sort by

57 publications mentioning ath-MIR172b

Open access articles that are associated with the species Arabidopsis thaliana and mention the gene name MIR172b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 122
This finding also suggested an indirect role for miR172, which limits the accumulation of AP2 protein by translational inhibition [9], in negatively regulating WUS to confer floral determinacy. [score:7]
The impact of PWR on multiple but not all of the five MIR172 genes and the finding that a mutation in MIR172d, whose expression is independent of PWR (Figure 7), also affects determinacy demonstrate that the expression diversification of this miRNA family is functionally relevant. [score:6]
PWR promotes the expression of CRC and several MIR172 genes at the transcriptional levelBecause AP2 is under the regulation of miR172 in the flower, experiments were performed to assess whether miR172 accumulation or activity was compromised by mutations in PWR. [score:5]
The miR172d-1 mutation provides direct genetic evidence for the role of miR172 as a positive regulator of floral determinacy, and the absence of flowering time defects in this mutant suggests that the developmental functions (flowering time and floral determinacy) assigned to miR172 can be uncoupled. [score:5]
Individual MIR172 genes may have distinct developmental functionsIn addition to its role in floral development, miR172 regulates flowering time as a negative regulator of floral repressors that belong to the AP2 transcription factor family [18]. [score:5]
The first characterization of miR172 function was made possible by transgenic lines in which miR172 was overexpressed (yielding early-flowering and ap2-like phenotypes) or lines in which the miR172 target AP2 was made resistant to regulation by the miRNA [9], [40]. [score:4]
In addition to its role in floral development, miR172 regulates flowering time as a negative regulator of floral repressors that belong to the AP2 transcription factor family [18]. [score:4]
Although a role for miR172 as a positive regulator of floral determinacy has previously been inferred from findings that established it as a negative regulator of AP2 in the flower, the ag-10 mir172d-1 phenotype provides direct loss-of-function evidence that at least one of the MIR172 genes, MIR172d, is required for the proper termination of the floral stem cells. [score:4]
Its role in floral stem cell maintenance has been evidenced by the severely indeterminate flowers produced when AP2 is simultaneously misexpressed and resistant to regulation by miR172 [8]. [score:4]
In addition, the ag-10 ap2-2 mir172d-1 triple mutant was generated to determine whether the floral determinacy defects of ag-10 mir172d-1 could be suppressed by ap2-2. The phenotype of the triple mutant clearly demonstrates that miR172 -mediated repression of AP2 is required for floral determinacy as the ap2-2 mutation completely rescued the floral determinacy defects of ag-10 mir172d-1 (Figure 6C). [score:4]
By studying miR172, which represses its target APETALA2 (AP2) and thereby promotes the determinate growth of flowers (also known as floral determinacy), we show that the five MIR172 genes undergo differential transcriptional regulation. [score:4]
PWR promotes the expression of CRC and several MIR172 genes at the transcriptional level. [score:3]
PWR contributes to the robustness of the floral determinacy network through MIR172 and CRC The termination of the floral meristem requires various regulatory factors whose functions are orchestrated during the different stages of floral development. [score:3]
miR172 is also known to promote flowering by targeting several members of the AP2 gene family in addition to AP2 [18]. [score:3]
miR172 is present in the inner whorls from early stages onward [9], [21], while CRC is not expressed until carpel growth is initiated in late-stage flowers [35]. [score:3]
miR172 regulates AP2 transcription factor genes involved in the distinct processes of flowering time and floral development [18], but the individual contributions of the five MIR172 genes to these processes are unknown. [score:3]
Because AP2 is under the regulation of miR172 in the flower, experiments were performed to assess whether miR172 accumulation or activity was compromised by mutations in PWR. [score:3]
Interestingly, the mir172d-1 mutation did not affect flowering time (data not shown), suggesting that other MIR172 genes are sufficient to confer this developmental function. [score:3]
Furthermore, specific regulation of MIR172c and MIR172e in the outermost floral whorl by a transcriptional corepressor indicates that the MIR172 family members are differentially regulated in the flower [9], [20], [21]. [score:3]
This was not surprising because the expression of AP2 in the outer two whorls may have masked the effects of miR172 in the small number of floral stem cells. [score:3]
CRC acts downstream of AG, and miR172 represses AP2 expression. [score:3]
Diversification in the regulation of the MIR172 genes and their common function in negatively regulating AP2 make the stem cell termination network more robust. [score:3]
PWR promotes floral stem cell termination by enhancing the expression of CRC and three of the five MIR172 genes. [score:3]
A similar role in the floral meristem was revealed when miR172-resistant AP2 was expressed and found to confer indeterminate floral organ production [8]. [score:3]
AP2 encodes an AP2-domain-containing transcription factor and is regulated by miR172. [score:2]
These findings indicate that PWR specifically regulates CRC and some, but not all, of the MIR172 genes through the recruitment of Pol II to these loci. [score:2]
MIR172d is required for floral determinacyCoincidental with the observation that miR172 levels were reduced in pwr mutants, the mutation in another enhancer isolated from the ag-10 genetic screen was mapped to the MIR172d locus. [score:2]
Coincidental with the observation that miR172 levels were reduced in pwr mutants, the mutation in another enhancer isolated from the ag-10 genetic screen was mapped to the MIR172d locus. [score:2]
Individual MIR172 genes may have distinct developmental functions. [score:2]
Taken together, these findings indicate that differential regulation of MIR172 genes with overlapping functions enhances the robustness of the genetic network underlying floral stem cell termination. [score:2]
The 3′ products resulting from cleavage of AP2 mRNA by miR172 were detected using 5′ RACE RT-PCR for L er, ag-10, pwr-1, ag-10 pwr-1, and ag-10 mir172d-1. UBIQUITIN 5 was used as the loading control. [score:1]
The abundance of miR159, miR172, and miR173 (underlined) was reduced in both pwr alleles relative to their respective controls. [score:1]
Although further studies are necessary to determine whether PWR acts as a chromatin remo deling factor, this potential mode of activity may help explain how altered PWR function yields pleiotropic defects and changes in the transcript levels of otherwise unrelated genes, including MIR172B, CRC, and FT. [score:1]
In the present study, the POWERDRESS (PWR) gene was found to promote floral determinacy through CRC and miR172. [score:1]
First, northern blot analysis revealed that reductions in mature miRNA abundance were restricted to three (miR172, miR173, and miR159) of the examined miRNA species in both pwr alleles (Figure 4). [score:1]
Pol II occupancy was clearly reduced at the MIR172b, MIR172c, and CRC loci in pwr-1 (Figure 5D, Figure 2E), while only mild changes or no changes were observed at the MIR172d, MIR172e, MIR166a, and MIR167a loci (Figure 5D). [score:1]
