sort by

256 publications mentioning hsa-mir-106a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-106a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 412
The green circle indicates the number of genes that are downregulated when miR-106a-5p is upregulated, whereas the red circle indicates the number of genes that are upregulated when miR-106a-5p is downregulated. [score:13]
Left: downregulated genes when miR-106a-5p is upregulated; Right: upregulated genes when miR-106a-5p is downregulated. [score:13]
In total, 89 genes were downregulated (mean fold-change ≤0.5) in miR-106a-5p -overexpressing cells, whereas 76 genes were upregulated (mean fold-change ≥2.0) in miR-106a-5p -downregulated cells (Figure 1C). [score:12]
As can be seen in Figure S1 in File S1, while miR-106a-5p was significantly upregulated by transfection of pre-miR-106a-5p and downregulated by transfection of anti-miR-106a-5p, the expression levels of miR-106b were unaffected. [score:9]
These results strongly demonstrate that FASTK is the target gene of miR-106a-5p, which directly recognizes the 3′-UTR of the FASTK transcript to downregulate its expression. [score:9]
miR-106a-5p increases cell migration and invasion by inhibiting the anti-metastatic gene TGFBR2 (transforming growth factor-β receptor 2) in colorectal cancer [16], inhibits the cellular extrinsic apoptotic pathway by targeting FAS in gastric cancer [10], and promotes cell growth and invasion by targeting ZBTB4 (zinc-finger and BTB domain containing 4) in breast cancer [14]. [score:9]
The statistical analysis for FASTK protein expression changes after the overexpression or downregulation of miR-106a-5p in three independent experiments are shown in Figure 2C. [score:8]
We found that miR-106a-5p expression is significantly downregulated in astrocytoma tissues and is negatively associated with advanced clinical staging, whereas FASTK exhibited the opposite expression pattern. [score:8]
In our study, miR-106a-5p directly targets FASTK expression in astrocytoma cells and they play important roles in the disease progression. [score:8]
Then, the survival outcome of patients with high miR-106a-5p expression levels or high FASTK expression levels (≥ median) was compared with patients exhibiting low miR-106a-5p expression levels or low FASTK expression levels (< median) using Kaplan-Meier survival analysis. [score:8]
miR-106a-5p is one of the most significantly downregulated miRNAs in astrocytomas, and its low expression is significantly associated with poor survival outcome, which triggered our interest in investigating its function and its target genes during astrocytoma development. [score:7]
In this study, we found that the overexpression of miR-106a-5p significantly inhibited astrocytoma cell proliferation and migration and promoted apoptosis, which supports the role of miR-106a-5p as a tumor suppressor in astrocytomas. [score:7]
In order to identify the total transcripts regulated by miR-106a-5p directly or indirectly, we first measured the global mRNA expression change through mRNA microarray by overexpressing or knocking down miR-106a-5p in cancer cells. [score:7]
As FASTK is the direct target gene of miR-106a-5p, we asked whether FASTK was upregulated in human samples. [score:7]
Furthermore, the reduced expression of miR-106a-5p is associated with poor survival outcome, suggesting that miR-106a-5p elicits a tumor suppressive role during astrocytoma development and/or progression [8]. [score:6]
A set of 36 genes was identified as candidate miR-106a-5p targets (Figure 1C and Table 1) In order to validate the specificity of pre-miR-106a-5p and anti-miR-106a-5p and their off target effects, we transfected U251 cells with equal amounts of pre-ncRNA, pre-miR-106a-5p, anti-ncRNA or anti-miR-106a-5p, and the expression level of miR-106b, another member of the miR-106 family whose sequence is most similar to miR-106a-5p, was assessed by quantitative RT-PCR assay. [score:6]
Next, we combined bioinformatics programs to select candidate miR-106a-5p targets from the differentially regulated genes to refine the number of miR-106a-5p targets. [score:6]
In our previous studies, we found that the reduced expression of miR-106a-5p is significantly associated with poor survival outcome, so we asked whether FASTK upregulation was correlated with patient survival. [score:6]
The oligonucleotide miR-106a-5p mimic (pre-miR-106a-5p), mimic negative control (pre-ncRNA), miR-106a-5p inhibitor (anti-miR-106a-5p) and the inhibitor negative control (anti-ncRNA) were purchased from GenePharma (Shanghai, China). [score:5]
In contrast, miR-106a-5p inhibits cell proliferation and induces apoptosis by targeting E2F1 (E2F transcription factor 1) in gliomas [20]. [score:5]
Recently, miR-106a-5p was found through bioinformatics prediction followed by experimental validation to inhibit glioma cell growth by targeting the transcription factor E2F1 [20]. [score:5]
However, there are few reports about miR-106a-5p function and its target genes as a tumor suppressor, particularly in astrocytomas. [score:5]
Notably, as shown in Figure 2J and Figure 2K, patients with low miR-106a-5p or high FASTK expression levels exhibited poorer survival outcomes than patients with high miR-106a-5p or low FASTK expression levels (p = 0.014 and p = 0.038, respectively). [score:5]
We may suggest that the tumor suppressive potential of miR-106a-5p is due to inhibition of FASTK which interacts with TIA1 to mediate Fas -induced apoptosis during astrocytoma pathogenesis. [score:5]
Since it has been shown that miRNAs expressed at low levels (<100 copies per cell) did not significantly repress target-containing transcripts [28], the absolute expression levels of miR-106a-5p in astrocytoma cells was measured. [score:5]
Overexpression of miR-106a-5p and corresponding decreased FASTK expression, decreased oncogenic potential of cells, as evidenced by decreased proliferation rate, cell migration and increased apoptosis damage. [score:5]
Using Kaplan-Meier survival analysis, we showed that the low expression of miR-106a-5p or the increased expression of FASTK is significantly associated with poor survival outcome in astrocytoma patients. [score:5]
Only those genes that were inversely expressed relative to miR-106a-5p expression change were chosen. [score:5]
As shown in Figure 3D, the overexpression of miR-106a-5p induced by transfection of pre-miR-106a-5p reduced the migration of U251 cells by approximately 30% compared to control -transfected cells, whereas the knockdown of FASTK significantly suppressed the ability of astrocytoma cells to migrate through non-matrigel-coated membranes by approximately 65%. [score:5]
At this concentration, it is obviously that miR-106a-5p can efficiently suppress FASTK expression in astrocytoma cells. [score:5]
The overexpression of miR-106a-5p inhibits astrocytoma cell proliferation, migration, and invasion and promotes apoptosis. [score:5]
These results demonstrate that the endogenous level of miR-106a-5p can be specifically manipulated by miR-106a-5p mimics or inhibitors, ant this approach have no obvious off target effects. [score:5]
The inhibition of migration induced by the interference of FASTK was also stronger than that elicited by miR-106a-5p overexpression. [score:5]
Whether miR-106a-5p is a tumor suppressive or oncogenic miRNA remains controversial, and the regulatory mechanism underlying miR-106a-5p -mediated function remains to be elucidated in different cancers. [score:4]
In our previous studies, we found that miR-106a-5p is significantly downregulated in astrocytomas. [score:4]
However, the potential role of miR-106a-5p as an oncogene or a tumor suppressor in cancer development remains controversial. [score:4]
To reduce the false positives and to obtain a more accurate assessment of the genuine miR-106a-5p targets, only the mRNAs that were present in both the pre-miR-106a-5p- and the anti-miR-106a-5p -transfected groups were considered as candidate miR-106a-5p targets. [score:4]
Moreover, we show that FASTK is a direct target for miR-106a-5p. [score:4]
FASTK is a direct target gene of miR-106a-5p. [score:4]
FASTK is a Direct Target of miR-106a-5p. [score:4]
Fas-activated serine/threonine kinase (FASTK) was identified as a direct target of miR-106a-5p. [score:4]
miR-106a-5p overexpression was achieved by transfecting cells with pre-miR-106a-5p, whereas miR-106a-5p knockdown was achieved by transfecting cells with anti-miR-106a-5p. [score:4]
As shown in Figure 2E, miR-106a-5p overexpression significant decreased the luciferase reporter activity (normalized against β-gal activity) compared with the pre-ncRNA treatment, whereas the inhibition of miR-106a-5p significantly increased the reporter activity. [score:4]
Differentially regulated genes in cells with increased or decreased expression of miR-106a-5p. [score:4]
These results suggest that miR-106a-5p regulates FASTK expression not only via a post-transcriptional mechanism but also by affecting its mRNA stability. [score:4]
0072390.g001 Figure 1 (A) Overexpression or knockdown of miR-106a-5p. [score:4]
As FASTK exhibited a higher PicTar score, we sought to verify whether FASTK was a direct target gene of miR-106a-5p. [score:4]
These results elucidate the underlying mechanism by which miR-106a-5p inhibits astrocytoma development and progression. [score:4]
The mechanism by which miR-106a-5p decreases oncogenic potential of cells is most likely through inhibition of FASTK, a potential regulator of Fas -induced apoptosis. [score:4]
Overexpression and Knockdown of miR-106a-5p. [score:4]
The transcripts regulated both directly and indirectly by miR-106a-5p were identified using a previously reported method [27]. [score:4]
To determine whether the negative regulatory effects of miR-106a-5p on FASTK expression were mediated through binding to the presumed complementary sites at the 3′-UTR of FASTK, we fused the entire FASTK 3′-UTR into a downstream position of a firefly luciferase reporter plasmid. [score:4]
We calculated the probability of whether the differentially regulated genes were predicted miR-106a-5p targets using three wi dely used programs: TargetScan, PicTar, and microRNA. [score:4]
As shown in Figure 1A, the expression of miR-106a-5p was significantly increased by the introduction of pre-miR-106a-5p, whereas anti-miR-106a-5p abolished the miR-106a-5p levels in U251 cells. [score:3]
For comparison, the expression levels of miR-106a-5p in pre-ncRNA- or anti-ncRNA -transfected cells were arbitrarily set at 1. The results are presented as the mean ± SD of three independent experiments (*** p<0.001). [score:3]
Notably, the inhibitory effect induced by si-FASTK was stronger than that induced by pre-miR-106a-5p. [score:3]
In contrast, anti-miR-106a-5p significantly increased the expression of FASTK (Figure 2B). [score:3]
The predicted interaction between miR-106a-5p and its target binding sites within the FASTK 3′-UTR is illustrated in Figure 2A. [score:3]
Subsequently, we asked whether miR-106a-5p or FASTK expression levels represented specific molecular signatures for subsets of astrocytomas. [score:3]
As shown in Figure 2F, the expression of miR-106a-5p was progressively decreased from the control samples to the WHO grade IV astrocytomas. [score:3]
In this study, FASTK was experimentally validated as a miR-106a-5p target. [score:3]
Relative expression of miR-106b-5p after miR-106a-5p transfection. [score:3]
miR-106a-5p, which is located on Xq26.2, belongs to the miR-17 family, whose overexpression has been detected in various types of human cancer. [score:3]
We found that miR-106a-5p significantly suppressed cell proliferation and migration and promoted cell apoptosis in vitro. [score:3]
To the best of our knowledge, this study is the first report showing direct regulation of FASTK by miR-106a-5p. [score:3]
miR-106a-5p is highly expressed in gastric [9], [10], [11], [12], [13], breast [14], [15], colorectal [16] and non-small cell lung cancers [17]. [score:3]
All of the cells transfected with pre-miR-106a-5p exhibited reduced expression of FASTK relative to the cells transfected with pre-ncRNA. [score:3]
In summary, our data indicate that miR-106a-5p is a tumor suppressor gene in astrocytomas. [score:3]
The Role of miR-106a-5p Targeting of FASTK in Cell Proliferation, Migration and Apoptosis. [score:3]
miR-106a-5p Target Prediction. [score:3]
The expression levels of miR-106a-5p or FASTK were first stratified in the astrocytomas by the median value. [score:3]
We then surveyed potential genes that were inversely expressed relative to miR-106a-5p using mRNA microarray analysis. [score:3]
Although much remains to be elucidated in terms of the role of miR-106a-5p in the pathogenesis of astrocytomas, miR-106a-5p represents a new potential therapeutic target for the treatment of astrocytomas. [score:3]
As every coin has two sides, the divergent function of miR-106a-5p as an oncogene or a tumor suppressor in cancer development might depend on the tumor type, and further investigation is required to better understand this issue. [score:2]
Among the list of the 36 genes obtained from the mRNA microarray assay, FASTK (Fas-activated serine/threonine kinase) and PHTF2 (putative homeodomain transcription factor 2) were predicted as miR-106a-5p targets. [score:2]
Only the genes predicted as miR-106a-5p targets by at least two of the above-mentioned algorithms were considered positive. [score:2]
The mRNA microarray profiles clearly showed differential mRNA expression patterns among pre-miR-106a-5p- and anti-miR-106a-5p -transfected cells compared with their corresponding control transfectants (Figure 1B). [score:2]
As shown in Figure 3E, the overexpression of miR-106a-5p induced by transfection with pre-miR-106a-5p resulted in a significant increase in apoptotic cells compared with the negative control -transfected cells. [score:2]
For the luciferase reporter assays, cells were cultured in 6-well plates, and each well was transfected with 2 µg of firefly luciferase reporter plasmid, 2 µg of β-galactosidase expression vector (Ambion), and equal amounts of pre-ncRNA, pre-miR-106a-5p, anti-ncRNA, or anti-miR-106a-5p using Lipofectamine 2000 (Invitrogen). [score:2]
Identification of Transcripts Regulated by miR-106a-5p using Microarray Analysis. [score:2]
Then we validated the miR-106a-5p target gene through western blot analysis, quantitative real-time PCR and luciferase reporter assay. [score:2]
These results further confirm the negative regulation of FASTK by miR-106a-5p in vivo. [score:2]
The knockdown of FASTK induced similar effects on astrocytoma cells as those induced by miR-106a-5p. [score:2]
We first transfected U251 cells with equal concentrations of pre-ncRNA, pre-miR-106a-5p, anti-ncRNA or anti-miR-106a-5p. [score:1]
To calculate the absolute expression levels of miR-106a-5p in astrocytoma cells, a series of synthetic miR-106a-5p oligonucleotides (from 10 [−4] fmol to 10 [2] fmol) were reverse-transcribed and amplified. [score:1]
Cells transfected with pre-miR-106a-5p, si-FASTK or their corresponding negative controls were suspended in serum-free DMEM culture medium at a concentration of 4×10 [5] cells/mL and then added to the upper chamber (4×10 [4] cells/well). [score:1]
The role of miR-106a-5p and FASTK in cell apoptosis in U87 cells. [score:1]
The role of miR-106a-5p and FASTK in cell proliferation, migration and apoptosis. [score:1]
mRNAs present in both the pre-miR-106a-5p- and the anti-miR-106a-5p -transfected groups. [score:1]
The resulting Ct values were plotted versus the log [10] of the amount of input miR-106a-5p. [score:1]
Next, the expression of miR-106a-5p and FASTK was evaluated and stratified according to tumor grade in 84 astrocytoma tissues and in 20 NAT samples. [score:1]
Briefly, U251 cells were transfected with pre-ncRNA, pre-miR-106a-5p, anti-ncRNA or anti-miR-106a-5p using Lipofectamine 2000. [score:1]
To investigate the cellular phenotypes triggered by the targeting of FASTK by miR-106a-5p, U251 cells were transfected with pre-miR-106a-5p and siRNA against FASTK (si-FASTK) and analyzed for the changes in proliferation, migration, and apoptosis. [score:1]
Cells transfected with pre-miR-106a-5p, si-FASTK or with their corresponding negative controls were harvested at 24 h after transfection and washed in cold PBS. [score:1]
The miR-17 family is divided into three clusters according to consensus seed regions, and miR-106a-5p is a member of the miR-106a-363 cluster, which is located on Xq26.2. [score:1]
In our previous study, we established a unique molecular diagnostic signature for astrocytomas including miR-21, miR-24, miR-30c, miR-106a-5p, miR-124, miR-137, and miR-181b [8]. [score:1]
The levels of mature miR-106a-5p were quantified using Taqman microRNA probes (Applied Biosystems) as previously reported [21]. [score:1]
miR-106a-5p was present in astrocytoma cells at 1040 copies per cell. [score:1]
For each well, equal concentrations (100 pmol) of pre-ncRNA, pre-miR-106a-5p, anti-ncRNA or anti-miR-106a-5p were added. [score:1]
U87 cells were transfected with equal concentrations of pre-ncRNA, pre-miR-106a-5p, si-NC and si-FASTK. [score:1]
However, the downstream effectors of miR-106a-5p in astrocytomas remain elusive, and thus, further research is required to fully understand its contributions to this malignancy. [score:1]
The resulting plasmid was introduced into U251 cells combined with a transfection control plasmid (β-gal), as well as pre-ncRNA, pre-miR-106a-5p, anti-ncRNA or anti-miR-106a-5p. [score:1]
For each well, 100 pmol of pre-ncRNA, pre-miR-106a-5p, anti-ncRNA or anti-miR-106a-5p was transfected. [score:1]
Firefly luciferase reporters containing either wt or mut FASTK 3′-UTRs were co -transfected into U251 cells with pre-miR-106a-5p, anti-miR-106a-5p and their corresponding negative controls. [score:1]
