sort by

287 publications mentioning mmu-mir-1a-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-1a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 659
Therefore, miR-1 could suppress cancer metastasis in vivo by downregulating target gene expression. [score:10]
Western blot data indicated that miR-1 overexpression significantly downregulated WASF2, TWF1, CNN3, TMSB4X and CORO1C (Figure 5G), showing that miR-1 could inhibit breast cancer cell metastasis by targeting the WASF2, TWF1, CNN3, TMSB4X and CORO1C genes. [score:10]
These results showed that miR-1 inhibited the growth of gastric and breast cancer by downregulating the expression of its target, CDK4, in vivo. [score:10]
Western blot analysis of metastatic solid tumors indicated that the expression levels of miR-1 targets including WASF2, TWF1, CNN3, CORO1C and TMSB4X were significantly downregulated in the solid tumors of miR-1 -overexpressing mice compared with the control mice (Figure 7F). [score:9]
of metastatic solid tumors indicated that the expression levels of miR-1 targets including WASF2, TWF1, CNN3, CORO1C and TMSB4X were significantly downregulated in the solid tumors of miR-1 -overexpressing mice compared with the control mice (Figure 7F). [score:9]
To further reveal the genes targeted by miR-1, miR-1 was overexpressed in cells, and the expression levels of the 41 target genes were then detected. [score:9]
The downregulation of CDK4 expression mediated by miR-1 caused tumor cell cycle arrest in the G0/G1 phase, resulting in inhibited cancer cell proliferation. [score:8]
The simultaneous expression regulation of target genes by miR-1. The miR-1 -mediated suppression of tumor growth and metastasis in vivo. [score:8]
The miR-1 overexpression significantly downregulated 5 genes (TMSB4X, TWF1, CNN3, WASF2 and CORO1C) of the 35 predicted target genes in the examined cells (Figure 5B). [score:8]
The dual-luciferase reporter assay results indicated that miR-1 significantly reduced the activity of luciferase fused to the 3′ UTR of TMSB4X, TWF1, CNN3, WASF2 or CORO1C compared with the controls (Figure 5D), showing that these 5 genes could be directly targeted by miR-1. These data presented that TMSB4X, TWF1, CNN3, WASF2 and CORO1C genes were the targets if miR-1. Figure 5 A. The prediction of genes targeted by miR-1. As predicted, 35 genes associated with cell migration were miR-1 targets. [score:8]
The dual-luciferase reporter assay results indicated that miR-1 significantly reduced the activity of luciferase fused to the 3′ UTR of TMSB4X, TWF1, CNN3, WASF2 or CORO1C compared with the controls (Figure 5D), showing that these 5 genes could be directly targeted by miR-1. These data presented that TMSB4X, TWF1, CNN3, WASF2 and CORO1C genes were the targets if miR-1. Figure 5 A. The prediction of genes targeted by miR-1. As predicted, 35 genes associated with cell migration were miR-1 targets. [score:8]
Among the 35 target genes, 5 genes (TMSB4X, TWF1, CNN3, WASF2 and CORO1C) were significantly downregulated in response to miR-1 overexpression. [score:8]
To explore whether miR-1 could simultaneously suppress tumor growth and metastasis by synchronously regulating the expressions of these six target genes, the miR-1 -guided cleavage of the target mRNAs in the Ago complex was investigated. [score:8]
Based on the degree of tumor cell differentiation detected histopathologically, the gastric primary tumors were classified into three grades, i. e., grade 1, 2 or 3. The data presented that the expression level of miR-1 was not correlated with tumor cell differentiation (Figure 1E), indicating that the miR-1 expression was downregulated in gastric cancers at various stages of differentiation. [score:8]
CDK4 was predicted to be a target gene of miR-1. B. Expression levels of endogenous CDK4 in response to miR-1 overexpression in cells. [score:7]
C. The miR-1 expression levels in tumors derived from miR-1 -overexpressing MGC-803 cells or miR-1 -overexpressing MDA-MB-231 cells using quantitative real-time PCR analysis. [score:7]
However, the expression levels of the other 40 potential targets related to the cell cycle showed little change in response to miR-1 overexpression (data not shown). [score:7]
E. Effects of miR-1 overexpression on its target gene expression in breast cancer cells. [score:7]
Taken together, these data showed that miR-1 could inhibit cancer cell metastasis by targeting actin -associated genes, leading to the inhibition of actin cytoskeleton formation (Figure 5H). [score:7]
The results showed that the overexpression of miR-1 significantly inhibited the proliferation rates of gastric cancer cells compared with the negative control, while miR-1 overexpression had no effect on the growth of normal cells (Figure 2B). [score:6]
In this context, the miR-1 -mediated downregulation of the TMSB4X, CNN3, TWF1, CORO1C and WASF2 genes led to the inhibition of tumor cell metastasis of breast and gastric cancers. [score:6]
These data indicated that TMSB4X, TWF1, CNN3, WASF2 and CORO1C were the target genes of miR-1. To explore the direct interactions between miR-1 and the five target genes, the miR-1 precursor and the 3′ UTR of TMSB4X, TWF1, CNN3, WASF2 or CORO1C were co -transfected into MGC-803 cells. [score:6]
The results indicated that the tumor growth was significantly inhibited in the mice treated with miR-1 -overexpressing MGC-803 cells or miR-1 -overexpressing MDA-MB-231 cells compared with the control cells (Figure 7A). [score:6]
Therefore, miR-1 could simultaneously regulate the expressions of the six target genes in cells. [score:6]
Quantitative real-time PCR analysis indicated that the expression level of miR-1 in tumors was 3.5-6 times higher than that in the controls (Figure 7C), showing the upregulation of miR-1 in gastric and breast cancers in vivo. [score:6]
F. The effect of miR-1 on the expression levels of its target genes in solid tumors. [score:5]
The quantitative real-time PCR data revealed that CDK4 was significantly downregulated compared with the controls when miR-1 was overexpressed (Figure 3B). [score:5]
The Western blot results indicated that miR-1 overexpression led to a significant decrease in the level of CDK4 protein in the examined cells (Figure 3D and 3E), indicating that miR-1 could target CDK4 in gastric or breast cancer cells. [score:5]
Mice were treated with miR-1 -overexpressing MGC-803 cells or miR-1 -overexpressing MDA-MB-231 cells. [score:5]
The western blot data indicated that CDK4 protein was significantly downregulated in tumors derived from miR-1 overexpressing cancer cells compared with that in the controls (Figure 7D). [score:5]
To assess the effect of miR-1 overexpression on the expression of CDK4 in vivo, the miR-1 precursor was transfected into the gastric or breast cancer cells, and then the CDK4 protein level was determined. [score:5]
The miR-1 targets related to the cell cycle were predicted using the miRanda, TargetScan and PicTar algorithms. [score:5]
Figure 7The miR-1 -mediated tumor suppression in vivo A. Effect of miR-1 overexpression on tumor growth in vivo. [score:5]
The miR-1 -guided cleavage of target mRNAs in the Ago complex occurred in a miRNA-concentration -dependent manner (Figure 6B), indicating that miR-1 could guide the cleavage of its targets. [score:5]
The putative target genes of miR-1 were predicted using the miRanda, TargetScan and PicTar algorithms (Creighton et al, 2008; Doran and Strauss, 2007; Krek et al, 2005). [score:5]
These findings presented that miR-1 simultaneously suppressed tumor growth and metastasis by synchronously targeting multiple genes. [score:5]
The miR-1 -mediated suppression of tumor growth and metastasis in vivoTo explore the role of miR-1 in tumorigenesis in vivo, miR-1 was overexpressed in gastric cancer cells (MGC-803) or breast cancer cells (MDA-MB-231), and the cancer cells were then injected into nude mice to examine the tumor growth. [score:5]
C. The influence of miR-1 on target gene expression. [score:5]
In the present study, we showed that miR-1 could simultaneously cleave six targets in vitro and that miR-1 was co-localized with its targets in cells. [score:5]
To investigate whether miR-1 could synchronously target the mRNAs of its six target genes in cells, the co-localization of miR-1 and its targets was assessed. [score:5]
On the other hand, the findings of this study revealed that TMSB4X, CNN3, TWF1, CORO1C and WASF2 genes were directly targeted by miR-1. The TMSB4X, CNN3, TWF1, CORO1C and WASF2 genes encode cytoskeletal proteins related to actin filament dynamic regulation, and they are involved in cancer metastasis [22, 25– 35]. [score:5]
Taken together, these findings showed that miR-1 could efficiently inhibit tumorigenesis and metastasis in vivo by targeting CDK4, WASF2, TWF1, CNN3, CORO1C and TMSB4X (Figure 7G). [score:5]
To confirm the target gene predictions, miR-1 was overexpressed in gastric cancer cells (MGC-803, HGC-27 and MKN45) and in the normal cells (GES-1). [score:5]
The results revealed that the miR-1 overexpression significantly inhibited the migration of gastric cancer cells (MGC-803, HGC-27 and MKN45) but not that of normal cells (GES-1) (Figure 4A), indicating that miR-1 might be required for gastric cancer cell metastasis. [score:5]
Further analysis showed that miR-1 simultaneously targeted CDK4 (cyclin -dependent kinase 4), TWF1 (twinfilin actin binding protein 1), WASF2 (WAS protein family, member 2), CNN3 (calponin 3, acidic), CORO1C (coronin, actin binding protein, 1C) and TMSB4X (thymosin beta 4, X-linked), key genes involved in the cell cycle and metastasis, leading to the simultaneous inhibition of tumor growth and metastasis. [score:5]
The above data indicated that miR-1 could inhibit tumor growth and metastasis by targeting CDK4 gene and TWF1, WASF2, TMSB4X, CNN3 and CORO1C genes, respectively. [score:5]
A. The prediction of genes targeted by miR-1. As predicted, 35 genes associated with cell migration were miR-1 targets. [score:5]
To explore the molecular mechanism of miR-1 -mediated cell cycle arrest in cancer cells, the miR-1 targets related to the cell cycle were predicted using the miRanda, TargetScan and PicTar algorithms. [score:5]
The data revealed that metastasis of the breast cancer cells to the lungs of the mice was significantly suppressed by miR-1 mimic or miR-1 precursor compared with the negative control (Figure 7E), indicating that miR-1 could inhibit tumor metastasis. [score:4]
To investigate the mechanism underlying the miR-1 -mediated regulation of breast cancer cell metastasis, the expression levels of WASF2, TWF1, CNN3, TMSB4X and CORO1C genes in miR-1 -overexpressing cells were examined. [score:4]
Downregulation of miR-1 in gastric cancer cells and tissues. [score:4]
Taken together, these findings revealed a significant correlation between miR-1 downregulation and primary human tumorigenesis. [score:4]
D. The direct interactions between miR-1 and its target genes. [score:4]
The quantitative real-time PCR results showed that the miR-1 expression was significantly decreased in all cancer cells compared with that in the corresponding normal cells (Figure 1A), indicating that miR-1 might be a tumor suppressor. [score:4]
Downregulation of miR-1 in cancer cells and gastric cancer tissues. [score:4]
The cell migration and invasion assay results indicated that the miR-1 overexpression significantly inhibited the breast cancer cell migration and invasion (Figure 4D and 4E). [score:4]
These results demonstrated that miR-1 could mediate gastric or breast cancer cell cycle arrest in the G0/G1 phase by directly targeting the CDK4 gene (Figure 3F). [score:4]
Overexpression of miR-1 in cells. [score:3]
To elucidate the mechanism underlying the miR-1 -mediated inhibition of gastric cancer cell growth, the cell cycle was analyzed in cells transfected with the precursor miR-1 and the negative control miRNA. [score:3]
At 48 h after transfection, the miR-1 expression was detected with quantitative real-time PCR. [score:3]
The cell proliferation assay results indicated that miR-1 overexpression inhibited breast cancer cell growth compared with the control (Figure 2H). [score:3]
The above data revealed that CDK4 was a target gene of miR-1. Figure 3 A.. [score:3]
Fluorescence in situ hybridization was conducted to intracellularly localize miR-1 and its target mRNAs. [score:3]
The above data revealed that CDK4 was a target gene of miR-1. Figure 3 A.. [score:3]
The target mRNA (200 ng) was incubated in 20 μl of reaction solution containing 10 μl of Ago2 complex, 2 μl of 10 mM ATP/2 mM GTP solution, and 10 U/ml of RNasin (Promega, USA) and miR-1 (Genepharm, China) at 37°C. [score:3]
The results indicated that CDK4, a key gene required for the G1-S transition in the cell cycle [12], was a target of miR-1. This gene contains an miR-1 recognition site in the 3′UTR of CDK4 (Figure 3A). [score:3]
At 24 h after transfection, the mRNAs of the 35 target genes of miR-1 were detected using quantitative real-time PCR. [score:3]
Each miR-1 target mRNA was incubated with the Ago2 complex and different concentrations of miR-1 for 1 h. Then the cleavage products were detected by Northern blot analysis. [score:3]
MDA-MB-231 and MDA-MB-435 cells were transfected with 30 nM of the miR-1 precursor or the negative control miRNA to overexpress miR-1. At 48 h after transfection, the migrated cells were examined. [score:3]
The genes (TMSB4X, TWF1, CNN3, WASF2 and CORO1C) targeted by miR-1 are indicated in the boxes. [score:3]
Each target mRNA of miR-1 was incubated with miR-1 and the Ago2 complex for various times at 37°C. [score:3]
B. The interactions between miR-1 and its targets in vivo. [score:3]
The time-course results showed that all six targets could be cleaved in the miR-1-Ago complex (Figure 6A). [score:3]
H. Mo del for the miR-1 -mediated inhibitory mechanism of cancer cell metastasis. [score:3]
The expression level of miR-1 in grade 1 (n=10), grade 2 (n=8) and grade 3 (n=12) samples was analyzed by quantitative real-time PCR. [score:3]
The expression of miR-1 was normalized to U6 (Applied Biosystems, USA). [score:3]
These results indicated that miR-1 could inhibit the adhesion of gastric cancer cells. [score:3]
Figure 2 A. miR-1 overexpression in gastric cancer and normal cells. [score:3]
I. Effects of miR-1 overexpression on breast cancer cell cycle. [score:3]
E. The expression of miR-1 in gastric cancers at various stages of differentiation. [score:3]
When the six target mRNAs were co-incubated at equivalent levels with the miR-1-Ago2 complex, all six mRNAs were cleaved (Figure 6C). [score:3]
The results showed that 41 genes including CDK4 were the potential targets of miR-1 (Figure 3A). [score:3]
The miR-1 overexpression resulted in obvious morphological changes in the cells, including a decreased number of adherent cells and an increased number of round cells (Figure 5F). [score:3]
The results indicated that there was a significant correlation between miR-1 expression level and tumorigenesis (Figure 1D). [score:3]
These data indicated that miR-1 could inhibit the growth of gastric and breast cancer tumor in vivo. [score:3]
Therefore, our study identified a novel mechanism of simultaneous inhibition of tumor growth and metastasis mediated by a miRNA (miR-1). [score:3]
A. Effect of miR-1 overexpression on tumor growth in vivo. [score:3]
Taken together, these findings revealed that miR-1 could function as a gastric and breast cancer suppressor by inducing cell cycle arrest. [score:3]
The above data revealed that the miR-1 -mediated inhibition of gastric cancer cell proliferation but not normal cell proliferation was due to cancer cell cycle arrest in G0/G1 phase. [score:3]
The underlying mechanism of miR-1 -mediated synchronous suppression of tumor growth and metastasis. [score:3]
B. Influence of miR-1 overexpression on human skin cancer A375 cell migration. [score:3]
To detect the expression of miR-1, total RNA was extracted from cells and tissues with a mirVana miRNA Isolation Kit (Ambion, USA). [score:3]
A. The expression of miR-1 in gastric cancer, skin cancer, breast cancer and normal cell lines. [score:3]
The miR-1 -mediated tumor suppression in vivo. [score:3]
To reveal the role of miR-1 in tumorigenesis, the expression levels of miR-1 in the cells of skin cancer, breast cancer and gastric cancer, three of the most common malignant cancers worldwide, were examined. [score:3]
To facilitate the miR-1 -guided cleavage of target mRNA, the endogenous Ago2 complex was obtained. [score:3]
This inhibition of cancer cell proliferations by miR-1 suggested the involvement of miR-1 in the cell cycle or/and cancer cell senescence. [score:3]
G. Mo del for the miR-1 -mediated inhibitory mechanism of tumor growth and metastasis. [score:3]
E. The influence of miR-1 overexpression on breast cancer cell invasion. [score:3]
These results indicated that miR-1 triggered the cycle arrest in G1/G0 phase, resulting in the inhibition of breast cancer cell growth. [score:3]
C. The miR-1 -guided simultaneous cleavage of miR-1 target mRNAs. [score:3]
The results showed that the miR-1 expression level in cancerous tissues was significantly lower than that in the paired normal tissues (Figure 1C). [score:3]
The confocal microscopy images showed that miR-1 was co-localized with the mRNAs of the six target genes (Figure 6D). [score:3]
In the present investigation, miR-1 was shown to simultaneously inhibit tumor growth and metastasis of breast and gastric cancers by synchronously targeting CDK4 and TMSB4X, CNN3, TWF1, CORO1C and WASF2 genes. [score:3]
The data revealed that miR-1 could inhibit the metastasis of gastric cancer cells. [score:3]
H. The effect of miR-1 overexpression on breast cancer cell proliferation. [score:3]
D. The intracellular co-localization of miR-1 and its six target genes. [score:3]
miR-1 -guided cleavage of miR-1 target mRNA. [score:3]
Previous studies have shown that miR-1 expression is decreased in several types of cancers, such as prostate cancer [38– 40], lung cancer [41], bladder cancer [42, 43], hepatocellular carcinogenesis [44], head and neck squamous cell carcinoma [45] and thyroid carcinogenesis [46]. [score:3]
G. The overexpression of miR-1 in breast cancer cells. [score:3]
The results indicated that 35 genes associated with cell migration might be targeted by miR-1 (Figure 5A). [score:3]
MDA-MB-231 cells expressing luciferase were transfected with the miR-1 precursor, and these cells were then intravenously injected into mice via the tail vein. [score:3]
Figure 1 A. The expression of miR-1 in gastric cancer, skin cancer, breast cancer and normal cell lines. [score:3]
To explore the role of miR-1 in tumorigenesis in vivo, miR-1 was overexpressed in gastric cancer cells (MGC-803) or breast cancer cells (MDA-MB-231), and the cancer cells were then injected into nude mice to examine the tumor growth. [score:3]
The tumor sizes of mice injected with miR-1 -overexpressing MGC-803 or MDA-MB-231 cells were significantly larger than those of the controls (Figure 7B). [score:3]
B. The effect of miR-1 concentration on target cleavage. [score:3]
C. The expression of miR-1 in tumor specimens from gastric cancer patients. [score:3]
These findings revealed that miR-1 could simultaneously guide the cleavage of its six target mRNAs. [score:3]
The senescence -associated β-galactosidase staining results revealed that not all cells were stained, indicating that senescence did not occur in the miR-1 -overexpressing cancer and normal cells (Figure 2D). [score:3]
B. Effects of miR-1 overexpression on the adhesion of gastric cancer cells. [score:3]
These data showed that miR-1 could inhibit the metastasis of breast cancer cells. [score:3]
Mechanism of miR-1 -mediated inhibition of gastric and breast cancer cell growth. [score:3]
A. miR-1 overexpression in gastric cancer and normal cells. [score:3]
However, miR-1 overexpression had no significant effect on the number of adherent normal cells (GES-1) (Figure 4B). [score:3]
These findings demonstrated that miR-1 could inhibit breast cancer metastasis in vivo. [score:3]
Intracellular co-localization of miR-1 and its target mRNAs. [score:3]
D. of the miR-1 target CDK4 in tumors. [score:3]
The target genes of miR-1 were predicted to elucidate the role of miR-1 in cancer cell metastasis. [score:3]
Inhibition of gastric and breast cancer cell growth by miR-1. Effects of miR-1 on the growth of gastric and breast cancer cells and normal cells. [score:3]
However, miR-1 overexpression had no effect on the cell cycle of GES-1 cells (Figure 2C). [score:3]
The morphology of miR-1 -overexpressing cells was examined with optical microscopy. [score:3]
The mRNAs of all six miR-1 targets were equivalently co-incubated with the Ago2 complex and miR-1. One hour later, the cleavage products were examined by Northern blot analysis. [score:3]
Prediction of miR-1 target genes. [score:3]
The results indicated that miR-1 was differentially expressed in both cancerous and normal cells. [score:3]
Figure 6 A. The time-course assays of the miR-1 -guided cleavage of target mRNAs. [score:2]
To determine whether miR-1 could directly interact with CDK4, the CDK4 3′UTR and CDK4 3′UTR mutant constructs were generated (Figure 3A). [score:2]
A 500 -bp fragment of miR-1 target's 3′-UTR was amplified with sequence-specific primers (TWF1, 5′-GATCACTAATACGACTCACTATAGG GTGCATTA TCAGTTACAACCT-3′ and 5′-TGGCAC TCTGATTAAACTGCAT-3′; WASF2, 5′- GATCACTAATACGACTCACTATAGGGCTTTAGACCCAGAGCCCT TTAAGA-3′ and 5′-AGAGACCTCAATCTGTCCAA GCT-3′; TMSB4X, 5′-GATCACTAAT ACGACTCACTATAGGGTGCGCCGCCAATATGCACTGT-3′ and 5′-TGGCACT CTGATTAAACTGCAT-3′; CNN3, 5′- GATCACTAATACGACTCACTATAGG GATCCACA CAGAAGGAGCTCAGT-3′ and 5′-CAAATGCATCA CCCAGGCCT A-3′; CORO1C, 5′- GATCACTAATA CGACTCACTATAGGGAGCTGGTTATT GGTGTG GTCCTA-3′ and 5′-ATGAGAGCGGTGGTAATA TGAATC-3′; CDK4, 5′- GATCACTAATACGACTCACTA TAGGGCATGGAAGGAAGAAAAGCTG-3′ and 5′-TTC AAGCGATCCTCCTGCCT-3′). [score:2]
To evaluate the role of miR-1 in the regulation of the cell cycle of breast cancer cells, miR-1 was overexpressed in MDA-MB-231 and MDA-MB-435 breast cancer cells (Figure 2G). [score:2]
The apoptosis assays demonstrated that percentages of apoptotic miR-1 -overexpressing cancer cells were similar to those of the controls (Figure 2F), indicating that miR-1 had no effect on the apoptosis of gastric cancer cells. [score:2]
The confocal microscopy data indicated that the formation of actin stress fibers was destroyed in miR-1 -overexpressing cells compared with the control cells (Figure 5E). [score:2]
Mechanism of gastric and breast cancer cell cycle regulation mediated by miR-1.. [score:2]
A. The time-course assays of the miR-1 -guided cleavage of target mRNAs. [score:2]
The cancer cell metastasis analysis revealed that the miR-1 overexpression in human skin cancer A375 cells had no effect the cancer cell migration compared with the control (Figure 1B). [score:2]
At the same time, the cell invasion assays showed that miR-1 overexpression led to a significant decrease in the invasion of cancer cells (MGC-803, HGC-27 or MKN45), whereas the invasion of normal cells (GES-1) was not affected by miR-1 (Figure 4C). [score:2]
For the dual-luciferase reporter assays, HGC-27 cells were plated in a 96-well plate, incubated overnight, and then co -transfected with the miR-1 miExpress vector (Applied Biosystems, USA) or the vector only and CDK4-3′UTR, TMSB4X-3′UTR, TWF1-3′UTR, CNN3-3′UTR, WASF2-3′UTR or CORO1C-3′UTR constructs using Attractene Transfection Reagent (Qiagen, USA). [score:2]
The FACS analysis showed that the numbers of cells at G0/G1 phase in the miR-1 -overexpressing HGC-27, MGC-803 and MKN45 cells were significantly increased compared with the controls (Figure 2C). [score:2]
The expression of miR-1 was measured using quantitative real-time PCR. [score:1]
MDA-MB-435 cells were transfected with 30 nM of the miR-1 precursor and then cultured for 48 h. The cells were fixed with 4% polyformaldehyde for 15 min at room temperature. [score:1]
Therefore the effect of miR-1 on the fiber formation of actin was explored. [score:1]
E. Effects of miR-1 on the actin filament formation. [score:1]
Moreover, the analysis of the pRb the phosphorylation, in which decreased phosphorylation is a marker of cell senescence [11], revealed that pRb was phosphorylated in all cells (Figure 2E), indicating that miR-1 did not affect gastric cancer cell senescence. [score:1]
To evaluate the effect of miR-1 on the metastasis of gastric cancer cells, miR-1 was overexpressed in cancer cells, followed by detection of cancer cell migration, adhesion and invasion. [score:1]
Cells were treated with 30 nM of the miR-1 precursor or the negative control RNA for 48 h and whole-cell extracts were analyzed by. [score:1]
Cells were transfected with the miR-1 precursor or the negative control. [score:1]
C. Interaction between miR-1 and CDK4. [score:1]
A375 cells were transfected with the miR-1 precursor or the negative control. [score:1]
F. The influence of miR-1 on cell morphology. [score:1]
Gastric cancer cells (MGC-803, HGC-27 and MKN45) and the normal cells (GES-1) were transfected with the miR-1 precursor or the negative control. [score:1]
Then, MDA-MB-231 cells were transfected with 30 nM of the miR-1 precursor. [score:1]
MDA-MB-435 cells were transfected with the miR-1 precursor and then cultured for 48 h. The cells were subjected to fluorescence in situ hybridization using a DIG-labeled miR-1 probe and a biotin-labeled mRNA probe. [score:1]
The miR-1 precursor or the negative control miRNA was transfected into gastric cancer cells (MGC-803, HGC-27 and MKN45) and the normal cells (GES-1). [score:1]
Cells treated with the miR-1 precursor or negative control miRNA for 48h were stained with rhodamine-phalloidin (red) and DAPI (blue) to label F-actin and nuclei, respectively. [score:1]
To examine the effects of miR-1 on cancer cell metastasis in vivo, the animal mo del of breast cancer cell metastasis to lung was established as described previously with some modifications [6, 13, 19]. [score:1]
The cancer cells (MGC-803, HGC-27 and MKN45) and normal cells (GES-1) were transfected with 30 nM of the miR-1 precursor or the negative control miRNA (Ambion, USA). [score:1]
Effects of miR-1 on gastric and breast cancerous cell metastasis. [score:1]
In this investigation, miR-1 was shown to be significantly downregulated in gastric and breast cancer cells compared with normal cells. [score:1]
Breast cancer cells were transfected with 30 nM of the miR-1 precursor or the negative control miRNA. [score:1]
The miR-1 -mediated pathway for cancer cell metastasis. [score:1]
Cells were transfected with the miR-1 precursor or the negative control miRNA and were then incubated for 48 h. Then, the cells were trypsinized, and 5 × 10 [4] cells were resuspended in 100 μl serum-free media and added to the inserts. [score:1]
Cells were transfected with 30 nM of the miR-1 precursor or the negative control for miR-1 (Ambion, USA). [score:1]
MGC-803, HGC-27, MKN45 and GES-1 cells were transfected with the miR-1 precursor or the negative control miRNA. [score:1]
Gastric cancer cells (MGC-803) or breast cancer cells (MDA-MB-231) were transfected with the miR-1 precursor or the negative control. [score:1]
At 48 h after miR-1 overexpression, the invaded cells were evaluated. [score:1]
Breast cancer cells (MDA-MB-231 and MDA-MB-435) were transfected with 30 nM of the miR-1 precursor or the negative control miRNA. [score:1]
These data indicated that miR-1 could initiate cell cycle arrest in the G0/G1 phase in cancer cells but not normal cells, contributing to the inhibition of cancer cell proliferation by miR-1. To evaluate the effects of miR-1 on cell senescence, MGC-803, HGC-27, MKN45 and GES-1 cells were transfected with the miR-1 precursor, and were then examined for senescence. [score:1]
Cells (5×10 [4]) treated with 30 nM of the miR-1 precursor or the negative control were resuspended in serum-free medium and transferred to the coated plates. [score:1]
A. Effect of miR-1 on gastric cancer cell metastasis. [score:1]
The miR-1 construct or the vector only and the luciferase plasmid containing the 3′UTR of CDK4 mRNA or its mutant were co -transfected into HGC-27 cells. [score:1]
Cells were transfected with the precursor miR-1 or the negative control miRNA. [score:1]
Cells were plated in 96-well plates, incubated overnight, and then transfected with 30 nM of the miR-1 precursor or the negative control miRNA (Ambion, USA) using Lipofectamine® RNAiMAX (Life Technologies, USA). [score:1]
Cells transfected with the miR-1 precursor or the negative control miRNA were collected 48 h after transfection by centrifugation at 300 × g for 10 min. [score:1]
C. The role of miR-1 in cancer cell invasion. [score:1]
The miR-1 precursor and the 3′ UTR of TMSB4X, TWF1, CNN3, WASF2 or CORO1C were co -transfected into MGC-803 cells. [score:1]
Figure 4 A. Effect of miR-1 on gastric cancer cell metastasis. [score:1]
Cells were plated in glass bottomed dishes (In Vitro Scientific, USA), incubated overnight, and then transfected with 30 nM of the miR-1 precursor or the negative control RNA for 48 h. The transfected cells were fixed in 4% paraformaldehyde for 15 min. [score:1]
The samples were characterized using haematoxylin and eosin staining (400×) and quantitative real-time PCR of miR-1. D. Scatter plot showing the expression level of miR-1 in tumor (n=44) and corresponding normal samples (n=42) from gastric cancer patients. [score:1]
Red, miR-1. Blue, nuclei. [score:1]
Breast cancer cells were treated with 30 nM of the miR-1 precursor or the negative control miRNA and cultured for 48 h. The whole-cell lysates were subjected to. [score:1]
At the same time, the synthesized miR-1 (miR-1 mimic) or physiological saline was injected into the mice treated with MDA-MB-231 cells. [score:1]
In addition, the cell cycle analysis showed that the number of cells in the G0/G1 phase was 20% higher after transfection with the miR-1 precursor than with the negative control (Figure 2I), indicating that miR-1 had a positive effect on breast cancer cell cycle arrest in the G0/G1 phase. [score:1]
Cells were transfected with the miR-1 precursor or the negative control miRNA. [score:1]
C. Effects of miR-1 on the cell cycle. [score:1]
At 48 h after transfection, cells (2×10 [5]) transfected with the miR-1 precursor or control cells (2×10 [5]) were intravenously injected via the tail vein into nude mice. [score:1]
Every 3 days after the injection, the mice were intravenously injected via the tail vein with 200 nM of synthesized miR-1 or physiological saline. [score:1]
To label miR-1, the cells were incubated with hybridization buffer containing 100 nM DIG-labeled miR-1 probe (5′-DIG-ATACATACTTCTTTACATTCCA -3′) overnight at 37°C. [score:1]
Quantitative real-time PCR for the quantification of miR-1. Pathological analysis of gastric cancer patients. [score:1]
F. s. Breast cancer cells treated with the miR-1 precursor were cultured for 48 h, then, the adherent cells were examined. [score:1]
These data indicated that miR-1 could initiate cell cycle arrest in the G0/G1 phase in cancer cells but not normal cells, contributing to the inhibition of cancer cell proliferation by miR-1. To evaluate the effects of miR-1 on cell senescence, MGC-803, HGC-27, MKN45 and GES-1 cells were transfected with the miR-1 precursor, and were then examined for senescence. [score:1]
Cells were transfected with 30 nM of the miR-1 precursor (Ambion, USA) or the negative control miRNA (Ambion, USA) using Lipofectamine® RNAiMAX (Life Technologies, USA). [score:1]
To evaluate the miR-1 expression in more clinical samples, 42 pairs of cancerous tissues and corresponding normal tissues from the same patients with gastric cancer were examined. [score:1]
Based on the results of our studies and those of previous studies, miR-1 could serve as a biomarker for the clinical diagnosis of tumors and the restoration of miR-1 in cancers might be a potential therapeutic strategy for cancer. [score:1]
To investigate the role of miR-1 in cancer cell growth, miR-1 was overexpressed in gastric cancer cells (MGC-803, HGC-27 and MKN45) and normal gastric cells (GES-1) (Figure 2A). [score:1]
F. Mo del for the miR-1 -mediated pathway in the cell cycle of cancer cells. [score:1]
The data from the cell adhesion assays showed that the number of adherent cancer cells (MGC-803, HGC-27 or MKN45) was significantly decreased compared with the control when miR-1 was overexpressed in cancer cells (Figure 4B). [score:1]
Cells treated with the precursor miR-1 or the negative control miRNA were subjected to with the phosphorylated pRb antibody (P-pRb). [score:1]
Cells transfected with the precursor miR-1 or the negative control miRNA were treated using senescence -associated β-galactosidase staining. [score:1]
Cells were transfected with 30 nM of the miR-1 precursor or the negative control. [score:1]
[1 to 20 of 207 sentences]
2
[+] score: 548
In fact, we discovered that miR-1 directly regulates myocardin mRNA in a heterologous expression system via a target site in the 3′ UTR using luciferase reporter assays and demonstrated that over -expression of miR-1 in embryonic cardiomyocytes resulted in a down-regulation of myocardin. [score:11]
Our search for miR1-/133a targets identified myocardin, which was strongly up-regulated in mutant hearts, while several other putative miR-1/133a targets that have been described before were not altered, indicating that miR-1/133a target control strongly depends on the cellular context. [score:10]
Unbiased transcriptional profiling and molecular analysis of putative miR-1/133a target molecules up-regulated in miR-1/133a d KO mutants uncovered several direct targets of miR-1 and miR-133a including myocardin, Kcnmb1 and BMP-10. [score:9]
Initially, it was surprising to see that the increased myocardin activity in miR-1/133a d KO mutants and myocardin transgenic embryos caused up-regulation of multiple smooth muscle marker genes, since the relatively normal expression of smooth muscle genes in myocardin mutant hearts seems to suggest that smooth muscle gene expression in cardiomyocytes is not under direct control of myocardin [34], [35]. [score:9]
Please note that several genes up-regulated in myocardin -overexpressing NIH3T3 cells were also upregulated in miR-1/133a d KO embryos. [score:9]
Transgenic overexpression of myocardin in the heart resulted in a strong induction of expression of both miR-1/133 gene clusters, which together with the inhibition of myocardin by miR-1 suggests the existence of a negative regulatory loop that acts as a rheostat to regulate miR-1/133a. [score:9]
In total, 90 out of 139 genes up-regulated by myocardin overexpression were also up-regulated in miR-1/133a d KO mutant hearts. [score:9]
Several genes that are significantly up-regulated in miR-1/133a d KO hearts are also up-regulated after transgenic expression of myocardin. [score:9]
Of course, up-regulation of myocardin does not account for all effects of miR-1/133a as illustrated by 382 genes up-regulated in miR-1/133a d KO mutants but not in myocardin overexpressing hearts. [score:9]
Down-regulation of miR-1, which occurs under different pathological conditions [10], and subsequent increase of myocardin activity might explain the up-regulation of smooth muscle marker genes in various diseases of the heart [5]. [score:9]
In contrast, it seems likely the down-regulation of Msx1/2 [29] and Tbx1/Six1/Eya1 [21] in miR-1/133a d KO hearts occurred by secondary means independent of the up-regulation of myocardin, probably due to the loss of myocardial cells or the global arrest of heart development in miR-1/133a d KO mutants. [score:8]
Hence, we screened for predicted target sites of miR-1 and miR-133a in transcripts that were up-regulated in miR-1/133a d KO mutant hearts using Targetscan (v6) and miRanda (microrna. [score:8]
We also detected a conserved miR-133a target site in the 3′-UTR of Kcnmb1 [23] (Fig. 5D), which is normally specifically expressed in smooth muscle cells but up-regulated in miR-1/133a d KO mutant hearts. [score:8]
miR-133a -mediated inhibition of Kcnmb1 and miR-1 -mediated suppression of myocardin render Kcnmb1 expression dependent on the balance of miR-1/133a and myocardin concentrations in the cell, which might be important for the regulation of pathophysiologic conditions. [score:8]
90 out of 139 genes up-regulated by 1.5-fold in myocardin-transgenic hearts were also up-regulated in miR-1/133a d KO mutants (Suppl. [score:7]
Interestingly, the adverse effects of the loss of miR-1/133a and up-regulation of myocardin became apparent at the same developmental stage when smooth muscle gene expression is normally lost in cardiomyocytes. [score:7]
While the majority of dysregulated genes in miR-1/133 KO mice and myocardin overexpressing mice showed an up-regulation (Suppl. [score:7]
Directed expression of myocardin in the heart recapitulates the miR-1/133a knock-out phenotypeMyocardin is a potent transcriptional co-activator of serum response factor (SRF) controlling gene expression of smooth muscle and cardiac cells. [score:7]
In addition, defects in cell cycle regulation and cardiac conduction have been attributed to the up-regulation of the putative miR-1 target molecules Hand2 and Irx5, as well as of the Kcnd2 potassium channel [16]. [score:7]
However, diseases of the heart also go along with changes of miR-1/133a expression similar to intronic myomirs, although it is often not clear whether such changes are due to an increase of non-cardiomyocytes in diseased hearts [10]. [score:7]
Myocardin regulates miR-1/133 expression in vivo Previous studies demonstrated that miR-1 genes are direct transcriptional targets of the transcription factor SRF [14], which depends on myocardin or MRTFs to achieve cell type specific transcriptional activity [24]. [score:7]
Fig. S10B) we found only few genes that were down-regulated both in miR-1/133 d KO embryos and in myocardin overexpressing embryos. [score:6]
Overexpression of myocardin leads to up-regulation of miR-1 and miR-133a. [score:6]
One of the strongest up-regulated genes in that group was myocardin, which carries a conserved target site for miR-1 in the 3′-UTR (Fig. 5C). [score:6]
50% reduced expression of miR-1 and miR-133a expression in single cluster knock-out embryonic hearts and complete loss in miR-1/133 d KO embryonic hearts at E10.5 using Taqman probes. [score:6]
To understand the molecular events leading to the miR-1/133a d KO phenotype and to analyze whether increased levels of myocardin induce a similar set of genes up-regulated in miR-1/133a d KO cells, we decided to overexpress myocardin in vitro in NIH3T3 cells and in vivo in embryonic hearts. [score:6]
In contrast, we did not observe transcriptional up-regulation of a number of previously described miR-1 or miR-133a target molecules like SRF, IRQ5, Hand2 or HDAC4 in d KO hearts (Fig. 4). [score:6]
27 out of 382 genes, which were up-regulated at least 1.5-fold, contained conserved target sites for miR-1 or miR-133a. [score:6]
We reasoned that the up-regulation of myocardin, which is a well-characterized transcriptional co-activator of SRF that serves as a major regulatory switch for smooth muscle gene expression [24], [27], is instrumental for mediating effects of miR-1 during early heart development. [score:6]
Note that the miR-133a and miR-1 target genes Kcnmb1 and BMP-10 are not significantly up-regulated in myocardin transgenic embryonic hearts. [score:6]
Surprisingly, we did not observe up-regulation of several previously described miR-1/133 target mRNAs such as SRF, IRQ5, Hand2 or HDAC4 in miR-1/133 d KO mutant hearts at E10.5 [6], [7]. [score:6]
Transgenic overexpression of myocardin in the developing heart, which closely mimicked the transcriptional increase seen in miR-1/133a d KO mice, recapitulated many aspects of the miR-1/133a d KO phenotype proving the mechanistic relevance of myocardin up-regulation. [score:6]
Analysis of the expression of different myocardin splice isoforms in E10.5 d KO hearts revealed that only the cardiac-specific but not the smooth muscle-specific isoform of myocardin was up-regulated in d KO hearts essentially ruling out effects of miR-1 on myocardin mRNA splicing (Suppl. [score:6]
Transgenic overexpression of the newly discovered miR-1 target myocardin recapitulated major aspects of the miR-1/133a phenotype. [score:5]
Overexpression of myocardin in embryonic hearts recapitulated major aspects of the miR-1/133a mutant phenotype, suggesting that loss of myocardin suppression is the primary reason for incorrect heart muscle specification in the mutants. [score:5]
Increased expression of pri-miR-1/133a in Myocardin overexpressing embryos and analysis of the interaction of myocardin with SRF -binding sequences in miR-1-1/133a-2 and miR-1-2/133a-1 promoters. [score:5]
Mice with targeted inactivation of individual miR-1/133a cluster are viable and fertile and show no gross morphological aberrationsThe two miRNA miR-1/133a clusters constitute functional units at mouse chromosome 2 and chromosome 18 as both miRNAs are expressed in the heart and skeletal muscle as bi-cistronic messages. [score:5]
Co-transfection of either miR-1 or miR-133a together with corresponding reporter plasmids efficiently suppressed luciferase activity whereas reporter plasmids carrying mutated miRNA binding sites were not affected (Fig. 5E, F) confirming our assumption that myocardin and Kcnmb1 are primary targets of miR-1 and miR-133a, respectively. [score:5]
We assume that the failure of immature miR-1/133a d KO mutant cardiomyocytes to acquire a more mature phenotype activates a cellular stress program inhibiting further proliferation, since no evidence for direct regulation of cell proliferation by miR-1/133a was found. [score:5]
Specifically, myocardin overexpression phenocopied morphological changes, reduced cardiomyocyte proliferation, and induced expression of a large set of smooth muscle marker genes all observed in miR-1/133a d KO mutants. [score:5]
miR-1 overexpression has been shown to decrease the pool of proliferating ventricular cardiomyocytes [14] and to attenuate cardiomyocyte hypertrophy by targeting molecules involved in calcium signaling [17]. [score:5]
Of note, we did not observe increased BMP-10 expression in myocardin overexpressing E10.5 hearts as in miR-1/133a d KO mutants (Suppl. [score:5]
Expression analysis at E10.5 confirmed a complete loss of miR-1 and miR-133a expression in d KO embryos (Fig. 2A,H, I). [score:5]
Expression levels of miR-133a dropped slightly after TAC in both single cluster mutants suggesting that the respective remaining miR-1/133a gene cluster possesses only a limited ability to react to the loss of individual alleles by increased expression both under baseline and pathological conditions (Fig. 1I). [score:5]
Directed expression of myocardin in the heart recapitulates the miR-1/133a knock-out phenotype. [score:5]
In addition, we found that myocardin overexpression stimulated expression of miR-1/133a, which argues for a negative feedback loop required for adjustment of myocardin concentrations in the heart. [score:5]
Expression of the miR-1 target myocardin induces smooth muscle cell-like morphology in NIH3T3 cells. [score:5]
We concluded that miR-1 and miR-133a control the faithful expression of genes in a functionally redundant manner by adjustment of myocardin levels to allow specification of early cardiomyocytes with hybrid expression of cardiomyocyte and smooth muscle specific markers to more differentiated fetal cardiomyocytes. [score:5]
Figure S9 Comparative expression analysis of genes in myocardin overexpressing NIH3T3 cells and in hearts of miR-1/133a dko embryonic hearts at E10.5. [score:5]
Most importantly, we observed a striking overlap of genes up-regulated in myocardin-transgenic and miR-1/133a d KO hearts. [score:4]
Affymetrix GeneArray and quantitative RT-PCR analysis revealed an up-regulation of smooth muscle marker genes including Acta2 and Kcnmb1, which resembled several of the transcriptional changes observed in miR-1/133a KO hearts (Fig. 6B–E, Suppl. [score:4]
Several miRNAs, which play a role during heart development, are specifically expressed in the heart or skeletal muscle such as miR-1/133a miRNAs or the so-called myomiRs located in introns of muscle-specific genes. [score:4]
In contrast to the miR-1/miR133a cluster, miR-206 and miR-133b are expressed mainly in somites during skeletal muscle development [11] and later become confined to slow skeletal muscle fibers. [score:4]
To validate the regulatory interactions between miR-1 and myocardin or miR-133a and Kcnmb1 we inserted the respective miRNA binding sites as well as mutant target sites into the 3′-UTR of a luciferase reporter (Fig. 5C, D). [score:4]
Deletion of miR-1/133a clusters induces up-regulation of smooth muscle-specific genes leading to multiple transcriptional changes in embryonic hearts. [score:4]
Similarly, we did not detect a compensatory increase of miR-1 and miR-133a expression in embryonic hearts of single miRNA cluster knock-out mice at E10.5 (Fig. 2A). [score:4]
As expected, miR-1 overexpression resulted in a significant reduction of myocardin mRNA (Fig. 5G) and protein (Fig. 5H) while miR-133a overexpression caused a significant decline of Kcnmb1 mRNA (Fig. 5I) and protein (Fig. 5J) concentrations compared to miRNA controls (Fig. 5H′, J′). [score:4]
In wild type hearts, expression of ANP at this developmental stage was mostly confined to the trabecular layer (Fig. 3E) further supporting the view that the compact layer was more severely affected than the trabecular layer by the loss of miR-1/133a although some morphological abnormalities in the trabecular layer were present as well. [score:4]
It is tempting to speculate that the joint regulation of two different miRNA genes targeting different genes by myocardin is a reason for the evolutionary conservation of miR-1 and miR-133a linkage. [score:4]
miR-1/133a regulated genes that do not respond to myocardin overexpression are indicated. [score:4]
Previous studies demonstrated that miR-1 genes are direct transcriptional targets of the transcription factor SRF [14], which depends on myocardin or MRTFs to achieve cell type specific transcriptional activity [24]. [score:4]
Furthermore, these results indicated that increased abundance of myocardin transcripts is due to miR-1 mediated repression and not caused by general up-regulation of the smooth muscle program. [score:4]
Figure S11 BMP10 is a direct primary target of miR-1. Putative miR-1 WT and mutant binding sites located in the ORF of BMP-10 were cloned into the pmirGLO Dual-Luciferase Vector. [score:4]
No significant increase of miR-1 expression in miR-1-1/133a-2 and miR-1-2/133a-1 mutants after TAC compared to sham-operated mice while expression levels of miR-133a dropped slightly after TAC in both single cluster mutants. [score:4]
Myocardin regulates miR-1/133 expression in vivo. [score:4]
1003793.g004 Figure 4Deletion of miR-1/133a clusters induces up-regulation of smooth muscle-specific genes leading to multiple transcriptional changes in embryonic hearts. [score:4]
Next, we generated mice that lack both clusters and hence completely fail to express miR-1 and miR-133a. [score:3]
Since we demonstrated that miR-1 represses myocardin we speculated that miR-1 might be part of a negative feedback loop that restricts its own expression. [score:3]
The two miRNA miR-1/133a clusters constitute functional units at mouse chromosome 2 and chromosome 18 as both miRNAs are expressed in the heart and skeletal muscle as bi-cistronic messages. [score:3]
Primary sequences of mature miR-1 or miR-133a are identical and both gene clusters show similar expression patterns suggesting that these miRNAs serve at least partially overlapping functions. [score:3]
Therefore, we analyzed expression of miR-1 in myocardin transgenic hearts at E10.5. [score:3]
The reduction of cardiomyocyte proliferation in miR-1/133a d KO seems to rely on a different mechanism since BMP-10 expression was increased in miR-1/133a d KO mice but not decreased as in myocardin mutants [5]. [score:3]
Mice with targeted inactivation of individual miR-1/133a cluster are viable and fertile and show no gross morphological aberrations. [score:3]
Taken together our results suggested that myocardin represents a primary target for miR-1 and Kcnmb1 for miR-133a miRNAs in vivo at E10.5. [score:3]
To get insights into the molecular processes that are affected by loss of miR-1/133a we performed a comparative RNA expression analysis of the developing heart using RNA isolated from E10.5 hearts (n = 4, d KO; n = 5, controls). [score:3]
Figure S7 Expression of cardiac and smooth muscle isoforms of myocardin in embryonic hearts of WT and miR-1/133a d KO embryos. [score:3]
Myocardin and Kcnmb1 are primary targets of miR-1 and miR-133a. [score:3]
The pattern of miR-1 expression was not altered in single cluster mutants as visualized by whole mount in situ hybridization using LNA-probes (Fig. 2B–G) again indicating that miR-1-1 and miR-1-2, respectively miR-133a-1 and miR-133a-2 might substitute for each other. [score:3]
miR-1 mediated suppression of luciferase activity via WT but not mutant miRNA binding sites located in the BMP-10 mRNA. [score:3]
Rather, it supports the relevance and the efficiency of miR-1 mediated repression of BMP-10, which seems to be able to normalize increased BMP-10 levels in myocardin overexpressing mice. [score:3]
Unbiased gene ontology enrichment analysis using genes that were at least 1.5-fold up-regulated in miR-1/133a d KO compared to control hearts at E10.5 revealed that terms subsumed in the category “cell differentiation” showed the most significant enrichment. [score:3]
Figure S10 Transgenic expression of myocardin (tg) in embryonic hearts recapitulates transcriptional changes induced by deletion of miR-1/133a clusters (d KO) at E10.5. [score:3]
The function of intronic myomiRs has been addressed in a number of elegant papers suggesting functions mainly under cardiac stress and in disease conditions [8], [9] while the exact role of miRNAs miR-1 and miR-133a is less clear, in part due to putative compensatory actions of these highly similar miRNAs. [score:3]
Primary sequences of mature miR-1 or miR-133a are identical and both gene clusters show similar expression in the heart and skeletal muscle. [score:3]
miR-1 and miR-133a represent a particularly intriguing example since the two gene clusters, which encode mir-1-1/133a-2 and miR-1-2/133a-1, are completely identical and apparently expressed in the same tissue: heart and skeletal muscle [6], [7]. [score:3]
Taken together, our results suggest that miR-1 mediated repression of myocardin limits transcriptional activation of both miR-1 and miR-133a clusters thereby adjusting its expression (and of miR-133a) in a negative feedback loop (Fig. 7P). [score:3]
Transgenic overexpression of myocardin in the embryonic heart recapitulates the miR-1/133a phenotype. [score:3]
Affymetrix DNA microarray -based transcriptional analysis of myocardin -overexpressing NIH3T3 cells and miR-1/133a d KO mutant hearts. [score:3]
Putative miR-1/133a target genes are indicated. [score:3]
miR-1/133a clusters contribute equally to miR-1/133a expression in the developing heart. [score:3]
1003793.g002 Figure 2 miR-1/133a clusters contribute equally to miR-1/133a expression in the developing heart. [score:3]
Figure S6 Gene ontology enrichment analysis of genes at least 1.5-fold up-regulated in miR-1/133a d KO compared to wt control hearts at E10.5. [score:3]
Hearts of myocardin -expressing transgenic embryos showed a thin compact layer and a preserved trabecular structure at E10.5 (Fig. 7C, D) strongly resembling the morphologic phenotype seen in miR-1/133a d KO embryos. [score:3]
Myocardin is a primary target of miR-1 in the embryonic heart. [score:3]
1003793.g005 Figure 5(A, A′) Western blot analysis of increased myocardin expression in miR-1/133a d KO embryonic hearts at E10.5 compared to WT. [score:2]
Figure S3 Deletion of both miR-1/133a clusters leads to arrest of heart development and embryonic lethality. [score:2]
The oligonucleotides used for the qRT-PCR are directed to the exons flanking the intron containing the miR-1/133 coding region. [score:2]
Deletion of single miR-1/133a clusters did not lead to major developmental defects and did not impair viability of adult mice while deletion of both miR-1/133a gene clusters caused early embryonic lethality due to severe heart malformations. [score:2]
for miRNAs was performed as described previously [11] using dual DIG-labeled LNA antisense probes (Exiqon) for mmu-miR-1. Embryos of different developmental stages were isolated and immediately fixed in PFA. [score:2]
The lack of developmental abnormalities in single miR-1/133a gene cluster mutants corroborates previous findings on miR-133a-1 and miR-133a-1 KO animals [15]. [score:2]
To resolve the biological function of miR-1/133a clusters in vivo, we generated knock-out mice for each individual cluster (Suppl. [score:2]
Transcriptional profiling of miR-1/133a double mutant hearts revealed an up-regulation of genes characteristic for immature cardiomyocytes. [score:2]
Analysis of miR-1 and miR-133a concentrations in individual cluster mutants revealed no significant change of miR-1 expression after TAC compared to sham-operated mice (Fig. 1H). [score:2]
Deletion of both miR-1/133a clusters revealed a fundamentally new role of miR-1/133a in early heart development. [score:2]
Whole mount in situ hybridization for miRNAs was performed as described previously [11] using dual DIG-labeled LNA antisense probes (Exiqon) for mmu-miR-1. Embryos of different developmental stages were isolated and immediately fixed in PFA. [score:2]
All three loci produce bicistronic transcripts containing one miRNA from the miR-1/206 family and one from the miR-133 family essentially forming functional units [12] that are under the transcriptional control of heart and muscle specific regulatory programs [13], [14]. [score:2]
miRNAs miR-1/133a are essential for early cardiac development. [score:2]
We have generated compound mutant mice of both miR-1/133a gene clusters resulting in early arrest of heart development while single cluster mutants showed normal morphology but reacted differently to pressure overload. [score:2]
Arrest of heart development at E10.5 and reduced diameter of the compact layer of the ventricular wall in miR-1/133a d KO embryos are clearly visible. [score:2]
Additional RT-PCR based Taqman assays designed to detect pri-miR-1-1, pri-miR-1-2, pri-miR-133a-2, and pri-miR-133a-1 unveiled increased expression of all pri-miRNAs (Fig. 8A) indicating that both miR-1/133a clusters are activated by myocardin. [score:2]
Interestingly, we found a significant reduction of the ejection fraction in miR-1-1/133a-2 knockout mice while miR-1-2/133a-1 mutants maintained the same normal ejection fraction as wildtype controls indicating that individual miR-1/133a clusters contribute differently to cardiac remo deling in response to pressure overload (Fig. 1F). [score:2]
1003793.g003 Figure 3Loss of miR-1/133a leads to aberrant heart development and causes embryonic lethality. [score:2]
Loss of miR-1/133a leads to aberrant heart development and causes embryonic lethality. [score:2]
Intriguingly, the genetic linkage of miR-1 and miR-133a allows concomitant regulation of both genes by myocardin thereby including miR-133a into the negative feedback loop constituted by miR-1 and myocardin. [score:2]
Expression of miRNAs was quantified using FAM labeled TaqMan microRNA Assays (miR-1: #002222, miR-133a: #002246). [score:2]
