in a variety of cell types in the heart, including cardiomyocytes [24, 36], fibroblasts [29], as well as endothelial cells [30]. [score:1]
[1 to 20 of 87 sentences]
8
[+] score: 186
The study also proves that LINC01088 can target miR-24-1-5p to regulate the expression of PAK4, and influence cell proliferation and migration. [score:6]
The western blotting data indicated that PAK4 expression in A2780 cells stably transfected with miR-24-1-5p recombinant plasmids was indeed lessened (Fig.   4D), while LINC01088 had no direct effect on the expression of PAK4 (data not shown). [score:6]
In our study, we demonstrated that LINC01088 targeted miR-24-1-5p to regulate the expression of PAK4, but the exact mechanism of the interaction between LINC01088 and miR-24-1-5p required further exploration. [score:6]
Taken together, these findings demonstrated that PAK4 was the target of miR-24-1-5p, indicating that miR-24-1-5p might participate in the development and progression of epithelial ovarian tumors by targeting PAK4. [score:6]
The above experiments demonstrated that LINC01088 might suppress cell growth by targeting miR-24-1-5p. [score:5]
This is inconsistent with our results which suggest that cells with increased expression of miR-24-1-5p and decreased expression of PAK4 demonstrate enhanced proliferation. [score:5]
The relative LINC01088 expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the relative miR-24-1-5p expression was normalized to miR-484, and analysed by the 2 [−ΔΔCt] method. [score:5]
Inoguchi et al. [25] also verified that miR-24-1-5p inhibited bladder cancer cell proliferation by targeting forkhead box protein M1 (FOXM1). [score:5]
Moreover, we performed in vivo experiment with cells stably overexpressing miR-24-1-5p +  LINC01088, the result showed that LINC01088 inhibited tumor growth facilitated by miR-24-1-5p (Fig.   3E). [score:5]
Plasmids expressing miR-24-1-5p were transfected into A2780 cells to establish stable cell line expressing miR-24-1-5p. [score:5]
Further exploration indicated that miR-24-1-5p was a target of LINC01088, which provided experimental support for the role of LINC01088 in effective suppression of the occurrence of epithelial ovarian cancers. [score:5]
Lastly, we detected PAK4 expression in miR-24-1-5p -expressing cells. [score:5]
This study confirmed that miR-24-1-5p could promote epithelial ovarian tumors by negatively regulating PAK4 expression. [score:4]
The brief diagrammatic representation is made in the Fig.   6. This implies that LINC01088 might inhibit the development of epithelial ovarian tumors through its interaction with miR-24-1-5p and the downstream effector protein PAK4. [score:4]
PAK4 is the potential target of miR-24-1-5pIt had previously been demonstrated that miR-24-1-5p increased in benign epithelial ovarian tumors and promoted cell proliferation, and was also involved in the development of epithelial ovarian tumors. [score:4]
The luciferase activity assay showed that miR-24-1-5p could significantly inhibited firefly luciferase activity (Fig.   2G), indicating that LINC01088 could target miR-24-1-5p. [score:4]
This study demonstrates that the expression of LINC01088 is lowered in benign epithelial ovarian tumors compared to normal ovarian epithelial tissues, and LINC01088 expression has a negative correlation with that of miR-24-1-5p. [score:4]
Western blot was conducted to examine the protein expression of PAK4 in A2780 cells stably transfected with pcDNA6.2-GW/ EmGFP-miR-24-1-5p or control plasmids (cropped; full length blots can be found in Supplementary Fig.   S1). [score:3]
The solution was then added into each well of the 6-well plate and culture for 48 h. Establishment of stable cell line expressing miR-24-1-5pA2780 cells transfected with recombinant plasmids of miR-24-1-5p or miR-LacZ for 48 h were harvested for flow cytometry sorting based on green fluorescent protein (GFP) accumulation. [score:3]
Gene ‘BLAST’ on NCBI suggested that PAK4 was the possible target of miR-24-1-5p (Fig.   4A). [score:3]
As reported in Braoudaki’s retrospective study in patients with ependymoma (EP) [22], miR-24-1-5p was up-regulated significantly in relapse and progression cases compared to clinical remission and survival cases. [score:3]
miR-24-1-5p is a target of LINC01088. [score:3]
Establishment of stable cell line expressing miR-24-1-5p. [score:3]
Figure 2 miR-24-1-5p is a target of LINC01088. [score:3]
Cells transfected with LINC01088-, miR-24-1-5p- or LINC01088 +  miR-24-1-5p- overexpressing plasmids were injected subcutaneously in the dorsal flank of the nude mice. [score:3]
Figure 4 PAK4 is the potential target of miR-24-1-5p. [score:3]
While Goto et al. [24] indicated that miR-24-1-5p could clearly inhibit cell proliferation, migration and metastasis in prostate cancer. [score:3]
Construction of miR-24-1-5p expression plasmids. [score:3]
Furthermore, we transfected A2780 cells with miR-24-1-5p expressing plasmids labeled with biotin and tested LINC01088 by PCR using RNA sediments “pulled-down” by co-precipitation, and the results proved the existence of LINC01088 (Fig.   2F). [score:3]
Balb/c nude mice were subcutaneously implanted with cells stably overexpressing miR-24-1-5p. [score:3]
miR-24-1-5p is a target of LINC01088To determine the role of LINC01088 in tumorigenesis of ovarian epithelial cells, we constructed LINC01088-lentiviral vectors and transfected them into A2780 cells. [score:3]
Hence, we studied the target genes downstream of miR-24-1-5p further. [score:3]
PAK4 is the potential target of miR-24-1-5p. [score:3]
Data are represented as mean +/− SD, **means P < 0.01 vs normal group (ANOVA) and showed a negative relation between the expression LINC01088 and miR-24-1-5p (spearman rank correlation was −0.568, P < 0.01). [score:3]
The demonstrated that miR-24-1-5p cloud remarkably facilitated cell proliferation, while LINC01088 distinctly inhibited cell proliferation promoted by miR-24-1-5p (Fig.   3A). [score:3]
A2780 cells were transiently transfected with 5ug miR-24-1-5p expression plasmids labeled with biotin using Lipofectamine 3000 (Invitrogen, USA) for 48 h. The cells were then lysed in RIPA buffer and centrifuged at 14 800 rpm to remove the precipitate. [score:3]
To verify the interaction between LINC01088 and miR-24-1-5p, we conducted RT-qPCR analysis using a total of 22 clinical tissue samples, and found a negative correlation between the expression levels of LINC01088 and miR-24-1-5p (spearman rank correlation was −0.568, P < 0.01) (Fig.   2D,E). [score:3]
Construction of miR-24-1-5p expression plasmidsThe genetic sequence of mature miR-24-1-5p (MIMAT0000079) was identified by using Genbank. [score:3]
A2780 cells were transiently transfected with miR-24-1-5p expression plasmids labeled with biotin, PCR was performed to detect LINC01088 after reverse transcription through Oligo dT15. [score:3]
During the course of this study, it was demonstrated that PAK4 was the target of miR-24-1-5p. [score:3]
Thus, it can be summarized that the proliferation of ovarian cancer cells is regulated by numerous factors, miR-24-1-5p and PAK4 are only the tip of the iceberg. [score:2]
It had previously been demonstrated that miR-24-1-5p increased in benign epithelial ovarian tumors and promoted cell proliferation, and was also involved in the development of epithelial ovarian tumors. [score:2]
The luciferase activity assay showed that miR-24-1-5p inhibited firefly luciferase activity dramatically (Fig.   4C). [score:2]
Figure 3 LINC01088 reduces cell proliferation promoted by miR-24-1-5p. [score:1]
Next, we went on to explore the effect of miR-24-1-5p on the growth of ovarian epithelial cells. [score:1]
Female Balb/c nude mice were randomly divided into four groups (control, miR-24-1-5p, LINC01088 and miR-24-1-5p +  LINC01088). [score:1]
Has-mir-24 has two forms, mir-24-1 and mir-24-2, located on Chromosome 9 and Chromosome 19 respectively [21], which includes three mature sequences, miR-24-1-5p, miR-24-3p and miR-24-2-5p. [score:1]
Gene Blasting was performed and two potential binding sites between miR-24-1-5p and PAK4 were found. [score:1]
showed that there was an interaction between LINC01088 and miR-24-1-5p. [score:1]
However, the possible roles of miR-24-1-5p in epithelial ovarian tumors haven’t been reported yet. [score:1]
After reverse transcription, real-time qPCR was conducted to determine the miR-24-1-5p level in 12 benign epithelial ovarian tumor tissue specimens and the matched normal tissues. [score:1]
Figure 6Schematic representation of the interaction among LINC01088, miR-24-1-5p and PAK4. [score:1]
was performed among control group, miR-24-1-5p group, miR-24-1-5p +  LINC01088 group and LINC01088 group to determine cell proliferation. [score:1]
LINC01088 reduces cell proliferation promoted by miR-24-1-5pThe experiments described above demonstrated the interaction between LINC01088 and miR-24-1-5p. [score:1]
The relative luciferase activity was notably decreased in A2780 cells co -transfected with pcDNA6.2-GW/EmGFP-miR-24-1-5p, PRL-TK and pMIR-PAK4 3′UTR reporter plasmids. [score:1]
The diameter of the scratch was recorded under light microscopy at 24 h. Female Balb/c nude mice (5–6 weeks old) were randomly divided into groups (control, miR-24-1-5p, LINC01088 and miR-24-1-5p +  LINC01088), and each group contained five mice. [score:1]
The solution was then added into each well of the 6-well plate and culture for 48 h. A2780 cells transfected with recombinant plasmids of miR-24-1-5p or miR-LacZ for 48 h were harvested for flow cytometry sorting based on green fluorescent protein (GFP) accumulation. [score:1]
Firstly, we assessed the impact of miR-24-1-5p on cell proliferation. [score:1]
The reverse transcription of miR-24-1-5p was conducted at 16 °C for 30 min and then 42 °C for 30 min, inactivated by incubating at 85 °C for 5 min (TaqMan, USA). [score:1]
To date, the action mechanism of miR-24-1-5p in carcinomas remains unclear. [score:1]
The experiments described above demonstrated the interaction between LINC01088 and miR-24-1-5p. [score:1]
The genetic sequence of mature miR-24-1-5p (MIMAT0000079) was identified by using Genbank. [score:1]
These findings suggested that miR-24-1-5p promoted cell proliferation but did not affect cell migration, hinting that miR-24-1-5p was an oncogene and LINC01088 could reduce cell proliferation promoted by miR-24-1-5p. [score:1]
LINC01088 reduces cell proliferation promoted by miR-24-1-5p. [score:1]
The relative luciferase activity was notably decreased in A2780 cells co -transfected with pcDNA6.2-GW/EmGFP-miR-24-1-5p, PRL-TK and pMIR-LINC01088 reporter plasmids. [score:1]
Gene Blasting was performed and found two potential binding sites between LINC01088 and miR-24-1-5p. [score:1]
At last, we explored the influence of miR-24-1-5p on tumorigenicity in animals. [score:1]
Female Balb/c nude mice were subcutaneously implanted with A2780 cells stably transfected with pcDNA6.2-GW/EmGFP-miR-24-1-5p or pcDNA6.2-GW/EmGFP-miR-LacZ controls, respectively. [score:1]
The reverse transcription products of miR-24-1-5p were mixed with TaqMan universal PCR master mix II (ABI, USA) and the mixture was incubated at 95 °C for 10 min, followed by 40 cycles, with an extension time of 15 s each at 95 °C and 60 s each at 60 °C. [score:1]
gov and found out that miR-24-1-5p had two binding sites for LINC01088 (Fig.   2C). [score:1]
[1 to 20 of 70 sentences]
9
[+] score: 182
Figure 6BNIP3 was the direct target of miR-24-3p, and its expression level changed after miR-24-3p overexpression or silencing in U87-GSCs and U251-GSCs. [score:8]
MiR-24-3p silencing up-regulated LC3-II/I ratio and BNIP3 expression and reduce P62, TOMM 20, and CYPD expression. [score:7]
The combination of miR-24-3p, EMAP-II and TMZ inhibited tumor growth in vivo by inducing BNIP3 -mediated mitophagyTo prove the above findings, the growth -inhibitory effect of EMAP-II, TMZ and miR-24-3p inhibitor on U87-GSCs and U251-GSCs was tested in xenografted mice. [score:7]
Regarding the mechanisms underlying this effect, the combination of TMZ and EMAP-II upregulated BNIP3 expression by down -regulating miR-24-3p, thereby strengthening BNIP3 -mediated mitophagy. [score:7]
This study aims to verify whether low-dose EMAP-II enhances the cytotoxic effects of TMZ on GSCs and explores the mechanism by which EMAP-II induces BNIP3 -dependent mitophagy via miR-24-3p down-regulation to enhance the inhibitory effects of TMZ on GSC malignant biological behavior. [score:6]
To furtherly explore whether miR-24-3p could affect BNIP3 in the combination of EMAP-II and TMZ, GSCs were treated with EMAP-II and TMZ on the basis of over-express or down-regulate miR-24-3p. [score:6]
To prove the above findings, the growth -inhibitory effect of EMAP-II, TMZ and miR-24-3p inhibitor on U87-GSCs and U251-GSCs was tested in xenografted mice. [score:5]
miRNA-24-3p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting p27Kip1. [score:5]
Previous study show miR-24-3p promoted cell proliferation and inhibited apoptosis in human breast cancer cells by targeting p27Kip1 (Lu et al., 2015). [score:5]
Tumor-bearing mice were divided into the following four groups: (1) Control group, whose mice treated with 0.9% sodium chloride; (2) EMAP-II+TMZ group, whose mice were treated with 400 μM TMZ after pretreatment with 0.05 nM EMAP-II for 0.5 h; (3) miR-24-3p(–) group, whose mice were treated with cells stably expressing miR-24-3p(–); (4) EMAP-II+TMZ+miR-24-3p(–) group, whose mice were treated with cells stably expressing miR-24-3p(–) and 400 μM TMZ after pretreatment with 0.05 nM EMAP-II for 0.5 h. The cells were fixed in 2.5% glutaraldehyde (electron microscopy grade) in phosphate-buffered saline (PBS) at 4°C for 2 h, dehydrated in an ethanol series and embedded in Epon resin. [score:5]
