sort by

661 publications mentioning hsa-mir-29b-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-29b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 539
1005238.g007 Fig 7 (A&B) Knockdown of miR-29 in IMR-90 cells or PASMCs leads to upregulation of KLF4 expression (n = 3); increased miR-29 levels by mimic in PASMCs suppress the expression of KLF4 (n = 3); (C) miR-29 suppresses 3’UTR luciferase reporter of KLF4 which depends on an intact miR-29 binding site (n = 3); (D) Knockdown of KLF4 in PASMCs, in which miR-29 is also knocked down, restore the expression of CNN1 and α-SMA (n = 3). [score:17]
In general, miRNAs are negative regulators of their targets, therefore, we hypothesized that miR-29 indirectly upregulates the expression of SMC-related genes by targeting a negative regulator of SMC differentiation. [score:13]
Since there is no predicted miR-29 binding site in the 3’UTR of FBXO32 mRNA, it is likely that miR-29 indirectly suppresses the expression of FBXO32 by targeting Foxo3a, which is also upregulated in miR-29 knockdown cells. [score:12]
While expression of miR-29 is suppressed by treatment of PDGFB, miR-29 is known to directly target the expression of components of the PDGF pathway, such as PDGFRB [29 – 31 ]. [score:10]
Future implications are to study the expression and function of miR-29 in human pulmonary vascular diseases, which might lead to establishing miR-29 as a therapeutic target for disease intervention. [score:9]
This reduced expression of α-SMA is associated with upregulation of COL1A1(red), a known direct target of miR-29. [score:9]
Most recently, it has been shown in a vascular injury mo del that upregulation of miR-29 suppresses the expression of PDGFRB in modulating SMC phenotype [32 ]. [score:8]
Interestingly, knockdown of miR-29 leads to significant upregulation of all PDGF ligands and receptors (15%-30% upregulation, p<0.05), except for PDGFB (Fig 9A). [score:8]
Interestingly, KLF4 is a predicted target of miR-29 (TargetScan) and the binding site of miR-29 within 3’UTR of KLF4 is evolutionarily conserved among all species of vertebrates (total 22 species, TargetScan). [score:7]
Upregulation of miR-29 expression during postnatal lung development. [score:7]
Indeed, in miR-29 knockdown IMR-90 cells, expression of all components of the PDGF pathway, except for PDGFB, is significantly upregulated (Fig 9A). [score:7]
We then investigated whether KLF4 is under the control of miR-29 in PASMCs, and found that over -expression of miR-29 with its mimic resulted in a two fold reduction of KLF4 mRNA, while knockdown of miR-29 resulted in about a two fold upregulation of KLF4 expression in PASMCs (Fig 7B). [score:7]
As expected, knockdown of miR-29 alone results in more than a two fold upregulation of KLF4 and significantly reduced expression of α-SMA and CNN1 (Fig 7D). [score:7]
The postnatal growth retardation and lethality are coincident with the drastic upregulation of miR-29 expression in multiple organs during postnatal development. [score:7]
Disruption of miR-29 leads to upregulation of Klf4 expression in vSMCs in vivo. [score:6]
Disruption of miR-29 leads to upregulation of Klf4 expression in vSMCs in vivo We then investigated the expression of Klf4 in miR-29 null mouse lungs. [score:6]
Moreover, by targeting a large number of ECM-related genes, miR-29 plays a significant role in collagen vascular diseases that has been increasingly recognized as potential causes for the development of PAH. [score:6]
Our next inquiry was to determine how miR-29 up-regulates the expression of SMC-related genes. [score:6]
It has been showed that down-regulation of miR-29 is associated with dystrophic muscles[54, 60] and restoration of miR-29 expression improved dystrophy pathology[60]. [score:6]
miR-29 also directly suppresses the expression of ECM-related genes associated with synthetic phenotypes, such as collagen [22, 23, 68]. [score:6]
This upregulation of FBXO32 is not presented in SMCs of airway and large proximal vessels, consistent with the expression pattern of miR-29 (S4A and S4B Fig). [score:6]
Here we showed that KLF4 is directly targeted by miR-29 in vSMCs and our data indicates that Klf4 is a physiological target of miR-29 in vivo. [score:6]
As expected, and consistent with miR-29 expression pattern, we found that the prominent upregulation of COL1A1 is associated with distal vessel walls of miR-29 null lungs (Fig 4A–4D). [score:6]
We selected hsa-miR-29c-3p miRCURY LNA microRNA inhibitor (product#: 4105460–001, and sequence: CCGATTTCAAATGGTGCT) and miRCURY LNA microRNA inhibitor negative control (product#: 199007–001, sequence: AGAGCTCCCTTCAATCCAA) for knockdown assay based on our published data that hsa-miR-29c LNA antisense (50nM) can efficiently reduce the endogenous levels of all three miR-29 family members. [score:5]
Upregulation of components of PDGF pathway in both miR-29 knockdown cells and miR-29 null lungs. [score:5]
Together, these results suggest that it is highly relevant to examine the expression and function of miR-29 in vSMCs of pulmonary vascular diseases. [score:5]
The most drastic upregulation of miR-29 (S2 Table and S3 Fig, about 20–40 folds) happens during postnatal development, a period in which distal vSMCs gradually switch from synthetic to contractile phenotypes in human or animal lungs. [score:5]
One of the most upregulated genes in miR-29 knockdown human lung myofibroblast cells is FBXO32 (Atrogin-1), together with its activator FOXO3a (Fig 10A). [score:5]
Moreover, it has been shown in vitro that MYOCD induces the expression of miR-24 and miR-29 and promotes SMC differentiation by suppressing PDGFRB [32]. [score:5]
This analysis showed that upregulation of KLF4 by miR-29 knockdown is reversed by co-transfection of KLF4 siRNA, which leads to even lower KLF4 levels, as compared to cells of miR-29 knockdown alone. [score:5]
Upregulation of Foxo3a and Fbxo32 in both miR-29 knockdown cells and miR-29 null lungs. [score:5]
We found that knocking down levels of endogenous miR-29 resulted in about 25–50% reduction of both α-SMA and calponin1 (CNN1), while increased miR-29 levels resulted in about a two fold upregulation of α-SMA and CNN1 in PASMCs (Fig 6A). [score:5]
Previously we showed that levels of miR-29 are significantly upregulated during embryonic and postnatal lung development that was confirmed by Next Generation of Sequencing and qRT-PCR [23] (S2 Table and S3 Fig). [score:5]
First, we examined whether targets of miR-29 are derepressed in D KO lungs by staining COL1A1, a well-known target of miR-29 [22, 23]. [score:5]
Together, our study showed that miR-29 is a central player in promoting SMC differentiation by suppressing the expression of KLF4, PDGFRB and ECM-related synthetic genes. [score:5]
1005238.g004 Fig 4 (A&B) Increased COL1A1 IHC signal is prominently associated with vessel walls, where endogenous miR-29 expression is highly expressed. [score:5]
This analysis revealed that knockdown of endogenous miR-29 results in 20–35% reduction of about 15 smooth muscle- and actin cytoskeleton-related genes including well-known SMC markers (all p<0.05), such as CNN1, CNN3 (calponin3), ACTG2 (actin, gamma 2, smooth muscle, enteric), ACTA2 (α-SMA), SMTN (smoothelin), TAGLN, as well as MYOCD, a master regulator of SMC gene expression (Fig 6B and S1 Table). [score:5]
Together our ISH analysis revealed a vessel specific expression of miR-29 in vSMCs in both human and mouse lungs, suggesting a conserved expression pattern in vSMCs of distal vessels including those of distal pulmonary arteries. [score:5]
Disruption of miR-29 expression in vivo results in aberrant vSMC differentiationSince expression of miR-29 family members (miR-29a/b/c) transcribed from both loci are enriched in vSMCs (Fig 1F), we decided to investigate the role of miR-29 in vivo by generating mutant mice in which both loci were deleted (double knockout or miR-29 null mice). [score:4]
This confirmed that KLF4 is a direct target of miR-29. [score:4]
Together, our results identified that FBXO32 is a novel downstream gene of miR-29, suggesting miR-29 might regulate smooth muscle protein degradation by modulating the expression of Foxo3a/Fbxo32. [score:4]
However, little is known regarding the expression and function of miR-29 during development in vivo. [score:4]
Disruption of miR-29 leads to upregulation of components of the PDGF pathway. [score:4]
We then examined whether reduction of KLF4 by siRNA can rescue defects in the expression of contractile markers of miR-29 knockdown cells. [score:4]
In the course of our study, KLF4 proved to be the direct target of miR-29 in cancer cell lines [65, 66]. [score:4]
This is consistent with the decreased expression of MYOCD and a large number of SMC contractile markers in miR-29 knockdown cells and miR-29 null lungs (Fig 5 and Fig 6). [score:4]
Then, we examined whether reduction of KLF4 by siRNA can restore the expression of α-SMA and CNN1 in miR-29 knockdown PAMSCs. [score:4]
We then performed co-immunofluorescence staining of α-SMA with FBXO32, and found that levels of FBXO32 are drastically upregulated specifically in the distal vessel walls of miR-29 null lungs, negatively correlated with the reduced α-SMA staining (Fig 10C–10F). [score:4]
Suppression of KLF4 rescues the defective SMC phenotype of miR-29 knockdown cells. [score:4]
We found that miR-29 family members are abundantly, selectively and dynamically expressed during mouse and human lung development. [score:4]
Levels of Foxo3a and Fbxo32 are significantly upregulated in miR-29 deficient cells. [score:4]
This might be due to the upregulation of Foxo3/Fbxo32 in the skeletal muscle of miR-29 null mice, which requires careful examination. [score:4]
Moreover, disruption of miR-29 leads to significant upregulation of Foxo3a/Fbxo32, a pathway well known for skeletal muscle wasting, which might lead to excessive degradation of important smooth muscle cell proteins. [score:4]
Together, our results suggested that miR-29 suppresses the PDGF pathway in promoting vSMC differentiation during lung development in vivo. [score:4]
1005238.g006 Fig 6 (A) qRT-PCR results of α-SMA and CNN1 mRNAs in PASMCs in which the level of miR-29 is either elevated by miR-29 mimic or knocked down by miR-29 antisense LNA oligos (n = 3); (B) mRNA levels of contractile SMC markers in IMR-90 cells, in which miR-29 is knocked down (n = 3, Affymetrix array data); (C) Levels of α-SMA protein in IMR-90 cells, in which endogenous miR-29 is knocked down. [score:4]
Upregulation of KLF4 in miR-29 null lungs. [score:4]
While we were working on this project, it was reported that Foxo3a is a direct target of miR-29 during chondrogenic differentiation[41]. [score:4]
Moreover, our work also suggests a novel role of miR-29 in regulating the expression of Foxo3a/Fbxo32 in distal vSMCs. [score:4]
Instead, mRNA levels of both CNN1 and α-SMA in these cells are 30–70% higher than those of cells with miR-29 knockdown alone, negatively correlated with reduced KLF4 expression. [score:4]
We then investigated whether miR-29 directly target KLF4 to exert its effects on SMC gene expression. [score:4]
We found that the level of Pdgfrb is significantly upregulated in miR-29 null lungs (Fig 9B). [score:4]
# CN-001000-01) were transfected at 5nM for upregulation of miR-29 in cultured cells. [score:4]
By investigating the expression and function of miR-29 in vivo, we found a vessel selective enriched expression and function of miR-29 during mouse lung development. [score:4]
To ask whether the PDGF pathway is under the control of miR-29 in vSMCs, we first examined their expression in our array data of miR-29 knockdown IMR-90 cells. [score:4]
In distal lung vSMCs, miR-29 promotes the differentiation of vSMCs by targeting Klf4 and the PDGF pathway, two major negative regulators of vSMC maturation. [score:4]
KLF4 is a direct target of miR-29 in SMCs. [score:4]
Upregulation of COL1A1 in distal vasculature of miR-29 D KO lungs. [score:4]
We first performed qRT-PCR for Foxo3a and Fbxo32, and found that both of them are significantly upregulated in miR-29 null lungs, as compared to littermate controls (Fig 10B). [score:3]
To determine whether KLF4 is a direct target of miR-29, we conducted a 3’UTR luciferase assay. [score:3]
Together, these results for the first time showed that KLF4 is a physiological target of miR-29 in vivo, and increased KLF4 in distal vSMCs of miR-29 null lungs likely contribute to the immature vSMC phenotype. [score:3]
This suppression was abolished by mutating the miR-29 complementary binding site in KLF4 3’UTR(Fig 7C). [score:3]
To examine the expression pattern, we performed in situ hybridization (ISH) for miR-29 using DIG-labeled LNA probes. [score:3]
Luciferase reporter analysis revealed that the activity of reporter containing wild type 3’UTR of KLF4 was significantly suppressed (about 40% reduction) by miR-29, but not by miR-365 (Fig 7C). [score:3]
This strongly suggests that endogenous miR-29 promotes the expression of vSMC contractile markers. [score:3]
In this study, we found that miR-29 expression is selectively enriched in vSMCs of distal vessels of mouse lungs, a pattern that is also conserved in human lungs. [score:3]