The miR-1/133a d KO phenotype differs significantly from the previously described defect of miR-133a d KO mice, which becomes apparent only at later stages [15] suggesting fundamentally different mechanisms. [score:1]
In the mammalian genome, two distinct gene clusters code for miR-1 and miR-133a. [score:1]
Potential overlapping functions of miR-133a-1 and miR-133a-2 have been investigated by deletion of miR-133a coding regions without impairing miR-1 expression. [score:1]
The lack of gross morphological abnormalities after genetic inactivation of single miR1-1/miR-133a gene cluster mutants seems to indicate redundant functions but does not rule out a differential requirement of individual miR-1/133a gene clusters under specific conditions. [score:1]
No compound homozygous miR-1-1/133a-2//miR-1-2/133a-1 mutant mice were recovered at the newborn stage while the number of miR-1/133 d KO embryos matched the expected frequencies until E11.5. [score:1]
Fig. S10A) providing a convincing molecular explanation for the similarity of miR-1/133a d KO and myocardin-transgenic heart phenotypes. [score:1]
To further validate these findings, we transfected miR-1, miR-133 or control miRNA into isolated embryonic cardiomyocytes. [score:1]
Table S2 Deletion of both miR-1/133a clusters leads to embryonic lethality. [score:1]
” Figure S1 Deletion of miR-1/133a coding clusters on mouse chromosome 2 and chromosome 18. [score:1]
The complete loss of miR-1/133a did not interfere with formation of the primary heart tube but affected maturation and further specification of embryonic cardiomyocytes during expansion of the compact layer of the myocardium. [score:1]
In the mammalian genome two distinct gene clusters located on two different chromosomes encode miR-1 and miR-133a: the miR-1-1/133a-2 and the miR-1-2/133a-1 cluster. [score:1]
1003793.g001 Figure 1Deletion of single miR-1/133a clusters does not cause gross morphological alterations in the heart but results in decreased ejection fraction in miR-1-1/133a-2 mutants after TAC. [score:1]
Since, we found a miR-1 binding site located within the ORF region of BMP-10 mRNA, which is able to repress BMP-10 mRNA as indicated by luciferase reporter assays in vitro, it seems likely that miR-1 directly represses BMP-10 in vivo (Suppl. [score:1]
Transcriptome analysis of myocardin transgenic hearts revealed additional similarities between miR-1/133a d KO and myocardin-transgenic hearts. [score:1]
Our results suggest that miR-1 is one of the postulated negative factors restricting myocardin activity in cardiomyocytes. [score:1]
Figure S2 Deletion of single miR-1/133a genomic clusters does not lead to gross morphological alterations in heart and skeletal muscle. [score:1]
Our analysis suggested that the loss of miR-1 mediated repression of myocardin initiates a cascade of molecular events that is responsible for many aspects of miR-1/133a d KO phenotype. [score:1]
Mice mutant for single miR-1/133a cluster were born at the expected Men delian ratio and were viable with survival rates identical to WT littermates (Suppl. [score:1]
Transfection of miR-1 or of scrambled control (scr) into embryonic cardiomyocytes confirms miR-1 mediated repression of endogenous myocardin transcripts (qRT-PCR; G) and of myocardin protein (Western Blot; H, H′). [score:1]
Importantly, we identified a strong enrichment of terms associated with cardiomyocyte and smooth muscle cell differentiation suggesting that miR1/133a repress genes involved smooth/striated muscle differentiation. [score:1]
Deletion of single miR-1/133a clusters does not cause gross morphological alterations in the heart but results in decreased ejection fraction in miR-1-1/133a-2 mutants after TAC. [score:1]
Next, we analyzed heart functions of single miR-1/133a cluster mutants by cardiac magnetic resonance imaging (MRI) both under baseline condition and after pressure overload induced by transverse aortic constriction (TAC). [score:1]
A third miRNA cluster on mouse chromosome 1, related to miR-1/miR133a, encodes for miR-206 and miR-133b. [score:1]
70%-confluent HEK293 cells were transfected with 50 ng of the respective plasmid/24-well with or without 50 pmol of miRIDIAN microRNA mimic miR-1 or miR-133a (Thermo) using Lipofectamine 2000 (Invitrogen). [score:1]
We observed that miR-1/133a d KO cardiomyocytes failed to get rid of their hybrid smooth muscle/cardiomyocyte phenotype and did not acquire a more mature cardiomyocyte-specific identity. [score:1]
Table S1 Deletion of single miR-1/133a gene clusters does not lead to embryonic lethality. [score:1]
Figure S5 Loss of miR-1/133a leads to reduced proliferation rates in embryonic hearts. [score:1]
Interestingly, we found a strong induction of mature miR-1/133a levels (Fig. 7O). [score:1]
[1 to 20 of 143 sentences]
3
[+] score: 405
qPCR of miR-1 candidate target genesmiRNAs are thought to impact gene regulation by targeting mRNAs for degradation via complete sequence matches or inhibition of translation when there is imperfect binding between a miRNA and its target sequence (Djuranovic, Nahvi & Green, 2011). [score:12]
As miR-1 has multiple experimentally validated targets from this study (Ets1, Met, Bag4) and from published studies (MET, PTK1, HDAC4, ANXA2, BDNF and FOXP1) that have roles in tumorigenesis, it is likely that miR-1’s ability to reduce the expression of many tumor promoting genes could have a global influence on the suppression of tumor development (Nasser et al., 2008; Datta et al., 2008; Yan et al., 2009; Reid et al., 2012). [score:8]
In cell lines, miR-1 expression is correlated with decreased Met1 and Bag4 expression and directly targets the oncogene Ets1. [score:8]
Consistent with their down-regulation in tumors, numerous studies have demonstrated tumor suppressor functions of miR-1. Increased expression of miR-1 in vitro has been associated with increased apoptosis, decreased migration and decreased cell growth (Hudson et al., 2012; Wei et al., 2012; Yamasaki et al., 2012; Yoshino et al., 2012). [score:8]
Evaluation of Ets1 as a miR-1 targetmRNA expression data is only correlative and does not show a direct effect of miRNAs on predicted target gene expression. [score:8]
Furthermore a construct containing mutated miR-1 binding sites did not show reduced luciferase expression providing additional evidence that miR-1 regulates Ets1 expression via direct binding to the predicted miR-1 binding sites in the Ets1 3’UTR (Fig. 4C). [score:7]
We also observed decreased mRNA expression of previously described human miR-1 targets, Met, Twf1, and Ets1, in the mouse which establishes that miR-1 targets these mRNAs in more than one species. [score:7]
Most of the published studies on miR-1 have been in human cancers and using human cell lines and it is possible that miR-1 has unique targets in the mouse which confer tumor suppressor activities that ameliorate some of the effects of silencing target oncogenes. [score:7]
To identify putative targets of miR-1, miR-133a, miR-124a-3, miR-134, and miR-206, we searched the literature to identify targets of these miRNAs that had been detected by expression arrays in tumors and had been further validated by other methods. [score:7]
We chose miR-1 for expression studies in mouse cSCCs to test our hypothesis because it showed a significant difference in expression between FVB/NJ and SPRET/EiJ for six probes on the array and showed a significant difference in expression by qPCR (Table 1). [score:7]
In addition, there was evidence from the literature showing down-regulation of miR-1 in a variety of human cancers and a link between miR-1 down-regulation and cancer phenotypes (Nasser et al., 2008; Datta et al., 2008; Yan et al., 2009; Nohata et al., 2012a; Nohata et al., 2012b). [score:7]
Furthermore, we show that Bag4, a novel miR-1 target, is significantly down-regulated in the B9 cell line. [score:6]
As this could be an indirect effect of miR-1 expression, we assessed the effect of miR-1 expression on a luciferase construct containing the 3’UTR of Ets1. [score:6]
Here, we describe the effects of expressing miR-1 in cSCC cells and the identification of Ets1, as a miR-1 target in the mouse. [score:5]
mRNA expression of predicted targets of miR-1 (A) Met, (B) Ets1, (C) Twf1 and (D) Bag4 were assessed by qPCR. [score:5]
By qPCR, two of the candidate targets, Ets1 and Met, and our positive control Twf1 showed significant down-regulation in miR-1 transfected A5 cells compared to scrambled miR precursor transfected cells at both 48 and 72 h post-transfection (Fig. 3 and Fig. S1, Met p-values 0.0001 and 0.002; Ets1 p-value = 0.0001 and 0.0002; Twf1 p-values = 0.0001 and 0.006 respectively). [score:5]
This is the first study to show that mouse Ets1, like the human ETS1 gene, is targeted by miR-1. Our studies showing similar miR-1 targets between the mouse and human suggest that mouse mo dels of miR-1 may be useful in elucidating the role of miR-1 in cancer. [score:5]
Based on these, we anticipated that expression of miR-1 in cSCC cells would have tumor suppressing abilities (Nohata et al., 2012b). [score:5]
These candidate target genes were prioritized based on our database searches and those which had been validated in the literature as being targets of miR-1 in studies of primary human tumors or cancer cell lines. [score:5]
We chose seven putative miR-1 targets, Bag4, Ets1, Met, Sp1, Taok1, Trp53, and Zfp148, and one positive control, Twf1, which previously had been shown to be a miR-1 target by Applied Biosystems, for testing. [score:5]
Functional characterization of miR-1 expression miR-1 expression in cSCC cells decreases cell proliferationThere are several published studies showing in vitro and in vivo effects of miR-1 on tumor suppression (Nasser et al., 2008; Datta et al., 2008; Yan et al., 2009; Nohata et al., 2011; Nohata et al., 2012a; Nohata et al., 2012b). [score:5]
*, p-value < 0.01, **, p-value < 0.001, NS, not significant (A) of Ets1 expression 24, 48 and 72 h after transient transfection of A5 with scrambled control miR (SC) or miR-1. (B) of Ets1 expression 24, 48 or 96 h after transient transfection of B9 with SC or miR-1. Gapdh was used as a loading control. [score:5]
However, many of the targets tested in our study that have been reported to have oncogenic properties, such as Bag4, Ets1 and Met, showed decreased expression in A5 and/or B9 cells following miR-1 transfection. [score:5]
68/supp-2 Figure S2Ets1 levels following miR-1 transfection b. (A) of Ets1 expression 24, 48 and 72 h after transient transfection of A5 with scrambled control miR (SC) or miR-1. (B) of Ets1 expression 24, 48 or 96 h after transient transfection of B9 with SC or miR-1. Gapdh was used as a loading control. [score:5]
The remaining targets did not show statistically significant differences in expression between control and miR-1 A5 transfected cells (data not shown). [score:5]
**, p-value < 0.01. miR-1 expression in cSCC cells decreases cell proliferationThere are several published studies showing in vitro and in vivo effects of miR-1 on tumor suppression (Nasser et al., 2008; Datta et al., 2008; Yan et al., 2009; Nohata et al., 2011; Nohata et al., 2012a; Nohata et al., 2012b). [score:5]
Thus, we may have missed critical tumor suppressing targets of miR-1 through this approach. [score:5]
First, these cell lines may not be as responsive to the effects of miR-1 because they lack high expression levels of targets. [score:5]
We show evidence that miR-1 expression is decreased in cSCCs and that its expression in vitro leads to decreased proliferation of cSCC cell lines, increased apoptosis and modest effects on cell cycle. [score:5]
Initial studies on miR-1 focused on its expression in heart and skeletal muscle as it was thought not to be expressed in other tissues. [score:5]
Bag4 mRNA expression was significantly reduced in B9 cells transfected with miR-1 at all three time points (Fig. S1; 48 h p-value = 0.0007, 72 h p-value = 0.02 and 96 h p-value = 0.004), but it only showed significant down-regulation of mRNA at 72 h in A5 cells transfected with miR-1 compared to scrambled control cells (Fig. 3D and Fig. S1, p-value = 0.01). [score:5]
Fold mRNA expression of predicted targets of miR-1 (A) Met, (B) Ets1, (C) Twf1 and (D) Bag4 were assessed by qPCR. [score:5]
Our results showed decreased Met mRNA expression in cells transfected with miR-1, but observed no correlation between miR-1 expression and cell motility. [score:5]
Based on our observations and reports in the literature supporting miR-1 as having tumor suppressor function in a variety of cancer types (Nasser et al., 2008; Datta et al., 2008; Yan et al., 2009; Li et al., 2012; Hudson et al., 2012; Nohata et al., 2011; Nohata et al., 2012a; Nohata et al., 2012b; Tominaga et al., 2013), we hypothesized that miR-1 acts as a tumor suppressor in cutaneous squamous cell carcinoma (cSCC). [score:5]
The median miR-1 expression was lower in the tumors (3% of control sno-202) compared to median miR-1 expression in FVB/NJ (22% of control sno-202) and SPRET/EiJ (110% of control sno-202). [score:4]
In B9 miR-1 transfected cells Met showed significantly decreased expression only at 48 h (p-value = 0.001), and Ets1 showed significantly decreased expression at 48 and 72 h post-transfection compared to scramble miR control transfected cells (p-values 0.008 and 0.005 respectively). [score:4]
miR-1 expression resulted in lower luciferase expression with the wildtype Ets1 3’UTR compared to a scrambled precursor miRNA. [score:4]
Consistent with a role for miR-1 in dysregulation of Ets1 in cancer, a study published after we chose Ets1 as a candidate showed that Ets1 is targeted by miR-1 in HepG2 cells (Wei et al., 2012). [score:4]
68/supp-1 Figure S1Candidate miR-1 target genes in B9. [score:3]
As the endogenous expression of miR-1 differs between skin cancer susceptible and cancer resistant mice, it may play a role in the differences in cancer risk observed in these strains, but the exact mechanism remains to be elucidated. [score:3]
Ectopic expression of miR-1 has also been shown to induce G0/G1 arrest in several different cancer cell lines (Nohata et al., 2012b). [score:3]
68/fig-2 Figure 2Decreased miR-1 expression in cSCCs. [score:3]
miR-1 was also found to target c-Met in rhabdomyosarcomas and colorectal cancer leading to decreased cell motility and proliferation (Yan et al., 2009; Reid et al., 2012). [score:3]
Site-directed mutagenesis was carried out to mutate two base pairs in each of the three miR-1 binding sites in the Ets1 3’UTR using QuikChange Lightning Multi Site-Directed Mutagenesis kit according to the manufacturer’s protocol (Agilent Technologies, Santa Clara, CA). [score:3]
Candidate miR-1 target genes in B9. [score:3]
As Ets1 had not been confirmed as a target of miR-1 in the mouse, and since several studies support a role of Ets1 in cSCC and cancer phenotypes such as metastasis, apoptosis and proliferation, we decided to further evaluate murine Ets1 as a miR-1 target (Keehn, Smoller & Morgan, 2004; Hahne et al., 2009; Nagarajan et al., 2009). [score:3]
qPCR of miR-1 candidate target genes. [score:3]
By Western, Ets1 was down-regulated in the miR-1 transfected A5 cells at 24, 48 and 72 h post-transfection and in B9 cells at 48 and 96 h post-transfection compared to scramble control miR transfected cells (Figs. 4A and 4B; Fig. S2). [score:3]
miR-1, along with miR-133a, miR-205 and let-7d, showed decreased expression in SCCs of the head and neck in comparison to normal adjacent tissue (Childs et al., 2009). [score:3]
RNA was isolated from a duplicate well for each mock, scrambled control or miR-1 transfected experiment to confirm increased miR-1 expression in the miR-1 transfected cells. [score:3]
Five of the six miRNAs evaluated showed similar fold-differences in expression between microarray and qPCR for FVB/NJ and SPRET/EiJ skin (Fig. 1 and data not shown); however, only miR-1, miR-133a and miR-206 showed statistically significant differences in expression by qPCR (p-value < 0.05). [score:3]
miR-1, miR-133a, and miR-206 are all part of a group of myo-miRs, miRNAs whose expression is enriched in skeletal and cardiac muscle (McCarthy, 2008). [score:3]
A nonparametric Mann-Whitney U test was performed to test for differences between miR-1 expression in tumors versus SPRET/EiJ and FVB normal skin. [score:3]
Our positive control, Twf1, showed decreased expression in miR-1 transfected B9 cells at 48, 72 and 96 h (p-values = 0.0004, 0.0002 and 0.03 respectively). [score:3]
In more detailed analyses of one miRNA, miR-1, we show that miR-1 expression leads to decreased cell proliferation which may be the result of modestly higher apoptosis in later time points (72 or 96 h) in combination with a reduced number of cells in S phase. [score:3]
There are several published studies showing in vitro and in vivo effects of miR-1 on tumor suppression (Nasser et al., 2008; Datta et al., 2008; Yan et al., 2009; Nohata et al., 2011; Nohata et al., 2012a; Nohata et al., 2012b). [score:3]
Some miR-1 oncogene-like targets have been identified that were not evaluated for expression in our cells. [score:3]
Our data is consistent with a publication showing Ets1 to be a target of miR-1 in a human liver cancer cell line (Wei et al., 2012). [score:3]
qPCR for miR-1 expression was conducted as described above. [score:3]
The effect of miR-1 expression on additional tumor phenotypes. [score:3]
Targets for miR-1 were prioritized for further study by the number of predicted binding sites per 3’UTR (>1 site), strength of binding score, and predicted binding of the miRNA in both human and mouse. [score:3]
To measure expression of predicted targets, mRNA expression was measured at 48 and 72 h post miR-1 or scrambled precursor miR negative control transfection in A5 cells and at 48, 72 and 96 h post-transfection in B9 cells using SYBR green quantitative real-time PCR. [score:3]
The effect of miR-1 expression on additional tumor phenotypes miR-1 has been shown to induce apoptosis in multiple cancer cell lines including maxillary sinus SCC, head and neck SCC, and renal cell carcinoma (Nohata et al., 2011; Kawakami et al., 2012; Nohata et al., 2012a; Nohata et al., 2012b). [score:3]
In this study, we identified a correlation with proliferation and miR-1 expression levels which is consistent with other studies (Yan et al., 2009; Reid et al., 2012). [score:3]
Following analysis, six miRNAs (miR-1, miR-133a, miR-124a-3, miR-134, miR-206, and miR-9-1) showed a significant difference in average expression and had a 2.0 fold or greater difference across one or more probe sets. [score:3]
miR-1 expression following transfection was confirmed for all phenotypic experiments by qPCR and is below detectable limits for the mock or scrambled control transfected A5 and B9 cell lines. [score:3]
Western blot analysis of Ets1 expression (A) 72 h after transient transfection of A5 cells with scrambled control miR (SC) or miR-1 and (B) 48 h after transient transfection of B9 cells with (SC) or miR-1. alpha-tubulin (A5) or Gapdh (B9) was used as a loading control. [score:3]
Based on the expression data in the primary tumors and the strain specific differences in expression, we chose miR-1 as a strong candidate miRNA to evaluate further for a role in cSCC. [score:3]
miRNA-1 expression decreased in mouse cSCCs. [score:3]
Decreased miR-1 expression has been observed in a number of cancers including skin, lung, liver, bladder, renal and prostate (Li et al., 2012; Hudson et al., 2012; Nohata et al., 2012a; Tominaga et al., 2013; Nohata et al., 2012b). [score:3]
68/fig-3 Figure 3Validation of candidate miR-1 target genes by qPCR. [score:3]
miR-1 expression in cSCC cells decreases cell proliferation. [score:3]
Decreased miR-1 expression in cSCCs. [score:3]
org were searched for predicted mRNA targets for miR-1 in both mouse and human. [score:3]
A few studies have looked at miRNA expression in human cSCCs, but beyond miR-1 none of the miRNAs identified in those studies overlap with the ones identified here (Dziunycz et al., 2010). [score:3]
68/fig-6 Figure 6Effect of miR-1 expression on tumor phenotypes. [score:3]
Another weakness of this study was that candidate targets of miR-1 were chosen based on the literature and predicted in silico screens rather than experimentally. [score:3]
We first assessed whether Ets1 protein levels were decreased by miR-1 expression. [score:3]
Validation of candidate miR-1 target genes by qPCR. [score:3]
From these data, we expected that miR-1 expression would be decreased in mouse cSCCs. [score:3]
**, p-value < 0.01. of Ets1 expression (A) 72 h after transient transfection of A5 cells with scrambled control miR (SC) or miR-1 and (B) 48 h after transient transfection of B9 cells with (SC) or miR-1. alpha-tubulin (A5) or Gapdh (B9) was used as a loading control. [score:3]
Our data suggests that Bag4 may also be a target of miR-1 which is a novel finding. [score:3]
Effect of miR-1 expression on tumor phenotypes. [score:3]
Our positive control for miR-1 transfection, Twf1, also belongs to the family of PTKs regulated by Ets1. [score:2]
In cardiomyocytes miR-1 regulates apoptosis via Bcl-2 and IGF-1 (Yu et al., 2008; Tang et al., 2009). [score:2]
We observed a significant decrease of 1.7-fold in absorbance at 96 h post-transfection in A5 miR-1 transfected cells compared to the scrambled control miR transfected cells suggesting that miR-1 is playing a role in growth inhibition (Fig. 5A, 72 h p-value = 0.01; 96 h p-value = 0.0001). [score:2]
A5 and B9 cells were transfected with miR-1, scrambled miR control or mock transfected. [score:1]
Ets1 levels following miR-1 transfection b.. [score:1]
In skeletal muscle, miR-1 has a role in cellular proliferation and differentiation (Chen et al., 2006). [score:1]
miR-1 expression was measured in eleven mouse cSCCs and six normal mouse skin RNA samples (3 FVB/NJ and 3 SPRET/EiJ) by qPCR relative to control gene sno-202. [score:1]
Another possible explanation for the discordant results is that we evaluated the effects of miR-1 expression in mouse and not human cell lines. [score:1]
To determine if miR-1 decreased cell proliferation, we transfected A5 and B9 cSCC cells with miR-1 or scrambled precursor miRNA. [score:1]
A5 cells transfected with a scrambled control miR (SC) are shown in black and A5 cells transfected with miR-1 are shown in gray. [score:1]
B9 cells transfected with a scrambled control miR (SC) are shown in black and B9 cells transfected with miR-1 are shown in gray. [score:1]
A 1,278 base pair product was generated containing the predicted three miR-1 binding sites and was cloned into a pGL3 Control Luciferase vector (Promega, Madison, WI). [score:1]
68/fig-4 Figure 4Evaluation of Ets1 as a miR-1 target. [score:1]
There was a trend for a modest increase in cells in G0/G1 for miR-1 transfected A5 cells at all time points, but this was only significant at 48 h post-transfection (p-value = 0.04); Fig. 6C. [score:1]
The B9 cells showed a statistically significant decrease in apoptosis in the miR-1 transfected cells at 48 h (p-value = 0.04) and a statistically significant increase in apoptosis at 72 h (p-value = 0.003). [score:1]
We observed significantly decreased cell proliferation in the A5 miR-1 transfected cells at 96 h post-transfection (p-value, < 0.0001) and for the B9 miR-1 transfected cells at 72 h post-transfection (p-value < 0.01). [score:1]
Previous studies have reported a role of miR-1 in migration. [score:1]
The percentage of apoptotic cells staining positive for AnnexinV and propidium iodide is indicated in scrambled control (SC) (black) and miR-1 transfected cells (gray) for representative experiments is shown. [score:1]
These results suggest that miR-1 may have an extremely modest effect on cell cycle progression resulting in fewer cells in S phase. [score:1]
Shown is a representative sample at 72 h post-transfection for the A5 (A) SC and (B) miR-1 transfected cells and for the B9 (C) SC and (D) miR-1 transfected cells. [score:1]
There was a trend for more cells in G2-M in the miR-1 transfected cells for both A5 and B9 for some time points (Fig. 6 and Fig. S4), but the absolute differences are quite small and were not significant except for the miR-1 transfected B9 cells at 48 h (p-value = 0.02), Fig. 6F. [score:1]
No consistent differences were observed in cell motility between miR-1 and scrambled control miR transfected cells for any of the time points (Fig. 7 and Fig. S5 and data not shown). [score:1]
To determine if the decreased proliferation seen in the cells transfected with miR-1 was the result of increased apoptosis, we performed FACS analysis of AnnexinV and PI stained miR-1 transfected and scramble control miR transfected A5 and B9 cells. [score:1]
Effect of miR-1 on cell motility. [score:1]
At 24 h post-transfection with miR-1, scrambled miR control or mock transfected, A5 and B9 cells were trypsinized and 2000 cells (A5) or 3000 cells (B9) were plated in quadruplicate in a 96-well plate. [score:1]
Functional characterization of miR-1 expression. [score:1]
miR-1 reduces cell proliferation in vitro. [score:1]
All of these functions are also important in tumorigenesis and are consistent with a role for miR-1 in cancer. [score:1]
This is not the first study to look at the role of miR-1 in the skin or in SCCs. [score:1]
Transfections of A5 and B9 cells included mock transfection, scrambled miR control (AM17110) or miR-1 precursor (AM17150) as described above. [score:1]
qPCR of miR-1 levels from eleven primary mouse cSCCs was conducted as for normal skin. [score:1]
Black diamond, scrambled control miR transfected; gray square, miR-1 transfected; *, p-value < 0.01; ***, p-value < 0.0001. [score:1]
Cell motility for miR-1 and SC transfected B9 cells are shown for 0, 8, 11, and 13 h after removal of insert at approximately (A) 48 h (B) 72 h, (C) or 96 h after transfection. [score:1]
At 70% confluency, 0.10 µg Luc- Ets1 3’UTR and Luc- Ets1 3’UTR-mutated were each co -transfected with 10 pmol of a scrambled control miR or miR-1 into each well. [score:1]
Effects of miR-1 on B9 cell motility. [score:1]
Evaluation of Ets1 as a miR-1 target. [score:1]
By array analysis, miR-1 showed about a 2-fold down regulation in human cSCCs compared to matched normal skin (Darido et al., 2011). [score:1]
Scrambled pre-miR (AM17110) negative control and miR-1 (AM17150) precursor were purchased from Ambion (Life Technologies, Grand Island, NY). [score:1]
To evaluate miR-1 expression in cSCC, we performed qPCR of miR-1 in eleven cSCCs isolated from DMBA/TPA chemically -treated C57Bl6/FVB mice. [score:1]
Cell motility for miR-1 and scrambled control (SC) transfected A5 cells are shown for indicated time points after removal of insert at approximately (A) 48 (B) 72 h or (C) 96 h after transfection. [score:1]
In contrast to previous studies we observed only modest effects of miR-1 on apoptosis and cell cycle and did not observe any consistent effects on migration. [score:1]
Finally, we observed no significant differences in cell motility of miR-1 transfected A5 or B9 cells. [score:1]
68/fig-7 Figure 7Effect of miR-1 on cell motility. [score:1]
A5 and B9 cells transfected with miR-1 or scrambled miR control were trypsinized and counted at 48, 72 and 96 h post-transfection. [score:1]
68/supp-5 Figure S5Effects of miR-1 on B9 cell motility. [score:1]
Black diamond, scrambled control miR transfected; gray square, miR-1 transfected; *, p-value < 0.01; ***, p-value < 0.0001. miR-1 has been shown to induce apoptosis in multiple cancer cell lines including maxillary sinus SCC, head and neck SCC, and renal cell carcinoma (Nohata et al., 2011; Kawakami et al., 2012; Nohata et al., 2012a; Nohata et al., 2012b). [score:1]
Probes were specific to either mature (miR-1, miR-133a, miR-124a-3, miR-206) or precursor (miR-134, miR-206, miR-9-1) miRNAs concordant with the array results. [score:1]
Additional studies are warranted to further evaluate Bag4 as a miR-1 target and any role it may have in cSCC. [score:1]
[1 to 20 of 131 sentences]
4
[+] score: 379
Other miRNAs from this paper: mmu-mir-1a-2, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-1b
In this study, we demonstrated that ADAM9 repressed miR-1. Inhibition of ADAM9 protein expression or protease activity rescued miR-1 suppression and down-regulated expression of its target CDCP1 in lung cancer cells. [score:14]
To explore whether metalloproteinase activity is important for miR-1 suppression in lung cancer cells, we treated the cells with the broad-spectrum metalloproteinase inhibitor BB94, which has been demonstrated to suppress ADAM9 expression [3], and then detected the expression levels of CDCP1 and miR-1 by quantitative reverse transcription- PCR. [score:11]
Using histone deacetylase inhibitors or ectopic expression of tumor suppressor C/EBPα (a member of the basic leucine zipper family of transcription factors) can re-activate miR-1 expression in lung cancer cells [12]. [score:9]
Among these 505 lung adenocarcinoma samples, cancer samples in which miR-1 expression was lower than the mean miR-1 expression of normal samples were defined as “miR-1 low” samples (n = 469); likewise, cancer samples in which miR-1 expression was higher than the mean miR-1 expression of normal samples were defined as “miR-1 high” samples (n = 36). [score:9]
In this study, we showed that ADAM9 enhances CDCP1 expression by suppressing miR-1. Manipulating the dysregulated miRNA by targeting the ADAM9-CDCP1 axis can affect the progression of lung cancer. [score:8]
Ectopic miR-1 expression reduced the tumorigenic properties and induced apoptosis of cancer cells, suggesting that miR-1 re -expression therapy is a potential strategy for suppressing oncogenes and arresting tumor development. [score:8]
We found that miR-1 expression is increased in ADAM9-knockdown cells over time in serum free culture, but that enhancement was not found in control cells, which suggests other factors or pathways are also likely to regulate miR-1 expression in ADAM9-knockdown cells. [score:8]
Suppression of ADAM9 decreases CDCP1 expression but increases miR-1 expression. [score:7]
As shown in Figure 8D, our mo del suggests that ADAM9 promotes CDCP1 expression by inhibiting miR-1 expression via activation of EGFR signaling. [score:7]
CDCP1 is a target of miR-1. Overexpression of miR-1 decreased CDCP1 protein expression and prolonged survival time in mice bearing lung tumors. [score:7]
Although miR-1 is predominantly expressed in cardiac tissue and smooth and skeletal muscle [26], recent studies have revealed that miR-1 expression is often repressed in various types of cancer [27] and demonstrated therapeutic potential by targeting several oncogenes [28]. [score:7]
To further examine whether miR-1 reduces CDCP1 protein expression via targeting the CDCP1 3′-UTR, and whether this inhibition influences cell migration, we transiently transfected a miR-1 mimic oligomers into Bm7 cells. [score:7]
Expression of miR-1 was suppressed in lung tumor specimens, but increased in ADAM9-knockdown lung cancer cells. [score:6]
These results demonstrated that, regardless of the site, mutations in the CDCP1 3′-UTR or miR-1 relieved the suppression of translation. [score:6]
Because miR-1 was predicted to target CDCP1, we explored whether miR-1 can directly bind to the CDCP1 3′-UTR and inhibit CDCP1. [score:6]
Taken together, these results demonstrate that miR-1 expression is inhibited in lung cancer cells and can be restored in lung cancer cells by ADAM9 knockdown. [score:6]
To determine whether miR-1 is dysregulated in lung cancer, we examined the endogenous expression levels of miR-1 in 10 primary clinical lung tumor specimens and found that most (80%) tumor samples exhibited lower expression levels of miR-1 than their normal counterparts (Figure 1C). [score:6]
Figure 8(A) Gene Set Enrichment Analysis (GSEA) showed enrichment of the TCGA lung adenocarcinoma dataset with EGFR signaling up-regulation-responsive genes (n = 18) expressing lower levels of miR-1. NES, normalized enrichment score; FDR, false discovery rate. [score:6]
In our study, we found that ADAM9 dysregulates several miRNAs, such as miR-218 and miR-1, the top two miRNAs targeting the CDCP1 3′-UTR for reducing CDCP1 protein expression. [score:6]
Upon EGF stimulation, miR-1 expression was significantly suppressed in both control and ADAM9-knockdown cells (unicolor filled bars). [score:6]
Next, we examined whether EGFR signaling regulates miR-1 expression over time in lung cancer cells treated with EGF or EGFR inhibitor. [score:6]
Furthermore, we examined the relative endogenous expression levels of miR-1 in cancer tissues with an up- or down-regulated EGFR signaling gene signature. [score:6]
Down-regulation of miR-1 led to CDCP1 overexpression, promoting the malignancy of lung cancer cells. [score:6]
Under starvation and without any treatment, miR-1 expression was increased in ADAM9-knockdown cells at time 0 (Figure 7D) and miR-1 expression increased over time compared to control shGFP cells (Figure 7E, open bars). [score:5]
ADAM9 suppresses miR-1 expression in lung cancer cells. [score:5]
Figure 5(A, B) Relative CDCP1 RNA expression in CL1-0 cells (A) and A549 cells (B) with miR-1 inhibitor treatment. [score:5]
Figure 3 CDCP1 is a target of miR-1(A) Schematic representation of miR-1 targeting the CDCP1 3′-UTR. [score:5]
Notably, miR-1 -mediated tumor suppressor effects are similar to the effect of histone deacetylase inhibitors. [score:5]
Moreover, miR-1 represses genes such as PNP (purine nucleoside phosphorylase) and PTMA (prothymosin-α), leading to down-regulation of pathways regulating the cell cycle, mitosis, DNA replication, and actin dynamics in prostate cancer [30– 32]. [score:5]
Figure 2Negative correlation between CDCP1 and miR-1 in lung cancer cells treated with BB94, a broad-spectrum inhibitor of metalloproteases(A, B) Quantitative RT-PCR analysis of CDCP1 expression in A549 cells (A) or Bm7brm cells (B) treated with different doses of BB94. [score:5]
Treatment with miR-1 inhibitor increased CDCP1 expression and tumor cell mobility. [score:5]
ADAM9 and CDCP1 were reported to show increased expression in cells with progressive migration ability (CL1-0 < F4 < Bm7brm) from the same original tumor [3]; we found that miR-1 expression was lower in the lung cancer cells with greater migration (Figure 1G). [score:5]
Therefore, dysregulation of miR-1 expression may be important for tumor development. [score:5]
High levels of CDCP1 were detected in F4 cells overexpressing CDCP1 without 3′-UTR, but these were slightly reduced when cells were co-expressed with miR-1 mimic (Figure 4C). [score:5]
Since the EGFR has been reported to promote prostate cancer metastasis to bone by down -regulating miR-1 [19], we further investigated whether ADAM9 may suppress miR-1 expression by activating EGFR signaling. [score:4]
The GSEA results showed that EGFR signaling up-regulation-responsive genes were correlated with “miR-1 low” cancer samples (Figure 8A). [score:4]
The stimulation of ectodomain shedding of pro-EGFR ligands by ADAM9 results in the activation of EGFR signaling, which represses miR-1 transcription and reduces its negative regulation of CDCP1 expression. [score:4]
Conversely, EGFR signaling down-regulation-responsive genes were correlated with “miR-1 high” cancer samples (Figure 8B). [score:4]
These results indicate that miR-1 regulates CDCP1 protein expression and influences cell migration. [score:4]
Down-regulation of miR-1 has been detected in lung cancer [12] and hepatocellular carcinoma specimens [13] using methylation -mediated silencing of the miR-1 gene. [score:4]
ADAM9 knockdown reduced EGFR signaling and increased miR-1 expression. [score:4]
As shown in Figure 8C, the endogenous levels of miR-1 were significantly (P < 0.05) higher in samples with a down-regulated EGFR signaling gene signature. [score:4]
Aberrant expression of miRNAs, such as miR-1, has been detected in various types of clinical tumor specimens and cancer cell lines, and may be correlated with cancer development. [score:4]
Negative correlation between CDCP1 and miR-1 in lung cancer cells treated with BB94, a broad-spectrum inhibitor of metalloproteases. [score:3]
miR-1 directly regulates CDCP1. [score:3]
Mutations in the miR-1 binding sites in the CDCP1 3′-UTR or in the primary miR-1 sequence were produced using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's protocol. [score:3]
Manipulating CDCP1 protein expression by miR-1 affects cell migration. [score:3]
Here, we demonstrated that miR-1 was regulated by ADAM9 and that miR-1 can directly bind to the 3′-UTR of CDCP1. [score:3]
A combination of low miR-1 and high PIK3CA expression was highly linked to recurrence in patients after surgery [29]. [score:3]
Negative association between EGFR signaling and miR-1 expression in TCGA lung adenocarcinoma. [score:3]
Restoration of miR-1 inhibits tumor cell mobility and improves animal survival. [score:3]
Thus, the results indicated that ADAM9 can reduce miR-1 levels and increase CDCP1 expression in lung cancer cells. [score:3]
When CL1-0 and A549 lung cancer cells were treated with a miR-1 inhibitor, both CDCP1 RNA levels (Figure 5A and 5B) and CDCP1 protein levels (Figure 5C and 5D) were dramatically increased. [score:3]
In addition, the migration ability of lung cancer Bm7 cells transfected with the miR-1 mimic was significantly inhibited (Figure 4B). [score:3]
Thus, our results demonstrate that miR-1 has an antitumor effect in inhibiting the metastasis of lung tumors and prolonging animal survival time. [score:3]
In lung cancer, ectopic expression of miR-1 reduced the protein levels of MET, Pim-1, FoxP1, and HDAC4 to influence the survival of cancer cells and oncogenic properties [12]. [score:3]
Furthermore, we performed nuclear/cytosol fractionation to investigate whether nuclear EGFR can act as a transcriptional repressor to suppress miR-1 expression [19]. [score:3]
The miR-1 mimic, miR-1 inhibitor, and negative control oligomers (Ambion, Austin, TX, USA) were transfected in cells as previously described [14]. [score:3]
In addition, a negative correlation between miR-1 and PIK3CA expression was detected in nearly 70% of non-small cell lung cancer specimens. [score:3]
However, in ADAM9-knockdown cells, Tarceva treatment only partly rescued miR-1 expression after 17 h, and miR-1 remained at relatively low levels compared to control cells (Figure 7E, bicolor bars). [score:3]
ADAM9 -mediated EGFR signaling reduces miR-1 expression. [score:3]
Quantitative examination of BB94 -dependent CDCP1 RNA and miR-1 expression showed a negative correlation between CDCP1 and miR-1 (correlation coefficient R = –0.86) (Figure 2E). [score:3]
However, the level of miR-1 expression did not correlate with the overall survival of lung adenocarcinoma patients from the TCGA dataset (Figure 1H). [score:3]
The CDCP1 binding sites, and the seed region or non-seed region of miR-1, were mutated to determine the effects on translation (Figure 3A). [score:3]
In contrast, miR-1 expression was significantly increased in lung cancer cells treated with BB94 (Figure 2C and 2D). [score:3]
Ectopic expression of miR-1 decreased cell survival and migration ability in lung cancer cells. [score:3]
Figure 6(A) Ectopic expression of pri-mir-1 in HEK 293 and F4 cells. [score:3]
In addition, the migration ability following miR-1 inhibitor treatment was significantly increased in CL1-0 cells (Figure 5E) and A549 cells (Figure 5F). [score:3]
To examine whether the restoration of miR-1 inhibits the tumorigenesis of cancer cells, we generated a construct by inserting the primary mir-1 (pri-mir-1) sequence behind the EmGFP gene sequence and found that the mature form of miR-1 was successfully processed when the construct was transfected into 293 and F4 cells (Figure 6A). [score:3]
This suggests that miR-1 can directly bind to the 3′-UTR of CDCP1 at two sites. [score:2]
The results showed that CDCP1 protein expression was decreased in miR-1 mimic -treated cells compared to negative control treatment (Figure 4A). [score:2]
miR-1 mutations at seed or non-seed sites are marked with red letters and underlines. [score:2]
After further excluding 176 cancer samples containing both up- and down-regulated EGFR signaling gene signatures, the endogenous level of miR-1 in each group was calculated. [score:2]
Our results reveal a novel regulatory mechanism of miR-1 involved in the ADAM9-CDCP1 axis in lung adenocarcinoma. [score:2]
The results showed that miR-1 inhibited luciferase activity compared to the empty vector control (neg) in HEK 293 cells (Figure 3B), F4 cells (Figure 3C), and A549 cells (Figure 3D). [score:2]
The expression levels of miR-1 were detected 48 h after transfection and shown as the fold-change compared with the miR negative control. [score:2]
To further demonstrate that the reduction of cell migration by the miR-1 mimic was mediated by CDCP1, western blot analysis and cell migration assays were performed in F4 lung cancer cells overexpressing miR-1 mimic and/or CDCP1 lacking the 3′-UTR (Figure 4C and 4D). [score:2]
Notably, miR-1 expression was significantly decreased in recurrent tumors compared to primary tumors, suggesting that this miRNA is involved in tumor progression. [score:2]
In addition, cell survival was reduced in Bm7 lung cancer cells at 48 h after transfection with pri-mir-1 (Figure 6C). [score:1]
A consistent pattern of decreased CDCP1 in pri-mir-1 -transfected cells was observed in different lung cancer cell lines, such as Bm7, and H1299 (Figure 6B). [score:1]
Two potential miR-1 binding sites located at 2487–2508 bp (site WTD) and 2533–2554 bp (site WTE) from the transcription start site of CDCP1. [score:1]
Although cell migration was decreased by addition of the miR-1 mimic, the effect was lost in adding CDCP1 without the 3′-UTR (Figure 4D, bar 4). [score:1]
The primary sequence of miR-1, including the flanking precursor sequence (MI0000651), was amplified from human leukocyte DNA. [score:1]
Furthermore, the level of miR-1 was highest in normal lung tissue and dramatically decreased in primary and recurrent lung tumors from the TCGA dataset (Figure 1F). [score:1]
Figure 4(A) Western blot analysis of CDCP1 in Bm7 lung cancer cells treated with miR-1 mimic oligonucleotides. [score:1]
Additionally, seed or non-seed sequences are critical for binding of miR-1 to the 3′-UTR of CDCP1. [score:1]
Schematic representation of the pri-mir-1 construct is shown at the top. [score:1]
miR-1 promoter analysis and western blotting. [score:1]
Although miR-1 was not significantly negatively correlated with CDCP1 in this small cohort, we observed a significant reverse correlation between miR-1 and CDCP1 in lung adenocarcinoma from the TCGA dataset (Figure 1E). [score:1]
Restoring the miR-1 levels in lung cancer cells had an antitumor effect, as shown by decreasing cancer migration and metastasis. [score:1]
Arrows indicate the time points of pri-mir-1-liposome therapy. [score:1]
The miR-1 binding sites were predicted in the CDCP1 3′-UTR using miRSystem [16]. [score:1]
In order to understand the correlation between miR-1 and EGFR signaling activity in clinical lung cancer specimens, we utilized the lung adenocarcinoma cancer data set containing both mRNA and miRNA data from TCGA and performed a gene set enrichment analysis (GSEA) [20]. [score:1]
The two miRNAs showing the highest fold-change were miR-218 and miR-1, and because miR-218 was assessed in our previous report [15], miR-1 was selected for further analysis in this study. [score:1]
Thus, miR-1 shows potential as a therapeutic agent for lung cancer. [score:1]
We co -transfected the miR-1 plasmids (construct shown in Figure 6A) and different reporter constructs (as shown in Figure 3A) containing the CDCP1 3′-UTR following the luciferase gene into HEK 293 cells. [score:1]
Mutated sequences at these two miR-1 binding sites are marked with red letters. [score:1]
Two putative promoter regions upstream of the human primary miR-1-1 (pri-miR-1-1) and miR-1-2 (pri-miR-1-2) are known for encoding miR-1 transcripts [19]. [score:1]
DNA hypermethylation in the miR-1 gene silences miR-1 in colorectal cancers [33]. [score:1]
Furthermore, luciferase activity was not significantly reduced by miR-1 constructs with mutated binding sites (MTD and MTE; Figure 3B–3D) or by seed region or non-seed region mutants (Figure 3E). [score:1]
Two potential miR-1 binding sites on the CDCP1 3′-UTR were predicted at 2487–2508 bp and 2533–2554 bp from the transcription start site. [score:1]
Cancer cells (5 × 10 [4]) were intracardially injected into mice and then tumor-bearing mice were treated with 25 mg of pri-mir-1-liposome complexes by intravenous injection twice per week for 3 weeks. [score:1]
[1 to 20 of 102 sentences]
5
[+] score: 365
mRNA as well as protein expression of several previously described direct miR-1 or miR-133a target molecules was analyzed in heart tissue of WT and respective single miR-1/133a cluster knock-out animals to validate the regulation of these targets in our in vivo mo dels. [score:10]
0113449.g004 Figure 4 mRNA as well as protein expression of several previously described direct miR-1 or miR-133a target molecules was analyzed in heart tissue of WT and respective single miR-1/133a cluster knock-out animals to validate the regulation of these targets in our in vivo mo dels. [score:10]
The previously identified miR-1 target B56α was not upregulated at transcript-level nor on protein level and the miR-1 target Sorcin (SRI) was significantly more abundant only in miR-1-1/133a-2 mutant hearts. [score:8]
Of note Kcne1 was upregulated in both knock-out mo dels, however many other previously described miR-1 or miR-133a targets were not regulated after loss of roughly 50% miR-1 or miR-133a. [score:8]
Our unbiased analysis of transcriptional changes after mutation of single miR-1/133a clusters revealed the miR-1 target Sorcin [36] to be significantly upregulated at least in miR-1-1/133a-2 knock-out mice and we could confirm this finding at the protein level. [score:8]
Clearly, we observed upregulation of the miR-1 target gene Kcne1 in the miR-1/133a knock-out mice and confirmed that by qRT-PCR (Figure 4F). [score:7]
Although the miR-133a target SRF was increased in miR-133a double mutant hearts [6], it was not increased in embryonic hearts after complete deletion of miR-1/133a [7], indicating that there are also developmental stage specific components modulating miRNA mediated regulation of target protein abundance. [score:7]
We detected significant upregulation of the miR-1 target Kcne1 in both single cluster knock-out (F). [score:7]
In the heart of single cluster knock-out animals the miR-1 target myocardin was not upregulated at protein level (A) or mRNA level (C). [score:7]
We found Kcne1 upregulation in microarray experiments and qRT-PCR, however we did not detect KCNE1 protein expression in adult wildtype or miR-1/133a knock-out mouse cardiomyocytes. [score:7]
On the other hand, adenoviral overexpression [8] or increased expression of miR-1 or miR-133a in rabbit cardiomyocytes during chronic heart failure [9] have been linked to modulation of intracellular calcium release and promotion of arrhythmogenesis due to dysregulation of phosphatase activities. [score:6]
The miR-1 target connexin43 was significantly upregulated in only miR-1-1/133a-2 mutant hearts, corresponding to the more severe loss of miR-1 in this mo del (G). [score:6]
The miR-1 target myocardin, that is a SRF interacting transcriptional coactivator, was found to be increased after deletion of both miR-1/133a clusters in embryonic heart [7] or after complete deletion of both miR-1 copies in neonatal heart [5], but was not significantly upregulated in the adult single cluster mutant cardiomyocytes. [score:6]
Taken together, although we did not identify a single miR-1 or miR-133a target molecule responsible for the modulation of adrenergic signaling in our mo dels, numerous molecules related to this pathway are potential targets of miR-1/133a regulation. [score:6]
Unbiased transcriptome analysis did not reveal prominent changes in the expression of components of the adrenergic signaling cascade that may be target of miR-1 or miR-133a regulation (Table 2). [score:6]
We observed a downregulation of the previously described miR-1 target gene CAV1.2 (I, L). [score:6]
We did not find upregulation of the previously described miR-1 target IRX5 (H, J). [score:6]
Microarray analysis detected no significant upregulation of the previously described miR-1/133a targets connexin43/Gja1, Irx5 or Cav1.2, but qRT-PCR analysis with higher n-number revealed increased abundance of connexin43 by qRT-PCR in miR-1-1/133a-2 mutant mice (Figure 4G). [score:6]
Previously we have shown that the clustered miRNAs miR-1 and miR-133a act as functional units, with miR-1 negatively regulating the abundance of myocardin that in turn enhances the expression of the miR-1/133a clusters by direct transcriptional activation [7]. [score:5]
RyR2 Ser2814 has been identified to be regulated by PP2A regulatory subunit B56α that is a candidate miR-1 target gene [8], [9]. [score:5]
In addition, loss of miR-1-2 caused ventricular septal defects (VSDs) with partial penetrance and this has been attributed to dysregulation of gene programs influenced by direct miR-1 targets like Hand2 [2]. [score:5]
We only found few transcriptional changes in molecules previously described to be direct targets of miR-1 or miR-133a regulation (Table 1). [score:5]
analysis reveals unchanged expression of the potential miR-1 targets B56α (A) and a significant increase in protein abundance of Sorcin (SRI) in miR-1-1/133a-2 mutant hearts (B). [score:5]
Mutation of single miR-1/133a clusters reveal molecular targets modulated by physiological levels of miRNA regulation in cardiomyocytes. [score:5]
Although Cacna1c, coding for Cav1.2 protein, which is the α-subunit of the L-type calcium channel was suggested to be a miR-1 target in humans [17], we could not confirm direct regulation of Cav1.2 protein abundance by miR-1 in mouse cardiomyocytes, obviously because the miR-1 binding sites are not sufficiently conserved in mouse Cacna1c. [score:5]
miRNA expression analysis demonstrates that expression of miR-1 and miR-133a is confined to cardiomyocytes (C). [score:5]
Although several components of the adrenergic signaling cascade are potential direct targets of repression by miR-1 or miR-133a no particularly significant change in the abundance of these molecules in vivo or in isolated cardiomyocytes was detected. [score:4]
However, our detailed analysis of the electrophysiological properties of isolated cardiomyocytes from both miR-1/133a knock-out mo dels did not reveal striking alterations of potassium and sodium current expression and function. [score:4]
Reduction of miR-1 to approximately 70% (miR-1-2/133a mutants) or 40% (miR-1-1/133a-2 mutants) and concomitant miR-133a reduction revealed gradual regulation of several previously described miR-1/133a targets like Kcne1 [18] and connexin43 [39] and SRF [6]. [score:4]
We suggest that the sum of subtle changes governed by miR-1/133a regulates the impact of adrenergic signaling on L-type calcium channel activity and thus caused LQT in the mo dels with reduced miR-1/133a expression. [score:4]
The comment indicates that the gene belongs to the smooth muscle gene program (sm) or is a predicted target of miR-1/133a regulation (t). [score:4]
Indeed the molecular basis of I [to] is Kcnd2/Kv4.2 that has previously been claimed to be transcriptionally regulated by the miR-1 target Irx5 and to be at least in part responsible for cardiac conduction defects observed in miR-1-2 mutant mice [2]. [score:4]
However, the B56α subunit was not regulated in cardiomyocytes with reduced miR-1/133a expression. [score:4]
family, member 2Affymetrix GeneChip transcriptome analysis after loss of single miR-1/133a clusters revealed only limited regulation of miR-1/133a target molecules. [score:4]
We show here, that the two miR-1/133a expressing genomic clusters are involved in regulation of the impact of adrenergic signaling in cardiomyocytes and in the modulation of the electrical properties of the adult heart. [score:4]
Altogether these data support the notion that dysregulation of L-type calcium channel activity by disturbed impact of ß-adrenergic signaling is the cause of LQT in mice with reduced expression of miR-1/133a (Figure 9B). [score:4]
These experiments yielded similar inward and outward current components for both miR-1/133a knock-out mo dels and the respective control groups (Figure 5C), proving the functional expression of the most important ion currents. [score:4]
In E10.5 embryonic hearts deletion of both miR-1/133a clusters resulted in upregulation of myocardin at the RNA, as well as at the protein level [7]. [score:4]
In vivo transcriptional regulation of miR-1/133a clusters would affect both miRNAs within the cluster, and modulation of miRNA abundance without complete loss of expression occurs also in pathophysiological settings [38]. [score:4]
Nevertheless, the regulatory interaction between miR-1 and Kcne1 might be of more importance in humans and indicates that KCNE1 might be added to a miR-1/133a regulated network of genes that modulates repolarization of cardiomyocytes. [score:3]
Potential miR-1/133a targets involved in modulation of adrenergic signaling. [score:3]
Analysis of the electrophysiological properties of cardiomyocytes isolated from mutant mice indicated modulation in the adrenergic control of calcium channel activity upon reduced miR-1/133a expression in the single cluster mutant mice. [score:3]
Indeed only after more than 50% reduction of mature miR-1 and miR-133a we observed a moderate impact on SRF expression and concomitant increase of few smooth muscle markers in the adult heart. [score:3]
Indeed the rescue of the long QT-phenotype either by inhibition of the adrenergic signaling or by Verapamil -induced modulation of L-type calcium channel activity in vivo indicates that the miRNAs miR-1 and miR-133a modulate an important functional property of the heart (Figure 9). [score:3]
Taken together these data indicate a regulation of particular aspects of β-adrenergic signaling in miR-1/133a knock-out cardiomyocytes, may be by modulatory factors acting downstream in the adrenergic signaling cascade. [score:3]
In summary, we suggest that modulation of components of adrenergic signaling regulating the action potential duration of cardiomyocytes might be subject to complex regulation by miR-1 and miR-133a. [score:3]
miR-1/133a regulates the impact of adrenergic signaling on L-type calcium channel activity in vivo In vivo heart function is constantly modulated by the sympathetic and parasympathetic stimuli, thus cardiomyocytes are always subject to regulation by β-adrenergic signaling although to a varying degree. [score:3]
Thus, besides the fundamental role of miR-1/133a in development the potential relevance of the most abundant miRNAs in the heart in regulating electrophysiological properties of cardiomyocytes is still unclear to date. [score:3]
Our thorough analysis of parameters uncovered that the miR-1/133a clusters are needed to maintain specific functions in heart electrophysiology and modulation of miR-1/133a dosage caused a striking change in the frequency dependent modulation of QT duration leading to long QT disease phenotype that becomes particularly evident at lower heart rates. [score:3]
Of the 177 molecules analyzed to be related to adrenergic signaling 39 were predicted potential targets of miR-1 or miR-133a. [score:3]