Combination treatment with EMAP-II and TMZ induced mitophagy and inhibited GSC malignant behavior by down -regulating miR-24-3p. [score:4]
The combination of TMZ and EMAP-II induced mitophagy to inhibit malignant GSC behavior by down -regulating miR-24-3p. [score:4]
All the results indicated that combination treatment with EMAP-II and TMZ induced mitophagy and inhibited GSC malignant behavior by down -regulating miR-24-3p. [score:4]
Compared with control group, The LC3-II/I ratio and BNIP3 expression was increased (P < 0.05, P < 0.05), but P62, TOMM20 and CYPD expression levels were decreased in the EMAP-II+TMZ, miR-24-3p(–) and miR-24-3p(–)+EMAP-II+TMZ groups [P < 0.05, P < 0.05, P < 0.05). [score:4]
MiR-24-3p overexpression or silencing do not influence BNIP3 mRNA expression. [score:4]
These resultsillustrate that miR-24-3p negatively regulates BNIP3, which inhibits mitophagy and promotes GSC proliferation, migration and invasion. [score:4]
miR-24 up-regulation in oral carcinoma: positive association from clinical and in vitro analysis. [score:4]
Compared with the EMAP-II+TMZ, miR-24-3p(–) group, The LC3-II/I ratio and BNIP3 expression was increased (P < 0.05, P < 0.05)], but P62, TOMM20 and CYPD expression levels were decreased in miR-24-3p(–)+EMAP-II+TMZ group(P < 0.05, P < 0.05, P < 0.05). [score:4]
MiR-24-3p overexpression decreased the LC3-II/I ratio and increased P62, TOMM20, and CYPD expression levels. [score:4]
Figure 7The effects of miR-24-3p and BNIP3 on mitophagy-related protein expression levels and U87-GSC and U251-GSC malignant behavior. [score:3]
BNIP3 was found to be the target gene of miR-24-3p using bioinformatics software. [score:3]
Figure 5The effects of miR-24-3p on mitophagy-related protein expression levels and U87-GSC and U251-GSC malignant behavior. [score:3]
By using TargetScan Human Release 6.2 Software, there was a potential binding site between miR-24-3p and 3′-UTR of BNIP3. [score:3]
The LC3-II/I ratio and BNIP3 increased, but P62, TOMM 20, and CYPD expression decreased in the miR-24-3p(–)+EMAP-II+TMZ group. [score:3]
The expression of mitophagy-related proteins was affected by cotransfection of BNIP3 and miR-24-3p. [score:3]
The miR-24-3p(–) indicates miR-24-3p inhibition. [score:3]
We also found that the combinaltion of TMZ and EMAP-II decreased miR-24-3p expression and that. [score:3]
After infection, the cells that stably expressed the miR-24-3p-silencer [miR-24-3p(–)] were selected. [score:3]
Our results showed that the combination of EMAP-II and TMZ reduced miR-24-3p expression. [score:3]
Furthermore, we also found that combination of miR-24-3p(–), EMAP-II and TMZ inhibited tumor growth in vivo. [score:3]
BNIP3 was the target gene of miR-24-3p. [score:3]
Data are presented as the mean ± SD of n = 3. (C) of BNIP3 levels in U87-GSCs and U251-GSCs treated with EMAP-II and TMZ on the basis of miR-24-3p overexpression or silencing. [score:3]
The combination of miR-24-3p, EMAP-II and TMZ inhibited tumor growth in vivo by inducing BNIP3 -mediated mitophagy. [score:3]
The expression level of miR-24-3p in GSCs was detected by real-time PCR. [score:3]
MiR-24-3p overexpression also promoted the abilities of GSC proliferation, migration, and invasion. [score:2]
MiR-24-3p expression levels were decreased in the EMAP-II and TMZ groups and the EMAP-II and TMZ combination group (P < 0.05). [score:2]
MiR-24-3p silencing inhibited GSC proliferation, migration, and invasion. [score:2]
Moreover, miR-24-3p promoted cell proliferation in glioma cells via cooperative regulation of MXI1 (Xu et al., 2013). [score:2]
And can EMAP-II and TMZ regulated mitophagy via miR-24-3p? [score:2]
miR-24-3p and miR-27a-3p promote cell proliferation in glioma cells via cooperative regulation of MXI1. [score:2]
BNIP3 -mediated mitophagy influenced GSC malignant behavior by down -regulating miR-24-3p. [score:2]
QRT-PCR was performed using TaqMan Universal Master Mix II with Taq-Man microRNA assays for miR-24-3p and U6 expression. [score:2]
MiR-24-3p has been found to be significantly overexpressed in oral squamous cell carcinoma (Lin et al., 2010) and promotes glioma cell proliferation (Xu et al., 2013). [score:2]
While miR-24-3p knockdown exerts the opposite effects. [score:2]
MiR-24-3p expression levels were obviously decreased in the EMAP-II and TMZ combination group. [score:2]
In particular, the miR-24-3p(−)+EMAP-II+TMZ group had the smallest tumors and the longest survival time. [score:1]
The minimum volume occured in the miR-24-3p(–)+EMAP-II+TMZ group. [score:1]
The minimum volume was noted in the miR-24-3p(–)+EMAP-II+TMZ group (Figures 8A–C). [score:1]
The miR-24-3p silencer was ligated into the pLenti6.3/V5eDEST vector (GenePharma, Shanghai, China), and then a pLenti6.3/V5eDEST-miR-24-3p-silencing vector was generated. [score:1]
However, whether EMAP-II induces mitophagy in GSCs via miR-24-3p and enhances the cytotoxic effects of TMZ on GSCs has not been reported. [score:1]
The tumor volumes of the xenografts were significantly smaller in the EMAP-II+TMZ, miR-24-3p(–) and miR-24-3p(–)+EMAP-II+TMZ groups than in the Control group. [score:1]
To investigate whether BNIP3 participated in the effects exerted by the combination of EMAP-II and TMZ on GSCs, we divided the cells into the following four groups (n = 3): (1) Control group; (2) EMAP-II+TMZ group, whose cells were treated with 400 μM TMZ for 48 h after pretreatment with 0.05 nM EMAP-II for 0.5 h; (3) BNIP3(+)+EMAP-II+TMZ group, whose BNIP3 -overexpressing cells were treated with 400 μM TMZ for 48 h after pretreatment with 0.05 nM EMAP-II for 0.5 h; and (4) BNIP3(–)+EMAP-II+TMZ group, whose BNIP3-silenced cells were treated with 400 μM TMZ for 48 h after pretreatment with 0.05 nM EMAP-II for 0.5 h. To study the effects of miR-24-3p on mitophagy in GSCs, we divided the cells into the following five groups (n = 3): (1) Control group; (2) Agomir-24-3p-NC group, whose cells were transfected with an NC miR-24-3p agomir; (3) Agomir-24-3p group, whose cells were transfected with a miR-24-3p agomir; (4) Antagomir-24-3p-NC group, whose cells were transfected with an NC miR-24-3p antagomir; and (5) Antagomir-24-3p group, whose cells were transfected with a miR-24-3p antagomir. [score:1]
A lentivirus encoding a miR-24-3p silencer was generated using a pLenti6.3/V5eDEST Gateway Vector Kit (Life Technologies Corporation, Carlsbad, CA, USA). [score:1]
miR-24-3p(–) group, [$] P < 0.05 vs. [score:1]
Mouse survival time were much longer in the EMAP-II+TMZ, miR-24-3p(–) and miR-24-3p(–)+EMAP-II+TMZ groups than in the Control group. [score:1]
All the results show that miR-24-3p-BNIP3- mitophagy is related with xenografted tumor growth. [score:1]
The results of our experiments with the xenografted mice showed that the EMAP-II+TMZ, miR-24-3p(–) and miR-24-3p(–)+EMAP-II+TMZ groups had smaller tumors and longer survival times than the other groups. [score:1]
Mitophagy-related proteins were affected by miR-24-3p. [score:1]
Mouse survival time was significantly longer in the miR-24-3p(–)+EMAP-II+TMZ group than in the other groups (Figure 8D). [score:1]
MiR-24-3p expression levels were decreased in the EMAP-II and TMZ combination group compared with the EMAP-II and TMZ groups (P < 0.05; Figure 5A). [score:1]
The cells were transfected with a miR-24-3p agomir, miR-24-3p antagomir, or the appropriate NC (GenePharma, Shanghai, China) using Lipofectamine 3,000 reagent (Life Technologies Corporation), according to the manufacturer's instructions. [score:1]
Mouse survival time was significantly longer in the miR-24-3p(–)+EMAP-II+TMZ group than in the other groups. [score:1]
The results of these studies suggested that miR-24-3p may serve as an oncomir. [score:1]
[1 to 20 of 63 sentences]
10
[+] score: 136
Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation. [score:6]
The aforementioned experiments suggested that in addition to effecting erythroid differentiation, upregulated GATA-1 bound and activated the miR-27a and miR-24 genes, which led to further repression of GATA-2 translation and facilitated GATA-1 replacement of GATA-2 at miRNAs promoter (Figure 6A). [score:6]
Here, miR-27a and miR-24 perform post-transcriptional protection through repressing the translation of GATA-2, which should not be expressed in differentiated erythroid cells. [score:5]
In contrast to miR-451 locus whose expression was restricted to the fetal liver in embryonic day (E) 16.5 mouse embryos, the major site of haematopoiesis and erythropoiesis at this stage of development, miR-27a and miR-24 seem to serve as universal regulators in different cell types. [score:5]
As expected, the percentage of benzidine -positive cells (Supplementary Figure S4A) and gamma-globin accumulation (Supplementary Figure S4B) increased in miR-27a or miR-24 over-expressed K562s, whereas the percentage of benzidine -positive cells decreased in K562s following the inhibition of miR-27a or miR-24. [score:5]
Increased GATA-2 expression led to a decrease in the levels of Pri-27a∼24 and mature miR-27a or miR-24 (Figure 5E), whereas GATA-2 knock-down increased the transcription and maturation of miR-27a and miR-24 (Figure 5E). [score:4]
Figure 5. The GATA switch regulated miR-27a and miR-24 expression. [score:4]
Collectively, the expression patterns of miR-27a and miR-24 in two separate erythroid differentiation mo dels (K562s and HPCs) suggested that they may be two potential regulators of erythroid differentiation. [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:4]
Therefore, miR-27a and miR-24 accelerated the development of mature erythroid populations by repressing GATA-2 expression in transplanted mouse mo dels. [score:4]
Remarkably, only a few reports have raised concerns about the expression of miR-27a and miR-24 in haematopoiesis (30, 31). [score:3]
These binding changes resulted in transcriptional changes of miR-27a and miR-24, as evidenced by an increase or decrease in their primary and mature transcripts on GATA-1 over -expression or silencing (Figure 1H). [score:3]
miRNA mimics (miR-27 a and miR-24), miRNA inhibitors (Anti-27a and Anti-24) and negative control molecules (Scramble) were obtained from Dharmacon (Austin, TX, USA) and transfected with DharmFECT1 (Dharmacon, Austin, TX, USA) at a final concentration of 60 nM. [score:3]
These results were consistent with the expression levels of miR-27a and miR-24 (Figure 5E). [score:3]
To determine whether GATA-1 would influence the expression of miR-27a and miR-24, the primary and mature transcripts of miR-27a and miR-24 were evaluated in K562s transfected with siRNAs specific to GATA-1 or constructs overexpressing GATA-1 (Figure 1G). [score:3]
Similarly, inhibition of miR-27a or miR-24 resulted in increased GATA-2 occupancy and decreased GATA-1 binding with DNA sequences (Figure 6B and C). [score:3]
Enforced expression of miR-27a and miR-24 in mouse enhanced mature erythroid populations. [score:3]
The effect of GATA-1 on miR-27a and miR-24 expression in HPC erythroid differentiation was examined. [score:3]
These data suggested that the inhibition of GATA-2 could rescue the erythroid deficiency caused by miR-27a or miR-24 silencing. [score:3]
Figure 7. MiR-27a and miR-24 overexpression enhanced erythropoiesis in mice. [score:3]
Over -expression of miR-27a or miR-24 decreased the binding of GATA-2 and increased GATA-1 occupancy (Figure 6B and C). [score:3]
Our study demonstrates that GATA factors elaborately control the transcription of miR-27a and miR-24 and reveals a regulatory circuit that regulates the GATA-1/2 switch via miR-27a and miR-24 to promote erythroid maturation. [score:3]
MiR-27a and miR-24 co -targeted GATA-2 in erythrocytes. [score:3]
By the light of nature, we further demonstrated the GATA-1/miR-27a/24/GATA-2 regulatory circuit in human erythroid cells, representing the decoding of an expansive regulatory layer of GATA-1 and GATA-2. In details, GATA-2 localized to chromatin sites of the miRNA promoter and transcriptionally repressed miR-27a and miR-24 in early stage erythroblasts. [score:3]
As expected, treatment with miR-27a or miR-24 mimics increased the level of primary transcript in K562s, whereas repression of miR-27a or miR-24 by miRNA inhibitors decreased the level of pri-miRNA (Figure 6D). [score:3]
Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
Figure 3. Suppression of miR-27a or miR-24 blocked erythroid differentiation in zebrafish. [score:3]
Animals that displayed miR-27a and miR-24 overexpression demonstrated an increase in region 3 (R3) of CD71 [low]/TER119 [high] erythrocytes and a concomitant decrease in region 1 (R1) of CD71 [high]/TER119 [high] erythroblasts from bone marrow and spleen (Figure 7A, B). [score:3]
Zebrafish demonstrate increased miR-27a and miR-24 levels during development and is a classic and reliable mo del to study haematopoietic gene function (Figure 3B). [score:2]
MiR-27a and miR-24 mediated a forward regulatory circuit composed of a GATA switch. [score:2]
A previous study reported the effect of miR-24 on zebrafish cardiac development (15). [score:2]
GATA-2 modulated the regulatory effects of miR-27a and miR-24 on erythroid differentiation. [score:2]
To analyse the roles of miR-27a and miR-24 in vivo, we used miRNA MOs to test whether the knock-down of endogenous miRNAs would affect zebrafish erythropoiesis. [score:2]
Figure 2. MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
We speculate that miR-27a and miR-24 may serve at a ‘standby state’, which means they are ready for the manipulation by different cellular factors, as GATA-1 in erythropoiesis, c-MYC in tumour metastasis (33), Runx2 in osteoblast differentiation (28) and PU. [score:1]
Data from control (SCR, n = 3), miR-27a (n = 3) and miR-24 (n = 3) animals are shown as the means ± SD. [score:1]
As expected, miR-27a and miR-24 reduced luciferase gene activity by ∼50% and ∼30%, respectively. [score:1]