1003218.g005 Figure 5pri–miRNA abundance and Pol II occupancy at MIR genes in pwr-1 and pwr-2. (A) Transcript levels of pri-miR172a-e in pwr-1. pri-miR172a and pri-miR172b transcript levels were reduced in pwr-1, while no significant changes were observed for pri-miR172c, pri-miR172d, and pri-miR172e. [score:1]
To determine if PWR affected the transcription of individual MIR172 genes, real-time RT-PCR was performed for all five miR172 pri-miRNAs in pwr-1. Decreased transcript levels of pri-miR172a and pri-miR172b were observed in pwr-1, while the three remaining pri-miRNAs exhibited only subtle changes or were not affected (Figure 5A). [score:1]
Therefore, the reduced miR172 levels in pwr likely compromised the full repression of AP2 by miR172. [score:1]
PWR contributes to the robustness of the floral determinacy network through MIR172 and CRC. [score:1]
Considered together with the effects of PWR on the transcription of some, but not all, of the MIR172 genes, these findings also demonstrate that the contributions of individual members of a miRNA family to one particular developmental process can be distinguished. [score:1]
1003218.g004 Figure 4miRNA abundance in pwr-1 and pwr-2. (A) Abundance of miR159, miR172, miR173, miR166, and miR390 in L er, pwr-1, Col, and pwr-2 detected by small RNA northern blotting. [score:1]
For example, the pri-miR172b precursor is particularly abundant in the shoot apex at the induction of flowering [41]. [score:1]
First, the early flowering phenotype of pwr is in contrast to the late-flowering phenotype expected for a reduction of miR172 and is instead consistent with the increased FT transcript levels observed. [score:1]
Three unique mature miR172 sequences are produced from these five loci (one from MIR172a and b, one from MIR172c and d, and one from MIR172e), and publicly available datasets indicate that the three mature miR172 species differentially accumulate in inflorescences, rosette leaves, seedlings, and siliques [19]. [score:1]
The next question addressed was how PWR promotes the accumulation of miR172. [score:1]
Although the latter effectively corresponds to loss of miR172 -mediated repression of AP2, it does not distinguish among the mature miR172 produced from the five MIR172 loci. [score:1]
Semi-quantitative 5′ RACE PCR showed that the 3′ cleavage products from AP2 mRNA were reduced in ag-10 mir172d-1 relative to ag-10 (Figure S1), suggesting that miR172 -mediated repression of AP2 was compromised. [score:1]
In addition to the possibility that the effect of PWR on floral stem cell termination is temporally distributed, the changes in miR172 accumulation and pri-miR172 transcript levels in pwr-1 shed light on how PWR contributes to the robustness of the floral determinacy network. [score:1]
[1 to 20 of 49 sentences]
2
[+] score: 94
The down-regulation of WRKY44 in miRNA172-OX plants was consistent with its up-regulation in gi mutants, indicating that GI and miRNA172 were in the same pathway suppressing WRKY44. [score:9]
Because a previous report indicated that subgroup 1 was involved in sugar signaling [36], we detected the interaction of members of this subgroup (i. e., WRKY44 and WRKY20) and a member of another subgroup (WRKY 74) with TOE1 (Target of EARLY ACTIVATION TAGGED 1), a target of miRNA172 and suppressor of flowering. [score:7]
Although both level and function of miRNA172 are reported to be enhanced during drought in maize, Arabidopsis, and potato (Solanum tuberosum) [41- 45], differential expression of its family members and other regulating mechanisms have not been studied. [score:4]
Because the expression of CO was not promoted under DR as was that of GI, we focused on miRNA172, a factor downstream of GI. [score:3]
Arabidopsis lines (Col-0 ecotype) over -expressing miRNA172 were used in this study. [score:3]
Given the higher drought tolerance of miRNA172 over -expression plants, we can conclude that GI–miRNA172 may be involved in drought tolerance of Arabidopsis (Figure 4A,C). [score:3]
WRKY44 could interact with TOE1, a target of miRNA172. [score:3]
Seeds of transgenic lines over -expressing miRNA172 (miRNA172-OX) were selected on MS agar medium with 20 mg/L hygromycin. [score:3]
GI Promoted the Level of miRNA172E under Drought ConditionsBecause the expression of CO was not promoted under DR as was that of GI, we focused on miRNA172, a factor downstream of GI. [score:3]
Transcriptional level of WRKY20, WRKY44, and WRKY51 in co and miRNA172–over -expressing plants (miRNA172-OX) under standard (CK, white rectangles) and drought (DR, black rectangles) conditions. [score:3]
0073541.g009 Figure 9Transcriptional level of WRKY20, WRKY44, and WRKY51 in co and miRNA172–over -expressing plants (miRNA172-OX) under standard (CK, white rectangles) and drought (DR, black rectangles) conditions. [score:3]
We examined the expressions of WRKY44 and its co-members in subgroup 1, including WRKY20 and WRKY51, in co mutant and miRNA172-OX line(Figure 9). [score:3]
GI–miRNA172 may be involved in sugar signaling by inhibiting WRKY44. [score:3]
Among the targeted genes of miRNA172, TOE1 is the most influential because a single mutant of toe1 exhibited early flowering [40, 53]. [score:3]
Notably, miRNA156 inhibits the transcription of miRNA172b via SPL9 and, redundantly, SPL10 [11]. [score:3]
American Journal of Plant Sciences 1 69-76 44 Hwang EW, Shin SJ, Park SC, Jeong MJ,Kwon HB (2011) Identification of miR172 family members and their putative targets responding to drought stress in; Solanum tuberosum. [score:3]
GI–miRNA172 may affect sugar concentration by inhibiting WRKY44. [score:3]
* Significantly different (P<0.05) expression between miRNA172-OX and WT under both CK and DR conditions. [score:3]
The most significant was WRKY44, which was significantly suppressed by GI and miRNA172. [score:3]
In the LD and DR condition, increasing peak expression of GI promoted the processing of miRNA172. [score:3]
Because co exhibited a similar drought phenotype to that of gi, and CO and miRNA172 are two independent factors downstream of GI [40], CO may affect drought escape by regulating other factors. [score:2]
The primers for gene amplification and enzymes for cloning are listed in Table 4. The miRNA172 fragments were cloned into pCAMBIA1301 expression vector and transgenesis was carried out by the floral-dip method mediated by Agrobacterium [27]. [score:2]
This further confirmed the regulation of WRKY44 by GI–miRNA172. [score:2]
MiRNA172 could suppress the levels of WRKY44 and TOE1, which encode interactive proteins. [score:2]
Also, GI–miR172 may function in sugar signaling by down -regulating WRKY44. [score:2]
Also, several microRNAs (miRNAs) participate in these pathways to maintain homeostasis and accurate flowering time, i. e., miRNA159 in the phytohormone pathway [8], miRNA156 in the autonomous pathway [9, 10], and miRNA172 in the photoperiod pathway. [score:1]
According to our observations, the gi mutant was more sensitive and miRNA172-OX was less sensitive to drought than WT plants, indicating that GI–miRNA172 affects drought defenses other than escape. [score:1]
This study indicated that GI– miRNA172 and WRKY may be factors connecting these two pathways. [score:1]
For semi-quantitative RT-PCR of primary miRNA pri-miRNA172, leaf samples were harvested 4 h after dawn at 2 d intervals for 8 d. There were three biological replicates. [score:1]
The involvement of cryptochromes may explain why GI– miRNA172 was implicated in drought response. [score:1]
The levels of WRKY51 and WRKY20 were unchanged in miRNA172-OX. [score:1]
Table S1 The flowering time of miRNA172-OX transgenic lines. [score:1]