miR-29 promotes the expression of contractile SMC markers. [score:3]
To further examine miR-29 expression in SMCs, we sorted and collected SMCs (α-SMA-EGFP transgenic mice) or type I epithelial cells (T1α-EGFP transgenic mice, gift from Dr. [score:3]
Expression of miR-29 in vasculature of mouse lungs. [score:3]
Expression of miR-29 in mouse lungs. [score:3]
1005238.g005 Fig 5Disruption of miR-29 expression in vivo leads to aberrant vSMC differentiation. [score:3]
In this study, we also showed that Pdgfrb is a physiological target of miR-29 in vivo (Fig 9B–9F). [score:3]
In this study, we found that the expression of contractile SMC markers is significantly attenuated in miR-29 null lungs, preferentially affecting vSMCs of distal pulmonary vasculature. [score:3]
A evolutionarily conserved miR-29 binding site is present in the 3’UTR of Foxo3a (Targetscan). [score:3]
We showed that miR-29 promotes vSMCs differentiation by targeting Klf4, the PDGF pathway and ECM-related synthetic markers. [score:3]
By co-staining with α-SMA, we found that miR-29 ISH signal co-localizes with α-SMA within vessel walls suggesting an enriched expression in vSMCs (Fig 1D). [score:3]
Interestingly, disruption of miR-29 results in defects in vSMCs differentiation of distal vessels, reminiscent of vSMC phenotype observed in the early stage of PAH in which immature/synthetic vSMCs of distal arteries failed to differentiate and were unable to tune down the expression of collagens and other extracellular-related genes. [score:3]
We found that the level of KLF4, a known negative regulator of SMC differentiation, is significantly increased (more than 40%, P<0.01) in miR-29 knockdown cells (Fig 7A). [score:3]
Together, results from these two cell lines suggest that expression of KLF4 is under the control of miR-29. [score:3]
Expression of miR-29 in human lung vasculature. [score:3]
This strongly suggests that derepression of KLF4 contributes to the negative regulation of SMC differentiation in miR-29 knockdown cells. [score:3]
Expression of miR-29 in mouse lungs is abundant, selective and dynamic. [score:3]
Our data suggested that miR-29 promotes SMC differentiation at least partially by suppressing KLF4 and components of the PDGF signaling pathway. [score:3]
Disruption of miR-29 expression in vivo results in aberrant vSMC differentiation. [score:3]
Disruption of miR-29 expression in vivo leads to aberrant vSMC differentiation. [score:3]
Together, these results suggested that miR-29 is part of the miRNA regulatory network in promoting SMC differentiation. [score:2]
This is the first evidence that miR-29 selectively regulates vSMCs differentiation and vessel wall formation. [score:2]
1005238.g010 Fig 10 (A) Affymetrix array data of Foxo3a and Fbxo32 in miR-29 knockdown cells (n = 3). [score:2]
Here, we report a vessel specific role of miR-29 in promoting the differentiation of vSMC during mouse lung development. [score:2]
Here, we report that miR-29 is required for postnatal growth and development. [score:2]
miR-29 also plays a critical role in regulating the PDGF pathway in multiple cell types [29, 32]. [score:2]
miR-29 regulates KLF4. [score:2]
Due to the nature of systemic knockout of miR-29 in animals examined in this study, and diverse functions of miR-29 in different cell types and organs, failure of multi-organs might contribute to the growth retardation and lethality. [score:2]
To do this, we repeated the experiment, in which miR-29 was knocked down alone in PASMCs. [score:2]
S3 Fig Levels of miR-29 a/b/c in RNA samples of mouse lungs at different stages of postnatal development (qRT-PCR, n = 3). [score:2]
We first turned to our array data of IMR-90 cells, in which endogenous miR-29 was knocked down. [score:2]
These findings suggest that miR-29 is specifically required for the proper differentiation of vSMCs of distal lung vasculature during development. [score:2]
The immature/synthetic vSMC phenotype of distal lung vessels of miR-29 null mice indicates a potential dysregulation of miR-29 in the pathogenesis of PAH. [score:2]
Since expression of miR-29 family members (miR-29a/b/c) transcribed from both loci are enriched in vSMCs (Fig 1F), we decided to investigate the role of miR-29 in vivo by generating mutant mice in which both loci were deleted (double knockout or miR-29 null mice). [score:2]
Unlike miR-29, there is little change in levels of miR-143/145 during embryonic and postnatal development (S2 Table). [score:2]
miR-29ab1 [+/-]; miR-29b2c [+/-] mice are viable and fertile, and were used to breed for generation of double knockout (miR-29 null) mice with mixed genetic background containing 129/SvJ and C57BL/6. [score:2]
1005238.g009 Fig 9 (A) Affymetrix array data of components of PDGF signaling pathway in miR-29 knockdown cells (n = 3). [score:2]
In addition, Western Blot analysis showed a more than 60% reduction in α-SMA protein in miR-29 knockdown cells (Fig 6C). [score:2]
Smooth muscle related genes reduced in miR-29 knockdown IMR-90 cells. [score:2]
Generation of miR-29 knockout mice. [score:2]
The strongest ISH signal of miR-29 in adult mouse lungs was detected in distal vascular structures (Fig 1B and 1C). [score:1]
In addition, we also found potent activity of miR-29 in promoting SMC differentiation in vitro. [score:1]
S5 Fig A) Hearts of miR-29 D KO and WT littermates at age four weeks were fixed overnight in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with H&E. [score:1]
In embryonic day 18.5 (E18.5) lungs, in which α-SMA positive cells are found in limited numbers of distal vessels with relatively thick walls, a typical morphological feature before extrauterine adaptation; high levels of miR-29 were also selectively detected in α-SMA positive cells of these vessel walls (Fig 1E). [score:1]
miR-29 null mice began to die around 4 weeks of age and none of them survived to the age of 6 weeks (Fig 3D). [score:1]
Interestingly, levels of miR-29 in the media layer of large arteries, such as the dorsal aorta, where vSMCs reside, are much lower (S1A and S1B Fig). [score:1]
We first manipulated miR-29 levels in PASMCs by transfecting with miR-29 mimic or LNA antisense oligos. [score:1]
Previously, we have carried out Affymeritx array profiling for downstream genes of miR-29 in human fetal lung fibroblast cells (IMR-90) [23]. [score:1]
Examination of the lungs of miR-29 D KO mice at age four weeks revealed significant defect in differentiation of vSMCs. [score:1]
Interestingly, results from different cell types showed a potential reciprocal negative feedback loop of miR-29 and components of the PGDF pathway. [score:1]
Luciferase reporters were co -transfected with miR-29 mimic or miR-365 mimic, an unrelated miRNA as negative control. [score:1]
Postnatal growth retardation and lethality of miR-29 null mice. [score:1]
miR-29 D KO mice develop smaller hearts. [score:1]
Due to the difficulty in isolation and culture of mouse lung SMCs, and also based on the selectively enriched expression of miR-29 in vSMCs of human lungs, we decided to investigate the role of miR-29 in human pulmonary arterial smooth muscle cells (PASMCs). [score:1]
We then investigated the expression of Klf4 in miR-29 null mouse lungs. [score:1]
After pre-hybridization (50% formamide, 10mM Tris-HCl pH8.0, 600mM NaCl, 1X Denhardt’s solution, 200μg/mL tRNA, 1mM EDTA, 0.25% SDS, 10% dextran sulfate) at RT for 2 hrs, hybridization was carried out at 50°C overnight in the same hybridization buffer containing 25nM of miR-29c (TAGCACCATTTGAAATCGGTTA) or miR-29a (TAGCACCATCTGAAATCGGTTA) and miR-29b (TAGCACCATTTGAAATCAGTGTT) DIG-labeled LNA probes. [score:1]
This analysis revealed much higher PDGFRB staining in distal vessel walls of miR-29 null lungs, negatively correlated with reduced signal of α-SMA staining (Fig 9C–9F). [score:1]
All miR-29 null mice die within 6 weeks of birth, while none of wild type littermates died in the same period. [score:1]
S4 Fig (A&B) Double IF staining of FBXO32 (red) and α-SMA (green) in WT control and miR-29 D KO lungs. [score:1]
However, we observed a significant postnatal growth retardation, and miR-29 D KO are consistently smaller with about 25%, 40% and 50% reduction of body weight at ages of two, three and four weeks, respectively (Fig 3B and 3C). [score:1]
Since both miR-29 loci were systemically deleted in D KO mice, the observed vSMC phenotype may results of secondary or accumulated causes. [score:1]
Endogenous miR-29 is required for proper SMC differentiation in vitro Since both miR-29 loci were systemically deleted in D KO mice, the observed vSMC phenotype may results of secondary or accumulated causes. [score:1]
Most of these miR-29 null mice develop a hunchback, indicating weakness of the skeletal muscles. [score:1]
Endogenous miR-29 is required for proper SMC differentiation in vitro. [score:1]
Human fetal lung fibroblasts (IMR-90) and human pulmonary arterial smooth muscle cells (PASMCs) were cultured and transfected with miR-29 mimics, miR-29 LNA antisense or KLF4 siRNA as described [23, 73]. [score:1]
However, by examining the weight of hearts of miR-29 null and wild type littermates, there is no significant sign of heart failure. [score:1]
In distal small arteries, miR-29 specifically co-localizes with α-SMA staining (Fig 2D, 2E and 2F). [score:1]
To examine the levels of PDGFRB in distal vessel wall of miR-29 null lungs, we performed co-immunofluorescence staining of α-SMA and PDGFRB. [score:1]
By double immunofluorescence staining of KLF4 and α-SMA, we found significantly increased Klf4 staining in the nucleus of cells associated with distal vessel walls of miR-29 null lungs, inversely correlated with the reduced staining of α-SMA (Fig 8A–8D). [score:1]
A fragment of the 3’UTR of KLF4 containing the wild type or mutated miR-29 binding sites was cloned into the psiCHECK2 dual luciferase reporter plasmid. [score:1]
miR-29 is known for its roles in fibrosis, cell proliferation/apoptosis, tumor and adaptive and innate immunity [42– 54]. [score:1]
Scale bar: 100μM (TIF) A) Hearts of miR-29 D KO and WT littermates at age four weeks were fixed overnight in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with H&E. [score:1]
# 002112), mmu-miR-29b (Cat. [score:1]
Levels of COL1A1, α-SMA and KLF4 are not significantly altered in airway SMCs of miR-29 D KO lungs. [score:1]
This indicates a critical role of miR-29 in the postnatal vSMC maturation. [score:1]
Together, these analyses suggest that defects in vSMC differentiation in miR-29 null lungs, might lead to the reduction in pulmonary arterial pressure. [score:1]
However, there is no significant difference between miR-29 null and control mice in heart weight when normalized to body weight (S5C Fig). [score:1]
We then performed qRT-PCR to examine the levels of Pdgfrb in miR-29 null or wild type lungs. [score:1]
This was further confirmed by western blot analysis (Fig 8F and 8G), in which protein levels of KLF4 of miR-29 null lungs are significantly higher than those of control littermates. [score:1]
We found that there is a significant reduction in heart weight, left ventricle weight and right ventricle weight when normalized to tibial length in miR-29 null mice (S5B Fig). [score:1]
1005238.g001 Fig 1 (A) miR-29 family members are the most abundant miRNAs in adult mouse lungs, representing about 19% of total reads of known miRNAs (Next Generation of Sequencing). [score:1]
This profiling revealed that miR-29 family members (miR-29a/b/c) transcribed from two genomic loci, miR-29a/b1 and miR-29b2/c, are the most abundant miRNAs in adult mouse lungs (Fig 1A). [score:1]
Moreover, levels of miR-29 in airway SMCs is also much lower than those present in the distal vascular structure (Fig 1B and 1C). [score:1]
We then examined whether this vessel specific pattern is also present in human lungs, and found that high levels of miR-29 is selectively detected in vSMCs of small arteries including pulmonary arteries, but not in the vSMCs (media layer) of large pulmonary arteries (Fig 2A, 2B and 2C). [score:1]
This indicates a reduction of heat size in miR-29 null mice. [score:1]
[1 to 20 of 159 sentences]
2
[+] score: 476
QRT-PCR analysis showed that, in comparison with normal breast tissues, SPIN1 appears significantly up-regulated in 10 (47.6%) and down-regulated in 5 (23.8%) of the 21 TNBC specimens studied (Figure 7B) and the analysis of its correlation with miR-29b-1-5p overexpression demonstrated that it is negatively correlated with SPIN1 expression (Figure 7C). [score:11]
It has been demonstrated that the miR-29 family might function as a tumor suppressor and that expression of these miRNAs inhibits cell proliferation, promotes apoptosis of cancer cells, and suppresses tumorigenicity by targeting multiple oncogenes [38, 39]. [score:11]
Moreover, after transfection with either hsa-miR-29b-1-5p mimic, or hsa-miR-29b-1-5p mimic plus negative control miScript target protector, or hsa-miR-29b-1-5p mimic plus miScript target protector (Figure 7G), the levels of SPIN1 mRNA were strongly higher in cells transfected with hsa-miR-29b-1-5p mimic plus miScript target protector than in control cells (cells transfected with hsa-miR-29b-1-5p Mimic or hsa-miR-29b-1-5p Mimic plus Negative control miScript Target Protector). [score:9]