With the exception of observations from the activin -induced haematopoietic differentiation mo del (32), miR-27a and miR-24 have been constantly demonstrated increased accumulation as differentiation proceeds, which support the idea that activation of the miR-27a and miR-24 loci might be required for the terminally differentiated cells. [score:1]
Overall, the aberrant miR-27a or miR-24 levels fed back to positively modulate the level of their own primary transcripts. [score:1]
MiR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs. [score:1]
A conservation analysis of miR-27a and miR-24 sequences indicated that they are highly conserved among multiple species, including zebrafish (Figure 3A). [score:1]
A bioinformatic analysis showed that the GATA-2 3′ UTR has potential binding sites for both miR-27a and miR-24 (Figure 4A). [score:1]
Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24. [score:1]
Thus, our attempt to investigate the regulatory mechanism of miR-27a and miR-24 during erythropoiesis led to the identification of another erythroid GATA member, GATA-2. Figure 4. GATA-2 was post-transcriptionally regulated by miR-27a and miR-24 during erythropoiesis. [score:1]
Meanwhile, in vitro and in vivo functional analyses indicated that miR-27a and miR-24 promoted erythroid differentiation in CD34+ HPCs, zebrafish and mice. [score:1]
Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D). [score:1]
These results suggested that miR-27a and miR-24 are required for erythroid differentiation during primitive haematopoiesis in zebrafish. [score:1]
Cell-counting analyses at different stages of differentiation showed an increase of mature erythroblasts (orthochromatic and erythrocyte) in miR-27a- or miR-24-transduced HPCs with a concomitant decrease of immature erythroblasts (basophilic and polychromatic erythroblasts) (Figure 2A and B). [score:1]
To test the roles of miR-27a and miR-24 in vivo, we conducted transplantation experiments in mice. [score:1]
Moreover, the miRNA-transduced HPCs generated larger colonies, when a typical BFU-E generated by GFP-transduced HPCs was ∼30∼60 μm, whereas the miR-27a- or miR-24 colonies were larger than 100 μm (Supplementary Figure S2E). [score:1]
MiR-27a and miR-24 display completely evolutionary conservation among eukaryotes and are organized in a cluster on chromosome 19 of the human genome. [score:1]
Additionally, a reduction in hbbe3 and scl staining was also observed in miR-27a and miR-24 MOs -injected embryos at 10 somites (Figure 3G), which suggested an impairment of early erythroid differentiation by miRNA MOs treatment. [score:1]
The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:1]
For measurement of Pri-miR-27a∼24-2, miR-27a and 24 expression, q-PCR was performed using Taqman probes (Applied Biosystems, Foster City, CA, USA): pri-miR-27a∼24 (Hs03294931_pri), miR-27a (TM408), miR-24 (TM402), human GAPDH (Hs9999905_M1), RNU6B (TM1093) according to manufacturer’s instruction. [score:1]
To determine the effect of miR-27a and miR-24 on erythrocyte differentiation in adult haematopoietic tissues, a flow cytometry analysis was performed 8 weeks post-transplantation. [score:1]
As erythropoiesis proceeds, GATA-1 level increased, and GATA-1 displaced GATA-2 from their shared binding site, thus leading to transcriptional activation of miR-27a and miR-24 (Figure 6E). [score:1]
This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29). [score:1]
Taken together, these results demonstrated that miR-27a and miR-24 were required for the proper erythroid differentiation in primary cultured CD34+ HPCs. [score:1]
[1 to 20 of 58 sentences]
11
[+] score: 118
The expression of miR-24 due to sustained JNK activation may lead to a suppression of SR-B1, which in turn can potentially suppress JNK (ref). [score:7]
Taken together, our data reveal that JNK-miR-24 directly contributes to the suppression of Smad4 expression, which leads to a subsequent reduction of homeostatic negative regulator IRAK-M, in low-grade inflammatory monocytes programmed by super-low-dose LPS. [score:7]
Our data map out an integrated negative feedback circuit that involves JNK-miR-24 -mediated suppression of Smad4, which in turn leads to reduced expression of IRAK-M. The reduction of IRAK-M may allow sustained elevation of JNK and miR-24 in low-grade inflammatory monocytes programmed by super-low-dose LPS (Fig. 7a). [score:5]
Given the known role of IRAK-M in suppressing JNK activation and causing monocyte tolerance 13, we plan to further confirm that the disruption of IRAK-M may lead to non-resolving inflammatory monocyte polarization through sustained miR-24 expression. [score:5]
Indeed, we demonstrated that the selective JNK inhibitor SP600125 potently inhibited the induction of miR-24 in the CD11b [+]Ly6C [++] pro-inflammatory monocytes challenged by super-low-dose LPS (Fig. 5b). [score:5]
The levels of miR-24 expressed in splenocytes of HFD-fed ApoE [−/−]/ Irak-M [−/−] mice were significantly higher as compared with the miR-24 levels expressed in splenocytes of HFD-fed ApoE [−/−] mice (Fig. 7k). [score:4]
Our data complement these studies and further define molecular mechanisms responsible for the reduction of SR-B1 by super-low-dose LPS, through the upregulation of miR-24. [score:4]
However, our study serves as a key step to present at least the cardinal principle for the establishment of non-resolving low-grade inflammation, with a specific focus on the disruption of a cardinal negative feedback regulator IRAK-M mediated by sustained expression of miR-24. [score:4]
We demonstrated that the reduction in IRAK-M is also coupled to the reduction of SR-B1, aided by sustained activation of JNK and expression of miR-24. [score:3]
Given our above finding of sustained elevation of miR-24 mediated by chronic JNK activation, we tested whether elevated miR-24 may be critically responsible for the reduction of Smad4 mRNA and its downstream target IRAK-M. We observed that the application of miR-24 antagomir in cultured monocytes restored the RNA levels of both Smad4 and IRAK-M reduced by super-low-dose LPS (Fig. 6e,f). [score:3]
Bone marrow cells isolated from WT C57 BL/6 mice or IRAK-M [−/−] mice were cultured in RPMI 1640 medium supplemented with 10 % fetal bovine serum, 2 mM L-glutamine, 1% penicillin/streptomycin and with M-CSF (10 ng ml [−1]) in the presence of super-low-dose LPS (100 pg ml [−1]), and mirVana miR-24 antagomir (10 nM, Life Technologies, Carlsbad, CA) or JNK inhibitor SP600125 (10 μM, Sigma-Aldrich), was also added to the cell cultures in some experiments. [score:3]
We further tested whether the sustained JNK activation may be responsible for the elevated expression of miR-24 in polarized monocytes. [score:3]
We focused our attention to examine the pathophysiological relevance of miR-24 induction by super-low-dose LPS, as miR-24 is among the most highly expressed miRNAs previously observed in both human patients with familial hypercholesterolemia, as well as in HFD-fed ApoE -deficient mice 38. [score:3]
Subclinical-dose endotoxin selectively induces miR-24 that causes the reduction of negative feedback modulators of inflammation such as Smad4-IRAK-M, which in turn leads to sustained low-level activation of JNK, miR-24 and reduced expression of SR-B1. [score:3]
Polarized monocytes reduce SR-B1 expression through miR-24. [score:3]
In contrast, miR-24 mimic failed to exert its degradation effect on mutant SR-B1 target with defective miR-24 -binding site (Fig. 4g). [score:3]
Our data reveal that the reduction of SR-B1 and inflammatory monocyte polarization are critically coupled, due to the elevated expression of miR-24 by polarized inflammatory monocytes. [score:3]
To test the expression of miR-24 in living cells, 100 pM SmartFlare RNA probe of miR-24-3p (Millipore, Billerica, MA) was added to the cell cultures and incubated at 37 °C for 16 h. The cells were harvested and stained with anti-Ly6C, anti-Ly6G and anti-CD11b antibodies. [score:3]
We next searched the 3′-untranslated region (3′-UTR) of SR-B1 and found putative miR-24 -binding sites (Fig. 4e). [score:3]
Through flow cytometry analyses, we observed that super-low-dose LPS selectively induced the expression levels of miR-24 in the CD11b [+]Ly6C [++] pro-inflammatory monocytes (Fig. 4c). [score:3]
The expression levels of miR-24-3p within CD11b [+]Ly6C [++] monocytes were examined by flow cytometry. [score:3]
It is interesting to note that miR-24 is also among the most highly expressed miRs in plasma samples from human atherosclerosis patients 38. [score:3]
Suppression of SR-B1 in inflammatory monocytes by super-low-dose LPS is dependent on miR-24 induction. [score:3]
The disruption of the IRAK-M homeostatic circuit is due to miR-24 -mediated suppression of Smad4. [score:3]
Adoptive transfer of in vitro cultured murine monocytesBone marrow cells isolated from WT C57 BL/6 mice or IRAK-M [−/−] mice were cultured in RPMI 1640 medium supplemented with 10 % fetal bovine serum, 2 mM L-glutamine, 1% penicillin/streptomycin and with M-CSF (10 ng ml [−1]) in the presence of super-low-dose LPS (100 pg ml [−1]), and mirVana miR-24 antagomir (10 nM, Life Technologies, Carlsbad, CA) or JNK inhibitor SP600125 (10 μM, Sigma-Aldrich), was also added to the cell cultures in some experiments. [score:3]
Polarization of monocytes through reduction of Smad-4 and IRAK-M. Reduction of IRAK-M is due to miR-24 -mediated suppression of Smad4. [score:3]
Application of miR-24 antagomir in cultured BMM restored the expression levels of SR-B1 (Fig. 4d). [score:3]
Induced miRNAs including miR-24 and miR-29 by super-low-dose LPS identified through miRNAseq were listed in Supplementary Table 1. We further confirmed the elevated expression of miR-24 and miR-29 in HFD-fed ApoE -deficient mice conditioned with super-low-dose LPS as compared with PBS-conditioned control mice (Fig. 4a,b). [score:2]
RNA co-immunoprecipitation analyses showed direct association of miR-24 with the SR-B1 3′-UTR within the microprocessor complex (Supplementary Fig. 4). [score:2]
RNA co-immunoprecipitation analyses also showed direct association of miR-24 with the Smad4 3′-UTR within the microprocessor complex (Fig. 6k). [score:2]
Luciferase reporter assays demonstrated that miR-24 dose dependently reduced the SR-B1 target messenger RNA stability (Fig. 4f). [score:2]
To test the mechanism for miR-24 -mediated reduction of Smad4 and IRAK-M, we searched the 3′-UTR of Smad4 and IRAK-M, and found a highly conserved miR-24 -binding site in the 3′-UTR of Smad4 (Fig. 6i). [score:1]
Total miRs isolated from splenocytes were used for real-time reversre transcriptase–PCR analyses for the relative levels of miR-24 (a) and miR-29 (b). [score:1]
HEK293 cells were plated in 24-well clusters, then co -transfected with 500 ng constructs with or without miR-24 mimic. [score:1]
Fresh LPS, miR-24 antagomir and SP600125 was added to the cell cultures every 2 days. [score:1]
Likewise, the miR-24 antagomir also restored the protein levels of Smad4 and IRAK-M (Fig. 6g,h). [score:1]
Our data unravel that subclinical super-low-dose LPS programmes the sustained elevation of pJNK and miR-24 levels, to enable the non-resolving low-grade polarization of monocytes, due to the disruption of the Smad4-IRAKM negative feedback circuit both in vitro and in vivo. [score:1]
Fresh LPS, SP600125 and miR-24 antagomir was added every 2 days. [score:1]
The reduction of SR-B1 through elevated miR-24 may further facilitate the establishment of polarized inflammatory monocytes. [score:1]
Fluorescent RNA probe for miR-24-3p was added to the cell cultures 16 h before harvesting. [score:1]
Mean fluorescent intensity of miR-24 probe, phosphorylation of JNK and production of MCP-1 within the CD11b [+]/Ly6G [-]/Ly6C [+] inflammatory monocytes were determined by flow cytometry. [score:1]
A previous animal study also suggests that miR-24 may be correlated with lipid accumulation and hyperlipidemia 39. [score:1]
Our data further reveal the molecular mechanism for sustained reduction of IRAK-M, due to miR-24-triggered degradation of the transcription factor Smad4. [score:1]
[1 to 20 of 43 sentences]
12
[+] score: 114
In our study, we found that mimics to miR-186 or miR-24 significantly downregulated Gabra4 expression in AW8 neurons, which may suggest that alcohol downregulates Gabra4 expression via these two miRNAs. [score:11]
Transfection of mimics of miR-186, miR-24, and/or miR-375 downregulates Gabra4 expressionWe assessed the effects of mimics or inhibitors of miR-155, miR-186, miR-24, or miR-375 on changes in Gabra4 expression in control and AW8 neurons. [score:10]
This may suggest that the upregulation in expression of miR-186, miR-24 and/or miR-375 during AW modulates Gabra4 expression at the posttranscriptional level. [score:8]
Transfection with molecular mimics of miR-186, miR-24, or miR-375 also downregulated Gabra4 expression, whereas transfection with the corresponding inhibitors of these microRNAs normalized Gabra4 expression in AW neurons to the level measured in control neurons. [score:8]
miR-24 mimic significantly reduced Gabra4 expression in AW8 + M neurons and its corresponding inhibitor normalized its expression (Fig. 6B). [score:7]
Figure 6Transfection of mimics to miR-186, miR-24, or miR-375 into cortical neurons downregulates Gabra4 expression during AW. [score:6]
This study provides evidence for a novel role for miR-186, miR-24 and/or miR-375 in mediating the effects of AW on downregulation of Gabra4 expression in cultured mouse cortical neurons. [score:6]
We determined changes in miR-155, miR-186, miR-24, and miR-375 expression at various time intervals after onset of AW, and found that these miRNAs were significantly upregulated at AW5 min, AW6, AW8, AW12, and/or AW24 h (Fig. 5A– D). [score:6]