Controls for the co mutant and miRNA172-OX was Col-0, the wild type in their respective ecotype backgrounds. [score:1]
Figure S1 The level of pri- miRNA172s and mature miRNA172 in miRNA172-OX plants. [score:1]
Because WRKY44 is involved in sugar metabolism and signaling, GI–miRNA172 might function in drought escape and defense by affecting sugar signaling. [score:1]
Plant Physiol 143:473-486 40 Jung JH, Seo YH, Seo PJ, Reyes JL, Yun J et al. (2007) The GIGANTEA-regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. [score:1]
The level of WRKY44 was significantly reduced in miRNA172-OX plants (P = 0.015 under CK; P = 0.027 under DR) (Figure 9). [score:1]
E1-2 line was used as miRNA172-OX. [score:1]
[1 to 20 of 38 sentences]
3
[+] score: 83
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR172a, ath-MIR159b, ath-MIR319a, ath-MIR319b, ath-MIR172c, ath-MIR172d, ath-MIR390a, ath-MIR390b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR390a, gma-MIR390b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR156f, gma-MIR172f, gma-MIR156g, gma-MIR159d, gma-MIR156h, gma-MIR156i, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR156t, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR399f, gma-MIR399g, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
To determine how the gma-miR172 was expressed during soybean development, the expression levels of mature sequences of gma-miR172a/b, gma-miR172c, gma-miR172d/e, gma-miR172f, gma-miR172g, gma-miR172/h/i/j, gma-miR172k and gma-miR172l were analyzed by qRT-PCR. [score:6]
The expression level of Glyma03g33470 was also analyzed by qRT-PCR using the primer pairs spanning the miR172 cleavage sites and its mRNA abundance also exhibited a temporal specificity expression pattern during the growth and development stage of soybean. [score:5]
Temporal and Spatial Expression Patterns of gma-miR172 and Their Target Genes in Soybean. [score:5]
gma-miR172 together with its targets are likely regulated by day length in soybean and play an important role in flowering time control [37]. [score:4]
In Arabidopsis, miR172 serves as a negative regulator of AP2 to specify floral organ identity and also acts as a repressor of the AP2-like genes, the Target of EAT 1 (TOE1) and SCHLAFMU TZE (SMZ) to promote early flowering [19, 20, 21]. [score:4]
The results indicated that Glyma03g33470 was the target gene of miR172 in soybean. [score:3]
Mathieu J. Yant L. J. Mürdter F. Küttner F. Schmid M. Repression of flowering by the miR172 target SMZ PLoS Biol. [score:3]
In addition, Zhao found that GI didn’t affect the expression level of GmTOE4a in soybean [24], but it could affect the relative level of mature miR172 in Arabidopsis [25]. [score:3]
The results showed that gma-miR172f, gma-miR172g and gma-miR172h/i/j could not be detected in young seedlings and all the other five gma-miR172 members could be expressed in a low level at initial stage, gma-miR172d/e and gma-miR172k increased slightly subsequently, but the RNA abundance of gma-miR172a/b and gma-miR172c increased rapidly throughout the entire vegetative phase and peaked at 28 DAE (a flower bud appeared approximately on the 30th day) in the initiation of flowering phase, then gradually decreased during the reproductive phase under SDs (Figure 2A). [score:3]
In our previous studies, we found that the expression levels of some members of gma-miR172 could be induced by a shorter day. [score:3]
Eight potential AP2-Like target genes of soybean gma-miR172 were obtained from PMRD database (Available at: http://bioinformatics. [score:3]
5′ rapid amplification of the cDNA ends (5′RACE) was used to determine whether these putative targets were cleaved by gma-miR172 with RNA isolated from 20 DAE (Day after emergence) leaves. [score:3]
For expression pattern analysis of gma-miR172 and Glyma03g3347, the seeds of “DongNong 42” were grown under LDs and SDs in the greenhouse. [score:3]
Over -expression of miR172 causes the loss of spikelet determinacy and floral organ abnormalities in rice [22]. [score:3]
However, the roles of soybean miR172 and its AP2-like targets on flowering time are currently unclear. [score:3]
miR172 was confirmed to participate in the flowering control pathway in many plants but we did not find that miR172 had a diurnal rhythm expression pattern in Arabidopsis [25]. [score:3]
Zhu Q. H. Upadhyaya N. M. Gubler F. Helliwell C. A. Over -expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa) BMC Plant Biol. [score:3]
The putative target gene of soybean miR172, Glyma03g33470, shared high peptide identities with AP2 and TOE genes and contained two AP2 domains, similar to the previous reports on TOE1 in Arabidopsis [25]. [score:3]
There are 12 members (miR172a–l) in the soybean miR172 family and they are predicted to target some important AP2-like genes, as shown in Table S1. [score:3]
To further investigate whether the regulation of Glyma03g33470 by gma-miR172a plays a role in controlling flowering, a version of Glyma03g33470 mRNA (rGlyma03g33470) that carried silent mutations in the gma-miR172 complementary sites was introduced into toe1 mutant plants to render the mRNA resistant to miR172-directed cleavage (Figure 6A). [score:2]
miR172 played a negative regulation of AP2. [score:2]
Zhu Q. H. Helliwell C. A. Regulation of flowering time and floral patterning by miR172 J. Exp. [score:2]
It has been shown that GI regulates miR172 processing rather than the transcription of the miR172 in Arabidopsis [25]. [score:2]
In conclusion, it is likely that GmGI also regulates miR172 maturation (processing) in soybean rather than miR172 transcription. [score:2]
A miRcute miRNA first-strand cDNA synthesis kit (Tiangen) was used to perform first-strand cDNA synthesis of gma-miR172. [score:1]
The main players are the miR156, miR159 and miR172 families. [score:1]
miR172 is one of the earliest microRNAs isolated by small RNA sequencing in Arabidopsis [16] and later found in ferns, gymnosperms and the flowering plants, but not in lycopods and moss [17, 18]. [score:1]
The miR172 family of soybean (gma-miR172) was encoded by twelve genomic loci (gma-miR172a to gma-miR172l) based on miRBase version 21.0 (Available at: http://www. [score:1]
A progressive increase of miR172 level promotes the juvenile-to-adult transition in maize [3]. [score:1]
According to the difference of mature sequence, the members of gma-miR172 were divided into eight categories (Table 1). [score:1]
GmGI promotes miR172 metabolism and represses Glyma03g3347. [score:1]
[1 to 20 of 31 sentences]
4
[+] score: 66
miR156 is thought to repress floral induction by repressing the expression of miR172 [7], thus elevating the expression of miR172-regulated AP2-like transcription factors, which repress the expression of floral activators, such as FT and SOC1 [48– 50]. [score:8]
The effect of spl mutations on the expression of flowering genesWe explored the molecular basis for these phenotypes by examining the effect of spl2/9/11/13/15 and spl3/4/5 on the expression of genes that regulate flowering time (SOC1, MIR172B) and the floral meristem identity transition (LFY, AP1, FUL) in the shoot apices of 11 day-old shoots grown in LD. [score:7]
Although loss of SPL9 does not have a major effect on the expression of MIR172B and SOC1, their expression was significantly reduced in spl2, 9, 11, 13, 15 mutants. [score:5]
SPL9 is bound to the promoters of the flowering time genes MIR172B and SOC1 in vivo, and promotes their expression when it is over-expressed [7, 18]. [score:5]
In contrast to their effect on pri-miR172b, most of these mutant lines only produced a small decrease in the level of miR172 (Fig 7B), possibly because of feedback regulation of other miR172 genes by the AP2-like transcription factors targeted by this miRNA [48]. [score:4]