After selecting SPIN1 as predicted target of hsa-miR-29b-1-5p, the two target sites of SPIN1 3′UTR, predicted by MIRDB, were searched by the two wi dely used miRNA target prediction programs: Targetscan 7.0 (http://www. [score:9]
In conclusion, the results show that miR-29b-1-5p inhibits both WNT and Akt signaling pathways by downregulating SPIN1 and suggest that miR-29b-1-5p, through SPIN1, might regulate the expression of MYC, CXCR4 and VEGFA counteracting their contribution to tumorigenesis. [score:9]
We found that miR-29b-1-5p expression was downregulated in fifteen of the twenty-one TNBC tissues (71.4%); a potent upregulation was observed in two of the twenty-one tissues (9.5%); no variations were observed in the other four TNBC tissues (Figure 1A). [score:9]
In particular, it has been reported that in mouse breast cancer cells, miR-29b inhibits metastasis by targeting a network of pro-metastatic regulators involved in angiogenesis, collagen remo deling and proteolysis [13], whereas in the metastatic human breast cancer cell line MDA-MB-231, aberrant expression of miR-29b can contribute to migration and invasion [17]. [score:8]
Thus, in TNBC cells the simultaneous miR-29b-1-5p down regulation and SPIN1 up-regulation can potentially be associated with TNBC malignancy and may be a potential new druggable target for TNBC. [score:7]
Enrichment of miR-29b has been found in luminal breast cancers where it inhibits metastasis by targeting a network of pro-metastatic regulators involved in angiogenesis, collagen remo deling and proteolysis as VEGFA, PDGF, MMP9, indirectly affecting differentiation and epithelial plasticity, with loss of miR-29b increasing metastasis and promoting a mesenchymal phenotype. [score:7]
Moreover, in many malignant cells miR-29b was proved to be an epi-miRNA that targets DNA methyltransferases (DNMTs) and/or regulates DNA demethylation pathway members, leading to the downregulation of global DNA methylation [18]. [score:7]
Accordingly, in both cell lines the inhibition of endogenous miR-29b-1-5p by miR-29b-1-5p-LNA (a miR-29b-1-5p inhibitor), compared to the negative control, resulted in the upregulation of SPIN1 mRNA and protein (Figure 7F). [score:7]
In our previous studies on osteosarcoma (OS), a tumor in which the miRNA-29 family members (miR-29a/b/c; miR-29s) are often deregulated [20, 21], we found that ectopic expression of miR-29b-1 was able to suppress the stemness properties of the 3AB-OS cell line [22], a novel CSC line by us produced [23], suggesting that miR-29b-1 could be a novel therapeutic agent against OS. [score:6]
We observed that, after miR-29b-1 overexpression, paclitaxel effects were more potent than in cells in which miR-29b-1 was downregulated. [score:6]
We have shown that, in most TNBC specimens studied, SPIN1 appeared significantly upregulated and negatively correlated with miR-29b-1-5p expression. [score:6]
Here we demonstrated that miR-29b-1-5p expression was significantly downregulated in most TNBC tissues and in all the examined cell lines. [score:6]
The analysis of miR-29b-1-5p expression in all the four TNBC cell lines studies evidenced its strong downregulation (Figure 1B). [score:6]
Together, these results suggest that SPIN1 silencing induces a phenotype similar to that produced by miR-29b-1 overexpression also proposing that SPIN1 may be, at least in part, responsible for the effects triggered by miR-29b-1. In MDA-MB-231 and BT-20 cells miR-29b-1 overexpression represses WNT/β-catenin and Akt signalling pathways through SPIN1Wnt/β-catenin and AKT signaling have been found to be aberrantly activated and to play crucial roles in the development and progression of breast cancer [27]. [score:6]
In this study we analyzed the effects of paclitaxel on MDA-MB-231 and BT-20 cells in which miR-29b-1 was either downregulated or was ectopically overexpressed. [score:6]
Conversely, inhibiting endogenous miR-29b-1-5p, resulted in the upregulation of SPIN1 mRNA and protein, according to the fact that miR-29b-1-5p and SPIN1 show an inverse correlation. [score:6]
Taken together, these data suggest that miR-29b-1-5p by downregulating SPIN1 inhibits both WNT and Akt signaling pathways. [score:6]
To evaluate the effects of miR-29b-1 overexpression on these pathways and the possible role of SPIN1, we employed MDA-MB-231 and BT-20 TNBC cells in which either miR-29b-1 was up/down-regulated or SPIN1 expression was silenced. [score:6]
We found, in both, MDA-MB-231 and BT-20 cells (Figure 4F, top and bottom panels) that the inhibition of mammosphere-formation determined by miR-29b-1 overexpression was maintained also in the secondary and tertiary mammospheres. [score:5]
Thus, to assess if miR-29b-1 functions are required for the control of WNT/β-catenin and Akt signaling, we inhibited the endogenous miR-29b-1-5p by the miR-29b-1-5p-LNA inhibitor. [score:5]
We also found a strong SPIN1 expression in both MDA-MB-231 and BT-20 cells, which was remarkably reduced following ectopic miR-29b-1-5p overexpression. [score:5]
Searching putative miR-29b-1-5p targets we have found an algorithm predicting SPIN1 as potential target gene. [score:5]
This solidly suggested that miR-29b-1-5p downregulation could play a role in TNBC development. [score:5]
Moreover, in breast cancer patients miR-29b is shown to act as tumor suppressor and low miR-29b expression in primary tumor tissues is a prognostic factor for breast cancer patients [14]. [score:5]
The miScript Target Protector for the miR-29b-1-5p binding site in the 3′UTR of SPIN1 mRNA was obtained from Qiagen (target binding site sequence provided: 5′-AAAUCACAGUUACUUCUAAACCAGAUUUCA-3′; MTP0077240). [score:5]
MiR-29b has been reported to have many targets and to regulate ECM protein expression and tumor microenvironment. [score:5]
We have found that miR-29b-1-5p expression -compared to normal conditions- was significantly down-regulated. [score:5]
The results show (Figure 9B and 9D) that this inhibitor determined opposite effects to those obtained by miR-29b-1 overexpression (Figure 9A and 9C). [score:5]
We also showed that SPIN1-silencing decreased both the expression of the key stemness genes and MYC levels, thus mirroring the effects determined by miR-29b-1 overexpression. [score:5]
These findings suggested that miR-29b-1-5p down-regulation could play a role in TNBC development. [score:5]
In addition, it has been reported that miR-29b-1/mir-29a promoter sequence is regulated by MYC, contributing to mir-29 downregulation in human malignancies [53]. [score:5]
Moreover, miR-29b-1 overexpression markedly decreased MYC levels also lowering the expression of the key stemness genes OCT4, SOX2 and NANOG. [score:5]
These results were very similar to those already reported in Figure 3B (top panel) and 3C (left panel) for MDA-MB-231 cells overexpressing miR-29b-1. Also for mammosphere formation, wound closure, cell invasivity and paclitaxel effects SPIN1 silencing mimicked the effects of miR-29b-1 overexpression. [score:5]
Both MDA-MB-231 and BT-20 cell lines were allowed to grow till 90% confluence and then transfected with a locked nucleic acid (LNA) probe containing a sequence specific antisense oligonucleotide targeting has-miR-29b-1-5p, miRCURY LNA™ miR-29b-1-5p Power Inhibitor (50 nM, 427008-8, Exiqon A/S). [score:5]
Overall, these results suggest that miR-29b-1-5p could directly control SPIN1 and that it could exert its effects by keeping SPIN1 downregulated. [score:5]
In addition, using miScript target protector for SPIN1, our results suggested that SPIN1 may be directly controlled by miR-29b-1-5p. [score:4]
However, albeit the miR-29 family members share a common seed region sequence (thus predicting that they target overlapping sets of genes), they frequently exhibit differential regulation and different subcellular distribution, suggesting different functional importance [40]. [score:4]
Figure 7 (A) MiR-29b-1-5p predicted target site within SPIN1 3′UTR identified by TargetScan (top) and microRNA (bottom) online software. [score:4]
We have found that, upon miR-29b-1 upregulation, the Wnt and Akt signaling pathways deeply fell in MDA-MB-231 and BT-20 cells. [score:4]
MiR-29b-1 overexpression strongly inhibited migration and invasion of MDA-MB-231 and BT-20 cells. [score:4]
Moreover, in human luminal breast cancer, GATA3 - which works by regulating miRNA-29b expression - emerged as a strong predictor of clinical outcome [13]. [score:4]
In addition, in human ER+PR+ breast cancer cells, the downregulation of miR-29 members increases mammosphere formation in vitro and tumor initiating capability in vivo [19]. [score:4]
We found that SPIN1 seems to be directly controlled by miR-29b-1-5p and that SPIN1 silencing mirrored the effects of miR-29b-1 overexpression. [score:4]
As Wnt/β-catenin and AKT signalling have been found to be aberrantly activated and to play crucial roles in the development and progression of breast cancer [27, 50, 51], we also analysed the effects of miR-29b-1 overexpression and the possible role of SPIN1 on these pathways. [score:4]
Figure 9MiR-29b-1 represses Wnt/β-catenin and Akt signalling pathways through SPIN1 in TNBC cells(A and B) Evaluation of mRNA and protein expression of Wnt/β-catenin, Akt pathway and stemness regulators in MDA-MB-231 and BT-20 cells stably transfected with empty vector (control) and miR-29b-1 expressing vector (miR-29b-1). [score:4]
miRCURY LNA™ miR-29b-1-5p Mimic (25 nM; 470851-001; Exiqon A/S) was transfected alone or co -transfected with miScript Target Protector (25 nM) into MDA-MB-231 and BT-20 cells according to the manufacturer's protocol. [score:3]
BT-20 cells (Figure 5A, bottom panel and 5B, right panel) evidenced a migration ability much lower than MDA-MB-231 cells, as at 32 h, the scratch in control cells was very far from being repaired and miR-29b-1 overexpression furthermore lowered (about 10%) cell repairing capacity. [score:3]
MiRNA-29b-1-5p is downregulated in TNBC tissues and cell lines. [score:3]
Moreover, ectopic miR-29b-1 markedly decreased self-renewal capacity of the cells even inhibiting their migration and invasive properties. [score:3]
Overall, these results suggest that ectopic miR-29b-1 expression sensitizes the cells to the effects of paclitaxel. [score:3]
Moreover, using SPIN1 miScript protector, we demonstrated that SPIN1 rescue reversed the molecular effects produced by the mimic-miR-29b-1-5p on the expression of genes (OCT4, SOX2, NANOG, MYC, PTEN, CXCR4 and VEGFA) involved in the cell functions analysed. [score:3]
To assess whether miR-29b-1 affects cell susceptibility to paclitaxel (one of the major drugs used for breast cancer chemotherapy), we treated MDA-MB-231 and BT-20 miR-29b-1overexpressing cells and their relative controls with 50, 100 and 200 nM paclitaxel for 24h. [score:3]
Phase contrast and fluorescence microscopy (Figure 4D, top panel) show that MDA-MB-231 control cells efficiently formed spheres whereas, following miR-29b-1 overexpression, they formed fewer primary mammospheres than control cells. [score:3]
Interestingly, the accumulation of the cells at the sub-G0/G1 phase and flow cytometry analysis of the Annexin V (Figure 3D and 3E) suggest that ectopic miR-29b-1 expression could lead to apoptosis. [score:3]
Conversely, the inhibition of miR-29b-1-5p produced opposite effects. [score:3]
analysis (Figure 9A, right panel) confirmed the effects of miR-29b-1 on MYC and PTEN expression, whereas, in contrast to mRNA analysis, it evidenced lower β-catenin and AKT1,2,3 levels. [score:3]
Effect of miR-29b-1 overexpression on cell proliferation markers and self-renewal in MDA-MB-231 and BT-20 cell lines. [score:3]
Ectopic overexpression of miR-29b-1 in MDA-MB-231 cells and BT-20 cells. [score:3]
Moreover, qRT-PCR and western blot analyses showed that miR-29b-1-5p overexpression strongly impairs SPIN1 mRNA and protein levels (Figure 7E). [score:3]
Figure 2(A and B) Phase contrast and fluorescence microscopy of untransfected cells and cells stably transfected with either empty vector (control) or miR-29b-1 expressing vector (miR-29b-1). [score:3]
Interestingly, in tertiary mammospheres we also observed a sharp decrease of miR-29b-1-5p expression with an inverse correlation with stemness. [score:3]
QRT/PCR and western blot analyses (Figure 10A and 10B) evidenced effects very similar to those determined by miR-29b-1 overexpression. [score:3]
Moreover, the effects of paclitaxel on cell cycle were in keeping with the perturbing effects induced by miR-29b-1 overexpression. [score:3]
QRT-PCR and western blot analyses (Figure 9C) show that miR-29b-1 overexpression potently decreased the mRNA and protein levels of these genes (in particular SOX2). [score:3]
In MDA-MB-231 cells, silencing SPIN1 mirrored the miR-29b-1 overexpression. [score:3]
In MDA-MB-231 and BT-20 cells, miR-29b-1 ectopic expression strongly decreased cell proliferation, viability, self-renewal, migration and invasiveness, also increasing sensitivity to paclitaxel. [score:3]
Predicted has-miR-29b-1-5p target genes were obtained using MIRDB database (http://mirdb. [score:3]