U251 cells were transfected with equal concentrations of pre-ncRNA, pre-miR-106a-5p, si-NC and si-FASTK. [score:1]
0072390.g002 Figure 2 (A) A schematic description of the hypothesized duplexes formed by interactions between the FASTK 3′-UTR binding sites and miR-106a-5p. [score:1]
The relative cell survival rate of the pre-miR-106a-5p -transfected cells at 96 h was 74.4%. [score:1]
Firstly, U251 cells were transfected with pre-miR-106a-5p or anti-miR-106a-5p and their corresponding controls. [score:1]
Evaluation of the absolute expression level of miR-106a-5p in astrocytoma cells. [score:1]
miR-106a-5p belongs to the miR-17 family, which includes miR-17-5p, miR-20a, miR-20b, miR-106a-5p, miR-106b and miR-93. [score:1]
U251 cells in logarithmic growth were transfected with pre-miR-106a-5p or si-FASTK with their corresponding controls. [score:1]
[1 to 20 of 111 sentences]
2
[+] score: 187
Other miRNAs from this paper: hsa-mir-17, hsa-mir-20a, hsa-mir-34a, hsa-mir-34b, hsa-mir-34c
Thus, miR-106a may upregulate the expression of MDR1/P-gp and MDR1 by promoting CDX2 expression, which in turn enhances the cell efflux capability, leading to drug resistance. [score:8]
The parent groups were U87 or U251, the control groups were U87/DDP or U251/G, the miR-106a-NC groups were U87/DDP or U251/G cells transfected with negative miRNA control inhibitors, and the miR-106a -inhibitor groups were U87/DDP or U251/G cells transfected with miR-106a inhibitors. [score:7]
The expression of GST-π in U87/DDP and U251/G cells was higher than in U87 and U251 cells, respectively, but the expression of GST-π in miR-106a -inhibited U87/DDP and U251/G cells was significantly decreased. [score:7]
CDX2 positively regulates the expression of MDR1/P-gp, and miR-106a also enhanced the expression of CDX2. [score:6]
The c-Myc-regulated microRNA-17~92 (miR-17~92) and miR-106a~363 clusters target hCYP19A1 and hGCM1 to inhibit human trophoblast differentiation. [score:6]
However, the expression levels of MDR1 and MRP1 both decreased in miR-106a -inhibited U87/DDP and U251/G cells. [score:5]
MiR-106a inhibitors and negative miRNA control inhibitors were from RiboBio (China). [score:5]
We examined the expression of CDX2 and found that its expression decreased in miR-106a-silenced U87/DDP and U251/G cells. [score:5]
We found that inhibiting miR-106a significantly decreased the expression of ERCC1 in both U87/DDP and U251/G cells to the level of the corresponding control group. [score:5]
In addition, the expression of RhoE decreased after inhibiting miR-106a (Fig 5). [score:5]
Expression of miR-106a was significantly decreased in miR-106a -inhibited glioma cell lines. [score:5]
MiR-106a inhibition also decreased the expression of Topo-II in both U87/DDP and U251/G cells (Fig 3B). [score:4]
Furthermore, P-gp (P-glycoprotein) was more commonly referred to MDR1, which plays an important role in drug disposition and distribution, the flow cytometry assay result showed that the expression of P-gp decreased on the surface of both groups of miR-106a -inhibited cells (Fig 4). [score:4]
In this study, we found that miR-106a increased the expression of ERCC1, indicating that miR-106a also plays an important role in the regulation of the DNA repair pathway. [score:4]
In this study, we found that miR-106a positively regulates the expression of GST-π, indicating that miR-106a can reduce drug cytotoxicity by enhancing the detoxification capability of cells through GST-π. [score:4]
MiR-106a inhibition significantly decreased the expression of these proteins in both U87/DDP and U251/G cells. [score:4]
2011; 89: 1037– 1050. doi: 10.1007/s00109-011-0775-x 21656380 12Wang Z, Wang B, Shi Y, Xu C, Xiao HL, Ma LN, et al. Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2. Oncogene. [score:4]
The above results indicate that miR-106a may enhance the detoxification capacity of cells by positively regulating GST-π expression, leading to drug resistance. [score:4]
The drug sensitivity of both U87/DDP and U251/G cells was significantly enhanced (48.3 μM and 5.8 μM, respectively) after inhibiting miR-106a (Fig 2). [score:3]
We found that the intracellular content of rhodamine 123 decreased in both miR-106a -inhibited U87/DDP and U251/G cells, indicating that miR-106a enhances cell efflux. [score:3]
Abnormal expression of miR-106a was detected in gastric cancer, colon cancer and esophageal cancer. [score:3]
Values are presented as the mean ± SD, n = 5. The expression of miR-106a in human glioma U87, U87/DDP, U251 and U251/G cell lines. [score:3]
We next explored the effect of miR-106a on the expression of ERCC1. [score:3]
Our results showed that miR-106a inhibition reduced IL-1β, IL-6, IL-8 and TGF-β production, indicating that miR-106a may contribute to tumor cell drug resistance by promoting the production of these cytokines (Fig 6). [score:3]
0125473.g001 Fig 1The expression of miR-106a in human glioma U87, U87/DDP, U251 and U251/G cell lines. [score:3]
Cells were transfected with a miR-106a inhibitor or the corresponding control using Lipofectamine RNAiMAX (Invitrogen Life Technologies) according to the manufacturer’s instructions. [score:3]
Therefore, miR-106a may achieve its anti-apoptotic effect by increasing the expression of these two proteins. [score:3]
We found that miR-106a also increased the expression of RhoE and Topo-II. [score:3]
After miR-106a inhibition, the apoptosis rate of U251/G cells was significantly increased to a level similar to that of the U251 cells. [score:3]
After miR-106a inhibition, the transcription of NF- κB, Twist, AP-1 and Snail all decreased (Fig 7). [score:3]
To explore the role of miR-106a in tumor cell drug resistance, we detected the expression of miR-106a in normal U87 cells and the cisplatin-resistant cell line U87/DDP, as well as in normal and gefitinib-resistant U251 cells (U251/G, see Materials and Methodology for construction method). [score:3]
The expression of miR-106a in different human glioma cell lines. [score:3]
The effect of miR-106a on the expression of drug resistance-related genes in human glioma cell lines. [score:3]
0125473.g005 Fig 5(A) The effect of miR-106a on the protein expression of MDR1, MRP1, CDX2, GST-π, ERCC1 and RhoE in U87 and U87/DDP or U251 and U251/G cells. [score:3]
MiR-106a increased the expression of MDR1/P-gp and MRP1 and increased the cell efflux capacity of the tumor cells. [score:2]
In conclusion, this study revealed that miR-106a played an important role in the development of drug resistance to cisplatin and gefitinib in glioma. [score:2]
However, the role of miR-106a in tumor development remains controversial. [score:2]
These results indicate that miR-106a plays an important role in promoting the development of drug resistance in tumor cells. [score:2]
After miR-106a knockdown, the drug sensitivity of cells to cisplatin and gefitinib significantly increased. [score:2]
MiR-106a promotes drug efflux and enhances cell detoxification and DNA repair by promoting the expression of drug resistance-related genes. [score:2]
MiR-106a is aberrantly expressed in gastric cancer, esophageal cancer, glioma and colorectal cancer [15– 17]. [score:2]
This study explored the role of miR-106a in the development of resistance to cisplatin and gefitinib in glioma cells. [score:2]
MiR-106a inhibits chemotherapeutic drug -mediated apoptosis. [score:2]
However, after miR-106a knockdown, the p-AKT level in these two cell lines significantly decreased. [score:2]
As shown in Fig 3A, the apoptosis rate of miR-106a -inhibited U87/DDP cells was significantly increased compared with that of the control group. [score:2]
At the same time, miR-106a can also enhance the production of IL-1β, IL-6, IL-8 and TGF- β, and thus affect the tumor microenvironment to contribute to the development of drug resistance. [score:2]
As shown in Fig 1, the realtime PCR assay showed that miR-106a expression was significantly increased in both the cisplatin-resistant cell line and the gefitinib-resistant cell line. [score:2]
Values are presented as the mean ± SD, n = 5. (B) The effect of miR-106a on cisplatin drug sensitivity of U251 and U251/G cells. [score:1]
We found that miR-106a enhanced tumor cell resistance to both cisplatin and gefitinib. [score:1]
MiR-106a regulates a variety of functions, such as cell proliferation, tumor invasion and metastasis [10– 11]. [score:1]
0125473.g002 Fig 2 (A) The effect of miR-106a on cisplatin drug sensitivity of U87 and U87/DDP cells. [score:1]
0125473.g003 Fig 3(A) The effect of miR-106a on the apoptosis of U87 and U87/DDP or U251 and U251/G cells. [score:1]
0125473.g006 Fig 6(A) The effect of miR-106a on the production of IL-6, IL-8 and TGF-β in U87 and U87/DDP cells. [score:1]
We examined the effect of miR-106a on key proteins in the primary tumor signaling pathway. [score:1]
The effect of miR-106a on cytokine production in human glioma cell lines. [score:1]
The effect of miR-106a on the drug efflux of human glioma cell lines. [score:1]
The effect of miR-106a on the apoptosis of human glioma cell lines. [score:1]
0125473.g007 Fig 7(A) The effect of miR-106a on the phosphorylation of AKT in U87 and A549U87/DDP or U251 and U251/G cells. [score:1]
Although previous studies confirmed an important role for miR-106a in cancer [12], its effect on chemotherapeutic drug resistance in glioma has not yet been reported. [score:1]
These results indicate that miR-106a can enhance the DNA repair capacity of the tumor cells. [score:1]
We hypothesized that miR-106a mediates drug resistance through promoting drug efflux from tumor cells. [score:1]
0125473.g004 Fig 4(A) The effect of miR-106a on the intra-cellular Rh-123 content in U87 and U87/DDP or U251 and U251/G cells. [score:1]
The effect of miR-106a on drug resistance-related signaling molecules in human glioma cell lines. [score:1]
The results indicate that miR-106a can positively activate tumor cell transcriptional signaling pathways. [score:1]
In this study, the role of miR-106a in drug resistance in glioma was examined. [score:1]
In addition, the results of this study indicate that miR-106a activates important oncogenic signaling pathways. [score:1]
Values are presented as the mean ± SD, n = 5. To examine the mechanism of miR-106a -mediated changes on drug sensitivity in tumor cells, we studied the effect of miR-106a on drug -mediated apoptosis. [score:1]
The effect of miR-106a on cisplatin drug sensitivity in human glioma cell lines. [score:1]
[1 to 20 of 68 sentences]
3
[+] score: 178
Other miRNAs from this paper: hsa-mir-222, hsa-mir-106b, hsa-mir-3940
CXCL1 secreted by hAdSCs downregulated miR-106a expression in triple negative breast cancer, and resulted in ABCG2 upregulation and doxorubicin resistance. [score:9]
c of miR-106a inhibitor (5 or 50 nM) dose -dependently increased ABCG2 protein expression in MDA-MB-231 cells, and the effect of doxorubicin -induced cell death was antagonized by transfection of 50 nM miR-106a inhibitor but not negative control inhibitor (d). [score:9]
Ab CXCL1 neutralizing antibody, CM conditioned medium, con control, doxo doxorubicin, hAdSCs human adipose-derived stem cells, IgG isotype control antibody, inh miR-106a inhibitor, NC negative control inhibitor MSCs make themselves ideal candidates as a therapeutic tool in several diseases by acting as an immunosuppressant [30]. [score:9]
Moreover, neutralizing CXCL1 in hAdSCs’ CM by CXCL1 neutralizing antibody reversed the alteration of miR-106 expression back to 0.80 ± 0.08-fold of control, while hAdSCs’ CM with or without isotype control IgG antibody downregulated miR-106a expression to 0.47 ± 0.06-fold and 0.50 ± 0.07-fold of control, respectively (Fig.   6b). [score:8]
According to our findings, hAdSCs’ CM reduced the expression of miR-106a, and the inhibition of miR-106a resulted in ABCG2 upregulation and reduced doxorubicin sensitivity. [score:8]
In pancreatic cancer, miR-106a expression is elevated and has an oncogenic role by promoting cell proliferation, epithelial-mesenchymal transition and invasion by targeting tissue inhibitors of metalloproteinase 2 (TIMP-2) [57]. [score:7]
Furthermore, transfection of miR-106a inhibitor dose -dependently increased ABCG2 protein expression up to 3.20 ± 0.42-fold of control at 50 nM in MDA-MB-231 cells, while negative control inhibitor did not demonstrate significant alteration (Fig.   6c). [score:7]
In paclitaxel-resistant ovarian cancer, miR-106a is upregulated and downregulates numerous pro-apoptotic genes [56]. [score:7]
On the other hand, only miR-106a have ABCG2 as a predicted target among 25 downregulated miRNAs in DIANA-microT-CDS v. 5 [29]. [score:6]
Fas-activated serine/threonine kinase as a direct target of miR-106a inhibits cell proliferation and migration [59]. [score:6]
In order to further correlate CXCL1 in enhancing ABCG2 expression demonstrated in Fig.   4, we examined the expression of miR-106a under human recombinant CXCL1 treatment herein. [score:5]
By real-time PCR analysis, human recombinant CXCL1 dose -dependently decreased miR-106a expression in MDA-MB-231 cells (a), and neutralizing CXCL1 by CXCL1 neutralizing antibody reversed the expression of miR-106a which was reduced by hAdSCs’ CM (b). [score:5]
Zhi F, Zhou G, Shao N, Xia X, Shi Y, Wang Q, Zhang Y, Wang R, Xue L, Wang S, et al. miR-106a-5p inhibits the proliferation and migration of astrocytoma cells and promotes apoptosis by targeting FASTK. [score:5]
Ab CXCL1 neutralizing antibody, CM conditioned medium, con control, doxo doxorubicin, hAdSCs human adipose-derived stem cells, IgG isotype control antibody, inh miR-106a inhibitor, NC negative control inhibitor We have taken the peri-foci adipose tissues and extracted hAdSCs from breast cancer patients receiving breast mastectomy. [score:5]
These data implicated that CXCL1 secreted by hAdSCs reduced miR-106a expression in MDA-MB-231 cells, and consequently led to increased ABCG2 expression and diminished doxorubicin sensitivity. [score:5]
In TargetScanHuman v. 7.1 database [28], miR-106a-5p, miR-3656, miR-3940-5p, miR-6087, miR-4792, and miR-222-3p had been predicted to have ABCG2 as a target. [score:5]
CXCL1 released by hAdSCs altered miR-106a expression and contributed to enhanced ABCG2 expression and doxorubicin resistance. [score:5]
As shown in Fig.   6d, while transfection of negative control inhibitor resulted in 0.47 ± 0.05-fold of control cell viability reduced by doxorubicin, transfection of 50 nM miR-106a inhibitors increased cell viability back to 0.75 ± 0.05-fold of control. [score:5]
As a tumor suppressor, miR-106a decrease glucose uptake and ATP production by affecting the expression of SLC2A3 [58]. [score:5]
In conclusion, our findings suggest that CXCL1 secreted by hAdSCs elicits doxorubicin resistance through miR-106a -mediated ABCG2 upregulation in triple negative breast cancer. [score:4]
It has also been reported that downregulation of miR-106a in astrocytes is associated with poor prognosis. [score:4]
Our findings suggest that CXCL1 secreted by hAdSCs elicits doxorubicin resistance through miR-106a -mediated ABCG2 upregulation in triple negative breast cancer. [score:4]
CXCL1 at 10 ng/ml reduced miR-106a expression downed to 0.22 ± 0.06-fold of control. [score:3]
In addition, transfection of miR-106a inhibitor also reduced doxorubicin sensitivity. [score:3]
c Real-time PCR validation of hAdSCs’ CM-decreased miR-106a expression in MDA-MB-231 cells. [score:3]
MiR-106a has been reported as both tumor suppressor and oncomiR [19, 20]. [score:3]
CM conditioned medium, DMEM Dulbecco’s modified Eagle’s medium, hAdSCs human adipose-derived stem cells As shown in Fig.   5c, hAdSCs’ CM reduced the expression of miR-106a. [score:3]
On the other hand, miR-106a has been recognized as a tumor suppressor rather than an oncomiR in brain tumors [20]. [score:3]
Cells were transiently transfected with miRCURY LNA inhibitor of has-miR-106a-5p or negative control (Exiqon, Woburn, MA, USA) by Lipofectamine 2000 (LF2000, Thermo Fisher Scientific, Waltham, MA, USA). [score:3]
Herein, we suggest that miR-106a acts as tumor suppressor by eliciting chemoresistance in TNBC. [score:3]
To normalize the expression levels of miRNA-106a, U6 was used as internal control. [score:3]
By real-time PCR analysis shown in Fig.   5c, hAdSCs’ CM decreased miR-106a expression to 0.47 ± 0.12-fold of control. [score:3]
We found that CXCL1 (1–10 ng/ml) dose -dependently decreased miR-106a expression in MDA-MB-231 cells (Fig.   6a). [score:3]
Furthermore, microarray analysis also identified the role of miR-106a in regulating doxorubicin sensitivity. [score:2]
MiR-106a is significantly downregulated in gliomas compared with normal tissues, and decreases more markedly in high-grade gliomas than low-grade gliomas. [score:2]
A total of 10 ng RNA was reverse-transcribed by Universal cDNA Synthesis Kit II (Exiqon, Woburn, MA, USA), and miRNA expression was examined in final volumes of 10 μl using ExiLent SYBR Green Master Mix (Exiqon, Woburn, MA, USA) and LNA PCR primer sets (both U6 and has-miR-106a-5p were from Exiqon, Woburn, MA, USA). [score:2]
The role of miR-106a in cancer remains controversial and there is limited evidence linking miR-106a to chemotherapeutic responses. [score:1]
Given the controversial roles of miR-106a, we investigated the potential association of their expression levels in hAdSCs -induced chemoresistance in TNBC. [score:1]
It has been reported that the level of miR-106a is significantly higher in gastric and colorectal cancer than in adjacent normal tissues and serves as a promising biomarker [19]. [score:1]
Therefore, miR-106a-5p were chosen for further validation. [score:1]
The sequence of negative control was 5’-TAACACGTCTATACGCCCA-3’ and has-miR-106a-5p was 5’-TACCTGCACTGTAAGCACTTTT-3’. [score:1]
The role of miR-106a is complex and still debatable. [score:1]
[1 to 20 of 42 sentences]
4
[+] score: 167
Other miRNAs from this paper: hsa-mir-106b