MIR172B is a direct target of SPL9 [7]. [score:4]
To determine if other SPL genes also regulate the expression of MIR172B, we examined the abundance of pri-miR172b and miR172 in the shoot apices of 16-day old spl mutants grown in SD. [score:4]
We explored the molecular basis for these phenotypes by examining the effect of spl2/9/11/13/15 and spl3/4/5 on the expression of genes that regulate flowering time (SOC1, MIR172B) and the floral meristem identity transition (LFY, AP1, FUL) in the shoot apices of 11 day-old shoots grown in LD. [score:4]
To determine if the effect of these mutations on miR172 is functionally significant, we examined the expression of SPL3 and SPL5. [score:4]
Thus, SPL2, SPL9, SPL11, SPL13 and SPL15 all promote the expression of MIR172B, and all of these genes must be repressed to produce a significant reduction in the level of miR172. [score:3]
miR156 modulates the level of miR172 through its effect on the expression MIR172B [51]. [score:3]
Although spl3/4/5 mutants consistently had extra cauline leaves, they displayed little or no delay in flowering time under both LD and SD, and had no effect on the expression of the flowering time genes, MIR172B and SOC1. [score:3]
These SPL genes are downstream of miR172 and are repressed by the miR172-regulated AP2-like transcription factors, TOE1 and TOE2 [7, 51]. [score:2]
This latter observation is consistent with previous studies indicating that SPL3, SPL4 and SPL5 are downstream of SOC1, miR172, and the flowering time regulator, FT [51, 75, 76]. [score:2]
Quantification of miR172b was performed according to [7]. [score:1]
The abundance of (A) pri-miR172b, (B) miR172 and (C) SPL3 and SPL5 mRNA in the shoot apices of 16-day-old spl mutants. [score:1]
spl2/13, spl9/13, spl9/15, and spl9/13/15 all had between 30–50% of the normal amount of pri-miR172b, and higher order mutants had approximately 20% of the normal pri-miR172b levels (Fig 7A). [score:1]
miR172 levels are reduced in spl mutants. [score:1]
The biggest decrease in miR172 was observed in spl2/9/11/1315, which had approximately 60% of the normal level of this transcript. [score:1]
Quantification of miR156 and miR172 was performed according to [97]. [score:1]
spl2 and spl9 had normal levels of pri-miR172b, but spl11, spl13 and spl15 all had slightly reduced amounts of this transcript (Fig 7A). [score:1]
These mutants had similar effects on miR172 and SPL5 transcripts, but SPL3 transcripts were present at a much lower level in spl2/9/11/13/15 than was expected from the effect of this genotype on miR172. [score:1]
[1 to 20 of 22 sentences]
5
[+] score: 52
Tissue-specific expression of miR156, miR172, and miR156 -targeted SPL genes in alfalfaTo gain an insight into how miR156 and its target genes are regulated in alfalfa, we evaluated the expression of miR156, its target SPL genes, and miR172 in four tissue types at different developmental time points from the juvenile stage (10 day-old rooted cuttings) to just before flowering. [score:11]
To gain an insight into how miR156 and its target genes are regulated in alfalfa, we evaluated the expression of miR156, its target SPL genes, and miR172 in four tissue types at different developmental time points from the juvenile stage (10 day-old rooted cuttings) to just before flowering. [score:7]
Consistent with this finding, our RNA-Seq data revealed that the M. sativa miR172 precursor, MsmiR172 (which is homologous to M. truncatula Medtr2g101400), was significantly downregulated in both miR156OE genotypes (p < 0.00005) (the downregulation FC for genotype A11a and A17 are 11.09 and 8.33, respectively) relative to the WT control (Additional file 2: Table S2). [score:7]
In addition, three miR172 -targeted genes homologous to Medtr7g117690, Medtr7g100590 and Medtr2g093060, which encode AP2 domain transcription factors [38], were significantly downregulated in both A11a and A17 genotypes (Additional file 2: Table S2). [score:6]
Fig. 7Developmental and tissue-specific expression profiles of miR156, miR172, and miR156 -targeted SPL genes in M. sativa. [score:6]
Tissue-specific expression of miR156, miR172, and miR156 -targeted SPL genes in alfalfa. [score:5]
The height of the letter (amino acid) at each position represents the degree of conservation MsmiR172 is downregulated in miR156OE alfalfa plants MiR156 and miR172 signals are integrated at the SPL3, SPL4, SPL5 and SPL9 genes in the mo del plant Arabidopsis [36, 37]. [score:4]
In contrast, miR172 could be detected in all tissue types, except for roots, at 10 days, with the highest levels observed in stems, just before flowering, at 40 days (Fig.   7b). [score:1]
Sequence verification of alfalfa miR172 precursor. [score:1]
Alignment of miR172 precursor sequences from M. truncatula and M. sativa. [score:1]
The transcript levels of miR156 and miR172 were analyzed by stem loop qRT-PCR [58] and SPL genes by normal qRT-PCR using a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad). [score:1]
The height of the letter (amino acid) at each position represents the degree of conservation MiR156 and miR172 signals are integrated at the SPL3, SPL4, SPL5 and SPL9 genes in the mo del plant Arabidopsis [36, 37]. [score:1]
Relative gene transcript levels of (a) miR156, (b) miR172, (c) MsSPL6, (d) MsSPL12, (e) MsSPL13, (f) MsSPL2, (g) MsSPL3, (h) MsSPL4 and (i) MsSPL9 were analyzed by the 2 [-∆CT] method. [score:1]
[1 to 20 of 13 sentences]
6
[+] score: 30
While the expressions of 14 families (miR156/miR157, miR158, miR160, miR162, miR165/miR166, miR168, miR169, miR171, miR390, miR393, miR394, miR396, miR398, and miR399) were dramatically reduced, 3 families (miR159, miR167, and miR172) were up-regulated in CsCl -treated seedlings. [score:6]
First, similar to Fe -induced MIRNA genes, if some of MIRNA genes (miR159 and miR172) are dramatically up-regulated by a high concentration of Cs, then the final products, mature miRNAs, can be subsequently increased or maintained, irrespectively of processing retardation. [score:4]
We carefully speculated that the conflict might occur for an unstudied reason: the increase in the expression of MIR172 due to Cs-treatment. [score:3]
On the other hand, the expressions of two miRNA gene families, miR159 and miR172, were dramatically increased in stress -treated seedlings. [score:3]
For instance, we speculated that the increased levels of miR159, miR164, and miR172 should lead to a decrease in the target mRNAs, MYB33, CUC1, and AP2, respectively. [score:3]
A group of highly conserved miRNAs includes miR159, miR169, miR172, miR173, and miR394 are differentially expressed under Fe-deficiency and many miRNAs harbor IDE1/IDE2 motifs, Fe-deficiency responsive cis-acting elements, in their promoters [24]. [score:3]
The five genes belonging to the miR172 family—which mainly represses AP2 transcription factor genes that modulate flowering time and floral development—were also increased by about two fold in both of the stress treatments (Fig 3B, number 33–36). [score:2]
However, the dramatic accumulations of pri-miR159a (~ 4.5-fold), pri-miR164a (~3-fold), and pri-miR172a (~2.5-fold) were proportional to the levels of mature miR159 (~ 2-fold), miR164 (~ 1.6-fold) and miR172 (~ 2-fold) present. [score:1]
The reason for the simultaneous accumulation of precursors and mature miRNAs (miR159 and miR172) remains unclear. [score:1]
Likewise, the intermediate fragments of pri-miR166 and pri-miR172 were clearly detected in CsCl -treated seedlings (Fig 6B and 6C). [score:1]
C. The processing pattern of pri-miR172. [score:1]