In BT-20 cells (Figure 3B, bottom panel and 3C, right panel) miR-29b-1 overexpression increased the percentage of cells at the sub-G0-G1 and G2-M-phases by 6.6% and 3.9% respectively, whereas at G0-G1 and S phases the percentage of cells decreased by 8.5% and 1.7%. [score:3]
Ectopic expression of miR-29b-1 in MDA-MB-231 and BT-20 cell lines. [score:3]
We also assessed whether paclitaxel induces changes on the perturbing activity of miR-29b-1 overexpression on cell cycle. [score:3]
Since in several types of tumors, including breast cancer Wnt/β-catenin and Akt- signaling pathways are implicated in the regulation of self-renewal of CSCs, and recently Akt has been identified as an upstream regulator of SOX2 protein in breast carcinoma [28], we also investigated whether miR-29b-1 affected the expression of OCT4, SOX2 and NANOG, key stemness genes. [score:3]
Moreover, in MDA-MB-231 cells, cell growth, viability, self-renewal, responsiveness to paclitaxel, migration and invasion, similarly changed by either miR-29b-1 overexpression or SPIN1-silencing. [score:3]
Anyhow, to our knowledge, to date, the functional expression and the role of miR-29b-1-5p in breast cancer, particularly in TNBC cancer, have not yet been elucidated. [score:3]
Together, these results suggest that SPIN1 silencing induces a phenotype similar to that produced by miR-29b-1 overexpression also proposing that SPIN1 may be, at least in part, responsible for the effects triggered by miR-29b-1. (A) Real-time RT-PCR and western blot analyses of MDA-MB-231 cells stably transfected with either sh-Ctrl or sh-SPIN1. [score:3]
The only difference was that, in confront to that evidenced by miR-29b-1 overexpression (Figure 9A) here western blot analysis evidences a lowering in pAKT levels stronger than in AKT levels, suggesting that SPIN1 could even control AKT phosphorylation. [score:3]
In MDA-MB-231 cells (Figure 6A) analysis of relative cell number (left panel) shows that, in control cells, 50, 100 and 200 nM paclitaxel decrease cell growth by 13.7%, 33.4% and 37.3% respectively, whereas in cells overexpressing miR-29b-1 the decrease was 35.4%, 62.6% and 67%, respectively. [score:3]
In MDA-MB-231 and BT-20 cells miR-29b-1 overexpression represses WNT/β-catenin and Akt signalling pathways through SPIN1. [score:3]
Thus, to understand the role of miR-29b-1 in TNBC cells, it was ectopically overexpressed in MDA-MB-231 and BT-20 cells. [score:3]
In BT-20 cells overexpressing miR-29b-1 paclitaxel 50 nM and 100 nM increased the percentage of PI positive cells from 7.9% to 15.8% and 25.6%, respectively. [score:3]
To identify potential miR-29b-1-5p targets, we used a bioinformatics approach through the MIRDB. [score:3]
Vector construction for miR-29b-1 expression was previously described [22]. [score:3]
Eventually, we assessed whether SPIN1 could be involved in MDA-MB-231 and BT-20 cells tumorigenesis and invasivity and if it could be a miR-29b-1-5p target. [score:3]
miRCURY LNA™ miR-29b-1-5p Mimic and Negative Control Target Protector (25 nM; MTP0000002; Qiagen) designed not to bind the mRNA of mammals were co -transfected into TNBC cell lines as a negative control. [score:3]
The results reported in Figure 10C demonstrate that SPIN1 rescue determines the reversal of the molecular effects produced by the mimic-miR-29b-1-5p on the expression of genes (OCT4, SOX2, NANOG, MYC, PTEN, CXCR4 and VEGFA) involved in the cell functions here analyzed. [score:3]
In MDA-MB-231 and BT-20 cells paclitaxel enhances the perturbing effects induced on cell cycle by miR-29b-1 overexpression. [score:3]
Cytofluorimetric analysis of the proliferation marker Ki-67 (Figure 4A and 4B) shows that by miR-29b-1 overexpression, both MDA-MB-231 and BT-20 cells resulted to be less Ki-67 -positive than control cells. [score:3]
Effect of ectopic expression of miR-29b-1 on cell growth, viability, cell cycle distribution and apoptosis in MDA-MB-231 and BT-20 cell lines. [score:3]
Mir-29b is known to regulate a number of important genes that mediate carcinogenesis and tumor development in breast cancer [13]. [score:2]
Dysregulation of miR-29 family has been reported in various cancers including breast cancers [15, 16, 34, 41, 42]. [score:2]
MiR-29b-1-5p expression in TNBC tissues and cell lines, and mammosphere formation ability of TNBC cell lines. [score:2]
Overall, our data show that miR-29b-1-5p deregulation impacts on multiple oncogenic features of TNBC cells and their renewal potential, acting through SPIN1 action and suggest that both these factors should be further evaluated as new possible therapeutic targets against TNBC. [score:2]
MiR-29b-1 overexpression reduces migration and invasion of MDA-MB-231 and BT-20 cell lines. [score:2]
To test whether, low/absent miR-29b-1 levels are necessary for self-renewal in MDA-MB-231 and BT-20 cells, we studied the effect of miR-29b-1 overexpression by mammosphere assay. [score:2]
Cell cycle analysis by flow cytometry evidenced that in MDA-MB-231 cells compared to control cells, (Figure 3B, top panel and 3C, left panel) miR-29b-1 overexpression increased the percentage of cells at the sub-G0-G1 and G2-M-phases by 11.1% and 2.2% respectively, whereas it decreased the percentage of cells at the G0-G1 and S phases by 13.6% and 3.9% respectively. [score:2]
MiR-29b-1 overexpression increased to 14% the percentage of PI positive cells, whereas 100 and 200 nM paclitaxel increased this percentage to 19.4% and 22.5% respectively. [score:2]
MiR-29b-1 overexpression significantly decreased growth rate in both cell lines (left panels), showing decreased viability in MDA-MB-231 cells, but not in BT-20 cells (right panels). [score:2]
MiR-29b-1 overexpression markedly decreased self-renewal capacity of MDA-MB-231 and BT-20 cells. [score:2]
QRT-PCR assays (Figure 2C) evidences that, following pre-miR-29b-1 transfection, miR-29b-1-5p levels were up-regulated in MDA-MB-231 and BT-20 cells, compared with both control and untransfected cells, by approximately 19-fold and 6.5-fold, respectively (Figure 2C). [score:2]
QRT-PCR analysis (Figure 9A, left panel) showed that miR-29b-1 overexpression, compared to control cells, markedly decreased MYC levels whereas significantly increased PTEN levels. [score:2]
MiR-29b-1 overexpression increases sensitivity of MDA-MB-231 and BT-20 cell lines to paclitaxel. [score:2]
These data suggest that miR-29b-1-5p can regulate SPIN1 at both mRNA and protein levels. [score:2]
MiR-29b-1 inhibited MDA-MB-231 and BT-20 cell proliferation by perturbing cell cycle. [score:2]
These results suggest that SPIN1 may be directly controlled by miR-29b-1-5p. [score:2]
Interestingly, in tertiary mammospheres compared to adherent cells, miR-29b-1-5p expression dramatically decreased (Figure 1G), suggesting its inverse correlation with stemness. [score:2]
In MDA-MB-231 cells wound healing assay (Figure 5A, top panel and 5B, left panel) showed that, at 8 h and 32 h after scratching, cells overexpressing miR-29b-1 migrated more slowly than control cells. [score:2]
Also the relative invasion ability of both MDA-MB-231 and BT-20 was severely impaired by miR-29b-1 overexpression, as assessed through transwell invasion assay (Figure 5C, bottom panels). [score:2]
Figure 1 (A) miR-29b-1-5p expression was determined in 21 TNBC specimens (T) compared to 6 controls (N). [score:2]
MiR-29b-1-5p targets SPIN1. [score:2]
SPIN1 is under the control of miR-29b-1-5p. [score:1]
Indeed, after 32 h, the wound area was almost recovered in control cells whereas in miR-29b-1 cells wound closure was 38% lower. [score:1]
RNA-isolation and real-time RT-PCR for detection of miR-29b-1-5p and SPIN1 in FFPE samples Total RNA was isolated from FFPE tissues (five sections of 10 μm in thickness) using the RNA isolation kit FFPE (300115, Exiqon A/S, Vedbaek, Denmark) according to the manufacturer's instructions. [score:1]
This is a particularly important aspect of our research, because it is known that in the big family of miR-29 each member plays often opposing functions. [score:1]
This background led us to study the role of miR-29b-1 in TNBC cells. [score:1]
MiR-29 family consists of four closely related members (miR-29a, miR-29b-1, miR-29b-2 and miR-29c). [score:1]
To assess whether miR-29b-1-5p expression correlated with TNBC regenerative potential, we first evaluated the enrichment in CSCs of the TNBC cell lines. [score:1]
Moreover, miR-29b-1 significantly decreased the invasive ability of MDA-MB-231 cells (Figure 5C, top panel), which was 34% lower than control cells. [score:1]
The relationship between miR-29b-1-5p and SPIN1 expression was determined by evaluating Pearson's correlation coefficient (r). [score:1]
For stable transfection, MDA-MB-231 and BT20 cells were plated in 6-well dishes until they reached 90% confluence and then transfected with 3 μg of pCDHCMV-MCS-EF1-copGFP-T2A-PURO-miR-29b-1 or empty vector as a control (hereafter indicated as miR-29b-1 cells and control cells, respectively), using TransIT-X2™ Dynamic Delivery System (MIR 6003, Mirus Bio LLC, Madison, WI, USA) according to manufacturer's instructions. [score:1]
In BT-20 cells (Figure 6B), 50, 100 and 200 nM paclitaxel decreased the growth of control cells by 21.3%, 36.1% and 49.1% respectively, whereas in miR-29b-1 cells these concentrations decreased the growth by 37.2%, 58.3% and 69.3% respectively (left panel). [score:1]
Overall, these data reinforce the idea that miR-29b-1 may be involved in the control of growth and self-renewal capacity of MDA-MB-231 and BT-20 cells. [score:1]
The expression of miR-29b-1-5p in human triple -negative breast cancer (TNBC) tissues and cell lines, was evaluated by quantitative RT-PCR (qRT-PCR). [score:1]
In addition, RT-PCR analyses of the proliferative markers MKI67 and HIST4H4, show that miR-29b-1 markedly decreased their levels (Figure 4C). [score:1]
RNA-isolation and real-time RT-PCR for detection of miR-29b-1-5p and SPIN1 in FFPE samples. [score:1]
Interestingly, the effects of paclitaxel were in keeping with the perturbing effects of miR-29b-1 on the cell cycle. [score:1]
However miR-29b-1 did not change AKT1,2,3 and β-catenin (CTNNB1) levels. [score:1]
For miR-29b-1-5p detection, hsa-miR-24-3p (204260, Exiqon A/S), hsa-miR-26b-3p (204117, Exiqon A/S) and U6 snRNA (203907, Exiqon A/S) were used as control genes. [score:1]
Phase contrast microscopy (left panels) fluorescence microscopy (middle panels) and flow cytometry (right panels) of the green fluorescent protein (GFP) show, in both control and miR-29b-1 cells, a strong positivity for GFP (>92%), which demonstrates a high transfection efficiency. [score:1]
This suggested that in both cell lines the self-renewal capacity of each miR-29b-1 cell-generating sphere was much lower than in control cells. [score:1]
This could contribute to the effects induced by miR-29b-1 on proliferation, self-renewal, migration, invasion and chemosensitivity in TNBC cells. [score:1]
The same figure also shows that miR-29b-1 decreased their dimension. [score:1]
To investigate the effects of miR-29b-1 overexpression in MDA-MB-231 cells and BT-20 cells (Figure 3A), the cells were incubated for 0-96 h under cultural conditions, then, cell growth was analyzed by cell count, and cell viability by propidium iodide (PI) exclusion. [score:1]
For miR-29b-1-5p detection, cDNA samples were made out 40 ng of total RNA using the miRCURY LNA™ Universal RT microRNA PCR Universal cDNA Synthesis kit II (203301, Exiqon A/S) according to the manufacturer's recommendations. [score:1]
In MDA-MB-231 cells the percentage of SFE of miR-29b-1 cells was about 64% lower than control cells (Figure 4E, top panel, left), whereas the mean diameter of miR-29b-1 spheres (bottom panel, left)) was about 22% smaller than in control spheres. [score:1]
To further assess whether miR-29b-1 may control mammosphere self-renewal, primary mammospheres were dissociated into single cells and reseeded to analyze the ability to form secondary and tertiary mammospheres. [score:1]
Here we evaluated miR-29b-1-5p expression in human TNBC specimens and cell lines, employing both human TNBC FFPE tissues and TNBC cell lines. [score:1]
Overall, these results suggest that ectopic miR-29b-1 represses WNT/β-catenin and Akt signaling pathways. [score:1]
To further elucidate the role of SPIN1, we also analyzed whether, using SPIN1 miScript protector, the effects produced by the mimic-miR-29b-1-5p could be reversed. [score:1]
[1 to 20 of 140 sentences]
3
[+] score: 472
Since, hsa-miR29b expression in NSCLC cells is anti-proliferative, we hypothesize that expression of hsa-miR29b might downregulate MDM2 expression. [score:10]
These data suggest that loss of hsa-miR29b in cancers might lead to MDM2 upregulation and corresponding downregulation of p53 tumor suppressor. [score:9]
Although PTEN and Cdk2 display hsa-miR29b target sites (Fig.  4A), expression of hsa-miR29b in A549 or H157 cells had no impact either on PTEN (Fig.  4E) or Cdk2 (Fig.  4F) expression, suggesting that the observed effects of hsa-miR29b on MDM2 expression are indeed specific. [score:9]