Figure 5Time course of upregulation of miR-155, miR-186, miR-24, and miR-375 gene expression during AW in cultured mouse cortical neurons. [score:6]
Transfection of mimics of miR-186, miR-24, and/or miR-375 downregulates Gabra4 expression. [score:6]
microRNA profiling in neurons undergoing AW revealed upregulation in the expression of miR-155, miR-186, miR-24, and miR-375 after 8 h of AW. [score:6]
We assessed the effects of mimics or inhibitors of miR-155, miR-186, miR-24, or miR-375 on changes in Gabra4 expression in control and AW8 neurons. [score:5]
The sequence of upregulated miRNAs (miR-155, miR-186, miR-24, and miR-375) from TLDA card was verified as the 5p or 3p strand using www. [score:4]
Promoter-reporter experiments supported the idea that miR-155, miR-186, miR-24, miR-27b, or miR-375 bind to the 3′UTR of Gabra4 and thereby inhibit protein production. [score:3]
We confirmed changes in expression of selected miRNAs (miR-155, miR-186, miR-24, miR-375) by qPCR. [score:3]
2. These alcohol -induced epigenetic changes may have altered miRNAs expression such as miR-186/miR-24. [score:3]
To address this, we focused on the effects of miR-155, miR-186, miR-24 and/or miR-375 on changes in Gabra4 expression during AW. [score:3]
Control neurons (C) or AW8 neurons were transfected with scrambled oligos (30 nmol/L), mimic (30 nmol/L) or inhibitor (100 nM) of (A) miR-186, (B) miR-24, (C) miR-375, (D) miR-155. [score:3]
Several bioinformatic databases and prediction algorithms showed that the selected miRNAs (miR-155, miR-186, miR-24, miR-27b, and miR-375) have a large number of potential target genes including Gabra4. [score:3]
Cortical neurons were seeded at 10 [6] cells/mL in a 12-well plate then transfected at DIV8 for 2–3 h with mimic or inhibitor of miR-155, miR-186, miR-24, or miR-375 following the manufacturer’s instructions. [score:3]
Cortical neurons were cotransfected with pMIR-Gal + pMIR-Luc (Gal/Luc), pMIR-Gal + pMIR-Luc-3′UTR in the absence (Gal/Luc-3′UTR) or presence of scrambled oligo (Gal/Luc-3′UTR + Scr) or mimic of miR-155 (m155), miR-186 (m186), miR-24 (m24), miR-27b (m27b), or miR-375 (m375). [score:1]
Figure 7Transfection of miR-155, miR-186, miR-24, miR-27b, or miR-375 mimics decreases luciferase activity and Gabra4 protein levels in cultured mouse cortical neurons. [score:1]
miR-24 has a poorly conserved seed match among vertebrates at position 628 (8mer), a position that is very close to the presumed binding site of miR-186 along Gabra4 3′UTR. [score:1]
miR-155, miR-186, miR-24, miR-27b, and miR-375 have predicted binding sites along the 3′UTR of Gabra4 (1965 bp, NM_010251) (www. [score:1]
[1 to 20 of 24 sentences]
13
[+] score: 102
As expected, transfection of antagomiR-24 led to a dramatic downregulation of miR-24 level (Figure  5A) and the concomitant significant upregulation of p16 [INK4a] at both mRNA (Figure  5B) and protein levels as shown by immunostaining with p16 [INK4a] antibodies (Figure  5C). [score:7]
MiR-24 downregulation is sufficient to trigger p16 [INK4a] expression and MMP1 production in mature chondrocytesFinally, we aimed at determining whether modulation of miR-24 could be sufficient to promote p16 [INK4a] accumulation and p16 [INK4a] -dependent matrix remo deling secretome by using our 3D chondrocyte mo del. [score:6]
Finally, downregulation of miR-24 by an antagomir approach in primary chondrocytes leads to an increase in p16 [INK4a] expression and MMP1 secretion. [score:6]
Because miR-24 overexpression has been reported to induce apoptosis by repressing DNA damage response pathways [53], we relied on a loss-of-function experiment based on transfection of chondrocytes by either a specific inhibitor of miR-24 (antagomiR-24) or an irrelevant antagomiR as control. [score:5]
MiR-24 downregulation is sufficient to trigger p16 [INK4a] expression and MMP1 production in mature chondrocytes. [score:5]
Figure 5 MiR-24 downregulation is sufficient to trigger p16 [INK4a ] expression and matrix metalloproteinase 1 (MMP1) production in mature chondrocytes. [score:5]
Furthermore, we showed that miR-24 downregulation is sufficient to promote a marked increase in MMP1 secretion (Figure  5D) but has no significant effect on MMP13, IL-6, or IL-8 secretion (Figure  5E-G), suggesting the existence of a direct axis miR-24-p16 [INK4a]-MMP1. [score:5]
Moreover, miR-24 downregulation seems to follow and sustain a high level of p16 [INK4a] rather than initiate p16 [INK4a] accumulation. [score:4]
By RT-qPCR on mRNA from OA (n = 5) versus healthy (n = 6) human cartilage samples, we revealed a significant miR-24 downregulation in OA cartilage (Figure  4E) while p16 [INK4a] is increased (Figure  4F). [score:4]
We further showed that miR-24 expression plays a role as a negative regulator of the p16 [INK4a]/MMP1 axis. [score:4]
We found miR-24, a known negative regulator of p16 [INK4a], through the presence of two binding sites for this miR within its encoding and 3′ untranslated region (UTR) [51]. [score:4]
We next confirmed, on three independent chondrocyte samples placed in 3D, that IL-1β significantly repressed miR-24 expression (Figure  4B) with a concomitant expected induction of p16 [INK4a] mRNA (Figure  4C). [score:3]
One therapeutic strategy for OA treatment could be to restore/maintain the expression level of miR-24-encoding clusters in order to prevent p16 [INK4a] -dependent pathways in articular chondrocytes. [score:3]
We therefore evaluated, during chondrogenesis, whether the expression of miR-24 could also be reciprocal to that of p16 [INK4a] expression. [score:3]
These findings propose that miR-24-1/miR-24-2 clusters, together with the recently identified miR-140, which targets ADAMTS5 and HDAC4, two hypertrophic inducers [19, 20], are crucial in preventing chondrocyte terminal differentiation in OA. [score:3]
Accordingly, p16 [INK4a] expression increased while miR-24 level was repressed upon IL-1-beta addition, in OA cartilage and during in vitro terminal chondrogenesis. [score:3]
Chondrocytes expressing either p16 [INK4a] or miR-24 are marked by arrows showing mutual exclusion. [score:3]
Taken together, these data reveal for the first time that the senescent marker p16 [INK4a] and its epigenetic regulator miR-24 are reciprocally involved in both OA and bone developmental -associated matrix remo deling secretomes. [score:3]
p16 [INK4a] induction correlates with miR-24 repression in interleukin-1-beta -treated chondrocytes, osteoarthritic cartilage, and the end of an in vitro chondrogenesisWe next wanted to identify putative regulators of p16 [INK4a] in mature chondrocytes. [score:2]
By RT-qPCR, we revealed that, compared with days 0 to 7, miR-24 level is decreased at day 14 and significantly at day 21 (Figure  2D) in parallel with an increase in expression of the terminal differentiation marker, MMP13 (Figure  2B), while p16 [INK4a] remains elevated (Figure  2C). [score:2]
By genome-wide microRNA array, we identify miR-24 as a regulator of p16 [INK4a] in chondrocytes. [score:2]
We then checked whether miR-24 expression could be reversely correlated with that of p16 [INK4a] in OA cartilage compared with healthy cartilage. [score:2]
Nevertheless, miR-24 is part of a cluster containing two other miRs and regulated by the same promoter (Figure  4D). [score:2]
We identified miR-24 as a negative regulator of p16 [INK4a]. [score:2]
Figure 2 MiR-24 and p16 [INK4a ] expressions during chondrogenesis and role of p16 [INK4a ] in chondrocyte cell cycle arrest. [score:2]
We disclosed herein a new role of the senescence marker p16 [INK4a] and its regulation by miR-24 during OA and terminal chondrogenesis. [score:2]
p16 [INK4a] induction correlates with miR-24 repression in interleukin-1-beta -treated chondrocytes, osteoarthritic cartilage, and the end of an in vitro chondrogenesis. [score:1]
As expected, miR-24 is repressed in IL-1β -treated chondrocytes, in cartilages of patients with OA but also at the end of chondrogenesis while p16 [INK4a] accumulates. [score:1]
miR-24 is encoded by two genes: miR-24-1 and miR-24-2 [52]. [score:1]
Therefore, miR-24 repression is in vivo always accompanied by that of miR27a/b and miR23a/b (Figure  4A and D). [score:1]
These results were confirmed at the protein level on serial sections of OA cartilage samples by using p16 [INK4a] immunohistochemistry and miR-24 in situ hybridization (Additional file 1). [score:1]
We propose that—during OA progression, in response to IL-1β, or during endochondral -induced terminal chondrogenesis—a repression of miR-24- and miR-24-encoding clusters takes place. [score:1]
p16 [INK4a] and miR-24 are reversely correlated in osteoarthritis (OA) articular cartilage. [score:1]
Click here for file p16 [INK4a] and miR-24 are reversely correlated in osteoarthritis (OA) articular cartilage. [score:1]
LNA DIG-hsa-miR-24 probe and DIG-has-miR-141c (as negative control) were purchased from Exiquon (Copenhagen, Denmark) and diluted at 1pM. [score:1]
Finally, we aimed at determining whether modulation of miR-24 could be sufficient to promote p16 [INK4a] accumulation and p16 [INK4a] -dependent matrix remo deling secretome by using our 3D chondrocyte mo del. [score:1]
[1 to 20 of 36 sentences]
14
[+] score: 90
Firstly, miR-24, −30b or −142-3p downregulate expression of multiple FcRs that plays important role in antigen uptake and presentation (Naqvi A. R, In press) 21. [score:6]
Overexpression of miR-24, miR-30b, and miR-142-3p suppress type I cytokines by DCs. [score:5]
In our previous study we observed reduced expression of both mannose receptor and scavenger receptors (MSR1 and MARCO) in miR-24, −30b or −142-3p overexpressing DC and MΦ 20. [score:5]
Enforced expression of miR-24, miR-30b, and miR-142-3p in untreated MΦ significantly induced (~1.5–2 fold) CD86 expression (Fig. 5a,b). [score:5]
Marked induction (~2–4.5 fold) in PD-L1 expression was observed in miR-24, miR-30b, and miR-142-3p overexpressing cells compared to control mimic (Fig. 5a). [score:4]
We have recently shown that down-regulation of miR-24, -30b and -142-3p during MΦ and DC differentiation is necessary for acquisition of the functional phenotype 19. [score:4]
Flow cytometric analysis showed antigen processing was reduced to approximately 22%, 38% and 40% in DC overexpressing miR-24, miR-30b and miR-142-3p, respectively (Fig. 1g–j). [score:3]
Time kinetics of antigen uptake and processing in miR-24, miR-30b, and miR-142-3p overexpressing APCs. [score:3]
miR-24, miR-30b, and miR-142-3p induce PD-L1 expression in APCs. [score:3]
Impaired T-cell proliferation by MΦ and DC overexpressing miR-24, miR-30b and miR-142-3p. [score:3]
We examined the time kinetics of these pathways by analyzing cells at three different time points: 1.5, 6 and 18 h. In MΦ, antigen uptake as well as antigen processing was markedly inhibited by miR-24, −30b and −142-3p across the time points examined (Fig. 2a). [score:3]
As miRNA-target interaction is sequence specific, we examined the sequence conservation of miR-24, −30b and −142-3p in human and mice analogs. [score:3]
MΦ and DCs overexpressing miR-24, miR-30b, and miR-142-3p are defective in antigen processing. [score:3]
MiR-24, miR-30b, and miR-142-3p mimics or inhibitors were purchased from Qiagen (Gaithersburg, MD, USA). [score:3]
Time kinetics of antigen uptake and processing in MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p. [score:3]
In this study we demonstrate an inhibitory effect of miR-24, miR-30b, and miR-142-3p on the uptake as well as processing of Ova by APCs. [score:3]
PD-L1 surface expression is induced in miR-24, miR-30b, and miR-142-3p transfected MΦ and DC. [score:3]
Taken together, these results show that Th1 activation -associated cytokine profiles are suppressed in DC transfected with miR-24, miR-30b, and miR-142-3p. [score:3]
MΦ and DC overexpressing miR-24, miR-30b, and miR-142-3p exhibit impaired antigen processing. [score:3]
Our results show that CD4+ T-cells co-cultured with APCs overexpressing miR-24, −30b or −142-3p mimics are less efficient in secreting IFN-γ and TNF-α cytokines in the presence of Ova as well as reduced IFN-γ levels in assays performed with Th1 inducing antigen derived from CMV. [score:2]
MΦ transfected with miR-24, miR-30b and miR-142-3p mimics show reduced green signal compared to control mimics (Fig. 1a) suggesting impaired antigen processing upon enforced expression of the miRNA mimics. [score:2]
Overall, our results highlight novel mechanistic insights through which miR-24, miR-30b and miR-142-3p can regulate activation of adaptive immune responses guided by APCs. [score:2]
These results lend support to our hypothesis that in myeloid inflammatory cells, miR-24, −30b and −142-3p predominantly regulate critical components of cytoskeleton dynamics leading to altered cell morphology resulting in significant impairment of their capacity to efficiently process and present antigen to T-cells. [score:2]
In MΦ, overexpression of miR-24, −30b or −142-3p reduced CD4+ T-cell proliferation by ~56%, 46%, 44%, respectively, compared to control mimic (Fig. 3c). [score:2]
Compared to control mimic, no significant differences were noted in the presence of miR-24, miR-30b or miR-142-3p inhibitor (Fig. 1e). [score:2]
On the other hand, DCs transfected with miR-24, −30b or −142-3p showed ~38%, 45% and 48% reduction in T-cell proliferation (Fig. 3c). [score:1]
We therefore examined the impact of miR-24, miR-30b and miR-142-3p on antigen processing by MΦ and DC. [score:1]
Day 7 cultured BMDCs were transfected with murine analogs of miR-24, −30b, −142-3p or control mimic. [score:1]
Overall, these results clearly show miR-24, −30b, and −142-3p mediated impairment of antigen uptake and processing in APCs. [score:1]
We first tested whether murine analogs of miR-24, −30b and −142-3p can impact antigen processing. [score:1]