Although the processing interference of pri-miR172 conflicted with the levels of miR172—if the processing is interrupted, mature miR172 shouldn’t accumulate further—these results obviously show that Cs-toxicity retards the processing of pri-miRNAs into mature miRNAs. [score:1]
miR167, miR168, miR172, miR396, and miR398) were notably increased (Fig 3B, S2 Fig). [score:1]
[1 to 20 of 13 sentences]
7
[+] score: 23
We validated the expression of 4 targets of miR172, namely AP2 (APETALA2), TOE1 (TARGET OF EARLY ACTIVATION TAGGED1), TOE2, TOE3 out of 6. We observed highest expression of the targets at 48 h/4 °C (Fig.   5b–e). [score:11]
Comparatively, high expression of these targets was observed in case of RT, rather than cold imbibition (4 °C), which inversely correlates with increased expression of miR172 under cold imbibitions. [score:7]
Our results indicate possible role of miR172-target AP2/ TOEs module in seed germination process. [score:3]
Previous reports indicated role of miR172 in regulation of vegetative to reproductive phase change and cold stress induced response affecting root growth 29, 30. [score:2]
[1 to 20 of 4 sentences]
8
[+] score: 22
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
We showed that overexpression of AP2 in flowers, achieved through the expression of miR172‐resistant AP2, leads to prolonged WUS expression and indeterminate floral meristems (Zhao et al., 2007). [score:7]
The expression of an miR172‐resistant version of AP2 driven by its own promoter results in prolonged WUS expression and an indeterminate flower (Zhao et al., 2007). [score:5]
Thus, we expressed an miR172‐resistant version of AP2 (AP2m3) under the 35S promoter (Chen, 2004). [score:3]
AP2, a target of miR172 (Aukerman & Sakai, 2003; Chen, 2004), has also been implicated in the control of floral stem cells. [score:3]
This line exhibited loss of floral determinacy (Fig.   6c), as previously reported for the overexpression of miR172‐resistant AP2 (Chen, 2004; Zhao et al., 2007). [score:3]
But AP2 is normally repressed in the inner two whorls by the microRNA miR172 (Chen, 2004). [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 22
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Beyond miR156 and miR172, miR164 targets genes encoding NAM proteins, and may be involved in regulating ear development (Table  3), similar to how miR164 is postulated to regulate NAC-domain targets in Arabidopsis [58]. [score:8]
miR156a-l probably targets several SPL genes during the juvenile-to-adult phase transition in maize (Figure  4a, Tables  2 and 3), and is postulated to indirectly activate miR172 via SPL[31]. [score:4]
miR172 and its targets IDS1 and SID1 function to influence the SM to FM conversion. [score:3]
Figure 4 miR156 and miR172 in maize flower development (Adapted from Poethig (2009). [score:2]
Previous studies showed that miR156 and miR172 function throughout flower development from the earliest stages (floral induction, stage I) to very late stages (floral organ cell-type specification, stage IV) [31- 34]. [score:2]
miR172 has been shown to negatively regulate GL15 (Table  3), which promotes maintenance of the juvenile state [31]. [score:2]
The levels of miR156 and miR172 are conflicting during phase transition (Figure  4b). [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 21
It has been shown that AP2 and its closest homologs are the targets of miR172, which down regulates these target genes by a translational inhibition mechanism rather than by RNA cleavage [14]. [score:10]
Since AtAP2 is regulated on the protein level by miR172 in whorl 3 and 4, and the miR172 target site is also present in BnAP2 gene, of the expression of BnAP2 protein was performed. [score:6]
In addition, the miR172 target site is also present in BnAP2 gene through the sequence comparison between BnAP2 and AtAP2. [score:3]
The putative miRNA172 binding site is located within the coding region of BnAP2 gene but is outside of the conserved AP2 domains. [score:1]
Nucleotides in BnAP2 RNA that can base-pair with miRNA172 (with G∶U pairing allowed) are 1178CUGCAGCAUCAUCAGGAUUCU1198. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 20
Consistent with such modifications being important, plants expressing the appropriately modified version of MIM172 showed an altered phenotype (see below), whereas plants expressing an initial version of MIM172 in which a putative miR172 cleavage site was present (MIM172cs) did not. [score:5]
MIM172 plants were also late flowering, with 20.0±3.5 (n = 30) rosette leaves in long days (Figure S1B), consistent with the flowering time phenotype of plants that have increased expression of miR172 targets [4], [6], [51]. [score:5]
1001031.g001 Figure 1(A) A target mimic with an unmodified central sequence (MIM172cs), which retained complementarity to the central portion of miR172 across the cleavage site (red line) opposite position 10 to 11 of the miRNA, did not change flowering time. [score:3]
However, a single nucleotide mismatch introduced into the center of an authentic miR172 target site (MIM172sn), but without a bulge, was not sufficient to reduce miR172 activity. [score:3]
These differential effects could be due to the particularly high levels of miR172 levels during early flower development [6]. [score:2]
For example, maintaining the original central sequence of IPS1 in MIM172 could have reconstituted a cleavage site for miR172. [score:1]
AT2G45160, AT3G60630, AT4G00150 1, 2, 3, 4 MIM172 miR172 Delay in flowering time. [score:1]
[1 to 20 of 7 sentences]
12
[+] score: 19
Other miRNAs from this paper: ath-MIR319b, ath-MIR408
b The expression pattern of miR408/miR408* across various stages of arabidopsis development, and c the coverage pattern of sRNA fragments on the pri-miR319b transcript sequenceFrom the analysis of the expression data deposited in the mirEX 2.0 database it is clear that the relation between the level of a given pri-miRNA and its mature miRNA may be complex; for example, in the case of miR172b from arabidopsis (Fig.   3A) we observe modest variation in the expression of the pri-miRNA transcript across all of the tested stages and tissues when compared to the increased accumulation of mature molecules observed in the leaves and the inflorescence. [score:7]
b The expression pattern of miR408/miR408* across various stages of arabidopsis development, and c the coverage pattern of sRNA fragments on the pri-miR319b transcript sequence From the analysis of the expression data deposited in the mirEX 2.0 database it is clear that the relation between the level of a given pri-miRNA and its mature miRNA may be complex; for example, in the case of miR172b from arabidopsis (Fig.   3A) we observe modest variation in the expression of the pri-miRNA transcript across all of the tested stages and tissues when compared to the increased accumulation of mature molecules observed in the leaves and the inflorescence. [score:7]
Fig. 3Representative visualizations of miRNA gene expression: a a line graph displaying combined expression of pri-miRNA (RT-qPCR) and mature microRNA (NGS) for miR172b. [score:5]
[1 to 20 of 3 sentences]
13
[+] score: 18
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
AP2: APETALA2; TF: transcription factor; TOE1: TARGET OF EAT 1; SMZ: SCHLAFMÜTZE; SNZ: SCHNARCHZAPFEN; miR172: microRNA172; FT: Flowering Locus T; GA: gibberellin acid; EIN3: Ethylene Insensitive 3; CTR1: CONSTITUTIVE TRIPLE RESPONSE1; LFY: LEAFY; SOC1: SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1; AVG: Aviglycine; ACC synthase: 1-amino-cyclopropane-1-carboxylate synthase; Col-0: Columbia-0; SD: short-day; LD: long-day; RACE: rapid-amplification of cDNA ends; DAF: day-after-flowering; GFP: green fluorescent protein; DAG: days after germination; AP2/EREBP: APETALA2/Ethylene Responsive Element Binding Protein. [score:7]