Similar to the effects of ERK5 expression, overexpression of PPARγ in A549 or H157 cells also induced a 28-fold (A549, Fig.  3E) and 54-fold (H157, Fig.  3F) increase in hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c expression, as determined by Q-RT-PCR (Fig.  3E,F). [score:9]
Interestingly, the expression of Wnt7a in A549 cells (that lack endogenous Wnt7a) severely attenuated A549 cell proliferation (Fig.  2F), whereas depletion of hsa-miR29b in A549 cells re -expressing Wnt7a blocked the inhibitory effects of Wnt7a expression on A549 cell growth (Fig.  2F). [score:9]
Consistent with the induction of p53 -dependent gene transcription upon hsa-miR29b expression, knockdown of hsa-miR29b expression in non-transformed cells (Beas2B) resulted in reduced p53 -dependent gene transcription (Fig.  4I), an effect similar to that of PPARγ inhibition (Fig.  4I) (Winn et al., 2006). [score:8]
The reason for selecting hsa-miR29b over other miRNAs is 2-fold: 1) hsa-miR29b was upregulated by more than 19-fold in A549 cells expressing Wnt7a in comparison to empty vector control (Table 1), and 2) several studies have shown either a direct or an indirect role for hsa-miR29b in human cancers (Fabbri et al., 2007; Kole et al., 2011; Rothschild et al., 2012; Ru et al., 2012). [score:8]
We confirmed our observation experimentally through hsa-miR29b expression, wherein expression of hsa-miR29b could block the expression of MDM2 both at the transcript level and protein level (Fig.  4). [score:7]
To ascertain that the effects of hsa-miR29b expression on MDM2 were specific and that there were no off-target effects, we also tested the effects of hsa-miR29b re -expression on other proteins identified in silico, viz. [score:7]
Interestingly, Q-RT-PCR analyses of RNA isolated from ERK5 overexpressing NSCLC cells, revealed a 4-fold (A549) and a 3-fold (H157) increase in hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c expression (Fig.  3A,B). [score:7]
In order to identify potential hsa-miR29b targets, which are specific to lung cancer and tumor suppressor pathway, we scanned for hsa-miR29b targets in silico (http://www. [score:7]
In cells expressing the reporter, mature hsa-miR29b targets the binding site downstream of luciferase gene resulting in repression in luciferase gene expression and as detected by reduced luciferase enzyme activity. [score:7]
In strong contrast, treatment of Wnt7a expressing A549 or H157 cells with U0126 [that blocks only MEK 1 and 2 (Cameron et al., 2003; Kamakura et al., 1999; Winn et al., 2006)] has no impact on Wnt7a -induced hsa-miR29b expression (Fig.  3D), strongly suggesting that ERK5 (but not ERK 1 and 2) mediates Wnt7a -induced hsa-miR29b expression. [score:7]
Since, Wnt7a induce hsa-miR29b expression in NSCLC cell lines (Table 1; Fig.  1) and Wnt7a expression is lost in a majority of NSCLC cell lines (Winn et al., 2005), we probed next for the expression levels of hsa-miR29b in a panel of NSCLC cell lines using quantitative RT-PCR (qPCR, Fig.  2A). [score:7]
We show herein that hsa-miR29b expression is lost in non-small cell lung cancer (NSCLC) cell lines and stimulation of β-catenin independent signaling, via Wnt7a expression, in NSCLC cell lines results in increased expression of hsa-miR29b. [score:7]
Although a speculation, PPARγ might impose an indirect control on hsa-miR29b expression and regulate the biogenesis of mature form of hsa-miR29b, since Wnt7a or ERK5 could stimulate only the expression of mature form of hsa-miR29b (Figs 1, 3). [score:7]
Consistent with the effects on MDM2 expression, expression of hsa-miR29b in A549 cells increased p53 expression as determined by western blots with anti-p53 antibodies (Fig.  4G). [score:7]
Interestingly, knockdown of hsa-miR29b was enough to abrogate the tumor suppressive effects of Wnt7a and Fzd9 expression in NSCLC cells, suggesting that Wnt7a and/or hsa-miR29b plays a critical during lung tumorigenesis. [score:6]
As a strategy to identify potential miRNAs involved in the Wnt7a -dependent regulation of NSCLC cell growth, we performed miRNA expression profiling on Wnt7a-stimulated human lung adenocarcinoma cell line (A549) and identified hsa-miR29b as an important downstream target of Wnt7a. [score:6]
Since, hsa-miR29b expression was attenuated in all the NSCLC cell lines tested; we probed next if hsa-miR29b could affect NSCLC cell proliferation, either by using gene specific knockdowns (Fig.  2B,C) or re -expression of hsa-miR29b (Fig.  2D,E) in NSCLC cells. [score:6]
Finally, we also show that hsa-miR29b plays an important role as a tumor suppressor in lung cancer by targeting murine double mutant 2 (MDM2), revealing novel nodes for Wnt7a/Fzd9 -mediated regulation of NSCLC cell proliferation. [score:6]
hsa-miR29b induction later promotes downregulation of MDM2, increased p53 expression, and reduced cell proliferation (Fig.  5). [score:6]
Finally, we show for the first time that hsa-miR29b plays an important role as a tumor suppressor in lung cancer by targeting murine double mutant 2 (MDM2), revealing novel nodes for Wnt7a/Frizzled9 -mediated regulation of NSCLC cell proliferation. [score:6]
Expression of hsa-miR29b, on the contrary, failed to impact Wnt7a expression (data not shown). [score:5]
The same study also identified an inhibitor of DNA binding/differentiation 1 (ID1) as a novel target for hsa-miR29b (Rothschild et al., 2012), in addition to DNA methyl transferase 3B [DNMT3B (Fabbri et al., 2007)]. [score:5]
Furthermore, the loss of hsa-miR29b expression results in increased levels of MDM2, reduced p53 expression, and increased cell proliferation (Fig.  5). [score:5]
List of lung cancer-specific tumor-suppressor genes with potential hsa-miR29b targets. [score:5]
Consistent with our q-RT-PCR and Northern analysis, Wnt7a stimulation of three different NSCLC cells (A549, H157+Fzd9, and H661) expressing hsa-miR29b-luciferase reporter plasmid displayed a similar reduction in luciferase activities, strongly indicating an increased hsa-miR29b expression upon Wnt7a stimulation (Fig.  1F). [score:5]
Consistent to their effects on MDM2 mRNA, re -expression of hsa-miR29b in A549 or H157 cells (Fig.  4D) resulted in reduced MDM2 expression (Fig.  4D). [score:5]
The ability of PPARγ to induce hsa-miR29b expression suggests that induction of hsa-miR29b expression is the most distal event of Wnt7a signaling. [score:5]
Consistent with our Q-RT-PCR analyses, PPARγ expression also induced hsa-miR29b expression in NSCLC cells (A549, H157 and H661), as revealed by reduced hsa-miR29b-luciferase activities (Fig.  3G). [score:5]
The hsa-miR29b expression targets MDM2 mRNA to degradation, which results in increased p53 levels and reduced cell proliferation. [score:5]
Another study suggests increased efficacy of combination therapy of EGFR antibody with cisplatin/gemcitabine might be due to increased expression of hsa-miR29b and reduced expression of anti-apoptotic genes like DNA methyltransferease 3B (Samakoglu et al., 2012). [score:5]
In total, the results from several distinct and powerful analyses reveal a consistent story: Wnt7a stimulates hsa-miR29b expression and hsa-miR29b modulates NSCLC cell proliferation via repressing MDM2 expression. [score:5]
Consistent with the effects of hsa-miR29b knockdown on Beas2B cell proliferation, re -expression of hsa-miR29b was inhibitory to the cell growth of A549 or H157 cells as determined by clonogenic (Fig.  2D) or MTS cell proliferation assays (Fig.  2E). [score:5]
We show herein that hsa-miR29b expression is lost in NSCLC cell lines and Wnt7a-stimulation of NSCLC cell lines results in increased expression of hsa-miR29b. [score:5]
Interestingly, treatment of Wnt7a expressing A549 or H157+Fzd9 cells with PD98059 [that blocks, MEK 1, 2 and 5, (Cameron et al., 2003; Kamakura et al., 1999; Winn et al., 2006)], blocked Wnt7a -induced hsa-miR29b expression, as revealed by an increase in luciferase activities (Fig.  3D). [score:5]
For studies involving the use of MEK inhibitors PD98059 (20 µM, Sigma) or U0126, (10 µM, Calbiochem/EMD Biosciences, San Diego, CA), A549 and H157 cells were co -transfected either without or with pLNCX-Wnt7a-HA and hsa-miR29b-luciferase reporter plasmids followed by treatment with MEK inhibitors. [score:5]
Expression of Wnt7a, as expected induced hsa-miR29b expression as revealed by the reduced luciferase activities (Fig.  3D) in both the cell lines. [score:5]
miRNA expression profiling on a human lung adenocarcinoma cell line (A549) identified hsa-miR29b as an important downstream target of Wnt7a/Frizzled9 signaling. [score:5]
These data strongly suggest that Wnt7a specifically regulates hsa-miR29b expression in the lung, and that loss of Wnt7a and/or hsa-miR29b might be an important player in the development of lung cancer. [score:5]
In the presence of increased hsa-miR29b expression (Fig.  4B), we observed a corresponding decrease in MDM2 mRNA expression (by more than 50%) in both the cell lines tested (Fig.  4C). [score:5]
Indeed, re -expression of hsa-miR29b in NSCLC cells restored p53 expression and attenuated NSCLC cell proliferation (Fig.  4). [score:5]
For these studies, A549 or H157 cells expressing either hsa-miR29b luciferase reporter alone or together with Wnt7a-HA plasmid were treated without or with MEK inhibitors (Fig.  3D). [score:5]
We show herein that the activation of a β-catenin-independent pathway, mediated by Wnt7a/Fzd9, strongly induce hsa-miR29b expression in NSCLC cells (Fig.  1), while activators of β-catenin -dependent pathway (Wnt3), in strong contrast, failed to stimulate hsa-miR29b expression. [score:5]
Loss in hsa-miR29b expression results in increased MDM2 levels reduced p53 expression and increased cell proliferation. [score:5]
In the current study, we identify hsa-miR29b as a novel tumor suppressor, which is regulated by Wnt7a in NSCLC cells. [score:4]
hsa-miR29b regulates MDM2 expression. [score:4]
Interestingly, knockdown of hsa-miR29b was enough to abrogate the tumor suppressive effects of Wnt7a/Frizzled9 signaling in NSCLC cells, suggesting that hsa-miR29b is an important mediator of β-catenin independent signaling. [score:4]
hsa-miR29b regulates MDM2 expression in NSCLC cells. [score:4]
Of note, Wnt7a -mediated induction of hsa-miR29b expression is unidirectional. [score:4]
miRNA-29b suppresses prostate cancer metastasis by regulating epithelial–mesenchymal transition signaling. [score:4]
, PPARγ (Winn et al., 2006) could also regulate the expression of hsa-miR29b (Fig.  3E,F). [score:4]
Co -expression of hsa-miR29b and p53-luciferase reporter in A549 cells resulted in an 8-fold induction in p53 -dependent gene transcription in comparison to A549 cells transfected with p53-luciferase reporter alone (Fig.  4H). [score:3]
To test if the anti-proliferative effects of Wnt7a in NSCLC cells are mediated via the induction of hsa-miR29b, we first stimulated A549 cells with Wnt7a (to induce hsa-miR29b expression), followed by treatment with miR29b precursors. [score:3]
Since, normal bronchial epithelial cells (Beas2B) express high levels of hsa-miR29b (Fig.  2A), we first probed the effects of chemically synthesized double stranded miR29b precursor molecules (Ambion, anti-miR29b1 and anti-miR29b2) on Beas2B cell proliferation. [score:3]
Consistent with our PCR array and q-RT-PCR data, Northern analysis revealed a robust Wnt7a -induced expression of hsa-miR29b, as detected by hsa-miR29b specific probes (Fig.  1D). [score:3]
ERK5 and PPARγ modulate hsa-miR29b expression in NSCLC cells. [score:3]
It was also interesting to note that Wnt7a stimulated the expression of only the mature form of hsa-miR29b but not its primary or precursor form (Fig.  1D). [score:3]
We therefore probed if ERK5 could also modulate hsa-miR29b expression (Fig.  3A,B). [score:3]
In silico analysis for hsa-miR29b complimentary sites identified MDM2 as a potential target (Fig.  4A). [score:3]
Total RNA was extracted from a non-transformed cell line (Beas2B) or NSCLC cell lines (A549, H157, H661 and H2122) and hsa-miR29b expression was quantified as described in. [score:3]
In addition, NSCLC cell lines displaying Wnt7a loss also showed an accompanying loss of hsa-miR29b expression (Fig.  2). [score:3]
In order to test the specificity of ERK5 -mediated induction of hsa-miR29b, we made use of hsa-miR29b-specific luciferase reporter and MEK inhibitors, PD98059 and U0126 (Fig.  3D). [score:3]
miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. [score:3]
In total, by using several distinct and powerful analyses we establish that activation of a β-catenin-independent pathway by Wnt7a stimulates the expression of hsa-miR29b, but not hsa-miR29a or hsa-miR29c, in NSCLC cells. [score:3]
Thus, Wnt7a mediated regulation of hsa-miR29b represents a novel mechanism for Wnt7a/Fzd9 -mediated regulation of NSCLC cell proliferation. [score:3]
Q-PCR established the relative expression of hsa-miR29b in normal and NSCLC cell lines (Fig.  2A). [score:3]
ERK5 and PPARγ stimulate hsa-miR29b expression in NSCLC cells. [score:3]
Therefore, a decreased luciferase activity represents increased expression of hsa-miR29b and vice versa. [score:3]
Stimulation of NSCLC cells with Wnt7a not only induced the expression of hsa-miR29b but also attenuated NSCLC cell proliferation (Tennis et al., 2010; Winn et al., 2005). [score:3]