How to cite this article: Naqvi, A. R. et al. miR-24, miR-30b and miR-142-3p interfere with antigen processing and presentation by primary macrophages and dendritic cells. [score:1]
miR-24, miR-30b, and miR-142-3p impair Ova specific T-cell proliferation. [score:1]
Time kinetics of Ova uptake and processing reveals a similar impact of miR-24, −30b, and −142-3p on antigen uptake and processing by MΦ and DC at the early time points of 1.5 and 6 hr. [score:1]
Impaired T-cell activation and proliferation by miR-24, miR-30b, and miR-142-3p transfected APCs. [score:1]
We next examined the impact of PD-L1 blocking on T cell proliferation by miR-24, miR-30b, and miR-142-3p. [score:1]
[1 to 20 of 35 sentences]
15
[+] score: 86
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-23a, mmu-mir-24-2, mmu-mir-27a
A) RNA from 70Z/3 Pre-B cells overexpressing MSCV, MSCV-miR-23a27a24, or MSCV-miR24 retrovirus was analyzed by qRTPCR for expression of miR-24 target Trib3. [score:7]
1006887.g005 Fig 5. A) RNA from 70Z/3 Pre-B cells overexpressing MSCV, MSCV-miR-23a27a24, or MSCV-miR24 retrovirus was analyzed by qRTPCR for expression of miR-24 target Trib3. [score:7]
Together, these results suggest that miR-24 target Trib3 regulates immune cell gene expression networks that sustain lymphoid commitment while repressing myeloid development in mice. [score:7]
Mirn23a downregulates the BMP/Smad pathway through the targeting of the common Smad4 (mir-27a, miR-24), which is an obligate heterodimer partner for activated Smad1 and 5[57, 58]. [score:6]
Cells overexpressing EBF1 showed a significant decrease in miR-23a, miR-27a, and miR-24 expression (Fig 8D). [score:5]
Knockdown of EBF1 resulted in significantly increased expression of miR-23a, miR-24, and miR-27a, consistent with EBF1 negatively regulating mirn23a (Fig 8B). [score:5]
Overexpression of the individual cluster miRNAs demonstrated that miR-24 alone could enhance Ccl9 and Csf1r expression (S4B Fig). [score:5]
MiR-24 target Trib3 regulates hematopoietic gene expression networks. [score:5]
However, sustained commitment to the lymphoid lineage appears heavily dependent on miR-24 and its direct target Trib3. [score:4]
MiR-24 expression is ~8 fold overexpressed in these cells (S4A Fig). [score:4]
Genes differentially regulated >2 fold between control and miR-24 overexpressing cell lines are shown. [score:4]
MiR-24 expression was analyzed by qRT-PCR to validate overexpression. [score:4]
MiR-24 had the ability to upregulate critical myeloid genes Ccl9 and Csf1r. [score:3]
C) Heat map showing the individual components of the IL2/Stat5 signaling pathways affected by miR-23a, miR-24, or miR-27a expression. [score:3]
S4 Fig A) 70Z/3 pre B cells were transduced with control, mirn23a cluster, or miR-24 alone overexpression vectors. [score:3]
Mirn23a miRNA miR-24 targets Trib3, which represses Akt kinase and Smurf1 E3 ubiquitinase activity[20, 30, 31, 34, 51]. [score:3]
Genes significantly changed in miR-24 overexpressing 70Z/3 Pre-B Cells. [score:3]
Two unique MiR-24 overexpressing 70Z/3 cell lines were generated through limiting dilution along with a control line infected with empty retrovirus. [score:2]
S1 Table Two unique MiR-24 overexpressing 70Z/3 cell lines were generated through limiting dilution along with a control line infected with empty retrovirus. [score:2]
S3 Table Two unique MiR-24 overexpressing 70Z/3 cell lines were generated through limiting dilution along with a control line infected with empty retrovirus. [score:2]
This is consistent with our previous study showing that miR-24 alone could enhance myeloid development in vitro[3]. [score:2]
[1 to 20 of 21 sentences]
16
[+] score: 58
These and our findings may indicate a relevant role of miR-21, miR-24 and miR-27a in the malignant behavior of cervical cancer and HCC cell lines; for this reason we monitored their expression levels in human HCC tissues and their PT counterparts and then matched the miR expression levels with clinical patient features. [score:5]
We also found that miR-24 and miR-27a were downregulated in HCC cancer developed in cirrhotic liver. [score:4]
In this context, considering the subclass of HCC tumors developed in cirrhotic liver, miR-24 and miR-27a were downregulated in HCC in respect to PT tissues. [score:4]
In particular, the R value in the cirrhosis subgroup was 0.535±0.0947 (p<0.0001), suggesting that miR-24 was downregulated in HCC with respect to cirrhotic PT tissue. [score:4]
miR-24 was described as an anti-oncomiR by regulating c-myc and E2F2 in the HCC-derived cell line HepG2 and causing inhibition of cell proliferation (35). [score:4]
This suggests that downregulation of miR-24 and miR-27a influences the hepatocyte transformation of cirrhotic tissues. [score:4]
For miR-24 in cirrhotic HCCs, the data obtained indicate a linear correlation between mean overall survival and miR-24 expression. [score:3]
We analyzed the expression profile of the miRs most frequently cloned (miR-24, miR-27a and miR-21) in the tumor and peritumoral tissues from biopsy specimens of patients presenting with HCC. [score:3]
miR-24, miR-27a and miR-21 differential expression in HCC tissues from human biopsy specimens. [score:3]
For miR-24, a significant decrease in expression was observed in the HCV and HBV/HCV subclasses (R=0.523, p=0.0184; R=0.462, p=0.0311 respectively). [score:3]
miR-24 and miR-27a displayed the same expression trend in 66.7% of the cases examined; this may have occurred due to the fact that they are clustered in 1 transcript on chromosome 19. [score:3]
The observation that miR-24 expression is correlated with OS of cirrhotic HCC patients will be further validated in a larger group of patients. [score:3]
Similar to miR-24, miR-27a (Figs. 3 and 5) did not show dysregulation among the 41 cases, as the average R value was 0.915±0.204. [score:2]
Our data revealed miR-24 and miR-27a dysregulation in HCC in respect to their corresponding PT tissues and distinguished a profile in cirrhotic but not in non-cirrhotic tissues. [score:2]
miR-24 (Fig. 2) was not dysregulated, based on the average R value for the 41 examined cases (Fig. 5, R=0.77±0.109). [score:2]
In another study miR-24 acted as an oncomiR negatively regulating p16 in cervical carcinoma cells and the pro-apoptotic FAF1 protein in prostate, gastric and HeLa cancer cells (36, 37). [score:2]
The expression levels of the most frequently cloned miRNAs, miR-24, miR-27a and miR-21, were evaluated using real-time PCR in the tumor and corresponding PT tissues from the biopsy specimens of 41 HCC patients. [score:1]
Among the most abundant, miR-24 was noted. [score:1]
The most frequently isolated miRNAs were miR-24, miR-27a and miR-21 (Table III). [score:1]
Among the 200 bacterial clones sequenced, 118 clones corresponded to 31 known miRs cloned with different frequencies and the miR-24, miR-27a, miR-21 were cloned with the highest frequency. [score:1]
More studies are necessary to better explore the biological role of miR-24 and miR-27a in HCC and in other cancers. [score:1]
Real-time quantification of mature miR-24, miR-27a and miR-21 by stem-loop RT-PCR. [score:1]
In particular, the miRs cloned with the highest frequency were miR-21, miR-27a and miR-24 as noted in our study. [score:1]
[1 to 20 of 23 sentences]
17
[+] score: 40
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
It has been proposed that upregulation of bta-miR-24-3p inhibits the transcription of HO-1, therefore, hampering the cell’s ability to defends itself against pathogens [23]. [score:6]
It can be postulated that bta-miR-24-3p is over-expressed when exposed to a pathogen; however, further studies are needed to establish if HO-1 is the target of bta-miR-24-3p in M. bovis exposure in cattle. [score:5]
Bta-miR-24-3p upregulation has been reported in challenge studies. [score:4]
In the present study, an upregulation of bta-miR-24-3p was detected after animals became -positive. [score:4]
It has also been observed that bta-miR-24-3p was over-expressed in serum samples from patients with hepatocellular carcinoma [13]. [score:3]
In bovine mammary epithelial cells challenged with E. coli, an over -expression of bta-miR-24-3p was identified [22]. [score:3]
Bta-miR-24-3p regulate the production of HO-1 at the post-transcriptional level [21]. [score:2]
Fig 1 shows the interaction (P = 0.0268) of status (positive and negative groups) and season for bta-miR-24-3p. [score:1]
Bta-miR-22-3p and bta-miR-24-3p had the fewest number of copies in summer, 2013, an intermediate number of sequences in fall, 2013, and the greatest number in spring, 2014 (P< 0.0001). [score:1]
Serum antibody to M. bovis microRNA Negative Positive SE P-value bta-let-7b 11,691 15,421 1,200 0.0336 bta-miR-24-3p 15,908 24,390 1,495 0.0002 bta-miR-92a 83,405 64,330 4,156 0.0023 bta-miR-423-5p 124,920 101,818 6,315 0.0133 A total of 21 microRNAs were associated with season (Table 3). [score:1]
0161651.g001 Fig 1Interaction of season and antibody response to M. bovis for bta-miR-24-3p (P = 0.0268). [score:1]
Interaction of season and antibody response to M. bovis for bta-miR-24-3p (P = 0.0268). [score:1]
In this study, bta-miR-24-3p abundance increased in the seropositive group. [score:1]
[1 to 20 of 14 sentences]
18
[+] score: 38
As shown in Figure 3, the expressions of miR-711, miR-714, miR-744, miR -2137, miR -5130, miR -346, and miR -328 was still upregulated in the I/R group, but the expression of miR-24 and miR-490 were downregulated, compared to the control group grafts. [score:10]
The expressions of miR-711, miR-714, miR-744, miR-2137, miR-5130, miR-1892, miR-328, miR-346, miR-5099, and miR-705 were significantly upregulated in I/R injured heart grafts, while miR-490, miR-491, miR-210, miR-362, miR-24, miR-423, miR-128, miR-328, miR -181, and miR-532 were downregulated. [score:9]
As compared with cells under normxia, miR-711, miR-714, miR-328, miR-346, miR-210, miR-744, miR-5130, miR-181a and miR-2137 were significantly over-expressed in hypoxia/reperfusion treated cardiomyocytes, while the expression of miR-491, miR-211, miR-532, miR-185, miR-425, miR-128, miR-24 was down-regulated (Figure 4B). [score:7]
It has been demonstrated that ischemia precondition (IPC) increases cardiac expression of miRNA-1, miRNA-21 and miRNA-24. [score:3]
Since an entire heart tissue consists of multiple lineages of cells such as cardiomyocyte, endothelial cell, and fibroblast cell, the expression of miR-24 in heart is an accumulation from all cells in the heart, and other cells may buffer the reduction of miR-24 in cardiomyocytes. [score:3]
We observed a decrease in the expression of miR-24 in the I/R injured heart grafts but it was not significant. [score:3]
A substantial number of miRNA including miR-1 [12], miR-15 [13], miR-21 [14], [15], miR-24 [16], [17], [18], miR-499 [19], and the miR-17-92 family [20], miR-124 [21], miR-15a/b [22] (2012), miR-93 [23], miR-29 family [24], [25], miR-146a [26], [27], miR-145/451 [28], miR-384-5p [29], miR-424 [30], and miR-494 [31] have been identified in I/R injury. [score:1]
miR-24 has previously shown a protective effect on I/R injury [16], [17], [18]. [score:1]
However, we did see a significant reduction of miR-24 in hypoxia -treated primary cardiomyocytes, which is consistent with reported literature [16], [17], [18]. [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 37
Thus, CSCs over-express miR-24 and the let-7a/b miRs, which are known to negatively regulate Myc expression, while showing a very strong down-regulation of the miR-17/92 family, which is a known transcriptional target of Myc. [score:11]
In addition to this group of down-regulated miRs, CSCs can be distinguished from embryonic heart cells on the basis of seven up-regulated miRs: let-7a, let-7b, miR-24, miR-125b, miR-132, miR-149 and miR-223 (Fig. 2C). [score:7]
Among the six up-regulated miRs in CSCs we find the four most highly expressed miRs in these cells: miR-125b, miR 126, miR-133a and miR-24. [score:6]
miR-24 is also a known anti-proliferative miR that acts as a negative regulator of Myc expression [26]. [score:4]
As mentioned above, miR-24, miR-125b and miR-132 are among the top expressed miRs in CSCs. [score:3]
Additionally, miR-24 was shown to suppress cardiomyocyte apoptosis [43], [44]. [score:3]
VSBMCs display an unusual ability to switch between a proliferative and differentiated (contractile) phenotype ant it was recently shown that miR-24 is involved in the regulation of this process, promoting VSMC dedifferentiation [41], [42]. [score:2]
[48] miR-24 29.9±0.8 Response to cardiac injury. [score:1]
[1 to 20 of 8 sentences]
20
[+] score: 36
Overexpression of miR-126 or inhibition of miR-24 antagonizes FFAs -induced lipid accumulation in AML12 hepatocytes. [score:5]
To determine whether the disordered miR-126 or miR-24 levels induced by free fat acid (FFA) affect cellular triglyceride (TG) accumulation, we examined the TG levels in AML-12 cells transfected with mimic (Negative control) NC, miR-126 mimic or inhibitor NC, miR-24 inhibitor using Nile red staining. [score:5]
Whether up-regulation of reduced hepatic miR-126 using miR-126 mimic (or down-regulation of elevated hepatic miR-24 using antagomiR-24) approaches would alleviate liver steatosis in high fat diet-fed mice is currently under investigation in our laboratory. [score:5]
More important, overexpression of miR-126 or inhibition of miR-24 markedly improved fat accumulation in AML-12 cells expose to FFA (Figure 5). [score:5]
0080774.g005 Figure 5 AML12 cells were transfected with either miR-126 mimic, miR-24 inhibitor or their corresponding negative controls. [score:3]
To test the biological roles of miR-126 and miR-24, miR-126 mimic, miR-24 inhibitor or their corresponding negative controls were transfected into AML12 cells using lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. [score:3]