Over -expression of miR-106a, down-regulated SLC2A3 expression via targeting 3′UTR of SLC2A3, resulted in cell proliferation and cell glycolysis inhibition in GBM cells. [score:12]
MiR-106a was up-regulated in gastric carcinoma [10], colorectal cancer [11] and mantle cell lymphoma [12], whereas down-regulated in glioma. [score:6]
It was also revealed that miR-106a increased p53 expression via E2F1 inhibition, whereas the effect of miR-106a on the proliferation of glioma cells was independent of p53 status. [score:5]
showed that a marked reduction of SLC2A3 expression was observed after over -expression of miR-106a both in U251 and LN229 cells (Figure  2B). [score:5]
Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a -mediated cell glycolysis and proliferation. [score:5]
Also we found that miR-106a expression was negatively associated with SLC2A3 expression in 465 GBMs of TCGA (R = −0.1392, P = 0.0026). [score:5]
In conclusion, we have shown that miR-106a is one of the tumor suppressor miRNAs and SLC2A3 is a novel and critical target of miR-106a in GBM. [score:5]
Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. [score:5]
SLC2A3 is a direct target of miR-106a. [score:4]
Western blot assay showed that transfection with SLC2A3 plasmid without 3′UTR abrogated SLC2A3 expression targeted by miR-106a (Figure  6A). [score:4]
MiR-106a suppressed cell proliferation and induced cell apoptosis in glioma cells by targeting E2F1 [7]. [score:4]
By further transfecting with SLC2A3 without 3′UTR and miR-106a, expression of SLC2A3 largely overrode the effect of miR-106a on cell glycolysis and proliferation (Figure  6B-D). [score:3]
miRNA target bioinformatics analysis showed that SLC2A3 contained the highly conserved putative miR-106a binding sites (Figure  2A). [score:3]
Having demonstrated SLC2A3 as a target of miR-106a, we next examined the importance of SLC2A3 in miR-106a -mediated cell glycolysis and proliferation. [score:3]
Over-expressed miR-106a resulted in a significant decrease of glucose uptake and ATP production in U251 and LN229 cells (Figure  5B and C). [score:3]
MiR-106a is frequently down-regulated in various types of human cancer. [score:3]
MiR-106a was significantly down-regulated in human high grade glioma tissues [6]. [score:3]
These data indicate that the cases with lower miR-106a expression have a markedly worse outcome. [score:3]
Figure 2 SLC2A3 is a target gene of miR-106a. [score:3]
In our study, we also showed that SLC2A3 was over-expressed in high grade glioma tissues, and repression SLC2A3 abrogated miR-106a -mediated cell proliferation and glucose uptake in GBM cells. [score:3]
Figure 6 Expression of SLC2A3 abrogates miR-106a -mediated glycolysis and proliferation. [score:3]
We further explored the correlation between miR-106a and SLC2A3 expression in gliomas. [score:3]
In this study, we found that miR-106a was a tumor suppressor miRNA associated with GBM outcome, consistent with previous data [7, 13]. [score:3]
We also found miR-106a expression was significantly lower in U87 and LN229 cells (Additional file 3: Figure S2). [score:3]
GBM samples expressing lower level of miR-106a were associated with decreased survival relative to those with higher level (P = 0.008). [score:3]
miR-106a expression was significantly lower in U87 and LN229 cells. [score:3]
These findings suggest that SLC2A3 is a major functional target of miR-106a involved in glioma cell glycolysis and proliferation. [score:3]
To explore miR-106a expression in gliomas, we examined 19 human glioma specimens and 3 normal brain tissues using Real time PCR. [score:3]
SLC2A3 was identified as a core target of miR-106a in GBM cells. [score:3]
Further, miR-106a was significantly down-regulated in high grade gliomas compared to that of low grade gliomas (P < 0.05). [score:3]
Correlation analysis revealed that a significant negative correlation existed between miR-106a and SLC2A3 expression (R = −0.7465, P < 0.0001) (Figure  3B). [score:3]
Finally, the expression of SLC2A3 largely abrogated miR-106a -mediated cell proliferation and glucose uptake in GBM cells. [score:3]
These results suggest that miR-106a and SLC2A3 might be useful as a potential therapeutic target for GBM and more in-depth analyses are required in the future. [score:3]
Click here for file miR-106a expression was significantly lower in U87 and LN229 cells. [score:3]
To determine SLC2A3 -mediated effects of miR-106a on glioma cell proliferation, we first analyzed which genes were associated with cell proliferation and correlated with SLC2A3 expression in glioma. [score:3]
Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. [score:3]
MiR-106a inhibited GBM cell proliferation and glucose uptake by repressing SLC2A3. [score:2]
To determine whether miR-106a up-regulation affected glioma cell glycolysis, glucose uptake and intracellular ATP production were evaluated. [score:2]
Recent studies have shown that miR-106a has played important roles in the development and progression of human tumors. [score:2]
MiR-106 inhibits glioma cell proliferation. [score:2]
MiR-106a inhibits glioma cell glucose uptake. [score:2]
The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). [score:2]
To determine whether SLC2A3 was directly regulated by miR-106a, and luciferase reporter assay were performed. [score:2]
Decreased miR-106a and increased SLC2A3 indicated a poor survival of GBM patients. [score:1]
Next we investigated the correlation between miR-106a expression and overall survival through Kaplan-Meier survival curve analysis with a log-rank comparison. [score:1]
Functional role of SLC2A3 in miR-106a -mediated cell glycolysis and proliferation. [score:1]
Thus, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM treatment. [score:1]
The association of miR-106a with glioma grade and patient survival was analyzed. [score:1]
SLC2A3 is inversely correlated with miR-106a and GBM survival. [score:1]
In our present work, we showed the function and mechanism of miR-106a involved in glioblastoma (GBM). [score:1]
Furthermore, miR-106a treated cells represented significant ascends in G0/G1 phase in comparison to untreated cells (Figure  4C). [score:1]
Next, miR-106a induction significantly reduced cellular proliferation in U251 and LN229 cells (Figure  4B). [score:1]
To our knowledge, this is the first time to show the glycolysis function of miR-106a. [score:1]
Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM. [score:1]
Decreased miR-106a confers a poor prognosis in GBMs. [score:1]
Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. [score:1]
MUT- SLC2A3-3′UTR plasmids were generated from WT-SLC2A3-3′UTR by deleting the binding site for miR-106a “CACUUU”. [score:1]
Real-time quantification of hsa-miR-106a was performed by stem-loop RT-PCR. [score:1]
However the underlying mechanism of miR-106a involved in glioma remains elusive. [score:1]
Figure 1. (A) Real time PCR was employed to measure the expression of miR-106a in glioma specimens and normal tissues. [score:1]
As shown in Figure  1A, the levels of miR-106a decreased markedly in glioma in comparison to normal tissues (P < 0.01). [score:1]
[1 to 20 of 61 sentences]
5
[+] score: 146
PTEN, BCL2L11, and CXCL14 were identified as direct target genes of miR-106a in podocyte, suggesting miR-106a may regulate podocyte apoptosis by negatively regulating target genes. [score:8]
We found overexpression of miR-106a in podocytes resulted in the downregulation of mRNA and protein levels of PTEN, BCL2L11, and CXCL14 (Fig.   7a, b), while miR-106a had no effect on the expression of CASP7 and COL1A2 in podocytes. [score:8]
However, above reports did not show the reduced plasma expression of miR-17, miR-451, miR-106a, and miR-19b in disease groups, suggesting the downregulation of four-miRNA panel is specific for FSGS and may be involved in the pathogenesis of FSGS. [score:8]
Wang Z miR-106a is frequently upregulated in gastric cancer and inhibits the extrinsic apoptotic pathway by targeting FASMol. [score:8]
On the one hand, the downregulation of miRNAs such as miR-106a can result in the enhanced apoptosis of podocyte through targeting PTEN and BCL2L11, leading to the loss of podocyte and development of FSGS. [score:7]
b The protein expression analysis of target genes by western blotting in miR-106a or miR-control transfected human podocytes. [score:5]
Prediction of pathways co-regulated by four-miRNA panel and identification of targets of miR-106a in human podocyte during FSGS development. [score:5]
Fig. 7 a The relative mRNA expression of target genes in miR-106a or miR-control transfected human podocytes. [score:5]
a-d The expression of miR-17, miR-451, miR-106a, and miR-19b between in FSGS patients (n = 74) and in other chronic kidney diseases including 69 IgAN patients, 24 MSPGN patients, and 26 MN patients. [score:5]
Overexpression of miR-106a suppresses the apoptosis of human podocytes in vitro. [score:5]
Figure  5c showed miR-17, miR-451, and miR-106a were significantly downregulated in FSGS with proteinuria (n = 56) when compared with FSGS patients who were in remission (urinary protein <400 mg/24 h after treatment) (n = 18), whereas the expression of miR-19b did not differ in above two groups. [score:5]
Consistent with RT-PCR results, ISH results showed miR-106a was significantly downregulated in FSGS tissues compared with normal renal tissues (Figure  S5). [score:3]
The complementary 75-mer DNA oligonucleotides of CXCL14 3′-UTR sequence containing the putative miR-106a target sites were synthesized with flanking Spe I and Hind III restriction enzyme digestion sites (sense: 5′-CTAGTGGGCCCGACACAAATTATATATTGTTATGAAGCACTTTTTACCAACGGTCAGTTTTTACATTTTATAGCA-3′; antisense: 5′-AGCTTGCTATAAAATGTAAAAACTGACCGTTGGTAAAAAGTGCTTCATAACAATATATAATTTGTGTCGGGCCCA-3′). [score:3]
In this study, we found the expression of the three-miRNA panel, including miR-17, miR-451, and miR-106a was associated with complete remission of FSGS. [score:3]
Fig. 4 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
We found that miR-106a was not only expressed in podocytes, but also in other cell types, including endothelial cells, mesangial cells, and kidney tubules. [score:3]
Chen L MicroRNA-106a regulates phosphatase and tensin homologue expression and promotes the proliferation and invasion of ovarian cancer cellsOncol. [score:3]
Fig. 3 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
Above data suggest that miR-106a can suppress podocyte apoptosis in vitro. [score:3]
Among the four miRNAs, we selected miR-106a as a representative for identification of targets. [score:3]
Firstly, we confirmed the expression of miR-106a in FSGS patients via in situ hybridization (ISH). [score:3]
We found overexpression of miR-106a in human podocytes led to enhanced apoptosis. [score:3]
Since PTEN has been reported to be potent target of miR-106a [16], and miRTarBase database provided experimental evidences to support miR-106a:BCL2L11 interaction (detailed information is showed in the following link: http://mirtarbase. [score:3]
The efficacy of miR-106a overexpression was confirmed by RT-PCR (Figure  S6). [score:3]
Here, we found four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were significantly downregulated in FSGS compared with healthy controls. [score:3]
a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
A schematic of the study outlining the independent patients and samples used in discovery, training, validation, and blinded-test phases of the identification of plasma-miRNA panel for FSGS miRNA profiling in plasma from five FSGS patients and five healthy controls was performed by using a real-time PCR -based high-throughput miRNA array a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
Flow cytometry results showed that miR-106a overexpression led to reduced apoptosis rate in podocytes (Fig.   8b). [score:3]
MiR-106a suppresses podocyte apoptosis in vitro. [score:2]
results showed that the levels of miR-17, miR-451, miR-106a, and miR-19b were the lowest in FSGS patients compared with healthy controls and disease controls. [score:2]
Digoxigenin (DIG)-labeled RNA probes for miR-106a-5p were purchased from Pengekiphen (Suzhou, China). [score:1]
ROC curve analysis showed that miR-17 had AUC of 0.65 (95% CI, 0.50–0.80), miR-451 had AUC of 0.66 (95% CI, 0.50–0.81), and miR-106a had AUC of 0.69 (95% CI, 0.53–0.85) (Fig.   5d). [score:1]
miR-17, miR-451, and miR-106a were related to FSGS remission. [score:1]
Cells were co -transfected with the wild-type or mutant luciferase reporter vector (200 ng/well), and pRL-TK (10 ng/well) (Promega, Madison, WI, USA), and miR-106a mimics or miR-control (50 nM). [score:1]
b Human podocyte cells were transfected with miR-106a or miR-control. [score:1]
As a result, four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were the ones which fulfilled above criteria and then selected for further validation. [score:1]
As shown in Fig.   3b, the areas under ROC curves (AUCs) of miR-17, miR-451, miR-106a, and miR-19b were 0.66 (95% confidence interval (CI), 0.52–0.80), 0.66 (95% CI, 0.51–0.80), 0.70 (95% CI, 0.56–0.84), and 0.72 (95% CI, 0.59–0.86), respectively. [score:1]
A three-miRNA panel, including miR-17, miR-451, and miR-106a had AUC of 0.71 (95% CI, 0.55–0.86) (P  < 0.01) (Fig.   5e). [score:1]
Human podocytes were transfected with miR-106a mimics or miR-control (RIBOBIO) at a concentration of 50 nM. [score:1]
e ROC analysis of three-miRNA panel including miR-17, miR-451, and miR-106a for discriminating FSGS remission. [score:1]
Among the identified four miRNAs, we selected miR-106a as a representative for further functional study. [score:1]
c Wild-type or mutant binding sites of CXCL14 3′-UTR for miR-106a. [score:1]
As shown in Fig.   5b, the plasma levels of miR-17, miR-19b, and miR-106a were significantly lower in combined variants group than in NOS, tip lesion, or perihilar groups. [score:1]
Logistic regression demonstrated that a linear combination of values for miR-17, miR-451, miR-106a, and miR-19b produced the best mo del for FSGS diagnosis. [score:1]
The relative luciferase activity was reduced by miR-106a in the vector containing the CXCL14 3′-UTR. [score:1]
d HEK293 cells were transiently co -transfected with luciferase report vectors containing wild-type or mutant CXCL14 3′-UTR, and either miR-106a mimics or miR-control. [score:1]
For example, significant positive correlations were found between miR-17 and miR-451, and between miR-106a and miR-19b plasma levels, with correlation coefficient values of 0.773 and 0.843, respectively (P  < 0.001) (Figure  S3). [score:1]
One study in experimental animal mo del has found miR-17 and miR-106a were activated during the maintenance and recovery phases of renal ischemia-reperfusion injury [23]. [score:1]
The fold changes in miR-17, miR-451, miR-106a, and miR-19b were 0.55, 0.56, 0.59, and 0.55, respectively (Fig.   3a). [score:1]
Then we transiently transfected miR-106a mimics or miRNA control into human podocyte cell line. [score:1]
However, miR-106a had no effect on mutant vectors (Fig.   7d). [score:1]
ROC curve analysis showed that miR-17 had AUC of 0.61 (95% CI, 0.51–0.72), miR-451 had AUC of 0.76 (95% CI, 0.67–0.85), miR-106a had AUC of 0.64 (95% CI, 0.54–0.74), and miR-19b had AUC of 0.72 (95% CI, 0.62–0.82) (Fig.   4b). [score:1]
[1 to 20 of 52 sentences]
6
[+] score: 98
Furthermore, the expression levels of the PDCD4 protein in the OVCAR3/CIS cells that were transfected with the miR-106a inhibitor were significantly increased compared with that of the OVCAR3/CIS cells that were transfected with the control inhibitor (P<0.05; Fig. 3B and C). [score:6]
However, it remains unclear whether the downregulation of PDCD4 induced by the overexpression of miR-106a is involved in the resistance of the OVCAR3 cells to CDDP. [score:6]
In summary, the present study demonstrated that the enhancement of miR-106a expression contributes to the generation of CDDP-resistant ovarian cancer cells, partly by targeting PDCD4. [score:5]
Numerous miR-106a targets have been predicted by TargetScan, including PDCD4. [score:5]
Conversely, transfection with 100 pmol miR-106a inhibitors effectively reduced miR-106a expression and resulted in a significantly lower survival rate in the OVCAR3/CIS cell lines (Fig. 2C and D). [score:5]
The results provide evidence that miR-106a may potentially be used as a predictor of the chemotherapy response in ovarian cancer and is a promising therapeutic target in the treatment of this disease. [score:5]
Furthermore, knockdown of PDCD4 significantly increased the cell survival rate and had an overall effect that was similar to miR-106a overexpression. [score:4]
Conversely, the expression levels of the PDCD4 protein in the OVCAR3 cells that were transfected with the miR-106a mimic were significantly increased compared with that of the OVCAR3 cells that were transfected with the control inhibitor (P<0.05; Fig. 3D and E). [score:4]
Knockdown of miR-106a enhanced CDDP chemosensitivity in the CDDP-resistant OVCR3/CDDP cells, while the ectopic expression of miR-106a caused the OVCR3 cells to be resistant to CDDP -induced apoptosis. [score:4]
The present study investigated miR-106a expression in CDDP-resistant ovarian cancer cells and the effect of miR-106a downregulation on CDDP chemosensitivity in an ovarian cancer cell line by inducing apoptosis enhancement. [score:4]
Yang et al investigated miRNA expression profiles in cisplatin (CDDP)-resistant ovarian cancer cells and identified that miR-106a was upregulated in CDDP-resistant ovarian cancer cells (10). [score:4]
To directly test the correlation between miR-106a and CDDP resistance in the ovarian cancer cells, miR-106a expression was functionally changed using mimics and inhibitors in vitro, and subsequently, the resulting alterations of the drug sensitivity were evaluated by the MTT assay. [score:3]
PDCD4 is a target of miR-106a. [score:3]
To analyze the miR-106a expression levels, RNA was extracted from the cells. [score:3]