It was interesting to note that Wnt7a induced the expression of only hsa-miR29b but not hsa-miR29a or hsa-miR29c (supplementary material Table S1). [score:3]
A549 or H157 cells were transfected either with empty vector or phsa-miR29b plasmid for 24 h. The lysates were later immunoblotted for MDM2 (D), PTEN (E) and Cdk2 (F) expression. [score:3]
Schematic representation of the role of Wnt7a -induced hsa-miR29b expression in NSCLC proliferation. [score:3]
In addition, ERK5 and PPARγ, key effectors of Wnt7a/Fzd9 pathway, were also observed to be strong inducers of hsa-miR29b expression. [score:3]
To further validate our findings, we also tested the effects of hsa-miR29b re -expression on MDM2 protein levels. [score:3]
In strong agreement with our observations, recent studies also reveal specific induction of hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c (Kole et al., 2011; Rothschild et al., 2012; Ru et al., 2012). [score:3]
These data suggest that has-miR29b is a novel downstream target of Wnt7a/Fzd9 signaling and the anti-tumorigenic effects of Wnt7a in NSCLC cells. [score:3]
Absence of Wnt7a in NSCLC fails to activate the Wnt7a/Fzd9 pathway, which in turn fails to induce hsa-miR29b expression. [score:3]
We show herein for the first time that Wnt7a/Fzd9 signaling pathway in NSCLC cells leads to increased expression of hsa-miR29b (Fig.  1). [score:3]
Mature hsa-miR29b upon binding to its complimentary sequence in the reporter repress luciferase gene expression. [score:3]
Interestingly, ERK5, obligate for Wnt7a-stimulated PPARγ activation, was also observed to be indispensable for hsa-miR29b expression. [score:3]
In NSCLC, on the contrary, absence of Wnt7a fails to activate Wnt7a/Fzd9 pathway, which blocks induction of hsa-miR29b expression. [score:3]
Surprisingly, in the hsa-miR29 family, Wnt7a induced the expression of only hsa-miR29b, but not hsa-miR29a or hsa-miR29c. [score:3]
Real-time PCR analyses of the expression of hsa-miR29a, hsa-miR29b and hsa-miR29c in NSCLC cell lines. [score:3]
Additionally, we also performed Northern blot analysis using [32]P -labelled hsa-miR29b or hsa-miR29a/c specific probes to confirm the Wnt7a -induced hsa-miR29b expression (Fig.  1D). [score:3]
Consistent with our PCR array data, Wnt7a induced the expression of hsa-miR29b, but not hsa-miR29a or hsa-miR29c (Fig.  1B,C). [score:3]
Therefore, a decrease in luciferase activity represents increased expression of hsa-miR29b and vice versa. [score:3]
These data strongly suggest that the anti-proliferative effects of PPARγ are also mediated via the induction of hsa-miR29b expression. [score:3]
Wnt7a -induced hsa-miR29b expression is represented as the percentage of empty vector control. [score:3]
The reporter plasmids (hsa-miR29b-luciferase reporter and p53 luciferase-reporter), expression plasmids (pLNCX-Wnt7a-HA, pCDNA3.2-ERK5, pCDNA3.1-PPARγ and Fzd9) and CMV-β-galactosidase control plasmids were transiently transfected into NSCLC cells using LipofectAmine reagent (18324-012, Invitrogen, Carlsbad, CA, USA) as per the manufacturer's recommendations. [score:3]
Wnt7a/Fzd9 signaling regulates hsa-miR29b. [score:2]
We also interrogated Wnt7a -mediated regulation of hsa-miR29b by using an hsa-miR29b-specific luciferase reporter plasmid (Fig.  1E). [score:2]
In a more recent study, an important role for c-Src kinase in the regulation of hsa-miR29b was identified in human lung adenocarcinoma (Rothschild et al., 2012). [score:2]
Interestingly, our screening succeeded in identifying hsa-miR29b as a novel miRNA regulated by Wnt7a. [score:2]
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. [score:2]
Surprisingly, we also identify specific regulation of hsa-miR29b by Wnt7a but not by Wnt3, a ligand for β-catenin -dependent signaling. [score:2]
hsa-miR29b knockdown studies. [score:2]
hsa-miR29b regulates NSCLC cell proliferation. [score:2]
Interestingly, hsa-miR29b expression was severely attenuated in all the NSCLC cell lines tested when compared to non-transformed bronchial epithelial cell line (Beas2B, Fig.  2A). [score:2]
These data suggest that Wnt7a regulates hsa-miR29b, but not hsa-miR29a or hsa-miR29c. [score:2]
The current study also reveals a novel role for hsa-miR29b in MDM2 regulation. [score:2]
To corroborate our PCR array data, we performed q-RT-PCR analyses on RNAs isolated from two NSCLC cell lines (H661 and H157) transiently transfected with either empty vector, Wnt3, or Wnt7a expression vectors and by using primers specific for the hsa-miR29 family members (Fig.  1B,C). [score:2]
MicroRNA-29b is involved in the Src-ID1 signaling pathway and is dysregulated in human lung adenocarcinoma. [score:1]
Treatment of Beas2B cells with miR29b precursors showed a significant decrease in hsa-miR29b levels (>50%, Fig.  2B). [score:1]
Our data would also suggest that identifying pharmacological activators of Wnt7a/Fzd9 pathway and/or hsa-miR29b might have utility in the treatment of lung cancer. [score:1]
On the contrary, activation of Wnt7a/Fzd9 signaling by Wnt7a, and mediated by ERK5 and PPARγ, leads to the induction of hsa-miR29b. [score:1]
LR-0062), in which the mature hsa-miR29b complementary sequence was sub-cloned downstream of luciferase gene. [score:1]
After 48 h, total RNA was extracted and the expression levels of hsa-miR29b were measured as described in. [score:1]
hsa-miR29b-luciferase reporter plasmid was purchased from Signosis (Cat. [score:1]
Beas2B cells were treated with either negative control or synthetic double stranded miR29b precursors. [score:1]
Wnt7a/Fzd9 signaling leads to induction hsa-miR29b, which is mediated by ERK5 and PPARγ. [score:1]
We also confirmed that ERK5 -induced hsa-miR29b levels in A549 cells via Northern analyses (Fig.  3C). [score:1]
Fig. 5. Wnt7a/Fzd9 signaling leads to induction hsa-miR29b, which is mediated by ERK5 and PPARγ. [score:1]
Fig. 1. (A) Multiple alignments of hsa-miR29a, hsa-miR29b and hsa-miR29c. [score:1]
After 16 h, cells were transfected with 30 nM each of chemically synthesized double stranded miR29b precursors [Ambion, anti-miR29b1 (AM1234) and anti-miR29b2 (AM12626)] or with a negative control (AM17010, Ambion Life Technologies, Grand Island, NY) using Attractene Transfection Reagent (301005, Qiagen, Valencia, CA). [score:1]
A549, H157 and H661 cells were transfected either with empty vector or pLNCX-Wnt7a-HA along with hsa-miR29b luciferase reporter plasmid. [score:1]
The hsa-miR29b pcDNA plasmid was a kind gift from Dr Gregory Gores (Mayo Clinic). [score:1]
Beas2B cells were transfected with negative control precursors or chemically synthesized double stranded miR29b precursors (Ambion, 30 nM each of anti-hsa-miR29b-1 and anti-hsa-miR29b-2) together with p53 luciferase reporter plasmid. [score:1]
In this reporter, the complimentary sequence of hsa-miR29b has been engineered downstream of luciferase gene (Fig.  1E). [score:1]
We tested our hypothesis by measuring MDM2 transcript levels by Q-PCR in A549 and H157 cells upon re -expression of hsa-miR29b (Fig.  4B). [score:1]
In summary, we propose herein a novel role for Wnt7a/Fzd9 signaling in inducing hsa-miR29b. [score:1]
For these experiments, total RNA was extracted from normal lung bronchial epithelial cells (Beas2B), lung adenocarcinoma (A549, H2122), squamous cell carcinoma (H157+Fzd9) and large cell carcinoma cell lines (H661), reverse transcribed and the cDNAs were later used to measure the levels of hsa-miR29b expression (Fig.  2A). [score:1]
The binding site of hsa-miR29b differs from that of hsa-miR29a or hsa-miR29c at the underscored bases. [score:1]
The membranes were probed with 5′ end [32]P-γ-ATP -labeled DNA oligonucleotides of either hsa-miR29b (AACACTGATTTCAAATGGTGCTA) or hsa-miR29a/c (TAACCGATTTCAGATGGTGCTA and CCGATTTCAAATGGTGC, since the mature sequences of hsa-miR29a/c differ in only one nucleotide, we used the probes together). [score:1]
A549 or H157 cells were transfected either with empty vector or phsa-miR29b plasmid. [score:1]
[1 to 20 of 126 sentences]
4
[+] score: 400
e, analysis of PTEN mRNA expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively In the present study, we provided evidence that miR-29b expression in high-metastatic CD133 -positive A549 lines was down-regulated when compared to miR-29b expression in paired low-metastatic CD133-negtive A549 cell lines, miR-29b was confirmed directly targeted 3’-UTR of PTEN and MMP2 mRNAs and down-regulated MMP2 protein expression to suppress lung cancer metastasis in vitro and in vivo. [score:21]
We provided important evidence that miR-29b could suppress NSCLC cells proliferation, migration and invasion by targeting the 3’-UTR of MMP2 and PTEN mRNA to down-regulate MMP2 protein expression. [score:10]
Taken together, our results demonstrate that miR-29b serves as a tumor metastasis suppressor, which suppresses NSCLC cell metastasis by directly inhibiting MMP2 expression. [score:10]
Among the predicted target genes of the seven down-regulated miRNAs in CD133 -positive A549 cells, the tumor metastasis PCR array contained four target genes of miR-29b (Fig.   1c). [score:8]
In summary, our studies demonstrated that down-regulated miR-29b expression was found to be associated with increased MMP2 expression in CD133 -positive NSCLC cells through microarrays and bioinformatics analysis. [score:8]
e, analysis of PTEN mRNA expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively To explore the miRNAs related to NSCLC metastasis, miRNA PCR array (MAH-3100A detected 376 human disease–related miRNA) were used to evaluate miRNA expression in primary cultured CD133 -positive/negative A549 cells. [score:7]
Similar results were obtained when miR-29b inhibitor was transfected into the H460 cells, the miR-29b expression level decreased and MMP2 mRNA was up-regulated significantly after 48 h transfection compared with the NC group and Blank groups (Fig.   6b, c, * P < 0.05). [score:7]
There was no inhibition effect on the following site-specific mutagenesis of the miR-29b MMP2 3’ UTR binding sites (Fig.   6e, * P < 0.05), indicating that miR-29b directly regulated the target gene MMP2 negatively in NSCLC. [score:7]
miR-29b was found down-regulated in A549-H cells and up-regulated in A549-L cells. [score:7]
Through miR-29b overexpression or knockdown analysis, the fact was determined that miR-29b variations were not accompanied with the alteration of PTEN expression. [score:6]
Another reason that might explain our contrasting findings was that miR-29b directly inhibits CDC42 and p85α to activate p53 expression [34]. [score:6]
The inhibition of Sp1 by miR-29b resulted in the upregulation of PTEN in tongue squamous cell carcinoma [36]. [score:6]
and quantitative RT-PCR indicated that miR-29b down-regulated the expression of MMP2 at the protein and mRNA levels. [score:6]
While miR-29b down-regulated the expression of MMP2 at the protein and mRNA levels. [score:6]
org, TargetScan and Pictar datebases results revealed that the expression levels of miR-29b were significantly higher in the H460 and 95C cell lines compared to 16HBE cell line, while the expression levels were lower in the PGCL3, PAa, H520, A549, H1299 and 95D cell lines (Fig.   2a). [score:6]
These findings might indicate that upregulation of miR-29b had a potential to inhibit of metastasis of NSCLC. [score:6]
indicated that miR-29b down-regulated the endogenous protein expression of MMP2. [score:6]
org, TargetScan and Pictar datebases Quantitative RT-PCR results revealed that the expression levels of miR-29b were significantly higher in the H460 and 95C cell lines compared to 16HBE cell line, while the expression levels were lower in the PGCL3, PAa, H520, A549, H1299 and 95D cell lines (Fig.   2a). [score:6]
c, analysis of MMP2 mRNA expression levels in A549 and H460 cell lines after infection LV-miR-29b or miR-29b inhibitor, respectively. [score:5]
PTEN gene was not only indirectly regulated by miR-29b-p53-PTEN positively, but also directly regulated by miR-29b negatively. [score:5]
d, Western blots analysis of PTEN expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively. [score:5]
Twenty pairs of paraffin-embedded NSCLC tissues and normal tissues (Fig.   2b) and ten pairs of fresh NSCLC tissues and normal adjacent tissues (Fig.   2c) were also chosen to detect the expression levels of miR-29b, the results showed that the expression level of miR-29b in twenty cases of paraffin NSCLC tissues was (−1.893 ± 1.367), significantly lower than that in the adjacent lung tissue (−0.605 ± 0.639; P = 0.001, t = −3.817). [score:5]
Based on our findings, the expression of miR-29b is down-regulated in NSCLC compared to normal tissues and significantly associated with metastasis. [score:5]
b, analysis of miR-29b expression levels in A549 and H460 cell lines after infection LV-miR-29b or miR-29b inhibitor, respectively. [score:5]
There was no significant relationship of miR-29b expression with age (P = 0.578), gender (P = 0.862), histology (P = 0.625) and differentiation (P = 0.891); while miR-29b expression was found had significant relationships with lymphatic metastasis (P = 0.004) and clinic stage (P = 0.031). [score:5]