miR-1/133a controls expression of smooth muscle genes in cardiomyocytes. [score:3]
Using northern blot analysis (Figure 1A) as well as qRT-PCR (Figure 1B) we demonstrate here tissue specific expression of miR-1 and miR-133a in adult heart, skeletal muscle and with reduced abundance in bladder. [score:3]
Representative ramp depolarizations (−150 mV to +60 mV, 250 ms; holding potential −80 mV) recorded from WT and miR-1/133a KO ventricular cardiomyocytes (C) prove the functional expression of the most important ion currents. [score:3]
Cav1.2 has been described to be a miR-1 target molecule in rat and human [17]. [score:3]
Expression of miR-1/133a in WT and mutant animals. [score:3]
Interestingly, there is a significant change in the CaMKII dependent RyR2 Ser2814 phosphorylation at baseline and after stimulation confirming that miR-1/133a directly or indirectly affects β-adrenergic signaling of miR-1/133a mutant cardiomyocytes. [score:3]
The miRNAs miR-1 and miR-133a are abundantly expressed in skeletal muscle. [score:3]
However, the described miR-1 target sites are not conserved in the 3′UTR of mouse Cacna1c. [score:3]
Loss of a single miR-1/133a cluster did not reduce the survival (n/group ≥97, log-rank test p>0.45) or the body weight development (n/group ≥6) of the respective knock-out animals compared to WT (Figure 2D, E). [score:2]
In line with the common mo dels of miRNA action the longQT phenotype after loss of a single miR-1/133a cluster seems not to be caused by dysregulation of a single ion-channel or a single ion-channel interacting protein, thus we suggest that the miR-1/133a cluster fine-tune different components of the adrenergic signaling to the needs of physiological function in vivo. [score:2]
Knock-out of individual miR-1/133a clustersDeletion of the miR-1/133a clusters from mouse chromosome 2 and 18 has been previously described [7]. [score:2]
miR-1/133a regulates the impact of adrenergic signaling on L-type calcium channel activity in vivo. [score:2]
Therefore we suggest that miR-1/133a clusters participate in fine-tuning the regulation of cardiac repolarization according to the needs of the different species. [score:2]
0113449.g005 Figure 5 Action potential (AP) traces in isolated adult ventricular cardiomyocytes from the respective miR-1/133a cluster knock-out animals (blue) and the corresponding controls (black). [score:2]
This was different compared to a recent study using transgenic overexpression of miR-133 [34], but in line with our data that showed that there is no hypertrophic growth after loss of single miR-1/133a clusters [7] that could potentially be attributed to increased adrenergic signaling [28]. [score:2]
However, reduction of miR-1/133a abundance in the single cluster knock-out mice revealed other important physiological functions of these miRNAs. [score:2]
of APD90 in miRNA control (WT) and respective miR-1/133a knock-out cells (B). [score:2]
Kcne1 for instance has a prominent role in repolarization in humans or Cav1.2 as a part of L-type calcium-channel is regulated by miR-1 due to functional miR-1 binding sites in humans. [score:2]
Although we never observed death of animals during telemetric recording of, the unchanged survival of mutant knock-out animals supported the view that fatal Torsades de pointes arrhythmia did not occur in miR-1/133a KO mice. [score:2]
the respective miR-1/133a knock-out hearts. [score:2]
Action potential (AP) traces in isolated adult ventricular cardiomyocytes from the respective miR-1/133a cluster knock-out animals (blue) and the corresponding controls (black). [score:2]
miR-1/133a controls impact of β-adrenergic regulation on L-type calcium-channel. [score:2]
The deletion of the single miR-1/133a clusters offers the opportunity to modulate the miR-1/133a dosage in a way that closely matches the physiological relevant regulation. [score:2]
Our analysis of single miR-1/133a clusters in a mixed 129/C57 genetic background indicated that the single miR-1/133a clusters are not essential for early development and structural integrity of the heart. [score:2]
Increased Action Potential Duration at 90% of repolarization (APD90) in miR-1/133a knock-out ventricular cardiomyocytes. [score:2]
Interestingly, we observed activation of a smooth muscle gene program in the miR-1/133a knock-out mice (Acta2, calponin, transgelin, Myl9, Myh11; table 1). [score:2]
Knock-out of individual miR-1/133a clusters. [score:2]
We demonstrated that this phenotype is caused to a large extend by the loss of the regulatory interaction between miR-1 and myocardin [7]. [score:2]
To understand the molecular mechanisms, how miR-1/133a might cause the changed L-type calcium channel activity, we analyzed adrenergic signaling in cardiomyocytes isolated from WT and the respective miR-1/133a knock-out animals. [score:2]
In contrast to loss-of-function mutation in LQT1 patients which leads to prolonged QT durations and induction of ventricular tachycardia at higher heart rates [30] in the miR-1/133a mutant mouse mo dels we have detected the opposite effect on QT/RR slope, namely prolongation of action potential duration at lower heart rates. [score:2]
Loss of both miR-1/133a clusters is lethal at an embryonic stage earlier than E12.5 proving the function of miR-1/133a clusters in regulatory processes that are fundamental for embryonic cardiomyocyte specification. [score:2]
To understand the cellular basis for the observed changes and to identify the underlying mechanisms we performed single cell patch clamp analysis on adult isolated ventricular cardiomyocytes from both miR-1/133a cluster knock-out animals and respective littermate controls. [score:2]
Figure S2 Loss of miR-1/133a single clusters does not impair muscle structure. [score:1]
Thus the miR-1/133a clusters are essential for repression of the smooth muscle gene program in post-natal heart and for maintenance of repolarization properties that are essential for normal function of the heart in its physiological context (B). [score:1]
Loss of miR-1/133a impairs cardiac repolarization. [score:1]
β-adrenergic signaling is intact in after loss of miR-1/133a. [score:1]
Deletion of the miR-1/133a clusters from mouse chromosome 2 and 18 has been previously described [7]. [score:1]
0113449.g001 Figure 1 Northern blot (A) as well as quantitative RT-PCR (B) detected the miRNAs miR-1 and miR-133a in total RNA isolated from heart (ht), skeletal muscle (m. tibialis anterior) and bladder. [score:1]
Mice lacking a single miR-1/133a cluster develop normally and are vital. [score:1]
Electrocardiography was used to explore the electrophysiological consequences of loss of miR-1/133a clusters (Figure 3A). [score:1]
The qRT-PCR revealed that in adult heart tissue loss of the miR-1-1/133a-2 cluster leads to a significantly stronger reduction of miR-1 than deletion of the miR-1-2/133a-1 cluster (Figure 1D, n/group  = 4–6). [score:1]
The miR-1-1/133a-2 cluster on mouse chromosome 2 and the miR-1-2/133a-1 cluster on mouse chromosome 18 give rise to identical mature miR-1 or miR-133a molecules, respectively. [score:1]
Deletion of a single miR-1/133a cluster did not impair embryonic survival, as indicated by the Men delian distribution of genotypes after mating of heterozygous parents. [score:1]
Indeed, application of Propranolol and thus blockage of adrenergic signaling in vivo abrogated the longQT phenotype in miR-1/133a single cluster knock-out mice (ΔQT/ΔRR, p-values compared to untreated wildtype, wildtype 0.39±0.14 p>0.44, miR-1-1/133a-2 KO 0.43±0.08 p>0.32, miR-1-2/133a-1 KO 0.34±0.11 p>0.62, n = 7/4/9, Figure 9A). [score:1]
Deletion of one or the other miR-1/133a cluster specifically led to longer QT intervals in the. [score:1]
The observed longQT as well as the altered calcium-current are triggered by adrenergic signaling, indicating that the miR-1/133a clusters are essential for the maintenance of signaling pathways involved in adjustment of cardiomyocyte repolarization. [score:1]
Breeding of the respective heterozygous animals in a 129/C57 mixed genetic background resulted in offspring with the expected Men delian ratio, indicating that deletion of single miR-1/133a clusters did not cause embryonic lethality (Figure 2A). [score:1]
0113449.g008 Figure 8 The concentration of cAMP was not changed in the adult heart of miR-1/133a single cluster mutant mice (A). [score:1]
LQT in miR-1/133a mutant mice is caused by unleashed β-adrenergic control of L-type calcium channel. [score:1]
Transcriptome analysis after deletion of single miR-1/133a clusters. [score:1]
Moreover, reduced CaMKII signaling should reduce activity of the L-type calcium channel [35], thus this change cannot be accounted for the increased L-type calcium channel activity seen in the miR-1/133a single cluster mutant cells. [score:1]
Molecular changes induced by reduced miR-1/133a abundance. [score:1]
Molecular consequences of loss of single miR-1/133a clusters. [score:1]
Northern blot (A) as well as quantitative RT-PCR (B) detected the miRNAs miR-1 and miR-133a in total RNA isolated from heart (ht), skeletal muscle (m. tibialis anterior) and bladder. [score:1]
Deletion of the miR-1/133a clusters located on mouse chromosome 2 and 18 has been described previously [7]. [score:1]
5 µg of RNA were separated in a 15% denaturing polyacrylamide TBE-Urea gels (Invitrogen) and blotted to a Hybond-XL membrane (Amersham) that was subsequently hybridized with (γ-32P)ATP labeled miR-1 (ATACATACTTCTTTACATTCCA) or miR-133a (CAGCTGGTTGAAGGGGACCAAA) and U6 snRNA (ATATGGAACGCTTCACGAATT) probe diluted in ULTRAhyb buffer (Ambion) at 30°C overnight. [score:1]
Loss of single miR-1/133a clusters affects repolarization of the heart in vivo. [score:1]
Deletion of a single miR-1/133a cluster led to longQT and this was corroborated by significantly prolonged APD [90] duration at the single cell level. [score:1]
Loss of single miR-1/133a clusters affects repolarization of the heart in vivo Electrocardiography was used to explore the electrophysiological consequences of loss of miR-1/133a clusters (Figure 3A). [score:1]
To get insights into the molecular mechanisms leading to the phenotypic changes observed after loss of single miR-1/133a clusters we analyzed transcriptional changes in WT vs. [score:1]
To demonstrate that the dysregulation of adrenergic signaling on calcium-channel activity that was observed in vitro is also the cause of the longQT observed in vivo in miR-1/133a KO mice, we investigated the effect of adrenergic signaling on in WT and the respective miR-1/133a single cluster knock-out mice. [score:1]
However, whereas deletion of both miR-1/133a clusters was embryonic lethal, we did not observe a major phenotype if only a single miR-1/133a cluster was deleted from the genome. [score:1]
0113449.g002 Figure 2 Deletion of a single miR-1/133a cluster did not impair embryonic survival, as indicated by the Men delian distribution of genotypes after mating of heterozygous parents. [score:1]
Deletion of either miR-1/133a cluster resulted in significant reduction of miR-1 or miR-133a in the adult tissues. [score:1]
The concentration of cAMP was not changed in the adult heart of miR-1/133a single cluster mutant mice (A). [score:1]
However, homozygous deletion of single miR-1/133a clusters yielded no striking changes in the morphology of skeletal muscle [7]. [score:1]
However, we found in both miR-1/133a mutants a significantly prolonged APD [90], as would be expected from the data (for miR-1-1/133a-2 control cells 21.9±2.9 ms, n = 33, for miR-1-1/133a-2 KO cells 37.6±1.8 ms, n = 39, p<0.001; for miR-1-2/133a-1 control cells 23.2±1.4 ms, n = 31, for miR-1-2/133a-1 KO cells 32.4±2.8 ms, n = 29, p<0.01; Figure 5B). [score:1]
We believe that the miR-1/133a KO - induced gain of function effects on the Ca [2+] currents after β-adrenergic stimulation is similarly leading to prolonged QT durations at slow heart rate. [score:1]
The miRNAs miR-1 and miR-133a are the most abundant miRNAs found in the heart and these miRNAs are encoded in two clusters in the genome. [score:1]
Deletion of single miR-1/133a clusters led to a reduced abundance of miR-1 or miR-133a in the heart detected by northern blot (A) or qRT-PCR (D). [score:1]
Analysis ofs of our respective single miR-1/133a cluster KO mice revealed no change in the morphology of the R wave in any of our mo dels (Figure 3A). [score:1]
Thus the miR-1/133a clusters and myocardin constitute a feedback-loop and myocardin activates transcription of smooth muscle-related genes, amongst others the potassium channel Kcnmb1 that on the other hand is repressed by miR-133a. [score:1]
This is supported by the fact that both the β-blocker Propranolol as well as the Ca [2+] channel blocker verapamil attenuates the miR-1/133a KO - induced effects on the QT/RR slope in vivo (Figure 9A). [score:1]
[1 to 20 of 123 sentences]
6
[+] score: 351
Furthermore, Pax7 was up-regulated in YY1 over-expressed C2C12 cells and down-regulated in siYY1 knock-down cells compared to Vector or siNC controls, suggesting that Pax7 is under control by YY1-miR-1 signaling (Fig. 5G). [score:9]
However, YY1 expression level was found to be up-regulated at all time points examined (Fig. 2D, right), indicating that the down-regulation of miR-1 and miR-133 could be caused by elevated YY1 levels. [score:9]
Consistent with others' findings [15], both miR-1 and miR-133 were found to be robustly up-regulated during C2C12 differentiation whereas YY1 expression was gradually down-regulated (Fig. 2A). [score:9]
Interestingly, a search for putative miR-1 targets by multiple algorithm (TargetScan, PicTar, and miRanda) uncovered that Pax 7 could be a potential target with two putative target sites identified at 1557 and 2100 bp of its 3′UTR (Fig. 5A). [score:9]
A feedback regulation of YY1 by miR-1. miR-1 inhibits YY1 expression through targeting its 3′UTR. [score:8]
In keeping with the above results, Pax7 expression level was down-regulated during the course of C2C12 differentiation concomitant to the gradual increase of miR-1 expression level (Fig. 5F). [score:8]
This circuit involves the constitutive activity of NF-κB in myoblasts that regulates YY1 expression which subsequently suppresses miR-1 expression epigenetically and maintains cells in an undifferentiated state. [score:8]
Although miR-1 and miR-133 are clustered on the same chromosomal loci and transcribed together as a single transcript, there seems to be a stronger regulation on miR-133 by YY1 than on miR-1 as depleting YY1 increased miR-133 to a much higher levels than that of miR-1 (Fig. 2F) and over -expressing YY1 also down-regulated miR-133 more than miR-1 (data not shown). [score:7]
As differentiation is initiated, the down-regulation of the NF-κB-YY1 pathway leads to concomitant up-regulation of miR-1 that in turns further decreases YY1 as well as Pax7 levels to ensure proper differentiation into myotubes. [score:7]
Having gained insights into how YY1 regulates miR-1/133 family, we were intrigued to find out whether miR-1 can feedback on YY1 to regulate its expression since this type of feedback regulation is commonly existent between TFs and miRNAs. [score:6]
These miRs, in turn, each down-regulates a set of protein coding genes at post-transcriptional level, among which includes YY1 itself as target of miR-1 and miR-29 (Fig. 8B). [score:6]
For instance, MyoD and Mef2 regulate the expression of miR-1 that suppresses Histone Deacetylase 4 (HDAC4), resulting in augmented Mef2 activity [10], [11]. [score:6]
As expected, both miR-1 and miR-133 levels were up-regulated (Fig. 2C, middle and right), showing an inverse relationship with YY1 expression. [score:6]
Figure S4 Pax7 protein is down-regulated by miR-1 over -expression. [score:6]
Expression folds are shown with respect to TNF treated cells where miR-1 or miR-133 levels were set to a value of 1. (B) Expression of miR-1 and miR-133 was measured in C2C12 myoblasts stably expressing Vector or the IκBα-SR transgene. [score:5]
Conversely, myoblasts expressing the IκBα-SR inhibitor of NF-κB led to higher levels of miR-1/133 over that of control cells (Suppl. [score:5]
Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (G) Expression of the primary transcripts of miR-1-2/miR-133a-1 was detected by qRT-PCR in C2C12 transfected with siYY1 or siNC oligos, and normalized to GAPDH. [score:5]
This temporal expression pattern suggests that a dynamic change of miR-1 and 133 expressions occur during in vivo degeneration-regeneration process. [score:5]
In agreement with the known pro-myogenic function of miR-1, over -expression of miR-1 (Lane 3: miR-1+Vector) accelerated the myogenic program as shown by the significantly higher number of MyHC -positive cells (Fig. 4A and 4B) and increased expression of α-Actin (Fig. 4C) than that of control cells (Lane 1: NC+Vector). [score:5]
from qRT-PCR analysis (Fig. 6D) revealed that the expressions of miR-1 and miR-133 were up-regulated in siYY1 injected muscles compared to siNC injected muscles at all three time points (day 2, 4 and 6) during muscle regeneration. [score:5]
Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (E) Western blotting was performed to analyze the expression of YY1, Pax7, MyoD and Myogenin. [score:5]
Figure S2 NFκB suppresses miR-1 and miR-133 expression through YY1. [score:5]
It will be interesting to dissect the downstream regulatory targets mediating these functions of miR-1 and to elucidate the significance of YY1-miR-1 regulation in various events. [score:5]
Given that miRNAs are known for their multi -targeting capability, we suspected that additional targets may exist downstream of miR-1 and under control of YY1-miR-1 axis. [score:5]
As shown in Fig. 6A, for miR-1 expression, a sharp decrease of ∼5 fold in the first two days post-injury was observed, after which its expression level gradually increased to ∼2 fold of pre-injury level on day 6 but underwent a drop on day 9 during fiber maturation stage. [score:5]
Co-transfection of the resultant reporter plasmid together with miR-1 into C2C12 cells caused a repression on luciferase activity (Fig. 5B), indicating that miR-1 indeed directly targets Pax7. [score:4]
As expected, YY1 over -expression on top of miR-1 (Lane 4: miR-1+YY1) suppressed the pro-myogenic activity of miR-1 (Fig. 4A, 4B and 4C, Lane 4 compared to Lane 3). [score:4]
Among all the putative YY1 target miRNAs, miR-1 and miR-133 families are particularly attractive considering the pivotal roles of these muscle miRs in regulating myogenesis [5]. [score:4]
Collectively, our data from the above studies suggest that YY1 negatively regulates miR-1 and miR-133 expression both in physiological and pathological muscle conditions. [score:4]
Deletion of miR-1-2 in mice caused dysregulation of cardiogenesis [32]; miR-1 was found to promote apoptosis of cardiomyocytes; recently, miR-1 was also demonstrated to exert a strong pro-myogenic influence on poorly differentiated Rhabdomyosarcoma cells [33]; in skeletal myogenesis, miR-1 is known to be pro-myogenic through targeting histone deacetlylase 4 (HDAC4) [15]. [score:4]
Next, to address the functional significance of miR-1 regulation by YY1, we assessed the effect of YY1 expression on the pro-myogenic activity of miR-1 during C2C12 differentiation. [score:4]
0027596.g002 Figure 2YY1 negatively regulates miR-1/133 expression both in vitro and in vivo. [score:4]
Further investigation identified Pax7 as a downstream target of miR-1 thus forming a functional YY1-miR-1-Pax7 circuit which down-regulates Pax7 and promotes myogenic differentiation (Fig. 8A). [score:4]
YY1 negatively regulates miR-1/133 expression both in vitro and in vivo. [score:4]
The functions of miR-1 in muscle development and muscle diseases have been the focus of intensive study. [score:4]
Second, in addition to regulating the transcription of primary miR-1/133 transcripts, YY1 may also exert regulation at a later stage of miR-1/133 biogenesis, resulting in different rates of miR-1 and miR-133 production. [score:3]
At the functional level, we predicted that miR-1 binding to the Pax7 3′UTR would lead to the repression on Pax7 expression. [score:3]
miR-1 targets Pax7 during C2C12 differentiation. [score:3]
0027596.g004 Figure 4 (A) C2C12 cells were transfected with the indicated combination of NC or miR-1 oligos and Vector or YY1 expression plasmids. [score:3]
We reasoned there may be two possibilities: first, it may be attributed to the fact that three copies of miR-133 are under regulation by YY1 whereas only two copies of miR-1 are subjected to YY1 regulation (Fig. 3A–C). [score:3]
Moreover, we demonstrated that YY1 is targeted by miR-1 through a negative feedback loop. [score:3]
Consistent with this thinking, treatment of C2C12 myoblasts with TNFα as an activator of NF-κB reduced miR-1 and miR-133 expression (Suppl. [score:3]
Since YY1 is a transcriptional target of NF-κB [19], we reasoned that miR-1 and miR-133 should also come under negative control of NF-κB. [score:3]
Their responses to miR-1 over -expression were tested as above. [score:3]
C2C12 myoblasts were transfected with miR-1 oligos only or co -transfected with miR-1 oligos and an YY1 expression plasmid. [score:3]
To our expectation, it displayed an opposite trend as miR-1/133 expression: a marked increase during first two days followed by a decrease until day 6 and a bounce-back on day 9 (Fig. 6B). [score:3]
In addition, our studies focused on the regulation of YY1 on miR-1 and its downstream event; it will be interesting to explore how YY1 regulated miR-133 affect satellite cell proliferation and differentiation processes. [score:3]
0027596.g005 Figure 5 (A) Predicted target sites, A and B, of miR-1 in the 3′UTR of mouse Pax7. [score:3]
0027596.g007 Figure 7 (A) Predicted target site of miR-1 in the 3′UTR of mouse YY1. [score:3]
A significant decrease of Pax 7 at both protein (Fig. 6E) and RNA levels (Fig. 6F) was observed at all time points examined, in support of the argument that Pax 7 is positively regulated by YY1 mediated through miR-1. An evident decrease of MyoD expression was also detected in siYY1 muscles compared to siNC samples (Fig. 6E and 6F). [score:3]
Expression folds are shown with respect to wild type where miR-1, miR-133 or YY1 levels were set to a value of 1. (E) C2C12 myoblasts or (F) primary myoblasts were transfected with either negative control (siNC) or siRNA oligos against YY1 (siYY1). [score:3]
Consistent with this prediction, transfection of miR-1 oligos caused the decrease in both Pax7 mRNAs and proteins in addition to inhibiting the previously characterized target, HDAC4 (Fig. 5D–5E and Suppl. [score:3]
In addition to its anti-differentiation function, YY1, through its regulation on miR-1-Pax7, may play a crucial role in regulating satellite cell proliferation. [score:3]
Expression folds are shown with respect to day 0 where miR-1 and miR-133 levels were set to a value of 1. Quantitative values are represented as means ± S. D. (B) YY1 expression was measured by Western blotting. [score:3]
The above data suggested that an inverse correlation exists between the expression of miR-1/133 and YY1 during CTX -induced muscle regeneration. [score:3]
Expression folds are shown with respect to 3 day old mice where miR-1 and miR-133 levels were set to a value of 1. (D) TA muscles were isolated from 3 w, 4 w, 5 w, 8 w and 10 w old C57BL/6 wild type mice or mdx mice. [score:3]
Muscles from wild type (WT) or mdx mice aging from 3 to 10 weeks were collected and examined for miR-1 and 133 expressions by qRT-PCR. [score:3]
The expression profiles of miR-1 and miR-133 were examined by qRT-PCR analysis. [score:3]
In this study, we identified two new targets of miR-1, Pax7 and YY1, in addition to the previously known HDAC4. [score:3]
To test whether it mediates YY1 targeting by miR-1, a reporter plasmid was generated by cloning this site into pMIR-reporter vector. [score:3]
To test whether miR-1 targets Pax7, a ∼800 bp fragment of Pax7 3′UTR encompassing these two sites were cloned into a pMIR-reporter vector. [score:3]
miR-1 is shown to promote myoblast differentiation while miR-133 promotes myoblast proliferation and inhibits myogenic differentiation [15]. [score:3]
Subsequent functional study validated the existence of a novel YY1-miR-1/133 regulatory circuit during skeletal muscle differentiation both in vitro in C2C12 cells and in vivo in a CTX induced muscle regeneration mo del. [score:2]
Finally, other than miR-1 and 133 families, a number of miRNAs could be regulated by YY1 according to our results (Table 1 and Suppl. [score:2]
These findings suggest that miR-1 and miR-133 are subjected to regulation by NF-κB-YY1 signaling. [score:2]
The expression of miR-133 displayed a similar change but the decrease in degeneration stage was much stronger (∼10 fold) and the elevation in regeneration stage was lower compared to miR-1 level. [score:2]
Thus, the regulation by YY1 may exert a master control of the ratio of miR-1 and 133 which is critical for their net effect on myogenesis. [score:2]
The YY1-miR-1-Pax7 axis represents an important circuit that regulates transition from proliferation to differentiation. [score:2]
0027596.g008 Figure 8 The mo del depicts the role of the NF-κB-YY1-miR-1 regulatory circuit in myogenic differentiation. [score:2]
As shown in Fig. 2B, when induced to differentiation by serum withdrawal, a sharp increase of both miR-1 and miR-133 expression was detected compared to GM cells. [score:2]
The mo del depicts the role of the NF-κB-YY1-miR-1 regulatory circuit in myogenic differentiation. [score:2]
YY1 negatively regulates miR-1 during CTX -induced muscle regeneration. [score:2]
When performed in primary myoblasts, knocking down of YY1 led to an even more significant increase of miR-1 and miR-133 (13.5 and 273 fold, respectively) (Fig. 2F). [score:2]
Thus miR-1, miR-133 and miR-206 play central regulatory roles in muscle biology and are called muscle miRs. [score:2]
Collectively, our data support the existence of a feedback regulation on miR-1 by YY1. [score:2]
During the preparation of this manuscript, Chen et al recently demonstrated that miR-1 and miR-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7 using primary satellite cell culture [39]. [score:2]
Similar to mature miR-1 and miR-133, the level of pri-miR-1/133 transcripts was found to be induced upon siYY1 knockdown (Fig. 2G). [score:2]
Our view is consistent with a recent report demonstrating that miR-1 and miR-133 produced opposing effects on apoptosis in cardiomyocytes despite the similar regulation [38]. [score:2]
Given that a similar pro-myogenic effect was observed when miR-1 oligos were administrated into injured muscles [34], this suggests that YY1-miR-1 axis represents a functional regulatory circuit during CTX induced muscle regeneration. [score:2]
YY1 regulates the pro-myogenic function of miR-1 during C2C12 differentiation. [score:2]
Together, these data suggest that YY1 functions upstream of miR-1 in regulating its pro-myogenic action. [score:2]
YY1 regulates miR-1 in cardiotoxin -induced muscle regeneration. [score:2]
YY1 repression of miR-1/133 is mediated through multiple enhancers. [score:1]
Total RNAs were isolated and qRT-PCR was subsequently performed to measure the expression of miR-1 and miR-133, normalized to U6 (middle and right). [score:1]
Findings from the current studies demonstrate a repression of miR-1, miR-133 and miR-206 by YY1. [score:1]
Despite increasing amounts of reports on the number of miRNAs involved in myogenesis, miR-1 and 133 families remain on the center stage [5]. [score:1]
As visualized by Cytoscape, miR-1, miR-133, miR-206 as well as miR-29 are all under transcriptional repression by YY1. [score:1]
s were then cultured for 48 hours, at which time miR-1 and miR-133 expressions were measured by qRT-PCR and normalized to U6. [score:1]
Real-time PCR was performed to measure the expression levels of miR-1 and miR-133 normalized to U6 (middle). [score:1]
Muscles miRs constitute two distinct families, the miR-1 family (miR-1-1, miR-1-2, and miR-206) and the miR-133 family (miR-133a-1, miR-133a-2, and miR-133b). [score:1]
Relative Luciferase Unit (RLU) is shown with respect to wild type and NC transfection where luciferase activities were set to a value of 1. The data represent the average of three independent experiments ± S. D. (C) Upper: C2C12 myoblasts were transfected with either NC or miR-1 oligos. [score:1]
A mo del of NF-κB-YY1-miR-1-Pax7 circuit in skeletal myogenesis. [score:1]
The reporter construct was then transfected into C2C12 cells with negative control (NC) or miR-1 oligos along with Renilla luciferase plasmid. [score:1]
We noticed that the level of miR-1 rose faster during both C2C12 myoblast differentiation and CTX induced muscle regeneration, leading us to speculate that the predominant increase in miR-1 overweighs that in miR-133, favoring the progression of myogenic differentiation. [score:1]
The mutant plasmid was generated by mutating the miR-1 binding site from ACAUUCU to GGGCCUU. [score:1]
By qRT-PCR assay, both miR-1 and miR-133 levels increased over two folds upon YY1 depletion (Fig. 2E), suggesting that there is a negative regulation of miR-1 and miR-133 by YY1. [score:1]
The mutant Pax7-3′UTR plasmids were generated by deleting each of the miR-1 binding seed region ACATTCC. [score:1]
YY1 represses miR-1 functionally during C2C12 myogenesis. [score:1]
C2C12 myoblasts were transfected with either NC or miR-1 oligos. [score:1]
In addition, Nakasa T. also showed that administration of miR-1 together with 133 and 206 into injured muscles reduced fibrosis [34], suggesting a role for miR-1 in anti-fibrotic event with unknown mechanism. [score:1]
Co-transfection of the resultant reporter plasmid with miR-1 oligos led to ∼30% repression on luciferase activity (Figure 7B). [score:1]
A mutant YY1-3′UTR plasmid was generated by changing miR-1 binding site from ACATTC to GGGCCT. [score:1]
The above findings thus confirm the presence of a transcriptional repression of miR-1 and miR-133 by YY1. [score:1]
YY1-miR-1-Pax 7 axis during myogenesis. [score:1]
Indeed, a miR-1 binding site was predicted on the 3′ UTR of YY1 at 440 bp upstream of previously defined miR-29 binding site (Fig. 7A). [score:1]
Taken together, these results implicate the existence of a functional YY1-miR-1-Pax7 circuit during myoblast differentiation. [score:1]
Total RNAs were collected from cells differentiated (DM) for 0, 1, 3 or 5 days and used for measuring miR-1 and miR-133 expression levels. [score:1]
Others and our findings suggest that miR-1 not only functions during myogenic differentiation but also participates in satellite cell activation, proliferation and possibly self-renewal. [score:1]
Repression of muscle miR-1/133 family by YY1 was mediated through three YY1 binding sites located in multiple enhancer regions. [score:1]
miR-1 and miR-133 expression was then measured by qRT-PCR normalized to U6. [score:1]
RNAs and proteins were then extracted from injected muscles at the indicated days post-injection, and qRT-PCR was performed to measure the expression of miR-1 and miR-133, normalized to U6. [score:1]
Consistent with this prediction, transfection of miR-1 oligos caused decrease on both YY1 mRNA and protein levels (Fig. 7C). [score:1]
At the functional level, we predicted that miR-1 binding to the YY1 3′UTR would lead to repression of YY1 levels. [score:1]
[1 to 20 of 113 sentences]
7
[+] score: 300
Using a nanostring device, which digitally quantifies a wide set of mRNA transcripts starting from a very low quantity of tissue, we analysed RNA samples obtained from DRGs of mice which received intrathecal injections of 10 pmol of miRNA-1a-3p inhibitor or mismatch inhibitor in vivo every 24 h with in vivo transfection reagent from PID-4 to PID-9. Following qRT-PCR -based confirmation of the inhibition of miRNA-1a-3p by it's specific inhibitor, we then analysed the expression of 53 predicted targets in relation to that of five housekeeping genes, namely clathrin, heavy polypeptide (Cltc), glyceraldehyde-3-phosphate dehydrogenase (Gapdh), glucuronidase beta (Gusb), hypoxanthine guanine phosphoribosyl transferase (Hprt) and tubulin, beta 5 class I (Tubb5). [score:13]
Apart from evidence for miRNA-1a-3p binding to the 3′UTR of Clcn3 and regulation of it's translation, the finding that the expression of Clcn3 expression is reciprocally regulated with respect to miR-1a-3p expression in the DRG following peripheral tumour induction established Clcn3 as a miR-1a-3p target in sensory neurons. [score:13]
Amongst these, the expression of 3 targets, namely insulin-like growth factor 1 (Igf1), heart and neural crest derivatives expressed transcript 2 (Hand2) and Chloride channel 3 (Clcn3) (Fig 5, panel A), was strongly enhanced upon suppression of miRNA-1a-3p expression, suggesting miRNA–mRNA pairing. [score:11]
To comprehensively exclude false positives or targets that may be regulated only modestly, we directly analysed the impact of miRNA-1a-3p inhibition on the expression of all 53 target mRNAs in the DRG in vivo. [score:11]
Moreover, functionality of intrathecally delivered inhibitors or mimics was validated via qRT-PCR -based expression analysis on lumbar L3, L4 and L5 DRGs 24 h after injection (examples with knockdown of miR-1a-3p and miR-34c-3p with their respective inhibitors in comparison with respective mismatch inhibitors is shown in Fig 2, panel C; p < 0.05 two tailed t-test). [score:10]
Thus downregulating expression of Clcn3 in the DRG exerted the same functional effect on tumour -associated mechanical hypersensitivity as inhibition of miR-1a-3p, again emphasizing the in vivo significance of miR-1a-3p- Clnc3 as a miRNA–mRNA regulatory pair. [score:9]
Figure 5QRT-PCR analysis demonstrating induction of predicted miR-1a-3p target genes in lumbar DRGs in vivo following suppression of miR-1a-3p expression via inhibitor delivery intrathecally in vivo. [score:9]
QRT-PCR analysis demonstrating induction of predicted miR-1a-3p target genes in lumbar DRGs in vivo following suppression of miR-1a-3p expression via inhibitor delivery intrathecally in vivo. [score:9]
Thus, out of 62 mRNAs putative targets for miR-1a-3p predicted by at least 2 out of 14 algorithms applied, only 25 showed at least 50% up-regulation following miR-1a-3p inhibition in sensory neurons in vivo, thereby cautioning about the strength of interpretations that can be made from in silico analyses alone. [score:8]
Third, our results on regulation of miR-1a-3p expression in bone metastatic pain emerged to be intriguingly different to known findings in the context of neuropathic and inflammatory pain; whereas inflammatory pain as well as partial sciatic ligation are associated with a decrease in miR-1a-3p expression in the DRG and spinal cord, sciatic nerve axotomy induces a robust increase in miR-1a-3p expression in the DRG and a corresponding decrease in the spinal cord (Kusuda et al, 2011). [score:8]
Luciferase-reporter based assay in HEK293 cells demonstrating changes in translation of the Clcn3 gene following suppression of miR-1a-3p expression via graded delivery of the specific inhibitor. [score:8]
Expression of miR-1a-3p inhibitor dose -dependently increased the translation of luciferase protein from the Clcn3 reporter construct, whereas expression of the miR-1a-3p mimic exerted the opposite effect (Fig 6, panels B and C, p < 0.05, as compared to control samples, two tailed t-test). [score:8]
Interestingly, except for Hand2 and Igf1, almost all of genes that were functionally validated as miR-1a-3p targets in other systems were not found to be regulated by miR-1a-3p inhibition in sensory neurons, thereby highlighting the context-dependence of functionality of miRNA function and gene regulation. [score:7]
Reasoning that a transcript predicted as a target by several algorithms is likely to be a bona-fide, biologically significant target in terms of miRNA–mRNA pairing, we derived a condensed list of 53 candidate mRNA targets for the miRNA-1a-3p. [score:7]
Our behavioural analysis in the bone-metastases mo del indicated that inhibiting the tumour -induced upregulation of miR-1a-3p or miR-34c-5p, but not of miRNA-544-3p, in sensory neurons markedly attenuated tumour -mediated hyperalgesia. [score:6]
Luciferase-reporter based assay in HEK293 cells demonstrating changes in translation of the Clcn3 gene following suppression or induction of miR-1a-3p expression via graded delivery of the specific mimic. [score:6]
These results demonstrate that miR-1a-3p directly targets the Clcn3 3′UTR region to modulate its expression. [score:6]
Interestingly, qRT-PCR analysis on DRGs from tumour-bearing mice revealed that at PID-8, a time point at which we had initially observed that miRNA-1a-3p is upregulated (Fig 1, panel E), the expression levels of Clcn3 mRNA are significantly lower than levels in basal state or sham controls (Fig 5, panels B and C; two-tailed t-test assuming equal variances). [score:6]
Our results indicate that reversing cancer -mediated overexpression of miR-1a-3p or miR-34c-5p or reversing tumour -mediated downregulation of miR-483-3p in the sensory neurons reduces tumour -associated pain. [score:6]
QRT-PCR analysis representing changes in expression of miR-1a-3p target genes in ipsilateral lumbar DRGs in vivo at day 8 in the bone metastases mo del. [score:5]
In a HEK293 cell -based heterologous expression system, either miR-1a-3p or mismatch inhibitors were co -transfected with the Clcn3 reporter vector. [score:5]
Furthermore, the phenotype of exaggerated tumour -mediated hyperalgesia evoked by specifically knocking Clcn3 expression down in sensory neurons in vivo matched perfectly with attenuation of tumour -mediated hyperalgesia evoked by miR-1a-3p knockdown in the DRG. [score:5]
Figure 6 In vitro and in vivo validation of Clcn3 as a miR-1a-3p target gene and its functional contribution to tumor -induced mechanical hypersensitivity in the bone metastatic pain mo del employedBinding sites for miR-1a-3p (mmu-miR-1) on the 3' untranslated region (UTR) of the mouse Clcn3 gene. [score:5]
Validation of Clcn3 as a target for miR-1a-3p In silico analysis indicated that miR-1a-3p can bind to the 3 prime untranslated region (3′UTR) of the mouse Clcn3 gene (Fig 6, panel A). [score:5]
Figure 3Change in frequency of paw withdrawal to plantar application of a von Frey filament force of 0.07 g following induction of tumor growth in the calcaneous bone of the heel in mice receiving intrathecally delivered miR-1a-3p inhibitor (red symbols) or the corresponding mismatch inhibitors (green symbols) or vehicle (grey symbols). [score:5]
Mice were intrathecally injected with either miR-1a-3p -inhibitor or a mismatch inhibitor (as described above) at a concentration 10 pmol in a total of 10 µl volume per injection every 24 h starting on PID-4 until PID-9 (see injection scheme in Fig 2, panel A). [score:5]
Change in frequency of paw withdrawal to plantar application of a von Frey filament force of 0.07 g following induction of tumor growth in the calcaneous bone of the heel in mice receiving intrathecally delivered miR-1a-3p inhibitor (red symbols) or the corresponding mismatch inhibitors (green symbols) or vehicle (grey symbols). [score:5]
As the first step, we followed an unbiased and comprehensive approach to predict the mRNAs targets for miRNA-1a-3p by adapting 14 different state-of-art algorithms (Supporting Information Table S3), which utilize different parameters, such as seed region complementarily and thermodynamic stability to predict the targets of a given miRNA. [score:5]
Dysregulation of Clcn3 expression in the DRG in bone metastatic pain and it's relation to miR-1a-3pOwing to the potential impact of chloride channels on neuronal excitability, we were particularly interested in characterizing Clcn3 as a new target of miR-1a-3p. [score:4]
Because we observed that miR-1a-3p is upregulated by >10-fold in the DRG at PID-8 following tumour induction in the calcaneous bone, we asked whether reversing this pathophysiological induction influences tumour -associated hyperalgesia. [score:4]
Based upon the above results, we were intrigued by the question whether modulation of Clcn3 expression directly contributes to the functional role, which we observed for miRNA-1a-3p in the bone metastatic mo del (above). [score:4]
Moreover, this fits to the time-course of miR-1a-3p upregulation in ipsilateral DRGs following tumour induction (Fig 5, panel D, two-tailed t-test assuming equal variances). [score:4]
Here, we observed that miRNA-1a-3p was highly upregulated in the DRG in bone metastatic pain. [score:4]
* denotes p < 0.0001 from PID-5 through 14 in the vehicle and mismatch inhibitor groups and on PID-10, 12, 14 in the miR-1a-3p -inhibitor groupas compared to basal; † denotes p = 0.004 on PID-5, 0.003 on PID-7, 0.05 on PID-10 and 0.01 on PID-12 as compared to corresponding data point in the mismatch inhibitor group; ‡ denotes p < 0.0001 on PID-5, 0.0002 on PID-7, 0.05 on PID-10, and 0.004 on PID-12 as compared to corresponding data point in the vehicle group. [score:4]
* denotes p < 0.0001 on PID-5 through 15 in the vehicle, mismatch inhibitor and miR-1a-3p inhibitor groups as compared to basal; † denotes p = 0.007 on PID-10 and <0.0001 on PID-12 & 14 as compared to corresponding data point in the mismatch inhibitor group; ‡ denotes p < 0.0001 on PID-10, 12 & 14 as compared to corresponding data point in the vehicle group. [score:4]
Dysregulation of Clcn3 expression in the DRG in bone metastatic pain and it's relation to miR-1a-3p. [score:4]
Binding sites for miR-1a-3p (mmu-miR-1) on the 3' untranslated region (UTR) of the mouse Clcn3 gene. [score:3]
To confirm that miRNA-1 is able to functionally bind to 3′ UTR of Clcn3 and modulate it's expression, we constructed a luciferase reporter vector in which the 3′UTR of Clcn3 mRNA was fused to the luciferase coding sequence under pGK promoter in dual luciferase vector (pmiRGLO vector). [score:3]
In vitro and in vivo validation of Clcn3 as a miR-1a-3p target gene and its functional contribution to tumor -induced mechanical hypersensitivity in the bone metastatic pain mo del employed. [score:3]
Mechanical response thresholds calculated as von Frey filament strength required to achieve 50% withdrawal frequency following induction of tumor growth in the calcaneous bone of the heel in mice receiving intrathecally delivered miR-1a-3p inhibitor (red bars) or the corresponding mismatch inhibitors (green bars) or vehicle (grey bars). [score:3]
Validation of Clcn3 as a target for miR-1a-3p. [score:3]
Although both cohorts of mice developed significant mechanical hypersensitivity following tumour induction as compared to basal behaviour, the magnitude of mechanical hypersensitivity was significantly lesser in mice treated with miR-1a-3p -inhibitor as compared to mice treated with the corresponding mismatch inhibitor (Fig 3, panel A). [score:3]
Time course of tumor -induced changes in miR-1a-3p expression in ipsilateral lumbar DRGs via QRT-PCR analysis. [score:3]
In silico analysis indicated that miR-1a-3p can bind to the 3 prime untranslated region (3′UTR) of the mouse Clcn3 gene (Fig 6, panel A). [score:3]
LNA based in vivo inhibitors for miR-1a-3p, 34c-5p and 544-3p and respective mismatch controls with several mismatches were custom ordered from Exiqon (Denmark). [score:3]
Furthermore, our detailed analyses identified the chloride channel 3 (Clcn3) as a target of miR-1a-3p in sensory neurons and functionally validated Clcn3 as a novel pain modulator acting in the periphery. [score:3]
In a parallel experiment, either miR-1a-3p mimic or non -targeting mimic were co -transfected with the Clcn3 reporter vector and luciferase expression was measured 48 h thereafter. [score:3]
One of the most interesting aspects of this study was the identification of Clcn3, a chloride channel, as a functionally important gene target of miR-1a-3p in sensory neurons of the DRG. [score:3]
Summary of top 10 genes, which represent predictions as targets of miR-1a-3p via in silico analysis using 14 different algorithms. [score:3]
Taken together with the ex vivo analyses, these experiments underscore the tight reciprocal association between the expression of miRNA-1a-3p and Clcn3 and established their in vivo validity as a miRNA–mRNA modulatory pair in DRGs of tumour-bearing mice. [score:3]
In panel (C), * denotes p = 0.02 for miR-1a-3p, 0.04 for miR-34c-3p as compared to corresponding mismatch inhibitor and in panel (D), * denotes p = 0.001 for miR-370-3p and <0.0001 for miR-291b-5p as compared to non -targeting mimic, ANOVA followed by post hoc Fischer's test, n = 3 per group. [score:3]
Analysis of miR-1a-3p target genes in the context of tumor -induced hypersensitivity in the bone metastatic pain mo del. [score:3]
Thus, the miR-1a-3p- Clcn3 miRNA–mRNA regulation pair holds tremendous potential for modulating pain over multiple ways. [score:2]
Despite insights into it's dysregulation in inflammatory and neuropathic states, the functions of miR-1a-3p in pain modulation had not been analysed so far. [score:2]
One, although miR-1a-3p was characterized to be a non-neuronal miRNA with expression levels in the central nervous system 100- to 1000-fold lesser when compared to cardiac tissue (Mishima et al, 2007), later studies showed that miR-1a-3p is expressed in sensory neurons of the DRG in mice as well as humans (Bastian et al, 2011), which imparts it a particular translational significance; moreover, it has been well-characterized via in situ hybridization analysis to be localized to peptidergic nociceptors (Bastian et al, 2011). [score:2]
Based on these intriguing findings, we sought to identify genes regulated by miR-1a-3p in DRG neurons in an effort to work out mechanistic details. [score:2]
Owing to the potential impact of chloride channels on neuronal excitability, we were particularly interested in characterizing Clcn3 as a new target of miR-1a-3p. [score:1]
Following our protocol, we identified three miRNAs namely miR-1a-3p, miR-34c-5p and miR-370-3p to be enhancing tumour-pain and miR-483-3p to counteract it. [score:1]
Our in vivo analyses revealed as miR-1a-3p in the DRG to be a functionally important positive modulator of bone metastatic pain, indicating a pronociceptive function for miR-1a-3p. [score:1]
Here, we chose miRNA-1a-3p as our prototypic miRNA for detailed mechanistic analyses owing to several reasons. [score:1]
Secondly, mimicking miR-1a-3p in neuronal cultures attenuates neurite outgrowth (Bastian et al, 2011). [score:1]
For this purpose, we chose miRNA-1a-3p as our prototypic miRNA for detailed mechanistic analysis for various reasons (see Discussion Section). [score:1]
[1 to 20 of 62 sentences]
8
[+] score: 265
Other miRNAs from this paper: mmu-mir-1a-2, mmu-mir-1b
Figure 3t-AUCB prevented upregulation of miR-1 and restored the expression of KCNJ2 and GJA1 mRNA in ischemic myocardium (A) Ischemic upregulated miR-1 expression in MI hearts, while t-AUCB suppressed miR-1 expression in a dose -dependent manner. [score:15]
Second, it was well known that KCNJ2 and GJA1 were targets of miR-1. miR-1 could target the 3’ untranslated region (3’UTR) of KCNJ2 and GJA1 mRNA and suppressed the expression of KCNJ2 and GJA1 mRNA. [score:11]
Overexpression of SRF led to a downregulation of many SRF -dependent miRNAs in the heart including miR-1. Therefore, we hypothesized that low dose sEHIs decreased expression of miR-1 in MI mice was mediated at least in part via up-regulation of SRF protein. [score:11]
The result further demonstrated that sEHi indirect effected the expression of KCNJ2 and GJA1 mRNA via suppression miR-1. In the present study, we observed the obvious downregulation of KCNJ2/Kir2.1 and GJA1/Cx43 mRNA/protein induced by miR-1 overexpression when agomir were injected via the tail vein. [score:11]
Our study further found that the application of PI3K inhibitor wortmannin abolished the inhibitory effect of sEHi on miR-1. It was therefore expected that sEHi t-AUCB could down-regulate miR-1 expression in ischemic heart by activating PI3K/Akt pathway. [score:10]
We found the down-regulation of miR-1 by 5 mg/L t-AUCB was abolished by pretreatment with wortmannin, which caused a 2.1-fold increase in miR-1 level compared to the 5 mg/L t-AUCB+MI group (P<0.05, Figure 5B) (A) Ischemic downregulated PKA and GSK3β expression in MI hearts, while 5 mg/L t-AUCB restored PKA and GSK3β expression. [score:10]
In addition, miR-1 overexpression inhibited expression of the target mRNA and their corresponding proteins, whereas t-AUCB reversed the effects. [score:9]
Another important finding of this study was that the sEHi t-AUCB restored the impaired KCNJ2/Kir2.1 and GJA1/Cx43 mRNA/protein expression in ischemic myocardium via suppression miR-1. We first demonstrated that the expression of KCNJ2 and GJA1 mRNA were decreased in ischemic myocardial of mice, whereas t-AUCB restored KCNJ2 and GJA1 mRNA expression in a dose -dependent manner, which suggested a dose-effect relationship between sEHi and KCNJ2 and GJA1 mRNA (Figure 3C). [score:9]
Most importantly, we found that t-AUCB suppressed miR-1 overexpression and restored the impaired target mRNA and protein, which further suggested that the inverse relationship between sEHIs and miR-1 expression. [score:9]
Up-regulation of miR-1 and down-regulation of KCNJ2/Kir2.1 and GJA1/Cx43 mRNA/protein were observed in ischemic myocaridum, whereas administration of sEHIs produced an opposite effect. [score:7]
These restults indicated that sEHi negatively regulated the expression of miR-1. However, the actual mechanism responsible for miR-1 downregulation by t-AUCB in the ischemic myocardium remains poorly understood. [score:7]
Up-regulation of miR-1 in MI mice might be involved in the development of life-threatening arrhythmias such as ventricular tachycardia (VT), ventricular fibrillation, and atrioventricular block (AVB) by targeting the mRNAs of ion channel genes, i. e., KCNJ2 and GJA1 [16, 17], respectively. [score:7]
At the same time, we also observed a downregulation of KCNJ2 and GJA1 mRNA both in murine MI mo dels and in miR-1 overexpression. [score:6]
Here, we demonstrated for the first time, that the sEHi t-AUCB dose -dependently suppressed miR-1 upregulation in ischemic myocardium, which might be one of the mechanisms underlying the anti-arrhythmic effect of sEHi. [score:6]
It was therefore expected that the sEHi might up-regulate miR-1 expression in ischaemic heart. [score:6]
t-AUCB prevented upregulation of miR-1 and restored the expression of KCNJ2 and GJA1 mRNA in ischemic myocardium. [score:6]
Therefore, we could conclude that 5 mg/L might be the recommended dosage of t-AUCB to suppress miR-1 expression. [score:5]
t-AUCB suppressed miR-1 expression dose -dependently. [score:5]
Furthermore, miR-1 could also inhibit the expression of connexin 43 (Cx43) protein, resulting in slowed electrical conduction between adjacent cardiomyocytes and in strengthened early after depolarization [13]. [score:5]
In a preliminary study, we tested different doses of t-AUCB (5,15, 50 mg/L in drinking-water) in the animal mo del, and we found that t-AUCB doses above 5 mg/L did not increase the inhibition of miR-1 expression after MI (Supplementary Figure 1A). [score:5]
Moreover, we previous studies also showed the beneficial effects of sEHIs on the expression of miR-1 and its target arrhythmia-related genes in neonatal cardiac myocytes [24]. [score:5]
To confirm that AKT/GSK3β pathway was involved in regulation of miR-1, we injected t-AUCB -treated MI mice with PI3K inhibitor wortmannin (0.3 mg/kg) via the tail vein. [score:4]
Therefore, KCNJ2 and GJA1 mRNA were direct negatively modulated by miR-1. More important, we further demonstrated that sEHi t-AUCB could restore the expression of KCNJ2 and GJA1 mRNA, which were repressed by the agonist miR-1 agomir (Figure 3D). [score:4]
It was thought that the augmentation of β-adrenoceptor (βAR)- cyclic adenosine monophosphate (cAMP) -protein Kinase A (PKA) pathway might contribute to the upregulation of miR-1 [15]. [score:4]
However, the upregulation of miR-1 in ischemic myocardium after MI was incompletely understood. [score:4]
Therefore, down-regulation of miR-1 might provide protection against ischemic arrhythmia. [score:4]
miR-1 could downregulates KCNJ2 mRNA, resulting in decreased Kir2.1 protein, the K [+] channel subunit responsible for inward rectifier K [+] current (I [k1]). [score:4]
The activation of βAR/cAMP/PKA signaling might contribute to the upregulation of miR-1 in the pathogenesis of MI [15]. [score:4]
Thus, PPARγ agonist could also decrease level of SRF protein, which might in part mediated the up-regulation of miR-1 in MI mice treated with high dose sEHi. [score:4]
We found the down-regulation of miR-1 by 5 mg/L t-AUCB was abolished by pretreatment with wortmannin, which caused a 2.1-fold increase in miR-1 level compared to the 5 mg/L t-AUCB+MI group (P<0.05, Figure 5B) The concentration of EETs in the ischemic myocardium of MI mice was significantly increased in a dose -dependent manner after treatment with 0.2 mg/L, 1 mg/L and 5 mg/L of t-AUCB (all P<0.05, Figure 6A). [score:3]
In conclusion, sEHIs increase KCNJ2/Kir2.1 and GJA1/Cx43 mRNA/protein by suppressing miR-1 under ischemic arrhythmia conditions. [score:3]
However, some studies reported that there were no significant changes in these mRNA level both in murine mo del of MI and viral myocarditis, and in miR-1 overexpression [17, 27]. [score:3]
Given our results, we could assume that the overexpression of miR-1 caused post-transcriptional repression of Kir2.1 and Cx43 protein in ischemic myocardium. [score:3]
Therefore, we explore the effect of sEHi on the expression of miR-1. In our preliminary experiments, we found that the miR-1 level in ischemic myocardium of MI mice was significantly increased in a dose -dependent manner after treatment with 5, 15 and 50 mg/L t-AUCB (Supplementary Figure 1A). [score:3]
Therefore, miR-1 might be a new target for treating lethal ischemic arrhythmias. [score:3]
We conclude that sEHIs can repress miR-1, thus stimulate expression of KCNJ2/Kir2.1 and GJA1/Cx43 mRNA/protein in MI mice, suggesting a possible mechanism for its potential therapeutic application in ischemic arrhythmias. [score:3]
The effect of low dose (less than 5 mg/L) and high dose (great than 5 mg/L) t-AUCB on miR-1 expression were different. [score:3]
Because KCNJ2 (encodes Kir2.1) and GJA1 (encodes Cx43) were targets of miR-1, we further investigated of the effects of t-AUCB on the expression of KCNJ2 and GJA1 mRNA. [score:3]
In concordance with our study, some studies demonstrated that the reduction of GJA1 or KCNJ2 mRNA were associated with increased level of inhibitor miR-1 in MI rats [16]. [score:3]
Consistently, our previous in vitro whole-cell patch-clamp recording demonstrated that the current density of I [k1] was markedly decreased in miR-1 overexpression mo del of neonatal cardiac myocytes [24]. [score:3]
To this end, we evaluated the effects of sEHi trans-4-[4-(3-adamantan-1-yl-Ureido)-cyclohe-xyloxy]-benzoic acid (t-AUCB) on arrhythmia incidence, and the expression of miR-1 and its target arrhythmia–related genes. [score:3]
Moreover, the proteins involved in the calcium handling could also be regulated by miR-1 [29, 30]. [score:2]
Compared with the MI group, Kir2.1 and Cx43 protein expression was decreased to 46% and 45%, respectively, after transfected of miR-1 agomir (all P < 0.05). [score:2]
However, our present study found that miR-1 was negatively regulated by sEHi. [score:2]
Our results further revealed that PI3K/Akt signaling pathway might participate in the negatively regulation of miR-1 by sEHi. [score:2]