Mathieu J. Yant L. J. Mürdter F. Küttner F. Schmid M. Repression of flowering by the miR172 target SMZ PLoS Biol. [score:3]
microRNA172 (miR172), a small, non-coding RNA that can complement a region of its target genes, can post-transcriptionally repress all members of the AP2 family [14, 15, 16, 17]. [score:3]
Additionally, neither smz nor snz mutants display any notable early flowering phenotypes, whereas toe1toe2smzsnz quadruple mutants were found to flower even earlier than toe1toe2 double mutants but continued to flower significantly later than plants that constitutively express miR172 [12, 14, 15]. [score:3]
The hextuple mutant lacking all six AP2 family genes exhibits even an earlier flowering phenotype than toe1toe2smzsnz quadruple mutants, but its phenotype is similar to that of miR172-overproducing plants [18]. [score:1]
A comparison of the AfAP2-1 cDNA with five miR172s in A. fasciata revealed a putative miR172 recognition site (1238CTGCAGCATCATCAGGATTCT1258) within the sequence encoding the C terminus of AfAP2-1, which is outside of the conserved AP2 domains. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 16
Overexpression of miR172 in Arabidopsis and potato can promote flowering development and tuberization respectively [29]. [score:4]
The higher expression of miR172 in the leaves of OE lines correlates with the earlier bolting and flowering phenotypes of the OE lines [14]. [score:3]
The targets of miR172 and miR319 are AP2 and TCP, transcription factors, respectively. [score:3]
Since the OE lines contain higher sucrose contents [14], miR172 and miR397 might be induced indirectly by cold -induced sucrose accumulation. [score:2]
While the abundance of many stress -induced miRNAs is unaltered, the abundance of some miRNAs related to plant growth and development (miR172 and miR319) is elevated in the fast-growing lines. [score:2]
Only the abundance of miR172 and miR319 were significantly higher in the leaves of the OE lines (Table  2). [score:1]
The abundance of some miRNA (miR172 and miR397) induced by cold stresses increased in the OE lines but many other miRNAs (miR166, miR393, miR396 and miR408) induced by cold were unaltered [36]. [score:1]
[1 to 20 of 7 sentences]
15
[+] score: 16
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
miR172 inhibits the expression of several AP2 -family transcription factors (e. g. SCHLAFMÜTZE (SMZ) [21], TARGET OF EAT 1 (TOE1) and TOE2 [22]), which would otherwise repress the floral pathway integrator, FT, and inhibit floral transition [23]. [score:9]
The increase in miR172 abundance at 23°C is dependent on FCA, which is itself regulated by ambient temperature through both gene expression and protein stability [20]. [score:4]
FCA is involved in cleavage and polyadenylation of mRNAs [17][18][19] and also promotes the processing of specific miRNAs, including miR172, which plays a role in temperature-regulated flowering [20]. [score:2]
Since the abundance of miR172 is greater at 23°C than at 16°C [24], flowering is enhanced at the higher temperature by a reduction in the levels of the AP2 floral repressors leading to an increase in FT. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 15
Expression of miR172 activates FT transcription in leaves through repression of AP2-like transcripts SCHLAFMÜTZE (SMZ), SCHNARCHZAPFEN (SNZ), and TARGET OF EAT 1-3 (TOE1-3; Jung et al., 2007, 2011; Mathieu et al., 2009), whereas the increase in SPLs at the shoot apical meristem (SAM), leads to the transcription of FMI genes (Schwab et al., 2005; Schwarz et al., 2008; Wang et al., 2009; Yamaguchi et al., 2009). [score:5]
Repression of flowering by the miR172 target SMZ. [score:3]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
miR172 signals are incorporated into the miR156 signaling pathway at the SPL3/4/5 genes in Arabidopsis developmental transitions. [score:2]
The GIGANTEA-regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. [score:1]
The juvenile-to-adult phase transition is accompanied by a decrease in microRNA156 (miR156A/miR156C) abundance and a concomitant increase in abundance of miR172, as well as the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL3/4/5) transcription factors (TFs; Wang et al., 2009; Wu et al., 2009; Jung et al., 2011, 2012; Kim et al., 2012). [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 15
The major proportion of the identified microRNAs target transcription factors, with 63 reads (16%) for miR156/157 (targeting SPL family), 38 reads (9.6%) for miR172 (targeting AP2 family) and 26 reads (6.6%) for miR159 (targeting MYB/TCP family). [score:9]
Given the presence of miRs targeting transcription factor families such as SPL (miR156/miR157), MYB/TCP (miR159, miR319), ARF (miR160, miR167), AP2 (miR172), and GRF (miR396) there can be no doubt that miRs modulate the expression of many transcription factors during later stages of pollen development. [score:6]
[1 to 20 of 2 sentences]
18
[+] score: 14
In contrast, miR172 was repressed by N starvation (Table 2), which is consistency with the fact that miR156 negatively regulated the expression of miR172. [score:4]
miR156 and miR172 can prolong and promote the expression of juvenile vegetative traits in Arabidopsis, respectively [37], implying that N-starvation delays the transition of Arabidopsis from the vegetative to the reproductive phase by modulating the their abundance. [score:3]
For miR156, miR160, miR169, miR171, miR172, miR395, miR397, miR398, miR399, miR408, miR775, miR780.1, miR827, miR842, miR846, miR857, and miR2111, their targets have been predicted and most of them were validated previously (Table 2). [score:3]
Differential expression was also observed among members of the miR167, miR171, miR172, and miR319 families (Table S2). [score:3]
Similar trends were observed for other miRNA families, such as miR156, miR169, and miR172. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 14
For example, overexpression of miRNA156 in maize prolongs juvenile development while expression of miR172 promotes the transition to the adult phase of growth [30], [32]. [score:6]
In rice, osa-miR160, osa-miR164 and osa-miR172 are co-expressed with their targets in root, leaf, seedling, endosperm and embryo [46]. [score:5]
Finally, overexpression of an AP2 cDNA with mismatches to miR172 caused enlarged floral meristems and many whorls of petals or staminoid organs [29]. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 13
In addition to activation by CO, FT is regulated by GI through an independent pathway in Arabidopsis where GI upregulates microRNA172 which acts as a repressor of the APETALA 2 (AP2) domain gene TARGET OF EAT1 (TOE1) which in turn encodes a repressor of FT [56]. [score:6]
The position of the conserved miRNA172 target site is also shown. [score:3]
The TOE1 subfamily members have a smaller first AP2 domain due to an internal deletion of 10 amino acids and all contain a miR172 target site. [score:3]
FCA has also been shown to affect the level of miRNA172, providing a link to the photoperiod pathway in Arabidopsis [56]. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 13
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
Furthermore, by activating miR172 expression, GI directs post-transcriptional gene silencing of the AP2-type transcriptional repressors of FT (Jung et al., 2007). [score:4]
Overexpression of a miR172-related miRNA of soybean facilitates the DE response, promotes FT accumulation under drought conditions, and increases ABA sensitivity of Arabidopsis (Li et al., 2016). [score:3]