The overexpression of miR-106a was associated with the significantly increased survival rate of the OVCAR3 cells (Fig. 2B). [score:3]
The expression levels of miR-106a in the OVCAR3 and OVCAR3/CIS cells were detected using stem-loop qRT-PCR. [score:3]
To the best of our knowledge, this is the first study to describe an association between miR-106a, PDCD4 expression and drug resistance in CDDP -treated OVCR3 cells. [score:3]
The expression levels of miR-106a were normalized with reference to the expression levels of U6 snRNA, and the fold changes were calculated by relative quantification (2 [−ΔΔCt]) (13). [score:3]
org/) was used to computationally predict the targets of miR-106a. [score:3]
miR-106a may be used as a valid therapeutic target in strategies that employ novel multimodality therapies for patients with ovarian cancer. [score:3]
As shown in Fig. 3A, transfection of the miR-106a mimics in the OVCAR3 cells with the WT 3′-UTR (pLuc-PDCD4 3′-UTR-wild) vector significantly decreased the luciferase activity compared with the control inhibitor (P<0.05). [score:2]
These results indicated that miR-106a may play a crucial role in the development of CDDP resistance in epithelial ovarian cancer. [score:2]
All these data indicated that PDCD4 was post-transcriptionally regulated by miR-106a in the OVCAR3 cells. [score:2]
It was shown that miR-106a had an average 2.63-fold higher expression level in the OVCAR3/CIS cells compared with the OVCAR3 cells (P<0.05; Fig. 1E). [score:2]
In response to transfection with 100 pmol miR-106a mimics, the expression level of miR-106a in the OVCAR3 cells was increased 7.8-fold compared with the NC (Fig. 2A). [score:2]
The present study identified that miR-106a was overexpressed 2.7-fold in the CDDP-resistant OVCR3/CIS cells compared with the corresponding CDDP-sensitive parental cell line, and the subsequent qRT-PCR experiment confirmed this result. [score:2]
However, transfection of the miR-106a mimics in the OVCAR3 cells with the mutant 3′-UTR (pLuc-PDCD4 3′-UTR-mut) vector showed no effect on luciferase activity compared with the control inhibitor (P>0.05). [score:2]
The transfection of the miR-106a mimic, miR-106a antisense oligonucleotide (ASO) or negative control (NC) oligonucleotide was performed using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) in antibiotic-free Opti-MEM (Invitrogen) according to the manufacturer’s instructions. [score:1]
Correlation between miR-106a and CDDP resistance in ovarian cancer cells. [score:1]
org/) and the potential binding site of miR-106a (position 854–860) was predicted to be the PDCD4 3′-UTR. [score:1]
However, to the best of our knowledge, there have been no studies with regard to the mechanism of miR-106a modulating the sensitivity of ovarian cancer cells to CDDP. [score:1]
The OVCAR3/CIS cells were transfected with either the miR-106a ASO or an NC, and were subsequently incubated with various doses of CDDP. [score:1]
[1 to 20 of 32 sentences]
7
[+] score: 92
Therefore we tested mir-520c, we observed that mir-520c over -expression significantly decreased luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or a reporter carrying a seed-region mutant of the putative mir-106a target site (Figure 1B). [score:8]
The mir-106a target oligos had the sequence (seed region bolded): 5' CTAGTAATCCCTGTTCATTGTAA GCACTTTTGCTCAGCA 3' 3' ATTAGGGACAAGTAACATT CGTGAAAACGAGTCGTTCGA 5' The mutant mir-106a target oligos had nucleotides three through six of the seed region mutated (italicized): 5' CTAGTAATCCCTGTTCATTGTAAGC GTCCTTGCTCAGCA 3' 3' ATTAGGGACAAGTAACATTCG CAGGAACGAGTCGTTCGA 5' We utilized established methods [21] to clone these synthetic versions of putative miRNA target sites into a luciferase reporter gene (pMIR-REPORT; Ambion). [score:7]
Having demonstrated that over -expression of mir-106a or mir-520c was capable of repressing reporter gene expression via interaction with its putative target site, we investigated whether over -expression of these miRNAs could decrease endogenous APP levels in human cell lines. [score:7]
The mir-106a target oligos had the sequence (seed region bolded):5' CTAGTAATCCCTGTTCATTGTAA GCACTTTTGCTCAGCA 3'3' ATTAGGGACAAGTAACATT CGTGAAAACGAGTCGTTCGA 5' The mutant mir-106a target oligos had nucleotides three through six of the seed region mutated (italicized):5' CTAGTAATCCCTGTTCATTGTAAGC GTCCTTGCTCAGCA 3'3' ATTAGGGACAAGTAACATTCG CAGGAACGAGTCGTTCGA 5'We utilized established methods [21] to clone these synthetic versions of putative miRNA target sites into a luciferase reporter gene (pMIR-REPORT; Ambion). [score:7]
To determine if the putative mir-106a target site in the APP 3'UTR is capable of regulating gene expression, we cloned it into the 3' UTR of firefly luciferase. [score:6]
We observed a significant ~50% decrease (p < 0.0001) in luciferase activity when the putative mir-106a target site was included in the reporter compared to either a reporter lacking the putative target site or reporter carrying a seed-region mutant of the putative mir-106a target site. [score:6]
Figure 1 mir-106a target sequence regulates reporter gene expression. [score:6]
To experimentally confirm that APP levels can be regulated by miRNAs, we chose to initially study miRNA hsa-mir-106a (mir-106a; Figure 1A) since (i) the putative target site in the APP 3'UTR is 100% complementary to the seed region of the miRNA, (ii) it has a large free energy of seed region binding, and (iii) it is expressed in human brain [13]. [score:6]
Mir-106a and mir-520c, therefore, appear to inhibit translation of the APP transcript. [score:5]
APP [770 ]and APP [751 ]levels are reduced in cells over -expressing (A) mir-106a compared to cells expressing either mir-125b or the empty vector and (B) mir-520c compared to cells expressing the empty vector. [score:5]
Another miRNA, mir-520c, shares the same seed region target sequence as mir-106a but is not expressed in human brain (Figure 1A) [13]. [score:5]
All APP isoforms (APP [695], APP [751 ]and APP [770]) share the same 3' UTR [18] therefore we expect that the mir-106a mediated regulation of APP levels that we observe in the HEK-293 cell line should also occur in neurons given that mir-106a is expressed in the brain. [score:4]
To confirm that the miRNAs were being over-expressed, we utilized RT-QPCR to quantify miRNA levels and observed significant increases in both mir106a and mir-520c (Table 1) levels (p < 0.0001). [score:3]
We transfected naïve HEK-293 with mir-106a and mir-125b over -expression vectors and then performed quantitative Western blot analysis to determine APP steady state levels. [score:3]
Over -expression of mir-520c had a similar effect on APP levels as mir-106a (Figure 2B and 2D). [score:3]
Over -expression of mir-106a or mir-520c had no effect on APP mRNA levels (Figure 2E). [score:3]
We observed that mir-106a over -expression significantly decreased APP levels (Figure 2A). [score:3]
Figure 2 mir-106a and mir-520c can regulate APP levels post-transcriptionally. [score:2]
Mir-106a over -expression reduced APP levels by ~50% (p < 0.01) compared to cells transfected with the empty vector (Figure 2C). [score:1]
We co -transfected this reporter into naïve HEK-293 cells along with a mir-106a over -expression vector [14] and measured luciferase activity (Figure 1B). [score:1]
This reduction is not observed when a seed region mutant of mir-106a (106a*) is utilized. [score:1]
[1 to 20 of 21 sentences]
8
[+] score: 79
We showed that MAPK1 (ERK2, a potential target of miR-143), MAPK8 (JNK1, a demonstrated target of miR-455-3p), MAPK9 (JNK2, a demonstrated target of miR-17, miR-20b, and miR-106a), and p21 and RB (potential targets of miR-17 and miR-106a) were strongly upregulated at protein level upon inhibition of the miRNAs. [score:14]
Because the expression of the miR-17 family is directly controlled by the proto-oncogene MYC [32]– [34] and because we have recently demonstrated (7) that in human keratinocytes lacking p63, MYC expression is down regulated, the down-regulation of miR-17, miR-20, miR-106a, miR-143 and miR-455-3p genes we observed in keratinocytes lacking p63 could be due to MYC down-regulation. [score:13]
Using luciferase::3′UTR reporter constructs we further confirmed that MAPK9 was a direct target of miR-17, miR-20b, and miR-106a, since inhibitors of these miRNAs increased luciferase activity (Figure 4G), while mimic of the miR-17 family, on the contrary, inhibited the reporter activity (Figure S1B). [score:8]
It is noteworthy that RB was up-regulated upon either miR-17 (2.72 fold, Figure 4B) or miR-106a depletion (4.31 fold, Figure 4F) and we observed that the double knockdown of these genes restored the expression of K1 and K10. [score:7]
The strongest up-regulation of K1 and K10 was observed in MAPK1 and miR-106a double knockdown cells (Figure 5E). [score:5]
Among other conditions only the double knockdown of miR-106a and RB led to moderate restoration of K1 and K10 expression (Figure 5E). [score:4]
We found that miR-17, miR-20b and miR-106a were strongly downregulated in keratinocytes lacking p63. [score:4]
0045761.g004 Figure 4(A, C, and E) Expression levels of miR-17 (A), miR-20b (C), and miR-106a (E) in double knockdown of miRNAs and of their targets was systematically measured by RT-qPCR. [score:4]
Our study demonstrated that p63-regulated miR-17 and miR-106a could target RB and p21. [score:4]
We also demonstrated that LIMK1 was not a direct target of miR-17, miR-20b, or miR-106a (Figure 4H). [score:4]
The following miRNA inhibitors (LNA) were obtained from Exiqon: hsa-miR-143 (138515-00), hsa-miR-455-3p (138667-00), hsa-miR-30a (138468-00), hsa-miR-17 (138461-00), hsa-miR-20b (138221-00), hsa-miR-106a (138477-00), and hsa-miR-18 (138462-00), and scramble miR (199002-04) was used as a negative control. [score:3]
Based on their level of expression in human primary keratinocytes in culture (data not shown) and their biological relevance, we chose several potential candidates from our list: miR-17, miR-18a, miR-20b, miR-30a, miR-106a, miR-143 and miR-455-3p. [score:3]
Finally, MAPK1, p21, LIMK1, RB, and MAPK9 were all up regulated upon silencing of miR-106a (Figure 4E, 4F). [score:2]
In this study, we have characterized multiple miRNAs, including the mir-17 family (miR-17, miR-20b, miR-106a) and miR-30a, miR-143 and miR-455-3p, which are downregulated in p63-silenced keratinocytes, suggesting that they act downstream of p63. [score:2]
MiR-17, miR-20b and miR-106a belong to the miR-17 family. [score:1]
Similar experiments were performed with miR-106a. [score:1]
[1 to 20 of 16 sentences]
9
[+] score: 70
The aims of the present study were to: 1) perform a systematic investigation of the expression of ten candidate miRNAs (miR-22, miR-24, miR-31, miR-106a, miR-125b, miR-137, miR-205, miR-214, miR-221, miR-410) in human HF samples; 2) correlate these data with corresponding HF mRNA expression levels; and 3) test the identified target genes for enrichment in pathways and protein networks in order to delineate regulatory interactions in the human HF. [score:6]
Expression in the human HF was confirmed for seven of the ten candidate miRNAs, and numerous target genes for miR-24, miR-31, and miR-106a were identified. [score:5]
In the miRWalk2.0 [12] and TargetScan7.0 [13] analyses, 40%, 62%, and 42% respectively of the identified target genes for miR-24, miR-31 and miR-106a were not predicted by either tool. [score:5]
Significantly correlated target genes of miR-24, miR-31, miR-106a, and miR-221. [score:3]
The largest overlap in target genes was detected for miR-31 and miR-106a (n = 29). [score:3]
MiR-24 and miR-106a shared a total of 21 target genes. [score:3]
No overlap was found for miR-221 and the three remaining miRNAs In the investigation of a potential enrichment of miRNA target genes in biological pathways, IPA revealed the strongest enrichment of the respective target genes in ‘Hepatic Fibrosis/Hepatic Stellate Cell Activation’ (miR-24), and ‘JAK/STAT Signalling’ (miR-31 and miR-106a). [score:3]
Although none of the 53 identified target genes of miR-106a have yet been associated with MPB, two building blocks of the desmosome - Plakophilin 3 (PKP3) and Desmocollin 1 (DSC1), are reported to play a role in HF morphogenesis [35]. [score:3]
For miR-24, miR-31, and miR-106a several target genes and pathways of interest were identified (Table  1). [score:3]
Significant correlation between miRNA and mRNA expression was observed for miR-24, miR-31, miR-106a, and miR-221. [score:3]
Intriguingly, ten of the identified target genes were shared between miR-31, miR-24, and miR-106a, suggesting that they may be critical points in the signalling cascades that control HF biology. [score:3]
A further study reported, a differential expression for four miRNAs (miR-106a, miR-410, miR-221, miR-125b) in dermal papilla cells (DPCs) from the balding and non-balding scalp areas of eight patients with male pattern baldness (MPB) [7]. [score:3]
PPIs of significantly correlated target genes a miR-24; b miR-106a; and c miR-31. [score:3]
In the PANTHER analysis, ‘Integrin Signalling’ was the top pathway for the target genes of miR-24, miR-31 and miR-106a. [score:3]
The present analyses therefore provide strong support for the hypothesis that miR-106a contributes to MPB development via WNT signalling and that the regulation of cell-cell adhesion may be an important factor in MPB. [score:3]
Fig. 1Overview of all target genes with a significant correlation to miR-24, miR-31, and miR-106a. [score:3]
The largest overlap was found between target genes of miR-31 and miR-106a (n = 29). [score:3]
MiR-31, miR-24 (i. e., miR-24-3p, miR-24-2-5p), and miR-106a shared the following ten target genes: FZD7, JUN, MEIS2, TAX1BP3, RBM17, SFRP1, TP63, SMARCA4, COL17A1, and ZCCHC11. [score:3]
The third miRNA to show significant mRNA correlations in the present analyses, miR-106a, is reported to be upregulated in the balding, as compared to the non-balding, DPCs of males with MPB, which suggests that it may be implicated in MPB pathobiology [7]. [score:3]
Prediction of significantly correlated target genes of miR-24, miR-31, miR-106a, and miR-221. [score:3]
MiR-106a expression was correlated with a total of 53 genes (29 neg. [score:2]
Ten genes (FZD7, JUN, MEIS2, TAX1BP3, RBM17, SFRP1, TP63, ZCCHC11, COL17A1, SMARCA4) were significantly correlated with miR-24, miR-31, and miR-106a (Fig.   1, Additional file 1: Table S1). [score:1]
[1 to 20 of 22 sentences]
10
[+] score: 59
Lastly, AML differentiation causes downregulation of microRNA-106a, allowing for the expression of its target ULK1. [score:8]
Based on a miRNA profiling study that identified the miR-17 and miR-181 family members as the most downregulated miRNAs during neutrophil differentiation of NB4 APL cells [52], and our study identifying ULK1 as a novel target of the miR-17 family member miR-106a in lung cancer therapy [53], we hypothesized that this miRNA also targets ULK1 in AML. [score:8]
Accordingly, using an anti-miR-106a construct, we found that blocking miR-106a resulted in increased protein expression of ULK1 during ATRA treatment whereas overexpression of miR-106a resulted in markedly reduced ULK1 expression (Figure 6(f)). [score:7]
Our studies clearly indicate that ULK1 is functional in neutrophil differentiation of AML cells and that it is targeted by the oncogenic miR-106a, providing a possible explanation for low ULK1 expression levels in AML. [score:5]
The expression of the known miR-106a target p21 [CIP1], a gene induced during neutrophil differentiation, was determined as a positive control for the functionality of the miR-106a vector used (Figure 6(d)). [score:5]
Accordingly, preliminary data indicate that low ULK1 expression is associated with increased miR-106a expression in a small cohort of AML patient samples. [score:5]
1, or in the case of ULK1, by increased expression of its negative regulator miR-106a. [score:4]
Ectopic expression of miR-106a in NB4 cells is shown in Figure 6(e). [score:3]
We also showed that miR-106a targets the important autophagy gene ULK1 in AML. [score:3]
Jasmin Batliner identified ULK1 as miR-106a target in AML differentiation. [score:3]
Lastly, our preliminary data indicate that ULK1 mRNA is negatively associated with miR-106a expression in a cohort of 16 primary AML patient samples (Figure 6(g)). [score:3]
Posttranscriptional Regulation of ULK1 by miR-106a during AML Differentiation. [score:2]
Moreover, miR-106a expression prevented ULK1 induction upon ATRA -induced differentiation of NB4 paralleled by impaired neutrophil differentiation as seen by significantly reduced induction of CEBPE mRNA compared to control transduced cells (Figures 6(b) and 6(c)). [score:2]
miRNA expression was assessed using the miScript SYBR Green PCR kit and primer assay hsa-miR-106a (Qiagen). [score:1]
[1 to 20 of 14 sentences]
11
[+] score: 45
Left panel: linc-NeD125 expression in D283 Med cells transfected with LNA inhibitors targeting miR-19a, miR-19b and miR-106a (LNA miRs, gray bar) or with scrambled LNA (LNA CTRL, white bar). [score:7]
We demonstrate that, when expressed at the high levels found in G4 MBs, linc-NeD125 functions as a competing endogenous RNA (ceRNA) that, sequestering miR-19a-3p, miR-19b-3p, and mir-106a-5p, de-represses the expression of their targets CDK6, MYCN, SNCAIP and KDM6A, major driver genes of G4 MB. [score:7]
Their ectopic expression had no effect on the levels of miR-19a-3p, miR-19b-3p, or miR-106a-5p (Supplementary Figure 2), indicating that linc-NeD125 does not regulate their abundance [15]. [score:4]
Linc-NeD125 functions as a natural miRNA sponge, competitively binding and sequestering three endogenous miRNAs—miR-19a-3p, miR-19b-3p and miR-106a-5p—whose targets include CDK6, MYCN, SNCAIP, and KDM6A transcripts (Figure 8). [score:3]