AML12 cells were transfected with either miR-126 mimic, miR-24 inhibitor or their corresponding negative controls. [score:3]
In conclusion, the present study demonstrated that various miRNAs were differentially expressed in ob/ob mouse liver (especially for miR-126 and miR-24), suggesting that they were tightly linked to obesity and other metabolic disorders. [score:3]
miR-126 or miR-24 Regulates Lipid Accumulation in AML12 Hepatocytes Exposed to FFAs. [score:2]
The functional analysis in AML-12 liver cells showed that dysregulation of miR-126 and miR-24 is correlated with fat accumulation (Figure 5). [score:2]
[1 to 20 of 10 sentences]
21
[+] score: 34
miR-126, miR-24 and miR-23a are selectively expressed in microvascular endothelial cells in vivo, whereas miR-145 is expressed in pericytes. [score:5]
In addition, miR-23a, miR-23b, miR-24 and miR-30d were shown to be upregulated in hypoxia [38]. [score:4]
By screening for mature miRNAs with vascular expression patterns we found that miR-145, miR-126, miR-23a, and miR-24 were enriched in the microvasculature in vivo. [score:3]
We identified miR-145, miR-126, miR-24 and miR-23a as enriched in microvessels, and showed that microvascular expression of miR-145 is due to its presence in pericytes. [score:3]
The miRNAs identified in the present study - miR-145, miR-30D, miR-24, miR-23a and miR-23b - are therefore possible targets in future therapeutic strategies. [score:3]
miR-145, miR-126, miR-24, and miR-23a were selectively expressed in microvascular fragments isolated from a range of tissues. [score:3]
Differential expression of miR-126, miR-145, miR-24, and miR-23a in the mature microvasculature. [score:3]
Several other miRNAs also appeared as promising candidates for selective vascular expression, including miR-145, miR-30d, miR-23b and miR-24 (within the dashed lines in Figure 1b). [score:3]
In addition, miR-23a and miR-24 were consistently differentially expressed, with enrichments ranging from 5- to 16-fold. [score:3]
miR-23a and miR-24 were enriched in sprouts from EBs but not in fragments from embryonic day 14 kidneys. [score:1]
Based on the above described in silico analyses, we chose to further characterize the expression of miR-126-3p (the predominant mature form of this miRNA, hereafter referred to as miR-126), miR-145, miR-30d, miR-23b, miR-24 and miR-23a; the latter being co-transcribed with miR-24 [1]. [score:1]
Many of the miRNAs we identified scored favorably in one or more of these screens, including miR-23a [6- 8, 12], miR-23b [7, 8, 12], miR-24 [7, 8, 12] and miR-126 [6, 8, 12]. [score:1]
miR-145, miR-126, miR-24 and miR-23a were consistently enriched in adult microvessels. [score:1]
[1 to 20 of 13 sentences]
22
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
23
[+] score: 22
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-23a, mmu-mir-24-2, mmu-mir-27a
Transfection of a miR-24 inhibitor induced expression of band3 protein and promoted differentiation of K562 cells [37], suggesting that the miR-23a-27a-24 cluster can block erythroid terminal differentiation. [score:5]
We previously reported that miR-24 is involved in silencing the expression of band3 in K562 cells. [score:3]
For the miRNA overexpression mo del C57BL/6 mice (6-8 weeks) were randomly divided into FBL-3 control, pLVX-vector, pLVX-miR23a, pLVX-miR27a and pLVX-miR24 groups (n = 7 per group). [score:3]
G (an envelope plasmid) and pLVX-miR23a, pLVX-miR27a and pLVX-miR24 over -expression plasmids were separately co -transfected into HEK293T cells using X-treme GENE (Roche). [score:3]
The vector pLVX-miR23a, pLVX-miR27a and pLVX-miR24 group mice separately received 2×10 [6] pLVX-vector, pLVX-miR23a, pLVX-miR27a or pLVX-miR24 overexpressing FBL-3 cells through intravenous lateral tail vein injection. [score:3]
Stable overexpression of miR-23a, miR-27a and miR-24 promoted mouse erythroleukemia progression. [score:3]
The pLVX-miR-23a, pLVX-miR-27a and pLVX-miR-24 lentiviral vectors contained miR-23a, miR-27a and miR-24, respectively. [score:1]
A. The expression levels of miR-23a, miR-27a or miR-24 in FBL-3 cells were measured by real-time PCR. [score:1]
[1 to 20 of 8 sentences]
24
[+] score: 20
In particular, the following target proteins, involved in cell proliferation, were downregulated: DHFR targeted by miR24 [33], Cyclin D1 targeted by miR223 [34], and E2F-2 targeted by miR31 [35]. [score:12]
Moreover, the use of miRNA inhibitors against miR451, miR223, miR24, miR125b, and miR31 on HepG2 reduced the proapoptotic activity induced by MV-HLSC. [score:3]
Among miRNAs present in MV-HLSC, we detected several miRNAs with potential antitumor activity including miR451, miR223, miR24, miR125b miR31, and miR122 (Fig. 3A). [score:1]
Silencing Dicer in HLSC resulted in the modulation of different miRNAs, with a significant reduction of the antitumor miR223, miR24, miR31, and miR122 [55] in MVs. [score:1]
MVs released from DCR-Kd HLSC (MV DCR−), but not from CTR-A HLSC (MV CTR-A), showed a significant reduction of miR223, miR24, miR31, miR122, and miR214 as detected by qRT-PCR (Fig. 4B). [score:1]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
To evaluate whether single miRNAs with antitumor activity (miR451, miR223, miR24, miR125b, and miR31) were relevant for the proapoptotic effect of MV-HLSC, we transfected HepG2 with selected miRNA inhibitors (Fig. 5A). [score:1]
[1 to 20 of 7 sentences]
25
[+] score: 20
In cardiomyocytes, miR-24 directly targets the proapoptotic protein Bim and inhibits apoptosis. [score:6]
Regarding the 23b~27b~24 cluster upregulation, miR-24 can be highlighted. [score:4]
Importantly, it has been shown that miR-24 expression differed in age-related thymic involution. [score:3]
It is known that mRNA-target for a particular miRNA depends of cell context and this is the case of miR-24, which has been described in apoptosis and cell survival (41– 44). [score:3]
When comparing young versus aged TEC (a mix of cTEC and mTEC) a decrease in miR-148b, miR-19b, miR-24, and miR-322 expression was seen in aging (45). [score:3]
Yet, miR-24 function is complex since it enhanced survival in myeloid and B cell lines, as well as primary hematopoietic cells (44). [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 18
DEGs expression heat map was shown in Figure  4. Table 1 One hundred and thirty‐one differentially expressed genes (DEGs) were identified between IR + NS and IR + Zymosan‐A groups Up‐regulated gene Down‐regulated gene Stfa2 Ecm1 Egr1 Herpud1 Ccrl2 Zc3h12a Ier3 Irak2 Hbb‐b1 Stfa3 Mir5109 Atf3 Gramd1a Xcl1 Socs3 Lfng H2‐K1 Beta‐s BC100530 F630028O10Rik Ptafr Lpl Bpgm Ier5 Cyth1 Cxcl2 Slc4a1 BC117090 Gstm1 Bcl3 Ptgs2 H2‐Q4 Tnf Niacr1 Tnfsf13b Mir21 2010005H15Rik Ear1 Rasal3 Phf1 H2‐Q5 Erdr1 Txnip Mir22 Hba‐a2 Stfa1 Mt1 Smox Skil Rasl11b Nfkbia H2‐Ab1 H2‐Eb1 Hba‐a1 Gm5483 Rn45s Amica1 Cd74 Fmnl2 Mir24‐2 H2‐T22 Zfp36 Hbb‐b2 Stfa2 l1 Ear12 Neurl3 Nfkbid Cables1 Relb Nfkbiz Nfkb2 Hbb‐bt Saa3 Ear3 Ier2 Hmox1 Mir1901 Tnfaip3 H2‐T9 Ppp1r15a Mirlet7i Mt2 Ear7 5430421N21Rik Klf2 Tmcc2 Fn1 Junb Smim5 Gpnmb Marco Ear6 Bbc3 Jund H2‐Q6 H2‐Q10 Phlda1 Gabbr1 Mir146b Ggt1 Acvrl1 Irg1 H2‐Aa H2‐Q8 Thbs1 Gm15441 Mir1198 Prok2 Ceacam10 Rnf167 Tgif1 H2‐Q9 Nfkbie Jun Dusp2 Lars2 Ctsg Pik3ap1 Tgm2 H2‐Q7 Gadd45b Zmpste24 Antxr2 Steap4 Ear2 Sh2b2 Sertad1 Alas2 Ptger4 Basp1 Ninj1 John Wiley & Sons, Ltd Figure 4 Identification of differentially expressed genes (DEGs) between IR + NS and IR + Zymosan‐A groups. [score:9]
DEGs expression heat map was shown in Figure  4. Table 1 One hundred and thirty‐one differentially expressed genes (DEGs) were identified between IR + NS and IR + Zymosan‐A groups Up‐regulated gene Down‐regulated gene Stfa2 Ecm1 Egr1 Herpud1 Ccrl2 Zc3h12a Ier3 Irak2 Hbb‐b1 Stfa3 Mir5109 Atf3 Gramd1a Xcl1 Socs3 Lfng H2‐K1 Beta‐s BC100530 F630028O10Rik Ptafr Lpl Bpgm Ier5 Cyth1 Cxcl2 Slc4a1 BC117090 Gstm1 Bcl3 Ptgs2 H2‐Q4 Tnf Niacr1 Tnfsf13b Mir21 2010005H15Rik Ear1 Rasal3 Phf1 H2‐Q5 Erdr1 Txnip Mir22 Hba‐a2 Stfa1 Mt1 Smox Skil Rasl11b Nfkbia H2‐Ab1 H2‐Eb1 Hba‐a1 Gm5483 Rn45s Amica1 Cd74 Fmnl2 Mir24‐2 H2‐T22 Zfp36 Hbb‐b2 Stfa2 l1 Ear12 Neurl3 Nfkbid Cables1 Relb Nfkbiz Nfkb2 Hbb‐bt Saa3 Ear3 Ier2 Hmox1 Mir1901 Tnfaip3 H2‐T9 Ppp1r15a Mirlet7i Mt2 Ear7 5430421N21Rik Klf2 Tmcc2 Fn1 Junb Smim5 Gpnmb Marco Ear6 Bbc3 Jund H2‐Q6 H2‐Q10 Phlda1 Gabbr1 Mir146b Ggt1 Acvrl1 Irg1 H2‐Aa H2‐Q8 Thbs1 Gm15441 Mir1198 Prok2 Ceacam10 Rnf167 Tgif1 H2‐Q9 Nfkbie Jun Dusp2 Lars2 Ctsg Pik3ap1 Tgm2 H2‐Q7 Gadd45b Zmpste24 Antxr2 Steap4 Ear2 Sh2b2 Sertad1 Alas2 Ptger4 Basp1 Ninj1 John Wiley & Sons, Ltd Figure 4 Identification of differentially expressed genes (DEGs) between IR + NS and IR + Zymosan‐A groups. [score:9]
[1 to 20 of 2 sentences]
27
[+] score: 18
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
In contrast, only 5 miRNAs (miR-21, miR-26a, miR-24, miR-30b and miR-29a) were found to be downregulated both in vitro and in vivo by EF24 treatment. [score:4]
miR-24 is a putative oncomir and is overexpressed in breast and cervical carcinoma [35]. [score:3]
[1 to 20 of 3 sentences]
28
[+] score: 18
In spite of weak or undetectable circadian expression of mature miRNAs, we found that at least 57 circadian miRNA primary transcripts including pri-mir-122 and pri-mir-24 do show strong circadian expression and are under circadian regulation. [score:6]
These include miR-24 and miR-29a that show no circadian expression at mature levels but were reported to be involved in the regulation of circadian period 17. [score:4]
It has been reported that miR-24 regulates Per1 and Per2 expression and is required for generating a time delay for the circadian oscillator 17. [score:4]
Here we showed that miR-24 primary transcript is regulated by BMAL1/CLOCK. [score:2]
We found that four miRNAs (miR-24-3p, miR-101a-3p, miR-378-3p and miR-122-3p) showed significant circadian oscillations at mature levels with peak times close to those of their primary transcripts. [score:1]
As miR-122 and miR-24 have been previously reported to be involved in circadian rhythm, we wondered if other circadian miRNA primary transcripts also harbor miRNAs with important circadian functions. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 18
CE-RSCs from various species have been shown to have very similar properties and gene expression patterns [38- 41] Of the 4 miRNAs expressed most highly in CE-RSCs according to, miR-24 was also predicted to have a significant effect (p < 0.05) upon mRNA expression and miR-122 had p = 0.08. [score:7]
These miRNAs could also play a role in maintaining the progenitor cell state, as has been shown in other tissues; over -expression of miR-24 causes a delay in maturation of hematopoietic progenitor cells [43] and over -expression of miR-122 delays differentiation of human embryonic stem cells [44]. [score:5]
The following miRNAs had highly significant predicted effects on target mRNA levels and were selected for analysis by: miR-124, miR-125, miR-9, and miR-24. [score:3]
Whilst most of the candidate miRNAs predicted to affect mRNA levels (P < 0.05) at P4 were also in the adult, only miR-125, miR-378 and miR-24 were detected in all the different tissue types and developmental stages. [score:2]
In the adult retina miR-124 and miR-125 were again prominent, but others, including miR-24, miR-326, miR-370, miR-96 and let-7 also had highly significant predicted effects. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 17
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
[1 to 20 of 4 sentences]
31
[+] score: 17
In fact, in addition to being strongly induced during myogenesis, miR-24 expression is maintained at high levels in terminally differentiated muscle tissues (Sun et al., 2008). [score:3]
miR-24 is a non-muscle-specific miRNA involved in myogenesis; it is highly expressed in terminally differentiated muscle and it functions during both differentiation and homeostatic maintenance (Sun et al., 2008). [score:3]
In addition, these data were strengthened by the up-regulation of miR-24 in mdx/mIGF-1 mice compared to mdx littermates. [score:3]
To further support the pro-myogenic activity of mIGF-1, we analyzed the expression of another key player that functions during both differentiation and homeostatic maintenance of skeletal muscle tissues, namely the non-muscle-specific miR-24 (Sun et al., 2008). [score:3]
Figure 3G shows that miR-24 was significantly up-regulated in the diaphragm of 4-week-old mdx/mIGF-1 mice compared to mdx littermates. [score:3]
Transforming growth factor-beta-regulated miR-24 promotes skeletal muscle differentiation. [score:2]
[1 to 20 of 6 sentences]
32
[+] score: 17
Similarly, forced expression of either miR-24 or miR-210 in Treg resulted in a twofold decrease in Foxp3 expression demonstrating Foxp3 as a direct target of these miRNAs (47). [score:8]
Thus, to increase Foxp3 expression and promote Treg stability and suppressor function, approaches can be undertaken to increase miR-10a or miR-95 and/or decrease miR-15a-17, miR-24, or miR-210. [score:5]
Similarly, miR-23–miR-27–miR-24 cluster overexpression impairs TGF-β -mediated Treg induction (42). [score:3]
Moreover, miRNA (miR-31, miR-17–miR-92, and miR-23–miR-27–miR-24) antagomir treatment of T cells in vitro may be exploited to support iTreg generation, while in vivo treatment may foster pTreg generation. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Two of the six miRNAs showed a trend for a stronger upregulation during white adipocyte differentiation - miR-24-1* and miR-23b. [score:4]
The six miRNAs tending to demonstrate a stronger upregulation during the white adipocyte differentiation included miR-24-1* and miR-23b, members of a recently identified miR-23b cluster. [score:4]