Modes of GI -dependent but CO-independent pathways include the activation of a class of miRNA, the miR172, which targets the APETALA 2-like factors that repress FT and other flowering genes (Jung et al., 2007; Mathieu et al., 2009). [score:3]
Han Y Zhang X Wang Y Ming F 2013 The suppression of WRKY44 by GIGANTEA–miR172 pathway is involved in drought response of Arabidopsis thaliana. [score:3]
[1 to 20 of 4 sentences]
22
[+] score: 12
The abundance of SPL3 is regulated directly by miR156/miR157 via miRNA -induced transcript cleavage, and indirectly by the effect of miR156/miR157-regulated SPL proteins on the expression of miR172, which in turn represses a group of AP2-like genes that repress the transcription of SPL3, SPL4, and SPL5 [3, 9, 23, 35]. [score:7]
This combination of direct post-transcriptional regulation by miR156/miR157 and indirect transcriptional regulation via the miR172-AP2 pathway may be responsible for the hypersensitivity of SPL3 transcripts to variation in the abundance of miR156/miR157. [score:5]
[1 to 20 of 2 sentences]
23
[+] score: 10
Except promoting the expression of miR172, SPLs positively regulate miR156 expression as well [3]. [score:6]
Acting downstream of miR156 -targeted SPLs, miR172 also plays roles in developmental timing of Arabidopsis [3]. [score:4]
[1 to 20 of 2 sentences]
24
[+] score: 8
Although miRNAs in plants predominantly operate through transcript cleavage, several studies on miRNAs such as miR156, miR172, miR398, miR164 and miR165/6 show that transcript cleavage as well as translation repression may act upon the same targets [53, 54]. [score:5]
Among the 30 miRNA families detected at 2dpi, 10 (miR160, miR161, miR167, miR171, miR172, miR390, miR394, miR396, miR398 and miR408) displayed contrasting expression levels between viruses. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 8
During gametophyte and early seed development, for example, miR172 targets several APETALA2-like transcription factors, thus controlling seed size and yield; ap2 loss-of-function causes an increase of seed weight (Jofuku et al., 2005; Tang et al., 2012). [score:4]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
The miR172- AP2 interaction is conserved between Arabidopsis and maize (Wang et al., 2005). [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 8
Evidence on the differential expression of SPL genes and miR172 during dormancy induction has been obtained from transcriptomic studies in poplar and leafy spurge (Ruttink et al., 2007; Doğramaci et al., 2013), which suggests that this miRNA pathway may also play a regulating role in dormancy processes. [score:4]
An miRNA cascade involving miR156 and miR172 and their respective targets SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL), and APETALA2 (AP2)-like genes modulates flowering induction in Arabidopsis through the regulation of FT and other flowering-related genes (Khan et al., 2014; Spanudakis and Jackson, 2014). [score:4]
[1 to 20 of 2 sentences]
27
[+] score: 8
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157d, ath-MIR158a, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR161, ath-MIR162a, ath-MIR162b, ath-MIR163, ath-MIR164a, ath-MIR164b, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR170, ath-MIR172a, ath-MIR173, ath-MIR159b, ath-MIR319a, ath-MIR319b, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR172c, ath-MIR172d, ath-MIR391, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR397a, ath-MIR397b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, ath-MIR400, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR158b, ath-MIR159c, ath-MIR319c, ath-MIR164c, ath-MIR167c, ath-MIR172e, ath-MIR447a, ath-MIR447b, ath-MIR447c, ath-MIR773a, ath-MIR775, ath-MIR822, ath-MIR823, ath-MIR826a, ath-MIR827, ath-MIR829, ath-MIR833a, ath-MIR837, ath-MIR841a, ath-MIR842, ath-MIR843, ath-MIR845a, ath-MIR848, ath-MIR852, ath-MIR824, ath-MIR854a, ath-MIR854b, ath-MIR854c, ath-MIR854d, ath-MIR857, ath-MIR864, ath-MIR2111a, ath-MIR2111b, ath-MIR773b, ath-MIR841b, ath-MIR854e, ath-MIR833b, ath-MIR156i, ath-MIR156j, ath-MIR826b
miR165 affects shoot apical meristem development via the regulation of HD-ZIP III genes 51 52; miR172 mediates juvenile-to-adult transition by the suppression of several AP2 transcription factors 53; and miR773 targets a gene that encodes a DNA methyltransferase 36. [score:7]
In contrast, among the remaining three repressed miRNA families, miR167 and miR172 participate in the auxin response 37 and the juvenile-to-adult transition 38, respectively, and the function of miR841 is unknown. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 7
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
It has been reported that overexpression of micro RNA miR172, a negative regulator of AP2, results in the conversion of lodicules into the palea marginal region in transgenic rice plants [25]. [score:4]
Zhu Q. -H. Upadhyaya N. M. Gubler F. Helliwell C. A. Over -expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa) BMC Plant Biol. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 7
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
If LUCL is repressed by miR172, then mutations causing reduced miR172 accumulation are expected to cause the de-repression of LUCL. [score:2]
LUCL does not report miRNA activity LUCH does not report miRNA activity even though it contains the miR172 binding site [21]. [score:1]
We wanted to know whether LUCL, which was derived from the same transgene in an independent transformation event, is repressed by miR172. [score:1]
The stars indicate the miR172 binding sites. [score:1]
For this purpose, we generated a transgene in which the Luciferase (LUC) coding region fused to a portion of the APETALA2 (AP2) gene that contains the miR172 binding site [21] was behind a dual 35S promoter from the cauliflower mosaic virus (Figure  1A). [score:1]
LUCH does not report miRNA activity even though it contains the miR172 binding site [21]. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 5
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
If it were repressed by miR172, we would expect mutations in miRNA biosynthesis genes (reviewed in [14]), such as DICERLIKE1 (DCL1), HYPONASTIC LEAVES1 (HYL1), and SERRATE (SE) to de-repress LUCH expression. [score:4]
A transgene was constructed such that LUC was C-terminally fused in frame to the partial AP2 fragment containing the miR172 binding site [10] and the transgene was driven by a dual 35S promoter, which will be referred to as d35S, from Cauliflower Mosaic Virus (d35S::LUC-AP2). [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 5
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
In addition, SVP binds to the promoters and regulates the expression of other transcriptional regulators including miR172 and several floral repressors of the AP2 family [60]. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
AG expression is confined to the inner two whorls by the A-class gene AP2 [18]; in turn, AP2 translation in the third and fourth whorls is repressed by the microRNA mir172 [19]. [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 4
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR171a, ath-MIR172a, ath-MIR159b, ath-MIR319a, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, ath-MIR167d, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR396a, ath-MIR396b, ath-MIR398a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR531a, osa-MIR1425, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR531b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1873, osa-MIR1862d, osa-MIR1862e, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR1862f, osa-MIR1862g, ath-MIR5021, osa-MIR5072, osa-MIR5077, ath-MIR156i, ath-MIR156j, osa-MIR531c