Our data demonstrated that miR-29b inhibited in vitro cell proliferation, invasion and migration and in vivo suppressed NSCLC growth in a nude mice xenograft mo del. [score:5]
The regulatory mechanisms of a miRNA could differ among different microenvironments, miR-29b is upregulated in metastatic breast cancer tissues and indolent lymphocytic leukemia, functioning as an oncogene [21, 22]. [score:5]
d, Western blots analysis of MMP2 expression levels in A549 and H460 cell lines following LV-miR-29b or miR-29b inhibitor infection, respectively. [score:5]
The images showed that miR-29b overexpression inhibited A549-H cells migration and invasion (Fig.   5a). [score:5]
The luciferase reporter gene study further confirmed that miR-29b bound directly to wild-type MMP2 3’ UTR to inhibit the luciferase activity. [score:4]
Details are in the Additional file 1. H460 subline stably knockdown miR-29b (H460-LV-miR-29b inhibitor) and its control line (H460-LV-CON), were established as described in Additional file 1. Analysis for tumorigenicity was performed as described in Additional file 1. All data were analyzed using SPSS 13.0 (SPSS Inc, Chicago, IL, USA); A paired t test was used to investigate the difference in the expression level of miR-29b between normal and cancerous tissues. [score:4]
The influence of miR-29b on PTEN mRNA and protein expression levels were also evaluated in the A549 and H460 cells, There were no obvious changes on PTEN mRNA and protein expression levels in LV-miR-29b infected A549 cells or in miR-29b inhibitor transfected H460 cells compared with the NC or Blank groups (Fig.   7d, e). [score:4]
Details are in the Additional file 1. In vivo studiesH460 subline stably knockdown miR-29b (H460-LV-miR-29b inhibitor) and its control line (H460-LV-CON), were established as described in Additional file 1. Analysis for tumorigenicity was performed as described in Additional file 1. All data were analyzed using SPSS 13.0 (SPSS Inc, Chicago, IL, USA); A paired t test was used to investigate the difference in the expression level of miR-29b between normal and cancerous tissues. [score:4]
miR-29b is down-regulated in NSCLC tissues. [score:4]
Furthermore, the dual-luciferase reporter assay demonstrated that miR-29b inhibited the expression of luciferase gene containing the 3’-UTR of PTEN and MMP2. [score:4]
To verify whether MMP2 is a direct target of miR-29b, the 3’UTR of MMP2 cDNA was cloned into the downstream region of the luciferase reporter gene (psiCHECK-2-Wt-MMP2-3’UTR) and co -transfected this vector into 293-T cells with miR-29b mimic (Additional file 5: Figure S1A, B). [score:4]
Therefore, PTEN was a direct target of miR-29b. [score:4]
Our present results showed that miR-29b bound directly to the two PTEN 3’ UTR binding sites and PTEN was a miR-29b target gene. [score:4]
Furthermore, the dual-luciferase reporter assay demonstrated that miR-29b inhibited the expression of the luciferase gene containing the 3’-UTRs of MMP2 and PTEN mRNA. [score:4]
miR-29b affected PTEN expression by binding directly with the PTEN 3’ UTR. [score:4]
These findings indicated that miR-29b regulated MMP2 expression negatively. [score:4]
Additionally, dual-luciferase reporter assay and western blot results further elucidated that the miR-29b inhibited the expression of the luciferase gene containing the 3’-UTRs of MMP2 and PTEN mRNA. [score:4]
However, miR-29b is down-regulated in lung carcinoma tissues [23]. [score:4]
MMP2 as a target gene of miR-29b in NSCLC. [score:3]
Collectively, these observations suggested that miR-29b suppressed growth and metastasis of NSCLC cell in vitro and in vivo. [score:3]
The expression of miR-29b was down regulated in NSCLC tissues compared to the normal tissues. [score:3]
As expected, miR-29b inhibitor promoted cell migration and invasion (Fig.   5c) of A549-L cells. [score:3]
The expression level of miR-29b in ten cases of fresh non-small cell lung cancer tissues was (−1.996 ± 0.460), significantly lower than that in the adjacent lung tissue (−0.463 ± 0.257; P < 0.001, t = −9.016). [score:3]
Our results showed that miR-29b inhibited growth and metastasis of NSCLC cells in vitro and in vivo. [score:3]
was used to determine whether miR-29b regulates PTEN directly via the software-predicted binding sites. [score:3]
Spearman rank correlation analysis was applied to analyze the expression levels of miR-29b, tumor stage and lymphatic metastasis in NSCLC tissues. [score:3]
Figure  4a showed that cell migration and invasion ability was promoted in miR-29b inhibitor group comparing to the control groups. [score:3]
a, analysis of miR-29b expression levels in NSCLC cell lines and immortalized human bronchial epithelial cell line were shown relative to U6 snRNA as an internal control. [score:3]
Fig. 2Expression of miR-29b in NSCLC cell lines and paired NSCLC tissues. [score:3]
These data confirmed that miR-29b was a metastasis suppressor in NSCLC cells. [score:3]
The results show that miR-29b may be a novel therapeutic candidate target to slow NSCLC metastasis. [score:3]
Our findings provided novel evidence for the involvement of miR-29b in NSCLC metastasis, and suggested that miR-29b could be a potential new target for treatment of NSCLC metastasis. [score:3]
miR-29b inhibitor also increased H460 cells proliferation in a time -dependent manner (Fig.   4b, * P < 0.05, ** P < 0.01). [score:3]
miR-29b played a strong inhibitory role in tumor metastasis. [score:3]
d, Cells were counted in a light scope in four random views (* P < 0.05, n = 4) To further explore the mechanisms of miR-29b which suppresses lung cancer cell invasion and metastasis, we analyzed probable down stream tumor metastasis-related genes. [score:3]
Both sites were conserved among different species and fully complementary to the miR-29b seed sequence, corresponding to the basic rules for predicting miRNA target genes [26]. [score:3]
The results showed that miR-29b maybe a novel therapeutic candidate target or strategy for seeking to control NSCLC metastasis. [score:3]
In our study, low-level expression of miR-29b in NSCLC tissues was significantly associated with lymphatic metastasis. [score:3]
miR-29b suppresses cell proliferation, migration and invasion in A549 cells. [score:3]
a, Predicted binding sites in the 3’-UTR of MMP2 mRNA and seed sequence of miR-29b by TargetScan. [score:3]
All three databases used (TargetScan, PicTar, miRanda) identified the two PTEN 3’ UTR miR-29b binding sites. [score:3]
Ten human non-small cell lung cancer (NSCLC) cell lines and samples from thirty patients with NSCLC were analyzed for the expression of miR-29b by quantitative RT-PCR. [score:3]
MiR-29b was down-regulated 7.6-fold in CD133 -positive cells. [score:3]
combined with tumor metastasis PCR array showed that matrix metalloproteinase 2 (MMP2) and PTEN could be important target genes of miR-29b. [score:3]
of the mean tumor volume (cm [3]) demonstated that miR-29b lentivirus infection inhibited the tumor growth comparing to the control groups (Fig.   3d, ** P < 0.01). [score:3]
To confirm the sequence-specific repression of miR-29b, we designed mutated versions of psiCHECK-2-Wt-MMP2-3’UTR carrying 4-bp substitutions in miR-29b target site (psiCHECK-2-Mut-MMP2-3’UTR) (Additional file 5: Figure S1C, D). [score:3]
The gain-of-function studies revealed that ectopic expression of miR-29b decreased cell proliferation, migration and invasion abilities of NSCLC cells. [score:3]
a, Predicted binding sites in the 3’-UTR of PTEN mRNA and seed sequence of miR-29b by TargetScan. [score:3]
The expression of miR-29b was positively correlated with lymphatic metastasis (r = −0.547, P = 0.043). [score:3]
In contrasts, loss-of-function studies showed that inhibition of miR-29b promoted cell proliferation, migration and invasion of NSCLC cells in vitro. [score:3]
combined with tumor metastasis PCR array showed the potential target genes for miR-29b. [score:3]
are presented as means ± SEM (* P < 0.05, n = 3) TargetScan indicated that miR-29b had two highly conserved PTEN 3’ UTR binding sites (Fig.   7a). [score:3]
Through bioinformatics analysis and miRNA PCR array and tumor metastasis PCR array, PTEN, ETV4, COL4A2 and MMP2 were logically been speculated as miR-29b target genes. [score:3]
The taregets of miR-29b were analyzed by the TargetScan, PicTar and MiRanda databases. [score:3]
Our pilot study using miRNA PCR array found that miRNA-29b (miR-29b) is differentially expressed in primary cultured CD133 -positive A549 cells compared with CD133 -negative A549 cells. [score:2]
The target genes of miR-29b were determined by luciferase assay, quantitative RT-PCR and western blot. [score:2]
a, In Matrigel invasion and transwell migration assay, LV-miR-29b inhibitor infected H460 cells vs NC infected cells in a 200× light scope after crystal violet staining. [score:2]
Nude mice xenograft tumor assay confirmed that miR-29b inhibited lung cancer growth in vivo. [score:2]
A549 subline stably expressing miR-29b (A549-miR-29b) and its control line (A549-NC) were established as described in the Additional file 1. The cells were lysed with radioimmunoprecipitation assay buffer (Beyotime, Shanghai, China). [score:2]
b, miR-29b inhibitor increased cellular proliferation ability in H460 cells by CCK8 assay. [score:2]
This result proved that miR-29b bound directly to both PTEN 3’UTR binding sites. [score:2]
c, Photographs of subcutaneous tumors of mice injected with H460 cells that infected with LV-miR-29b inhibitor compared to NC infected cells treatment. [score:2]
Compared to H460 cells or H460-LV-NC cells group, tumor growth rates and tumor volumes of H460-LV-miR-29b -inhibitor cells group were significantly increased (Fig.   4c, d, * P < 0.05). [score:2]
c, In Matrigel invasion and migration assay, miR-29b inhibitor infected A549-L cells vs NC infected in a 200× light scope after crystal violet staining. [score:2]
After A549 cells were infected with lentivirus LV-miR-29b, the expression of miR-29b was increased significantly compared with the NC and Blank groups (Fig.   6b, * P < 0.05). [score:2]
However, there were no significant changes in the co -transfected with mutant-type3 PTEN-luc reporter and miR-29b mimic group and the blank or NC groups (Fig.   7c, * P < 0.05). [score:1]
Quantitative RT-PCR was performed using kits for U6 and mature miR-29b (ABI, Foster City, CA, USA), according to the manufacturer’s instructions. [score:1]
was performed using kits for U6 and mature miR-29b (ABI, Foster City, CA, USA), according to the manufacturer’s instructions. [score:1]
Two miR-29b binding sites in the 3’UTR region of PTEN were mutated to obtain psiCHECK-2-Mut1-3-PTEN-3’UTR plasmid (Additional file 6: Figure S2C–F). [score:1]
miR-29b deficiency alters the metastasis ability of H460 cells. [score:1]
Plasmid (0.5 μg) and 50 nmol/L miR-29b mimic/mimic NC were cotransfected using Lipofectamine LTX reagent (Invitrogen). [score:1]
Therefore, miR-29b silencing with antisense oligonucleotides was administrated in H460 cells. [score:1]
Effect of miR-29b on cell migration and invasion ability in A549-L and A549-H cells. [score:1]
c, analysis of miR-29b levels in 10 pairs of fresh NSCLC tissues Data present from Table  1 showed the clinicopathologic characteristics of miR-29b expression in NSCLC patients. [score:1]
We performed gain-of-function in A459 cells and loss-of-function in H460 cells of miR-29b. [score:1]
Clinicopathological analysis demonstrated that miR-29b had significant negative correlation with lymphatic metastasis. [score:1]
Based on these results, It’s concluded that miR-29b was related to metastasis in NSCLC. [score:1]
The 1500-bp fragment of the 3’UTR region of PTEN mRNA that included the predicted miR-29b recognition site was subcloned and inserted into a luciferase reporter plasmid (Additional file 6: Figure S2A, B). [score:1]
A 2-sample t test was used to analyse the clinicopathologic characteristics of miR-29b expression in the tissues of patients with NSCLC. [score:1]
Fig. 5Effect of miR-29b on migration and invasion ability of A549-L and A549-H cells. [score:1]
c, analysis of miR-29b levels in 10 pairs of fresh NSCLC tissuesData present from Table  1 showed the clinicopathologic characteristics of miR-29b expression in NSCLC patients. [score:1]
b, Schematic diagrams of miR-29b and PTEN 3’ UTR binding and wild-type and mutated psiCHECK-2-PTEN-3’UTR sequences. [score:1]
The analysis revealed that miR-29b bound to the MMP2 3’ UTR with a partially complementary pattern (Fig.   6a). [score:1]
e, Dual luciferase activity indicating relative luciferase activity following co-transfection with psiCHECK-2-Wt-MMP2-3’UTR or psiCHECK-2-Mut-MMP2-3’UTR and miR-29b mimic. [score:1]
b, analysis of miR-29b levels in 20 pairs of paraffin-embedded NSCLC tissues. [score:1]
[1 to 20 of 110 sentences]
5
[+] score: 399
BCL2L2 is a direct target of miR-29bTo identify miR-29b target genes that act as tumor suppressors, we questioned oncogenic genes highly expressed in tumor patients using miRNA site prediction (www. [score:10]