Nevertheless, the miRNAs mir-34c, mir-143, mir-24, mir-720 and mir-21 showed robust expression in the adipocyte cultures, and these 5 miRNAs were thus profiled in subcutaneous adipose tissue from healthy humans with different BMIs to examine their regulation in adipose tissue expansion. [score:4]
Five miRNAs (mir-21, mir-143, mir-34c, mir-24 and mir-720) were profiled in subcutaneous adipose tissue from healthy humans with varying degrees of obesity. [score:1]
Of the 10 miRNAs that showed expression in the adipocyte cultures, we chose a subset of 5 miRNAs (mir-34c, mir-143, mir-24, mir-720 and mir-21) to measure in human adipose tissue RNA samples from obese persons (BMI >30, n = 10) and non-obese persons (BMI <30, n = 10). [score:1]
Our results, in combination with these previous observations, suggest that this mechanism might therefore involve miR-24-1 and miR-23b. [score:1]
Figure 4 Expression levels of mir-21, mir-24, mir-34c, mir-143 and mir-720 were measured in subcutaneous adipose tissue of obese (BMI >30, n = 10) and non-obese (BMI <30, n = 10) healthy persons. [score:1]
[1 to 20 of 7 sentences]
34
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
As previously described for many clustered miRNAs (Lagos-Quintana et al., 2003; Lim et al., 2003), Mir24.1 had an expression pattern similar to that observed for Mir23b, including expression in the nasal epithelium (Supplemental Figures 3A– C), tongue (Supplemental Figures 3E,F,H,I) and maxillary process epithelium (Supplemental Figure 3D), though expression in the palatal shelf mesenchyme and overlying epithelium (Supplemental Figures 3D,F,H,I) and trigeminal ganglia (Supplemental Figure 3G) was weak. [score:7]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
We initially examined miRNA expression in E12.5 mouse embryo using whole mount ISH and LNA probes against Mir23b, Mir24.1, and Mir666 (Supplemental Figure 1). [score:3]
In mouse, Mir23b is part of a miRNA cluster that includes Mir23b, Mir27b, Mir3074.1, and Mir24.1. [score:1]
In zebrafish, this corresponds to mir23b, mir27d, and mir24.1. [score:1]
[1 to 20 of 5 sentences]
35
[+] score: 16
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
Of the down-regulated miRNAs a number have been reported to be down-regulated in prostate cancer relative to benign prostate tissues, i. e. miR-16 [23]– [25], miR-24 [26]– [28], miR-29a [26], miR-145 [23], [24], [27], [29], [30], and miR-205 [24], [31], [32]. [score:7]
[1 to 20 of 2 sentences]
36
[+] score: 16
miRNA expression levels were normalized to the level of miR-24 expression, which was unresponsive to Myostatin expression level, to correct for differential cDNA content. [score:7]
In contrast, miR-24 expression level was not affected by Myostatin genotype (data not shown). [score:3]
Real-time PCR expression values were normalized to miR-24 and then reported relative to MSTN [+/+ ]levels. [score:3]
2) on miR-24 expression level. [score:3]
[1 to 20 of 4 sentences]
37
[+] score: 13
Furthermore, to determine which miRNAs can suppress endogenous KSRP mRNA expression, NIH-3T3 cells were singularly transfected with let-7b, let-7c, miR-24 or miR-27b mimic and the steady-state KSRP expression level was assayed by western blot and quantitative RT-PCR. [score:6]
Eight candidate miRNAs targeting KSRP 3′UTR were predicted by these programs (Figure S4A), but only let-7b, let-7c, miR-24, miR-27a, and miR-27b were expressed during pituitary development, as evaluated by a miRNA profiling array experiment (Table S2). [score:4]
miRNA mimics for control, let-7b, let-7c, miR-24, and miR-27b (Qiagene) as well as miRNA inhibitors for control, let-7b, let-7c, miR-24, and miR-27b (Qiagene) were singularly transfected at 100 nM final concentration. [score:3]
[1 to 20 of 3 sentences]
38
[+] score: 13
Among the up-regulated miRNAs, miR-106b, miR-25 and miR-19b share the same primary transcripts, and miR-24 and miR-27 share primary transcripts. [score:4]
Some up-regulated miRNAs such as miR-19a, miR-24 and miR-128a were unchanged at the level of their primary transcripts. [score:4]
Some miRNAs such as miR-24, miR-186, let-7f and miR-320 showed changes in expression throughout all time points (Figure S2C). [score:3]
Among these miRNAs with shared directions of change in in vitro cultured hippocampal neurons and in vivo hippocampal CA1 regions after either neuronal stimulation or contextual conditioning were miR-24, miR-326, miR-320, miR-21 and miR-10b. [score:2]
[1 to 20 of 4 sentences]
39
[+] score: 13
miR-26a, miR-34a and miR-146a suppress HCC cell progression by targeting fucosyltransferase 8 (FUT8), the only enzyme responsible for β1,6-fucosylation of N-glycans [14]; O-GlcNAc transferase (OGT) was identified as a novel target of miRNA-7 in a mouse glioblastoma xenograft mo del [15] and of miR-24-1 in human breast cancer cells [16]; mature miR-17-5p and passenger miR-17-3p induce HCC by targeting N-acetylgalactosaminyltransferase 7 (GALNT7) [17]; Let-7c inhibits metastatic ability of mouse hepatocarcinoma cells via targeting mannoside acetylglucosaminyltransferase 4 isoenzyme A (Mgat4a) [11]. [score:13]
[1 to 20 of 1 sentences]
40
[+] score: 12
Inhibition of VSV replication was thus likely a direct effect of cellular miRNAs, in line with a previous report showing that VSV can be targeted by miR93 and miR24 [18]. [score:6]
In vivo, Dicer -deficient mice display increased susceptibility to Vesicular stomatitis virus (VSV) infection [18] due to impaired expression of miR-93 and miR-24 which directly target viral RNA. [score:6]
[1 to 20 of 2 sentences]
41
[+] score: 12
Our data also documented a statistically significant up-regulation of miR-23b cluster miRNAs (miR-23b, miR-27b, and miR-24) during postnatal aortic development (Supplementary Table S2), consistent with an inhibitory effect of these miRNAs on TGF- signaling. [score:7]
As with miR-29 and miR-145, computational analysis of the target gene profile for miR-27 and miR-24 showed a significant shift in the aortic samples from six-week old mice (Fig. 2), suggesting that these miRNAs also contribute to the mRNA expression profile in the adult aorta. [score:5]
[1 to 20 of 2 sentences]
42
[+] score: 12
Amplification was performed using a qPCR Thermal Cycler (Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands) with a denaturation step at 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s and 60 °C for 60 s. Data of these qPCR experiments were normalized using the geometric mean [26, 28] of the two uniformly expressed miRNAs, i. e., miR-16 and miR-24. [score:3]
miR-24 and miR-16, surrogate markers for total miRNA expression, were detectable in all samples. [score:3]
The expression profiles of miR-24 and miR-16 have been reported to be stable in several bodily fluids and tissues [24– 27], and were therefore used for normalization purposes. [score:3]
Again, miR-24 and miR-16 were detected in all samples, while the proportion of individuals with undetectable miR-219 was higher in the MS patients’ groups (Fig. 1c). [score:1]
Levels were normalized using the geometric mean of miR-24 and miR-16. [score:1]
Relative expression levels (REL) were calculated using the formula REL = 2 [− ∆Ct], where Ct is cycle threshold, and ∆Ct = Ct (miRNA) –  Ct (geometric mean of miR-16 and miR-24). [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 11
Within the genetic background scanned for miRNA expression on Exiqon arrays, miR-24 and miR-26b were significantly correlated with GH and PRL, with miR-26b being reported to have a potential impact upon expression of the TF Pit-1 in GH3 cells by inhibiting the Pit-1 inhibitor called Lef-1 [59]. [score:9]
We selected the top 9 miRNAs (miR-200a, miR-200b, miR-182, miR-429, miR-183, miR-200c, miR-141, miR-96 and miR-24) showing the highest standard deviations. [score:1]
Of the 9 miRNAs, miR-24 shows the best correlation with GH and PRL (Fig 6C). [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 11
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
[1 to 20 of 3 sentences]
45
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
With exception of miR-33a, miR223, miR-9, miR-24, and miR-429, whose expression level was low in activated B cells, such Prdm1 -targeting miRNAs were significantly upregulated by HDI. [score:8]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 2 sentences]
46
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
47
[+] score: 11
The miR-24 and miR-27a modulate immune response by inhibiting Th2 regulation through targeting IL-4 and GATA binding protein 3 (GATA3) of mouse CD4 T cells (33). [score:6]
Cho and colleagues reported that miR-24 and miR-27a collectively inhibit the differentiation of CD4 T cells into Th2 cells by targeting IL-4 and GATA3 (33). [score:5]
[1 to 20 of 2 sentences]
48
[+] score: 10
Up-regulation of miR-24 decreased DND1 expression resulting in lower P27 levels and increased proliferation and reduced apoptosis in TSCC cells. [score:6]
A recent study detected DND1 in human tongue squamous cell carcinoma (TSCC) and found that miR-24 directly targets DND1 mRNA [9]. [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 9
In contrast, miR-361-5p, alone with other microRNAs known to target VEGF directly, including miR-34a, miR-503 and miR-24, were dysregulated in CAD-EPCs (Fig. 2). [score:5]
MicroRNA-24 has been proved to target VEGF mRNA directly [28], and miR-24 is also loss in the plasma and of type 2 diabetes patients [29]. [score:4]
[1 to 20 of 2 sentences]
50
[+] score: 9
For example, hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 were considered as tooth tissue-specific miRNAs [4]; eight differentially expressed miRNAs were expressed during morphogenesis and seven were expressed in the incisor cervical loop containing the stem cell niche [1]; the three most highly expressed microRNAs in dental epithelium were identified as mmu-miR-24, mmu-miR-200c, and mmu-miR-205, while mmu-miR-199a-3p and mmu-miR-705 were found in dental mesenchyme [2]; and miR-200 was suggested to play an important role in the formation of incisor cervical loop during stem cell–fueled incisor growth [5]. [score:8]
Porcine ssc-miR-24 [14] was used as an internal control. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 9
Co-transfection with miR-181a mimic but not miR-24 mimic, led to downregulation of GFP protein expression compared to mock -transfected control (Ctrl), as shown by representative western blot. [score:5]
The GFP reporter containing wild type Sirt1 3′UTR was efficiently regulated by miR-181 but not by miR-24; a microRNA not predicted to target Sirt1 (negative control) (Fig.   4b, c). [score:4]
[1 to 20 of 2 sentences]
52
[+] score: 9
However, these as well as functional studies on mir-24 and its targets are still in the early stages. [score:3]
Tantalizing data predict p16 and dehydrofolate reductase (DHFR) as mir-24 targets among others [93], [94], [95], [96], [97]. [score:3]
We also identified specific KSHV and KS -associated pre-miRNAs, foremost among them mir-221, mir-140, mir-15a and mir-24. [score:1]
High levels of the precursor microRNA mir-24 emerged as a biomarker only in patient derived KS samples, not in any of the culture mo dels. [score:1]
Mir-24 has been shown to be important in cell-cycle regulation, cell growth and differentiation in a variety of cell types [91], [92]. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 8
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, mmu-mir-24-2, ocu-mir-24-1, ocu-mir-24-2
Indeed we have recently identified the involvement of a microRNA, miR-24, in the direct regulation of macrophage MMP-14 protein expression [29]. [score:5]
Indeed, we recently showed that high levels of miR-24 in nonfoamy macrophages limit macrophage MMP-14 protein expression [29]. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 8
This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis. [score:5]
miR-126-3p, miR-24, miR-16, miR-19b, and miR-17 were the top five miRNAs with the highest absolute expression values. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 8
In addition, developmental upregulation of some miRNAs identified in our screen was observed in differentiating oligodendrocytes in vitro, including miR-146, miR-23b, miR-24, and miR-27b in one study [13] and miR-204, miR-27b and miR-100 very recently in another study [20]. [score:5]
Besides miR-34a, other miRNAs that were identified in our screen were previously found to be associated with an inhibitory effect on proliferation of non-neural tumor cells, including miR-24 in HeLa cells [25] and miR-100 in oral squamous cell carcinoma [26]. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 8
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
Both ACTH and 17α-E2 up-regulated the expression of miRNA-212, miRNA-132, miRNA-154, miRNA-494, miRNA-872, miRNA-194, and miRNA-24-1, but reduced the expression of miRNA-322, miRNA-20b, miRNA-339, miRNA-27a, miRNA-551b, and miRNA-1224. [score:8]
[1 to 20 of 1 sentences]
57
[+] score: 8
Top 10 predicted targets for synergistic repression by mir-24, mir-26a, and mir-351. [score:3]
While superficially it seems that the mir-24 containing cluster is a generalized differentiation controlling locus, mir-24 has been observed to be specifically expressed in porcine satellite cells in a reciprocal fashion to mir-206 [25]. [score:3]
The placement of mir-24 in a rare myogenic population may hint at a role in regulating stem cell entry into differentiation, possibly by the control of timing or proportions of cells entering the process. [score:2]
[1 to 20 of 3 sentences]
58
[+] score: 8
Oppositely, miR-24, functioning as a tumor suppressor in LSCC, could significantly suppress cell proliferation and invasion ability of Hep2 cells via downregulation of S100A8 [8]. [score:8]
[1 to 20 of 1 sentences]
59
[+] score: 8
In addition to miR-27a and let-7b, the following miRNAs from the miRNA signature were considered to be tumor suppressors for DLBCL: miR-15a [29, 32, 43, 44], let-7c [20, 23], miR-24 [12], and miR-497 [9, 45]. [score:2]