AKT/GSK3β signaling pathway participated in regulation of miR-1 by sEHi. [score:2]
miR-1 agomir was purchased from RiboBio (Guangzhou, China). [score:1]
miR-1 had been demonstrated to be a potential arrhythmogenic factor in ischemic heart. [score:1]
However, in our present study, we observed that miR-1 level was decreased in dose -dependently in MI mice treated with 0.2, 1 and 5 mg/L t-AUCB (Figure 3A). [score:1]
Growing evidence indicated that microRNA-1 (miR-1) was a proarrhythmic factor in the ischemic heart. [score:1]
However, co-application of t-AUCB and miR-1 agomir could rescue this effect. [score:1]
Activation of transcription factor CREB was able to promote the transcription of miR-1 gene. [score:1]
The result indicated that miR-1 might also had effects on the mRNA stability of KCNJ2 and GJA1 genes. [score:1]
In addition, we also tested the distribution of miR-1 agomir after in vivo transfer procedures (Supplementary Figure 3). [score:1]
The aim of the present study was to investigate whether the anti-arrhythmic effects of sEHi were related to miR-1 expression in a mouse mo del of MI. [score:1]
miR-1 level were analyzed by real-time reverse transcription (RT)-PCR using the TaqMan MicroRNA RT Kit (Applied Biosystems). [score:1]
Consistent with our study, Shan et al. [14] reported that miR-1 level were increased 1.2-fold and 2.9-fold in rat hearts at 6 h and 3 months, respectively, after MI. [score:1]
We injection the agonist miR-1 agomir (10 nM) via the tail vein and found that agomir treatment caused a 16.07-fold increase in miR-1 level in the MI mice (P < 0.05). [score:1]
miR-1 level were quantificated by real-time PCR with RNA samples isolated from mice hearts 24 h after MI. [score:1]
This increased tendency of miR-1 was abolished by pretreatment with t-AUCB. [score:1]
We demonstrated, for the first time, that sEHi t-AUCB could abolish the repressing effects of miR-1 on KCNJ2/Kir2.1 and GJA1/Cx43 mRNA/protein in MI mouse hearts. [score:1]
In contrast, transfection of miR-1 agomir promoted ischemic arrhythmias. [score:1]
Real-time PCR detection of miR-1, KCNJ2, and GJA1 mRNA. [score:1]
Effects of t-AUCB on levels of miR-1, KCNJ2 and GJA1 mRNA in MI mice. [score:1]
Potential role of AKT/GSK3β signaling pathway in miR-1 reduction by sEHi. [score:1]
miR-1 expression was calculated after normalization to U6. [score:1]
It had been established that miR-1 was a proarrhythmic factor in the MI heart. [score:1]
Agomir of miR-1 (10 nM of ribonucleotide diluted in 0.2 mL saline) were injected via the tail vein after occlusion. [score:1]
[1 to 20 of 68 sentences]
9
[+] score: 244
G6PD mRNA expression was down-regulated by 71% in Hela (Hela-plenti-miR-1, P < 0.01) and by 65% in Siha (Siha-plenti-miR-1, P < 0.01) cells overexpressing miR-1. Treatment with plenti-G6PD partially restored G6PD expression in both Hela-plenti-miR-1 and Siha-plenti-miR-1 cells. [score:10]
G6PD is a novel target of miR-1. G6PD is a potential target of miR-1. Identification of the G6PD mRNA 3′-UTR seed region directly regulated by miR-1. Decreased miR-1 expression is associated with pathological features in HR-HPV-infected cervical cancer patients. [score:9]
In conclusion, we demonstrated that: i) miR-1 bound to the 3′-UTR seed region of G6PD mRNA; ii) decreased miR-1 expression in HR-HPV 16/18-infected cervical carcinoma was correlated with carcinogenic development; iii) overexpression of miR-1 down-regulated G6PD, reduced proliferation, and promoted apoptosis in HR-HPV16/18+ cervical cancer cells; iv) co-transfection of both G6PD siRNA and miR-1 sponge partially reversed miR-1 sponge -induced promotions in cell viability and neoplasm growth. [score:9]
To determine whether miR-1 contributed to carcinogenic events in HR-HPV-infected cervical cancer by targeting G6PD, miR-1 overexpression and/or miR-1 inhibition was established in cultured cervical cancer cells with or without G6PD overexpression. [score:9]
These findings, together with our results, indicate that miR-1 inhibits proliferation and promotes apoptosis in cervical cancer both in vitro and in vivo by targeting G6PD, suggesting that G6PD -targeting treatments may provide a new strategy for cervical cancer therapy. [score:7]
Taken together, these results indicate that miR-1 might suppress the development and progression of HR-HPV-16/18+ cervical cancer by directly targeting G6PD, and that miR-1 might therefore be a valuable novel therapeutic candidate. [score:7]
In this study, we demonstrate that miR-1 might suppress the development and progression of HR-HPV 16/18-infected cervical cancer by targeting G6PD. [score:6]
Together, these in vitro and in vivo results indicate that miR-1 might suppress the development and progression of HR-HPV-16/18+ cervical cancer by targeting G6PD. [score:6]
To further examine whether miR-1 directly targets G6PD mRNA in HR-HPV 16/18-infected (+) cervical cancer cells, G6PD expression was measured using qRT-PCR and Western blot in Hela and Siha cells transfected with miR-1 overexpression or control vectors. [score:6]
These data demonstrated that miR-1 down-regulated G6PD expression by binding to the predicted regions of the G6PD mRNA 3′-UTR. [score:6]
Five mice were randomly assigned to each of the following 17 groups: normal human cervical epithelial H8 cells (H8) -treated group; miR-1 overexpression cervical cancer cell (Hela/Siha-plenti-miR-1) -treated groups; miR-1 deficient human cervical cancer cell (Hela/Siha-miR-1-sponge) -treated groups; matched control groups (Hela/Siha-lemiR and Hela/Siha-CX-control); G6PD rescue groups (Hela/Siha-plenti-miR-1 + plenti-G6PD, Hela/Siha-plenti-miR-1 + G6PD control); and G6PD inhibition groups (Hela/Siha-miR-1-sponge + G6PD-siRNA, and Hela/Siha-miR-1-sponge + Empty-siRNA). [score:5]
Based on the TargetScan, miRanda, and Diana microT computational algorithms, we determined that miR-1, miR-133a, and miR-206 might target a combined site in the G6PD 3′-UTR gene sequence. [score:5]
G6PD protein expression was detected using in Hela and Siha cells transfected with miR-1 overexpression or sponge vectors according to a previously described protocol [5]. [score:5]
Plenti-G6PD treatment partially attenuated the inhibition of proliferation and increase in apoptosis caused by miR-1 overexpression in Hela-plenti-miR-1 and Siha-plenti-miR-1 cells (Figure 5). [score:5]
Plenti-G6PD -induced G6PD overexpression partially reversed the inhibition of xenograft growth resulting from plenti-miR-1 treatment alone. [score:5]
Our results demonstrate that miR-1 inhibited G6PD expression in human cervical cancer cells and tumors. [score:5]
By reducing G6PD expression, miR-1 inhibited proliferation and promoted apoptosis in HR-HPV+ cervical cancer cells, and reduced the growth of tumor xenografts in nude mice. [score:5]
In contrast, inhibition of miR-1 increased G6PD mRNA expression 2.3-fold in Hela cells and 1.8-fold in Siha cells (both P < 0.05) (Figure 3A). [score:5]
In this study, we demonstrated that G6PD is also a direct target of miR-1 in cervical cancer cells. [score:4]
However, partial G6PD knockdown counteracted miR-1 overexpression -induced growth (miR-1-sponge + G6PD-siRNA vs. [score:4]
These results indicate that miR-1 inhibited proliferation and promoted apoptosis and tumor formation in HR-HPV+ cervical cancer by down -regulating G6PD. [score:4]
miR-1 inhibited proliferation and promoted apoptosis in cervical cancer cells by down -regulating G6PD. [score:4]
Wild-type (wt) and mutant (mut) human G6PD mRNA 3′-UTR seed regions, which included the potential target site for miR-1, were cloned. [score:3]
A lentiviral system was used for miR-1 overexpression. [score:3]
All of the databases examined predicted two potential miR-1 target regions in the G6PD mRNA 3′-UTR (“seed regions”) (Figure 3D). [score:3]
Similarly, co-transfection of miR-1-sponge and G6PD-siRNA neutralized the increase in proliferative capacity and inhibition of apoptosis induced by miR-1-sponge treatment alone. [score:3]
We simultaneously used miRNA sponge technology to inhibit miR-1 activity in cultured cervical cancer cells [24, 25]. [score:3]
Levels of these miR-1 targets in miRNPs are also shown following miR-133a/206 transfection. [score:3]
MiR-1 inhibits proliferation and promotes apoptosis in cervical cancer cells by down -regulating G6PD. [score:3]
miR-1 expression in cervical cancer cells and samples. [score:3]
Computational predictions, RIP-Chip assays, and dual-luciferase reporter assays revealed that G6PD mRNA was the most highly-expressed target of miR-1 in cultured HR-HPV+ Hela and Siha cells. [score:3]
The relationship between miR-1 expression and HPV 16/18 infected in CC patients (N = 57). [score:3]
Low miR-1 expression was correlated with FIGO stages I–II (I, P = 0.000; II, P = 0.000), increased cell differentiation (well, P = 0.000; moderate, P = 0.001), and tumor diameter (≤ 4, P = 0.000; > 4, P = 0.03, Table 1). [score:3]
To determine whether increased miR-1 expression was associated with cervical cancer, surgical tissue samples from 57 HR-HPV+ cervical cancer patients and matched controls were examined. [score:3]
These results indicate that the loss of miR-1 -induced G6PD suppression may play a crucial role in pathogenic events in HR-HPV+ cervical cancer. [score:3]
Additionally, Hela/Siha-plenti-miR-1 was co -transfected with plenti-G6PD using the lentiviral overexpression system described above (named Hela/Siha-plenti-miR-1 + plenti-G6PD). [score:3]
Furthermore, regression analysis revealed that increased miR-1 levels in HR-HPV 16/18-infected cervical carcinoma were correlated with cancer inhibition. [score:3]
To verify direct interactions between miR-1 and the seed regions, a wild-type G6PD 3′-UTR (G6PD 3′-UTR-wt) and a chemically synthesized G6PD 3′-UTR with two seed region mutations(G6PD 3′-UTR-mut) were cloned into dual-luciferase reporter plasmids. [score:3]
These findings suggest that miR-1 targets G6PD. [score:3]
Tumor sizes were smaller in the miR-1 overexpression groups (plenti-miR-1 and plenti-miR-1 + G6PD control) than in the other groups between 16 and 27 days post-injection (P < 0.05). [score:3]
The top ten miR-1 targets identified by RIP-Chip are shown in Figure 2B; mRNAs enriched following miR-1 transfection are listed in the Supplemental data. [score:3]
RNA associated with AGO protein complexes was then isolated for microarray profiling to identify transcriptome-wide miR-1/133a/206 targets in cervical cancer cells. [score:3]
Databases were subsequently used to identify the potential target region of miR-1 in the G6PD mRNA 3′-UTR. [score:3]
G6PD-siRNA treatment partially reversed these miR-1 inhibition -induced effects. [score:3]
Dysregulation of miR-1 is involved in carcinogenic events in various cancers, including colon cancer [36, 37], hepatocellular carcinoma [38], and esophageal squamous cell carcinoma (ESCC) [39]. [score:2]
qRT-PCR revealed that decreased miR-1 expression and increased G6PD levels correlated with cancer development and malignant characteristics. [score:2]
Meanwhile, apoptosis rates markedly increased in miR-1 -overexpressing cells compared to control lemiR-infected cells (Figure 5B). [score:2]
miR-1 expression decreased in Hela and Siha cells compared to C33A cells (0.21 ± 0.02 in Hela vs. [score:2]
The vast majority of mRNAs examined were not enriched in miRNPs following miR-1 transfection (A). [score:1]
Luciferase activity decreased by approximately 77% when miR-1 mimics were co -transfected with the G6PD 3′-UTR-wt plasmid (P < 0.01), but not with the G6PD 3′-UTR-mut plasmid (P > 0.05) (Figure 3E). [score:1]
We then used co-IP RIP-Chip to validate these predictions and found that miR-1 had the strongest interaction with G6PD. [score:1]
In addition, patients with low miR-1 levels in cervical cancer samples had higher HR-HPV 16 and HPV 18 infection rates (P < 0.05, Table 2). [score:1]
Quantitative PCR for miR-1/133a/206 was performed using an Applied Biosystems 7300 Sequence Detection system. [score:1]
Multivariate analysis of HPV status and miR-1 levels in women diagnosed as CC (N = 57). [score:1]
miR-1-sponge + Empty-siRNA, P < 0.05). [score:1]
Briefly, 293T cells were seeded in 96-well plates and co -transfected with 100 ng/mL of the individual pGL3-G6PD 3′-UTR-wt/mut vectors and 50 nM miR-1 mimics or NC (Ribobio, Guangzhou, China). [score:1]
Similarly, Hela/Siha-miR-1-sponge was co -transfected with G6PD-siRNA plasmid; co-transfection with Empty-siRNA served as a control (named Hela/Siha-miR-1-sponge + G6PD-siRNA and Hela/Siha-miR-1-sponge + Empty-siRNA, respectively). [score:1]
RIP-Chip consistently indicated that G6PD mRNA was more strongly incorporated into miRNPs following miR-1 transfection than the other mRNAs examined (Figure 2A and Figure 2B). [score:1]
The plasmids were then co -transfected with miR-1 mimics or miRNA negative control (NC). [score:1]
At 27 days post injection, tumors were smallest in the G6PD -deficient siRNA -treated group and the plenti-miR-1 treated group and largest in the miR-1 sponge -transfected groups. [score:1]
Cultured Hela and Siha cells were transfected with pCMV-d2eGFP-miR-1 (destabilized eGFP with the miR-1 sponge in the 3′-UTR, named Hela/Siha-miR-1-sponge) or pCMV-d2eGFP-CXCR4 as a control (destabilized eGFP with the CXCR4 non -binding sponge sequence, named Hela/Siha-CX-control). [score:1]
Hela and Siha cells were transfected with plenti-miR-1, lemiR, plenti-miR-1+plenti-G6PD, plenti-miR-1+G6PD control, miR-1-sponge, CX-control, miR-1-sponge+G6PD-siRNA, or miR-1-sponge+Empty-siRNA. [score:1]
Hela and Siha cells were co -transfected with plenti-miR-1 along with the packaging plasmids psPAX2 and pMD2. [score:1]
Tumor growth was fastest in mice treated with miR-1 sponge -treated cervical cancer cells (miR-1-sponge and miR-1-sponge + Empty-siRNA groups, Figure 6). [score:1]
After 24 hours, cells were transfected with 25 nM “Pre-miRNA” (Ambion) for has-miR-1, has-miR-133a, has-miR-206, or Negative Control (NC, Ambion, Austin, TX, sense sequence AGUACUGCUUACGAUACGG) using RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions [13]. [score:1]
After confirming successful miR-1/133a/206 transfection, Affymetrix GeneChip microarrays were used to profile mRNAs associated with miRNPs following miR-1/133a/206 transfection. [score:1]
Effects of miR-1/G6PD on tumor formation in nude mice. [score:1]
Figure 4qRT-PCR was used to measure miR-1/133a/206 expression in different cervical cancer cells and in carcinoma samples from cervical cancer patients. [score:1]
G (Addgene), respectively (named Hela-plenti-miR-1 and Siha-plenti-miR-1). [score:1]
Co-immunoprecipitation (co-IP) revealed that transfected miR-1, miR-133a, and miR-206 were specifically incorporated into miRNPs in both Hela (Figure 1A) and Siha cells (Figure 1B). [score:1]
Figure 6H8 cells, Hela and Siha cells transfected with plenti-miR-1, lemiR, plenti-miR-1+plenti-G6PD, plenti-miR-1+G6PD control, miR-1-sponge, CX-control, miR-1-sponge+G6PD-siRNA, or miR-1-sponge+Empty-siRNA were injected into nude mice. [score:1]
miR-1:G6PD mRNA interaction. [score:1]
Relative G6PD enrichment in miRNPs consistently increased more than 50-fold following miR-1 transfection. [score:1]
We then performed regression analysis to examine the association between miR-1 levels and clinicopathologic parameters. [score:1]
Figure 1Northern blot analysis of miRNPs isolated after transfections with miR-1/133a/206 in Hela (A) and Siha (B) cells; these miRNAs were specifically recruited to miRNPs. [score:1]
Hela/Siha-plenti-miR-1 co -transfected with lemiR served as a control (named Hela/Siha-plenti-miR-1 + G6PD control). [score:1]
Therefore, miR-1 may serve as a novel therapeutic candidate in the treatment of HR-HPV 16/18-infected cervical cancer. [score:1]
miR-1/133a/206 expression was evaluated in different cervical cancer cell lines using qRT-PCR. [score:1]
H8 cells, Hela and Siha cells transfected with plenti-miR-1, lemiR, plenti-miR-1+plenti-G6PD, plenti-miR-1+G6PD control, miR-1-sponge, CX-control, miR-1-sponge+G6PD-siRNA, or miR-1-sponge+Empty-siRNA were injected into nude mice. [score:1]
analysis of miRNPs isolated after transfections with miR-1/133a/206 in Hela (A) and Siha (B) cells; these miRNAs were specifically recruited to miRNPs. [score:1]
qRT-PCR revealed that miR-1 levels were lower in neoplasm tissues than in normal tissues (0.34 ± 0.04 vs. [score:1]
Figure 2RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
All enrolled patients were then divided into two groups based on miR-1 levels; patients with miR-1 levels less than or equal to the median were assigned to the low level group, while those with miR-1 levels greater than the median were assigned to the high level group [33]. [score:1]
RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
Tumors were larger in miR-1 sponge -treated groups than in the other groups 16 days post-injection (P < 0.05). [score:1]
Among the many miRNAs identified, miR-1, miR-133a, and miR-206, each of which were predicted by all three software programs, were chosen for further validation. [score:1]
In control cells, plenti-miR-1 was replaced by control lemiR (named Hela-lemiR and Siha-lemiR). [score:1]
[1 to 20 of 87 sentences]
10
[+] score: 243
Other miRNAs from this paper: mmu-mir-1a-2, mmu-mir-1b
Moreover, enforced expression of miR-1 led to a reduction of Stx6, and knockdown of endogenous miR-1 induced an increase in Stx6 expression both at protein and mRNA levels (Fig. 6C & D), indicating that miR-1 negatively regulated the Stx6 expression by transcriptional inhibition. [score:11]
As shown in Fig. 8A and B, overexpression of miR-1 or response to hypoxia in CMs resulted in the up-regulation of PLM and down-regulation of Cav1.2, whereas forced expression of Stx6 alleviated these effects of miR-1 or hypoxia. [score:11]
The targets which were significantly down-regulated in the mice with over -expression of miR-1 (FDR < 0.05) were marked with green color and the targets with FDR < 0.01 were marked with dark green. [score:10]
Scrutinizing the Fig. 2, the differentially expressed targets of miR-1 were mainly involved in the ion-related BP, including GO:0055076 (transition metal ion homeostasis, P = 1.86 × 10 [−4]), GO:2000021 (regulation of ion homeostasis, p = 2.18 × 10 [−4]), GO:0051279 (regulation of release of sequestered calcium ion into cytosol, p = 2.62 × 10 [−4]), GO:0051924 (regulation of calcium ion transport, p = 3.60 × 10 [−4]), GO:0055072 (iron ion homeostasis, p = 4.38 × 10 [−4]) and GO:0010522 (regulation of calcium ion transport into cytosol, p = 4.38 × 10 [−4]). [score:9]
Firstly, we found that the differentially expressed genes in miR-1 Tg mice were significantly enrichment with the trafficking-related biological processes, and up-regulation of miR-1 significantly inhibited trafficking-related genes. [score:8]
To further validate results derived from microarray, we performed qRT-PCR expression analysis for the most differentially expressed genes that were targeted by miR-1 in the vesicle -mediated transport pathway. [score:7]
Hierarchical clustering of expression values of differentially expressed miR-1 targets was performed with R software using the metric of Euclidean distance and average linkage. [score:7]
In the gene expression profile, totally 787 genes were predicted to be targeted by the miR-1 in the TargetScan database. [score:7]
Our data revealed that miR-1 could suppress the luciferase activity of wild-type Stx6, and this suppressive effect was reversed by the miR-1 inhibitor. [score:7]
GO biological process terms with significant enrichment of differentially expressed miR-1 targets. [score:5]
We found that 132 and 38 targets of miR-1 were significantly differentially expressed in the miR-1 Tg mice under the control of FDR < 0.05 and FDR < 0.01, respectively. [score:5]
Heatmap of hierarchical clustering of differentially expressed targets of miR-1 in miR-1 Tg mice (TG) and wild type mice (WT). [score:5]
Under the control of FDR < 0.05, we found the differentially expressed targets of miR-1 were significantly enriched in the 21 terms (Fig. 2). [score:5]
Above results indicate that over -expression of miR-1 could inhibit the trafficking-related genes which participate in the vesicle -mediated transport pathway. [score:5]
These data indicated that over -expression of miR-1 resulted in the imbalance of intracellular Ca [2+] by modulating PLM through direct regulation of Stx6, and then contributed to arrhythmia in mice. [score:5]
We used the hypogeometric distribution mo del to test whether the differentially expressed targets of miR-1 were significantly enrichment with the biological processes (BP). [score:5]
The predicted target mRNAs of miR-1 were downloaded from the TargetScan database with release version 6.2 (http://www. [score:5]
To identify whether Stx6 is a direct target of miR-1 through this specific binding site, we constructed a wild type luciferase reporter gene vector containing the 3′UTR of Stx6 or mutant vector with several mutations in the binding site. [score:5]
Thus, we inferred that the differentially expressed targets of miR-1 in the miR-1 Tg mice behaved certain relationship with ion homeostasis in the trafficking system. [score:5]
Validation of differentially expressed target genes of miR-1 by quantitative RT-PCR and western blot. [score:5]
We found that miR-1 was significantly up-regulated in miR-1 Tg mice (Fig. 4A). [score:4]
In Fig. 3, 11 of 58 the vesicle -mediated transport pathway genes were significantly down-regulated in miR-1 Tg mice (FDR < 0.05). [score:4]
Second, our study suggested that the logistics molecules Stx6 is a direct target of miR-1 and participated in the process of miR-1 -induced arrhythmia. [score:4]
These results indicated that miR-1 caused the imbalance of Ca [2+] homeostasis in CMs at least partly via down-regulation of Stx6. [score:4]
MiR-1 is an important regulator of heart adaption after ischemic stress and is up-regulated in patients with myocardial infarction 17 29. [score:4]
miR-1 regulated 58 genes in vesicle -mediated transport pathway (Fig. 3), and the result showed that targets of miR-1 were significantly enrichment with the vesicle -mediated transport pathway genes (p = 4.23 × 10 [−3]). [score:4]
Stx6 is one of the direct targets of miR-1.. [score:4]
The microarray results showed that Braf, Ube3a, Mapk8ip3, Stx6 and Ap1s1 were most significantly down-regulated in the miR-1 Tg mice (FDR < 0.01). [score:4]
In this study, we found that Stx6 was decreased in MI tissues and hypoxic CMs and negatively regulated by miR-1. These studies indicated that Stx6 might serve as a potential target for ischemic arrhythmia. [score:4]
The generation of cardiomyocytes-specific over -expression of microRNA-1 (miR-1 Tg) mice was described in previous study 18. [score:3]
Over -expression of miR-1 broke the balance of Ca [2+], and induced cardiac arrhythmia. [score:3]
To investigate the function of the differentially expressed targets of miR-1 in the miR-1 Tg mice, we performed the biological process enrichment analysis using hygeometric mo del. [score:3]
The targets of miR-1 are functionally enriched with ion-related process. [score:3]
The two-tailed T-test was used to identify genes that were significantly differentially expressed between miR-1 Tg mice and WT mice. [score:3]
Neonatal mice CMs were transfected with Stx6 during overexpression of miR-1 (A) or hypoxia (B), and western blot was applied to analyze the protein levels of PLM and Cav1.2. [score:3]
From the TargetScan database, we predicted the sequence position 73–79 in the 3′UTR of Stx6 as a putative miR-1 binding site (Fig. 6A). [score:3]
As expected, miR-1 Tg mice exhibited an increase of PLM protein expression level and decrease of Cav1.2 protein level (Fig. 8D). [score:3]
More importantly, the protein levels of these differentially expressed trafficking-related genes were dramatically lower in miR-1 Tg mice too (Fig. 4C). [score:3]
Then, vesicle -mediated transport (GO:0016192), a key pathway during the trafficking process, was significantly enriched with the differentially expressed genes in the miR-1 Tg mice (p = 4.48 × 10 [−4]). [score:3]
We then co -transfected the reporter with miR-1 mimics or miR-1 inhibitor (AMO-1) into HEK293 cells. [score:3]
Round rectangle depicts miR-1 and octagon depicts targets of miR-1.. [score:3]
In addition, we found that over -expression miR-1 could increase the PLM level and decrease the Cav1.2 level both in vivo and in vitro. [score:3]
Stx6 is one of the targets of miR-1. Defect of Stx6 disturbs the intracellular Ca [2+]. [score:3]
How to cite this article: Su, X. et al. Over -expression of microRNA-1 causes arrhythmia by disturbing intracellular trafficking system. [score:3]
Distinct gene expression level emerges between miR-1 Tg mice and WT mice. [score:3]
Network of miR-1 regulated trafficking-related genes. [score:2]
Under the control of FDR < 0.05, 3417 genes were differentially expressed in the miR-1 Tg mice when compared with the WT group. [score:2]
However, the exact role of miR-1 in regulating the trafficking process is still unclear. [score:2]
Thus, we focused on analyzing the roles of miR-1 in regulating the pathway of vesicle -mediated transport. [score:2]
The dysregulation of trafficking-related genes in miR-1 Tg mice. [score:2]
We found that some trafficking-related genes were deregulated in miR-1 Tg mice, indicating that vesicle -mediated transport pathway may contribute to the process of miR-1 -induced arrhythmia in mice. [score:2]
The miR-1 regulates trafficking-related network. [score:2]
These data confirmed that miR-1 could regulate the trafficking-related genes. [score:2]
Meanwhile, we investigated the effect of miR-1 on expression of PLM and Cav1.2. [score:1]
CMs were transfected with 100 nmol/L miR-1, with X-treme GENE siRNA transfection reagent. [score:1]
miR-1. (A) Western blot analysis for the protein levels of PLM and Cav1.2 in myocardial infarcted mice heart tissues. [score:1]
qRT-PCR detection (B) and Western blot analysis (C) for trafficking-related genes in WT and miR-1 Tg mice. [score:1]
miR-1 or Hypoxia. [score:1]
Western blot (C) and qRT-PCR (D) were adopted to examine the effect of miR-1 on the protein and mRNA levels of Stx6. [score:1]
HEK293 cells were co -transfected in 24-well plates with the Stx6 WT or mutant constructs and miR-1, using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). [score:1]
Total RNA was extracted from three miR-1 Tg mice and three wild type (WT) mice, respectively. [score:1]
Thus, we considered whether miR-1 participates in the intracellular trafficking process by regulating trafficking-related genes. [score:1]
However, the mutated form of Stx6 3′UTR demonstrated lesser response to miR-1 (Fig. 6B). [score:1]
We performed bioinformatic and molecular biological methods to explore the role of miR-1 in intracellular trafficking process. [score:1]
[1 to 20 of 64 sentences]
11
[+] score: 221
In hypertrophic adult rat VCMs, down-regulation of miR-1/miR-133 levels promotes automaticity via up-regulation of HCN2/HCN4, but this defect can be reversed by forced expression of miR-1/miR-133 [10], [11]. [score:9]
It is possible that miR-1 targets a transcriptional or translational repressor or negative functional inhibitor of these ion channels, Adding another level of complexity is our previously reported observation that the transcript levels and functionality of ion channels do not necessarily correlated [27] because ion channel functions (gating and permeation) often depend on the presence of accessory units (such as beta subunit) and other factors (e. g., post-translational modification such as glycosylation). [score:9]
The ventricular-restricted expression pattern of miR-1, -30b, -126, -133, and -499 starkly contrasted the reverse pattern of pluripotency -associated miRs that were differentially expressed in hESCs, and the stable expression levels of miR-188 and -296, which remained relatively unchanged across the different developmental stages examined as reflected by the small variances (Figure 1A, D). [score:8]
We also showed that GATA4 is a probable target of miR-499 but not miR-1. However, our data did not allow us to exclude the possibility that GATA4 down-regulation was merely an indirect or secondary effect. [score:7]
Figure 4A shows that LV-miR-1 transduction led to significant (p<0.05) up-regulation of the Kir2.1, Kv1.4, HERG, and DHPR transcripts and down-regulation of HCN4. [score:7]
These putative miR-1 and -499 targets agreed with our transcriptomic data and met one of two criteria: 1) The gene was expressed below a normalized log [2] value of 1.0 (∼500 signal intensity units) in all CM types assayed or 2) The gene was expressed below a normalized log [2] value of 2.0 (∼1000 signal intensity units) AND was expressed at least 2-fold lower in hE-, hF- and hA-VCMs compared with undifferentiated hESCs. [score:7]
Furthermore, miR-1 overexpression in hESC-VCMs led to the upregulation of some ionic currents. [score:6]
By contrast, I [Ks] was not expressed in hE-VCMs but was up-regulated by LV-miR-1. These results suggest that the effects of miR-1 on VCMs are context -dependent. [score:6]
Among these, GATA4 is a predicted target of miR-499 but not miR-1. Consistent with this prediction, transduction of hE-CMs by LV-miR-499, but not LV-anti-miR-499, led to a 3-fold downregulation of GATA4 (p<0.05). [score:6]
Of the remaining miRs differentially expressed in hE-VCMs, 23 continued to express highly in hF- and hA-VCMs, with miR-1, -133, and -499 displaying the largest fold differences; others such as miR-let-7a, -let-7b, -26b, -125a and -143 were non-cardiac specific. [score:5]
In adult rat ventricular myocytes, miR-1 overexpression has been shown to markedly increase I [Ca,L] [43] and suppress the α and β subunits of I [Ks] (i. e. KCNQ1 and KCNE1) [44]. [score:5]
Similar to the pro-cardiogenic role of miR-1, β-MHC also became significantly upregulated (2.5-fold; p<0.05) in EBs from stably LV-miR-499-transduced hESCs, although α-MHC was unaffected (p>0.05). [score:4]
This observation was consistent with the upregulation of NKX2.5 seen in EBs differentiated from LV-miR-1-transduced, but not LV-miR-133-transduced or WT, H7 hESCs that Srivastava and colleagues reported [8]. [score:4]
Conversely, the expression of miR-1, -499, and -133 varies greatly across developmental stages. [score:4]
Analysis of Putative Transcriptomic Effects of miR-1 and -499 Expression in CM Development and Maturation. [score:4]
Interestingly, LV-miR-499, but not -anti-499 or –miR1, upregulated MEF2C (by ∼2.5-fold, p<0.05). [score:4]
Consistently, Sluijter et al. independently identified the upregulation of miR-1 and -499 in beating cardiomyocytes differentiated from human fetal cardiac progenitors [47]. [score:4]
Interestingly, LV-miR-1-transduction of hE-CMs significantly upregulated GATA4 (by 15-fold; p<0.05). [score:4]
Consistently, after LV-miR-1 transduction, the transcripts of junctin (Jnct), triadin (Trdn) and ryanodine (RyR2) that play a role in Ca [2+] release were significantly up-regulated (p<0.05) whereas that of SERCA2a for Ca [2+] re-uptake was not affected (p>0.05; Figure 6E). [score:4]
Table S4 Summary of the numbers of the corresponding predicted targets of miR-1 or -499 in each of these select pathways. [score:3]
Next we performed target and pathway analyses of miR-1 and -499. [score:3]
Figure 4B shows that LV-miR-1-transduced hE-VCMs expressed nifedipine-sensitive (5 µM) L-type Ca [2+] channels (I [Ca, L]), a depolarizing component that underlies the Phase 2 plateau phase, with current densities, steady-state activation and inactivation properties not different from control hE-VCMs (p>0.05). [score:3]
C) Transcriptional expression of cardiac sarcomeric genes in LV-miR-1-, 133- and 499-transduced hESC-CMs. [score:3]
A) Transcriptomic analysis of predicted targets for miR-1 and -499 involved in select pathways as indicated. [score:3]
Transient transfection to overexpress miR-1 or -499 in these human progenitors reduces their proliferation by repressing histone deacetylase 4 or Sox6 although no functional properties were reported. [score:3]
A) Transcriptional expression of sarcolemmal ion channels (Kir2.1, HCN4, Kv1.4, Kv4.3, HERG, SCN5A, DHPR) in hESC-CMs after LV-miR-1 transduction. [score:3]
Similar to the reciprocal relationship described for normal and failing adult human CMs [14], we identified multiple functional groups of transcripts that were expressed at low levels (i. e. green) in the miR-1 and miR-499 abundant hE-, hF- and hA-VCMs. [score:3]
Upon cardiac differentiation of stably LV-miR-1-transduced hESCs by EB formation, however, all of α-MHC and β-MHC were significantly upregulated (2- and 3-fold increases, respectively) compared to EBs derived from control WT hESCs (p<0.05). [score:3]
By contrast, miR-1 has no effect on the percent yield of VCMs from hESC differentiation, but it uniquely facilitates electrophysiological and Ca [2+]-handling maturation by altering the expression levels of several immature related components (I [to], I [Kr], I [Kr] and I [f]) to levels closer to those of adults. [score:3]
The numbers of genes in each of these select pathways and the numbers of predicted miR-1 and -499 targets in these pathways are given in Table S4. [score:3]
Figure 7A shows the transcriptional profile heatmaps of miR-1 and -499 predicted targets identified in the selected GO/pathways as indicated. [score:3]
0027417.g004 Figure 4A) Transcriptional expression of sarcolemmal ion channels (Kir2.1, HCN4, Kv1.4, Kv4.3, HERG, SCN5A, DHPR) in hESC-CMs after LV-miR-1 transduction. [score:3]
Quantitative PCR confirmed these patterns and further showed that among all the plateau miRs identified (cardiac-specific or not), miR-1, -133, and -499 were most differentially expressed in hE-, hF- and hA-VCMs relative to hESCs after scaling the ΔCT values of each VCM type by the corresponding hESC value (with ratios of 15.0, 15.8, and 12.9, respectively versus 5.1 to 9.4 of the other seven miRs; Figure 1C). [score:3]
For instance, a 50% decrease in total miR-1 results in embryonic death attributable to ventricular septal defects and cardiac dysfunction [5]; whereas, miR-1 over -expression in adult murine ventricular (V) cardiomyocytes (CMs) promotes arrhythmogenesis by slowing conduction and depolarizing the sarcolemmal membrane via post-transcriptional repression of the Kir2.1-encoded inwardly rectifying current (I [K1]) and connexin (Cx) 43 -mediated gap junction [9]. [score:3]
Hyperpolarizing K [+] currents that are crucial for repolarization such as the transient outward current (I [to]), the slow (I [Ks]) and rapid (I [Kr]) components of the delayed rectifier, pharmacologically separated by their specific blockers 4-aminopyridine (4AP; 100 µM), Chromanol 293B (30 µM) and E4031 (10 µM), respectively, were weakly expressed or absent in control hE-VCMs but became significantly augmented after LV-miR-1 transduction (Figure 5, p<0.05). [score:3]
Indeed, miR-499 and miR-1 shared a number of overlapping targets including those that are known to play important roles in early cardiogenesis. [score:3]
Using established algorithms, we generated a list of 1448 and 1226 predicted mRNA targets for miR-1 and -499, respectively. [score:3]
However, our experiments showed that hE-VCMs already expressed I [Ca,L] at a level comparable to that in adult and I [Ca,L] remained unaltered after LV-miR-1 transduction. [score:3]
0027417.g007 Figure 7A) Transcriptomic analysis of predicted targets for miR-1 and -499 involved in select pathways as indicated. [score:3]
In mouse mo dels, several miRs have been implicated in normal cardiovascular development (e. g., miR-1, 18b, 20b, 21, 106a, 126, 133, 138, and 208) [3]– [8]. [score:2]
Target and pathway analyses of MiR-1 and -499. [score:2]
Subsequently, miR-1 regulates physiological hypertrophy and other changes in cell cycle and size, which in turn lead to a series of well-orchestrated functional changes in electrophysiological, Ca [2+]-handling and contractile properties for maturation. [score:2]
According to these analyses, miR-499 is most closely associated with the regulation of embryonic stemness, cell proliferation, cell size and apoptosis; whereas, miR-1 is implicated in control of embryonic stemness, cell cycle, hypertrophy and cell size. [score:2]
To assess any cytotoxic effect that miR-1, -133 or -499 expression might have on hE-CMs, a colorimetric MTT assay for cellular metabolisms was performed. [score:2]
To study the roles of miR-1 and -499 at a later stage of cardiac induction and chamber specification, we next transduced 20-day old cardiospheres derived by directed differentiation of WT hESCs [17]. [score:2]
Of note, however, a hyperpolarization overshoot followed by a Phase 4-like depolarization, pro-arrhythmic traits not observed in mature adult VCMs, were present in both control and LV-miR-1-transduced cells, indicating that the pro-maturation effect of miR-1 was at best partial. [score:1]
Currents and Current-Voltage Relationships in Control and miR-1 Transduced hE-VCMs. [score:1]
Figure S2 summarizes our criteria for selecting miR-1, -133 and -499 for further experiments. [score:1]
Also, LV-miR-1 but not -499 augmented the immature Ca [2+] transient amplitude and kinetics. [score:1]
LV-anti-miR-1 did not affect these AP parameters (Figure S5). [score:1]
A, C and E) Representative tracings of I [to], I [Kr] and I [Ks] recorded from WT, LV-miR-1-transduced E-VCMs as labeled. [score:1]
0027417.g005 Figure 5A, C and E) Representative tracings of I [to], I [Kr] and I [Ks] recorded from WT, LV-miR-1-transduced E-VCMs as labeled. [score:1]
By contrast, LV-miR-1 transduction did not bias the yield (p>0.05) but decreased APD and hyperpolarized RMP/MDP in hE-VCMs due to increased I [to], I [Ks] and I [Kr], and decreased I [f] (p<0.05) as signs of functional maturation. [score:1]
Calcium Handling in Control and miR-1, -133, and -499 Transduced hE-VCMs. [score:1]
0027417.g003 Figure 3A) Representative AP tracings of Control, LV-miR-1- and -miR-499-transduced hESC-derived ventricular derivatives as labeled. [score:1]
Neither LV-miR-1 nor -499 had effects on hE-derived atrial CMs when their percent distribution and AP parameters were assessed (Figure 2, Figure S4 and Table S2), suggesting that the effects observed were ventricular-specific. [score:1]
By contrast, none of miR-1, -133 and –anti-499 exerted any effect on contractile proteins (p>0.05). [score:1]
We conclude that miR-1 and -499 play differential roles in human cardiac differentiation: While miR-499 promotes ventricular specification in the context of hESC-derived cardiovascular progenitors, miR-1 serves to facilitate their electrophysiological maturation. [score:1]
In stark contrast, MESP1 was affected by none of LV-miR-1, miR-499 or –anti-miR-499 (p>0.05). [score:1]
B) Representative tracings of I [Ca,L] of control and LV-miR-1-transduced hE-VCMs as labeled. [score:1]
E) Representative tracings of I [f] recorded from control and LV-miR-1-transduced hE-VCMs. [score:1]
Figure S4 Representative AP tracings of Control, LV-miR-1- and -miR-499-transduced hE-ACMs, and bar graphs summarizing the AP parameters of the groups. [score:1]
Figure S5 Representative AP tracings of Control (n = 7) and LV-anti-miR-1-transduced (n = 8) hE-VCMs, and bar graphs summarizing the AP parameters of the groups. [score:1]
Figure S6 Representative tracings of Ca [2+] transients recorded from control (n = 6) and LV-anti-miR-1 transduced hESC-CMs (n = 12), and comparison of the amplitude, maximum upstroke velocity (V [max-upstroke], U) and maximum decay velocity (V [max-decay], D) of electrically -induced Ca [2+] transients of the two groups as indicated. [score:1]
No significant differences were observed among the control and experimental LV-miR-1-, 133- and -499-transduced groups (p>0.05; Figure S3). [score:1]
When normalized to the control group, transduction of hE-CMs by LV-miR-1, -133 and -499 led to significant 27.4±1.4-, 2.5±0.3- and 20.7±2.2-fold increase in the corresponding miRs, respectively (p<0.05). [score:1]
Ionic Basis of the effects of miR-1 on hESC-VCMs. [score:1]
Effects of miR-1 transduction on electrophysiological and molecular properties of hESC-derived CMs. [score:1]
Electrophysiological and Molecular Properties of Control and miR-1, -133, and -499 Transduced hE-VCMs. [score:1]
We conclude that miR-1 and -499 play differential roles in cardiac differentiation of hESCs in a context -dependent fashion. [score:1]
0027417.g006 Figure 6A) Representative tracings of Ca [2+] transients recorded from control, LV-miR-1-, 133- and 499-transduced hESC-CMs. [score:1]
While miR-499 promotes ventricular specification of hESCs, miR-1 serves to facilitate electrophysiological maturation. [score:1]
Figure S2 The criteria to select miR-1, -133 and -499 for further experiments. [score:1]
Although the ventricular yield was unchanged by miR-1, however, LV-miR-1 transduction of hE-CMs appeared to uniquely facilitate electrophysiological maturation: APD [50] and APD [90] decreased from 197.0±20.7 ms and 240.8±23.1 ms in control hE-VCMs to 139.7±14.2 ms and 174.7±16.6 ms (n = 17, p<0.05; Figure 3B–C) after miR-1 transduction, respectively. [score:1]
Consistent with the anticipated multi-faceted roles of miRs, miR-1 and -499 exert multiple but specific effects on a range of ion channel, Ca [2+]-handling and contractile proteins known to be important in ventricular biology. [score:1]
The effect on Ca [2+]-handling was consistent with a recent report of miR-1 enhancing excitation-contraction coupling by increasing phosphorylation of L- type and RyR2 channels [43]. [score:1]
B) The percentage distribution of ventricular, atrial and pacemaker phenotypes before and after LV-miR-1 or -miR-499 transduction. [score:1]
A) Representative AP tracings of Control, LV-miR-1- and -miR-499-transduced hESC-derived ventricular derivatives as labeled. [score:1]
Taken collectively, these results suggest that miR-1 and -499 play similar but distinct roles. [score:1]
Pie charts for B) miR-1 and C) -499 summarizing the number of genes (in parentheses) in each selected pathway or Gene Ontology (GO) classification that were found to agree with our transcriptomic data. [score:1]
LV-miR-1 (55.0% or n = 17 of 31, p>0.05), −133 (52.9% or n = 9 of 17, p>0.05) and –anti-499 (44.4% or n = 4 of 9, p>0.05) transduction also did not affect the ventricular yield. [score:1]
AP Parameters of Control and miR-1 and -499 Transduced hE-VCMs. [score:1]
A) Representative tracings of Ca [2+] transients recorded from control, LV-miR-1-, 133- and 499-transduced hESC-CMs. [score:1]
Collectively, our results indicated that miR-1 and -499 had specific and differential effects on ventricular specification and maturation. [score:1]
Specifically, our experiments demonstrate that miR-499 promotes ventricular specification while miR-1 serves to facilitate their electrophysiological maturation. [score:1]
D) Summary of the proposed sequence of biological processes that occur during human cardiogenesis and the actions of miR-1 and -499. [score:1]
The profiles of miR-1, let-7a, let-7b, miR-26b, miR-30b, miR-125a, miR-126, miR-133a, miR-143, and miR-499 in hE/F/A-VCM were confirmed by qPCR (Figure 1B). [score:1]
[1 to 20 of 87 sentences]
12
[+] score: 205
With our finding that TDP-43 overexpression increases protein levels of the miR-1/ miR-206 target, HDAC4, whose dysregulation correlates with ALS disease progression (15), further interrogation of TDP-43 levels, localization, and activity in skeletal muscle of individuals with ALS at various stages of the disease seems warranted. [score:10]
Although evidence of miR-1 or miR-206 dysregulation in mouse mo dels or human cases of ALS has not been reported, skeletal muscle up-regulation of the miR-1/206 target, HDAC4, which inhibits muscle reinnervation, is positively correlated with ALS progression and severity (15). [score:9]
Igf-1 and Hdac4 are reported targets of the miR-1 family in skeletal muscle, and miR-1 modulation affects protein levels of these two targets, without altering their mRNA expression (5, 27). [score:7]
Thus, two well validated miR-1 family targets were up-regulated at the protein, but not mRNA level in TDP-43 transgenic muscle, in agreement with our mo del of reduced miR-1/206 activity. [score:6]
Indeed, the reinnervation defect observed in muscle of miR-206 -null mice was attributed to up-regulation of this critical miR-1 family target (9). [score:6]
TDP-43 overexpression in vivo up-regulated IGF-1 and HDAC4, proteins whose synthesis is normally repressed by the miR-1 family (5, 27). [score:6]
Because miRNA activity requires interaction with the RISC, one potential mechanism by which TDP-43 negatively regulates miR-1 family activity may be through inhibiting their RISC association, thus decreasing their availability to repress target mRNA sequences. [score:6]
To directly test whether miR-1/miR-206 activity was suppressed by TDP-43, we returned to C [2]C [12] skeletal myoblasts where we depleted TDP-43 using a targeted siRNA. [score:6]
A, wings from control or dppGAL4::UAS-dmiR-1 -expressing flies (dpp> dmiR-1) show that miR-1 expression causes decreased L3-L4 intervein distance (25). [score:5]
Consequently, TDP-43 overexpression in skeletal muscle led to increased protein levels of the miR-1 family targets, IGF-1 and HDAC4. [score:5]
FIGURE 3. TDP-43 suppresses activity of miR-1 and miR-206 by inhibiting their association with AGO2. [score:5]
This type of discordant mRNA and protein expression can be a feature of altered miRNA function and is consistent with a mo del where TDP-43 limits the activity of the miR-1/miR-206 family in skeletal muscle, leading to increased IGF-1 translation. [score:5]
Together, these results support the idea that miR-1 family activity is decreased in TDP-43 transgenic muscle, resulting in increased translation of miR-1 family targets. [score:5]
Depleting TDP-43 increased miR-1 repression of this reporter (Fig. 3 C) without affecting baseline luciferase expression in the presence of a nontargeting control miRNA. [score:5]
Targeted deletions of miR-1 or miR-133 in mice generally result in impaired cardiac development and function (6 – 11). [score:4]
Here we show a unique physical and genetic interaction between TDP-43, an ALS disease protein, and the miR-1 family of muscle miRNAs that negatively regulates miR-1 family activity. [score:4]
Post-transcriptionally, several proteins regulate miR-1 family biogenesis including the KH-type splicing regulatory protein (KSRP) (18), Muscleblind-like splicing regulator (MBNL1) (19), and RNA -binding protein LIN28 (19). [score:4]
Furthermore, the fact that reduced Tdp-43 dosage enhanced the effects of dmiR-1 expression in the fly wing suggests that Tdp-43 may dampen miR-1 activity. [score:3]
To test whether the interaction of miR-1/miR-206 with TDP-43 occurs in a cellular context, we performed CLIP of TDP-43 from undifferentiated C [2]C [12] cells, which express miR-206 and miR-133b, but not abundant miR-1 or miR-133a (Fig. 1 D). [score:3]
This increase was observed despite unchanged Igf-1 and Hdac4 mRNA expression and elevated miR-1 family levels. [score:3]
We found that transgenic mice had higher protein levels of both TDP-43 and the miR-1 family target, IGF-1 (Fig. 4, A and B). [score:3]
We took advantage of an existing transgenic mouse line with human TDP-43 overexpressed primarily in skeletal muscle to analyze the effects on endogenous miR-1 family activity in vivo (26). [score:3]
Our results demonstrate that TDP-43 negatively regulates the activity of miR-1 and miR-206 in muscle through a physical interaction that limits their bioavailability for RNA -induced silencing complex (RISC) loading and offer a mechanism by which mature miRNAs can be differentially regulated at the level of their activity. [score:3]
Deletion of one miR-1 locus or both miR-1 loci causes cardiac defects without a detectable skeletal muscle phenotype, likely due to the persistent expression of miR-206 in skeletal muscle (7, 8, 11). [score:3]
Similarly, in worms, muscle expression of miR-1 is important for retrograde signaling to the motor neuron resulting in NMJ maintenance (14). [score:3]
In the presence of TDP-43, miR-1 was able to repress expression of a luciferase reporter with a validated miR-1 family binding site in the 3′-UTR (4). [score:3]
Given that TDP-43 is an ALS disease protein (28) and deleting miR-206 in mice exacerbates the phenotype of an ALS mouse mo del (9), we aimed to elucidate the consequence of the TDP-43- miR-1 family interaction in skeletal muscle. [score:3]
In Drosophila wings, misexpression of Drosophila miR-1 (dmiR-1) under the control of a decapentaplegic (dpp) promoter leads to decreased long vein 3-4 (L3-L4) intervein distance (Fig. 2 A). [score:3]
TDP-43 Overexpression Decreases miR-1/miR-206 Family Activity in Transgenic Mice. [score:3]
Although miR-1 and miR-133 cooperate to repress smooth muscle gene expression in the heart (6, 7, 10, 11), miR-1 promotes differentiation of striated muscle progenitors, whereas miR-133 maintains the undifferentiated state in vitro (5, 12, 13). [score:3]
In most higher vertebrates, the miR-1/miR-133a genomic locus was duplicated, with the expression of both loci being maintained in cardiac and skeletal muscle. [score:3]
FIGURE 4. TDP-43 overexpression decreases miR-1 family activity in mouse muscle. [score:3]
To our knowledge, a selective mature miRNA-protein interaction that limits miRNA activity, independent of miRNA biogenesis, has not been reported and suggests that the differential activity of mature miRNAs, including bicistronically encoded miRNAs, such as miR-1 and miR-133, can be regulated by selective interaction with RNA -binding proteins. [score:2]
This could decrease the activity of the miR-1 family in affected muscle, thus altering retrograde signaling at the NMJ through dysregulation of both HDAC4 (9) and MEF-2 (14), and ultimately contributing to motor neuron demise. [score:2]
Because the miR-1 family promotes differentiation and the miR-133 family keeps muscle in a less mature, more proliferative state (5, 12, 13), the TDP-43- miR-1 family interaction may be important to control the balance of these co-transcribed miRNA families to promote development and maintain adult muscle homeostasis. [score:2]
PCR was performed in triplicate on an ABI 7900HT (Applied Biosystems) using the following TaqMan expression assays (Life Technologies): miR-1, 000385; miR-206, 000510; miR-133b, 002247; Igf-1, Mm00439560_m1; and HDAC4, Mm01299558-g1, and was analyzed with SDS software (Life Technologies). [score:2]
Rau F. Freyermuth F. Fugier C. Villemin J. -P. Fischer M. -C. Jost B. Dembele D. Gourdon G. Nicole A. Duboc D. Wahbi K. Day J. W. Fujimura H. Takahashi M. P. Auboeuf D. Dreumont N. Furling D. Charlet-Berguerand N. (2011) Misregulation of miR-1 processing is associated with heart defects in myotonic dystrophy. [score:2]
Simon D. J. Madison J. M. Conery A. L. Thompson-Peer K. L. Soskis M. Ruvkun G. B. Kaplan J. M. Kim J. K. (2008) The microRNA miR-1 regulates a MEF-2 -dependent retrograde signal at neuromuscular junctions. [score:2]
eLife 2, e01323 24252873 8. Zhao Y. Ransom J. F. Li A. Vedantham V. von Drehle M. Muth A. N. Tsuchihashi T. McManus M. T. Schwartz R. J. Srivastava D. (2007) Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1–2. [score:2]
Given the extended half-life of miRNAs and the observations from deep-sequencing studies that the miR-1 family accounts for up to half of accumulated miRNAs in cardiac and skeletal muscles (20, 21), directly controlling the activity of these critical myogenic regulators and their differential activity as compared with miR-133 may be important to maintain muscle homeostasis. [score:2]
Elia L. Contu R. Quintavalle M. Varrone F. Chimenti C. Russo M. A. Cimino V. De Marinis L. Frustaci A. Catalucci D. Condorelli G. (2009) Reciprocal regulation of microRNA-1 and insulin-like growth factor-1 signal transduction cascade in cardiac and skeletal muscle in physiological and pathological conditions. [score:2]
Wystub K. Besser J. Bachmann A. Boettger T. Braun T. (2013) miR-1/133a clusters cooperatively specify the cardiomyogenic lineage by adjustment of myocardin levels during embryonic heart development. [score:2]
The predilection of TDP-43 for miR-1/miR-206 was observed in both in vitro miRNA pulldowns as well as in vivo CLIP experiments. [score:1]
We concluded that a protein or complex of proteins in C [2]C [12] cells preferentially interacts with the mature form of the miR-1/miR-206 family, but not miR-133, in vitro. [score:1]
TDP-43 Disrupts Association of miR-1/miR-206 with AGO2. [score:1]
The same band was observed when fluorescently labeled miR-206 was incubated with C [2]C [12] lysates and could be competed with either miR-1 family member, but not with miR-133 (Fig. 1 B). [score:1]
The miR-1 Family Physically Interacts with TDP-43. [score:1]
The miR-1 family, composed of miR-1 and miR-206, whose mature sequences are nearly identical, and the miR-133 family (1, 2) are highly conserved and are enriched in cardiac and skeletal muscle in species as distantly related as flies and humans (3 – 5) (see Fig. 1 A). [score:1]
TDP-43 similarly enhanced miR-206 -mediated reporter repression (Fig. 3 C), demonstrating that loss of TDP-43 enhances activity of both miR-1 family members. [score:1]
C [2]C [12] cells were maintained in DMEM, 10% FBS and transfected in triplicate with the indicated vectors, miRNA mimics (Life Technologies, miR-1: PM10660; miR-206: PM10409 or Pre-miR miRNA Precursor Negative Control #1), and siRNAs (Sigma, Mission siRNA Universal Negative Control #1: SIC001; siTDP-43: SAS1-Mm01-00198818) using Lipofectamine 2000 (Life Technologies). [score:1]
To validate the interaction between TDP-43 and miR-1 in a more in vivo context, and to determine the consequences on miR-1 function, we turned to the Drosophila system. [score:1]
In mammals, up to three genomic loci encode bicistronic transcripts to produce miR-133 and either miR-1 or miR-206. [score:1]
We performed Western analyses to compare levels of a second miR-1 family target, HDAC4, in the same skeletal muscle preparations in which we measured TDP-43 and IGF-1 (Fig. 4 B). [score:1]
TDP-43 decreased activity of mature miR-1 and miR-206, but not the co-transcribed miR-133 family, by preventing the bound miRNAs from associating with the RISC. [score:1]
Rao P. K. Missiaglia E. Shields L. Hyde G. Yuan B. Shepherd C. J. Shipley J. Lodish H. F. (2010) Distinct roles for miR-1 and miR-133a in the proliferation and differentiation of rhabdomyosarcoma cells. [score:1]
Proteins enriched in the Bio- miR-1 pulldown lane were identified by mass spectrometry and included KSRP and TDP-43. [score:1]
Instead, it is possible that interaction with TDP-43 stabilizes miR-1 and miR-206, preventing their degradation or clearance, and leading to their accumulation, while also limiting their RISC -associated activity. [score:1]
These findings also establish, for the first time, a mechanistic link between TDP-43 and the miR-1/miR-206 family that may be an unappreciated component of ALS pathogenesis. [score:1]
Although KSRP is required for biogenesis of the miR-1 family in specific contexts (18), the effects of TDP-43 on the miR-1 family have not been reported. [score:1]
A, sequence alignment of the miR-1/miR-206 family or the miR-133 family. [score:1]
These interactions could be competed with unlabeled miR-1 or miR-206, but not with unlabeled miR-133a. [score:1]
Loss of TDP-43 Enhances miR-1 Effects in Drosophila. [score:1]