Given the high expression levels of miR-19a-3p, miR-19b-3p and miR-106a-5p in D283 Med cells (Figure 2E), miRNA loss-of-function experiments were performed. [score:3]
As shown in Figure 2B, only miR-19a-3p, miR-19b-3p, and miR-106a-5p were significantly overexpressed in tumour specimens, with 2- to 4-fold increases over control levels. [score:3]
Collectively, these results demonstrate that linc-NeD125 controls the in vitro expression of four genes known to drive G4 MB, i. e. CDK6, MYCN, SNCAIP, and KDM6A, by competing with their transcripts for binding to miR-19a-3p, miR-19b-3p and miR-106a-5p. [score:3]
miR-19a-3p, miR-19b-3p and miR-106a-5p repress G4 MB driver gene expression. [score:3]
Effects of miR-19a-3p, miR-19b-3p, miR-106a-5p inhibition on D283 Med cell properties. [score:3]
Linc-Ned125 de-represses G4 MB driver gene expression by sequestering miR-19a-3p, miR-19b-3p, and miR-106a-5p. [score:3]
Right panel: number and positions of miR-19a-3p, miR-19b-3p, miR-106a-5p, miR-191a-5p MREs on linc-NeD125 sequence. [score:1]
Interaction of miR-19a-3p, miR-19b-3p and miR-106a-5p with G4 driver genes. [score:1]
Middle panel: Western blot analysis of five G4 MB driver gene protein products in D283 Med cells transfected with LNAs against miR-19a, miR-19b, miR-106a (LNA miRs) or with scrambled LNA (LNA CTRL). [score:1]
The same tool was used to eliminate 2 of the 6 miRNAs that could bind the pull-down bait, leaving a short list of 4 miRNAs—namely miR-19a-3p, miR-19b-3p, miR-106a-5p and miR-191-5p—which are specifically bound by linc-NeD125 (Figure 1D, right panel). [score:1]
Among those, we found that the microRNAs bound by linc-NeD125, miR-19a-3p, miR-19b-3p and miR-106a-5p, were predicted to pleiotropically repress five G4 driver genes (Figure 2C). [score:1]
To verify the specificity of miRNA-linc-NeD125 interaction, we cloned the wild type and mutant linc-NeD125 into luciferase reporter vectors (Figure 4A, left panel) and transfected them into D283 Med cells, along with the LNAs complementary to miR-19a-3p, miR-19b-3p, and miR-106a-5p. [score:1]
[1 to 20 of 16 sentences]
12
[+] score: 33
P-values for chosen candidates were as follows: miR-17(1.92E [−09]), miR-18a(2.62E [−09]), miR-29c(4.71E [−09]), miR-106a(1.84E [−08]), miR-135a(8.26E [−09]), miR-135b(1.99E [−08]), miR-221(9.19E [−05]), miR-222(2.04E [−05]) (see Supporting Table S2) Expression profiles of these candidates can be found in Figure 2. Three out of eight miRNAs exhibited decreasing expression during brain development (miR-17, miR-18a (belonging to the same cluster), miR-106a) [24]. [score:6]
MiR-17, miR-18 and miR-106a showed up to 19, 28 and 21 fold change differences in expression in F50 versus adult tissue, with the highest level of expression observed at F50, independent of the brain tissue type (Figure 4). [score:5]
A number of miRNAs including the entire miR-17/92 cluster (with miR-17 and miR-18a being particularly significant), as well as the miR-106a/363 cluster, excluding miR-19b-2 and miR-92a-2 (with miR-106a and miR-18b having the lowest p-values), exhibited decreasing expression throughout development. [score:4]
MiR-17 and miR-106a play a role in the regulation of amyloid precursor protein (APP), which is known to be involved in familial Alzheimer's disease. [score:4]
The same predicted targets were found for miR-17 and miR-106a. [score:3]
It could be considered that miRNAs which were highly expressed in fetal tissue might be involved in the development and growth of a particular region of the brain, such as the frontal cortex or cerebellum (e. g. miR-17, miR-18 or miR-106a). [score:3]
Numerous developmental stage or tissue-specific microRNAs including, miR-17, miR-18a, miR-29c, miR-106a, miR-135a and b, miR-221 and miR-222 were found by microarray analysis. [score:2]
Furthermore, a strong correlation between miR-17, miR-106a and APP has been observed in differentiating neurons and during brain development [32]. [score:2]
The first group included miR-17, miR-18a and miR-106a. [score:1]
The correlation coefficient values (R [2]) for particular miRNAs include: miR-17 (R [2] = 0.84), miR-18a (R [2] = 0.94), miR-29c (R [2] = 0.92), miR-106a (R [2] = 0.81) and miR-135a (R [2] = 0.89) miR-135b (R [2] = 0.95), miR-221 (R [2] = 0.91) and miR-222 (R [2] = 0.88). [score:1]
Interestingly, miR-17, miR-18a and miR-106a belong to the same miRNA family. [score:1]
Eight different candidate miRNAs: hsa-miR-17, hsa-miR-18a, hsa-miR-29c, hsa-miR-106a, hsa-miR-135a hsa-miR-135b, hsa-miR-221 hsa-miR-222 and two reference miRNAs: hsa-miR-103 and hsa-miR-191 were profiled by. [score:1]
[1 to 20 of 12 sentences]
13
[+] score: 33
Target onco/tumor suppressor genes Type of cancer Colon lung pancreas prostate APC 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a EP300 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a DNMT1 17-5p, 32, 106a MSH3 17-5p, 20a, 106a RB1 17-5p, 20a, 106a HOXB4 17-5p, 20a, 106a RECK 21, 106a, 155 ETV1 17-5p, 20a,106a SYT7 17-5p, 20a,106a EGR1 191, 32, 106a PTEN 17-5p, 21, 20a,106a MCL1 17-5p, 32, 20a,106a STAT3 17-5p, 21, 20a,106a Table should be read in this way: APC is a target gene of miR-17-5p, miR-32, miR-20a and miR-106a and this gene is involved in colon and pancreatic cancer Another important observation from Figure 2 is that all the miRNAs except miR-155 and miR-24-2 are overexpressed in colon, pancreatic and prostate cancer. [score:9]
Target onco/tumor suppressor genes Type of cancer Colon lung pancreas prostate APC 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a EP300 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a DNMT1 17-5p, 32, 106a MSH3 17-5p, 20a, 106a RB1 17-5p, 20a, 106a HOXB4 17-5p, 20a, 106a RECK 21, 106a, 155 ETV1 17-5p, 20a,106a SYT7 17-5p, 20a,106a EGR1 191, 32, 106a PTEN 17-5p, 21, 20a,106a MCL1 17-5p, 32, 20a,106a STAT3 17-5p, 21, 20a,106a Table should be read in this way: APC is a target gene of miR-17-5p, miR-32, miR-20a and miR-106a and this gene is involved in colon and pancreatic cancerAnother important observation from Figure 2 is that all the miRNAs except miR-155 and miR-24-2 are overexpressed in colon, pancreatic and prostate cancer. [score:9]
Patients with high expression of either miR-155, miR-17-3p, miR-106a, miR-93 or miR-21 and low expression of either let-7a-2, let-7b or miR-145 were found to have a significantly worse prognosis. [score:5]
For example, APC is involved in colon and pancreatic cancer and it is a predicted target of miR-17-5p, miR-32, miR-20a and miR-106a. [score:3]
EP300 is involved in colon and pancreatic cancer (predicted target of miR-17-5p, miR-32, miR-20a and miR-106a), and so on. [score:3]
A univariate Cox proportional hazard regression mo del with global permutation test in BRB-Array-Tools indicated that eight miRNAs (miR-155, miR-17-3p, miR-106a, miR-93, let-7a-2, miR-145, let-7b, and miR-21) were related to the adenocarcinoma patients survival. [score:2]
It has been observed that miR-32, miR-29b-2, miR-21, miR-20a, miR-191, miR-17-5p, miR-106a, miR-155 and miR-24-2 all have significant dysregulation in lung, colon and pancreatic cancer cell line. [score:2]
[1 to 20 of 7 sentences]
14
[+] score: 31
Next, we overexpressed miR-106a-5p, miR-106b-5p, and miR-17-5p, separately, and detected whether the three miRNAs could downregulate the expression of ATAD2 in K1 and TPC1 cells. [score:8]
NEAT1_2 functions as a competing endogenous RNA to regulate ATAD2 expression and promotes PTC progression by sponging miR-106b-5p a Relative expression levels of miR-106a-5p, miR-106b-5p, and miR-17-5p were detected by qRT-PCR in PTC cells transfected with si-NEAT1_2 or NC. [score:6]
Neither miR-106a-5p nor miR-17-5p could downregulate the expression of ATAD2 (Supplementary Figure  2). [score:6]
Among these 28 miRNAs, qRT-PCR indicated that miR-106a-5p, miR-106b-5p, and miR-17-5p were upregulated in PTC cells transfected with si-NEAT1_2 compared with the NC group. [score:3]
Fig. 6 a Relative expression levels of miR-106a-5p, miR-106b-5p, and miR-17-5p were detected by qRT-PCR in PTC cells transfected with si-NEAT1_2 or NC. [score:3]
We found that miR-106a-5p, miR-106b-5p, and miR-17-5p were significantly highly expressed in the NEAT1_2 knockdown group compared with their levels in the NC group (Fig.   6a). [score:3]
Thus, miR-106-5p was speculated to be the miRNA that binds to both NEAT1_2 and the 3′ UTR of ATAD2. [score:1]
The sequence was si-NEAT1_2 (sense): 5′-GGA GGA GUC AGG AGG AAU AUU-3′, si-ATAD2 (sense): 5′-GGA CCA AGA AGU CCU UAC UTT-3′, miR-106b mimic (sense) 5′-UAA AGU GCU GAC AGU GCA GAU-3′, miR-106a mimic (sense) 5′-AAA AGU GCU UAC AGU GCA GGU AG-3′, miR-17-5p mimic (sense) 5′-CAA AGU GCU UAC AGU GCA GGU AG-3′. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 30
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20b
Because bioinformatic analysis of the 3′-UTR of the TF transcript suggests that TF expression may be regulated by miR-19a, miR-20b, and miR-106a, we investigated the potential of these miRNAs to regulate TF expression in G-M cells and trophoblasts differentiated from hESCs and found that miR-20b mimics inhibited TF expression in these cells, but did not disturb the differentiation process because the expression of G-M cell-specific marker gene PU. [score:11]
miRNA mimics and inhibitors for miR-19a, miR-20b, and miR-106a were purchased from GenePharma Co. [score:3]
Louis, Missouri, USA) and then transfected with 2 μg TF-3′-UTR or mutant plasmid DNA with 100 nM inhibitors or 100 nM mimics of miR-19a, miR-20b, or miR-106a mixed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:3]
Surprisingly, the expressions of miR-20b and miR-106a were significantly higher in hESCs than in HSPCs, G-M cells, and trophoblasts. [score:3]
Similarly, reverse transcriptase PCR for TF mRNA and western blotting for TF protein also showed that TF expression in G-M cells or trophoblasts was reduced by miR-20b mimics, but not by miR-19a or miR-106a mimics (Figure  4C). [score:3]
Figure 3 miR-19a, miR-20b, and miR-106a expression in hematopoietic cells and trophoblasts derived from human embryonic stem cells. [score:3]
We therefore asked whether miR-19a, miR-20b or miR-106a mimics could alter TF expression in G-M cells and trophoblasts using the TF-3′-UTR reporter assay, TF mRNA, and TF protein analysis. [score:2]
DNA analysis shows that there are miRNA -binding sites for miR-19a, miR-20b, and miR-106a in the 3′-UTR of the TF mRNA transcript. [score:1]
In the 3′-UTR of TF mRNA, there are binding sites for miR-19a, miR-20b, and miR-106a (Figure  1). [score:1]
[1 to 20 of 9 sentences]
16
[+] score: 27
Hsa-miR-106a-5p has been reported to target BMP groups, thus inhibiting the cells from osteogenesis 27. [score:5]
Among these mRNAs, ARID4B are cell cycle inhibitors 29, and the elevated expression of hsa-miR-106a-5p suggests that it enables cell proliferation in DPSCs. [score:5]
Next is has-miR-106a (developed from has-miR-106b), which regulates a diverse range of mRNA related to transcription regulators such as ZBTB7A, enzyme such as MYLIP and kinase such as BMPR2, MICA and ARID4B. [score:3]
Hence, in DPSCs, hsa-miR-106a-5p is predicted to suppress PKD2 to enable cell proliferation. [score:3]
However, in DPSCs, the hsa-miR-106a-5p could suppress the response of this gene and allow proliferation rather than differentiation. [score:3]
In DPSCs, hsa-miR-106a-5p probably suppresses the BAMB1 and could instead play the antagonistic role. [score:3]
The other gene that is regulated by hsa-miR-106a-5p is MICA, which is known to activate natural killer receptor and induce immune surveillance in cancer cells 36. [score:2]
The computational data also predicted that hsa-miR-106a-5p is connected to various mRNAs such as ARID4B, ZBTB7A, BAMB1, PKD2, BMPR2, MYLIP and MICA. [score:1]
The miRNAs are namely hsa-miR-516a-3p, hsa-miR-125b, hsa-miR-190a, hsa-miR-106a and hsa-miR-584-5p. [score:1]
Hsa-miR-106a-5p also reacts to PKD2, which allows calcium influx 34 into cells that would trigger maturing of cells into specialized functions. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 26
The best score was obtained for 3 miRNA seeds, corresponding to miRNAs that are expressed higher in the embryonic liver (miR-106a, miR-18a and miR-574-3p), and for which the predicted targets expression displays a negative correlation. [score:7]
Comparison of the expression of regulated miRNAs and their cognate-predicted targets in our arrays revealed significant anti-correlation only for specific regulated miRNAs, which we grouped into two: miRNAs that are enriched in the embryonic liver, including miR-106a, miR-18a and miR-574-3p, and miRNAs that are enriched in the adult liver, including let-7a and c, miR-23b and miR-22. [score:7]
miR-106a has oncogenic activity in humans [42] and upregulation of miR-18a expression is associated with poor prognosis of serous ovarian cells [43]. [score:6]
As for the possible roles of these miRNAs during liver development; while miR-574-3p's role has not yet been studied, miR-106a and miR-18a belong to the oncogenic clusters, miR-106a-363 and miR-17-92, and may regulate cell cycle and apoptosis in the embryonic liver. [score:3]
In summary, the miRNA seeds that achieved the best scores in terms of anti-correlation with their predicted target genes are presented, and correspond to miRNAs let-7a, let-7b, let-7c, miR-22, and miR-23b, for adult liver-enriched miRNAs (Table 2), and miR-106a, miR-18a and miR-574-3p, for embryonic liver-enriched miRNAs (Table 3). [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 26
Expression changes were also validated by q-RT-PCR for seven miRNAs: 5 up-regulated (hsa-miR-21, hsa-miR-29a, hsa-miR-29b, hsa-miR-221 and hsa-miR-222) and 2 down-regulated (hsa-miR-93 and hsa-miR-106a) (Figure 3B-H). [score:9]
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
In addition, eight of the down-regulated miRNAs belong to the three paralog clusters miR-17/92, miR-106a/363 and miR-106b/25, while three of the up-regulated miRNAs are part of the miR-23/24 paralog clusters. [score:7]
Validation of the differential expression of miR-29a (B), miR-29b (C), miR-221 (D), miR-222 (E), miR-21 (F), miR-93 (G) and miR-106a (H) was carried out by q-RT-PCR using specific TaqMan microRNA assays, normalizing their expression values with respect to RNU6B levels and to the NS state by calculating 2 [-ΔΔCt]. [score:2]
[1 to 20 of 4 sentences]
19
[+] score: 24
We were able to predict several important targets of miR-106a using miRanda, PicTar and TargetScan, namely the microtubule -associated protein MAP7, which is predominantly expressed in cells of epithelial origin and is essential for cell polarization and differentiation, the early growth response protein EGR2, the BCL2L2 protein, which is an anti-apoptotic member of the BCL2 protein family, the mitogen-activated protein kinase MAPK9, the oncogene MYCN, as well as the tumour suppressor gene TP53INP. [score:9]
Among the miRNAs that were down-regulated between normal and pre-neoplasic cervical samples, but had increased expression in cervical cancer samples, were miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p. [score:6]
Six miRNAs displayed relative decreased expression in the transition from normal cervix to atypical dysplasia and increased expression in the transition from atypical dysplasia to cervical carcinoma, namely miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p (Figure 4B). [score:5]
This may suggest that miR-106a may play an important role during the initial stages of atypical growth by targeting proteins involved in cell growth and proliferation rather than being directly involved in cervical carcinogenesis, depending on its cellular concentration. [score:4]
[1 to 20 of 4 sentences]
20
[+] score: 23
MiR-106a inhibits glioma cell growth by targeting E2F1 independent of p53 status. [score:4]
Among miRNAs encoded by the miR-106a-363 cluster only miR-106a is expressed at detectable levels in E10 cells. [score:3]
Likewise, the more potent anti-proliferative miR-20b decreased expression miR-19a and miR-93 (Figures 6C, 7C) as well as increasing the level of miR-106a by about 60% (Figure 8C); changes consistent with an anti-proliferative effect (Qin et al., 2010; Fang et al., 2011). [score:3]
Our preliminary studies had revealed that, among members of the miR-106a-363 cluster, only miR-106a was detectable in human cultured squamous carcinoma cells (clone E10), while all sibling miRNAs from the paralogous cluster were expressed. [score:3]
Similarly, the level of expression of pri-miR-106a (3′-end) was 0.0003 ± 0.00006, while that of pri-miR-92a-2 (3′-end) was not detectable in any of the samples assayed (also in HTC116 and HT29 cells, results not shown). [score:2]
An anti-proliferative effect has previously been observed for miR-19a (Qin et al., 2010), miR-106a (Yang et al., 2011) and miR-363-3p (Sun et al., 2013). [score:1]
Only miR-19b, miR-20b, miR-92a, and miR-106a were detectable in these cells. [score:1]
This likely explains why only miR-106a is detected in E10 cells. [score:1]
The miR-17-92 cluster, located on human chromosome 13, encodes six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. The miR-106a-363 cluster, located on human chromosome X, encodes six miRNAs: miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. [score:1]
presented in Figure 2 suggest that the significantly decreased cell densities observed with transfectants for mimic of miR-19a, miR-20b -, mir-106a, miR-363-3p -, and miR-363-5p were caused by diminished proliferation. [score:1]
The levels of expression of hsa-pri-miR-17, hsa-pri-miR-92a-1, hsa-pri-miR-106b, hsa-pri-miR-25, hsa-pri-miR-106a, and hsa-pri-miR-92a-2 were measured in E10 cells after transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:1]
Therefore, miR-20b and miR-106a may be the only mature microRNAs exclusively originating from the miR-106a-363 transcript. [score:1]