BLAST2GO helped in localization of predicted targets and KEGG (Kyoto Encyclopedia for Genes and Genomes) pathway analysis concluded that miR9662, miR894, miR172, and miR166 might be involved in regulating saponin biosynthetic pathway. [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 4
RAP2.7 is repressed by miR172, which binds to its mRNA, hence preventing translation in the adult phase (Zhu and Halliwell, 2011; Higgins et al. 2010; Aukerman & Sakai, 2003). [score:3]
Jung J. H., Seo Y. H., Seo P. J., Reyes J. L., Yun J., Chua N. H. & Park C. M. (2007) The GIGANTEA regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 4
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
Interestingly, Wang et al. have found Northern blot expression evidence of the ath-MIR172b* sequence [6]. [score:3]
In Arabidopsis, the two candidates are the miRNA* sequences of MIR172 precursors. [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 4
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
Nonetheless, the expression of over 200 miRNAs has been characterized within wild type floral inflorescence using MPSS [33] and it is probable post-transcriptional regulation plays a substantial role in restricting organ-enriched expression in a manner similar to that noted between miR172 and AP2 [27]. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 3
The expression of miR169b and miR172b* was also detected by northern blot hybridization (Figure 2a). [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
The involvement of miRNAs as key regulators of flowering time (miR159, miR172, miR156, and miR171), hormone signaling (miR159, miR160, miR167, miR164, and miR393), or shoot and root development (miR164), was reviewed by (Wang and Li, 2007). [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Based on A. thaliana annotation, miRNA target genes were found for several conserved miRNAs in hybrid yellow poplar (Table S4): ARF10 (miR160), CYP96A1 (miR162), NAC (miR164), PHB and DNA -binding factor (miR165/166), NF-YA8 (miR169), SCARECROW transcription factor family protein (miR170/171), SNZ (miR172), MYB (miR319), GRF (miR396), copper ion binding (miR408), SPL11 (miR529) etc. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
Titrations were conducted in 10 mM phosphate (pH 6.5), 1 mM β-mercaptoethanol and 10% D [2]O. Aliquots of a 400 μM pri-miR172-ls solution were added to a 200 μM [15]N-labeled DCL1-A sample. [score:1]
ZZ Exchange Spectroscopy (ZZ-EXSY): ZZ exchange spectra were acquired on the perdeuterated DCL1-A sample in the presence of 1.25 equivalents of pri-miR172-ls (described above). [score:1]
RNA Imino [1]H assignment: natural abundance 1H-15N HSQC and 1H-1H NOESY (mixing time 150 ms) spectra of pri-miR172-ls RNA in 20 mM Cacodylic acid buffer pH 6 were acquired. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 3
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
In addition to these main factors, miRNA172 and other transcription factors such as AINTEGUMENTA, LEUNIG, SEUSS, RABBIT EARS (RBE), and STERILE APETALA, are involved in fine-tuning of expression of the floral ABCE genes in Arabidopsis thaliana [5, 6, 7, 8, 9, 10, 11, 12, 13]. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
Han Y, Zhang X, Wang Y, Ming F. The suppression of WRKY44 by GIGANTEA-miR172 pathway is involved in drought response of Arabidopsis thaliana. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
MiR156 promotes juvenile development, while miR172 promotes reproductive development. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
Photoperiodic flowering can also be triggered in a CO-independent manner, via GI regulation of miR172 processing (Jung et al., 2007). [score:2]
The GIGANTEA-regulated microRNA172 mediates photoperiodic flowering independent of CONSTANS in Arabidopsis. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 3
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 2
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR172a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR394a, ath-MIR394b, ath-MIR396a, ath-MIR396b, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, ath-MIR403, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR396e, ath-MIR856, ath-MIR858a, osa-MIR169r, osa-MIR396f, ath-MIR2111a, ath-MIR2111b, osa-MIR396g, osa-MIR396h, osa-MIR396d, ath-MIR858b, ath-MIR156i, ath-MIR156j
The abundance of miR172 was 20 times low as compared to miR156 in our dataset which is consistent with the previous finding that these two miRNAs are conversely regulated [36]. [score:1]
miR156, miR159, miR167, miR319, miR396 and miR172 possessed 5, 8, 10, 8, 7 and 6 members respectively whereas other miRNA families such as miR157, miR160, miR169, miR858, miR894, miR2111 etc. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 2
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
On reconciling the interactions between APETALA2, miR172 and AGAMOUS with the ABC mo del of flower development. [score:2]
[1 to 20 of 1 sentences]
49
[+] score: 2
AP2 family genes are regulated by microRNA (miR172), and can be divided into AP2 and ANT groups [10, 11]. [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 2
354 p. 64 Wollmann H, Mica E, Todesco M, Long JA, Weigel D (2010) On reconciling the interactions between APETALA2, miR172 and AGAMOUS with the ABC mo del of flower development. [score:2]
[1 to 20 of 1 sentences]
51
[+] score: 1
37)>CUA(501.61), 10:G(37156.57)>CUA(161.5), 11:A(10397.81)>GC(26.88), 13:G(87930.11)>CUA(1043.6), 14:A(34341.26)>G(44.23), 15:C(38019.92)>GUA(109.1) MIR170 5:U(50752.3)>GC(244.7), 8:G(50752.3)>CA(23.8) MIR171a 7:A(2397.55)>GU(54.5) MIR172a, MIR172b, MIR172c 8:U(211955.28)>GC(157.21), 11:U(83771.26)>C(90.98) MIR319a, MIR319b 9:A(1866.44)>CU(37) MIR390a, MIR390b PRE74:A(6807.15)>G(21.5), PRE76:C(6807.15)>U(78.6), 6:C(41119.9)>UA(27.6), 7:A(20563.45)>G(48.5) MIR858 5:G(12416.25)>CU(13. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
In addition, experiments by Vaucheret and data from other studies also reveals evidence of long miRNA variants; for example, careful examination of previously published miRNA northern blots found the presence of double bands for some miRNAs, such as for ath-miR169, ath-miR156 and ath-miR172 [31]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Other miRNAs from this paper: ath-MIR172a, ath-MIR172c, ath-MIR172d, ath-MIR172e
However, recent research has revealed that the microRNA miR172, which might be AG-independent, is a major factor in restricting AP2 activity, and that whether stamens or petals develop relies on the balance between AP2 and AG activity, rather than a mutual exclusion of the two genes [15]. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
The abundance of zma-miR172 was extremely low compared to that of zma-miR156 in our dataset, which was consistent with previous finding that these two miRNAs are conversely regulated. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
Eight cis-NATs were coincidently the precursors of miR162, miR167, miR171, miR172, miR398 and miR408 (Table  3). [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
During post-germination stages, miR156 and miR172 mediate the emergence of vegetative leaves, a stage of transition to autotrophic growth [40, 41]. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
Additionally, AGO4 is also involved in RNA cleavage and is shown to trigger ta-siRNA generation, e. g., by miR172 and miR390 (Qi et al., 2006; Montgomery et al., 2008). [score:1]
[1 to 20 of 1 sentences]