This miRNA signature consists of 10 miRNAs: miR-130, miR-27, miR-17, miR-10, miR-155, let-7a-5p, let-7, miR-24-3p, miR-15, and miR-16-5p. [score:1]
Five out of the ten miRNAs (let-7c, miR-15a, miR-18a, miR-24, and miR-130a) showed an increased amount of circulating miRNA with age for both Smurf2 [T/T] and wild-type mice (Fig 4). [score:1]
Since miRNAs can have different aliases, the 10 miRNAs (Fig 1) are identified as the following for the rest of this manuscript: let-7 = let-7b, let-7a-5p = let-7c, miR-10 = miR-10b, miR-130 = miR-130a, miR-155 = miR-155, miR-27 = miR27a, miR-24-3p = miR-24, miR-17 = miR-18a, miR-15 = miR-15a, and miR-16-5p = miR-497. [score:1]
Since then, it has been discovered that a number of other miRNAs, including miR-17 [13, 19], miR-27 [19, 20, 41], miR-24 [19], miR-10 [19, 20], and let-7 [12, 19, 20], play an important role in lymphoma biology. [score:1]
This key circulating miRNA signature consists of ten miRNAs (let-7c, let-7b, miR-15a, miR-18a, miR-27a, miR-155, miR-24, miR-130a, miR-10b, and miR-497), which were responsible for DLBCL initiation and was present prior to the formation of visible tumor. [score:1]
Specifically, let-7c, miR-27a, miR-155, and miR-24 were significantly increased, while the rest of the miRNAs had an increased trend. [score:1]
[1 to 20 of 7 sentences]
60
[+] score: 8
Thus, for six miRNA families – mir-135, mir-205, mir-142-3p, mir-15/16, mir-218 and mir-24 - we obtained evidence for their functional relevance in the inner ear on two levels: (a) the miRNAs were differentially expressed between the two tissues; and (b) their predicted targets were differentially expressed in a manner consistent with the currently accepted mo del of miRNA regulation. [score:8]
[1 to 20 of 1 sentences]
61
[+] score: 7
The target small RNA expression value was normalized with a reference gene: the exogenous spike-in cel-miR-39, or the endogenous hsa-miR-24 [21] or RNU48 [22], as indicated in the respective legends. [score:5]
The same results were observed upon normalization with two endogenous small RNAs, namely the miR-24 [21] or the RNU48 [22] (Fig.   4b,c), indicating that our data were independent on the type of normalizer used (Fig.   4d). [score:1]
Quantitative RT-PCRs using Sybr Green or TaqMan (Invitrogen) for s-RNYs, cel-miR-39, miR-24, miR-17, miR-92a, miR-126, miR-133, miR-145, miR-155, RNU48, and miR-208 were performed on a StepONE system (Applied Biosystem). [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 7
Guo et al. [4] found that miR-21 and miR-24 appeared together at 12 h after exposure to 50 J/m2 UVB and a sub-G1 DNA content fraction and apoptotic cells appeared at 12 h post-irradiation, suggesting that miR-21 and miR-24 together inhibited growth. [score:3]
For example, miR-21 is known to be involved in the progression of cancer and has been described as an oncogenic miRNA [30], but when it appears together with miR-24, it inhibits growth [4]. [score:3]
However, the present study did not find any changes in miR-21 or miR-24 in the UVB group. [score:1]
[1 to 20 of 3 sentences]
63
[+] score: 7
We analyzed by Q-PCR the expression of three miRNAs (miR-24, miR-23a and miR-29b) known to be expressed in thyroid epithelial cells [20]. [score:5]
Dicer-amplifying primers positions are shown in A. (C) Q-PCR analysis of mature miR-24, miR-23a, miR-29b relative expression in mice thyroids. [score:2]
[1 to 20 of 2 sentences]
64
[+] score: 7
uL5 (rpL11) directly binds to c-Myc MBII domain [53] but also recruits of micro -RNA -induced silencing complex (miRISC) with miR-24 or miR-130a to c-Myc mRNA at its 3′ untranslated region (3′-UTR), leading to c-Myc mRNA degradation [54]. [score:4]
Challagundla K. B. Sun X. X. Zhang X. DeVine T. Zhang Q. Sears R. C. Dai M. S. Ribosomal protein L11 recruits miR-24/miRISC to repress c-Myc expression in response to ribosomal stress Mol. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 6
Interestingly, we also noted that miR-24 was strongly induced upon BD-TS differentiation; miR-24 contains a perfect seed match to a site within the Cdx2 3′-UTR, and is computationally predicted to target Cdx2 by TargetScan, PicTar, and miRTIF [43]) (Table S3). [score:5]
Levels of Cdx2 decline as BD-TS cells differentiate [35], and our results suggest miR-24 may contribute to Cdx2 repression in this context. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 6
For example, miR-24 inhibits cardiomyocyte apoptosis by regulating its target gene Bim, one B-cell lymphoma 2 (Bcl2) family members, in a mouse MI mo del [7]. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
miR-24, used as endogenous control [57] was stably expressed in whole brain and the brain regions studied of G93A-SOD1, B6. [score:3]
miRNA levels were normalized to miR-24 and expressed as fold changes using the formula 2 [-ΔCt]. [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 6
In the heart, miR-24 attenuates cardiac fibrosis and inhibits the differentiation of cardiac fibroblasts by targeting furin, a protease for TGF-β maturation [14]. [score:5]
Wang J. Huang W. Xu R. Nie Y. Cao X. Meng J. Xu X. Hu S. Zheng Z. MicroRNA-24 regulates cardiac fibrosis after myocardial infarction J. Cell. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 6
miR-24 is upregulated during myoblast differentiation, and its expression is repressed by TGF-β1 in a Smad3 -dependent manner [45]. [score:6]
[1 to 20 of 1 sentences]
70
[+] score: 5
GM-CSF increases macrophage MMP-14 levels and activity by suppressing miR-24. [score:3]
Di Gregoli K Jenkins N Salter R White S Newby AC Johnson JL MicroRNA-24 regulates macrophage behavior and retards atherosclerosis. [score:1]
Moreover, reduction of miR-24 drives advanced atherosclerotic plaque progression. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 5
Moreover, it has been shown in vitro that MYOCD induces the expression of miR-24 and miR-29 and promotes SMC differentiation by suppressing PDGFRB [32]. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
Venn analyses revealed sixteen differentially expressed miRNAs in wildtype primary mesenchymal cells that were treated with dexamethasone (Fig. 1A), of which eleven were up regulated (let-7 family, miR-125b, miR-146a, miR-148a + b, miR-152, miR-423) (Table S1) and five were down regulated (miR-1724a, miR-23a+b, miR-24-1,-2, miR-29a) (Table S1). [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
The miRNA expression profiles were normalized either to reference gene U6 (snRNA) or to the average obtained between miR-23a, miR-23b, and miR-24, whose expression levels are stable under the experimental conditions applied in this study. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
miR-29 family genes have been shown to regulate the expression of multiple ECM components in TM cells 11– 13. miR-24 regulates the induction of TGFβ1 in TM cells in response to cyclic mechanical stress [14]. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, Chowdhury D, Dykxhoorn DM, Tsai P, Hofmann O, et al. miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to “seedless” 3′UTR microRNA recognition elements. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, mmu-mir-24-2
The AE2 mRNA was translated into proteins, while translation of both AE1 and p16 was normally silenced by several factors, including miR-24 and gastrin [24, 25]. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
NFATs may also control genes encoding signaling molecules as variate as Ca [2+] regulators [inositol 1,4,5-trisphosphate (IP [3]) receptor (IP [3]R), regulator of calcineurin 1 (RCAN1)], growth factors (VEGF, neurotrophins), myelination genes (P0 and Krox-20), glucose regulation genes (insulin, HNF1, PDX, and GLUT2), cell cycle and death regulator/activators [p21 [Waf1], c-Myc, cyclin -dependent kinase 4 (CDK4), B-cell lymphoma 2 (Bcl-2), and cyclins A2, D1, and D2], oncogenes (Wnt, β-catenin), microRNAs (miR-21, miR-23, miR-24, miR-27, miR-125, miR-195, miR-199, and miR-224), and surfactants (sftpa, sftpb, sftpc, and abca3) [9, 65– 74]. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to “seedless” 3′UTR microRNA recognition elements. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
Although miRNA expression among these samples was highly correlated overall, such as in the case of miR-22-3p or miR-24-1-3p (Fig. 3A), several miRNAs appeared to be specifically or preferentially expressed in either the MIN6 cells or human beta cells/islets (Fig. 3A). [score:5]
[1 to 20 of 1 sentences]
80
[+] score: 5
[33] By comparing our miRNA expression results with the independent miRNA profiles, we identified four miRNAs (miR-141, miR-29c, miR-24 and let-7a) that were shared between these data sets and were differentially expressed in GCs. [score:5]
[1 to 20 of 1 sentences]
81
[+] score: 5
Nine miRNAs with the highest expression levels (average Ct value range 19.6–22.5) were common amongst the four groups of mice despite the differences in age and disease state, and they were miR-133a, miR-126-3p, miR-24, miR-30c, miR-30b, miR-1, miR-16, miR-19b and miR-145 (Table S1). [score:5]
[1 to 20 of 1 sentences]
82
[+] score: 5
Northern blot analysis showed no significant differences in the expression of miR-24 and miR-339 between normal and dystrophic mRNA samples (data not shown). [score:3]
By analyzing this 3′-UTR, we identified putative consensus binding sites for three miRs: miR-24, miR-222 and miR-339. [score:1]
Among the several miRs predicted to bind the β1-syntrophin 3′-UTR, three miRs (miR-222, miR-24, and miR-339) were identified by the different databases utilized. [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 4
For example, several RNA -binding proteins have been recently shown to control the accessibility and regulation of a given mRNA by a specific miRNA such as PUM2 that is involved in p27 mRNA regulation by miR-221 and miR-222 [48] or RPL11 involved in the control of Myc mRNA regulation by miR-24 [49]. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
For example, miR-24 has been shown to be regulated during macrophage and dendritic cell differentiation potentiates innate immunity (Fordham et al., 2015). [score:2]
Regulation of miR-24, miR-30b, and miR-142-3p during macrophage and dendritic cell differentiation potentiates innate immunity. [score:2]
[1 to 20 of 2 sentences]
85
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, mmu-mir-24-2
The c-Myc mRNA level is also regulated by RPL11 via the recruitment of miR-24/miRISC to the 3' untranslated region of c-Myc mRNA [80, 81]. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Some miRNAs have been identified to regulate the expression of FoxM1, including miR-149, miR-134, miR-370, miR-494, miR-194, and miR-24-1 [37– 43]. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig). [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Expression of p16/INK4A is repressed by miR-24 and miR-31 which are also involved in the regulation of cell proliferation and progression of cell cycle in many cancers [141, 142]. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
Moreover, miR-145 (Sachdeva et al, 2009), miR-34a (Christoffersen et al, 2010), miR-24 (Lal et al, 2009), miR-141 (Zhang et al, 2010), miR-185-3p (Liao & Lu, 2011) and let-7 (Melton et al, 2010) are found to repress c-Myc expression directly and adversely affect c-Myc's oncogenic function. [score:4]
[1 to 20 of 1 sentences]
91
[+] score: 4
Sufficiently high levels of expression was found only in 10 miRNAs: miR-133a, miR-206, miR-1, miR-145, miR-24, miR-19b, miR-17, miR-106b, miR-20a and miR-21. [score:3]
The other significantly altered miRNAs (miR-1, -133a, -133b, -145, -21 and miR-24) were always found to be diminished, although modestly (≤50%) and varying between the age and muscle/plasma/sex groups. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 4
In human CD8 [+] T cells, miR-23a cluster (miR-23a, miR-27a, miR-24), and miR-720 were upregulated by TGF-β 36 37. [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 3
Fordham J. B. Naqvi A. R. Nares S. Regulation of miR-24, miR-30b, and miR-142-3p during macrophage and dendritic cell differentiation potentiates innate immunity J. Leukoc. [score:2]
The miR-24, miR-30b, and miR-142-3p were all identified be to be involved in macrophage differentiation [25]. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 3
Following a report documenting hypersusceptibility of Dicer-1 -deficient mice to VSV infection as a result of impaired miR-24 and miR-93 expression [26], we examined the contribution of miR-93 in the replication of CHPV. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Other miRNAs from this paper: mmu-mir-24-2
Ye SB Exosomal miR-24-3p impedes T-cell function by targeting FGF11 and serves as a potential prognostic biomarker for nasopharyngeal carcinomaJ Pathol 2016 37. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Other miRNAs from this paper: mmu-mir-128-1, mmu-mir-24-2, mmu-mir-128-2
Qian L miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytesJ. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
In addition, non-muscle-specific miRNA involved in myogenesis (e. g. miR-24, miR-181 and mir-214) were broadly expressed [41]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Several other studies performed on whole PBMCs or serum have emphasized the clinical significance of miRNAs in arthritis as disease-specific biomarkers (serum miR-16 and miR-223 in early RA, and serum miR-24 and miR-125a-5p in established RA) or inflammation-specific biomarkers (miR-146a, miR-132 and miR-16 in PBMCs) [10, 25, 26]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Restrained miR-24 inhibits endothelial apoptosis and reduces myocardial infarct size (10). [score:3]
[1 to 20 of 1 sentences]