Transfection with miR-20b mimic led to 60% increase in the level of mirNA-106a (Figure 8C), while in cells transfected miR-19a mimic the level of miR-20b was increased 4-fold (Figure 8D) in agreement with microarray results (Figure 3). [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 23
hy926 cells Not shown HIF1A Angiogenesis[123] miR-200b HMVECs Downregulated upregulated ETS1 Angiogenesis hypoxia[135, 136] HUVECs KLF2 miR-210 HUVECs Upregulated EFNA3 Angiogenesis hypoxia[131, 132, 150] HIF3A miR-424 HUVECs, hMVECs, hBOECs and hMBECs Upregulated CUL2 Angiogenesis[137] HIF1A* miR-429 HUVECs Upregulated HIF1A Hypoxia[12, 109] HIF3A miR-433 HUVECs Downregulated HIF1A Proliferation and migration[138] miRNAs proven to directly bind HIF mRNAs are in bold, and indirect effects are marked with “*” ARNT aryl hydrocarbon receptor nuclear translocator, CUL2 cullin-2, EFNA3 ephrin A3, EGLN1 prolyl hydroxylase domain-containing protein 2 (PHD2), ETS1 ETS Proto-Oncogene 1, Transcription Factor, HIF1A hypoxia-inducible factor 1-alpha, HIF1AN hypoxia-inducible factor 1-alpha inhibitor, HIF3A hypoxia-inducible factor 3 alpha, KLF2 Kruppel-like factor 2 The miR-17 family includes miR-17, miR-18a/b miR-20a/b, miR-93 and miR-106a/b. [score:23]
[1 to 20 of 1 sentences]
22
[+] score: 22
MicroRNA-106a is also closely related to ovarian development; some studies have shown that downregulation of the expression of microRNA-106a inhibits cell growth and metastasis of ovarian cancer cells [32]. [score:9]
The results predicted that microRNA-24, microRNA-106a, microRNA-19b and microRNA-25 may be closely related to apoptosis; n = 3. Table 1 Predicted target genes analysis of microRNAs expressed in huMSC-EXOs. [score:5]
Hao, H. et al. miR-106a suppresses tumor cells death in colorectal cancer through targeting ATG7. [score:5]
Chen, X. H., Ling, X. M. & Shi, S. microRNA-106a induces the proliferation and apoptosis of glioma cells through regulating JNK/MAPK pathway. [score:2]
We predicted that microRNA-24, microRNA-106a, microRNA-19b and microRNA-25 may be closely related to apoptosis. [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 21
[33] Therefore, the underexpression of miR-17/92 cluster members, miR-185-5p and miR-106a/b, and subsequent upregulation of p38α may underlie the observed size reduction of patient-derived neurospheres and the decreased neural differentiation efficiency in patient-derived neurospheres. [score:6]
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
[37] The patient-derived neurospheres showed reduced expression levels of miR-17/92 cluster members and miR-106a/b. [score:3]
[32] As the downstream targets of DGCR8, which may be causally linked to the observed phenotypes, we examined the miR-17/92 cluster and miR-106a/b. [score:3]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[33] The miR-17 family (Figure 3c) includes miR-17 (in the current study, hsa-miR-17-3p showed FC=0.7 and P=0.0449; Supplementary Figures 3a and 3b), miR-20a/b, miR-93 and miR-106a/b. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
This was likely because miR-106a and miR-302-367 cluster directly target TGF-β receptor 2 (TGFBR2) and accelerate the mesenchymal-to-epithelial transition (MET) necessary to induce mouse iPSCs [35, 36]. [score:4]
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 20
Upon treatment of Colo-357 with G2535, the oncogenic miRNAs miR-17, miR-19b-1, miR-20a, miR-106a, miR-200b and miR-221 showed decreased expression and the tumor suppressor miRNAs let-7a, let-7b, let-7c, let-7d, let-7f, let-7i and miR-16-1 showed increased expression. [score:7]
Treatment of Panc-1 with G2535 elicited decreased expression of the oncogenic miRNAs miR-17, miR-20a, miR-106a, miR-222 and increased expression of the tumor suppressor miRNAs let-7a, let-7d, let-7e and let-7f. [score:7]
Upon treatment of Panc-1 with B-DIM, the oncogenic miRNAs miR-17, miR-20a, miR-106a, miR-221, and miR-222 all showed decreased expression. [score:3]
In regards to Colo-357, treatment with B-DIM showed decreased expression of the oncogenic miRNAs miR-17, miR-19b-1, miR-20a and miR-106a. [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 17
Similarly, in embryoid bodies, hypoxia downregulated miRNA clusters- miR-17/92 or its paralogs miR-106a/363 or miR-106b/25 have been shown to be upregulated [33]. [score:7]
The miR-512/519a cluster was highly represented containing 14 upregulated miRNA while 2 members of the miR-17/92 cluster and its paralogs miR-106a/363 and miR-106b/25 showed down-regulation in hypoxic hESCs. [score:7]
A role for HRMs in cytokine expression modulation has also been demonstrated for BMP2 (miR-106b, -20a, and miR-106a), Zinc finger and BTB domain containing 16 or ZBTB16 (miR-1271, miR-342), and Chemokine (C-X-C motif) ligand or CXCL3,6, and 8 (miR-106a/b, -20a, -493 and miR-425) via the HRMs indicated [49, 67, 68]. [score:3]
[1 to 20 of 3 sentences]
27
[+] score: 16
Other miRNAs from this paper: hsa-mir-19a, mmu-mir-106a, mmu-mir-106b, mmu-mir-19a, hsa-mir-106b
LP of 400 mg/kg/day containing 112 mg/kg/day of GSE) via gavage, significantly down-regulated expressions of miR-106 and mRNA of its precursor gene MIR106B, and up-regulated mRNA expression of CDKN1A. [score:11]
Figure 3GSE significantly increased (A) mRNA expressions of CDKN1A and p21 protein production, and miR-106 mimic abrogated such increases in (B) CDKN1A mRNA expression and (C) p21 protein production in A549 cells. [score:5]
[1 to 20 of 2 sentences]
28
[+] score: 16
Up-regulation of miR-20b, a member of the miR-106a cluster located on X chromosome, was also consistently observed in the high c-Myc state and seven putative binding sites in the vicinity of the miR-106a cluster were also identified even though no direct binding between c-Myc and these binding sites has been reported [33]. [score:5]
Among these 54 miRNAs, miR-16, miR-20a, miR-20b, let-7b, miR-17-5p, miR-27a, miR-106a, miR-106b, miR-107, miR-193a, miR-210, miR-320, and miR-361 were predicted to target VEGF. [score:3]
Computational predictions indicated that miR-20a, miR-20b, miR-17-5p, miR-106a, and miR-106b had binding sites in Construct I. With slightly relaxed criteria about free energy and conservation, miR-15b, miR-16, miR-17-5p, miR-20b, and miR-107 have computationally predicted target sites in Construct II reporters (Table 4). [score:3]
To test the specificity of prediction of miRNA target sites, we first did experiments with a luciferase activity assay to test: a) the effects of miR-106a and miR-106b on Construct II; and b) the effects of miR-15b and miR-16 on Construct I. We found that all of these miRNAs showed repression of 20–27% of luciferase activity. [score:2]
This binding site is shared by 12 different miRNAs, according to the bioinformatics prediction, but only miR-17-5p, miR-20a, miR-20b, miR-106a, and miR-106b were detected in DFOM-untreated CNE cells. [score:1]
When the prediction was carried out with miRanda software, RNAhybrid, and FindTar algorithms separately, binding sites for miR-15b and miR-16 on Construct I and miR-106a and miR-106b on Construct II would be detected by one of these algorithms. [score:1]
According to the criteria, no binding sites for miR-15b and miR-16 on Construct I and miR-106a and miR-106b on Construct II were found. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 16
The down-regulation of miR-106a/b (Fig. 2), perhaps with other down-regulated miRNAs (let-7i, miR-15, -26, -29, -93 -101), may favor higher APP levels in AD brains. [score:7]
This validates this target prediction for APP, and is consistent with the fact that miR-106a/b is down-regulated in AD-affected brain [94]. [score:6]
In humans, the over -expression of miR-106a/b was shown to reduce APP protein levels in kidney cells [93, 94]. [score:3]
[1 to 20 of 3 sentences]
30
[+] score: 15
The mitogen-activated protein kinase (MAPK) signaling pathway was associated with the smallest P-value (1.8×10 [−11]) among the pathways targeted by the five miRNAs over-expressed in NPC exosomes, which included hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:5]
E. The identification of five over-expressed miRNAs in P-serum-EXOs/N-serum-EXOs, TW03 (EBV [+])-EXOs/NP69-EXOs, and TW03 (EBV [−])-EXOs/NP69-EXOs: hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:3]
For example, miR-20a-5p, miR-24-3p, and miR-106a-5p converge on MAPK1 and miR-20-5p and miR-106a-50 converge on TAOK3, demonstrating a combinatorial effect of miRNAs on the same target. [score:3]
Five miRNAs, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were commonly over-expressed in the exosomes from P-serum and TW03 (EBV [+]) or TW03 (EBV [−]) cells (Fig. 5E). [score:3]
Our results showed that five exosomal miRNA clusters, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were abundant in NPC tumor-derived exosomes from patient sera or TW03 cell lines versus the exosomes from healthy donor sera or NP69 cells. [score:1]
[1 to 20 of 5 sentences]
31
[+] score: 15
The miRNA miR-106a inhibits the expression of transforming growth factor (TGF)-beta receptor 2 [42]. [score:5]
E2F1 regulates the expression levels of five miRNAs belonging to two genomic miRNA clusters that are very similar to each other (miR-17 ~ 92 and miR-106a ~ 363) [40]. [score:4]
Among the miRNAs associated with positive regulation of the EEF2 gene that showed a significant change in their abundance in plasma samples of patients with lupus nephritis class IV were: hsa-miR-584-5p [48], hsa-miR-589-3p [49], hsa-miR-145-5p [48], hsa-miR-183-5p [48], Hsa-miR-125b-5p [35] and hsa-miR-106a-5p [50]. [score:2]
8 of these miRNAs have been previously associated with the regulation of SLE (hsa-miR-361-3p [26], hsa-miR-145-5p [27], hsa-miR-410-3p [28], hsa-miR-125 [29], hsa-miR-199a-5p [26], hsa-miR-550b-2-5p [5], hsa-miR-106a-5p [30], and hsa-miR-183-5p [31]). [score:2]
Equally, we highlight the presence of an E2F1–miRNA feedback loop mechanism, which can be associated with the pathogenesis of SLE, within which it is the negative feedback mechanism of miR-106a (which showed a low relative abundance log FC = -2.69) on E2F1. [score:1]
We found that miR-106a-5p presented higher numbers of genes that have been experimentally associated with a total of 1,199 genes (S1 Table). [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 15
We validated our microrray results by quantitative RT-PCR on CD5 [+], GC and CD5 [−] activated and resting B cell mRNA samples as shown in Supplementary Figure 3. In fact, we validated 10 different miRNAs: mir-150, mir-20b, mir-23a, mir-211, mir-15b, mir-21, mir-106a, mir-146a, mir-9* and mir-155 whose expression trends by quantitative RT-PCR highlighted the same expression trend shown by microarray analysis. [score:5]
The miRNAs profile comparison between resting and activated B cells showed the up-regulation of 19 miRNA in activated B cells: mir-98, mir-106a, mir-20a, mir-17-5p, mir-20b, mir-16-2, mir-18a, mir-155, mir-21, mir-181d, mir-425-5p, mir-148a, mir-15b, mir-15a, mir-181b mir-181c, mir-181a, mir-130b, mir-148b (Table 3). [score:4]
MiRNAs belonging to the cluster mir-17/92 and the paralogous clusters mir-25/106b and mir-106a/363 showed a similar trend of expression, i. e. mir-17-5p, mir-20a, mir-106a, mir-20b, mir-18a, mir-106a, mir-18b, mir-20b, mir-106b, mir-93 and mir-25 (Cluster 1, Figure 1). [score:3]
Considering all differentially expressed miRNAs, we detected miR-150, miR-361, miR-130b, miR-181b and members of miRNA clusters miR-17-5p, miR-106a, miR-20a and miR-20b as the most variable miRNAs (FDR = 0.0077) (Table 1). [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 14
Moreover, miR-130b [99], miR-301a [100], miR-106a [101], miR-103a [102], miR-495 [103], and miR-532-5p [104] directly inhibit RUNX3 translation at the post-transcriptional level. [score:6]
In addition, increased H3K9 dimethylation and reduced H3 acetylation, as well as the increased miR-130b, miR-301a, miR-106a, miR-103a, miR-495, and miR-532-5p, synergistically inhibited the expression of RUNX3 Numerous studies have demonstrated that H. pylori infection is closely related to abnormal CpG island methylation. [score:5]
In addition, increased H3K9 dimethylation and reduced H3 acetylation, as well as the increased miR-130b, miR-301a, miR-106a, miR-103a, miR-495, and miR-532-5p, synergistically inhibited the expression of RUNX3 The exploitation of characteristic epigenetic alterations during the malignant transformation of gastric mucosa allows for the prevention, diagnosis, treatment, and prognostic evaluation of gastric cancer from a new perspective independent of protein expression. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 14
An increased expression of miR-106/302 family members inhibits the tumor suppressor p21 and rescues human mammary epithelial cells from Ras -induced senescence [14]. [score:7]
The tumor suppressor p21, regulating transition through the cell cycle and acting downstream of p53, has already been associated with hsa-miR520 belonging to the miR-106/302 family [14]. [score:4]
Although detectable, neither miRNA-106b, nor miRNA-106a, miRNA-17-5, miRNA-93, and miRNA-20 were differentially expressed in our mo del. [score:3]
[1 to 20 of 3 sentences]
35
[+] score: 14
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
[1 to 20 of 2 sentences]
36
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Three miRNAs, miR-26b, miR-106a and miR301b, have been demonstrated to regulate HSP70 expression, and were also shown to be significantly increased in Parkinson’s disease patients resulting in aberrant α-synuclein aggregation in Lewy bodies [68]. [score:6]
MicroRNA 106 family members have been shown to regulate some DNA damage response transcripts [27] as well as some mRNAs encoding proteostatic factors [68], whereas the miR-17, miR-19b, miR-20a and miR-106a cluster that regulate cellular senescence have also been shown to regulate moderators of the mTOR nutrient sensing pathway [75]. [score:4]
MicroRNAs miR-17, miR-19b, miR-20a and miR-106a have been shown to target PTEN, which encodes a major silencer of the AKT-mTOR pathway [74]. [score:3]
Other DNA-damage associated miRNAs have also been associated with cellular senescence; the miR17-92 cluster and its paralogues the miR-106a and miR-106b clusters have also been implicated in cell senescence in several tissues and cell types [75, 84]. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
Genes targeted by three of the altered miRNAs were examined: miR-20a regulates E2F1, miR-106a regulates RBI, and miR-127 regulates BCL6. [score:6]
Western blot of mammary gland lysates after 12 wks of E [2] showed that levels of RBI and E2F1 were decreased and BCL6 protein was increased, data that are in agreement with the increase miR-20a and miR-106a and the decrease in miR-127 detected [198]. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 13
As shown in Figure 2, the serum levels of miR-17, miR-20a and miR-106a were significantly elevated in response to virus infection (p < 0.01), consistent with the results from the TaqMan Arrays, while the expression of miR-376c in serum samples of H7N9 patients was slightly higher than that in healthy controls (p < 0.05). [score:3]
66 hsa-miR-511 −4.05 16.61 hsa-miR-26b −4.01 16.15 hsa-miR-210 −4.01 16.15 hsa-miR-489 −3.98 15.78 hsa-miR-22* −3.98 15.74 hsa-miR-15a* −3.97 15.70 hsa-miR-106a −3.92 15.15 hsa-miR-331-5p −3.91 15.04 hsa-miR-194 −3.88 14.73 hsa-miR-139-5p −3.85 14.38 hsa-miR-193a-5p −3.84 14.37 hsa-miR-29a −3.80 13.94 hsa-miR-24 −3.75 13.43 hsa-miR-140-5p −3.71 13.12 hsa-miR-28-3p −3.69 12.91 hsa-miR-151-3p −3.67 12. [score:1]
Four miRNA molecules (miR-17, miR-20a, miR-106a and miR-376c) were selected for validation of the TaqMan Array data in a larger scale population by quantitative RT-PCR. [score:1]
The ROC curves of miR-17, miR-20a and miR-106a showed a moderate distinguishing ability with a corresponding area under the curve (AUC) value of 0.897 (95% CI: 0.818–0.976), 0.825 (95% CI: 0.718–0.933) and 0.898 (95% CI: 0.798–0.998), respectively (Figure 3A–C). [score:1]
Figure 2The serum levels of miR-17, miR-20a, miR-106a and miR-376c were determined by quantitative RT-PCR in individual healthy controls (n = 36) and patients (n = 21). [score:1]
Figure 4 ROC curve for a combination of miR-17, miR-20a, miR-106a and miR-376c was constructed. [score:1]
In summary, we, for the first time, provided an overview of host serum miRNA alterations in response to H7N9 virus infection, as well as identified the diagnostic ability of combined miR-17, miR-20a, miR-106a and miR-376c serum levels, thus promoting our understanding of this emerging virus pathogenesis. [score:1]
Furthermore, miR-17, miR-20a, miR-106a and miR-376c used in this study for the diagnosis of H7N9 virus infection did not overlap with those for enterovirus and H1N1 virus infections, thus indicating high diagnostic specificity of these four miRNAs. [score:1]
MiR-17 (A), miR-20a (B) and miR-106a (C) showed a moderate discriminating efficiency with an AUC value more than 0.8, while miR-376c (D) exhibited a poor diagnostic ability with an AUC value of 0.622. [score:1]
Finally, an important question remains to be answered: whether the serum levels of four miRNAs (miR-17, miR-20a, miR-106a and miR-376c) could be used for discriminating H7N9 virus from other types of viral infections with the same good performance. [score:1]
When the serum levels of these four miRNAs were subjected to combined analysis by multiple logistic regression, the generated ROC curve reflected a higher ability to differentiate patients with H7N9 virus infection from healthy controls (AUC value: 0.96; 95% CI: 0.917–1.000), demonstrating the diagnostic accuracy of miR-17, miR-20a, miR-106a and miR-376c as effective biomarkers in combination (Figure 4). [score:1]
[1 to 20 of 11 sentences]
39
[+] score: 13