These results confirm that the TDP-43- miR-1 family interaction occurs endogenously in muscle cells. [score:1]
B, EMSAs revealed an miRNA-protein complex (arrow) in undifferentiated C [2]C [12] cell lysate that interacted with fluorescently labeled miR-1 or miR-206 probe (Fluo- miR-1, Fluo- miR-206). [score:1]
Furthermore, miR-1 levels were elevated in TDP-43 transgenic muscle, although miR-1 transcription is not affected by denervation (9). [score:1]
The miR-1 and miR-133 family loci are under transcriptional control of key myogenic proteins including myogenin, MyoD, serum response factor (SRF), myocardin (MYOCD) (3, 4, 16), and myocyte-enhancing factor 2 (MEF-2) (17). [score:1]
This is consistent with the observation that miR-1 and miR-206 levels greatly exceed those of miR-133 in mature muscle (20, 21). [score:1]
These factors presumably control miR-1 family levels in specific contexts. [score:1]
Interestingly, this apparent decrease in miR-1 family activity occurred despite elevated levels of both miR-1 and miR-206 in TDP-43 TG muscle (Fig. 4 D), further highlighting the dampening effect that TDP-43 has on miR-1 family activity in muscle. [score:1]
To ensure that biotinylated miR-1 could be used as a bait, we confirmed that biotinylating miR-1 did not affect its ability to compete with labeled miR-1 for interaction with the protein complex (Fig. 1 B). [score:1]
We found a prominent band representing an miRNA-protein complex in C [2]C [12] lysates incubated with labeled miR-1 that was effectively lost with the addition of excess unlabeled miR-1 or miR-206, but not with unlabeled miR-133 (Fig. 1 B). [score:1]
5′-biotinylated miR-1 (Bio- miR-1) also effectively competed for binding. [score:1]
King I. N. Qian L. Liang J. Huang Y. Shieh J. T. C. Kwon C. Srivastava D. (2011) A genome-wide screen reveals a role for microRNA-1 in modulating cardiac cell polarity. [score:1]
Loss of TDP-43 Increases miR-1/miR-206 Family Activity in Skeletal Myoblasts. [score:1]
These experiments reveal that a conserved interaction between miR-1 and TDP-43 occurs in vivo. [score:1]
We used fluorescently labeled mature miR-1 and protein lysates from undifferentiated C [2]C [12] cells, a mouse skeletal myoblast cell line. [score:1]
Proteins that co-precipitated with biotinylated miR-1 were separated on denaturing polyacrylamide gels (Fig. 1 C), and mass spectrometry was used to identify the bands that emerged in miR-1, but not control or miR-133a, pulldowns. [score:1]
To determine the identity of the proteins that interacted with the miR-1 family in EMSAs, we used biotinylated mature miR-1 to affinity-purify the interacting proteins. [score:1]
C, average levels of HDAC4 protein and Hdac4 mRNA in samples analyzed in A and B. D, relative levels of miR-1 and miR-206 detected by using the same samples analyzed in A–C (NS, not significant; *, p < 0.05). [score:1]
C, eluates from negative control (Biotin), Bio- miR-133a, or Bio- miR-1 pulldowns were run on denaturing gels. [score:1]
FIGURE 2. Loss of TBPH, the Drosophila Tdp-43 ortholog, increases miR-1 activity in fly wings. [score:1]
To identify proteins that physically interact with and might regulate activity of the miR-1/miR-206 family, but not the miR-133 family (Fig. 1 A), we performed RNA electrophoretic mobility shift assays (EMSAs) seeking proteins that uniquely bind and alter the migration of these miRNAs. [score:1]
Here, we report that TDP-43, an RNA -binding protein that aggregates in individuals afflicted with ALS, physically associates with the mature form of the miR-1/miR-206 family of miRNAs in muscle cells, but not with the co-transcribed miR-133. [score:1]
FIGURE 1. TDP-43 interacts with the miR-1/miR-206 family, but not miR-133. [score:1]
[1 to 20 of 84 sentences]
13
[+] score: 199
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-122, mmu-mir-1a-2, mmu-mir-1b
In line with this view, the pro-survival BCL-2 [7] and IGF-1 [6] have been verified to be targets of miR-1. It is therefore conceivable that miR-1 produces its cardiac damaging effects by repressing expression of multiple survival target genes during cardiac injury. [score:7]
Considering the multiple target property of a miRNA, it is speculated that other proteins related to cardiac injury may also be regulated by miR-1 directly or indirectly. [score:6]
Further study showed that exogenous overexpression of miR-1 in cultured cardiac myocytes exacerbates H [2]O [2] -induced injury and knockdown of miR-1 expression produces protective effects [7]. [score:6]
Sayed et al demonstrated that miR-1 inhibits cardiac hypertrophy by affecting the growth-related targets, including Ras GTPase-activating protein (RasGAP), cyclin -dependent kinase 9 (Cdk9), fibronectin, and Ras homolog enriched in brain (Rheb) [10]. [score:5]
To construct reporter vectors bearing miRNA-target sites, we first obtained fragments of the 3′UTRs of HSP60, 70 and PKCε containing the exact target sites for miR-1 by PCR amplification. [score:5]
Moreover, in a previous study, our lab demonstrated that miR-1 overexpression induces adverse structural remo deling and impaired cardiac contractile function by targeting calmodulin (CaM) and cardiac myosin light chain kinase (cMLCK) in 4- and 6-month old miR-1 transgenic mice, but not 2-month old mice [27]. [score:5]
In miR-1 Tg mice, the expression of cardiac PKCε was significantly inhibited (Fig. 5A), while in mice administered with LNA-antimiR-1 it was increased (Fig. 5A). [score:5]
miR-1 is the first miRNA that has been extensively explored and confirmed to be a key regulator of cardiac development and disease [7], [8], [9], [10], [11]. [score:5]
PKCε and HSP60 are bioinformatically predicted to be the conservative targets of miR-1 by Targetscan. [score:5]
Interestingly, in this study we found that LNA-antimiR-1 inhibited miR-1 expression by 83% at a dose of 1 mg/kg and exerted apparent cardiac protective effects, reflecting the potential of LNA-antimiR-1 as a therapeutic agent against cardiac injury clinically. [score:5]
Consistently, the study reported by Shan et al demonstrated that miR-1 inhibits the expression of HSP60 in rat cardiomyocytes [5]. [score:5]
However, these previous studies dealt with transient alterations of miR-1 expression and the effects of long-term overexpression of miR-1 on cardiac injuries have not been studied. [score:5]
These results indicate that PKCε and HSP60 are direct targets of miR-1. Previously studies indicate that miR-1 may be a critical factor in cardiac injury. [score:4]
These results indicate that PKCε and HSP60 are direct targets of miR-1. In this study, a cardiac specific miR-1 transgenic mouse line was established by inserting the precursor sequence of mmu-miR-1a-2 incorporated with the cardiac-specific α myosin heavy chain (αMHC) promoter into the mouse genome (Fig. 1A). [score:4]
LNA-antimiR-1 was used to achieve in vivo knockdown of endogenous miR-1. LNA-antimiR-1, administered via tail vein at a dose of 1 mg/kg, significantly reduced miR-1 expression in the heart by about 83% (Fig. 1C). [score:4]
On the contrary, knockdown of miR-1 by LNA-antimiR-1 inhibited the increases of serum CK and LDH levels caused by IR injury (Fig. 3A, B). [score:4]
Overexpression and Knockdown of miR-1 in Mice. [score:4]
In an earlier study, Zhao et al found that miR-1 participates in cardiogenesis by regulating the expression of a transcription factor Hand2 [8]. [score:4]
To this end, we generated a cardiac-specific miR-1 over -expression mouse line and employed the LNA-antimiR-1 -mediated miR-1 knockdown technique. [score:4]
We found that miR-1 overexpression enhanced caspase-3 activity after IR injury. [score:3]
Identification of PKCε and HSP60 as the Targets of miR-1. Discussion. [score:3]
Among the predicted targets of miR-1 identified by computational analysis, PKCε and HSP60 are highly conserved across species which are known to mediate cardioprotective effects. [score:3]
Further studies are required to obtain the full picture of the target network of miR-1 related to cardiac injury. [score:3]
To experimentally establish these genes as target of miR-1, we subcloned the 3′UTRs of PKCε and HSP60 into the 3′UTR of a luciferase plasmid to construct chimeric vectors. [score:3]
Expression of PKCε and HSP60 in miR-1 Tg and LNA-antimiR-1 Treated Mice before and after I/R Injury. [score:3]
Cardiac specific transgenic overexpression of miR-1 in mice led to a 3.2 fold increase in cardiac miR-1 level with no changes in liver, kidney, brain and skeletal muscle, indicating the successful establishment of miR-1 Tg mice (Fig. 1B). [score:3]
We successfully established cardiac-specific miR-1 overexpression mice, which are more sensitive to I/R stress than wild-type controls. [score:3]
In conclusion, this study demonstrated that miR-1 aggravated cardiac ischemia/reperfusion injury via inhibiting pro-survival proteins, e. g. PKCε and HSP60. [score:3]
However, in miR-1 Tg mice the increase was suppressed and in LNA-antimiR-1 treated mice PKCε level was elevated (Fig. 5A). [score:3]
Consistent with cardiac infarct size result, serum CK and LDH were robustly released after IR injury, which was further increased in miR-1 overexpression mice. [score:3]
B, C. Luciferase reporter activities of chimeric vectors carrying luciferase gene and a fragment of PKCε or HSP60 3′UTR containing the binding sites of miR-1. Data are expressed as mean±SEM; n = 4; *P<0.05 vs control, #P<0.05 vs miR-1. Apoptosis of cardiac myocytes was detected by staining mouse heart cryosections with the In situ Cell Death Detection Kit (TUNEL fluorescence FITC kit, Roche, Indianapolis, IN, USA) according to the manufacturer’s instruction. [score:3]
Yu et al demonstrated that overexpression of miR-1 abrogates insulin growth factor 1 (IGF-1) -mediated protection against glucose -induced cardiomyocyte injury in vitro [6]. [score:3]
These results demonstrated that the detrimental action of miR-1 on the heart may be mediated by repressing the expression of PKCε and HSP60. [score:3]
Synthesis of miR-1 and anti-miR-1 Antisense Inhibitor (AMO-1). [score:3]
Verification of PKCε and HSP60 as targets of miR-1.. [score:3]
Our group discovered that miR-1 promotes cardiac ischemic arrhythmias by targeting KCNJ2 gene, which encodes Kir2.1 inward rectifier K [+] channel protein subunit, and GJA1 gene encoding connexin-43 gap junction channel protein subunit [9]. [score:3]
The expression of miR-1 was strongly increased in both serum, cardiac tissues and cultured cardiac myocytes during cardiac injury induced by various stimuli [6], [7], [9], [11]. [score:3]
In this study, we experimentally established PKCε and HSP60 as targets of miR-1 in mice, which is in line with the detrimental role of miR-1 in the heart. [score:3]
B, C. Luciferase reporter activities of chimeric vectors carrying luciferase gene and a fragment of PKCε or HSP60 3′UTR containing the binding sites of miR-1. Data are expressed as mean±SEM; n = 4; *P<0.05 vs control, #P<0.05 vs miR-1. A. Sequence alignment between miR-1 and the 3′UTRs of PKCε and HSP60 of human and mouse. [score:3]
After that, several studies showed that miR-1 exacerbates cardiac injury by affecting the expression of a host of protective proteins, e. g. BCL2, HSP60, insulin growth factor 1(IGF-1), etc [6], [7], [11]. [score:3]
In contrast, knockdown of miR-1 with LNA-antimiR-1 alleviated cardiac I/R injury. [score:2]
Knockdown of miR-1 by LNA-antimiR-1 represents a new strategy in treating cardiac injury. [score:2]
These results indicate that miR-1 produces harmful effects on the heart cardiac I/R, while knockdown of miR-1 produces protective effects against I/R injury. [score:2]
In this study we employed both gain- and loss-of-function approaches to elucidate the roles of miR-1 in cardiac injuries and the therapeutic potential of miR-1 knockdown. [score:2]
Interestingly, Zhao et al observed increased proliferation of cardiac myocytes at postnatal day 10 of in mice with miR-1-2 knockout [16], indicating that miR-1 is pro-survival molecule. [score:2]
Effects of miR-1 on Creatinine Kinase (CK), Lactate Dehydrogenase (LDH) Release, Cardiac Caspase-3 Activity and Cardiomyocyte Apoptosis after IR Injury. [score:1]
All pyrimidine nucleotides in the NC or miR-1 were substituted by their 2′- O-methyl analogues to improve RNA stability. [score:1]
0050515.g001 Figure 1Schematic illustration of generation of miR-1 transgenic mice (A), level of miR-1 in miR-1 transgenic mice (B), LNA-1 treated mice (C), and ischemia reperfusion (IR) hearts of mice (D). [score:1]
We and others found that serum level of miR-1 was closely related to cardiac injury in acute myocardial infarction (AMI) patients [14], [15]. [score:1]
Effects of miR-1 on cardiac infarct area of mice after ischemia/reperfusion injury in mice. [score:1]
In this study, a cardiac specific miR-1 transgenic mouse line was established by inserting the precursor sequence of mmu-miR-1a-2 incorporated with the cardiac-specific α myosin heavy chain (αMHC) promoter into the mouse genome (Fig. 1A). [score:1]
To exploit the underlying mechanisms for the harmful effects of miR-1 on the heart, we evaluated the influence miR-1 on PKCε and HSP60 expression which are known to play a protective role against cardiac injury. [score:1]
Cotransfection of the chimeric vectors with miR-1 (Fig. 6B, C) resulted in lower luciferase activity relative to the transfection of chimeric vectors alone. [score:1]
In rats, serum miR-1 level is increased after myocardial infarction, which strongly correlates with infarct size and can be significantly reduced by ischemic preconditioning [14]. [score:1]
Echocardiography of wild type (WT) and miR-1 transgenic (miR-1 Tg) mice. [score:1]
As shown in Fig. 2A, infarct size was larger in miR-1 Tg mice than in WT controls 24 h after reperfusion, while LNA-antimiR-1 treatment reduced infarct size. [score:1]
As shown in Fig. 1D, miR-1 levels increased by 2.3 fold in wild type and 4.3 fold in miR-1 Tg mice when subjected to I/R, while LNA-1 treatment decreased miR-1 level in mice with I/R injury. [score:1]
0050515.g004 Figure 4 WT, wild type; miR-1 Tg, miR-1 transgenic; LNA-1, LNA-antimiR-1; Scr, Scrambled LNA sequence. [score:1]
Schematic illustration of generation of miR-1 transgenic mice (A), level of miR-1 in miR-1 transgenic mice (B), LNA-1 treated mice (C), and ischemia reperfusion (IR) hearts of mice (D). [score:1]
Moreover, miR-1 overexpression in the heart from two months old miR-1 transgenic mice caused no functional and structural alterations as indicated by echocardiographic measurement (Table 1). [score:1]
Furthermore, we examined the effects of miR-1 on caspase-3 activity of ischemic heart. [score:1]
Consistent with previous in vitro reports, this study provided in vivo data supporting the detrimental role of miR-1 on cardiac I/R injury in mice. [score:1]
Generation of miR-1 Transgenic Mice. [score:1]
Circulating levels of miR-1 are significantly increased in patients with AMI, which positively correlates with serum CK-MB level [14], a marker of ischemic myocardial damage. [score:1]
Additionally, a scrambled RNA was used as a negative control (NC); miR-1, sense: 5′-UGGAAUGUAAAGAAGUGUGUAU-3′ and antisense: 5′-AUACACACUUCUUUACAUUCCA-3′. [score:1]
Sequence alignment between miR-1 and the 3′UTRs of PKCε and HSP60 of human and mouse. [score:1]
Synthesis and Administration of Locked Nucleic Acid Antisense miR-1. Effects of miR-1 on serum creatinine kinase, lactate dehydrogenase level and cardiac caspase-3 activity after IR injury in mice. [score:1]
Generation of miR-1 transgenic mice and the detection of miR-1 levels. [score:1]
Effects of Gain- and Loss-of-function of miR-1 on Infarct Size of I/R Hearts. [score:1]
The IA/AAR ratio was significantly increased from 50.6±3.6% (WT) to 64.9±4.8% (miR-1 Tg). [score:1]
The pre-miR-1 sequence flanked by 5′end αMHC promoter and 3′end poly(A) was obtained by digestion and extraction, which was then injected into fertilized eggs of C57BL/6 mice. [score:1]
Effects of miR-1 and LNA-1 on cardiomyocyte apoptosis in heart subjected to ischemia/reperfusion (I/R) injury by TUNEL staining. [score:1]
The miRNA:mRNA complementary between miR-1 and the 3′UTRs of PKCε and HSP60 are shown in Fig. 6A. [score:1]
miR-1 and its antisense oligonucleotidesAMO-1 were synthesized by GenePharma (Shanghai GenePharma Co. [score:1]
The antisense sequence of miR-1 (LNA-antimiR-1) was synthesized by Exiqon (Denmark) and five nucleotides or deoxynucleotides at both ends of the antisense molecules were locked (LNA; the ribose ring is constrained by a methylene bridge between the 2′- O- and the 4′- C atoms). [score:1]
The muscle-specific miRNA miR-1 is one of the miRNAs shown to play a role in cardiac injury [5], [6], [7]. [score:1]
WT, wild type; miR-1 Tg, miR-1 transgenic; LNA-1, LNA-antimiR-1; Scr, Scrambled LNA sequence. [score:1]
The positive miR-1 transgenic mice were identified by the successful PCR amplification of αMHC. [score:1]
The repression of PKCε and HSP60 transcription activities by miR-1 was alleviated by co-application of AMO-1. The negative control sequences produced no effects on luciferase activity of the chimeric vectors. [score:1]
[1 to 20 of 79 sentences]
14
[+] score: 177
The main findings of this study document that: i) connexin 43 expression and activity (with its consequent displacement from the gap junction) increases in response to hypertrophic stress in cardiomyocytes in vitro and in vivo; ii) miR-1 directly targets for Cx43 repression and it is concurrently down-regulated in hypertrophic cardiomyocytes in vitro and in vivo; iii) molecular myocyte remo deling in cardiac hypertrophy increases MAPK-ERK1/2 activation, which in turn hyper-phosphorylated Cx43 and this shift redistributes Cx43 away from the intercalated disks favoring gap junction disassembling; iv) the hypertrophic myocardium is therefore prone to ventricular tachyarrhythmia (VT); v) angiotensin II type 1 receptor (AT1R) blockade reduces the maladaptive hypertrophic signaling inhibiting ERK1/2 activation while maintaining the pro-survival Akt function, attenuating miR-1 down-regulation and Cx43 displacement from the gap junction. [score:14]
Thus, Cx43 mRNA and protein levels are up-regulated with a concurrent down-regulation of miR-1 levels in aortic banded hearts in vivo as it is expected by miR-1 direct targeting of Cx43 [32]. [score:10]
Among the highly expressed miRs in the myocardium, miR-1 has an essential regulatory role in the development of cardiac hypertrophy and it controls cardiac electrophysiology for its ability to modulate the expression levels of molecular targets that adjust the electrical coupling of the cardiac fiber cells [17]. [score:9]
In conclusion, this study provides in vivo and in vitro evidences that the selective AT1R inhibition reduces total and phosphorylated levels of Cx43 through miR-1 expression normalization and ERK1/2 inhibition in hypertrophic stressed cardiomyocytes. [score:7]
Thus, it is tempting to speculate that ERK1/2 dependent signaling stimulated by cardiac stretch and AngII release mediates miR-1 down-regulation and Cx43 increased expression. [score:6]
Intriguingly, MAPKs are known regulators of miR-1/miR-133 biogenesis [52] and we have recently shown in vascular smooth muscle cell that ERK1/2 activation suppresses miR-133 expression [13], the miR-1 cognate bicistronic gene. [score:6]
Overall these data indicate that a hypertrophic stimulus on cardiomyocytes induces miR-1 down-regulation increasing the expression of Cx43, which in turn is phosphorylated by the hypertrophic stress -induced MAP kinases and so drifted away from the gap junction. [score:6]
Indeed, we speculate that miR-1 overexpression leads to inhibition of ERK 1/2 phosphorylation in vivo, and the latter in turn prevents Cx43 phosphorylation and displacement from the gap junction. [score:5]
MiR-1 is abundantly expressed in skeletal and cardiac muscle, and it directly targets Cx43 for repression [34, 35]. [score:5]
C: immunohistochemistry and confocal microscopy in murine normal and hypertrophic heart sections; panels a-b show normal Cx43 expression in the gap junction (a) and very low level of its phosphorylation at Ser279/Ser282; ISO -induced LVH determined hyper-phosphorylation of Cx43 and its displacement from the gap junction to the cytoplasm of hypertrophic cardiomyocytes (c); panel d shows a significant reduction of phospho-Cx43 and its stabilization within the gap junction by adenovirus -mediated miR-1 selective intra-myocardial overexpression (red: α-sarcomeric actin, α-SA; green: Cx43 or p-Cx43; blue: DAPI). [score:5]
The latter molecular adaptation provides a potential explanation of our findings showing that miR-1 regulates not only Cx43 expression through the expected gene silencing mechanism but it also indirectly modulates Cx43 activity. [score:5]
Furthermore, miR-1 overexpression inhibits MAPK-ERK1/2 phosphorylation in hypertrophic cardiomyocytes in vivo [53]. [score:5]
Accordingly, the development of LVH, occurrence of hyperkinetic VT and reduction in cardiac function after pressure overload in an experimental rat mo del of ascending aortic banding are prevented by AT1R which is associated with the attenuation of miR-1 down-regulation and the consequent stabilization of Cx43 activity within the gap junction. [score:5]
Here we confirm these data and provide the first evidence that AT1R blockade prevents miR-1 down-regulation in hypertrophic stressed cardiomyocytes. [score:4]
Levels of miR-1 are significantly up-regulated in cardiac muscle already at 48-72 hours (data not shown). [score:4]
In particular, Cx43 is a direct target of miR-1 gene-silencing activity [34, 35]. [score:4]
222±11µm [2] in Con; p<0.05) and miR-1 down-regulation in Ad-Empty mice (Figure 8A). [score:4]
all, N=6), whereas Valsartan administration reduced miR-1 down-regulation by AngII treatment in vitro (Figure 7A, right panel). [score:4]
Furthermore, AngII stimulation significantly down-regulated (-68% decrease) miR-1 levels in cultured myocytes vs. [score:4]
Importantly, in agreement with the data on rat LV hypertrophy by aortic banding, miR-1 down-regulation by Iso -mediated hypertrophy was associated with Cx43 increased protein levels and enhanced phosphorylation (Figure 8B). [score:4]
However, it is still unknown whether miR-1 and Cx43 are interconnected in the pro-arrhythmic context of left ventricular hypertrophy (LVH) and whether miR-1 expression and activity can be regulated by an anti-hypertrophic treatment, such as AT1R antagonization. [score:4]
In an additional set of experiments to assess the direct role of miR-1 on Cx43 expression and activity, myocyte hypertrophy was induced in 8-12 weeks old C57BL/6 mice by Isoproterenol daily injection (Iso, 50mg/kg body weight i. p. ) for 14 days [19]. [score:4]
Therefore, the purpose of this study was to examine: (i) whether miR-1 and Cx43 dysfunctions underlie the onset of VT associated to cardiac hypertrophy in a rat mo del of pressure overload; (ii) whether miR-1 directly modulates Cx43 expression and activity in hypertrophic myocytes in vitro and in vivo; (iii) to assess whether the treatment of pathologic LVH by AT1R blockade could normalize miR-1 levels, limit the adverse electrical remo deling of Cx43 and reduce the induction of life-threatening VT. [score:4]
MiR-1 was significantly down-regulated in hypertrophic and arrhythmic group of rats (LVH) in contrast to sham-operated rats (-61% decrease, p<0.01 vs. [score:3]
On the other hand, Ad-miR-1 overexpression prevented cardiomyocyte hypertrophic response to Iso treatment (cross sectional area, 233±12µm [2]; p=NS vs. [score:3]
Cx43 has been already established as a target of miR-1 [34]. [score:3]
Importantly, miR-1 overexpression significantly reduced Cx43 protein levels with a concomitant significant reduction of its phosphorylated levels (Figure 8B). [score:3]
0070158.g008 Figure 8 A: cardiac levels of miR-1 after adenovirus -mediated cardiac overexpression in control saline -injected (Saline-Con) and in Iso -induced hypertrophic mice (Iso-LVH, *p<0.05 vs. [score:3]
C: cultured cardiomyocytes provided additional evidences, through gain- and loss-of-function assays, that Cx43 is a direct target of miR-1; cardiomyocytes were grown on 6-well plates to 70% confluence. [score:3]
A: cardiac levels of miR-1 after adenovirus -mediated cardiac overexpression in control saline -injected (Saline-Con) and in Iso -induced hypertrophic mice (Iso-LVH, *p<0.05 vs. [score:3]
In hypertrophic rats treated with VAL, the expression levels of miR-1 were increased (115%) returning to the normal baseline values of the sham-operated groups (-16% decrease, p=NS). [score:3]
miR-1 modulates Cx43 expression and phosphorylation in hypertrophic cardiomyocytes. [score:3]
At sacrifice, miR-1 was correctly over-expressed in Ad-miR-1 treated mice when compared to Ad-Empty (Figure 8A). [score:2]
Finally, we tested whether miR-1 plays a direct role in the modulation of Cx43 activity in an in vivo hypertrophic heart. [score:2]
Thus, these data above provide the first direct evidence that miR-1 plays a major role in the modulation of Cx43 activity and location in in vivo cardiac hypertrophy. [score:2]
Indeed, we confirmed through gain (using a miR-1 mimic) and loss (Anti-miR-1) of function in vitro experiments that miR-1 directly modulates Cx43 levels (Figure 7C). [score:2]
Briefly, in a group of mice (n=7) an Adenoviral vector (10 [11] pfu/mL) carrying a miR-1 construct under the ubiquitous CMV promoter (Ad-miR-1) [11] was intra-myocardially released by 5 direct epicardial injections of 3µL each in the anterior LV and apical region, followed by delivering of 30µL of adenoviral construct dissolved in 30% pluronic F127 gel (Sigma), in order to cover the entire LV wall. [score:2]
Right panel: cardiomyocytes stimulated with Angiotensin II showed lower expression levels of miR-1 compared to unstimulated cardiomyocytes (Con), with increased miR-1 levels in AngII+Val group (*p<0.03 vs. [score:2]
Real time RT-PCR for miR-1 (A) and for Connexin 43 (B) levels. [score:1]
0070158.g007 Figure 7Real time RT-PCR for miR-1 (A) and for Connexin 43 (B) levels. [score:1]
Moreover, cardiac miR-1 levels have been found reduced in pathological conditions such as acromegaly [51]. [score:1]
To this aim, either an Ad-miR-1 or an Ad-Empty intra-myocardial deliver was performed in C57BL/6 mice and 72 hrs later the adenoviral-infected mice were treated with Isoproterenol (Iso) to induce LVH or just saline as control (Con) for 14 days. [score:1]
Specific miR-1 mimic (30nM per well), and Anti-miR-1 (60nM per well) were transfected using siPORT NeoFX Transfection Agent (Ambion) according to the manufacturer’s protocol. [score:1]
Thus, 72 hours later, 8 adenovirus -transfected mice were administered Iso as above described (n=4, Ad-Empty+Iso and n=4, Ad-miR-1+Iso) while 6 mice were administered only saline solution (n=3 Ad-Empty+Saline and n=3 Ad-miR-1+Saline). [score:1]
Accordingly, the gap-junction displaced and myocyte cytoplasmic accumulated hyper-phosphorylated Cx43 in hypertrophic hearts was significantly reduced in the Ad-miR-1 treated mice (Figure 8C). [score:1]
B: total and phosphorylated (Ser279/Ser282) Cx43 levels in normal and hypertrophic mouse hearts after Adeno-Empty or Adeno-miR-1 myocardial release (*p<0.05 vs. [score:1]
miR-1 modulates Cx43 activity in cardiac hypertrophy. [score:1]
To investigate the relationship between electrical remo deling of pressure-overloaded hypertrophic hearts and miR-1 levels, we first assessed the differential expression of this miRNA in SHAM, SHAM+VAL, LVH and LVH+VAL rats. [score:1]
[1 to 20 of 48 sentences]
15
[+] score: 173
Our previous study revealed that miR-1 was upregulated when the phagocytic activity of shrimp hemocytes was inhibited, indicating the involvement of miR-1 in the regulation of phagocytosis [11]. [score:7]
The results showed that the expression level of miR-1 was significantly upregulated in cancerous macrophages compared with those in the isolated murine macrophage and the immortalized macrophage ANA-1 (Fig. 2A), suggesting that miR-1 might play important roles in the regulation of phagocytosis in cancerous macrophage. [score:6]
The target predictions indicated that the clathrin heavy chain 1 (CLTC1) gene might be a target gene of miR-1 in shrimp. [score:5]
The potential target genes of miR-1 were predicted using miRanda, TargetScan and Pictar [28]– [30]. [score:5]
Considering all the above data, miR-1 was involved in phagocytosis by inhibiting the expression of CLTC1 gene (Fig. 3E). [score:5]
These findings showed that the overexpression of miR-1 resulted in the inhibition of phagocytic activity in cancerous macrophage, but it had no effect on phagocytosis of normal macrophage. [score:5]
Based on target predictions, the clathrin heavy chain 1 (CLTC1) gene might be a target gene of miR-1 (Fig. 3A). [score:5]
To reveal the mechanism of the miR-1 -mediated phagocytosis regulation, the targets of miR-1 were predicted using computational strategies. [score:4]
The results indicated that miR-1 played an important role in the expression regulation of CLTC1 gene in macrophages. [score:4]
The results showed that miR-1 could regulate phagocytosis by targeting the clathrin mRNA. [score:4]
For a comprehensive evaluation of the effects of miR-1 on phagocytosis in cancerous macrophage, the expression of miR-1 was knocked down using the anti-miRNA oligonucleotide (AMO) AMO-miR-1. The results indicated that the miR-1 expression was specifically silenced in RAW264.7 and ANA-1 cells by AMO-miR-1 (Fig. 2D). [score:4]
Due to the downregulation of miR-1 in the cancerous macrophage RAW264.7, the gain-of-function experiments of miR-1 were conducted to evaluate the effects of miR-1 overexpression on phagocytosis of macrophages. [score:4]
The results showed that the luciferase activity of the treatment miR-1+ CLTC1 3′ UTR was significantly decreased compared with those of the controls (control+ CLTC1 3′ UTR and miR-1+ CLTC1 3′ UTR mutant) (Fig. 3B), showing that miR-1 inhibited the expression of CLTC1 gene. [score:4]
The data demonstrated that the expression of CLTC1 gene was significantly decreased by miR-1, but not by the negative control (Fig. 3C). [score:3]
0098747.g003 Figure 3(A) miR-1 targets analysis. [score:3]
The expression level of miR-1 was normalized with U6. [score:3]
However, miR-1 took no effect on the expression of CLTC1 3′ UTR mutant (Fig. 3B). [score:3]
To silence the expression of miR-1, the anti-miRNA-1 oligonucleotide (AMO-miR-1) was injected into shrimp at 0.144 mM/shrimp for twice at an interval of 12 h. As a control, the sequence of AMO-miR-1 was scrambled, yielding AMO-miR-1-scrambled. [score:3]
It was revealed that the overexpression of miR-1 led to a significant decrease of phagocytic percentage of RAW264.7 cells against FITC-labeled E. coli (Fig. 2C). [score:3]
The loss-of-function data indicated that the phagocytosis percentage of miR-1-silenced hemocytes was significantly increased compared with that of the control (AMO-miR-1-scrambled) (Fig. 1C), showing that the downregulation of miR-1 led to the increase of phagocytic activity. [score:3]
The miR-1 (5′-UG GAAUGUAAAGAAGUAUGUAU-3′) in miExpress vector was obtained from Applied Biosystem (USA). [score:3]
To silence the expression of miR-1 in RAW264.7 and ANA-1 cells, the cells were transfected with 50 nM of anti-miRNA oligonucleotide (AMO) AMO-miR-1 or the control AMO-miR-1-scrambled. [score:3]
This differential expression of miR-1 might result from the immortalization process. [score:3]
The expression of miR-1 was determined by quantitative real-time PCR. [score:3]
Prediction of target genes of miR-1. 15. [score:3]
The Northern blot results showed that miR-1 was overexpressed in RAW264.7 and ANA-1 cells (Fig. 2B). [score:3]
Clathrin heavy chain 1 gene (CLTC1) was a predicted target gene of miR-1. (B) The interaction between miR-1 and CLTC1 gene. [score:3]
Quantitative real-time PCR analysis of CLTC1 gene expression in RAW264.7 cellsRAW264.7 cells were transfected with 30 nM of miR-1 precursor (Ambion, USA) or the negative control of miR-1. At 24 h after transfection, the cells were collected and total RNAs were extracted with mirVana miRNA isolation kit (Ambion, USA), followed by the treatment with RNase-free DNase I. The first-strand cDNA of CLTC1 was synthesized by reverse transcription with PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). [score:3]
Northern blots showed that the expression of miR-1 was knocked down in shrimp hemocytes compared with the control (AMO-miR-1-scrambled) (Fig. 1B). [score:3]
The expression of miR-1 was quantified with real-time PCR (left). [score:3]
RAW264.7 and ANA-1 cells were respectively transfected with 30 nM of miR-1 precursor (Applied Biosystems, USA) to overexpress miR-1 in mammal macrophage cells. [score:3]
The results showed that the seed sequence of miR-1 was complementary to the 3′ untranslated region (UTR) of CLTC1 gene. [score:3]
Silencing and overexpression of miR-1 in mammal macrophage cell lines. [score:3]
0098747.g002 Figure 2(A) Expression levels of miR-1 and phagocytic activities in the isolated murine macrophage, the immortalized macrophage ANA-1 and the cancerous macrophage RAW264.7. [score:3]
The sequence conservation of miR-1 suggested that miR-1 might be involved in the regulation of phagocytosis in mammals as revealed in shrimp. [score:2]
The role of miR-1 in the regulation of phagocytosis in mammalian macrophages. [score:2]
The findings presented that miR-1 played important roles in the regulation of phagocytosis in shrimp in vivo. [score:2]
Dual-luciferase reporter assays were performed in RAW264.7 cells to evaluate the interaction between miR-1 and its target gene 3′ untranslated region (3′ UTR). [score:2]
4. Loss-of-function assay of miR-1 in shrimp in vivo To silence the expression of miR-1, the anti-miRNA-1 oligonucleotide (AMO-miR-1) was injected into shrimp at 0.144 mM/shrimp for twice at an interval of 12 h. As a control, the sequence of AMO-miR-1 was scrambled, yielding AMO-miR-1-scrambled. [score:2]
1. The regulation of phagocytosis mediated by miR-1 in shrimp. [score:2]
3. The mechanism of phagocytosis regulation mediated by miR-1.. [score:2]
The results demonstrated that the fluorescence intensity in cells treated with miR-1 and EGFP- CLTC1 was significantly decreased compared with the controls (Fig. 1D), showing that miR-1 could target the CLTC1 gene. [score:2]
However, the knockdown of miR-1 did not take any effect on the phagocytic activity of RAW264.7 cells. [score:2]
In this study, the data presented that miR-1 was involved in the regulation of phagocytosis through the interaction between miR-1 and the 3′ UTR of clathrin heavy chain 1 (CLTC1) gene. [score:2]
As assayed, the miR-1 expression level in the isolated macrophages was around twice higher than that in the immortalized macrophages (Fig. 2A). [score:2]
The results showed that the miR-1 sequence was highly conserved in 6 typical species from invertebrates to the highest mammalian Homo sapiens (Fig. 1F). [score:1]
The AMO-miR-1 and AMO-miR-1-scrambled were synthesized by Sangon Biotech (Shanghai) Co. [score:1]
At 24 h after transfection with AMOs, miR-1 precursor or control miRNA, the cells at 3∼5×10 [5] cells/ml were washed twice with PBS. [score:1]
The conserved nucleotides of miR-1 were analyzed with sequence alignment. [score:1]
The miR-1 precursor and its negative control was transfected into RAW264.7 cells, followed by the detection of CLTC1 gene transcript. [score:1]
The miR-1-specific AMO (AMO-miR-1) and the negative control AMO-miR-1-scrambled were injected into shrimp, respectively. [score:1]
To further characterize the role of miR-1 in phagocytosis, the expression of miR-1 was silenced using miR-1-specific anti-miRNA oligonucleotide (AMO) in shrimp in vivo (Fig. 1A). [score:1]
In the case of miR-1 expression silencing, the phagocytic activity of shrimp hemocytes was evaluated with FITC-labeled white spot syndrome virus (WSSV) in vivo. [score:1]
RAW264.7 cells were transfected with 30 nM of miR-1 precursor (Ambion, USA) or the negative control of miR-1. At 24 h after transfection, the cells were collected and total RNAs were extracted with mirVana miRNA isolation kit (Ambion, USA), followed by the treatment with RNase-free DNase I. The first-strand cDNA of CLTC1 was synthesized by reverse transcription with PrimeScript 1st strand cDNA synthesis kit (Takara, Japan). [score:1]
Cells were transfected with miR-1 precursor or control miRNA. [score:1]
The miR-1 precursor and the negative control were transfected into RAW264.7 cells, respectively. [score:1]
When the High Five cells were at about 70% confluence, they were cotransfected with the miR-1 precursor (30 nM) and a plasmid containing the EGFP gene or EGFP- CLTC1 or EGFP- CLTC1-mutant (2 µg/mL) using Cellfectin transfection reagent according to the manufacturer's protocol (Invitrogen, USA). [score:1]
The miR-1 precursor and the negative control were purchased from Applied Biosystem (USA). [score:1]
0098747.g001 Figure 1(A) Nucleotide sequences and modifications of the anti-miRNA-1 oligonucleotide (AMO-miR-1) and AMO-miR-1-scrambled. [score:1]
The sequence of AMO-miR-1 was randomly scrambled, generating AMO-miR-1-scrambled (5′-TCTACTCTAAT CTA TC-3′) with the same modifications as above. [score:1]
The precursor of miR-1 was transfected into RAW264.7 and ANA-1 cells, respectively. [score:1]
The sequence of AMO-miR-1 (5′-ACTTCTTTA CA TTC CA-3′) was modified with 2′-O- methyl (bold) and phosphorothioate (the remaining nucleotides). [score:1]
The miR-1 precursor and the plasmid EGFP- CLTC1 or EGFP- CLTC1-mutant or EGFP were cotransfected into insect High Five cells. [score:1]
The sequences of miR-1 from different species of animals were aligned. [score:1]
The cells were transfected with AMO-miR-1 or AMO-miR-1-scrambled. [score:1]
The blots fixed on the nylon membrane were probed with digoxigenin (DIG)-labeled miR-1 (5′- ATACATACTTCTTTACATTCCA-3′) or DIG-labeled U6 (5′-GGGCCATGCTAATC TTCTCTGTATCGTT-3′) probe. [score:1]
2. Effects of miR-1 on phagocytosis of mammalian macrophages. [score:1]
The sequences of miR-1 from six typical species including Marsupenaeus japonicas, Drosophlia melanogaster, Bmobyx mori, Apis mellifera, Mus musculus and Homo sapiens were obtained from miRbase (http://www. [score:1]
After the transfection of miR-1 precursor, however, the phagocytic percentage was unchanged in ANA-1 cells (Fig. 2C). [score:1]
The RAW264.7 cells were co -transfected with miR-1 and clathrin heavy chain 1 gene 3′ UTR or the mutant of clathrin heavy chain 1 gene 3′ UTR using Attractene Transfection Reagent (Qiagen, USA). [score:1]
The shrimp hemocytes were subjected to Northern blot using miR-1 or U6 probe. [score:1]
[1 to 20 of 71 sentences]
16
[+] score: 154
By contrast, in the up-regulated genes of 23DSI, the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p appeared to regulate the ribonucleoprotein complex assembly, cellular protein complex assembly, microtubule -based process, response to oxidative stress, multicellular organismal aging, respiratory electron transport chain, pyrimidine ribonucleoside triphosphate biosynthetic process, positive regulation of epithelial cell differentiation, positive regulation of cell proliferation, apoptosis, energy coupled proton transport, electron transport chain, ATP synthesis-coupled proton transport, anatomical structure formation involved in morphogenesis, ribonucleoprotein complex biogenesis, mitotic cell cycle, larval development, microtubule polymerisation or depolymerisation, female gamete generation, regulation of transcription from RNA polymerase II promoter, and imaginal disc development, among others (Table  2 and Additional file 6: Table S4). [score:12]
In 23 DSI, the high level of bantam and low levels of miR-1, miR-71, miR-7, and miR-7-5p possibly regulated and organised a specific gene expression profile for sexual maturation and egg production by inhibiting and strengthening specific gene expression and metabolic processes. [score:8]
Furthermore, among all samples, bantam was distinctly up-regulated in 23 DSI, and miR-1, miR-71, miR-7-5p, and miR-7 were distinctly up-regulated in 23SSI. [score:7]
To analyse the effect of the differential expression of miRNAs on female development after pairing, we sequenced the libraries of 23DSI and 23SSI, predicted the target genes of miRNA-1-miRNA-71-miRNA-7-miR-7-5p (Additional file 3: Table S1) and bantam (Additional file 4: Table S2), and analysed the differential expression of these genes in 23DSI compared with 23SSI. [score:7]
In unpaired females (23SSI), bantam was notably not up-regulated, whereas miR-1, miR-71, miR-7, and miR-7-5p were significantly up-regulated. [score:7]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
Although miRNAs do not regulate all genes in organisms, evidence provided by miRNA analyses in the present study indicated that pairing likely limited the expression of non-essential genes through increasing the expression of bantam and specific genes by maintaining miR-1, miR-71, miR-7, and miR-7-5p at relatively low levels. [score:6]
By contrast, in paired females (23DSI), the above mentioned miRNAs were not up-regulated, suggesting that the functions of the target genes of miR-1-miR-71-miR-7-miR-7-5p were required in paired females. [score:6]
Similar miRNA profiles were observed in 18SSI and 18DSI, with the presence of identically expressed high-abundance miRNA, such as miRNA-1, miRNA-71b-5p and let-7. By contrast, in 23DSI and 23SSI, most of these high-abundance miRNAs were down-regulated. [score:6]
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
We found that the target genes of miR-1-miR-71-miR-7-miR-7-5p, such as ribosomal protein genes (CAX72037.1, CAX71939.1, CAX78482.1, CAX77178.1, AAP06483.1, CAX77387.1, CAX72859.1, CAX70956.1, CAX71543.1, CAX83047.1, CAX70121.1) (Additional file 6: Table S4), thioredoxin peroxidase (CAX75860.1), tubulin (XP_002580033.1, CAX75788.1, CAX75500.1, CAX71989.1, CAX76110.1), ATP synthase- H + transporting (CAX75390.1, CAX76063.1), and cytochrome c oxidase (CAX74747.1, CAX76589.1), among others, were significantly up-regulated. [score:6]
Out of the 50 genes, 33 were the predicted target genes of bantam (Figure  3B), whereas only 2 were predicted target genes of miR-1-miR-71-miR-7-miR-7-5p. [score:5]
revealed that in unpaired females, the highly-expressed miRNA-1, miRNA-71, miRNA-7, and miR-7-5p only inhibited the limited pathways, such as proteasome and ribosome assembly. [score:5]
Differential expression of the predicted target genes of bantam and miRNA-1-miRNA-71-miRNA-7-5p- miR-7 between samples from 23 DSI and 23SSI. [score:5]
For instance, in ribosome assembly, 15 of 49 detected genes in this metabolic process were predicted as the target genes of miR-1-miR-71-miR-7-miR-7-5p, whereas only 1 of 49 genes was the predicted target gene of bantam (Figure  3A). [score:5]
For example, the higher expression of bantam was observed only in 23DSI, whereas higher expression of miR-1, miR-71, miR-7-5p, and miR-7 manifested only in 23SSI (Figure  1B). [score:5]
The predicted target genes of bantam hardly participated in the proteasome, porphyrin metabolism, ribosome, whereas more predicted target genes of miR-1-miR-71-miR-7-miR-7-5p were involved in these process. [score:5]
C. miR-1, with respect to 23DSI, was significantly up-regulated in 23SSI (P < 0.01). [score:4]
Moreover, few of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p participated in the peroxisome, RNA degradation, mRNA surveillance pathway, axon guidance, basal transcription factors, apoptosis, glycerophospholipid metabolism, insulin signalling pathway, lysosome, regulation of actin cytoskeleton, and endocytosis. [score:4]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
The miRNAs with high-abundance, such miRNA-1c, miRNA-1a, miRNA-1, miRNA-71b-5p, let-,7 and so on showed identical expression. [score:3]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
To confirm the differentially expressed miRNAs in 23DSI, 23SSI, 18DSI, and 18SSI, bantam, miRNA-1, and miR-71 were selected for quantitative RT–PCR analysis. [score:3]
Only several high-abundance miRNAs differentially expressed between 23DSI and 23 SSI, such as bantam, miR-1, miR-71, miR-7, and miR-7-5p. [score:3]
The transcriptomes of 23DSI and 23SSI revealed that the predicted target genes of miRNA-1, miRNA-71, miRNA-7, and miR-7-5p were associated with the ribonucleoprotein complex assembly and microtubule -based process. [score:3]
However, none of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p are involved the citrate cycle, gastric acid secretion, glycolysis/gluconeogenesis, protein digestion and absorption, aminoacyl-tRNA biosynthesis, fatty acid biosynthesis, and the pentose phosphate pathway. [score:3]
These results suggested that miR-1, miR-71, miR-7, and miR-7-5p played an essential role in regulating ribosomal assembly. [score:2]
Furthermore, the low abundance of miR-1, miR-71, miR-7, and miR-7-5p in 23DSI compared with 23SSI was likely capable of promoting specific gene expression. [score:2]
In particular, various ribosomal protein genes were regulated by miR-1-miR-71-miR-7-miR-7-5p. [score:2]
We found the level of high-abundance miRNAs such as miR-1, miR-1a, miR-1c, miR-71b-5p, and let-7 to be higher in 18DSI and 18SSI than in 23DSI and 23SSI. [score:1]
For example, their levels of miR-1c, miR-1a, miR-1, miRNA-71b-5p, and let-7 were far lower than those in 18 DSI or 18SSI. [score:1]
Similarly, higher amount of miR-71 (Figure  2B) and miR-1 (Figure  2C) were observed in 23SSI than in 23DSI. [score:1]
[1 to 20 of 34 sentences]
17
[+] score: 140
No changes in Pax7 protein expression were detected in mutant compared to WT embryos indicating that miR-206 is not required to suppress expression of Pax7 in somites (Figure  6B, C), probably due to the presence of miR-1, which shows a similar expression pattern as miR-206 during skeletal muscle development but is more wi dely expressed compared to miR-206 in adult muscles. [score:10]
Deletion of both miR-1/133a clusters, which are expressed in heart and all skeletal muscles, results in early embryonic lethality due to defects in heart development caused by the failure to restrict myocardin expression and concomitant upregulation of smooth muscle genes [2]. [score:9]
miR-206 miR-133b miR-1 MDX Muscle regeneration Pax7 miRNAs regulate protein expression at the post-transcriptional level by decreasing transcript abundance or inhibiting protein translation. [score:8]
However, the seed sequences of miR-206 and miR-1 important for target recognition [1] are identical, indicating only limited differences in the target specificity of miR-206 and miR-1. The miR-206/133b locus also directs expression of the long non-coding RNA linc-MD1, which was postulated to act as a competing endogenous RNA or miRNA decoy [9] adding a further potential function to the miR-206/133b locus. [score:8]
Yet, important differences in the expression pattern of miR-1/206/133 miRNA clusters exist: the miR-1/133a clusters are expressed in heart and all skeletal muscles, while expression of miR-206/133b becomes restricted to a subset of oxidative muscle fibers by hitherto unknown molecular mechanisms. [score:7]
It seems possible that previous anti-miR approaches were biased by off-target effects or affected expression of miR-1, which can also suppress Pax7. [score:7]
The dramatic enhancement of muscle dystrophy in miR-206/mdx compound mutants was attributed to impaired differentiation of myofibers due to the up-regulation of Pax7, which contains identical binding sites for miR-206 and miR-1 in its 3′ untranslated region (UTR) [12]. [score:6]
In contrast, the miR-206/133b cluster shows a more restricted expression, which might argue for a distinct function of this cluster albeit muscle cells expressing miR-206/133b also transcribe miR-1/133a. [score:5]
Mdx mutation did not cause significant changes in the expression of miR-1. Samples were isolated from ≥3 different animals each, and qRT-PCR was performed in triplicate for each of the samples. [score:4]
TaqMan MicroRNA Expression Assays and the Applied Biosystems StepOnePlus system were used to quantify miR-206 and miR-1 expression. [score:4]
Apparently, the concomitant loss of miR-206, miR-133b and the potential miR-133 sponge in linc-MD1 is compatible with normal muscle development and functions, which might be explained by expression of the miR-1/133a clusters in type I myofibers compensating for deletion of miR-206/133b. [score:4]
Expression of miR-1 (B) was also analyzed in the respective muscles and appeared unchanged in the soleus muscle of miR-206/133b knock-out mice (black bar). [score:4]
We conclude that the miR-206/133b cluster is dispensable for development, function and regeneration of skeletal muscle, probably due to overlapping functions of the related miR-1/133a clusters, which are strongly expressed in skeletal muscle. [score:4]
Commitment of muscle cells is controlled by a core program of myogenic regulatory factors of the MyoD family, which also control transcription of the miR-1/206/133 miRNA clusters [6, 33] resulting in a prominent expression of these miRNAs in muscle cells. [score:4]
Expression of miR-1 is not changed in soleus muscle of miR-206/133b knock-out mice. [score:4]
In fact, the seed sequences of miR-1 and miR-206 are identical, which predicts a comparable repression of Pax7 by either miR-206 or miR-1 (Figure  6D) according to target algorithms like miRanda [28]. [score:3]
Alternatively, subtle differences in the genetic background and/or strain-depended differences in the expression of miR-1/133a compensating for the loss of miR-206/133b might differentially affect the course of muscular dystrophy in miR-206/133b [−/−]//mdx [y/-] and miR-206 [−/−]//mdx [y/-] compound mutants. [score:3]
Deletion of both miR-1 copies leads to cardiac defects with partially penetrant neonatal lethality [3] but did not cause a major skeletal muscle phenotype, which was attributed to the remaining expression of miR-206 in skeletal muscle. [score:3]
Moreover, we found that the lack of miR-206/133b did not increase the concentration of the potential miR-206 and miR-1 target Pax7 in differentiating satellite cells on the 5th day after induction of differentiation (Figure  10C). [score:3]
Further genetic studies targeting the miR-1/133a together with the miR-206/133b gene clusters specifically in skeletal muscle will probably reveal the prevalent physiological function of miR-1/206/133 in mammals. [score:3]
The expression of miR-1 was not significantly altered after loss of miR-206 (Figure  3B, M. soleus samples). [score:3]
Since the two miR-1/133a clusters display virtually identical expression patterns, partially overlapping or redundant functions of these miRNAs seem likely. [score:3]
The mouse genome contains two miR-1/133a gene clusters located on chromosome 2 and 18, giving rise to identical mature miR-1 and miR-133a miRNAs while the structurally related miR-206/133b cluster is located on mouse chromosome 1. The mature miR-133b differs in only one nucleotide from miR-133a and the primary sequence of miR-206 is highly related to miR-1. Importantly, miR-1 and miR-206 do not differ in the seed sequence that is assumed to determine target specificity of miRNAs [1]. [score:3]
Analysis of the 3′ untranslated region (UTR) of Pax7 using miRanda indicates identical binding sites for miR-206 and miR-1. Differences in the primary sequence of miR-206 and miR-1 do not lead to substantial changes in the predicted miRNA-Pax7 UTR interaction (D). [score:3]
The two miR-1/133a clusters generate identical mature miR-1 and miR-133a miRNAs in heart and skeletal muscle, while the cognate miR-206/133b cluster is exclusively expressed in skeletal muscle. [score:3]
Small RNA sequencing of mouse soleus muscle revealed that even in the muscle with highest expression of miR-206 miR-1 is by far the most abundant miRNA (GSE63342; 30812 miR-206 versus 281944 miR-1 tags per million miRNA tags). [score:3]
The miRNAs miR-1, miR-206 and miR-133a/b are specifically expressed in striated muscle. [score:3]
Similarly, miR-1 and miR-206 are structurally related and contain identical seed sequences important for miRNA-target recognition. [score:3]
Taken together, our results question a major role of the miR-206/133b cluster in development, function and regeneration of skeletal muscle in mouse and argue for overlapping functions of the miR-206/133b and miR-1/133a gene clusters during myogenesis. [score:2]
It was proposed that miR-1/206 repress Hdac4 [11], which in turn might regulate genes involved in controlling muscle-derived signals that enhance synapse formation under pathological conditions [10]. [score:2]
Three different gene clusters code for the muscle-specific miRNAs miR-206, miR-1 and miR-133a/b. [score:1]
miR-206/133b are processed from a common precursor and thus might be regarded as a functional unit similar to the miR-1/133a clusters [2]. [score:1]
Antisense oligonucleotides specific for miR-206 (CCACACACTTCCTTACATTCCA), miR-1 (ATACATACTTCTTTACATTCCA) and U6 (ATATGGAACGCTTCACGAATT) were used. [score:1]
The miRNAs miR-206, miR-1 and 133a/b are encoded in three clusters on mouse chromosome 1, 2 and 18. [score:1]
Analysis of published small RNA sequencing results [25] reveals that miR-206 is much less abundant in skeletal muscle than the related miR-1 (GSM539875; 20124 miR-206 versus 745064 miR-1 tags per million miRNA tags). [score:1]
The primary sequence (A) of mature miR-1/133a encoded on chromosome 2 and 18 is identical, miR-206 differs in four bases from miR-1, and miR-133b differs in one base from miR-133a (red). [score:1]
Generation of skeletal muscle specific miR-1/miR133a//miR-206/133b triple mutants will probably solve this controversy in the future. [score:1]
In contrast we observed a moderate, not significant reduction of miR-1 in some mdx muscles (Figure  3B), possibly related to the emergence of other non-muscle cell types in the dystrophic muscles. [score:1]
In addition, the primary sequence of miR-206 differs from miR-1 while miR-133b is very similar to miR-133a. [score:1]
[1 to 20 of 39 sentences]
18
[+] score: 138
Findings regarding the miRNA -mediated silencing of LGTV replication in the tick cell line are in an agreement with our data on miRNA -mediated suppression of mosquito-borne DEN4 virus demonstrating that DEN4 genome targeting for mosquito-enriched miRNAs attenuates virus replication in several mosquito-derived cell lines 5. Thus, both studies indicate that: (1) targets for miRNAs with high arthropod vector abundance [mir-1 in ticks 20 and mir-275 or mir-184 in mosquitoes 21] should be used for the effective virus suppression in the respective vector host; (2) target insertions for arthropod vector-specific miRNAs into several distant genome regions are more effective to control virus replication in invertebrate cells than targeting of only single site such as the 3′ NCR (Fig. 4); (3) co -targeting of virus genome for invertebrate vector-specific and brain tissue-enriched miRNA is associated with independent, simultaneous silencing of virus replication in both biological species/tissue types without the interference between miRNA targets (Fig. 4). [score:17]
To confirm that attenuation of C(mir), E(mir) and 3′(mir) viruses was due to the presence of targets for vertebrate brain-specific mir-124 and/or mir-9 and not due to the presence of targets for tick-specific mir-1 (see Fig. 4A), we compared growth rates in the mouse brain for 3′(1/1/1), 3′(9/9/9) and 3′(124/124/124) viruses carrying of three target copies for homologous mir-1, mir-9, or mir-124 miRNA (see Fig. S4A). [score:6]