miR-106a-5p and miR-181b-5p are two of the most significantly downregulated miRNAs in astrocytomas, and their low expression levels are significantly associated with a poor survival outcome; this observation triggered our interest in investigating their function and their target genes during astrocytoma development. [score:7]
In our recent work, we proved that miR-106a-5p inhibits the proliferation and migration of astrocytoma cells and promotes apoptosis by targeting FASTK [10]. [score:5]
In our previous study, we established a unique molecular diagnostic signature for astrocytomas that included miR-21-5p, miR-24-3p, miR-30c-5p, miR-106a-5p, miR-124-3p, miR-137 and miR-181b-5p [7]. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 12
By applying a combination of various prediction algorithms, we identified the 3′-UTR of c-FOS as a potential target for miR-181a and miR-181b (down-regulated the in EBV -associated lymphomas), CD44 as a potential target of miR-20a and miR-106a, and the IL1R1 as a target of miR-205 and -125a. [score:10]
For the expression of miRNAs miR-125a, -181a, -181b, -106a, -106b, and 17, the following primer pairs were used: 5′miR-125a_EcoCGGAATTCTGGCTCTCAGAATGTCTC-3′, 3′miR-125a_Bam 5′-CGGGATCCGCCATCGTGTGGGTCTCAA-3′; 5′miR-181a-Bam 5′-GCGGATCCTGTGATGTGGAGGTTTGCC; 3′miR-181a-Bgl 5′-GCAGATCTAGTGAGCTTGTCCACACAG-3′; 5′miR-181b-Bam 5′-GCGGATCCCAACGCTGTCGGTGAGTT-3′, 3′miR-181b-Bgl 5′-CAGATCTGCATGGGTGCTGAGGTCCT; 5′miR-17Eco 5′-GGGAATTCCGTGTCTAAATGGACCTC-3′, 3′miR-17-Bam 5′-GGGATCCACAGCATTGCAACCGATCCCAA-3′; 5′miR-106a Eco 5′-GCGAATTCGCTTAGACTCTGTAAGCC-3′, 3′miR-106a-Bam 5′-GGGATCCTACGCTGAAATGCAAACCTGC-3′; 5′miR-106b Eco 5′-GCGAATTCTGGTAAGTGCCCAAATTGCTGG-3′; 3′miR-106b Bam 5′-GGATCCAGCACAGGATCTAGGACACATG-3′; 5′potmiR-27 Eco 5′-GCGAATTCTGGAGCTCATGAAGAGACCAAG-3′, 3′potmiR-27 Bgl 5′-GGAAGATCTAGGACAGTCTGTGTCCTCAG-3′; 5′potmiR-34 Eco 5′-GCGAATTCTGCTGTGTCAGAAAGGCTTCAC-3′, 3′potmiR-34 5′-GCGGATCCTGGGCATTCTTTCATCCCATC-3′; 5′ potmiR-42 Eco 5′-GCGAATTCGTCTGTATTCTCTTCTGGC-3′; 3′potmiR-42 Bam 5′-GGATCCCTGCTTTGAGAGTTCCTGAGT-3′. [score:2]
[1 to 20 of 2 sentences]
41
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
As quoted above, up-regulation of miRNAs, including miR-17-92 cluster, miR-106a, and miR-34, occurs during tamoxifen -induced hepatocarcinogenesis in female rats (Pogribny et al., 2007), also long-term-administration of 2-AAF resulted in disruption of regulatory miR-34a-p53 feed-back loop (Pogribny et al., 2009). [score:5]
In rats, tamoxifen up-regulate miR-17-92 cluster, miR-106a, and miR-34 (Pogribny et al., 2007). [score:4]
Inhibits invasion and migrationKutay et al., 2006; Gramantieri et al., 2008; Jiang et al., 2008; Li et al., 2008, 2009b; Su et al., 2009 miR-106a/b Prevention of E2F1 acumulation. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
43
[+] score: 12
The intensity of the yellow scale in the heat map corresponds to the mean log2 expression of miRNAs on the microarrays, as shown in the key on Figure 1. Expression of 3 related genomic clusters containing predominantly neuronal miRNAs; the miR-17 cluster (A), the miR-106a cluster (B) and the miR-106b cluster (C). [score:5]
0011109.g006 Figure 6Expression of 3 related genomic clusters containing predominantly neuronal miRNAs; the miR-17 cluster (A), the miR-106a cluster (B) and the miR-106b cluster (C). [score:3]
Paralogs of miR-92a, are located in the miR-17 and miR-106a genomic clusters, which we found to be expressed predominantly in neurons, both in NT2-N and in primary human neurons (microarray data validated by qPCR; Fig. 6A, B & Table S1). [score:3]
Among the 49 neuronal miRNAs in primary human neurons were members of 3 related genomic clusters; 4 members of the miR-17 cluster on chromosome 13 (miRNAs 17, 19a, 19b, and 20a; Fig. 6A), 3 members of the miR-106a cluster on chromosome X (miRNAs 19b, 20b, and 106a; Fig. 6B) and 2 members of the miR-106b cluster on chromosome 7 (miRNAs 106b and 93; Fig. 6C). [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 11
One category is oncogenic miRNA, which promotes tumorigenesis by inhibiting the expression of tumor suppressor genes, such as miR-106a (14) and miR-21 (15); the other category is tumor suppressor miRNA, which promotes tumor formation by activating oncogenes to inhibit cell differentiation and the cell cycle, such as miR-15b and miR-200b (16). [score:11]
[1 to 20 of 1 sentences]
45
[+] score: 11
Interestingly, the inhibition of miR-17-5p and/or miR-106-5p leads to the recovery of TRIM8 -mediated p53 tumour suppressor activity, which in turn strongly inhibits MYCN -dependent cell proliferation. [score:7]
While the miR-106a/363 cluster is rarely expressed in adult human tissues, the miR-17-92 and miR-106b/25 clusters are emerging as key actors in a wide range of biological processes including tumorigenesis [39, 40, 41]. [score:3]
The human genome contains two paralogues of the miR-17-92 cluster: the miR-106b/25 cluster, located on chromosome 7 (7q22.1) in the 13th intron of the Mini-Chromosome Maintenance gene (MCM7), and the miR-106a/363 cluster, located on chromosome X (Xq26.2). [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 11
In this study, which utilized a unilineage monocytic culture, downregulation of miR-17-5p, miR-20a and miR-106a during differentiation was associated with the upregulation of runt-related transcription factor 1 (RUNX1)—a promoter of M-CSF receptor transcription (17). [score:7]
The authors went on to identify RUNX1 as a direct target of miR-17-5p, miR-20a, and miR-106a. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 11
Among the miRNAs whose expression was suppressed by butyrate, members of the miR-106b family, including miR-17, miR-20a/b, miR-93 and miR-106a/b, regulate p21 translation and cancer cell proliferation [15, 16]. [score:8]
We analyzed the effects of treating HCT116 and HT29 human colon cancer cells with the same dose (2 mM) of butyrate on miR-92a expression using qPCR to measure the abundance of primary (pri-miR-17-92a and pri-miR-106a-92a), precursor (pre-miR-92a), and mature miR-92a. [score:1]
Consistent with previous reports [21, 27], pri-miR106a-92a was not detected in human colon cancer cells. [score:1]
Pri-miR-106a-92a was not detected in either cell line. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 11
Second, TAL1 is a putative target of several miRNAs that are up-regulated in hematopoietic stem cells, such as hsa-miR-17-5p, hsa-miR-197, hsa-miR-106 and hsa-miR-20 [39], and of some that are down-regulated in differentiated megakaryocytes, such as hsa-miR-106 and hsa-miR-20 [40], suggesting that miRNAs might regulate TAL1 at different stages of hematopoietic development. [score:11]
[1 to 20 of 1 sentences]
49
[+] score: 11
It has been shown that the low expression of miR-106a in human glioma specimens is significantly correlated with high levels of E2F1 protein and high-grade glioma, E2F1 is a direct functional target of miR-106a, the suppressive effect of miR-106a on the glioma may result from inhibition of E2F1 via post-transcriptional regulation [23]. [score:11]
[1 to 20 of 1 sentences]
50
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Similarly, it is demonstrated that miR-106a and miR-224 are upregulated in the brains of PD patients, ultimately leading to impaired chaperone -mediated autophagy (CMA) and α-synuclein accumulation. [score:4]
Similarly, many researchers found that the amyloid precursor protein (APP) expression is also influenced by miRNA-101, miRNA-16, miRNA-106a, and miRNA-644 (Patel et al., 2008; Delay et al., 2011; Long and Lahiri, 2011; Liu et al., 2012). [score:3]
Several research groups demonstrated that miRNA-548d, miRNA-224, miRNA-373, miRNA-198, miRNA-106a, miRNA-26b, and miRNA-301b show altered expression in PD patients (Alvarez-Erviti et al., 2013; Burgos et al., 2014; Cardo et al., 2014). [score:3]
miR-106a and miR-224 cause a dose -dependent reduction in heat shock 70 kDa protein (hsc70) and lysosome -associated membrane protein 2 (LAMP-2A), respectively, to impair autophagic mechanism in SH-SY5Y cells (Alvarez-Erviti et al., 2013). [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 11
Calin et al. reported that one of the most upregulated miRNAs is miR-106a, which is consistently reported in six studies, and the five most downregulated miRNAs are miR-30a-3p, miR-139, miR-145, miR-125a, and miR-133a, which are consistently reported and differentially expressed in four studies; these miRNAs may actually be of clinical use as diagnostic/prognostic biomarkers or therapeutic targets [3]. [score:11]
[1 to 20 of 1 sentences]
52
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
MiR-106 targets RB while miR-150 targets TP53 [89]. [score:5]
The expression of miR-146b, miR-221, let-7a,, miR-17-5p, miR-27a and miR-106a was significantly reduced in the serum of patients with NSCLC and miR-29c was significantly increased, while low levels of plasma-miRNA let-7b were statistically significantly associated with poor survival [170]. [score:3]
miR-106 and miR-150 were identified as oncomirs in lung cancer because of their activities in regulating growth and apoptosis. [score:2]
miR-106, miR-150, miR-131, miR-10b. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 10
Our results showed an early Mtb -dependent upregulation of miR-106-5p and a specific interaction between this miRNA and CTSS. [score:4]
Curiously, one of the miRs we showed to be more differentially regulated during mycobacteria infection, in addition to miR-106-b was miR-142-3p (Figure 1A). [score:2]
We made use of gain or loss-of-function experiments to modulate miR-106-b-5p during Mtb infection. [score:1]
The results were in agreement with a decrease in protein levels and hydrolytic activity for CtsS using mimics (Figure 4B, left panels) and a significant increase in protein and enzyme activity using miR-106-b-5p inhibitors (Figure 4B, right panels) calculated 3 days p. i. A similar trend on Mtb survival using mimics experiments was confirmed by CTSS siRNA (Figure 4A, top right). [score:1]
We further provide means how to revert this process by manipulation of miR-106-5p helping to control the infection. [score:1]
Importantly most members of the miR-17-92 cluster and all members of the miR-17 cluster are present in the list: hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-106a-5p, hsa-miR-106b-5p, and hsa-miR-93-5p which have been implicated all in innate and adaptive immune responses (36). [score:1]
[1 to 20 of 6 sentences]
54
[+] score: 10
Consequently, inhibition of miR-106a-5p expression weakened the invasive ability of this tumor. [score:5]
In another study, Li et al. [120] pointed out a high expression of miR-106a-5p and an inverse correlation of these levels and APC mRNAs in GBM tissue. [score:3]
Li D. Wang Z. Chen Z. Lin L. Wang Y. Sailike D. Luo K. Du G. Xiang X. Jiafu G. D. MicroRNA-106a-5p facilitates human glioblastoma cell proliferation and invasion by targeting adenomatosis polyposis coli proteinBiochem. [score:2]
[1 to 20 of 3 sentences]
55
[+] score: 10
Other miRNAs from this paper: hsa-mir-17, hsa-mir-20a, hsa-mir-23b, hsa-mir-106b
Within the list of candidates with experimentally validated interactions we selected, as an example, the micFFLs involving E2F1 and RB1 as targets and a set of miRNAs (miR-106a, miR-106b miR-17 miR-20a and miR-23b) as master regulators (see Table S4). [score:4]
A prototypical example: The micFFL involving E2F1 and RB1 as targets and a set of miRNAs (miR-106a,miR-106b, miR-17, miR-20a and miR-23b) as master regulators. [score:4]
In the last section we discuss a prototypical example of this situation, i. e. the micFFL involving E2F1 as TF, RB1 as T and a set of miRNAs (miR-106a, miR-106b, miR-17, miR-20a and miR-23b) as master regulators. [score:2]
[1 to 20 of 3 sentences]
56
[+] score: 10
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-30c-2, hsa-mir-30c-1
We detected pmiR-RB-PVT1luciferase activity with or without miR-29b-3p/ miR-30C-5p/ miR-106a-5p mimics and inhibitors. [score:3]
Bioinformatic analysis by TargetScan and Miranda revealed putative miRNA response elements (MREs) of miR-29b-3p/ miR-30C-5p/ miR-106a-5p shared by PVT1 (Supplementary Figure 3A) and the 3′UTR of Mcl-1 [27– 29]. [score:3]
The luciferase activity of pmiR-RB-PVT1 which contained PVT1 at the 3′UTR of Rluc showed no response to miR-29b-3p/ miR-30C-5p/ miR-106a-5p mimics and inhibitors (Supplementary Figure 3B and 3C). [score:3]
These data demonstrate that PVT1 does not contain functional binding sites of miR-29b-3p/ miR-30C-5p/ miR-106a-5p to support Mcl-1 mRNA stability. [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 10
In the study of Li et al. (2011) was observed that three miRNA clusters: miR-17, miR-106b, and miR-106a were significantly upregulated that interfere with iRNA machinery directly connected with important reprogramming pathways: TGF-β signaling and cell cycle. [score:5]
Type of cells Processes involved Non-coding RNA Reference hESC Pluripotency, self-renewal, cell cycle and fate specification miR-302 Suh et al. (2004), Bar et al. (2008), Lipchina et al. (2011) hESC Inhibition of pluripotency miR-145 Xu et al. (2009) iPSC Pluripotency miR-17, miR-106b, and miR-106a Li et al. (2011) Fibroblasts to iPSC Reprogramming miR-302, miR-372 Anokye-Danso et al. (2011), 2012, Subramanyam et al. (2011) Fibroblasts to iPSC Reprogramming Combination of miR-302, miR-200c, and miR-369 Miyoshi et al. (2011) iPSC Reprogramming LincRNAs Loewer et al. (2010) hESC Neural differentiation LincRNAs Ng et al. (2012) iPS-derived neural progenitors Neural differentiation LincRNAs Lin et al. (2011) hESC Differentiation to neuroectoderm miR-200, miR-96 Du et al. (2013) hESC-derived neural stem cells Suppression of selfrenewal, neural differentiation miR-124, miR-125b and miR-9/9 Roese-Koerner et al. (2013) hESC Neural differentiation miR7 Liu et al. (2012) hESC Neural differentiation miR125 Boissart et al. (2012) hESC, human embryonic stem cells; iPSC, induced pluripotent stem cells. [score:5]
[1 to 20 of 2 sentences]
58
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In the vascular wall, miR-424 miR-155, miR-503, and miR-222 can contribute to the differentiation of monocytes into macrophages, unlike the miR-20a, miR-106a, and miR-17, which prevent this mechanism by suppressing the transcriptor factor acute myeloid leukemia-1 (AML-1) and downregulating macrophage-colony-stimulating factor receptor [51]. [score:6]
Among these, miR-328, miR-330-3p, miR-221, and miR-125a-5p had their expressions reduced, while miR-192, miR-486-5p, miR-19b, miR-106a, miR-130b, miR-18a, and miR-769-5p displayed increased levels after the intervention. [score:3]
In vitro studies show that some miRNAs, such as miR-20a, miR-17, and miR-106a, can contribute to macrophage infiltration in adipose tissue. [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 10
It was reported that miR-17-5p and miR-106a was found to be up-regulated by N-Myc in human neuroblastomas, while the activation of N-Myc was revealed to be directly regulated by the E2F1-3 transcriptional regulators in neuroblastomas [81, 82]. [score:7]
It was also confirmed that miR-125 and miR-106a were upstream regulators of E2F3 and RB1, respectively, via the mechanisms involved cisplatin -induced K562 cell apoptosis [88]. [score:2]
We believe that, except for miR-200, miR-17 and miR-106, other miRNAs may also form negative feedback loops with E2F3, which needs to be further explored. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 10
Relative expression is shown for (A), miR-17-92 cluster members or (B), representative paralog cluster members, miR-106a and -106b. [score:3]
While knockout of the miR-17-92 cluster results in immediate post-natal death of all progeny, knockout of either or both the miR-106a or miR-106b clusters are viable without an apparent phenotype [64]. [score:3]
However knock out of the miR-17-92 cluster together with miR-106a or 106b cluster results in embryonic lethality [25]. [score:2]
001 for miR-106a and p <. [score:1]
Representative for these paralog clusters are miR-106a and miR106b (Fig. 2B). [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 10
Wang et al. demonstrated that PDGF-D markedly inhibited miR-106a expression and subsequently up-regulated Twist1 expression in gemcitabine-resistant hepatoma cells [118]. [score:10]
[1 to 20 of 1 sentences]
62
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-184, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
An overall down-regulation of the Rb pathway was apparent, with mutations in RB1 in three samples and global up-regulation of MDM2 (RB1 repressor) and of RB1 -targeting miRNAs (miR-215, miR-106a, miR-17, miR-20a, miR-93, miR-215, miR-21). [score:10]
[1 to 20 of 1 sentences]
63
[+] score: 10
Silencing of Bcr-Abl provokes a downregulation of these lncRNAs; among them, beta globin locus transcript 3 (non-protein coding) (lncRNA-BGL3) acts as a tumor suppressor transcript acting as a ceRNA for those miRNAs that target the oncosuppressor PTEN, such as miR-17, miR-20 and miR-106. [score:10]
[1 to 20 of 1 sentences]
64
[+] score: 9
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
Surprisingly, only few miRNA identified as part of the signature distinguishing ALK(+) ALCL from T-cells or ALK(−) ALCL were affected by ALK knockdown: miR-20b, miR-106a, miR-886-5p and miR-181a. [score:2]
The miR-17~92 cluster families (miR-17~92 cluster itself and its paralog clusters miR-106a~363 and miR-106b~25) are part of the miRNA signature defining ALK(+) ALCL. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 9
MiRNAs involved in inflammatory signaling may play a role in regulation of CYP3A expression 32. miR-106a could regulate IL-10 and IL-8 expression 43 44, while miR-126 is involved in regulation of NF-κB signaling pathway 45 46. [score:8]
Therefore, a total of 13miRNAs, namely miR-21-5p, miR-27a-3p, miR-27b-3p, miR-103a-3p, miR-106a-5p, miR-107, miR-126-5p, miR-130a-3p, miR-142-5p, miR-206, miR-371b-5p, miR-491-3p, and miR-1260b, were selected. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 9
miR-106b, a member of miR-106∼25 cluster, has been shown to down regulate the expression levels of TGFBR2, SMAD2 and BMP family genes in CRC [84], miR-126-3p to suppress breast cancer metastasis [85], and miR-126-5p to inhibit the migration and invasiveness of prostate cancer cells [86]; the function of their corresponding miRNA* sequences observed in this study awaits further experimentation. [score:8]
This analysis revealed the prominence in all three EVs of members from the following families: let-7 (12/12 members observed, let-7a/b/c/d/e/f/g/i, miR-98-5p), miR-181 (6/6, miR-181a-1/a-2/b-1/b-2/c/d), miR-30 (6/6, miR-30a/b/c-1/c-2/d/e), miR-320 (7/8, miR-320a/b-1/b-2/c-1/c-2/d-1/d-2), miR-8 (5/5, miR-141, miR-200a/b/c and miR-429), miR-17 (6/8, miR-106a/b, miR-17, miR-18a, miR-20a and miR-93), miR-192 (2/2, miR-192 and miR-215) and miR-25 (3/4, mir-25 and mir-92a/b). [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 9
MicroRNAs that function as oncogenes, including miR-17, miR-21, and miR-106a, were upregulated, whereas microRNAs that function as tumor suppressors, such as miR-101, miR-181, miR-449, miR-486, and let-7a, were downregulated in gastric cancer [42, 43]. [score:9]
[1 to 20 of 1 sentences]
68
[+] score: 9
Three of the up-regulated miRNA species (miR-106, miR-590-5p and miR-17) in the current study are also reported to be overexpressed in CD4 [+] T cells in multiple sclerosis (MS) patients [38– 41]. [score:6]
Conversely, the miR-17, miR-106, and miR-590-5p expression data suggest the disrupture of the TGF-β signaling. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 9
Other miRNAs from this paper: mmu-mir-155, mmu-mir-106a, mmu-mir-106b, hsa-mir-155, hsa-mir-106b
Over -expression of miR-106–363 could induce anchorage-independent growth, and human T-lymphomas also showed over -expression of this miRNA cluster [104]. [score:5]
In SL3-3 MuLV -induced T-lymphomas, proviral insertion and over -expression of the miR-106a cistron has also been reported [105]. [score:3]
Similarly a CIS previously identified in RadLV—induced T-lymphomas in mice (Kis2) has been found to encode the precursor for the miRNA cluster, miR-106–363 [104]. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 9
A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
Figure 1 A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
The miR 17 family (miR 17, miR 20a, miR 20b, miR106a, miR106b, miR 93) is a part of this cluster and few studies have shown that over -expression of miR-17 family promotes HCC progression and cancer metastasis [10, 11]. [score:3]
[1 to 20 of 3 sentences]
71
[+] score: 9
A similar pattern was observed for the paralogous miR-106-363 cluster showing a non-significant down-regulation in expression of miR-106a, miR-18a, and miR-20b after 24 h and a highly significant down-regulation of miR-106a, miR-18a, miR-20b, and miR-19b after 5 days of E. faecalis infection (Figure 1B). [score:9]
[1 to 20 of 1 sentences]
72
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 9
Other miRNAs from this paper: hsa-mir-17
Li et al first reported that the expression levels of miRNA-17 family, including miR-17-5p and miR-106a were down-regulated in response to BMP2 in C2C12 samples that underwent osteoblast differentiation [22]. [score:6]
The decreased expression levels of miR-17-5p and miR-106a in human adipose-derived MSCs (hADSCs) underwent differentiation toward osteogenic lineages and increased levels during adipocyte differentiation were also confirmed by Li et al [23]. [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 9
Other miRNAs from this paper: hsa-mir-21, hsa-mir-27a, hsa-mir-490
However, Zhimin Li et al. reported that MiR-27a may up-regualte MDR1/P-glycoprotein expression by targeting HIPK2 in human ovarian cancer cells [19], Li H et al. also reported that miR-106a may be involved in the development of drug resistance and the regulation of PDCD4 expression [20]. [score:9]
[1 to 20 of 1 sentences]
75
[+] score: 8
The hsa-mir-106 target is RB1 (retinoblastoma 1) which has transcription coactivator activity and is involved in the negative regulation of cell growth. [score:4]
In TarBase, there are two validated targets for hsa-mir-20 and one for hsa-mir-106a. [score:3]
The sites in Alus with sense orientation are overrepresented most significantly in the categories ‘information processing’ (the sites for hsa-mir-106a and - 20b occur in 8 of 7 proteins in this category), and ‘protein modifications”, where 12 of 15 proteins have hsa-mir-17-5p site and 11 of 15 – hsa-mir-20b site. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 8
This in turn prevents miR-106a-5p from suppressing one of its targets, the tumor suppressor gene PTEN [21]. [score:7]
The authors discovered that FER1L4 acts as a ceRNA that takes up miR-106a-5p (Table 1 and Figure 1). [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 8
MiR-106a targets the TGF-β recteptor TGFBR2 and is highly expressed in metastatic CRC cell lines, and promotes cancer cell migration and invasion in vitro (Feng et al., 2012). [score:4]
Clinical relevance of microRNA miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 in colorectal cancer. [score:1]
Colorectal cancer migration and invasion initiated by microRNA-106a. [score:1]
The human miR-17 family consists of eight miRNAs (miR-17, miR-18a/b, miR-20a/b, miR-93, and miR-106a/b), with three of these (miR-17, miR-18a, and miR-20a) transcribed from the miR-17-92 miRNA locus. [score:1]
Like miR-20a, miR-106a/b also appear to enhance metastasis or an EMT phenotype. [score:1]
[1 to 20 of 5 sentences]
78
[+] score: 8
miR Targets Tumor Impact on metastasis Description miR-106a ∼ 363, miR-106b ∼ 25 BIM, p21 Gastric cancer The miR-106b-25 cluster is involved in E2F1 post-transcriptional regulation and may play a key role in the development of TGFβ resistance in gastric cancer E2F1 Prostate cancer microRNA expression becomes altered with the development and progression of prostate cancer. [score:8]
[1 to 20 of 1 sentences]
79
[+] score: 8
The expression of miR-106a, miR-106b, miR-17-5p, miR-92, miR-93, miR-190, miR-20a and miR-130 were highest in EB (panel B). [score:3]
The expression of miR-106a, miR-106b, miR-17-5p, miR-92, miR-93, miR-130a, miR-20a and miR-190 were much higher in EB than in either hES cells or adult cells (Figure 6, panel B). [score:3]
The third was located on chromosome X and includes miR-106a, miR-363, and miR-20b. [score:1]
The members of miR-17-92 cluster and its paralogs such as miR-106a, miR-106b, miR-93, and miR-17-5p are related to DNA replication and cell mitosis in cancer cells [60- 62], moreover, miR-17-5p and miR-20a can induce heterochromatic features in promoters that undergo overlapping transcription and possess sequence complementarity to the miRNA seed region [63]. [score:1]
[1 to 20 of 4 sentences]
80
[+] score: 8
Because the seed region of miR-17, miR-106a and miR-20a are identical, the expression correlation of hsa-miR-17 and its target genes might be affected by other miRNAs. [score:5]
In addition, we present the selected tissues of miRNAs and their targets in Table 4. Table 4 shows that three of five MTI-supported tissues of hsa-miR-34a are prostate tissues; four of five MTI-supported tissues of hsa-miR-106a are colon tissues; three of five MTI-supported tissues of hsa-miR-222 are uterus tissues; three of five MTI-supported tissues of hsa-miR-26a are pancreatic tissues; and four of six MTI-supported tissues of hsa-miR-141 are pancreatic tissues. [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 8
Next, we utilized the miRNA bioinformatics database TargetScan and miRanda, and identified 6 target miRNAs (miR-17, miR-20a, miR-93, miR-106a, miR-106b, miR-20b) for hsa_circ_000984. [score:5]
MiR-106b level was determined by using qPCR after SW480 and SW620 cells were transfected with the miR-106b mimics and miR-106 inhibitors (Figure 3E and 3F). [score:3]
[1 to 20 of 2 sentences]
82
[+] score: 8
To date, miR-17, miR-18a\b, miR-19a, miR-20a\b, miR-21, miR-106a\b, miR-340, miR-421, and miR-658 have been shown to be highly expressed in gastric cancer tissues[17– 20], whereas the expression of miR-34b, miR-34c, and miR-128a is upregulated in undifferentiated gastric cancer tissues[21]. [score:8]
[1 to 20 of 1 sentences]
83
[+] score: 7
We identified the five miRNAs that were most consistently upregulated (miR-21, miR-106a, miR-17, miR-18a and miR-20a) and two most consistently downregulated (miR-378 and miR-638) in at least four profiling studies. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
MiR-106a and miR-106b have shown putative binding site at the position 252–258 of 3′-UTR for STAT3 gene, when analyzed by all three web servers, which have the potential to down regulate the expression of this gene. [score:4]
In the condition of elevated expression of miR-93 and miR-124, miR-106a, and miR-106b, Th17 immune diminished and L. donovani parasite finds the favorable condition to replicate in the macrophages of human. [score:3]
[1 to 20 of 2 sentences]
85
[+] score: 7
Other miRNAs from this paper: hsa-mir-223
It is, therefore, reasonable to speculate that a potent silencing escape affecting X-linked miRNAs like miR223 and miR106a could have a direct impact on the control of the fate lineage determination of hematopoietic progenitors, and consequently, could significantly impact the magnitude of the innate inflammatory response in males and females. [score:2]
X chromosome-linked miR223 and miR106a are potentially key miRNAs that may contribute to the contrasting outcome of the inflammatory response in males and females by regulating the innate immune signaling in PMNs and monocytes, respectively. [score:2]
On the other hand, Fontana et al. found miR106a to be functionally involved in the negative regulation of monocyte differentiation and maturation (61). [score:2]
For instance, number of reports described the crucial role of X-linked miR223 and miR106a in the differentiation of neutrophils and monocytes, the key cell players of the innate immunity at early stages of infection. [score:1]
[1 to 20 of 4 sentences]
86
[+] score: 7
Of them, hsa-miR-378 is located in the intron of protein-coding genes PPARGC1B, an experimentally validated transcriptional targets of MYC [40], and another eight miRNAs (hsa-miR-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, and hsa-miR-106b) belong to three paralogous clusters located on chromosome 13 (the hsa-miR-17 cluster), chromosome X (the hsa-miR-106a cluster), and chromosome 7 (the hsa-miR-106b cluster), with the former two clusters having been proved to be regulated by MYC [41]. [score:4]
In our network, MYC was predicted to regulate 10 miRNAs: miR-378, hsa-miR-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, and hsa-miR-106b, and hsa-miR-125b. [score:2]
While the hsa-miR-106 family have been implicated in breast cancer [43] and gastrointestinal tumor [44], our results furthermore suggest it may be a central miRNA underpinning the general tumorigenesis mechanism. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 7
Expression stability of the reference miRNA combination (miR-28, miR-103, and miR-106a) and reference gene PPIA. [score:3]
The miRNA expression data were normalized to the reference gene combination of miR-28, miR-103, and miR-106a [18]. [score:3]
Normalization was assessed with the reference miRNA combination miR-28, miR-103, and miR-106a [18], (S2 Fig). [score:1]
[1 to 20 of 3 sentences]
88
[+] score: 7
miRNA-sponged LCLs were generated by transducing LCL35 with pLCE-sCXCR4 (control sponge, described in [81]) or pLCE-s17/20/106, containing nine imperfect target sites for miR-17, miR-20a, or miR-106a in the 3′UTR of GFP [81], and FAC-sorting for high GFP -expressing cells 48-hrs post-infection. [score:5]
Shown are the mature miRNA sequences for miR-106a, miR-17, and miR-20a as identified by deep sequencing and the sequence of the LMP1 3′UTR cluster containing the seed match site. [score:1]
The miR-17/20/106 sponge contains nine imperfect binding sites within the 3′UTR of GFP for miR-17, miR-20a, or miR-106a (Table S15); miR-106b and miR-93 differ from these three miRNAs in their 3′ non-seed sequences (Figure 6C, Table S1- S4). [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 7
However, the identification of target genes specific for miR-519d is especially challenging because it shares target sequence specificity with miR-17-5p, miR-20 A and B, as well as miR-106 A and B. Other microRNAs overexpressed more than twofold in human male breast cancer, but not yet described in female breast cancer are miR-183, miR-197, miR-493-5p, and 519d. [score:7]
[1 to 20 of 1 sentences]
90
[+] score: 7
Moreover, a further and deeper comparison among pre-miR-214-3p-EV, antago-miR-24-3p-EV and anti-IL-3R-EV miR content led us to hypothesize that their overlapping anti-angiogenic effects might also depend on the combined action of a pattern of shared miRs (miR-222-3p, miR-16-5p, miR-484 for all EV samples; miR-19b-3p miR-17-5p, miR-196b-5p, miR-365b-5p for pre-miR-214-3p-EVs and anti-IL-3R-EVs; miR-106a-5p, miR-197-3p, miR-193b-3p for antago-miR-24-3p-EVs and anti-IL-3R-EVs) which may be involved in the regulation of a network of genes related to cancer development/progression. [score:3]
a Meta-analysis algorithm of the most significant pathways targeted by miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, miR-193b-3p, miR-518d-5p and miR-191-5p. [score:3]
As shown in Fig.   8a and resumed in Fig.   8b, miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, and miR-193b-3p significantly correlated with at least 2 of the following pathways: pathway in cancer, adherens junction, p53 signaling pathway, cell cycle and ECM receptor interaction; whereas, miR-518d-5p and miR-191-5p did not. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 7
On the other hand, p53 decreases expression of distinct miRNA clusters, such as miR-106b/miR-93/miR-25, miR-17-15p/18a/19a/20a/19b-1/92-1 and miR-106a/18b/20b/19b-2, through an indirect mechanism which involves repression of E2F1 [158]. [score:4]
These authors showed that miRNAs 20-b, miR-20a, miR-17, miR-21, miR-106a, miR-18a, mir-21, miR106b, mir-18b, miR-421, miR-340, miR-19a and miR-658 were highly expressed in GC. [score:3]
[1 to 20 of 2 sentences]
92
[+] score: 7
We also noticed down-regulation of miR-92a in both CD4 [+ ]and CD8 [+ ]lymphocytes with age, in accordance with the report by Hackl, et al. [11] that showed miR-17, miR-19b, miR-20a, and miR-106a were down-regulated in human cells, including CD8 [+ ]lymphocytes, in an aging population. [score:7]
[1 to 20 of 1 sentences]
93
[+] score: 7
miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. [score:3]
H19 acts on chromatin organization through the recruitment of chromatin modifying complex PRC2 (1) and on post-transcriptional control as a miR decoys sequestering miR-106a and miR-let7 (2) or as a precursor for miR-675-5p and miR-675-3p (3) H19 also interact with p53 (TP53) and inactivate the tumor suppressor protein action (4) Furthermore, possible base pairing between H19 and the antisense transcripts 91H and HOTS may have biological outcomes (5). [score:3]
On one hand, the lncRNA H19 acts as miR sponge to sequester miR-106a as well as the mir-let7 family members (Kallen et al., 2013; Imig et al., 2015). [score:1]
[1 to 20 of 3 sentences]
94
[+] score: 7
Altogether, both lymphoma subtypes had only eight common miRs: three that were upregulated (miR-210, 155 and miR-106a), and five that were downregulated (miR-139, 150, 149, 320 and miR-34a-5p) (Figure 2D). [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
Xiao et al. identified miR-106a as a dramatically up-regulated miRNA in GC [26]. [score:4]
They also found that the expression of miR-106a was significantly related to tumor stage, lymphatic, distant metastasis and invasion. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 7
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-34a, hsa-mir-449a
No noticeable level of miR-106a was expressed with trials using 10 ng, 20 ng, and 30 ng total RNA (data not shown). [score:3]
Several miRNAs (including miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) that funnel proliferating cells to senescence regulate cellular senescence via either or both p53/p21 and p16/pRb pathways [14]. [score:2]
PCR reactions were then performed according to manufacturer's instructions to quantitate the expression levels of miRNAs (miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) using Taqman Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, USA), and Taqman microRNA assay (Applied Biosystems, USA) for the miRNAs of interest. [score:2]
[1 to 20 of 3 sentences]
97
[+] score: 7
And some of these miRNAs, such as miR-26b, miR-106a and miR-301b (targeting Hsc 70), or miR-21, miR-224 and miR-373 (targeting LAMP2A) have been confirmed to target the 3' UTR of either Hsc 70 or LAMP2A [42]. [score:7]
[1 to 20 of 1 sentences]
98
[+] score: 7
The small RNA sequencing data showed the upregulation of the miR-302b/367 and miR-106a/363 clusters, and downregulation of let-7 family members and the miR-17/92 cluster. [score:7]
[1 to 20 of 1 sentences]
99
[+] score: 7
In an ischemia -induced mo del of retinal neovascularization, seven miRNAs (miR-106a, miR-146, miR-181, miR-199a, miR-214, miR-424, and miR-451) were upregulated, and three miRNAs (miR-31, miR-150, and miR-184) were downregulated. [score:7]
[1 to 20 of 1 sentences]
100
[+] score: 6
There are only a few studies on the expression changes of miRNA in the serum of patients with GC, which are summarized in Table 2. Some miRNAs were reported to be up-regulated, including miR-20b, miR-20a, miR-17, miR-106a, miR-18a, miR-21 [72], miR-17-5p, miR-21, miR-106a and miR-106b [73]. [score:6]
[1 to 20 of 1 sentences]