Previously, we showed that insertion of targets for mosquito specific mir-184 and mir-275 into a distant position within the 3′ NCR of DEN4 genome completely blocks virus replication in mosquito-derived Aag2 and C6/36 cells 5. To explore if insertion of multiple miRNA targets into the 3′ NCR of LGTV can increase virus attenuation in tick cells, we generated a panel of viruses containing two or three copies of homologous (mir-1) or heterologous (mir-1, mir-275, mir-279) targets sequences (Fig. 3A), and compared their replication kinetics in Vero and ISE6 cells infected at a low MOI of 0.01 pfu per cell (Fig. 3B and S2). [score:6]
For E/NS1 insert: a single copy of mir-1 target in E(1) virus (Fig. 2A) was replaced with a set of miRNA-targets as indicated and dE/NS1R was inserted into E5 virus. [score:5]
A translational frame (ORF) was restored by inserting a targeting cassette for mir-9, mir-124, mir-1, and mir-124 miRNAs downstream of 5′ promoter region. [score:5]
To generate 3′(mir) clone carrying sequences complementary to tick- and CNS-specific miRNAs (Fig. 4A), a fused mir-1/mir-9 target sequence was inserted at nt position 10, and two copies of mir-124 target were introduced at nt positions 14 and 244 of the 3′ NCR of LGTV clone E5. [score:5]
However, replication of LGTV containing three targets for tick-specific mir-1 in the same sites of the 3′ NCR was suppressed in these cells. [score:5]
To construct the viruses with multiple targets for homologous (mir-1) or heterologous (mir-1, mir-275, and mir-279) tick-specific miRNAs, 4 sites for target insertions were selected in the 3′ NCR at nt positions 7, 14, 118 and/or 244 of wt TP-21 clone (Fig. 2A). [score:5]
Similarly, to generate E(mir) clone, a miRNA targeting cassette containing targets for mir-124/mir-1/mir-124/mir-275/mir-124 was fused with duplicated E/NS1 stem-anchor region and inserted at nt position 2489 of E5 genome. [score:5]
To assure concurrent restriction of LGTV neurotropism in vertebrate host and replication in its tick vectors, targets for tick-specific mir-1 and/or mir-275 were inserted in tandem with sequences complementary to CNS-specific mir-124 and/or mir-9 into either dCGR, dE/NS1R, or 3′ NCR and three miRNA -targeted C(mir), E(mir) and 3′(mir) viruses were generated, respectively (Fig. 4A). [score:5]
Tick-enriched miRNAs (mir-1, -275 or 279) likely guide the RISC onto corresponding complementary target sequence inserted into LGTV genome inducing destabilization/endonucleolytic degradation of viral RNA or its translational repression. [score:5]
To establish if insertion of tick-specific miRNA targets into the open reading frame (ORF) of LGTV genome also results in host-specific attenuation of virus replication, we generated a E(1) virus carrying mir-1 target in the ORF using topology described earlier 24 25. [score:5]
miRNA targeting of the 3′ NCR of LGTV for tick-specific mir-1, mir-275 and mir-279 greatly inhibits virus replication in tick-derived cells. [score:5]
There is a possibility that insertion of targets for tick-specific miRNAs (mir-1 and mir-275) in combination with targets for CNS-specific miRNAs (mir-124 and mir-9) might prevent microRNA -induced silencing complex (RISC) -dependent attenuation of LGTV replication in the CNS of vertebrates. [score:5]
To generate 3′(9/9/9), 3′(124/124/124) and 3′(gf/gf/gf) viruses, three target sequences for mir-1 in 3′(1/1/1) construct were replaced with targets for CNS-specific mir-9 or mir-124, or with sequence corresponding to position 241–260 nts of eGFP coding sequence 37. [score:5]
To verify these results, we constructed viruses carrying of three target copies for homologous mir-1, mir-9, or mir-124 miRNA (Fig. S4A) and found that replication of LGTV containing three targets for CNS-specific mir-124 or mir-9 in the 3′ NCR was indistinguishable (p > 0.5; 2-way ANOVA) as compared to replication of LGTV control virus with three copies of random sequences in ISE6 cells (Fig. S4A,B). [score:4]
Growth of viruses containing the mir-1, mir-275, or mir-279 target was severely restricted, whereas replication of LGTV with target for mir-184 was only slightly attenuated as compared to wt-EcoR* (Fig. 1G). [score:4]
To generate a set of 3′(T) viruses carrying a single target in the 3′ NCR, complementary sequence for tick-specific mir-1, mir-184, mir-275, mir-279, or mir-263a miRNA was inserted at nt position 14 of the 3′ NCR of wt LGTV genome. [score:3]
A single target copy for tick-specific mir-1 was introduced in the genome between duplicated sequences encoding the C-terminal stem-anchor domains of E protein and 10 N-terminal amino acid (AA) residues of the NS1 protein (Fig. 2A). [score:3]
A control construct [E(1*)] was generated by introducing synonymous substitutions in each of 7 AA codons that encoded the mir-1 target sequence in the E(1). [score:3]
To generate an E(1) clone, a single copy of mir-1 target was fused in-frame with codon-optimized sequence of an E/NS1 stem-anchor region (2171–2488 nts). [score:3]
Viruses containing miRNA target for mir-1, mir-184, mir-275, mir-279 or mir-263a in the 3′ NCR and wt-EcoR* were recovered by transfection of plasmid DNA into Vero cells. [score:3]
Insertion of a single copy of a target for tick-specific mir-1 into the ORF of LGTV selectively attenuates virus replication in tick-derived ISE6 cells, but not in Vero cells. [score:3]
Interestingly, the targeting of LGTV genome for only two copies of mir-1 in C(mir)/3′(mir) was sufficient to completely restrict virus vector tropism. [score:3]
Based on this data, we selected only target sequences for mir-1, mir-275, and mir-279 for the following studies. [score:3]
Thus, an increase in the number of mir-1 targets to 2 or 3 copies in the 3′ NCR was associated with gradual decrease of viral growth in the tick-derived cells. [score:3]
The growth rate of 3′(1/1/1) virus with targets for tick-specific mir-1 was indistinguishable from that of a control 3′(gf/gf/gf) virus, which contains three copies of 20 nt sequences from green fluorescent protein (GFP) gene inserted at positions nt. [score:3]
A mir-1 or scrambled mir-1 (mir-1*) target sequence (pixelated box) was fused with the codon-optimized sequence of an E/NS1 stem-anchor region (2171–2488 nt, gray box) and inserted in-frame at nt position 2489 of the LGTV genome (wt). [score:3]
In contrast, none of the ticks exposed to viruses containing intact targets for tick-specific mir-1 and mir-275 became infected (Fig. 5, p < 0.001 for all viruses, one-tailed Fisher’s exact test). [score:3]
Presence of the mir-1, mir-275, or mir-279 target in LGTV genome resulted in a strong decrease in relative RNA amounts (30–80 folds) by 3 days post infection (dpi) as compared to that of wt-EcoR*. [score:2]
To corroborate results of competition experiment, we compared the multicycle replication kinetics of wt-EcoR* and mir-1, -184, -275, and -279 targeted viruses in ISE6 cells infected at an MOI of 0.01. [score:2]
To investigate the possibility for selective restriction of LGTV in the ticks, we selected a set of 5 miRNAs (mir-1, -184, -275, -279 and -263a) (Table S1), which have been found to be wi dely expressed in eggs, larvae and adults (female and male) of cattle ticks Rhipicephalus microplus 20. [score:1]
[1 to 20 of 32 sentences]
19
[+] score: 128
Upstream inhibitors like miR-1 besides downstream inhibitors like miR-25 thus show interesting properties for anti-cancer treatments in Wnt -dependent cancers and further support current findings that upstream components of the Wnt pathway are also valid and rational targets for cancer-therapies, even in cells with downstream mutations [15], [54], [55]. [score:8]
Lentiviral expression of miR-1 inhibits expression of the Wnt reporter, axin2/Conductin-LacZ in primary mouse mammary epithelial organoid cultures. [score:7]
As shown in Fig. 5, while pLV control vector (as followed by DsRED expression) did not influence the expression of β-gal reporter (green) (Fig. 5A-A″″), expression of miR-1 within the organoids strongly repressed reporter activity (Fig. 5B-B″″) (see quantification in Fig. 5C). [score:7]
0026257.g005 Figure 5Lentiviral expression of miR-1 inhibits expression of the Wnt reporter, axin2/Conductin-LacZ in primary mouse mammary epithelial organoid cultures. [score:7]
Epistasis experiments revealed that miR-1 and miR-613 target the pathway upstream of Axin or active β-catenin, and that miR-25 acts downstream, at the level of β-cat, likely by targeting β-cat's coding sequence. [score:5]
Hsa-miR-1 expressing cells displayed markedly reduced viability at day 4. While control-virus infected HT29 cells exhibited normal proliferation and colony-formation efficiency at day 7, Pre-miR-1 expressing HT29 cells did not show any obvious signs of proliferation (Fig. 4A–C). [score:5]
Importantly, overexpression of miR-25 and miR-1 inhibited proliferation/viability of human colon cancer cells that are known to be dependent on sustained β-cat signaling for their survival [22], [24]. [score:5]
miR-1 inhibits expression of a Wnt-responsive reporter (conductin-lacZ) in primary mammary organoids. [score:5]
Furthermore, expression of miR-1 in primary mammary epithelial organoids derived from a Wnt-reporter mouse (conductin-lacZ) significantly reduced the expression of the β-gal reporter. [score:5]
These data strongly suggest that ectopic expression of miR-1 may be sufficient in inhibiting the Wnt-responsive reporter in an in vivo context. [score:5]
Finally, the very strong anti-proliferative effect of hsa-miR-1 in Wnt/β-catenin dependent human cancer cells (HT29) but not in HEK293 cells, combined with its strong inhibitory effect on an in vivo Wnt-reporter in primary mammary epithelial organoids (Fig. 5), and its lack of known oncogenic properties, highlight its potential as a novel miRNA -based candidate for the development of anti-cancer therapies. [score:4]
Elevated reporter activity by simultaneous siRNA mediated knockdown of Axin1 and Axin2 could be strongly inhibited by transfection of Pre-miR-25 (P<0.05; unpaired t-test), while miR-1 and miR-613 showed no significant influences (P>0.05). [score:4]
The organoids transduced with control lentiviral vector (A″) shows significantly higher expression of Axin2-β-gal compared to organoids expressing miR-1 (B″). [score:4]
That said, it is important to note that cMET has been previously suggested to be a direct target of miR-1 [49], [50], [51]. [score:4]
Hsa-miR-1 and -613 seem to be not closely/directly related but share identical seed sequences and act upstream of Axin and probably downstream of GSK3 (as judged by their inhibitory effect on LiCl mediated activation of the reporter). [score:4]
Secondary validation and functional testing of 3 candidate miRs, namely miR-1, miR-25 and miR-613 confirmed their inhibitory effect on the activity of the Wnt pathway. [score:3]
Control and miR-1 expression vectors (pLV-miR-1 from Biosettia Inc. [score:3]
Taken together, these data suggest that miR-25 represses the Wnt pathway downstream of GSK3β, Axin1/2 and stabilized β-catenin, while miR-1 and miR-613 act upstream of Axin1/2 and stabilized β-catenin but probably downstream of LiCl -mediated inhibition of GSK3β. [score:3]
0026257.g004 Figure 4 (A) HT29 colon cancer cells expressing pLV-Hsa-Pre-miR-1 or control vectors at day 4 of puromycin selection. [score:3]
We introduced a miR-1 expression construct into mammary epithelial organoids derived from the conductin-lacZ in vivo reporter mouse using lentiviral transduction (pLV-miR-1 from Biosettia Inc. [score:3]
While miR-1 and miR-613 could slightly reduce Wnt3a-CM mediated induction of β-catenin protein levels in HEK293 cells, miR-25 and miR-613 expression resulted in a moderate (∼20%) reduction in LiCl induced total β-catenin protein level, (Fig. 3B). [score:3]
To understand at which step these miRs (miR-1,-25,-613) modulate the linear cascade of the Wnt pathway, and to identify their potential target genes, a series of epistasis experiments were conducted in HEK293 cells using the Wnt reporter and different pathway activators (Fig. 3 A, B). [score:3]
HT29 cells stably expressing intronic miR-1 in the 5′-UTR of rPURO, a red fluorescent puromycin-N-acetyl-transferase, were generated. [score:3]
, USA) and investigated whether expression of miR-1 could influence the expression of the β-gal reporter compared to pLV-empty vector control. [score:2]
Moreover, alignment of miRs that could regulate the Wnt reporter made intra- and inter -family related functional consensus sequences apparent (i. e. the seed of miR-1 and miR-613 or within the miR-302 and -515 families (Fig. S8)). [score:2]
In vivo context analysis of the regulation of axin2/Conductin-lacZ reporter by miR-1. Results. [score:2]
MiR-613 showed the strongest inhibition in the primary validation assay (Fig. S1) and shares the same seed sequence as the miR-1/206 superfamily (5′-GGAAUGU-3′) but shows no additional overall conservation (Fig., S4). [score:2]
0026257.g003 Figure 3 (A) Epistasis experiments with synthetic human Pre-miR-1, Pre-miR-25 and Pre-miR-613. [score:1]
Secondary validation of miR-1, miR-25 and miR-613. [score:1]
HEK293 cells that stably express hsa-miR-1, while showed an initial reduction in cell proliferation at day 4 of selection compared to control, did not display any major proliferation defect by day 7. These results may suggest that the compromised viability in HT29 cells, as compared to HEK293 cells, can be due to a specific Wnt-dependence of HT29 colon cancer cells for their survival (Fig. 4D). [score:1]
Characterization of miR-1 overexpression in HT29 and HEK293 cells. [score:1]
Renilla gene activity with an inserted β-catenin CDS in the 3′UTR indicated a significant miR-25 -dependent reduction while control siRNAs, miR-1 or miR-613 had no effect (Fig. 3E). [score:1]
We also investigated the potential function of the candidate Wnt -inhibitor miR-1 in the Wnt -dependent HT29 cancer cell line, because miR-1 was identified as one of the strongest repressors of Wnt-3a -induced activation of the STF reporter (Fig. 4). [score:1]
Pre-mir-1 may function most upstream, followed by miR-613 and then miR-25, which seems to influence the most downstream activity at the level of β-catenin. [score:1]
In fact in most cases, miR-1 transduced organoid colonies exhibited almost no immuno-reactivity towards β-gal under identical exposure conditions. [score:1]
This could indicate that some miRs or miR-families may repress the Wnt pathway components/activity mainly with the seed sequence (miR-1/613 -family), while others may require the coordinated action of the seed and co-seed (miR-25/92 -family). [score:1]
Phylogenetic analysis support the miR-base classification that miR-1 belongs to the miR-1/206 family including hsa-miR-206 and the Drosophila dme-miR-1, an indication of the high evolutionary conservation of this family (shown in Supplementary, Fig. S2A by alignments and phylogenetic quartette puzzling trees); hsa-miR-25 belongs to the evolutionary conserved miR-25/92 family [39] including Drosophila miR-92a+b/310/311/312/313, shown in Fig. S2B, and shares only the seed sequence with other miRs like miR-4325 or miR-367. [score:1]
Lenti-pLV-miR-1 and -pLV-control transduced cells were selected with puromycin for up to 7 days. [score:1]
pLV-miR-1 and pLV-miR-control lentivirus were obtained from Biosettia (San Diego, USA). [score:1]
3 out of 38 candidate miRs (miR-1, miR-25, miR-613) were further characterized in Wnt-responsive cultured cells and all were validated for their Wnt -inhibitory properties identified in the initial screen. [score:1]
Figure S4 Screening results and alignment of studied miRs (miR-1/206 and miR-25/92 family) and miRs with a similar seed sequence. [score:1]
50–100-fold) could only be reduced by miR-1 and miR-613 that can block a more upstream part of the pathway and are thus more efficient (Fig. 3D). [score:1]
Hsa-Pre-mir-1 had a lesser ability to reduce total β-catenin protein levels under conditions of high pathway activation with LiCl. [score:1]
HPLC grade human synthetic Pre-miR™ precursor miRNAs that are strand-selection optimized/approved and chemically modified siRNA-like precursor miRs (Pre-miR-1™ #AM17100; Pre-miR-25™ #AM17100; Pre-miR-613™ #AM17100) were purchased from Ambion. [score:1]
[1 to 20 of 44 sentences]
20
[+] score: 125
We observed that approximately 1/10 of the recently identified 578 miRNAs are highly expressed in the mouse heart; SRF overexpression in the mouse heart resulted in altered expression of a number of miRNAs, including the down-regulation of mir-1 and mir-133a, and up-regulation of mir-21, which are usually dysregulated in cardiac hypertrophy and congestive heart failure [3, 13- 16]. [score:14]
In conclusion, our current study demonstrates that cardiac-specific overexpression of SRF leads to altered expression of cardiac miRNAs, especially the down-regulation of miR-1 and miR-133a, and up-regulation of miR-21, the dysregulation of which is known to contribute to cardiac hypertrophy. [score:12]
The pri-mir-1-1 is expressed at 6-fold higher than pri-mir-1-2. Therefore, the contribution of pri-mir-1-1 to the mature miR-1 pool may be greater than that of pri-mir-1-2. Given the fact that targeted mutation of mir-1-2 gene resulted in embryonic myocardial dysfunction and half of the mutant mice suffered early death due to ventricular septal defect (VSD) [4], one might speculate that a targeted mutation of mir-1-1 gene would also cause equally (or more) severe consequences. [score:9]
Real-time RT-PCR analysis revealed that mildly reduced SRF resulted in the down-regulation of miR-21 expression, but up-regulation of both miR-1 and miR-133a (Figure 5A). [score:9]
As shown in Figure 6, when pri-mir-1-1 and pri-mir-1-2 transcripts were down-regulated, so was miR-1 mature form; when pri-mir-133a1 and pri-mir-133a2 transcripts were down-regulated, the same was true for miR-133a mature form. [score:7]
Our findings demonstrate for the first time that it is possible to regulate at the same time the expression of three miRNAs, miR-1, miR-133a and miR-21, through targeting the components of SRF -mediated signaling pathway. [score:6]
The up-regulation of miR-21, and the down-regulation of miR-1 and miR-133a were observed in SRF-Tg compared to wild-type (WT) mouse heart (P < 0.01**, n = 3). [score:6]
Reducing cardiac SRF level using the antisense-SRF transgenic approach led to the expression of miR-1, miR-133a and miR-21 in the opposite direction to that of SRF overexpression. [score:6]
Interestingly, the down-regulation of miR-21, but up-regulation of miR-1 and mir-133a were observed in Anti-SRF-Tg compared to wild-type mouse heart (p < 0.01**, n = 3). [score:6]
When the mouse cardiac SRF level was reduced using the antisense-SRF transgenic approach, we observed an increase in expression of miR-1 and miR-133a miRNA, and a decrease in expression of miR-21. [score:5]
The miR-1 was ranked number one in the level of expression among all the microRNAs detected, and it alone accounted for 7% of all the microRNA expression signals, and 9% of the 50 cardiac-enriched microRNA signals. [score:5]
miR-1 ranks number 1 in expression, miR-133a ranks number 7 in expression. [score:5]
The down-regulation of miR-1 correlates closely with that of miR-133a in SRF-Tg at various time points from 7 days to 6 months of age (p < 0.05, n = 3 for all time points, except n = 6 for miR-21 at 6 months). [score:4]
Mir-1 and mir-133a are down-regulated in cardiac hypertrophy and cardiac failure, suggesting that they may play a role in the underlying pathogenesis [14, 43]. [score:4]
SRF is known to regulate mir-1, which regulates certain critical cardiac regulatory proteins that control the balance between differentiation and proliferation during cardiogenesis [4]. [score:4]
These findings suggest that SRF may regulate these two miRNAs at the level of polycistronic transcription, rather than at each individual miRNA (pri-mir-1 or pri-mir-133a) transcription, thereby keeping the expression of both miRNAs closely correlated. [score:4]
Our data revealed that the down-regulation of miR-1 correlates closely with that of miR-133a in the SRF-Tg at various time points from 7 days to 6 months of age (Figure 7B). [score:4]
The expression levels of miR-1, miR-133a and miR-21 were observed to be in the opposite direction with reduced cardiac SRF level in the Anti-SRF-Tg mouse. [score:4]
The miR-1 is the most abundant miRNA that is expressed in the heart. [score:3]
In addition, serum response factor (SRF), an important transcription factor, participates in the regulation of several cardiac enriched miRNAs, including mir-1 and mir-133a [4, 6]. [score:2]
Generally, the pri-miRNA transcript contains one miRNA (e. g pri-mir-21), but it can also contain more than one miRNAs (e. g. mir-1 and mir-133a). [score:1]
Both miR-1 and miR-133a are produced from the same polycistronic transcripts, which are encoded by two separate genes in the mouse and the human genomes [42]. [score:1]
Our present study revealed that miR-1 accounted for 7% of all the 578 miRNAs detected by the microarray. [score:1]
Both pri-mir-1-1 and pri-mir-1-2 are processed into mature miR-1, but pri-mir-1-1 transcript level is 6-fold higher than that of pri-mir-1-2 (n = 3, p < 0.05*). [score:1]
For examples, the mature miR-1 is processed from pri-mir-1-1 and pri-mir-1-2 transcripts that are transcribed from two genes, mir-1-1 (on chromosome 2) and mir-1-2 (on chromosome 18), respectively. [score:1]
It is plausible that increasing mir-1 and mir-133a level at a specific time point may have potentially beneficial effects against the pathological conditions. [score:1]
[1 to 20 of 26 sentences]
21
[+] score: 115
Inhibition of endogenous miR-1 and miR-206 by using antimiRs blocked the downregulation of most targets in differentiating cells, thus indicating that miRNA activity and target interaction are required for muscle differentiation (14). [score:10]
Follistatin controls skeletal muscle development through antagonizing the myogenic inhibitor myostatin (55), and Sun et al. (29) have shown miR-1 suppresses HDAC4 and subsequently upregulates the production of follistatin, stimulating skeletal myocyte fusion in vitro and in vivo. [score:9]
miR-1 and miR-206 promoted differentiation of myoblasts through downregulation of HDAC4 and the p180 subunit of DNA polymerase alpha, while miR-133 promoted proliferation through downregulation of serum response factor (SRF) in C2C12 cells (11– 13). [score:7]
Interestingly, in C2C12 differentiating cells, Mtor is important for upregulation of MyoD, which in turn upregulates miR-1 (29). [score:7]
Consistent with miR-1a reduction, soleus muscle from HFD-fed mice showed lower expression of Myf5, a transcription factor essential for miR-1a upregulation compared to control-fed mice (51). [score:5]
A reduction in miR-1a expression in soleus of HFD-fed animals was observed, and, particularly, miR-133a was upregulated after 12 weeks of HFD compared to control mice. [score:5]
On the other hand, IGF-1 and IGF-1R are targets for miR-1a, and a feedback loop between miR-1 expression and IGF-1 signal transduction cascade has been proposed in striated muscle (16). [score:5]
miR-1a, miR-133a, and miR-206 are specifically induced during myogenesis (49) and myogenic transcription factors, such as MyoD, Myf5, Myog, and Mef2, mediate upregulation of these miRNAs (49– 51). [score:4]
In conclusion, as summarized in Figure 6, we provided for the first time data indicating decreased myogenesis in oxidative skeletal muscle of insulin-resistant mice due to dysregulation in expression of myomiRs, mainly miR-1a and miR-133a. [score:4]
Downregulation of miR-1, miR-206, and miR-133 levels has been reported in white adipocytes (41) and in gastrocnemius muscle (42) of DIO mice and in vastus lateralis (43) and plasma (44, 45) of type 2 diabetic patients. [score:4]
The mo del with an adjusted R [2] = 0.734 resulted in the following variables appearing to account for the ability to predict glycemia (p < 0.05): body weight, gastrocnemius weight, Mtor, Rheb, Mstn, miR-1a, and miR-206 expression. [score:3]
miR-1a expression was different along the time (4 vs. [score:3]
Lower Expression of miR-1 is Correlated with Insulin Resistance in DIO Mice but Is Not Restored by Pioglitazone Treatment. [score:3]
Muscle-specific miRNAs, miR-1a, miR-133a, and miR-206, are recognized as important regulators of skeletal muscle development (10). [score:3]
Feedback circuits in which miR-1a and miR-133a control the level of IGF-1, that in turn regulates miR-1a and miR-133a, have been described during skeletal muscle development (15, 16). [score:3]
” A significant positive correlation between miR-1 and miR-206 expression was found in all individuals (r = 0.70, p < 0.05). [score:3]
Among putative miR-1a, miR-206, and miR-133a targets, IGF-1, IGF-1R, and FSTL1 were already validated (15, 16, 52). [score:3]
Due to the fact that myomiRs are strongly associated to myogenesis and myomiR targets are involved in IGF-1/PI3K/AKT/MTOR pathway, we postulated that decreases in miR-1a and increases in miR-133a levels could be associated with decreased myogenesis in skeletal muscles of insulin-resistant mice. [score:3]
Figure 2 Time-course of muscle-specific microRNAs miR-133a (A), miR-1a (B), and miR-206 (E) expression in soleus muscle of high-fat diet (HFD) and control diet (CD)-fed mice. [score:3]
When we separated control from obese, we found a strong positive correlation between plasma insulin concentration and miR-1 levels (r = 0.82, p < 0.05) and miR-1 expression and mTOR mRNA levels (r = 0.51, p < 0.05) in soleus muscles of control diet-fed mice. [score:3]
Other variables used in the mo del were miR-1a (correlated to glycemia) and miR-206 (correlated to miR-1a levels), and miR-133a, Rheb, Igf-1, Mtor, and Mstn mRNAs expression, and gastrocnemius weight, because they were significantly associated to IR progression. [score:3]
Interestingly, miR-1a expression, together with other variables, appears to account for fasting glycemia increments. [score:3]
While miR-1a may be used as a biomarker for the manifestation and progression of diabetes, and lately glycemic control, it has been found dysregulated in plasma of diabetic subjects (44, 45). [score:2]
miRNA expression was then performed by the Taqman Real-time PCR method using the cDNA 15× diluted, 2× TaqMan Universal PCR master mix, and miRNA assays from Life Technologies: snoRNA-202 (001232), hsa-miR-1 (002222), hsa-miR-133a (002246), and hsa-miR-206 (000510). [score:2]
miRNA miR-1a did not present a time and diet interaction effect; however, miR-1a expression is lower in HFD mice compared to control and is reduced over the time. [score:2]
Hdac4, a transcription repressor, and target of miR-1 and miR-206, was increased in soleus muscle of mice in HFD for 12 weeks compared to control and with 4 and 8 weeks of HFD (Figure 3B). [score:2]
As well as this, miR-1a was correlated to glycemia. [score:1]
A negative correlation between miR-1 and fasting glycemia (r = −0.43, p < 0.05) and body weight (r = −0.48, p < 0.05) and a positive correlation between miR-1 and Kitt (r = 0.41, p < 0.05) were also found (Figure 4). [score:1]
Muscle-specific miRNAs (e. g., miR-1a, miR-133a, and miR-206) have been reported to play critical role in myogenesis. [score:1]
We evaluated the evolution of the expression of miR-1a, miR-133, and miR-206 in mice fed a HFD for 4, 8, or 12 weeks. [score:1]
Mtor and miR-1 correlation was lost, but Kitt and Fst mRNA levels were positively correlated and body weight and Myod mRNA levels negatively correlated with miR-1 levels in soleus muscles (Figure 4). [score:1]
Evidence was obtained that miR-1a may be an early-stage marker of IR evolution in skeletal muscle. [score:1]
Therefore, miR-1a may be a candidate for an early marker for increments on glycemia and miR-133a for skeletal muscle wasting in diabetic subjects. [score:1]
Regardless of improving insulin sensitivity, pioglitazone could not restore miR-1a, miR-133a, or miR-206 levels in soleus muscles (Figure 5). [score:1]
Therefore, probably, miR-1a contributes for reduced myogenesis in HFD animals. [score:1]
Figure 4 miR-1 is correlated with metabolic parameters in mice. [score:1]
Proliferation and differentiation are impaired in insulin resistant soleus muscles as miR-1a is consistently decreased. [score:1]
[1 to 20 of 37 sentences]
22
[+] score: 92
Several in vitro studies have indicated that the 3′ untranslated region (3′UTR) of EDN1 is a direct target of miR-1, and hence miR-1 inhibit the EDN1 expression and lead to attenuation of cell proliferation [28]. [score:10]
In this study, we found that miR-1 was significantly down-regulated and EDN1 was up-regulated in HCC tissues. [score:7]
Finally, we are the first to report that the up-regulation of EDN1 in HCC is correlated with a down-regulation of miR-1. Notably, the correlation between EDN1 and miR-1 was observed in the tissues of HCC patients, highlighting the clinical significance of our observations. [score:7]
These results suggested that up-regulation of EDN1 in HCC may be caused by a down-regulation of miR-1 in these patients. [score:7]
Because the edn1 gene in the edn1 transgenic fish does not include the 3′ UTR, the edn1 expression in the fish should not be targeted by miR-1. Moreover, the edn1 mRNA levels were at high levels at all ages of the transgenic fish. [score:5]
As shown in Fig. 9A, miR-1 was expressed at high levels in the 3-month-old edn1 transgenic fish (Fig. 9A1), but the expression was reduced in the 9-month-old edn1 transgenic fish with HCC (Fig. 9A2). [score:5]
microRNA-1 (miR-1) inhibits cell proliferation in HCC by targeting EDN1 [28]. [score:5]
0085318.g009 Figure 9(A) The RNA expression of miR-1 in the edn1 transgenic fish and human specimens was determined by in-situ hybridization, and EDN1 protein expression in human specimen by IHC. [score:5]
miR-1 inhibits EDN1 expression and leads to attenuation of hepatoma cell proliferation [28]. [score:5]
miR-1 is abnormally down-regulated in several types of cancers, including lung, colorectal, prostate, and thyroid cancers and rhabdomyosarcoma. [score:4]
The expression of miR-1 was at the high level in 3-month-old edn1 transgenic fish which is normal in pathological analysis (A1) and was decreased in the 9-month-old edn1 transgenic fish with HCC (A2). [score:3]
The association of EDN1 and miR-1 expression in patients with HCC was determined using the Wilcoxon signed-rank test [40]. [score:3]
MiR-1 regulates EDN1 expression in HCC. [score:3]
The results showed that the expression of miR-1 was significantly higher in normal liver tissue (Fig. 9A5) than in the HCC specimens at stages I to III (Figs. 9A6–A8). [score:3]
Association of EDN1 and miR-1 expression in patients with HCC. [score:3]
Thus, the miR-1 level is inversely related to the development of HCC. [score:2]
These results suggest that a decrease of miR-1 -mediated repression of EDN1 may contribute to the development of HCC. [score:2]
These findings indicated a potential role of miR-1 in EDN1 regulation HCC. [score:2]
Interestingly, the miR-1 levels were decreased in the HCC samples of the 9 month-old fish compared to those in the normal tissue samples of the 3 month-old edn1 transgenic fish, suggesting that miR-1 may be negatively regulated by edn1. [score:1]
In situ hybridization of miR-1. Sirius Red, Periodic Acid-Schiff, TUNEL, and oil red O staining. [score:1]
Locked nucleic acid (LNA) -modified DNA oligonucleotide probe (hsa-miR-1, ACATACTTCTTTACATTCCA; Exiqon, Vedbaek, Denmark) were used to detect the in situ hybridization signals of miR-1 in liver tissue sections. [score:1]
Statistical analysis demonstrated that there was an inverse correlation between the EDN1 and miR-1 levels in the HCC tissues (Figs. 9B–C). [score:1]
In addition, it has been reported that methylation -mediated silencing of the miR-1 gene induces hepatoma cell proliferation [29]. [score:1]
To assess the relation of miR-1 to EDN1, we initially measured the expression level of miR-1 in the edn1 transgenic fish. [score:1]
The Liver cancer survey tissue array (catalog#: LV809) were purchased from US Biomax (Rockville, MD, USA) for miR-1 in situ hybridization and EDN1 immunohistochemistry analysis. [score:1]
In situ hybridization of miR-1 In situ hybridization of miR-1 was performed using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon, Vedbaek, Denmark). [score:1]
The positive signal is shown in purple for miR-1 in-situ and brown for EDN1 IHC (200X). [score:1]
The miR-1 signal was very intense in the normal human liver tissues (A5), but was weakened in the tissue of HCC at stage I to III tissues. [score:1]
In situ hybridization of miR-1 was performed using the miRCURY LNA microRNA ISH Optimization Kit (Exiqon, Vedbaek, Denmark). [score:1]
[1 to 20 of 29 sentences]
23
[+] score: 86
It is also noteworthy that the most abundant EBOV miRNAs in EBOV-infected samples regulate target genes in vitro; for instance, miR-1-5p experimentally downregulated importin-α5 in HEK293T cells [14], while miR-T3-3p inhibited the expression of HDAC5 and RIPK (genes not originally predicted for this miRNA by TargetScan) [12]. [score:13]
Inspection of the data revealed miRNA expression trends that could be grouped into: (1) miRNAs that increased steadily during disease (miR-1-3p, miR-2-3p, and miR-VP-3p); (2) miRNAs that remained low until day 4, then increased on day 7 (miR-1-5p, miR-T1-3p, miR-T3-3p, miR-T3/T4-5p, and miR-T4-3p); and (3) one miRNA that was highest on day 4/peak viremia (miR-T2-3p). [score:5]
They confirmed that these miRNAs were produced in mammalian cell lines by transfecting the pre-miRNA sequence into these cells, and further demonstrated in vitro that one of the miRNAs (miR-1-5p) suppresses the expression of importin-α5, a nuclear transport protein that interacts with EBOV and may influence viral virulence in vivo. [score:5]
Genes targeted by miR-1-3p are involved in clathrin -mediated endocytosis, while those regulated by miR-1-5p participate in c-MET signaling. [score:4]
miRNA Overrepresented pathway P-value miR-1-3p Cargo recognition for clathrin -mediated endocytosis 1.12E-05 Clathrin -mediated endocytosis 7.06E-05 Disease 1.02E-04 miR-1-5p MET activates RAS signaling 2.57E-08 Signaling pathways regulating pluripotency of stem cells 7.96E-07 Hippo signaling pathway 3.81E-06 Signaling by MET 7.12E-06 Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met) 1.12E-05 miR-T3-3p Antagonism of Activin by Follistatin 1.61E-03 We performed a BLAT search in the UCSC Ebola Genome Browser (with default reference sequence Ebola virus/H. [score:4]
miRNA Overrepresented pathway P-value miR-1-3p Cargo recognition for clathrin -mediated endocytosis 1.12E-05 Clathrin -mediated endocytosis 7.06E-05 Disease 1.02E-04 miR-1-5p MET activates RAS signaling 2.57E-08 Signaling pathways regulating pluripotency of stem cells 7.96E-07 Hippo signaling pathway 3.81E-06 Signaling by MET 7.12E-06 Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met) 1.12E-05 miR-T3-3p Antagonism of Activin by Follistatin 1.61E-03 In this work, we demonstrated that putative EBOV-encoded miRNAs are detectable in circulation in different infection mo dels (mouse, rhesus macaque, cynomolgus macaque, and human) of various EBOV variants (EBOV/Mayinga-MA, EBOV/Kikwit, and EBOV/Makona). [score:4]
miR-1-3p putatively governs clathrin -mediated endocytosis, which is an entry mechanism used by EBOV 29, 30. miR-1-5p target genes, meanwhile, may control c-Met signaling. [score:3]
Enriched pathways from human target gene lists predict that miR-1-3p, miR-1-5p, and miR-T3-3p exert control over different processes in EBOV pathogenesis. [score:3]
In the mouse mo del, miR-1-5p was the most abundant on all days, representing an average of 31.0% of the total over the disease course, followed by miR-T3-3p and miR-1-3p at 22.4% and 15.4%, respectively. [score:3]
We then used ToppFun [21] with default parameters (hypergeometric distribution with Bonferroni correction, P-value < 0.05) on predicted human target genes for the three most abundant miRNAs (miR-1-5p, miR-1-3p, and miR-T3-3p) to perform gene set functional enrichment. [score:3]
The top three miRNAs with the most predicted gene targets were miR-1-5p, miR-T2-3p, and miR-VP-3p. [score:3]
As expected, primers designed to miR-1-3p (Liang) and miR-1-5p (Liang), which only aligned to SUDV variants, showed no target amplification (data not shown). [score:2]
In contrast to the EBOV/Kikwit cohort, one technical replicate in one NHP showed presymptomatic amplification of the most-abundant miR-1-5p at day 3 without direct detection of EBOV (miRNA Cq = 34.79, NTC Cq not detected after 45 cycles). [score:2]
Similar to the NHP findings, the miRNAs at the highest levels were miR-1-5p and miR-T3-3p, followed by miR-1-3p, miR-T4-3p, and miR-T3/T4-5p. [score:1]
Similar to the NHP groups, miR-1-5p, miR-1-3p, and miR-T3-3p were also present at the highest levels in this cohort, albeit with more balanced proportions of these top miRNAs relative to the total miRNA amount. [score:1]
In the human cohort, a similar pattern of miRNA abundances emerged, with miR-1-5p garnering an average of 73.4% over all days, and trailed by miR-T3-3p (6.6%), miR-1-3p (6.5%), and miR-T3/T4-3p (5.4%). [score:1]
Similar to the NHP and mouse groups, miR-1-5p, miR-T3-3p, and miR-1-3p presented at the highest concentrations. [score:1]
In all EBOV infection mo dels, miR-1-5p was the most abundant miRNA, comprising ~70% of the EBOV miRNAs detected in two macaque species and in humans. [score:1]
Circulating virus peaked and then declined after day 6 with viral miRNAs following two trends: (1) mirroring viral load (miR-1-3p, miR-1-5p, miR-2-3p, miR-T1-5p) and (2) increasing over time independent of viral load (miR-T1-3p, miR-T2-3p, miR-T3-3p, miR-T3/T4-5p, miR-T4-3p, miR-VP-3p). [score:1]
All putative miRNAs were detected in these samples, with miR-1-5p and miR-1-3p being most abundant, followed by miR-T3-3p, miR-T1-5p, miR-T4-3p, and miR-T3/T4-3p. [score:1]
EBOV miRNAs amplified in cell culture supernatants, with the most abundant miRNAs being miR-1-5p, miR-1-3p, and miR-T3-3p. [score:1]
The concentration of the most-abundant miR-1-5p was only 54-fold lower than circulating virus in the EBOV/Makona cohort despite the G-to-A substitution in the 20 [th] nucleotide of the EBOV/Makona sequence; it was ~257-fold lower than virus in the EBOV/Kikwit group. [score:1]
EBOV miRNA miRNA concentration by day post-exposure (fM) Day 0 (EBOV load ND) Day 1 (4.17E-05 pM) Day 2 (0.04 pM) Day 3 (3.99 pM) Day 4 (20.20 pM) Day 7 (0.22 pM) miR-1-3p ND ND ND 8.82 ± 6.92 20.94 ± 14.68 51.32 ± 37.27 miR-1-5p ND ND 1.08 ± 0.99 8.52 ± 1.51 25.11 ± 2.55 129.37 ± 6.68 miR-2-3p ND ND ND 2.40 ± 1.23 5.00 ± 1.11 12.41 ± 2.36 miR-T1-3p ND ND ND 0.74 ± 0.16 1.78 ± 0.41 18.44 ± 1.83 miR-T1-5p ND ND ND ND 14. [score:1]
A BLAT search of EBOV-miR-1-3p (Liang) and EBOV-miR-1-5p (Liang) did not produce a significant alignment, and NCBI BLAST results showed that these sequences were only found in SUDV. [score:1]
While still the main miRNA present in mouse EVD, miR-1-5p abundance was proportionally lower and closer to the next most-abundant miRNAs miR-T3-3p and miR-1-3p. [score:1]
In this cohort, miR-1-5p and miR-1-3p yielded the highest concentrations, followed by miR-T1-5p and miR-T3-3p. [score:1]
miR-1-5p was also the most represented miRNA in the cynomolgus macaque EBOV/Makona infection at an average of 67.7% of the total over all days, followed by miR-T3-3p (11.2%), miR-T4-3p (6.9%), miR-T3/T4-5p (6.7%), and miR-1-3p (4.2%). [score:1]
miR-1-3p and miR-1-5p, which were among the top miRNAs detected, lie in the intergenic region between VP30 and VP24. [score:1]
miR-1-5p was detected in the most samples (7 patients), followed by miR-T3/T4-5p and miR-T1-3p (5 patients). [score:1]
Similarly, miR-T3-3p was present at a concentration 26 times higher than virus in sample G14, miR-T3/T4-5p was 5-fold higher in sample G8, and miR-1-3p was 1.8-fold higher in sample G4. [score:1]
Similarly, miR-1-5p was most abundant in the EBOV/Makona group, followed by miR-T3-3p, miR-T4-3p, miR-T3/T4-5p, and miR-1-3p (Table  2 and Supplementary Fig.   S1b). [score:1]
Analysis of the distributions of viral miRNAs in the four species revealed that miR-1-5p was the predominant EBOV miRNA in all infection mo dels, followed by miR-T3-3p and miR-1-3p. [score:1]
In the mouse samples, average viral load was 5.22 ± 0.27 pM, with miR-1-5p concentrations ~400-fold lower over the course of infection. [score:1]
We found that miR-T1-3p shares the same seed sequence as the endogenous mouse miRNA mmu-miR-470, while miR-1-5p shares the same seed region as hsa-miR-155-5p [14], indicating that these may function as host miRNA analogs. [score:1]
EBOV miRNA miRNA concentration by day post-exposure (fM) Day −7 (EBOV load ND) Day 0 (ND) Day 3 (ND) Day 6 (51.71 pM) Day 7 (287.17 pM) Day 8 (295.55 pM) miR-1-3p ND ND ND 58.37 ± 20.57 557.04 ± 111.82 245.68 ± 48.88 miR-1-5p ND ND ND 216.36 ± 15.75 1424.69 ± 108.41 1151.34 ± 72.38 miR-2-3p ND ND ND 1.74 ± 1.32 8.02 ± 1.68 5.20 ± 3.76 miR-T1-3p ND ND ND 2.13 ± 0.52 12.04 ± 1.11 9.94 ± 0.55 miR-T1-5p ND ND ND 4.64 ± 1.06 31.27 ± 1.44 87. [score:1]
In our human samples, EBOV/Makona viral loads were much lower and ranged from 2.1 × 10 [−5] to 7.64 pM (mean 1.06 pM), with average miRNA levels from the most abundant viral miRNA, miR-1-5p, at 99.43 fM (~11-fold lower). [score:1]
The relative abundances of the miRNAs in this cohort mirrored the NHP groups, with miR-1-5p dominating the viral miRNA landscape. [score:1]
In rhesus macaques, miR-1-5p dominated the total EBOV miRNA content at 69.1% over all days, followed by miR-1-3p at 21.3% and miR-T3-3p at 2.7%. [score:1]
EBOV miRNA miRNA concentration by patient sample designator (fM)G1(0.031 pM)G2(0.367 pM)G3(0.336 pM)G4(0.012 pM)G5(7.64 pM)G6(7.50 pM)G8(3.47E-05 pM)G9(1.61E-04 pM)G14(1.04E-04 pM) miR-1-3p 2.67 ±  4.62* 21.74 ±  23.92 15.87 ± 10.68 21.78 ± 10.63 miR-1-5p 0.48 ± 0.11 110.09 ± 1.86 4.17 ± 0.87 361.67 ± 48.69 217.95 ± 5.70 1.39 ±  0.95 0.21 ±  0.26 miR-2-3p 0. 86 ± 0.74 1.38 ± 0.58 1.84 ± 0.25 miR-T1-3p 4.62 ± 1.02 0.38 ± 0.17 1.36 ± 0.45 9.42 ± 1.41 5.03 ± 2.31 miR-T1-5p 0.58 ± 0.99 4.55 ± 1.39 6.47 ± 0.56 miR-T2-3p 0.83 ± 0.87 2.80 ± 0.67 2.48 ± 1.26 miR-T3-3p 9.89 ± 4.67 36.29 ± 8.78 14. [score:1]
Similarly, miR-1-5p was not initially found in the UCSC reference but closer inspection of the pre-miR-1 annotation revealed that miR-1-5p spanned genome position 9892–9913, with a G to A substitution at position 9911 of the EBOV/Makona variant (20 [th] nucleotide of the miRNA sequence); no mismatches were present in the genomes of other EBOV variants. [score:1]
However, miR-1-5p was detected in sample G9 (viral load = 0.161 fM) and miR-T3-3p amplified in one technical replicate of sample G14 (viral load = 0.104 fM, 18 days after symptom onset). [score:1]
miR-1-3p, miR-1-5p, and miR-T3-3p were the most abundant in all variants tested. [score:1]
miR-1-5p was the most abundant miRNA (mean concentration 99.43 ± 142.16 fM), followed by miR-T3-3p (mean 15.76 ± 14.48 fM), miR-1-3p (mean 15.51 ± 9.00 fM) and miR-T3/T4-5p (mean 10.28 ± 11.14 fM). [score:1]
miRNA concentrations on day 7 rivaled those of viral load, with miR-1-5p only ~1.65 times lower than corresponding EBOV titer. [score:1]
However, miR-1-5p, miR-T3-3p, miR-T3/T4-5p, and miR-T4-3p were detectable in three different mice as early as day 2 post-exposure, when animals were asymptomatic for EVD. [score:1]
[1 to 20 of 45 sentences]
24
[+] score: 77
In contrast, as miR-1 and miR-133 are upregulated, expression of their targets may possibly be suppressed in P347S mice. [score:10]
Interestingly, expression of miR-1 and miR-133 were found to be decreased in cardiac hypertrophy, whereas their over -expression inhibited hallmarks of induced cardiac hypertrophy in vitro and in vivo [22]. [score:7]
Additionally, target transcripts for miR-1 and miR-133 comprise mRNA processing factors (for example, Syf11 [SYF2 homolog RNA splicing factor], Prpf8, and Hnrpl [heterogeneous nuclear ribonucleoprotein L]), an apoptosis inhibitor (Faim [Fas apoptotic inhibitory molecule]), and proteins that are involved in intracellular trafficking and motility (for example, Ktn1 [Kinectin 1]), Actr10 [ARP10 actin related protein 10 homolog], and Myh9 [non-muscle myosin heavy chain polypeptide 9]; see). [score:7]
Using a bioinformatics approach, potential target genes for miR-96, miR-183, miR-1, and miR-133 were predicted and screened against genes expressed in the mouse retina [41, 42] and 488 genes linked with eye diseases [40]. [score:7]
Expression of miR-1 and miR-133 decreased by more than 2.5-fold (P < 0.001), whereas expression of miR-96 and miR-183 increased by more than 3-fold (P < 0.001) in Pro347Ser retinas, as validated by qPCR. [score:5]
Among others, expression of miR-96, miR-183, miR-1, and miR-133 exhibited significant alterations in P347S mice by microarray analysis, and these changes were validated by qPCR. [score:3]
In light of this, it is unlikely that the significant changes observed in the expression of miR-96, miR-183, miR-1 and miR-133 are due to the altered cellular composition of the P347S retina. [score:3]
Similarly, the observed increased expression of miR-1 and miR-133 in the P347S retina may possibly suggest that a compensatory mechanism has been activated in the mutant retina in an attempt to prevent photoreceptor cell death. [score:3]
Potential target transcripts for miR-96, miR-183, miR-1 and miR-133 predicted by miRanda [39] were retrieved from the Sanger miR Database [37]. [score:3]
Expressions of mouse microRNA (miR)-96, miR-183, miR-133 and miR-1 were analyzed using Ambion miR microarrays (green, 'A-' in legend), Exiqon miR microarrays (blue, 'E-' in legend), and quantitative real-time reverse transcription polymerase chain reaction (qPCR; magenta). [score:3]
Many genes encoding factors that are involved in mRNA processing and splicing, and RNA -binding proteins belong to the predicted targets for miR-1 and miR-133. [score:3]
Potential retina specific targets of miR-1, miR-96, miR-133, and miR-183 were generated through computational means. [score:3]
More specifically, significant differences in expression of miR-1, miR-96, miR-133, and miR-183 in retina were observed between RHO mutant and wild-type mice. [score:3]
A subset of highly ranked potential targets for miR-96, miR-183, miR-1 and miR-133 are implicated in the visual cycle (for example Abca4, Pitpnm1 [membrane associated phosphatidylinositol 1], and Pde6a), in cytoskeletal polarization (for example, Crb1 and Clasp2 [CLIP associating protein 2]), and in transmembrane and intracellular signaling (for example, Clcn3 [chloride channel 3], Grina [N-methyl-D-aspartate -associated glutamate receptor protein 1], Gnb1 [guanine nucleotide binding protein beta 1 polypeptide] and Gnb2 [guanine nucleotide binding protein beta 2 polypeptide]). [score:3]
Note that for a number of miRs (for example, miR-1, miR-133, and miR-96), both Ambion and Exiqon microarrays detected similar alterations in expression between the P347S mutant and wild-type retinas. [score:3]
lists potential retinal target transcripts with the highest rankings for miR-96, miR-183, miR-1, and miR-133. [score:3]
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
The above conditions were met by miR-1, miR-96, miR-133, and miR-183 (highlighted in red in Figure 4b,c); these miRs were therefore selected for qPCR quantification. [score:1]
MiR-1, miR-96, miR-133, and miR-183 are highlighted in red; h and m in labels refer to human and mouse miRs. [score:1]
In contrast, miR-1 and miR-133 levels increased by more than 3-fold in retinas of P347S mice. [score:1]
Figure 6 displays corresponding data from the two different microarrays and qPCR analyses for miR-96, miR-183, miR-1, and miR-133. [score:1]
In summary, expression of miR-96 and miR-183 decreased by more than 2.5-fold (P < 0.001) in mutant retinas, whereas miR-1 and miR-133 increased by more than 3-fold (P < 0.001), as measured using qPCR. [score:1]
[1 to 20 of 22 sentences]
25
[+] score: 74
Future studies targeted on in vivo restoration of Pim-1 either by upregulation of Pim-1 or by knocking-down miR-1 will provide a platform for the development of gender specific treatment to combat the disease. [score:10]
Literature search and online target prediction tools (Target Scan and Pictar Scan) revealed miR-1 and miR-208a as possible inhibitors of Pim-1 expression [15, 17, 32]. [score:9]
We also demonstrate that early downregulation of pro-survival protein Pim-1 plays a major role in accelerating the progression of cardiomyopathy in female diabetics through upregulation of miR-1 and 208a. [score:7]
This was associated with significant downregulation of pro-survival Pim-1 and upregulation of pro-apoptotic Caspase-3, microRNA-1 and microRNA-208a. [score:7]
In vitro restoration of Pim-1 levels either through direct overexpression of Pim-1 or inhibition of miR-1 and 208a reverted this “ female disadvantage” in the diabetic cardiomyocytes. [score:6]
However, the miR expression study on human hearts did not reveal any significant difference between male and female diabetics although there was a trend for increased expression of miR-1 in female diabetics. [score:5]
MiR-1 has been well demonstrated as the direct regulator of Pim-1 in the heart independent of Akt [17] and our earlier study showed marked improvement in the survival of male diabetic cardiomyocytes following knockdown of miR-1 [15]. [score:4]
Our results newly show marked upregulation of miR-1 in the female diabetic heart. [score:4]
In support of this notion, inhibition of both miR-1 and -208a improved the survival of female diabetic cardiomyocytes. [score:3]
F-G Bar graphs showing the expression level of miR-1 (F) and miR-208 (G) in study groups (n = 5 at each time point). [score:3]
C-D. Bar graphs showing the expression level of miR-1 (C) and miR-208a (D) in diabetic and non-diabetic human heart. [score:3]
Here, we confirmed that female diabetic hearts more abundantly express miR-1 (Figure  3F) and miR-208a (Figure  3G) at 4 weeks after STZ -induced diabetes, with further increases during evolution of cardiomyopathy (P < 0.01 vs. [score:3]
Transfection with Pim-1 (Figure  5A-C) or anti-miR-1/208a (Figure  5D-E) rescued Pim-1 expression in both the male and female diabetic cardiomyocytes (Figure  5B and Figure  5D, P < 0.05 vs. [score:3]
Additional in vivo studies are necessary to understand the role of miR-1 and miR-208a in accelerating the development of cardiomyopathy in female diabetic hearts. [score:2]
To this aim, cardiomyocytes isolated from diabetic and non-diabetic mice at 12 weeks after STZ -induced diabetes were transfected with either hPim-1 plasmid or anti-miR-1/208a. [score:1]
Akt was decreased (Figure  4B) and miR-1 (Figure  4C) and miR-208 (Figure  4D) was increased in both the diabetic groups with no significant difference between genders, although there was a trend for increased levels of miR-1 in female diabetics (Figure  4C). [score:1]
In addition to miR-1, we also found early activation of miR-208a in the female diabetic mice, which might also account for increased LV dilation early in the female diabetic heart [42]. [score:1]
D representative blots and bar graphs showing the levels of Pim-1 in the isolated and cultured cardiomyocytes treated with either anti-miR-1/208a or scrambled sequence. [score:1]
Freshly isolated cardiomyocytes from diabetic and non-diabetic murine hearts of both genders were transfected either with human Pim-1 plasmid (8 μg/1×10 [6] cells) [15], or anti-miR-1/208 (50 nM, Life Technologies) using commercially available Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions. [score:1]
[1 to 20 of 19 sentences]
26
[+] score: 74
On the other hand, axotomy increases the relative expression of miR-1, -16, and 206 in a time -dependent fashion while in the dorsal horn there was a significant downregulation of miR-1. with capsaicin also increased the expression of miR-1 and -16 in DRG cells but, on the other hand, in the spinal dorsal horn only a high dose of capsaicin was able to downregulate miR-206 expression. [score:13]
The expression profile of miR-1 in DRG showed no change at day 1 after nerve injury but a significant downregulation at day 3, 7 and 14 post-surgery (Figure 2B). [score:6]
However, the expression pattern of miR-206 was similar to miR-1. A remarkable downregulation was observed as early as day 1, persisting at days 3, 7 and 14 (Figure 2B). [score:6]
Interestingly, all miRNA investigated showed a persistent upregulation in DRG following axotomy whereas in the dorsal horn only miR-1 was steadily downregulated. [score:5]
Moreover, capsaicin induced a significant upregulation of miR-1 and miR-16, but not miR-206, in DRG (Figure 4B). [score:4]
Interestingly, 10 min after capsaicin injection miR-1 and -16 were up-regulated in DRG. [score:4]
CFA injection induced a significant downregulation of miR-1, -16 in DRG as early as 12 h persisting until 7 days post-injection (Figure 1B). [score:4]
Using the partial sciatic nerve injury mo del we also observed a sustained downregulation of miR-1 and -206, but not miR-16, in DRG. [score:4]
Opposite to the results observed in the partial nerve lesion mo del, complete peripheral nerve section induced an upregulation of miR-1, -16 and -206 in DRG at days 1, 3 and 7 post-injury (Figure 3A). [score:4]
After sciatic nerve partial ligation, miR-1 and -206 were downregulated in DRG with no change in the spinal dorsal horn. [score:4]
Our results indicate that miR-1, -16, and -206, but not miR-122a are also expressed in DRG and the dorsal horn of the spinal cord. [score:3]
Previous northern blot analysis showed that miR-1, -16 and -206 are expressed in mouse cortex, cerebellum e midbrain [10, 26]. [score:3]
On the contrary, in the dorsal horn of the spinal cord the expression of miR-1, -16, and -206 showed a significant increase at day 1, 3 and 7 but not in the initial inflammatory process (Figure 1C). [score:3]
Quantitative real-time polymerase chain reaction analyses showed that the mature form of miR-1, -16 and -206, is expressed in DRG and the dorsal horn of the spinal cord. [score:3]
On the other hand, miR-1 showed a significant decrease in the spinal dorsal horn from day 1 to day 7 whereas no change was observed in the expression of miR-16 and -206 (Figure 3B). [score:3]
In our mouse mo del, CFA also induced a sustained down regulation of miR-1 and -16 from 12 hours to 7 days post-injection in DRG. [score:2]
Therefore, we investigated the temporal, spatial and stimulus -dependent specificity of miRNAs by monitoring the time-course expression of miR-1, miR-16, miR-122a, and miR-206 in mouse DRG and spinal cord dorsal horn under inflammatory and neuropathic pain states as well as after acute nociceptive stimulation. [score:1]
Here we investigate the time course gene expression profile of miR-1, -16, and -206 in mouse dorsal root ganglion (DRG), and spinal cord dorsal horn under inflammatory and neuropathic pain conditions as well as following acute noxious stimulation. [score:1]
Thereafter, we were able to detect miR-1, -16 and -206, but not miR-122a even after 40 cycles. [score:1]
[1 to 20 of 19 sentences]
27
[+] score: 73
miR-1, miR-133a and miR-133b expression is upregulated with aging in men. [score:6]
miR-1 has a specific set off predicted mRNA targets and the regulatory net-effect will thus differ from the effect of testosterone -mediated miRNA regulation. [score:5]
An overall effect of LHRH-agonist treatment was observed for miR-133a and miR-133b expression (P < 0.05), but not in miR-1 or miR-206 expression (P > 0.05). [score:5]
Where no effect of age and/or gender on miR-1 and miR-206 expression was detected (P > 0.05), a significant interaction on miR-1 expression was identified with a Two-Way ANOVA test (P < 0.05). [score:5]
An ordinary Two-Way ANOVA revealed an overall effect of both gender and age on miR-133a and miR-133b expression (B,C) ([**] P < 0.01) and a significant interaction for miR-1 expression ([**] P < 0.01). [score:5]
When using Bonferroni multiple comparison post-hoc test it was demonstrated that miR-1 (A), miR-133a (B), and miR-133b (C) expression levels were higher in elderly compared to younger men ([*] P = 0.02, [*] P = 0.03, [***] P = 0.008, respectively) There was no effect of age or gender on mir-206 expression (D) (P > 0.05). [score:4]
Therefore, it is likely that the decline in physical activity is the main determining factor involved in the age -dependent up-regulation of miR-1 and miR-133a/b. [score:4]
miR-1 and miR-206 expression were not altered by LHRH-agonist treatment before the training period (P > 0.05) (Figures 3A,D). [score:3]
The expression of mir-1 and mir-206 were identical in skeletal muscle in both castrated and sham operated mice (P > 0.05). [score:3]
miR-1, miR-133a, miR-133b, and miR-206 belong to a group of muscle specific miRNAs (myomiRs) crucial for the regulation of skeletal muscle development and function (Chen et al., 2006; van Rooij et al., 2008). [score:3]
miR-1 (E) and miR-206 (H) expression were not correlated with testosterone in men. [score:3]
Bonferroni multiple comparison post-hoc tests revealed a significant lower expression of mir-133a (B) ([*] P = 0.02) and mir-133b (C) ([*] P = 0.03), but not mir-1 (A) or miR-206 (D) in testosterone blocked patients at rest before training. [score:3]
The expression of mir-1 and mir-206 were not significantly different between castrated and sham operated mice (A). [score:3]
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
Partly in line with our previous results (Nielsen et al., 2010), a Two-Way ANOVA (RM) demonstrated a main effect of training in terms of decreased expression in all four myomiRs (miR-1, P < 0.0001. miR-133a, P < 0.01. miR-133b, P < 0.0001, miR-206 P < 0.05). [score:3]
In the current study, we found that the expression of miR-1, miR-133a, and miR-133b was higher in the skeletal muscle of elderly compared to younger men and that miR-133a/b was higher expressed in women compared to men. [score:3]
MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. [score:3]
We found an increased expression of miR-1 (P = 0.02), miR-133a (P = 0.03) and miR-133b (P = 0.008) in elderly men compared to younger men (Figures 1A–C). [score:2]
However, in addition to miR-133a/b, miR-1 was induced in the elderly group. [score:1]
ARE motifs near the miR-1/miR-133a loci, have not yet been identified. [score:1]
To address a potential involvement of miR-1, miR-133a, and miR-133b in the age-related decline in muscle function for both genders, we used a bonferroni multiple comparison post-hoc test. [score:1]
In line with our previous findings (Nielsen et al., 2010) aerobic fitness in all subjects was negatively correlated with miR-1 and miR-133a and miR-133b (Figures 2A–C) (P < 0.05, 0.01 and 0.001, r [2] = 0.11, 0.24, and 0.33, respectively). [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
A Two-Way ANOVA (RM) (miR-1, [****] P < 0.0001. miR-133a, [**] P < 0.01. miR-133b, [***] P < 0.001, miR-206 [*] P < 0.05). [score:1]
miR-1, miR-133a, and miR-133b (A–C) were inversely correlated with maximal oxygen uptake in women and men (n = 36) (P < 0.05, 0.01 and 0.001, R [2] = 0.11, 0.24, and 0.33). [score:1]
[1 to 20 of 25 sentences]
28
[+] score: 72
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-1b
IL11 is a predicted gene target of miR-1 [22] and miR-1 transfection of Hela cells down-regulates IL11, IL11Rα and STAT3 mRNA [29]. [score:6]
MiR-1 down-regulated IL11 gene expression and its’ signaling components, IL11Rα and gp130 in G3-derived AN3CA endometrial epithelial cells. [score:5]
Loss of miR-1 expression in primary type I human endometrial cancer [21] correlates with elevated IL11 expression [13, 14]. [score:5]
Restoration of miR-1 by synthetic miR-1 mimic transfection significantly down-regulated IL11, IL11Rα and gp130 in AN3CA cells, but not HEC1A cells. [score:4]
MiR-1 expression was detectable in most benign endometrial tissue samples, however expression in G1-3 endometrial tumour tissues was undetectable (n = 10/group) (Figure 1A). [score:4]
IL11 is a predicted target of miR-1 [22]. [score:3]
MiR-1 mimic significantly reduced HEC1A (p < 0.05) and AN3CA cell viability (p < 0.01) (Figure 1D), and significantly down-regulated IL11 mRNA and its’ signaling components, IL11Rα and gp130 in AN3CA cells (p < 0.05), but not HEC1A cells (Figure 1E). [score:3]
This finding suggests that miR-1 may regulate proliferation in endometrial cancer cells at least in part via IL11, however, the direct binding of miR-1 with the 3′UTR of IL11 was not established. [score:3]
Gene expression was normalised against 18 s. Table 2 IL11 F 5′-GTTTACAGCTCTTGATGTCTC-3′ R 5′-GAGTCTTTAACAACAGCAGG-3′ IL11Rα F 5′-GTCCCCTGCAGGATGAGATA-3′ R 5′-AGGCCAAGGCAAGAGAAGAT-3′ p130 F 5′-CATAGTCGTGCCTGTGTGCT-3′ R 5′-GCCGTCCGAGTACATTTGAT-3′ HEC1A or AN3CA cells were transfected according to manufacturers instructions using Lipofectamine [®] RNAiMAX and miR-1 mimic (100 nM; Life Technologies) for 72 h. A scrambled microRNA sequence (scr) (Life Technologies) was used as a control. [score:3]
MicroRNA (miR-1) has previously been demsontrated to act as a tumour suppressor in endometrial tumours [21]. [score:3]
MiR-1 was overexpressed by transfecting HEC1A and AN3CA cells with miR-1 mimic. [score:3]
MiR-1 expression and regulation of IL11 in human endometrial cancer and cell lines. [score:3]
Quantitative real-time RT-PCR was performed to determine miR-1 expression in whole tissue from G1-3 endometrial tumours versus benign endometrium. [score:3]
Gene expression was normalised against 18 s. Table 2 IL11 F 5′-GTTTACAGCTCTTGATGTCTC-3′ R 5′-GAGTCTTTAACAACAGCAGG-3′ IL11Rα F 5′-GTCCCCTGCAGGATGAGATA-3′ R 5′-AGGCCAAGGCAAGAGAAGAT-3′ p130 F 5′-CATAGTCGTGCCTGTGTGCT-3′ R 5′-GCCGTCCGAGTACATTTGAT-3′ HEC1A or AN3CA cells were transfected according to manufacturers instructions using Lipofectamine [®] RNAiMAX and miR-1 mimic (100 nM; Life Technologies) for 72 h. A scrambled microRNA sequence (scr) (Life Technologies) was used as a control. [score:3]
MiR-1 is absent in human endometrial cancer and cell lines and miR-1 mimic down regulates IL11 in AN3CA cells. [score:2]
Figure 1(A) MiR-1 expression was quantified in G1, 2, or 3 human endometrial cancer tissue, or benign (B) endometrium by real-time RT-PCR normalized to snU6 (n = 10/group) and in (B) normal proliferative phase endometrial epithelial cells (n = 4), or human endometrial cancer cell lines; Ishikawa, HEC-1A, RL95 and AN3CA derived from grade 1, 2, or 3 human endometrial cancers respectively, normalized to 18 s (n = 3 passages/cell line). [score:2]
We hypothesized that miR-1 regulates IL11 in endometrial tumours and that IL11 promotes high grade endometrial tumour growth. [score:2]
MiR-1 has approximately 1000 predicted targets in different cell types [22, 29], with only phosphodiesterase 7A (PDE7A) experimentally confirmed in endometrial cancer cells [21]. [score:2]
MiR-1 expression levels were normalised against control snU6 probes. [score:2]
Similarly, we found loss of miR-1 expression in a panel of human endometrial epithelial cell lines compared to normal proliferative phase endometrial epithelial cells. [score:2]
In AN3CA cells, miR-1 mimic significantly reduced cell proliferation versus scr control after 72 h (p < 0.01) (Figure 1F). [score:1]
Addition of IL11 to miR-1 mimic transfected cells restored AN3CA cell proliferation to control levels (Figure 1F). [score:1]
MiR-1 was significantly up regulated in both cell types treated with mimic versus scrambled (scr) control (Figure 1C). [score:1]
MiR-1 is reported to act as a tumour supressor, since restoration of mature miR-1 impairs endometrial cancer cell migration and invasion [21]. [score:1]
Regardless, miR-1 mimic significantly reduced cell viability in both HEC1A and AN3CA cells, in line with findings in other endometrial epithelial cell lines, including G1-derived HEC1B and G2-derived HEC265 [21]. [score:1]
Similarly, miR-1 was detected in primary human proliferative phase endometrial epithelial cells, but was undetectable in human endometial epithelial carcinoma cell lines (n = 3–4/group) (Figure 1B). [score:1]
In AN3CA cells, miR-1 mimic reduced cell proliferation and addition of IL11 to miR-1 mimic transfected cells restored AN3CA proliferation to control levels. [score:1]
Micro -RNA (miR-1) mimic transfection. [score:1]
HEC1A or AN3CA cells transfected with miR-1 mimic or scr control were seeded at a density of 10,000 cells per well in 96-well flat-bottom microplates (Costar, USA) 72 h after transfection. [score:1]
[1 to 20 of 29 sentences]
29
[+] score: 71
Irrespective of the cause of cardiac hypertrophy, the downregulation of miR-1 and upregulation of miR-214 seems to be implicated wi dely in murine cardiac disease, and in human cardiomyopathy. [score:9]
Upregulated mRNA targets of miR-1 include myotrophin (Mtpn), which can trigger myocardial hypertrophy [31], and Ctgf and thrombospondin, which regulate extracellular matrix remo delling, suggesting miRNAs may contribute towards fine tuning of the extracellular matrix proteins [32]. [score:7]
Seven miRNAs showed differential expression (Figure 1a, Figure S2a); miR-1 and miR-542-3p showed decreased expression, whereas miR-132, miR-214, miRNA-31, miR-210 and miR-10b showed increased expression. [score:7]
The second downregulated miRNA at a pre-disease stage was miR-133a, which belongs to the same transcriptional unit as miR-1 [24]. [score:6]
Downregulation of miR-1 has been reported as early as one day after TAB [8], and while miR-1 is abundant in adult hearts, its level is lower in the developing embryonic hearts of mice [24], [25], suggesting that reversion of miR-1 towards an embryonic expression level is an early response to cardiac stress. [score:6]
Together, these data further implicate downregulation of miR-1 and miR-133 in the development of HCM, and strategies to maintain their levels may represent a therapeutic opportunity. [score:5]
The heart is sensitive to miR-1 levels, with adenoviral overexpression of miR-1 previously shown to attenuate cardiac hypertrophy, and targeted homozygous deletion of a single copy (miR-1-2) in mice leads to significant embryonic lethality due to defects in cardiogenesis [25], [27]. [score:5]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
Nine miRNAs with the highest expression levels (average Ct value range 19.6–22.5) were common amongst the four groups of mice despite the differences in age and disease state, and they were miR-133a, miR-126-3p, miR-24, miR-30c, miR-30b, miR-1, miR-16, miR-19b and miR-145 (Table S1). [score:5]
Downregulated miRNAs included miR-1 and miR-133a, which are part of the same transcriptional unit, and three miR-30 family members, namely miR-30b, miR-30c and miR-30e. [score:4]
The expression levels of miR-1 and miR-133a were significantly lower at a pre-disease stage in DBL mice, and this represents the earliest recorded pathological change in our well-characterised mouse mo del of HCM [20]. [score:3]
The cardiac abundant miR-1 family consist of two copies with identical mature nucleotide sequences, and thus target the same mRNAs [24]. [score:3]
Furthermore, a requirement for miR-1 during post-embryonic development is suggested by impaired cardiac conduction in the few miR-1-2 homozygous null mice that survive to adulthood, and the high level of miR-1 in the adult heart. [score:2]
At a pre-disease stage, the co-transcribed miR-1 and miR-133a were significantly lower in DBL mice compared to NTG mice. [score:2]
It is unclear what causes the reduction of miR-1 levels in DBL mice, however, serum response factor regulates transcription of both copies in the heart [26]. [score:2]
[1 to 20 of 15 sentences]
30
[+] score: 70
Quantitative PCR assessment revealed that expression levels of serum miR-1 and miR-133a were directly associated with myocardial steatosis, independently of potential confounding factors. [score:4]
Kuwabara Y Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damageCirc Cardiovasc Genet. [score:3]
We observed an increase in miR-1 and miR-133a expression in the in vitro mo del of lipid -loaded cardiomyocytes. [score:3]
Second, increased levels of circulating miR-1 and miR-133a in patients with cardiovascular disease have been previously linked to myocardial ischemia and/or damage 32, 33. [score:3]
Ten KEGG pathways were enriched with the predicted targets of miR-1 and -133a (p < 0.050) (Supplementary Information, Table  S3). [score:3]
In the context of diabetes, the expression of miR-1 and miR-133a are reduced in mouse and rat mo dels of streptozotocin -induced type 1 diabetes 47, 52, 53. [score:3]
As shown, in Fig.   1B, we observed a direct association between myocardial steatosis and circulating miR-1 and miR-133a. [score:2]
First, our results show that miRNAs transcribed at the same clusters, such as miR-1 and miR-133a, could be regulated in parallel, at least in response to neutral lipid overaccumulation. [score:2]
Univariate analysis (mo del 1) revealed a direct association between circulating levels of miR-1 (β = 0.360, P = 0.006) and miR-133a (β = 0.335, P = 0.008), but not miR-133b (β = 0.157, P = 0.198). [score:2]
Future simplification of the miRNA methodology could allow the development of blood test based on serum miR-1 and miR-133a levels as a non-invasive tool to improve the detection, prediction, and monitoring of cardiac-related complications in the early stages of diabetes. [score:2]
We observed increased expression of miR-1 (2.4-fold and 2.6-fold for 50 and 100 μg/mL, respectively) and miR-133a (1.3-fold and 1.6-fold for 50 and 100 μg/mL, respectively) after exposure to lipoproteins as compared with control conditions. [score:2]
Here, we found a direct association between myocardial steatosis and serum miR-1 and miR-133a levels in type 2 diabetes patients and in a murine mo del of insulin resistance, even with verified absence of clinically evident myocardial ischemia and/or damage. [score:2]
Myocardial levels of miR-1 and miR-133a were similar in both groups (Fig.   2D). [score:1]
The highest area under the ROC curve (AUC) was observed for the mo del containing the clinical parameters and both miR-1 and miR-133a [AUC (95% CI) = 0.783 (0.654–0.912) for mo del 1; 0.866 (0.765, 0.967) for mo del 2; 0.825 (0.710–0.940) for mo del 3; 0.883 (0.793–0.972) for mo del 4]. [score:1]
Furthermore, we could not discard that other types of cardiac stress, beyond neutral lipid accumulation, could induce the secretion of miR-1 and miR-133a from cardiomyocytes. [score:1]
Univariate and multivariate logistic regressions were analysed to explore the association between serum levels of miR-1 and miR-133a, and myocardial steatosis as outcome. [score:1]
After demonstrating an increase in myocardial neutral lipid accumulation in our murine mo del of insulin resistance, we next analysed levels of miR-1 and miR-133a in the serum and myocardium of both diet groups. [score:1]
Neither miR-1, nor miR-133a were detected in the VLDL+IDL preparations added to HL-1 cardiomyocytes. [score:1]
Levels of circulating cardiomyocyte-enriched miR-1 and miR-133a are increased in an in vivo mouse mo del of high-fat diet -induced insulin resistance. [score:1]
miRNAs play a critical role the cellular response to physiologic and pathophysiologic stress [42], and several studies have demonstrated a role for both miR-1 and miR-133a in cardiac function 43– 45. [score:1]
The results obtained from patients and both in vivo and in vitro mo dels suggest that serum miR-1 and miR-133a levels hold significant promise as clinical indicators of myocardial steatosis. [score:1]
Type 2 diabetes patients in the third tertile of myocardial steatosis (high levels) showed a higher level of circulating miR-1 and miR-133a than those tertiles 1 and 2 (low-intermediate levels) (Fig.   1A). [score:1]
Quantitative miRNA analysis was restricted to cardiomyocyte-enriched miRNAs: miR-1, miR-133a/b, miR-208a/b, and miR-499. [score:1]
A correlation between the myocardial neutral lipid content and circulating levels of miR-1 and miR-133a was observed (ρ = 0.622, P = 0.031, ρ = 0.755, P = 0.005, respectively). [score:1]
Sensitivity and specificity were 73.7% and 74.2%, for mo del 1, 78.9% and 71.0% for mo del 2, 78.9% and 74.2% for mo del 3 and 78.9% and 77.4% for mo del 4. Levels of circulating cardiomyocyte-enriched miR-1 and miR-133a are increased in an in vivo mouse mo del of high-fat diet -induced insulin resistanceTo validate the association between myocardial neutral lipid accumulation and circulating cardiomyocyte-enriched miR-1 and miR-133a levels, we tested our clinical findings in an animal mo del of insulin resistance induced by a high-fat diet. [score:1]
These findings strengthen the clinical applicability of circulating miR-1 and miR-133a as biomarkers of myocardial steatosis in type 2 diabetes patients. [score:1]
Adjustment for different clinical, biochemical, metabolic or cardiac parameters had no effect on the association between myocardial steatosis content and circulating miR-1 or miR-133a levels (P < 0.010 for all mo dels). [score:1]
Circulating miR-1 and miR-133 levels have been consistently associated with conditions such as acute coronary syndrome 16, 32, 33, 40, hypertrophic cardiomyopathy [19], and Takotsubo cardiomyopathy [18]. [score:1]
The close association between myocardial steatosis and circulating miR-1 and miR-133a in our population of patients with well-controlled type 2 diabetes levels may be explained, at least in part, by the overaccumulation of neutral lipids in cardiomyocytes. [score:1]
A borderline association between miR-1 and LV mass was observed (β = −0.243, P = 0.071). [score:1]
Sensitivity and specificity were 73.7% and 74.2%, for mo del 1, 78.9% and 71.0% for mo del 2, 78.9% and 74.2% for mo del 3 and 78.9% and 77.4% for mo del 4. To validate the association between myocardial neutral lipid accumulation and circulating cardiomyocyte-enriched miR-1 and miR-133a levels, we tested our clinical findings in an animal mo del of insulin resistance induced by a high-fat diet. [score:1]
In agreement with previous findings, VLDL+IDL dose -dependently induced the release of miR-1 (27.5-fold and 33.9-fold increases for 50 and 100 μg/mL, respectively) and miR-133a (11.4-fold and 12.6-fold increases for 50 and 100 μg/mL, respectively) from HL-1 cells into the culture medium (Fig.   3B). [score:1]
Multivariate analysis was performed to explore in detail the relationship between myocardial neutral lipid content and miR-1 and miR-133a levels (Table  3). [score:1]
In mo del 2, myocardial steatosis was entered as a dependent variable and age, visceral fat volume, non-HDL-cholesterol, plasma TG, and miR-1 or miR-133a levels were subsequently entered as independent variables. [score:1]
Taken together, our findings suggest that miR-1 and miR-133a are robust predictors of myocardial steatosis in type 2 diabetes. [score:1]
Our clinical and in vivo findings suggest that lipid oversupply to the myocardium may underlie the observed alterations in serum miR-1 and miR-133a levels. [score:1]
To do that, we analysed four logistic regression mo dels: (i) mo del 1: clinical variables statistically associated, or close to be statistically associated, with myocardial steatosis, including age, plasma fasting glucose, visceral fat volume, non-HDL-cholesterol and plasma triglyceride; (ii) mo del 2: mo del 1 + miR-1; (iii) mo del 3: mo del 1 + miR-133a; (iv) mo del4: mo del 1 + miR-1 + miR-133a. [score:1]
Circulating cardiomyocyte-enriched miR-1 and miR-133a levels are independent predictors of myocardial steatosis in patients with type 2 diabetes. [score:1]
The fact that miR-1 and miR-133a were poorly associated with other clinical, biochemical, metabolic, hemodynamic, and cardiac parameters in regression mo dels supports the hypothesis that these miRNAs are independent predictors of myocardial steatosis. [score:1]
The active release of miR-1 and miR-133 from HL-1 cardiomyocytes in response to lipid overload and in the absence of cell damage allows us to speculate about the role of both miRNAs as extracellular mediators in cell-cell communication. [score:1]
Corroborating our clinical findings, we observed increases in serum levels of miR-1 (3.3-fold) and miR-133a (2.4-fold) in the Western diet group with respect to the chow diet group (Fig.   2C). [score:1]
Circulating cardiomyocyte-enriched miR-1 and miR-133a are released by HL-1 cardiomyocytes following intracellular neutral lipid accumulation. [score:1]
miR-1, miR-133a, and miR-133b levels were below the limit of detection in 22.2%, 13.9%, and 4.2% of patients, respectively. [score:1]
Both miR-1 and miR-133a affect several cellular pathways intimately involved in heart physiology and pathophysiology. [score:1]
The present study demonstrates for the first time that serum levels of cardiomyocyte-enriched miR-1 and miR-133a are predictors of myocardial steatosis in patients with well-controlled and uncomplicated type 2 diabetes of short duration. [score:1]
Figure 1(A) Quantification by RT-qPCR of serum miR-1 and miR-133a levels in patients with uncomplicated type 2 diabetes in tertiles 1 and 2 (low-intermediate levels; N = 48) or 3 (high levels; N = 24) of myocardial steatosis. [score:1]
Univariate regression analysis revealed an inverse association between miR-1 levels and the E/Ea ratio (β = −0.305, P = 0.030). [score:1]
Our results indicated that miR-1 and miR-133a levels in the systemic circulation may reflect not only myocardial ischemia/damage as previously proposed by other authors [32], but also active responses of cardiomyocytes to stressful conditions. [score:1]
Given that miRNAs may be packaged in lipoproteins 30, 31, we analysed the presence of both miR-1 and miR-133a in VLDL+IDL preparations to control for possible cross-contamination in our samples. [score:1]
No differences in serum miR-1 levels were observed between groups (type 2 diabetes group = 1.33 ± 0.35, control group = 1.01 ± 0.36; P = 0.073). [score:1]
Using logistic regression mo dels, we explored the association between the levels of myocardial steatosis and different potential predictors, including miR-1 and miR-133a. [score:1]
[1 to 20 of 51 sentences]
31
[+] score: 68
We also tested the expression level of other previously identified targets of miR-1a and miR-133a in Trbp knockdown myoblasts, however, we did not detect the alteration of the expression of these targets. [score:10]
Consistently, we observed an upregulation of Pax7 in SiTrbp -treated C2C12 myoblasts, which is correlated with the down-regulation of miR-1a. [score:7]
Others and we have demonstrated their regulatory roles: inhibition of miR-1, or miR-206 represses myogenesis, while overexpression of these miRNAs can promote myoblast differentiation[6, 8, 11]. [score:6]
Expression of miR-1a and miR-133a was dramatically down-regulated both in vitro and in vivo, when Trbp was inactivated. [score:6]
Intriguingly, miR-1a has been reported to promote myogenesis by repressing Pax7, which was modestly upregulated in SiTrbp -treated cells (Fig 6E). [score:4]
The impaired muscle differentiation in Trbp mutant mice or Trbp-knockdown cells is associated with reduced expression of miR-1a and miR-133a. [score:4]
Consistent with the results in C2C12 cells in vitro, we observed that the expression levels of miR-1a and miR-133a were significantly reduced in the muscle of Trbp [Myf5] mice in vivo (Fig 7B). [score:3]
As shown in Fig 7B, we found that while CTX -induced muscle injury resulted in reduced level of miR-1a and miR-133a (Fig 7B), loss of Trbp further reduced the expression levels of miR-1a and miR-133a in Trbp [Myf5] muscle (Fig 7B). [score:3]
We analyzed the expression level of several muscle enriched miRNAs, including miR-1a, miR-133a, and miR-206, in siRNA -treated C2C12 cells. [score:3]
The muscle-enriched miR-1a is expressed in both cardiac and skeletal muscles. [score:3]
The functional roles of muscle-enriched miR-1a and miR-133a, and their targets in myogenesis have been reported previously [7, 10, 11]. [score:3]
Pax7 has been demonstrated as a downstream target of miR-1a (and miR-206) [11]. [score:3]
The muscle enriched miR-1, miR-133, and miR-206 exhibit correlated expression pattern during myogenesis or in muscle regeneration. [score:3]
Here, we found that Trbp is required for the normal expression and function of miR-1a in skeletal muscle. [score:3]
However, in our previous study, cardiac-specific knockout of Trbp did not significantly alter the level of miR-1a in the neonatal heart [23]. [score:2]
In this study, we identified Trbp as a key regulator of myogenic miRNAs, miR-1a and miR-133a, in skeletal muscle cells. [score:2]
As expected, we observed that the levels of miR-1a and miR-133a were significantly reduced when Trbp was knockdown (Fig 7A). [score:2]
In our study, the level of miR-1a was drastically reduced when Trbp was inactivated. [score:1]
[1 to 20 of 18 sentences]
32
[+] score: 68
In silico miRNA Target Selection PipelineTarget sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:7]
The data above suggest that miR-1 suppresses Ctbp2 in R347 retinas and that miR-1 (and possibly miR-133) may regulate synaptic remo deling at photoreceptor synapses by targeting Ctbp2. [score:6]
As the Ctbp2 3′UTR also has a predicted target site for miR-133, miR-1/133 may co-target Ctbp2 (Fig. 3g); however this was not tested in our study. [score:5]
Target sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:5]
The miR-1/133 cluster and Ctbp2 are co-expressed in photoreceptors; expression of both miR-1 and miR-133 is increased by ~20-fold in R347 versus wt photoreceptors (Table 2) 12. [score:5]
In Silico Target SelectionAltered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:5]
Focusing on predicted targets for modulated miRNAs in R347 retina, including miR-1/133, miR-142 and miR-183/96/182, high-throughput proteome analysis provided a unique opportunity to explore miRNA regulation in a mo del system for inherited retinopathy. [score:4]
We validated miR-1 targeting of Ctbp2 in a 3′UTR assay (Fig. 3h); notably, the human equivalent miRNA (hsa-miR-1-3p) has also been shown to target CTBP2 in HeLa cells 43. [score:4]
We previously reported a marked up-regulation of miR-1/133 in mouse mo dels of RP 12. [score:4]
Of the six miRNAs of interest, the Ctbp2 3′UTR contains predicted target sites for miR-1 and miR-133 (Fig. 3g), the levels of which were significantly increased in R347 versus wt retinas (Table 2) 12. [score:3]
Ctbp2 protein in R347 versus wt retinas was decreased by ~50% (Table 2, LC-MS/MS) suggesting that miR-1 and miR-133 may target Ctbp2; the potential miR-1-Ctbp2 mRNA interaction was further tested in the study. [score:3]
Specifically, 23, 10, 6, 18, 35 potential target genes were identified for miR-1, miR-133, miR-142, miR-183, miR-96 and miR-182, respectively (Supplementary Table S3). [score:3]
Our data suggest that miR-1 may target three functional axes in the R347 retina; G-protein signaling/visual transduction, mitochondrial function, and synaptic transmission (Fig. 2b, Supplementary Table S3). [score:3]
Our results highlight widespread effects of these miRNAs in retina, in particular, miR-1 and the miR-183/96/182 cluster; we validated a number of specific miRNA-target interactions in vitro and in vivo. [score:3]
Pathway over-representation analysis 24 of miRNA-specific target gene lists identified a number of enriched pathway -based sets for miR-1 and miR-183/96/182 (Fig. 2b). [score:3]
Altered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:3]
Synthetic pre-miRNAs for mmu-miR-1a-3p (PM10617), mmu-miR-96-5p (PM10422), mmu-miR-182-5p (PM13088) and negative control were procured from Ambion (Thermo Fisher Scientific). [score:1]
miR-1 and miR-133 form a miRNA cluster and can influence neuronal function 42. [score:1]
[1 to 20 of 18 sentences]
33
[+] score: 67
THI treatment of non-injured mdx mice inhibits HDAC activity, and increases histone acetylation and the expression of the HDAC2 targets miR-29 and miR-1. Beneficial muscle genes are upregulated due to a THI -dependent S1P increase. [score:10]
The increase in expression of these genes, including miR-1 and miR-29, in turn alleviates fibrosis by decreasing fibrotic gene (Col1α1) expression (target of miR-29), and increases muscle metabolism (metabolic genes are targets of miR-1). [score:9]
These beneficial effects of THI correlate with increased nuclear S1P levels in the affected muscles, decreased nuclear HDAC activity and increased specific histone acetylation marks, resulting in upregulation of HDAC2 target genes miR-29 and miR-1. Further gene expression microarray -based analysis showed a significant decrease in inflammation genes and increase in metabolic genes, especially genes involved in fatty acid metabolism in muscles from THI -treated mdx mice. [score:8]
Previous studies have shown that HDAC2 binds to the promoter regions of miR-1 and miR-29 and downregulates their gene expression in mdx muscles (Cacchiarelli et al., 2010). [score:6]
Taken together, these data suggest that increasing nuclear S1P by treatment with THI inhibits HDAC activity in mdx muscles, resulting in upregulation of miR-1 and miR-29 and reduction of fibrosis. [score:6]
We examined HDAC2 activity in THI -treated mdx muscles by tracking the expression of its target genes, especially miR-1 and miR-29. [score:5]
miR-1 can regulate cellular metabolism through G6PD, and miR-29 downregulates fibrosis through Col1a1; both of these processes are affected by THI treatment in mdx mice. [score:5]
We are now showing that the beneficial effects of THI in mdx mice correlate with increased nuclear S1P, decreased HDAC activity, increased histone acetylation, and upregulation of miR-29, miR-1 and many metabolic genes. [score:4]
In mdx mice, HDAC2 is bound to the promoters of miR-1 and miR-29, keeping their expression repressed (Cacchiarelli et al., 2010). [score:3]
We observed a significant increase in gene expression of miR-1 and miR-29, along with a reduction in Col1a1. [score:3]
In addition, miR-1 has been shown to target metabolic genes, for example ABCA1 (ATP -binding cassette transporter ABCA1), PGM (phosphoglycerate mutase) and G6PD (glucose-6-phosphate dehydrogenase) (Cacchiarelli et al., 2010), which might explain the S1P-related effects on metabolism in THI -treated mdx muscles and C2C12 cells. [score:3]
There was a significant increase in expression of both miR-29 and miR-1 (9- and 5.6-fold, respectively) in diaphragms from THI -treated mdx mice compared with controls (Fig. 4E,F). [score:2]
Both miR-29 and miR-1 have been shown to positively regulate skeletal muscle regeneration, particularly myogenic differentiation (Chen et al., 2006; Wang et al., 2012). [score:2]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 14 sentences]
34
[+] score: 63
At the 14 days time point, WB showed that miRNA1 alone had no effect on both Cx43 and cTnT, miRNA133 increased only the expression of cTnT, while miRNA499 was able to markedly increase the expression of both Cx43 and cTnT (Fig. 3A). [score:5]
Consistently, the over -expression of miRNA1 in EB derived from human ESC can increase the expression of myosin heavy chain [33]. [score:5]
Recently, it has been suggested that certain miRNA are powerful regulators of cardiac differentiation processes [32], and it has been shown that miRNA1, miRNA133, and miRNA499 are highly expressed in muscle cells [32]. [score:4]
Moreover, miRNA1 is upregulated upon induction of cardiac differentiation in mouse and human ESC and in adult cardiac-derived progenitors [18, 19, 33]. [score:4]
The over -expression of miRNA1 alone or in association with miRNA499 failed to increase the expression level of the cardiac-specific differentiation markers considered. [score:4]
On the contrary, the coexpression of miRNA1 with miRNA499 did not increase the expression of the two cardiac-specific proteins compared with miRNA499 alone (Fig. 3A). [score:4]
It is currently unknown whether the concomitant over -expression of miRNA1, miRNA133, and miRNA499 or if the combination of two of these miRNA would result in a synergistic action, further increasing the efficiency of cardiac differentiation. [score:3]
01) (Fig. 2B), but had no effect on GATA4 (Fig. 2A), while miRNA1 triggered the expression of neither GATA4 nor Nkx2.5 (Fig. 2A, 2B). [score:3]
For example, loss- and gain-of-function studies documented that miRNA1 modulates cardiogenesis and muscle gene expression in Drosophila [20]. [score:3]
It has been shown that miRNA1 and miRNA133 are important regulators of embryonic stem cell (ESC) differentiation into CMC. [score:2]
Accordingly, we tested this hypothesis by over -expressing different combinations of miRNA1, 133, and 499 in P19 cells, which are considered an ideal mo del to study cardiac differentiation in vitro. [score:2]
At day 14, the over -expression of miRNA1 or miRNA133 alone or their combination did not increase the number of beating clusters compared with DMSO treatment (Fig. 1A). [score:2]
By simultaneously over -expressing miRNA499 and miRNA1, the number of beating EB significantly increased compared with: DMSO (+2.8-fold; p < . [score:2]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
After 4 days, the EB were transferred to plastic culture dishes in the presence of differentiation medium, and transfected with precursor molecules (pre-miRNA) for miRNA499 (PM11352, 10 nM), miRNA1 (PM10617, 10 nM), and miRNA133 (PM10413, 5 nM) in different combinations or with scrambled miRNA used as a negative CTRL (AM17110, 5 nM) (Supporting Information Table S1). [score:1]
Our results clearly showed that miRNA499 is a powerful activator of cardiac differentiation, particularly in comparison with miRNA1 and miRNA133. [score:1]
In particular, it has been clearly shown that miRNA133 and miRNA1 promote myoblast proliferation and differentiation, respectively, and that miRNA499 enhances the differentiation of cardiac progenitor cells into CMC [17– 20]. [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1, and p < . [score:1]
DMSO, scramble miRNA, miRNA1, and miRNA499 + 1). [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, miRNA1 + 499 and p < . [score:1]
naïve, scramble miRNA, miRNA133, miRNA1 + 499 and p < . [score:1]
miRNA1 + 499; *, p < . [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA1 + 499; #, p < . [score:1]
Likewise, miRNA1 triggers the differentiation of cardiac progenitor cells [18]. [score:1]
DMSO, scramble miRNA, miRNA1, and miRNA499 + 1; #, p < . [score:1]
miRNA1 + 133, §, p < . [score:1]
miRNA1 and p < . [score:1]
001), miRNA1 (+2.5-fold; p < . [score:1]
Although miRNA1 and miRNA133 are cotranscribed, the function of miRNA133 is different from miRNA1. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
miRNA1; §, p < . [score:1]
miRNA precursors were diluted in Opti-MEM I medium at the following concentration: miRNA1 and miRNA499 precursors 10 nM, miRNA133 precursor and scrambled miRNA 5 nM. [score:1]
DMSO, miRNA1 and miRNA133; ‡, p < . [score:1]
[1 to 20 of 33 sentences]
35
[+] score: 59
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
In prostate gland cells, miR-1 is a candidate tumor suppressor and is frequently downregulated in various types of cancer (Hudson et al., 2012). [score:6]
MiR-1 downregulation cooperates with MACC1 in promoting MET overexpression in human colon cancer. [score:5]
Tumour suppressors miR-1 and miR-133a target the oncogenic function of purine nucleoside phosphorylase (PNP) in prostate cancer. [score:5]
MiR-1 is tumor suppressor in thyroid carcinogenesis targeting CCND2, CXCR4, and SDF-1alpha. [score:4]
This conclusion notwithstanding, there is a provocative association between top KEGG pathways in the brains of mice exposed to MAM and in human cancers, with suspicion falling heavily on a prominent role for at least one miRNA, namely miR-1. However, miRNAs are but one of at least three known mechanisms of epigenetic regulation, and there is no information on the possibility that MAM modulates brain gene expression via cytosine methylation or histone modification. [score:4]
The most significant scoring sub-network of these MAM-differentially expressed genes (p < 10 [-46]) contained hubs for F-actin, NF-κB, cofilin, calcium/calmodulin -dependent protein kinase II (CaMKII), glycogen synthase, the AMPA receptor, BDNF, and miR-1. There is a large literature on miR-1, much of which is focused on cardiac muscle function (Mishima et al., 2007). [score:3]
The most significant molecular networks derived from 362 MAM-triggered, differentially expressed genes revealed hubs involving NF-κB (nuclear factor of kappa light polypeptide gene enhancer in B-cells), calcium -binding proteins (i. e., calcineurin, calmodulin), brain-derived neurotrophic factor (BDNF), glutamate receptors N-methyl- d-aspartate (NMDA), and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), cyclic AMP response element -binding factor (CREB), and miR-1 (Kisby et al., 2011a). [score:3]
MiR-1 also has an oncosuppressive role in breast, lung, thyroid, liver, renal, and colorectal cancer (Datta et al., 2008; Beltran et al., 2011; Leone et al., 2011; Kawakami et al., 2012; Kojima et al., 2012; Migliore et al., 2012), and, in the latter, this activity is silenced by miR-1 methylation (Suzuki et al., 2011). [score:3]
In support, miR-1 is altered in the colon of AOM -treated rats (Davidson et al., 2009) and was a prominent hub among the 362 genes that were differentially expressed in the brain of Mgmt [−/−] mice after systemic administration of MAM (Kisby et al., 2011a). [score:3]
In this rodent mo del, the expression of 27 miRNAs is significantly (>6-fold) increased (e. g., miR-1, miR-34a, 132, 223, and 224), while that of 19 miRNAs is reduced (<0.49-fold; e. g., miR-192, 194, 215, and 375) in the colon tumors (Davidson et al., 2009). [score:3]
Differential expression of microRNA-1 in dorsal root ganglion neurons. [score:3]
Available evidence suggests that miR-1 alters the cellular organization of F-actin, thereby inhibiting filopodia formation, cell motility, and tumor invasion. [score:3]
MiR-1 is present in nerve cells, at least in the peripheral nervous system (Bastian et al., 2011), and blood miR-1 expression has been used to distinguish normal subjects from patients with PD (Margis et al., 2011). [score:3]
The right-hand column shows the biological processes or signaling pathways potentially regulated by the miR-1/miR-133a cluster in human cancers examined by *Nohata et al. (2012). [score:2]
microRNA-1/133a and microRNA-206/133b clusters: dysregulation and functional roles in human cancers. [score:2]
Top MAM -associated KEGG pathways in mouse brain Genes Phenotype miR-1/miR- 133A-regulated in human cancers* Pathways in cancer 13 CC Yes Wnt signaling 10 AD, CC Yes Insulin signaling 9 AD, ALS Purine metabolism 9 Prostate cancer 8 CC MAPK signaling 7 AD, CC Yes Melanogenesis 6 PD? [score:2]
Most of these pathways have been implicated in AD and/or colon cancer (Kisby et al., 2011a) and, in a separate recent study, some (pathways in cancer, Wnt signaling, MAPK signaling, and calcium-pathway signaling) have been predicted to be regulated by miR-1/miR-133A (Table 2). [score:2]
The functional significance of miR-1 and miR-133a in renal cell carcinoma. [score:1]
Methylation mediated silencing of microRNA-1 gene and its role in hepatocellular carcinogenesis. [score:1]
Identification of miR-1 as a micro RNA that supports late-stage differentiation of growth cartilage cells. [score:1]
[1 to 20 of 20 sentences]
36
[+] score: 56
In cardiac and skeletal muscles, myogenic transcription factors MyoD, MEF2, and SRF drive the expression of miR1/206/133 clusters directly through upstream or intronic cis-regulatory elements [17]. [score:5]
The extent of growth inhibition exerted by miR-214mi was comparable to that by the mimic of miR-1, which is known to suppress RMS cell growth [41]. [score:5]
Indeed, dysregulation of microRNAs in RMS is a wide spread phenomenon for many specific microRNAs [26], and re -expression of miR-1/133a, miR-206, and miR-29 in RMS cells have been shown to induce myogenic differentiation and block xenograft tumorigenesis [22, 27]. [score:4]
6C, 6D), albeit miR-1 exhibited more potent activity in suppressing the anchorage-independent colony formation than miR-214. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
So, despite both miR-1 and miR-214 are able to induce RD cells to undergo myogenic differentiation (Fig. 3D, 3E) and suppress their tumorigenic activities (Fig. 4A-4E), only miR-214 reached these outcomes through blocking N-ras. [score:3]
Moreover, the average sizes of miR-1 and miR-214 -expressing colonies were much smaller than that of the vector cells (Fig. 4A). [score:3]
For these purposes, we generated stable RD cells expressing pre-miR-214 or pre-miR-1 from the constitutive P2GM vector. [score:3]
On histological sections, xenograft tumors expressing pre-miR-1 or pre-miR-214 showed decreased staining for Ki67 but increased staining for MHC (Fig. 4F), suggesting a benign growth relative to the vector-bearing tumors. [score:3]
Stem-loop RT-PCR confirmed the ectopic expression of miR-1 and miR-214 in their respective tumors (Fig. 4G). [score:3]
After plating approximately 500 stably transfected cells in a 60 mm petri dish and culturing for 14 days, we observed about 68 colonies of RD cells carrying the P2GM vector, and below 40 colonies of RD cells expressing either miR-1 or miR-214 (Fig. 4A and 4B). [score:3]
Some of these microRNAs that exhibit specific patterns of muscle expression are dubbed “myomiRs”; these include members of the bicistronic miR-1/133a and miR206/133b families [20], and a group of microRNAs, namely miR-208, miR-208b, and miR-499, that are embedded in genes encoding the myosin heavy chain [21]. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
Compared to the vector-bearing control RD cells, those that expressed pre-miR-1 or pre-miR-214 grew much slower (Fig. 4C, and 4D), and reached to smaller terminal sizes (Fig. 4E). [score:2]
When assayed for anchorage-independent growth in top agar plates, stable RD cells expressing pre-miR-1 or pre-miR-214 also formed fewer foci than the P2GM RD cells (Supplementary sFig. [score:2]
Human genomic DNA fragments containing pre-miR-1 or pre-miR-214 sequences were amplified by PCR and inserted at the NotI and PmeI site in the MSCV-P2Gm vector. [score:1]
Figure 2 (A) RT-PCR detection of miR-1, miR-133a, and miR-214 in RD and Rh30 cells, as well as in normal skeletal muscles (SKM). [score:1]
In the presence of 10% FBS, RD cells did not undergo apoptosis and neither miR-1 nor miR-214 were able to induce such (Fig. 3C). [score:1]
Figure 6 (A) IHC staining of N-ras in xenograft tumors derived from RD stable cells carrying P2GM, P2GM-miR-1, and P2GM-miR-214 constructs. [score:1]
Several studies reported decreased levels of miR-1, miR-206, and miR-133a in primary RMS tumor samples and cell lines [27, 41]. [score:1]
The levels of muscle specific miR-1 and miR-133a also decreased in RD and Rh30 cells in accordance with the oncogenic transformation, although the level of miR-206 did not show significant change (Fig. 2A). [score:1]
For generating the stable cell lines, P2GM, P2GM-miR-1(P-1) or P2GM-miR-214(P-214) plasmids were transfected into RD cells using Lipofectamie according to the manufacturer's procedure (Invitrogen). [score:1]
Figure 4 (A) 500 stable RD cells carrying constitutive P2Gm vector, P2Gm-miR-1, or P2Gm-miR-214 were cultured in 60 mm petri dishes in the presence of 10 μg/ml puromycin for 14 days. [score:1]
[1 to 20 of 23 sentences]
37
[+] score: 56
Alternatively, it is also possible that miR-1, -133a, -133b, and -206 are very sensitive to Myostatin and even low levels of Myostatin, such as those observed in MSTN [+/- ]mice, can inhibit their expression. [score:5]
Myostatin may regulates the expression of miRNAs such as miR-133a, miR-133b, miR-1, and miR-206 in skeletal muscle as it has been observed that the expression of those miRNAs are significantly higher in myostatin null mice compared to wild type and heterozygous mice. [score:5]
Over expression of miR-1 and miR-133 during the in-vitro development of embryoid bodies from mouse embryonic stem cells demonstrated that distinct steps in muscle development are specified by cooperative and opposing interactions between miR-1 and miR-133. [score:5]
Similarly, Liu et al. (2007) identified an intragenic MEF2 -dependent enhancer that directed miR-1 and miR-133a expression levels. [score:4]
Myostatin appears to control miR-1, -133a, -133b, and -206 in a dominant manner, as the presence of functional Myostatin (wild-type and heterozygous mouse muscle) similarly regulated miRNA expression. [score:4]
The expression level of miR-133a (p < 0.0001), miR-133b (p < 0.001), miR-1 (p < 0.001), and miR-206 (p <. [score:3]
While, miR-1 and miR-206 expression was lost in Myf5 [-/- ]mice, which indicates that miR-1 and miR-206 lie downstream of Myf5. [score:3]
001) in miR-1, miR-133a, miR-133b, and miR-206 expression. [score:3]
In order to sustain the increased growth observed in Myostatin -null mice elevated satellite cell proliferation, which is regulated by miR-133[19] and differentiation, which is regulated by miR-1 and -206 [19, 19, 21], must occur. [score:3]
Sampere et al. (2004) first identified the expression of the muscle specific miRNas such as miR-1, -133a and -206[5]. [score:3]
This increased level of miR-1, -133a, -133b, and -206 expressions was consistent with the enhanced skeletal muscle growth observed in MSTN [-/- ]mice. [score:3]
Subsequently, several miRNA expression profiling studies have consistently shown miR-1, -133a and -206 to be muscle specific[6- 11]. [score:3]
Recently, Sweetman et al. (2008) reported that over expression of Myf5 was capable of inducing miR-1 and miR-206 [23]. [score:3]
The miR-1 and miR-206 promote myogenesis, while miR-133 inhibits myoblast differentiation and promotes proliferation by repressing serum response factor and a key splicing factor[17- 20]. [score:3]
In this study, we observed higher miR-1, miR-133a, miR-133b, and miR-206 expression levels in the pectoralis muscle of MSTN [-/- ]mice as compared to MSTN [+/+ ]and MSTN [+/- ]animals. [score:2]
Given that skeletal muscle mass was increased in heterozygous Myostatin mice, this would seem to indicate that miR-1, -133a, -133b, and -206 are not required for the observed increased muscle mass observed in Myostatin -null and heterozygous mice. [score:1]
miR-1/-206 and miR-133 play opposing roles in modulating skeletal muscle proliferation and differentiation. [score:1]
001), miR-1 (p <. [score:1]
Thus, it is possible that miR-1, -133a, -133b, and -206 are necessary for the increased muscle mass observed in Myostatin -null mice, but they are not rate limiting. [score:1]
[1 to 20 of 19 sentences]
38
[+] score: 48
Other miRNAs from this paper: mmu-mir-1a-2, mmu-mir-1b
The downregulation of Tbx3 mRNA and upregulation of miR-1 were observed in the mouse as well as the rat (Fig. 5e,f). [score:7]
In the rat, following training, there was no significant change in Tbx18, Mef2c and Sp1 mRNAs in the sinus node, but there was a significant downregulation of Tbx3 mRNA and upregulation of NRSF mRNA and miR-1 (Fig. 4a). [score:7]
e. m. ) mRNA expression of Tbx18 (sinus node, n=6/6; right atrial muscle, n=7/6), Mef2 (sinus node, n=6/5; right atrial muscle, n=7/6), Sp1 (sinus node and right atrial muscle, n=6/6), Tbx3 (sinus node, n=5/8; right atrial muscle, 8/7), NRSF (sinus node and right atrial muscle, n=7/6) and miR-1 (sinus node, n=4/7; right atrial muscle, n=6/5) (normalized to expression of 18S in the case of mRNAs and RNU1A1 in the case of miR-1) in the sinus node and right atrial muscle of sedentary and trained rats shown. [score:5]
None of the other targets tested were significantly correlated with NRSF and miR-1, but other targets, including RyR2, were significantly correlated with Tbx3, although R [2] was less than for HCN4 (Supplementary Table 4). [score:5]
Detraining also restored the response to block of I [f], HCN4 and Tbx3 mRNA expression, and miR-1 expression, although intriguingly there appeared to be a rebound beyond the pre-training level in all cases (Fig. 5c–f). [score:5]
This study is the first to show that the heart rate adaption to exercise training is not the result of changes in autonomic tone as previously thought 13 14, and instead is primarily the result of a training -induced remo delling of the sinus node; of particular importance is a downregulation of HCN4 mRNA and protein, perhaps driven by Tbx3, NRSF and miR-1, and a consequent decrease in the density of I [f]. [score:4]
The cDNA products were subsequently diluted 80-fold and quantified using SYBR green based qPCR and a LNA-enhanced miRNA-specific primer for miR-1 (mouse: hsa-miR-1, target sequence: 5′-UGGAAUGUAAAGAAGUAUGUAU-3′, 204344; rat, rno-miR-1, target sequence: 5′-UGGAAUGUAAAGAAGUGUGUAU-3′, 205104, Exiqon). [score:4]
In the rat, there were significant correlations between heart rate and expression of Tbx3 mRNA, NRSF mRNA and miR-1 (Fig. 4c). [score:3]
In the rat, it was investigated whether expression of mRNAs for HCN4, Ca [2+]-handling proteins and voltage-gated Ca [2+] channels is correlated with the expression of Tbx3 mRNA, NRSF mRNA and miR-1. HCN4 was significantly correlated with Tbx3, NRSF and miR-1; R [2] was highest for Tbx3 (Fig. 4b and Supplementary Table 4). [score:3]
e. m. ) expression of HCN4 and Tbx3 mRNA (normalized to 18S) and miR-1 (normalized to RNU1A1) in the sinus node of sedentary, trained and detrained mice shown (n=4). [score:3]
Although the significant correlations of HCN4 with Tbx3, NRSF and miR-1 are suggestive, they do not prove a causative link for which further work is required (for example, use of genetically modified mice). [score:1]
Sinus node expression of miR-1 was measured using miRCURY LNA (Locked Nucleic Acid) Universal RT microRNA PCR setup (Exiqon, Denmark) using the manufacturer’s instructions for cDNA synthesis and qPCR. [score:1]
[1 to 20 of 12 sentences]
39
[+] score: 47
Taken together, miR-1 and miR-133a are significantly downregulated in dy [3K]/dy [3K] and dy [2J]/dy [2J] muscle while miR-206 expression is upregulated, reflecting the overall regenerative status of the dystrophic muscle. [score:9]
Moreover, both miR-1 and miR-206 were differentially expressed in dy [3K]/dy [3K] and dy [2J]/dy [2J] mice, which may reflect differences in disease development. [score:6]
Specifically, we demonstrate that loss of laminin α2 chain leads to downregulation of muscle-specific miR-1 and miR-133a together with increased expression of miR-206 in muscle, consistent with data on other types of muscular dystrophy. [score:6]
Increased proteasomal activity is a feature of MDC1A and recent studies demonstrated that proteasome inhibition partially improves muscle integrity in dy [3K]/dy [3K] mice accompanied by increased expression of miR-1 and miR-133a (Carmignac et al., 2011; Körner et al., 2014). [score:5]
We observed a decreased expression of miR-1 and miR-133a and an increase in miR-206 expression in dy [3K]/dy [3K] and dy [2J]/dy [2J] quadriceps muscle compared with wild-type controls (Figure 1A). [score:4]
Notably, expression of muscle-specific miR-1 and miR-133a were unaffected at young ages (Figure 4C). [score:3]
Hence, in this study, we have analyzed expression of six miRNAs (miR-1, miR-133a, miR-206, miR-21, miR-29c, and miR-223) in muscle and plasma from two different MDC1A mouse mo dels (dy [3K]/dy [3K] and dy [2J]/dy [2J]). [score:3]
In summary, the partial normalization of miR-1 and miR-133a in response to bortezomib administration indicates that these miRNAs are promising disease biomarkers for MDC1A. [score:3]
These observations make it difficult to draw any firm conclusions regarding the impact of miR-133a and miR-1 dysregulation on the MDC1A pathology. [score:2]
In contrast, the precise function of miR-1 and miR-133a in skeletal muscle is less clear. [score:1]
Studies on C2C12 myoblasts suggest that miR-133a and miR-1 promote proliferation and differentiation, respectively (Chen et al., 2006). [score:1]
Notably, administration of bortezomib resulted in a partial normalization of plasma levels of miR-1 and miR-133a in dy [3K]/dy [3K] mice (Figure 3C). [score:1]
All oligonucleotide sequences were designed by and ordered from Exiqon with the following product numbers: hsa-miR-1, 204344; hsa-let-7a-5p, 204775; hsa-miR-16-5p, 204409; hsa-miR-21-5p, 204230; hsa-miR-29c-3p, 204729; hsa-miR-133a, 204788; hsa-miR-206, 204616; and hsa-miR-223-3p, 204256. [score:1]
However, mice deficient for miR-133a do not display any skeletal muscle anomalies until they are adult and skeletal muscle from miR-1 -deficient mice is grossly normal (Zhao et al., 2007; Liu et al., 2011). [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 15 sentences]
40
[+] score: 47
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42]. [score:3]
In agreement with this observation, miR-1 is the most abundantly expressed miRNA in the heart but not in the liver or thymus (Figure 3), two other tissues used for miRNA library generation. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2). [score:3]
Thus, the high abundance of miR-1 as indicated by the number of sequence reads is associated with its high expression in the heart. [score:3]
Our small RNA blot analysis indicated that miR-1 was highly expressed in the heart but moderately in the stomach, testes, bladder and spleen (Figure 2). [score:3]
For instance, the miR-1 family has the highest frequency (411 times) in our sequences (Table 2) and the highest level of expression in the heart, but was barely detected in thymus and liver (Figure 2). [score:3]
Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46]. [score:3]
miR-1 is one of the highly conserved miRNAs and found to be abundantly and specifically expressed in the heart and other muscular tissues [41, 42]. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression. [score:2]
The miR-1 family is represented by three members (miR-1a, miR-1b and miR-1c) in diverse animals (miRBase). [score:1]
miR-1 was barely detected in the liver, with only trace amounts in the thymus (Figure 2). [score:1]
Therefore the total miR-1 count in our sequences could be derived largely from heart tissue. [score:1]
Our sequence analysis in this study indicated that miR-1 family (miR-1a, miR-1b and miR-1c) has the highest abundance (411 sequence reads). [score:1]
The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis). [score:1]
We cannot ascertain whether the miR-1 family is also represented by three members in pig because of the lack of complete genome information, but is possible because we found miR-1a, miR-1b and miR-1c homologs in our library (Table 2). [score:1]
The high level of miR-1 in the pig heart is in agreement with previous reports [43, 44]. [score:1]
However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2). [score:1]
Of these three members, miR-1a and miR-1c are represented by 312 and 72 reads, respectively, whereas miR-1b is represented by a lower number (22 reads). [score:1]
We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133. [score:1]
[1 to 20 of 22 sentences]
41
[+] score: 47
In dystrophic subjects miR-1, miR-133a and miR-133b are downregulated in the muscle and upregulated in the serum while conversely miR-31 is upregulated in the muscle and downregulated in the serum. [score:13]
Downregulation of certain miRNAs, including miRNA-1, miRNA-133a and miRNA-133b in dystrophic muscle ([43] and our unpublished data) coincide with their upregulation in the serum. [score:7]
The miR-133a, miR-133b, miR-1, strongly upregulated in the DAPC -associated myopathy mo dels, were slightly but significantly downregulated in the EDMD mouse mo del. [score:7]
Two recent studies reported the upregulation of miR-1, miR-133a, miR-133b and miR-206 in the serum of dystrophic animal mo dels and human patients [36], [40]. [score:4]
In agreement with previous results from 10 week old mice (Table 2) we observed a marked upregulation of miR-1, miR-133a, miR-133b and miR-206 in the sera of mdx mice at ages of both 4 and 22 weeks. [score:4]
In agreement with our mdx data, this analysis confirmed the upregulation of miR-1, miR-133a, miR-133b and miR-206, previously reported in DMD patients [36] and dystrophic dogs [40]. [score:4]
Three out of the eight dysregulated miRNAs in the EDMD mouse mo del, miR-1, miR-133a and miR-133b, were found to be dysregulated in the DAPC -associated pathologies (Table 3), but with opposite trends. [score:3]
The common dysregulated serum miRNAs in the DAPC -associated pathologies (Table 3) included the four principal muscle enriched miRNAs, miR-1, miR-133a, miR-133b and miR-206 [41], [42]. [score:2]
All p values are significant (p≤0.05, Exiqon screen), except for the miR-1 in the KI-Lmna [p. H222P] mouse. [score:1]
In particular high FC values in the three ages studied were found for the muscle enriched miRNAs miR-1, 133a, 133b, and 206. [score:1]
In agreement with a recent publication [36] we identified strong activation in dystrophic mice of the muscle-enriched miR-1, miR-133a, miR-133b and miR-206. [score:1]
[1 to 20 of 11 sentences]
42
[+] score: 44
On the other hand, in the muscle of mdx mice, miR-1 and miR-133a levels have been shown to be downregulated, whereas miR-206 levels are upregulated [26, 27]. [score:7]
It has also been reported that miR-1 and miR-133a levels are downregulated in dystrophic muscle and recover to normal levels by the rescue of dystrophin expression [26, 27]. [score:6]
Next, to analyze the effect of myomiRs via EVs on cell survival, we performed gain-of-function experiments of miR-1, miR-133a, and miR-206, which were upregulated within EVs during the differentiation of C [2]C [12] cells (S7 Fig), using C [2]C [12] cells and EVs extracted from C [2]C [12] cells transfected with each miRNA (Fig 4A, S8 Fig). [score:4]
This upregulation in myomiR levels is not limited to DMD patients, as increased levels of miR-1 were found in the sera of Becker muscular dystrophy (BMD), facioscapulohumeral muscular dystrophy, and limb-girdle muscular dystrophy patients, and increased levels of miR-133a and miR-206 were found in BMD patients [25]. [score:4]
Effect of myomiRs via EVs on the survival of C [2]C [12] myoblasts and myotubesNext, to analyze the effect of myomiRs via EVs on cell survival, we performed gain-of-function experiments of miR-1, miR-133a, and miR-206, which were upregulated within EVs during the differentiation of C [2]C [12] cells (S7 Fig), using C [2]C [12] cells and EVs extracted from C [2]C [12] cells transfected with each miRNA (Fig 4A, S8 Fig). [score:4]
To elucidate whether myomiR levels in the serum are positively associated with muscle degeneration, the levels of three myomiRs, namely, miR-1, miR-133a, and miR-206, in the sera of transgenic (tg) mdx mice, overexpressing a truncated dystrophin transcript with a deletion from exon 45 to 55, mdx mice, and wild-type (wt) mice were quantified by qRT-PCR. [score:3]
The expression of miR-1 and miR-133a in skeletal muscle can be restored by rescue of the dystrophin protein using exon-skipping techniques [27, 28]. [score:3]
We found significant decreases in the levels of miR-1, miR-133a, and miR-206 in the serum of tg mice (mdx mice overexpressing a truncated dystrophin protein showing normal muscle activities) compared with those of mdx mice at 7 weeks of age. [score:2]
The sequences of the three fragments were as follows: pre-miR-1a: 5′-GTTTAAACCCAGGCCACATGCTTCTTTATATCCTCATAGATATCTCAGCACTATGGAATGTAAGGAAGTGTGTGGTTTTGGACTAGT-3′, pre-miR-133a: 5′-GTTTAAACAGAAGCCAAATGCTTTGCTGAAGCTGGTAAAATGGAACCAAATCAGCTGTTGGATGGATTTGGTCCCCTTCAACCAGCTGTAGCTGCGCATTGATCACGCCGCAACTAGT-3′, pre-miR-206: 5′-GTTTAAACGCTTGGGACACATACTTCTTTATATGCCCATATGAACCTGCTAAGCTATGGAATGTAAAGAAGTATGTATTTCAGGCACTAGT-3′. [score:1]
miR-1, miR-133a, and miR-206 levels within EVs extracted from the culture medium of C [2]C [12] cells at different stages of differentiation. [score:1]
Levels are shown relative to that of the non -transfected cells, which was set to 1. (TIFF) Myoblasts (A) and myotubes (B), differentiated for 4 days, were incubated with or without low (0.7 μg), medium (2 μg), or high (6 μg) concentrations of EVs extracted from the medium of C [2]C [12] cells transfected with miR-1, miR-133a, or miR-206, or non -transfected (non-TF EVs) for 24 hrs in serum -depleted medium (A) or in the presence of H [2]O [2] (10 mM) (B). [score:1]
After the administration of GW4869, the levels of miR-1, miR-133a, and miR-206, as well as the level of CK, which is indicative of sarcolemmal leakage, were quantified. [score:1]
Three DNA fragments, namely, precursors of miR-1a, miR-133a, and miR-206 (pre-miR-1a, pre-miR-133a, and pre-miR-206) were synthesized (Bioneer, Alameda, CA), and inserted into the intron site of the pEM-157 vector, which contains the cytomegalovirus promoter driving transcription of the dsRed-fluorescent protein-coding sequence interrupted by an intron. [score:1]
miR-1, miR-133a, and miR-206 levels (B) and CK levels (C) in the serum were quantified by RT-quantitative PCR and the Fuji Dri-Chem system, respectively. [score:1]
Several groups, including our own, previously reported that three myomiRs, namely, miR-1, miR-133a, and miR-206, were increased in the sera of animal mo dels of muscular dystrophy as well as in patients [22– 24]. [score:1]
C [2]C [12] cells were cultured and transfected with miR-1, miR-133a, miR-206, miR-1/miR-133a, miR-1/miR-206, miR-133a/miR-206, or miR1/miR-133a/miR-206. [score:1]
S9 FigMyoblasts (A) and myotubes (B), differentiated for 4 days, were incubated with or without low (0.7 μg), medium (2 μg), or high (6 μg) concentrations of EVs extracted from the medium of C [2]C [12] cells transfected with miR-1, miR-133a, or miR-206, or non -transfected (non-TF EVs) for 24 hrs in serum -depleted medium (A) or in the presence of H [2]O [2] (10 mM) (B). [score:1]
Myotubes were incubated in serum -depleted medium, with 0.8 μg (A), 2 μg (B) of EVs extracted from the medium of C [2]C [12] cells transfected with miR-1, miR-133a, miR-206, or their four possible combinations (miR-1/miR-133a, miR-1/miR-206, miR-133a/miR-206, and miR1/miR-133a/miR-206) for the indicated times. [score:1]
Secondary structure of the myomiRs, miR-1 (A), miR-133a (B), and miR-206 (C) based on ΔG values. [score:1]
[1 to 20 of 19 sentences]
43
[+] score: 43
Among three selected targets for mosquito-specific miRNAs that were inserted into the 3’NCR of DEN4 genome, the presence of a target for the highly expressed miRNAs in mosquito cells Aag2 or C [7]10 (mir-184 and mir-275) reduced DEN4 replication to a greater extent than the inclusion of a target for the less expressed mir-1 miRNA (Figs 2 and S1) [37]. [score:11]
Based on this data, three mosquito-specific miRNAs (mir-184, mir-275 and mir-1) were selected for DEN4 genome targeting because they satisfy the following criteria: 1) they are highly expressed in different mosquito organs and mosquito-derived cell lines, and also remain abundant during flaviviruses infection [37]; 2) these miRNAs are evolutionarily conserved among insect species including mosquitoes, but they are different from their miRNA analogs in mammals. [score:5]
Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
Target sequences for mosquito specific mir-1 (5’-CTCCATACTTCTTTACATTCCA-3’), mir-184 (5’-GCCCTTATCAGTTCTCCGTCCA-3’) and mir-275 (5’-GCGCTACTTCAGGTACCTGA-3’) or human brain-specific mir-124 (5’-GGCATTCACCGCGTGCCTTA-3’) were introduced into the 3’NCR of DEN4 genome between nts 10,277 and 10,278 (position 1, Fig 1) or 10,474 and 10,475 (position 2, Fig 1); these sites of target insertion are located 15 or 212 nts downstream of the TAA stop codon in the 3’NCR, respectively. [score:5]
1004852.g001 Fig 1 Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
S1 FigRelative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
To investigate if miRNA targeting of DEN4 genome results in selective restriction of DEN4 replication in mosquitoes, a single copy of mir-184, mir-275, or mir-1 target sequence was introduced into the genome of DEN4 strain 814669 [40] (abbreviated D4s) between nucleotides (nts) 10277 and 10278 (15 nts downstream of the TAA stop codon preceding the 3’NCR). [score:3]
Relative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
Ribo-oligonucleotides for artificial mir-184 (5’UGGACGGAGAACUGAUAAGGGC), mir-275 (5’UCAGGUACCUGAAGUAGCGC), and mir-1 (5’UGGAAUGUAAAGAAGUAUGGAG3’) were synthesized by Integrated DNA Technologies, and were used in northern blot as positive controls and molecular weight standards. [score:1]
For each line 14 μg of total RNA was used in northern blot analysis and then hybridized with biotinylated probes complementary to mir-184 (A), mir-275 (B), and mir-1 (C). [score:1]
The biotinylated probes complementary to mir-184 (5’Biotin-GCCCTTATCAGTTCTCCGTCCA-Biotin3’), mir-275 (5’Biotin-GCGCTACTTCAGGTACCTGA-Biotin3’), and mir-1 (5’Biotin-CTCCATACTTCTTTACATTCCA-Biotin3’) were synthesized by Bioresearch Technologies and used at 2–10 ng/mL. [score:1]
[1 to 20 of 11 sentences]
44
[+] score: 43
In parallel to the data from qPCR analysis, WB analysis also confirmed that after treated with miR1-2mimics at 72h, BMSCs increased the expression of the protein of GATA4, NKx 2.5 and cTnI, while treated by Wnt inhibitor, the BMSCs exhibited a distinct reduction of the protein of GATA4, Nkx2.5 and cTnI, compared to the miR1-2 mimics group without Wnt inhibitor treatment (Fig.   6) Fig. 5Wnt/β-catenin signaling pathways were activated by miR1-2mimics treatment but blocked by LGK-974 in BMSCs. [score:6]
Yalan Yang et al also found that miR-1/206 targeted Secreted frizzled-related protein one (SFRP1), another inhibitor of Wnt signaling to promote skeletal muscle development [32]. [score:6]
The miR1 has been reported to be able to modulate cardiomyogenesis and maintain the expression of muscle genes via down regulating the Notch or STAT3 signaling pathways [12– 14]. [score:4]
It was reported that translocation of Nkx2.5 and GATA4 to the nucleus can drive BMSCs to Cardiac phenotype [19], miR-1 could upregulate Nkx2.5 to promote Cardiac differentiation [20]. [score:4]
Carley et al also reported that miRNA1 transfected embryonic stem cells could inhibit apoptosis by modulating the PTEN/Akt pathway in the infarcted heart [21]. [score:3]
In mammals, miR1 has two copies, one is for miR1-1, mainly related to skeletal muscle development [10], one is for miR1-2, mainly involved in myocardial development [11]. [score:3]
It was reported that in cardiac progenitor cells, the over -expression of miR1 and miR499 reduced the rate of cell proliferation and enhanced the differentiation via repressing the HDAC4 or Sox6 [8]. [score:3]
Expression levels of miR1-2 in BMSCs treated with 5-aza and miR1-2. Effect of 5-aza and miR-1 mimic on apoptosis in BMSCs. [score:3]
This was consistent with the previous reports that miR-1 induced the expression of several cardiomyocyte markers, including Nkx2.5, GATA4, cTnI, and Cx43 in MSCs [14]. [score:3]
ns, p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001 Previous studies strongly implied that miR-1 promoted cardiac differentiation in human embryonic stem cells, cardiac stem cells, or cardiac progenitor cells via regulating the activity of the Wnt/β-catenin signaling pathway. [score:2]
*, p < 0.05, **, p < 0.01, ***, p < 0.001, compared to miR1-2 mimics Fig. 6Expression of cardiac protein in BMSCs after miR1-2mimics treatment. [score:2]
b, c, d WB analysis confirmed that miR1-2mimics treatment increased the expression of cTnI(B), GATA4(C), and Nkx2.5(D) in mouse BMSCs, **, p < 0.01, ***, p < 0.001, compared to controls. [score:2]
However, the rate of apoptosis was significantly increased after 72h treatment with 5-aza (16.51% increase), not in miR1-2mimics group (Fig.   2b), indicating that unlike 5-aza, miR1-2 does not induce cell apoptosis (Fig.   2c) Fig. 2Apoptosis in BMSCs treated with 5-aza and miR1-2 mimics. [score:1]
Both miR1 and miR133 levels were increased in the differentiated ESCs, and miR1 was able to promote ESCs differentiation into cardiac lineage, however, miR133 may block the differentiation of myogenic precursors [9]. [score:1]
[1 to 20 of 14 sentences]
45
[+] score: 41
We found that the expression of muscle miRNAs, including miR-1a, miR-133a and miR-206, was up-regulated in the skeletal muscle of mdx mice. [score:6]
Northern blot analyses further confirmed a significantly increased expression of miR-206, whereas the expression of miR-1 modestly increased in the muscle muscle of mdx mice (Figure 1B, C). [score:5]
We have previously reported that the expression of muscle-specific miR-1 and miR-133 is induced during skeletal muscle differentiation and miR-1 and miR-133 play central regulatory roles in myoblast proliferation and differentiation in vitro. [score:4]
This mutation creates a binding site for miR-1 and miR-206, leading to the translational repression of myostatin, which phenocopies the "muscle doubling" that results from the loss of myostatin in mice, cattle, and humans [29, 30]. [score:4]
Furthermore, miR-1 and miR-133 are also important regulators of cardiomyocyte differentiation and heart development [22- 24]. [score:3]
We found that the expression levels of miR-1, miR-133 and miR-206 were higher in the skeletal muscle of one month-old mdx mice (Figure 1A). [score:3]
A subset of miRNAs, miR-1, miR-133, miR-206 and miR-208, are either specifically or highly expressed in cardiac and skeletal muscle and are called myomiRs [6, 7, 13]. [score:3]
We found that the expression miR-133a, together with that of miR-206 and miR-1a, was induced in the skeletal muscle of mdx mice. [score:3]
Additionally, embryonic stem (ES) cell differentiation towards cardiomyocytes is promoted by miR-1 and inhibited by miR-133 [22]. [score:3]
Paradoxically, miR-1 and miR-133 exert opposing effects to skeletal-muscle development despite originating from the same miRNA polycistronic transcript. [score:2]
Furthermore, miR-1 and miR-206 also participate the regulation of skeletal muscle satellite cell proliferation and differentiation [8]. [score:2]
Briefly, 20 μg of total RNAs isolated from skeletal muscle of 1 month old mdx and the control mice (Figure 1), or from the heart, skeletal muscle and liver tissues of miR-133a-1 transgenic and the control mice (Figure 2), were used and miRNA oligonucleotides with corresponding miRNAs (miR-1a, miR-133a and miR-206) sequences were used as probes. [score:1]
Among them, miR-1, miR-133, miR-206, miR-208 and miR-499 have been described as muscle specific miRNAs, or myomiRs [6, 13]. [score:1]
Interestingly, miR-1 and miR-133 also produce opposing effects on apoptosis [21]. [score:1]
[1 to 20 of 14 sentences]
46
[+] score: 38
However, these miRNAs can act as tumor suppressors in various human cancers [14]; for instance, miR-1 and miR-133a were found to be frequently down-regulated in bladder cancers, and suppress tumor growth by targeting TAGLN2 [15]. [score:10]
of patients Relative levels of miR-206 (mean ± SEM) P-valueGender   Male210.49 ± 0.070.32Female140.40 ± 0.06 Age (years)   ≥60190.45 ± 0.050.93<60160.46 ± 0.09 Diameter (cm)   ≥5130.46 ± 0.090.90<5220.45 ± 0.05 Location   Middle and proximal third230.47 ± 0.060.65Distal third120.42 ± 0.07 Degree of differentiation   well and moderately120.48 ± 0.070.70Poorly230.44 ± 0.07 Local invasion   T1 + T2100.65 ± 0.070.01T3 + T4250.37 ± 0.05 Lymph node metastasis   NO140.57 ± 0. 060.04YES210.38 ± 0.07 TNM stage   I + II120.60 ± 0.070.02 III + IV 23 0.38 ± 0.06  Expression of miR-133a was also found to be down-regulated in the tumors by the above criteria (Additional file 1: Figure S1), but expression of miR-1, whose genes are clustered with those encoding miR-133a [14], was not (Additional file 2: Figure S2). [score:8]
of patients Relative levels of miR-206 (mean ± SEM) P-valueGender   Male210.49 ± 0.070.32Female140.40 ± 0.06 Age (years)   ≥60190.45 ± 0.050.93<60160.46 ± 0.09 Diameter (cm)   ≥5130.46 ± 0.090.90<5220.45 ± 0.05 Location   Middle and proximal third230.47 ± 0.060.65Distal third120.42 ± 0.07 Degree of differentiation   well and moderately120.48 ± 0.070.70Poorly230.44 ± 0.07 Local invasion   T1 + T2100.65 ± 0.070.01T3 + T4250.37 ± 0.05 Lymph node metastasis   NO140.57 ± 0. 060.04YES210.38 ± 0.07 TNM stage   I + II120.60 ± 0.070.02 III + IV 23 0.38 ± 0.06   Expression of miR-133a was also found to be down-regulated in the tumors by the above criteria (Additional file 1: Figure S1), but expression of miR-1, whose genes are clustered with those encoding miR-133a [14], was not (Additional file 2: Figure S2). [score:8]
MiR-1 and miR-206 were shown to possess similar tumor-suppressor roles in rhabdomyosarcoma through blocking c-Met expression [16]. [score:5]
Click here for file (A) Distribution of miR-1 expression in a cohort of 35 human GC and noncancerous tissues by qRT-PCR. [score:3]
In a genome wide survey for microRNA expression, we previously identified several members of the myomiR family, namely miR-1/133a and miR-133b/206, whose levels were reduced in a neuroectodermic cancer (unpublished results). [score:3]
Here, we focus on miR-206, which along with its closely related paralogs miR-1, 133a, and miR-133b, plays very important roles in muscle differentiation. [score:1]
[1 to 20 of 7 sentences]
47
[+] score: 37
Transfection of miR-1 also showed significantly higher troponin T expression because miR-1 also regulates proliferation and differentiation of myoblast cells by targeting the transcription of HDAC4 [14]. [score:6]
miR-1 positive control transfection reduced its target gene (PTK9) expression significantly. [score:5]
The effect of miRNA transfection was determined by checking the expression of the PTK9 gene (a target of miR-1) using RT-qPCR [45]. [score:5]
We used miR-1 as a positive control, which was as assayed by the down-regulation of the PTK9 target gene (Additional file: 1 Figure S1). [score:5]
miR-1, miR-206, miR-133a and miR-133b did not affect MyHC expression. [score:3]
miR-1, miR-206, miR-133a, miR-133b, miR-6412 did not affect MyHC expression. [score:3]
Transfection efficacy of miRNA mimics was confirmed by real time RT-PCR analysis of PTK9 expression following miR-1 positive control transfection (Additional file: 1 Figure S1). [score:3]
Transfection of miR-1 positive control, miR-206 and miR-133a resulted in a significant increase of the troponin T -positive cell ratio, while transfection of miR-487b, miR-3963 and miR-6412 mimics significantly decreased troponin T expression (Figure  1). [score:3]
For example, miR-1, miR-206, miR-133 [13, 14] are known as muscle-specific miRNAs. [score:1]
A scrambled miRNA, mirVana miRNA mimic negative control and a miR-1 positive control were used. [score:1]
Transfection of miR-487b and miR-3963 mimics resulted in a significant decrease in the MyHC (fast) positive ratio (Figure  2), while miR-1 positive control, miR-206, miR-133a, miR-133b and miR-6412 did not affect the MyHC (fast) positive cell ratio. [score:1]
RPS29 was chosen as a housekeeping gene [46], and the expression changes of PTK9 by the miR-1 positive control were evaluated as PTK9/RPS29. [score:1]
[1 to 20 of 12 sentences]
48
[+] score: 37
Lim et al. identified 96 genes that were significantly down-regulated (p-value < 0.001) at both 12 and 24 hours with miR-1 over -expression and 174 genes with miR-124 over -expression. [score:8]
Ensembl accession numbers of genes down-regulated in human HeLa cells with miR-1 over -expression. [score:6]
Both miR-1 and miR-124 are known for their tissue specificity in mammals, where the former is preferentially expressed in heart and skeletal muscle, while the latter is preferentially expressed in brain. [score:5]
MobyDick analysis on the human 3' UTR sequences alone would not have been able to identify the target site of miR-1, which is derived from only the mouse sequence set (Figure 5A), where the signal for the target site may be stronger than in human. [score:5]
Click here for file Accession numbers of miR-1 over -expression. [score:3]
Accession numbers of miR-1 over -expression. [score:3]
The motif cluster with the most significant p-value predicted by CompMoby was the target site of miR-1 (Figures 5A, 5B) and miR-124 (Figures 5A, 5C). [score:3]
Lim et al. generated the datasets by independently over -expressing miR-1 or miR-124 in human HeLa cells and then profiling the mRNA on whole genome microarrays. [score:3]
Also shown is the match between the predicted motif cluster to the miR-1 seed region. [score:1]
[1 to 20 of 9 sentences]
49
[+] score: 35
As regards myomiRs, several studies report that miR-1 and miR-133 are under-expressed, while miR-206 is over-expressed in mdx muscles [25– 27]. [score:5]
We show that miR-133a (p = 0.03) and miR-222 (p = 0.03) are up-regulated in GRMD [MuStem] dogs compared to mock GRMD dogs (Fig.   4a), while miR-1, miR-206 and miR-486 expressions appear unchanged. [score:5]
In muscle, specific miRNAs (known as myomiRs), such as miR-1, miR-133 and miR-206, are involved in regulation of the proliferation or differentiation of myogenic cells [13– 16] and are especially regulated by transcription factors implicated in muscle growth and development [17, 18]. [score:4]
Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. [score:4]
Intriguingly, the expression of miR-1, miR-133a and miR-206 does not change. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in muscles (right and left Biceps femoris) of three 9-month-old GRMD and six mock GRMD dog by real-time PCR and normalized by RNU6B levels. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in 9-month-old healthy (n = 5) and GRMD (n = 3) dog muscle by real-time PCR and were normalized to RNU6B levels. [score:3]
On the other hand, miR-1, miR-133a, miR-206 expression levels are unchanged in GRMD dogs. [score:3]
For this reason, we aim at establishing, for the first time, a description of miRNA dysregulations in GRMD dog skeletal muscle based on a dedicated set: miR-1, miR-133a, miR-206, miR-222 and miR-486. [score:2]
Expression levels of miR-1, miR-133a, miR-206, miR-222, and miR-486 were determined in muscles (right and left Biceps femoris) of six 9-month-old GRMD [MuStem] dogs compared to six mock GRMD dogs. [score:2]
Chen J-F, Man del EM, Thomson JM, Wu Q, Callis TE, Hammond SM, Conlon FL, Wang D-Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 11 sentences]
50
[+] score: 35
Other miRNAs from this paper: mmu-mir-132, mmu-mir-1a-2, mmu-mir-1b
Figure 3 shows that there was no change in either the size (EGFP 26.2±2.0 pA; miR132 24.4±2.3 pA; miR1 23.21±1.6 pA; all groups n = 15; One way ANOVA, P>0.5), or frequency (EGFP 5.9±1.7 Hz; miR132 6.8±1.3 Hz; miR1 5.8±1.3 Hz; all groups n = 15; One way ANOVA P>0.8) of mEPSCs in miR132 -overexpressing neurons relative to EGFP- and miR1 -overexpressing control neurons. [score:5]
Neurons overexpressing miR132 demonstrate significantly reduced synaptic depression during the train relative to EGFP and miR1 -overexpressing controls at all time points (P<0.05), but no change in recovery after the train. [score:5]
At 2–3 days in culture, hippocampal neurons were infected with Lentivirus encoding one of the following: 1) the miR132 primary transcript along with EGFP as a real-time visual reporter of infection, 2) miR1 primary transcript along with EGFP as a control for nonspecific microRNA overexpression, or 3) EGFP alone as a control for viral infection and EGFP expression. [score:5]
While there are likely some residual errors in our peak current measurements, these are expected to be comparable between all groups—given the lack of effect of miR132, miR1 and EGFP expression on EPSC size—and are therefore not responsible for the effects on short-term plasticity observed with miR132 expression. [score:3]
0015182.g001 Figure 1(A) Representative traces showing typical paired-pulse responses from EGFP-, mir132-, and miR1 -overexpressing neurons with stimulus artifacts and presynaptic action currents blanked for clarity. [score:3]
We found a pronounced decrease in the rate of depression throughout the train in miR132 expressing neurons, relative to EGFP and miR1 controls (Figure 2B; 10 [th] Stimulus: EGFP 0.34±0.04, n = 33; miR132 0.69±0.07, n = 21; miR1 0.28±0.04, n = 13; One way ANOVA, P<0.0001; 40 [th] Stimulus: EGFP 0.15±0.02, n = 33; miR132 0.35±0.06, n = 21; miR1 0.09±0.02, n = 13; One way ANOVA, P<0.0005). [score:3]
Averaged over 3 biological replicates, miR132 -overexpressing neurons had a roughly 45-fold increase in the amount of mature miR132 transcript relative to EGFP-infected and miR1-infected controls at the age of recording (13–15 days in culture; fold increase of miR132 transcript relative to EGFP: miR132 47.3±7.7, n = 3; miR1 1.2±0.3, n = 2). [score:3]
Whereas both EGFP and miR1 control neurons demonstrated paired-pulse depression (i. e. the second response was smaller than the first), expression of miR132 led to paired-pulse facilitation (i. e. the second response was larger than the first) and a significant change in the PPR (Figure 1C; EGFP 0.77±0.04, n = 34; miR132 1.06±0.06, n = 21; miR1 0.87±0.05, n = 13; One way ANOVA, P<0.0005). [score:3]
However, when the rate of refilling of the RRP was monitored using the response to a test stimulus delivered 1.5 s following the RRP-depleting train, there was no difference in the extent of recovery in neurons overexpressing miR132 (Figure 2B; EGFP 0.82±0.06, n = 33; miR132 0.89±0.08, n = 21; miR1 0.78±0.07, n = 13; One way ANOVA, P>0.5). [score:3]
To control for the specificity of miR132, in some experiments we also infected neurons with a Lentivirus encoding the primary transcript of miR1, a non-neural, heart specific miRNA. [score:1]
However, we found no effect of miR132 or miR1 on EPSC size (Figure 1D; EGFP 4.37±0.43 nA, n = 21; miR132 3.78±0.52 nA, n = 21; miR1 3.98±0.97 nA, n = 21; One way ANOVA, P>0.7). [score:1]
[1 to 20 of 11 sentences]
51
[+] score: 35
miR-1 promotes myogenesis by targeting histone deacetylase 4, a transcriptional repressor of muscle gene expression [59]. [score:5]
miR-1 and miR-133 are expressed in cardiac and skeletal muscle and are transcriptionally regulated by the myogenic differentiation factors MyoD, Mef2, and SRF [22]. [score:4]
An acute bout of endurance exercise results in the up-regulation of miR-1 and miR-181. [score:4]
Both miR-1 and miR-181 expression, were increased in quadriceps by 40% and 37% (END vs. [score:3]
miR-1 and miR-181 expression are normalized to Rnu6. [score:3]
miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
In contrast, miR-1 over -expression in cultured skeletal myoblasts promotes skeletal muscle differentiation [20]. [score:3]
miR-1 and miR-181 expression following exercise. [score:3]
miR-1 and miR-181 are thought to play an important role in muscle differentiation and development as positive regulators of skeletal muscle remo deling and maintenance [26]. [score:3]
We speculate that miR-1 may also play a role in inducing antioxidant response in skeletal muscle. [score:1]
In Drosophila melanogaster, deletion of miR-1 gene results in an aberrant muscle maintenance [20], [29], [30]. [score:1]
Lastly, a recent study has shown that miR-1 levels are significantly increased in rat cardiomyocytes in response to oxidative stress [62]. [score:1]
Thus increased miR-1 in skeletal muscle of exercised mice may represent an adaptive response to oxidative stress imposed by acute exercise. [score:1]
[1 to 20 of 13 sentences]
52
[+] score: 35
We have previously reported that miR-206 is upregulated in the TA of 8-week-old mdx relative to wild-type controls, whereas the expression of miR-1 and miR-133a was unchanged (12). [score:6]
Similarly, the same tissues were analysed for expression of (D) miR-1, (E) miR-133a and (F) miR-206 by small RNA TaqMan normalized to miR-16 expression. [score:5]
This difference in expression between these dystromiRs is recapitulated in the results presented here, whereby miR-206 exhibits a dynamic pattern of expression over time in muscle, whereas miR-1 and miR-133a are relatively stable (Figure 4D–F). [score:5]
miR-1 and miR-133a are primarily expressed in skeletal and cardiac muscle, and miR-206 is restricted to skeletal muscle (41) and the role of these ‘myomiRs’ in muscle development and regeneration is already well established (41, 42), suggesting that these extracellular dystromiRs are unlikely to originate in non-muscle tissues. [score:4]
Interestingly, local injection of muscle-specific miRNAs has been shown to enhance muscle regeneration in injured rat muscle (51), and forced expression of miR-1 in HeLa (non-muscle) cells alters their transcriptional profile to become more muscle-like (52). [score:3]
It is possible that all three miRNAs originate from regenerating fibres, although the high levels of miR-1 and miR-133 expression in mature muscle mean that this is not trivial to demonstrate. [score:3]
The dystromiRs miR-1, miR-133 and miR-206 are present at low levels in myogenic precursor cells, are upregulated during myogenic differentiation and can be considered markers of adopting a muscle lineage (8, 41). [score:3]
miR-1 was restored to wild-type levels after a single administration of Pip6a-PMO (P < 0.01). [score:1]
In contrast expression of Myod1, miR-1 and miR-133a was relatively stable over the period measured, with only small changes observed longitudinally between time points and small fold change differences between mdx and Pip6e-PMO treated mdx mice at age-matched time points. [score:1]
miR-223 was analysed, in addition to the dystromiRs miR-1, miR-133a and miR-206, as this miRNA was not expected to change between C57Bl/10 and mdx samples. [score:1]
The results were similar between the dystromirs (miR-1, miR-133a and miR-206) and the control miRNA (miR-223). [score:1]
Fluctuations in the abundance of these miRNAs broadly matched miR-1, miR-133a and miR-206 levels in Pip6e-PMO -treated mice, although the baseline levels in the C57Bl/10 and untreated mdx mice showed greater variation. [score:1]
We (12), and others (13, 14), have shown that the serum of dystrophic animal mo dels (mdx mouse and CXMD [J] dog) and DMD patients is enriched for the dystrophy -associated miRNAs (dystromiRs): miR-1, miR-133 and miR-206. [score:1]
[1 to 20 of 13 sentences]
53
[+] score: 30
MiR-1 and miR-133a were proposed to contribute in muscle hypertrophy by the removal of their transcriptional inhibitory effect on growth factors such as IGF-1. Likewise, a regulatory feedback loop was demonstrated in vitro where IGF-1 downregulated miR-1 via the Akt/FoxO3a pathway [55]. [score:7]
Recent studies demonstrated that miR-29b, miR-133a, and 133b regulate myoblast proliferation and differentiation [38, 44], and miR-1 and miR-133 have been reported to regulate different aspects of skeletal muscle development in vitro and in vivo [23]. [score:4]
miR-1 promotes myocyte differentiation by repressing the expression of histone deacetylase 4 (HDAC4), a negative regulator of differentiation and a repressor of the MEF2 (myocyte enhancer factor-2) transcription factor [23]. [score:4]
Similar to miR-133a and miR206, miR-1 also regulate muscle differentiation and development [23, 77– 79]. [score:3]
The expression of miR-133 (miR-133a, miR-133b), miR-1, and miR-181 (miR-181a, miR-181b, and miR-181c) was profiled in muscle from patients affected by myotonic dystrophy type1 and it was observed that they were specifically induced during myogenesis [82]. [score:3]
miR-1 and miR-133 modulate skeletal-muscle-cell proliferation and differentiation by repressing the activity of HDAC4 (histone deacetylase 4; a signal -dependent inhibitor of muscle differentiation) and SRF, respectively, thereby establishing negative-feedback loops for muscle-cell differentiation [23]. [score:3]
The pivotal roles of three muscle-specific miRNAs, miR-1, miR-133, and miR-206, in the regulation of myogenesis have been well documented [17, 31, 32]. [score:2]
Of the 8 known miRNAs examined, 7 miRNAs (miR-425, miR-26a, miR-1a, miR-199a, miR-101, miR-378, and miR-151) showed a consistent pattern with the deep sequencing data (Figures 6(a)– 6(j)). [score:1]
A group of miRNAs, highly enriched in skeletal muscle (referred to as myomiRs), has recently been identified and includes miR-1, miR-133a, miR-133b, miR-206, miR-208, miR-208b, miR-486, and miR-499 [33– 37]. [score:1]
It was shown that FoxO3a increased the levels of miR-1 resulting in reduced IGF-1 protein levels. [score:1]
Out of 8 known miRNAs, 6 miRNAs have been functionally linked to myogenesis (i. e., miR-1a, miR-26a, miR-133a and miR-199a, miR-101, and miR-378 [38, 50, 51, 54, 55, 70]). [score:1]
[1 to 20 of 11 sentences]
54
[+] score: 30
In our study, we revealed that mIGF-1 expression was not able to modulate miR-29 and miR-1 expression in the mdx mouse mo del, further indicating that the expression of these miRNAs is strictly linked to the dystrophin rescue (Cacchiarelli et al., 2010). [score:7]
This class of miRNAs, poorly expressed in mdx, was upregulated in exon-skipping -treated animals and included muscle specific (miR-1 and miR-133) and more ubiquitous (miR-29 and miR-30) miRNAs. [score:6]
In particular miR-1 and miR-206, classified as myomiRs on the basis of their selective expression in skeletal and cardiac muscles, regulate muscle satellite cells proliferation and differentiation, by repressing Pax-7 (Chen et al., 2010). [score:4]
On the other hand, local injection of the NO-donor nitroglycerin (NTG) in mdx mice increased miR-1 and miR-29 expression, whereas did not modulate miR-206 (Cacchiarelli et al., 2010). [score:3]
It has been demonstrated that when dystrophin synthesis was restored the levels of miR-1, miR-133a, miR-29c, miR-30c, and miR-206 increased, while miR-23a expression did not change (Cacchiarelli et al., 2010). [score:3]
QRT-PCR analysis revealed that miRNAs classified within the degenerative group, namely miR-1, miR-29b, miR-29c, and miR-135a (Greco et al., 2009) were expressed in similar manner in diaphragm muscle of both mdx and mdx/mIGF-1 mice (Figure 2A). [score:3]
microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7. [score:2]
Dystrophic-signature miRNAs has been divided into three main classes: degenerative miRNAs (miR-1, miR-29c, and miR-135a), regeneration miRNAs (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), and inflammatory miRNAs (miR-222 and miR-223) (Greco et al., 2009). [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 9 sentences]
55
[+] score: 29
miR-1 and miR-206 expression is upregulated early during myogenic differentiation and downregulated during regeneration in injured muscle [39]. [score:9]
Myogenic regulatory factors Myf5 and Myogenin activate the expression of both miR-1 and miR-206, while MyoD is capable of activating only the expression of miR-206 [38]. [score:6]
miR-1 and miR-206 target Pax7 and regulate its expression [39]. [score:6]
Thus the coordinated expression of miR-1 and miR-206 is important for modulating the balance between proliferation and differentiation by directly regulating Pax7 [39]. [score:5]
Several miRs that were shown to play roles in muscle differentiation, including miR-1 and miR-206, did not show disrupted expression in emerin -null myogenic progenitors. [score:3]
[1 to 20 of 5 sentences]
56
[+] score: 29
Overexpression of miR-1 in hypertrophic cardiomyocytes suppresses cytoskeleton regulatory protein twinfilin-1 to reduce the cell size and attenuate the expression of hypertrophic markers [37]. [score:8]
We therefore showed that forced overexpression of miR-27b on burn wound margins significantly inhibited the mobilization of MSCs to the epidermis (Figure 7) and wound closure (Figure 8), while miR-1 and miR-27a had no obvious effects on the homing of MSCs in vivo. [score:5]
Interestingly, miR-1, miR136 and miR214 inhibited SDF-1α protein expression without affecting the luciferase activity of the p-MIR-Report-SDF-1α 3′UTR. [score:5]
First, we overexpressed specific miRNAs in mMSCs to reduce SDF-1α secretion and found that miR-1 (see Figure 6 and Figure S1), miR-27a and miR-27b significantly inhibited the migration of other normal mMSCs compared to negative controls in vitro (p<0.05) (Figure 6). [score:4]
The gene-specific primer pairs used to amplify specific target genes were as follows, and GenBank accession numbers also be included: mmu-miR-1(NR_029528.1): GSP, 5′-GGGGTGGAATGTAAAGAAGT-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-136(AJ 459747.1): GSP, 5′-GGAACTCCATTTGTTTTGA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-214(NR_029796.1): GSP, 5′-GACAGCAGGCACAGACA-3′ and reverse, 5′-TGCGTGTCGTGGAGTC-3′; mmu-miR-23a (NR_029740.1): GSP, 5′-CCATCACATGCCAGG-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27a (NR_029746.1): GSP, 5′-GGGGTTCACAGTGGCTAA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27b(NR_029531.1): GSP, 5′-GGGGTTCACAGTGGCTAAG′ -3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; U6(NM_001204274.1): forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; VEGF (NC_000083.6): forward, 5′-GTCCAACTTCTGGGCTCTTCT-3′ and reverse, 5′-CCTTCTCTTCCCCTCTCT-3′. [score:2]
Because 47% of miRNA target sequences are located in the 3′UTRs of mRNAs, 47% of them in open reading frames (ORFs) and the rest in the 5′UTR [35]– [36], we speculate that miR-1, miR136 and miR214 may bind to the ORF or 5′UTR of SDF-1α, but confirmation require further investigation. [score:1]
Figure S1 The effects of miR-23a, miR-136, miR-1 and miR-214 on MSC migration. [score:1]
They were named LV-mmu-mir-1, LV-mmu-mir-136, LV-mmu-mir-214, LV-mmu-mir-23a, LV-mmu-mir-27a, LV-mmu-mir-27b, and LV-cel-mir-67 (the negative control). [score:1]
Lane 1, MSCs; lane 2, MSCs/cel-miR-67; lane 3, MSCs/miR-27b; lane 4, MSCs/miR-27a; lane 5, MSCs/miR-1; lane 6, MSCs/miR-23a; lane 7, MSCs/miR-136; lane 8, MSCs/miR-214. [score:1]
As shown in Figure 5A, miR-27b, miR-27a, miR-1, miR-136, and miR-214 reduced the level of SDF-1α protein. [score:1]
[1 to 20 of 10 sentences]
57
[+] score: 28
[39] Hence, the observed increase in the expression of miR-142a and the miR-1a/133a cluster might be a direct consequence of the cell death process and a common feature in diseases that cause inflammation and apoptosis. [score:6]
As far as RP is concerned, Loscher et al. reported upregulation of miR-1a, miR-133a, and miR-142a in four different mouse mo dels of RP linked to genes involved in both autosomal dominant and autosomal recessive forms of the disease, rhodopsin and rds/peripherin, respectively. [score:6]
However, the role that upregulation of either miR-1 alone or the miR-1/133a cluster might be playing in the apoptotic process is not exempt from controversy. [score:4]
In any case, differential expression of miR-1a, miR-133a, and miR-142 in our study, as well as in the work of Loscher et al., is observed after the onset of apoptosis. [score:3]
In support of this, selective ablation of Müller cells resulted in photoreceptor death, and an altered expression of miR-1a, miR-133a, and miR-142. [score:3]
Tang Y, Zheng J, Sun Y, MicroRNA-1 regulates cardiomyocyte apoptosis by targeting Bcl-2. Int Heart J. 2009; 50: 377– 387. [score:3]
Pan Z, Sun X, Ren J, miR-1 exacerbates cardiac ischemia-reperfusion injury in mouse mo dels. [score:1]
He B, Xiao J, Ren AJ, Role of miR-1 and miR-133a in myocardial ischemic postconditioning. [score:1]
Yu XY, Song YH, Geng YJ, Glucose induces apoptosis of cardiomyocytes via microRNA-1 and IGF-1. Biochem Biophys Res Commun. [score:1]
[1 to 20 of 9 sentences]
58
[+] score: 28
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
Licofelone dramatically down-regulated the majority of miRNAs overexpressed in association with pancreatic tumor progression and upregulated miR1, miR122 and miR158 by many fold including those that regulate inflammation and CSCs. [score:10]
Researchers also have found that miR-1 is down-regulated in several types of cancers [45– 48] and that it acts as a tumor suppressor. [score:6]
[1 to 20 of 3 sentences]
59
[+] score: 27
In addition to potential tumor/metastasis suppressor ORFs naturally expressed in neural cells, both ATF-126 and Maspin cDNA up-regulated miRNAs previously associated with tumor suppression in many types of cancers, including miR-1 [23], [24] and miR-34 [25]. [score:10]
Interestingly, both, ATF-126 and Maspin cDNA, up-regulated miRNAs with potential tumor suppressive functions, such as miR-1 [23], [24] and miR-34 [25], while down -regulating oncogenes and metastasis promoters, including miR-10b [26] (Fig. 6C ). [score:7]
J Clin Endocrinol Metab 24 Nohata N Sone Y Hanazawa T Fuse M Kikkawa N 2011 miR-1 as a tumor suppressive microRNA targeting TAGLN2 in head and neck squamous cell carcinoma. [score:5]
Intriguingly again, miR-1 is naturally expressed in dorsal root ganglion neurons where it has a role in modulating neurite outgrowth [43]. [score:3]
Expression of miR-10b, miR-1, miR-34a, miR363, and miR-124 was validated in two independent assays using hydrolysis probes (Table S4). [score:2]
[1 to 20 of 5 sentences]
60
[+] score: 27
The direct proofs showing that miRNAs are involved in cardiac IPost were from recent one report [21], in which the expression of miR-133 and miR-1 were up-regulated by IPost. [score:7]
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
Recently, He et al. demonstrated that cardiac miR-1 and miR-133 were significantly increased by IPost during reperfusion in an I/R injury rat mo del, indicating some miRNAs may be involved in the regulation of cardiac IPost during reperfusion [21]. [score:2]
A recent study by Yang et al. has demonstrated that the muscle-specific miR-1 level is obviously increased in infarcted rat hearts where ischemic cardiomyocyte apoptosis plays an important role in cardiac ischemic injury [37]. [score:1]
[1 to 20 of 7 sentences]
61
[+] score: 27
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
Of the down-regulated miRNAs after HFD -induced obesity, the putative targets of mmu-miR-1, mmu-miR-204 and mmu-miR-133b, are implicated in cell differentiation. [score:6]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
The expression of mmu-miR-1 that we detected in white adipose tissue, can be due to the presence of brown adipocytes in white adipose tissue [47] and may be important in the metabolic adaptation that occurs in the mouse during HFD-feeding. [score:3]
Mmu-miR-1 targets UCP-1, which uncouples oxidative phosphorylation from the production of ATP in brown adipocytes and energy is dissipated as heat [46]. [score:3]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
Mmu-miR-1 has mainly been characterized as a muscle-specific miRNA [44] and it has been found to be expressed in brown adipocytes [45]. [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 27
MyomiRs may increase signal differentiation during embryogenesis, but other studies have shown that overexpression of miR1 and miR206 inhibits IGF-1 expression [47]. [score:7]
A recent study demonstrated that miR1 and miR206 play a major role in myoblast differentiation by regulating multiple target genes [42]. [score:4]
One study provided evidence that miR1 and miR206 directly target PAX3, leading to initiation of the myogenic program [41]. [score:4]
Second, the effect on muscle mass of upregulation of miR1 and miR206 by Acu-LFES should be studied further. [score:4]
The expressions of miR1 and miR206 were significantly decreased in diabetic mice but were increased by Acu-LFES in non-diabetic mice (2.5-fold for miR1 and 2.7 fold for miR206) and diabetic mice (2.0-fold for miR1 and 1.8-fold for miR206). [score:3]
MyomiRs include miR1, -133, -206, -208, and -499. [score:1]
In the current study, we found that miR1 and -206 were decreased in the muscle tissue of diabetic mice. [score:1]
Acu-LFES increase miR-1 and miR-206 microRNA in the muscle of control and diabetic mice. [score:1]
In a rat skeletal muscle injury mo del, injection of double-stranded miR1, miR133, and miR206 into muscle induced MYOD, PAX7, and myogenin, leading to increased muscle regeneration [40]. [score:1]
Acu-LFES not only increased miR1 and -206 in muscles of normal mice but also prevented the decrease of myomiRs in muscles of diabetic mice. [score:1]
[1 to 20 of 10 sentences]
63
[+] score: 26
Previously, in muscles from LGMD2A patients, we found Pax7 -positive SCs were highest in specimens from older patients with longer disease duration, correlating with downregulation of miR-1, miR-133a, and miR-206 [12]. [score:6]
In muscle biopsied from LGMD2A patients, Pax7 -positive SCs were highest in the fibrotic group and correlated with microRNA dysregulation as downregulation of miR-1, miR-133a, and miR-206 [12]. [score:5]
Pax7 -positive SCs were highest in the fibrotic group and correlated with microRNA dysregulation as downregulation of miR-1, miR-133a, and miR-206. [score:5]
The change in expression levels of miR-1 (Fig.   4b) and miR-133a (Fig.   4c) were also lower than that in the WT counterparts at both time points followed a similar pattern of slower decline. [score:3]
These observations strongly indicated that miR-206 and miR-1 participate in a regulatory manner that allows transition of SCs from proliferation to differentiation and that the absence or attenuation of this transition results in an excessive number of Pax7 -positive SCs, impaired myofiber repair/regeneration, and consequent increased fibrosis. [score:2]
TGF-β and microRNA (miR-1, miR-206, miR-133a) regulation were also assessed. [score:2]
Chen JF, Tao Y, Li J, Deng Z, Yan Z, Xiao X, Wang DZ: microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7. [score:2]
mirR-206 (a), miR-1(b), miR-133a (c), and TGF-β (d) levels in the regenerating CAPN3- KO and WT are relative to their baseline levels (dashed line), obtained from the uninjected muscles of 4 weeks post injection cohorts in each group. [score:1]
[1 to 20 of 8 sentences]
64
[+] score: 26
MicroRNA expression in the diaphragm of a dystrophin -deficient mouse, a mo del for Duchenne muscular dystrophy, revealed a dramatic increase in expression of the muscle-specific microRNA Mir206 [36], while skeletal muscle hypertrophy induced by functional overloading of the plantaris muscle results in downregulation of miR-1 and miR-133a, which are also muscle-specific miRNAs [37]. [score:8]
The importance of expression patterns of both the microRNAs and their targets can be illustrated by miR-1, which is expressed in embryonic heart and skeletal muscle. [score:7]
In the heart, however, miR-1 is required to regulate ventricular cardiomyocytes through repressing the cardiac transcription factor Hand2; Mir1 overexpression results in heart failure at about E13.5, due to a failure in proliferation [15]. [score:4]
Thirdly, miR-1 and miR-124, when transfected into human cells, cause downregulation of about 100 messages each [21]. [score:4]
Hdac4 is a repressor of muscle differentiation, and miR-1 is thought to target Hdac4 in muscles and thus promote muscle differentiation [14]. [score:3]
[1 to 20 of 5 sentences]
65
[+] score: 26
In previous studies, we reported that the sEHI -induced cardioprotective effect was mediated in part by restoring the impaired KCNJ2 (potassium voltage-gated channel subfamily J member 2)/Kir2.1 and GJA1 (gap junction protein alpha 1)/Cx43 mRNA and protein expression in cardiomyocytes by suppressing miR-1, which might be triggered by PI3K (phosphatidylinositol 3-kinase)/AKT pathway activation [18, 19]. [score:5]
It has been established that SRF positively regulates miR-1 expression in the heart [15]. [score:4]
Among them, two proarrhythmic miRNAs, i. e., miR-1 and miR-133, were downregulated in the MI mice after t-AUCB treatment (Additional file 1: Figure S2B). [score:4]
Previously, we showed that sEHIs might reduce the incidence of ischemic arrhythmias by suppressing microRNA-1 (miR-1) in the myocardium. [score:3]
We previously demonstrated that sEHIs might reduce the incidence of ischemic arrhythmias by suppressing miR-1 in cardiomyocytes [18, 19]. [score:3]
As miR-1 and miR-133 have the same proarrhythmic effects in the heart, we assumed that the beneficial effects of sEHIs might also relate to the regulation of miR-133. [score:2]
As we have previously demonstrated the role of miR-1 in the ischemic arrhythmia–related gene network [18, 19], we wanted to explore the regulatory function of miR-133 in arrhythmia in the present study. [score:2]
The aim of the present study was to complement and extend our earlier studies by investigating whether the beneficial effects of sEHIs are also related to miR-133 expression except miR-1 in a mouse mo del of MI. [score:1]
As miR-1 and miR-133 are clustered on the same chromosome loci and transcribed together in a tissue-specific manner [20], we speculated that miR-133 might also contribute to the anti-arrhythmic action of sEHIs. [score:1]
miR-1 and miR-133 have the same effects on cardiac arrhythmia, as they are both proarrhythmic [17, 25]. [score:1]
[1 to 20 of 10 sentences]
66
[+] score: 26
Other miRNAs from this paper: cel-let-7, cel-mir-1, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, cel-lsy-6, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, cel-mir-58b, mmu-let-7j, mmu-let-7k, cel-mir-58c
Translational activity was monitored through measurement of RL activity in the presence of miR-35 2′- O-Me inhibitor or a non-cognate miR-1 2′- O-Me inhibitor. [score:5]
RL-6×-miR-35-p(A) [0] reporter translation was specifically de-repressed when the extract was treated with a miR-35 2′- O-Me inhibitor, but not when supplemented with a non-cognate miR-1 control (Figure 5B). [score:5]
In untreated or mock -depleted extracts, a 2- to 4-fold increase in RL light counts was observed when a miR-35 2′- O-Me inhibitor was added prior to RL-6×-miR-35-pA [86] reporter translation, in comparison with a non-cognate miR-1 2′- O-Me control (Figure 4A, left panel). [score:5]
Translation counts were monitored over time in the presence of miR-35 or miR-1 2′- O-Me inhibitors. [score:5]
In a mock -depleted extract, as in an untreated extract, the reporter was significantly de-repressed when treated with miR-35 2′- O-Me inhibitor, but not when treated with a non-cognate miR-1 inhibitor (Figure 5C). [score:5]
S10 Worm lysate was pre-cleared with 25 μl of T1 streptavidin beads (Invitrogen) and non-specific 2′- O-Me oligonucleotides (miR-1, 10 pmol) for 1 h at 4°C with rotation. [score:1]
[1 to 20 of 6 sentences]
67
[+] score: 25
In this study, we have found that these miRs are highly expressed in CSCs, while expression of miR-1, the other cardiomyocyte specific miR, could not be detected. [score:5]
The fact that we could not detect expression of the cardiomyocyte-specific miR-1 in CSC samples using two independent methods, while we confirmed it to be highly expressed in total heart tissue, further demonstrates the absence of significant contamination from other cardiac cell types. [score:5]
Indeed, while miR-1 promotes differentiation of ES cells towards a cardiac fate, miR-133 inhibits differentiation into cardiac muscle [23], [27]. [score:3]
miR-206 is another member of the miR-1/133 family that exhibits skeletal muscle specific expression. [score:3]
To further explore this aspect and discard the possibility of eventual contamination of our samples with differentiated cardiomyocytes, we independently determined the expression levels of miR-1, a hallmark of cardiomyocyte differentiation, and two additional miRs known to be essential for muscle differentiation processes: miR-208a and miR-206. [score:3]
This analysis confirmed our previous observation that miR-1 cannot be detected in adult CSCs or in embryonic heart cells at day E9, although it is highly expressed in mouse heart tissue (Figure 2B). [score:3]
Additionally, miR-1 and miR-133a are key regulators of cardiomyocyte proliferation and differentiation, assuming antagonistic roles in these processes. [score:2]
The muscle specific miR-1 and miR-133a are encoded in the same bicistronic transcriptional unit, under the control of the cardiogenic transcription factors MEF2 and SRF [19], [20]. [score:1]
[1 to 20 of 8 sentences]
68
[+] score: 24
We speculate miR-1 and miR-133a are indirect targets of miR-320a downstream of SRF. [score:4]
Indeed, the expression of miR-1 and miR-133a were regulated by miR-320a. [score:4]
MiR-1, miR-133a and other targets of SRF may contribute to the development of atherosclerosis and CAD. [score:4]
Interestingly, the expression miR-1 and miR-133a, miRNAs regulated by SRF 21, were significantly decreased by miR-320a transfection in vivo and in vitro (Fig. 4F and G). [score:4]
Interestingly, recent studies have shown that SRF regulates the expression of miR-1 and miR-133a, miRNAs important for cardiac and skeletal muscles 46, 47. [score:4]
We detected the expressions of miR-1 and miR-133a by real-time PCR in aorta of miR-320a treated mice and endothelium cells treated with miR-320a. [score:3]
Our data reveal links among SP1, miR-320a, SRF and miR-1/miR-133a in endothelial dysfunction in atherosclerosis. [score:1]
[1 to 20 of 7 sentences]
69
[+] score: 24
miR-1 could also be an important target for use in therapy of cardiovascular disease. [score:5]
Two wi dely conserved miRNAs that display cardiac- and skeletal muscle–specific expression during development and in the adult are miR-1 and miR-133 [33], which are derived from a common precursor transcript (bicistronic) [34], [35]. [score:4]
The expression of miR-1 was reported to be especially high in cardiac precursor cells [33], [35]. [score:3]
In contrast, miR-206, which shares extensive sequence homology to miR-1, is found expressed exclusively in skeletal muscle with the co-transcribed miR-133b. [score:3]
Many results suggest that miR-1 genes modulate the effects of critical cardiac regulatory proteins to control the balance between differentiation and proliferation during cardiogenesis. [score:2]
miR-1 and miR-133a were up regulated in all three comparisons (days 12, 19, and 26) between Cor. [score:2]
For miR-1 and miR-292-3P, results were consistent for both miRNA array platforms and the data verified these results. [score:1]
Experiments also revealed that excess miR-1 in the developing heart leads to a decreased pool of proliferating ventricular cardiomyocytes [35]. [score:1]
There are also miRNAs such as miR-1, miR-133a and miR-133b, which increased progressively at day 19 and day 26. [score:1]
miR-1 has been reported to be abundant in rat heart but not in rat artery [36]. [score:1]
Two miRNAs (miR-1 and miR-292-3p) represented overlapping results from Affymetrix and Febit miRNA platforms. [score:1]
[1 to 20 of 11 sentences]
70
[+] score: 23