Moreover, we assessed MMP-2 activity and protein expression in U251 cells by gelatin zymography and western blotting, respectively, after transfection with synthetic miR-29b or inhibitor and found that both were significantly suppressed by the miR-29b mimic, but enhanced by transfection of miR-29b inhibitor (Figure 2B). [score:9]
In contrast, miR-29b inhibitor -transfected cells elevated mesenchymal marker expressions and diminished E-cadherin expression, as well as enhanced AKT activation and β-catenin expression. [score:9]
As a result, miR-29b inhibitor -induced MMP-2 protein levels were downregulated in response to all three, thus confirming that the synthetic miR-29b mimic downregulated MMP-2 protein levels by attenuating AKT/β-catenin signaling (Figure 2B right). [score:9]
According to previous reports, miR-29b suppresses angiogenesis, invasion, and metastasis by inhibiting MMP-2 expression in hepatocellular carcinoma [19]; however, to our knowledge, no study has examined the relationship between miR-29 and BCL2L2 expression and their effect on GBM cell phenotype. [score:9]
To better describe the tumor suppressive signaling of miR-29b mimic in PTEN-mutant U251 cells, we examined the expression levels of proteins known to regulate this transition-including phosphorylated AKT (p-AKT), AKT, and ß-catenin in cells transfected with miR-29b mimic or miR-29b inhibitor by western blotting (Figure 2D). [score:8]
Figure 7Mechanistic summary for tumorigenicity and stemness maintenance inhibiting actions of miR-29b through the direct targeting of BCL2L2 mRNA in GBMmiR-29b attenuates migration, invasion, and mesenchymal morphology by inactivating MMP-2 and decreasing Ang-2 and VEGF expression. [score:8]
Notably, miR-29 family members (miR-29a, -29b, and -29c) indirectly activate the p53 tumor suppressor by targeting p85α (the regulatory subunit of PI3K), resulting in cancer cell apoptosis [22]. [score:7]
To identify miR-29b target genes that act as tumor suppressors, we questioned oncogenic genes highly expressed in tumor patients using miRNA site prediction (www. [score:7]
To identify miR-29b target genes that act as tumor suppressors, we searched for oncogenic factors that are highly expressed in tumor patients using miRNA identification algorithms and TCGA (The Cancer Genome Atlas) GBM dataset. [score:7]
Interestingly, while both miR-29b and miR-29a/b suppressed BCL2L2 protein expression, miR-29b alone was more effective in inhibiting BCL2L2. [score:7]
Moreover, we confirmed that si- BCL2L2 -transfected cells displayed attenuated migration, invasion, angiogenesis, and stemness similar to that observed in miR-29b overexpressing cells, while miR-29b inhibitor counterparts displayed enhanced migration and invasion associated with the increased phosphorylation of AKT and expression of β-catenin (Figure 6). [score:7]
Moreover, the miR-29b mimic downregulated the expression of cancer stem-like marker proteins, including CD133, Musashi, Nanog, and Oct4, in U251 cells. [score:6]
Altogether, these analyses support the notion of a molecular system whereby miR-29b inhibits aggressive GBM development via BCL2L2 inhibition, and implicate miR-29b as a potential candidate in anti-cancer therapy (Figure 7). [score:6]
These data demonstrate that miR-29b directly binds the BCL2L2 3′UTR to inhibit its expression (Figure 5D). [score:6]
Figure 5 BCL2L2 is a direct target gene of miR-29b A. miR-29b (top left) and BCL2L2 protein or mRNA expression levels (top right) were monitored by quantitative real-time PCR or western blotting, respectively, in the following cancer cell lines: U251, U87MG, U373 (glioma); MCF7, MDA-MB-231 (breast); A549 and H460 (lung). [score:6]
This search revealed the BCL2L2 oncogene as an miR-29b target gene upregulated in the mesenchymal subtype of GBM (Figure 5A, bottom left). [score:6]
In this study, we demonstrate that BCL2L2 is an oncogenic, miR-29b target gene and is upregulated in the mesenchymal subtype of GBM. [score:6]
These phenomena demonstrate that miR-29b directly targets and represses oncogenic BCL2L2 expression. [score:6]
These data demonstrate that miR-29b directly binds the 3′UTR of BCL2L2 and inhibits protein and mRNA expression through sequence-specific mRNA cleavage (Figure 5D). [score:6]
Mechanistic summary for tumorigenicity and stemness maintenance inhibiting actions of miR-29b through the direct targeting of BCL2L2 mRNA in GBM. [score:6]
Accordingly, we found that treatment with synthetic miR-29b effectively attenuated angiogenesis by inhibiting tube formation in HUVECs (Figure 3A) and HBMECs (data not shown), as well as expression of the angiogenic factors Ang-2 and VEGF (Figure 3B). [score:5]
These analyses revealed an inverse correlation between miR-29b expression and BCL2L2 mRNA or protein level, supporting the notion that BCL2L2 is a target of miR-29b. [score:5]
Additionally, miR-29 has been reported as tumor suppressor to target oncogenes such as T-cell leukemia/lymphoma 1 (TCL1) [23, 24] and myeloid leukemia cell differentiation protein 1 (MCL1) [20]. [score:5]
Bottom right, BCL2L2 protein expression in U251 cells with Tet-inducible expression of the miR-29 cluster (miR-29a/b) or miR-29b alone. [score:5]
Contrarily, miR-29b inhibitor increased the expression of these mesenchymal-related proteins. [score:5]
Furthermore, forced miR-29b expression has been shown to abrogate myeloid cell leukemia-1 (MCL1) protein expression in human cholangiocarcinoma cells [20]. [score:5]
Concurrently, miR-29b potentiates cancer cell apoptosis by targeting p85α and CDC42 to subsequently activate the p53 tumor suppressor [22]. [score:5]
Accordingly, transfection with the miR-29b inhibitor rescued the expressions of these proteins dramatically (Figure 4B). [score:5]
In response to this finding, we assessed the expression of EMT-related proteins and found that miR-29b attenuated the expression of the mesenchymal markers Vimentin, Twist, and Snail, while enhancing that of the epithelial marker, E-cadherin. [score:5]
miR-29b limits the migratory and invasive capacities in U251 and U87MG GBM cells by inhibiting MMP-2 activity and protein expression. [score:5]
Conversely, the miR-29b inhibitor increased the expression of mesenchymal-related proteins (Figure 2D). [score:5]
In contrast, miR-29b inhibitor -transfected HUVECs displayed increased tube formation (Figure 3A), as well as Ang-2 and VEGF expression (Figure 3B). [score:5]
In particular, miR-29b expression enhances the survival of patients with hepatocellular carcinoma (HCC) by repressing matrix metalloproteinase 2 (MMP-2) expression and activity. [score:5]
In addition, miR-29b suppresses metastasis by targeting GATA3, which promotes epithelial-mesenchymal transition in breast cancer [32]. [score:5]
Anti-miR-C was used as an inhibitor of miR-C. To verify the above data, we examined whether miR-29b regulated the migratory potential, invasiveness, angiogenesis, and stemness maintenance of GBM by repressing BCL2L2. [score:4]
A. miR-29b downregulates tube formation in HUVECs. [score:4]
BCL2L2 is a direct target gene of miR-29b. [score:4]
To further elucidate the relationship between miR-29b and BCL2L2, we performed luciferase assays BCL2L2 -expressing vectors with a wild-type or mutated miR-29b binding site (Figure 5B), and found the miR-29b expression had no effect on luciferase activity in cells transfected with the mutant site (Figure 5C). [score:4]
These data confirmed that miR-29b represses BCL2L2 expression by directly binding its 3′UTR of BCL2L2 mRNA, and described their functional relationship in greater detail. [score:4]
Figure 3 A. miR-29b downregulates tube formation in HUVECs. [score:4]
To determine if miR-29b was also sufficient to regulate angiogenesis, human umbilical vein endothelial cells (HUVECs) and human brain microvascular endothelial cells (HBMECs) were transfected with miR-29b mimic or inhibitor. [score:4]
To characterize the function of miR-29b, U251 and U87MG GBM cells were transiently transfected with synthetic miR-29b or miR-29b inhibitor, which revealed that miR-29b markedly hindered their migratory and invasive capacities when compared to a scrambled miRNA -transfected cells (miR-C) (Figure 2A, top) by inhibiting MMP-2 activity and protein expression (Figure 2B). [score:4]
BCL2L2 is a direct target of miR-29b. [score:4]
A. miR-29b (top left) and BCL2L2 protein or mRNA expression levels (top right) were monitored by quantitative real-time PCR or western blotting, respectively, in the following cancer cell lines: U251, U87MG, U373 (glioma); MCF7, MDA-MB-231 (breast); A549 and H460 (lung). [score:3]
Significantly, miR-29b -transfected U251 and U87MG cells displayed defects in their ability to form neurospheres (Figure 4A), as well as a reduced expression of the CSC marker proteins CD133, Musashi, Nanog, and Oct4 (Figure 4B). [score:3]
Notably, miR-29b prevented both AKT activation and β-catenin expression (Figure 2D). [score:3]
miR-29b -dependent BCL2L2 gene regulation attenuates GBM tumorigenicityTo verify the above data, we examined whether miR-29b regulated the migratory potential, invasiveness, angiogenesis, and stemness maintenance of GBM by repressing BCL2L2. [score:3]
A. miR-29b inhibits the migratory potential and invasiveness of U251 and U87MG glioblastoma cells. [score:3]
In contrast, cells transfected with miR-29b inhibitor showed an increased potential for neurosphere formation (Figure 4A). [score:3]
pGL3uc vector and pTRE2 hyg-miR-29b or pTRE2 hyg-miR-29b-1~29a cluster expression constructs kindly provide by V. N. Kim (School of Biological Sciences, Seoul National University, Korea) [22]. [score:3]
As a result, only miR-29b could sufficiently inhibit both migratory potential (Figure 1A) and MMP-2 activity (Figure 1B). [score:3]
Cells were quantified in three fields from the scratched area (200 × 500 μm [2]) under a light microscope after transfection with scrambled control microRNA (miR-C) and synthetic miR-29b (Top) or anti-miR-C and miR-29b inhibitor (bottom). [score:3]
To do functional analyses, cell were transiently transfected with the vector control, BCL2L2 and a Tet-on inducible system with pTRE2 hyg-miR-29b or pTRE2 hyg-miR-29b-1~29a cluster expression constructs for 48 hrs using Lipofectamine 2000 (Invitrogene, Carlsbad, CA) according to the manufacturer's recommendation. [score:3]
miR-29b attenuates migration, invasion, and mesenchymal morphology by inactivating MMP-2 and decreasing Ang-2 and VEGF expression. [score:3]
These findings support that miR-29b can also suppress GBM aggressiveness by attenuating angiogenesis. [score:3]
We also showed that miR-29b inhibits tumorigenicity in GBM cells as defined by their capacities for migration, invasion, and self-renewal. [score:3]
The expression level of miR-29b was quantified by real-time qRT-PCR using Mir-X miRNA qRT-PCR SYBR kit (Clontech Laboratories Inc. [score:3]
These findings are consistent with earlier studies reporting that miR-29b suppresses the invasive and angiogenic potentials of HCC cells [19]. [score:3]
The inhibitor of miR-29b was a 2′- O-methyl -modified oligoribonucleotide single strand with the sequence 5′-AACACUGAUUUCAAAU GGUGCUA-3′. [score:3]
Therefore, we propose that miR-29b has potential as an anti-cancer therapy in GBM by targeting oncogenic BCL2L2. [score:3]
In wound healing assays (Figure 2A), we found that the wound margins in miR-29b -overexpressing cells displayed a rounded shape when compared to miR-29b inhibitor -transfected counterparts, which changed the fibroblast-like morphology as indicated by the arrowheads (Figure 2C). [score:3]
Right, MMP-2 protein levels were also examined after transfection of anti-miR-C and anti-miR-29b (20 nM) in response to treatment with PI3K (LY294002) or AKT (AKT-I) inhibitors for 1 hr, or co-transfection with siRNA β-catenin (10 nM). [score:3]
It was previously reported that miR-29b -expressing hepatocellular carcinoma (HCC) cells exhibit significantly lower microvessel densities and intrahepatic metastasis in animal mo dels [19]. [score:3]
To characterize the function of miR-29b in cancer cells, U251 cells were transiently transfected with synthetic miR-29b or miR-29b inhibitor and miR-29b expression was confirmed by quantitative real-time PCR (data not shown). [score:3]
In our wound healing assays, we found that the wound margin in miR-29b -overexpressing cells displayed a rounded shape compared to that of miR-29b inhibitor -transfected counterparts, which exhibited a more fibroblast-like morphology (Figure 2C). [score:3]
Figure 2 A. miR-29b inhibits the migratory potential and invasiveness of U251 and U87MG glioblastoma cells. [score:3]
miR-29b inhibits the maintenance of stemness. [score:3]
Thus, we confirmed that synthetic miR-29b mimic reduced the migratory and invasive capacity of cells by attenuating MMP-2 protein expression via AKT-β-catenin signaling (Figure 2B, right). [score:3]
Notably, si- BCL2L2 -transfected cells exhibited a decreased capacity for migration, invasion, angiogenesis, and stemness, similar to that observed in miR-29b -overexpressing cells. [score:3]
In contrast, miR-29b inhibitor -transfected cells displayed increased migration and invasion via activating p-AKT-ß-catenin signaling. [score:3]
Notably, the miR-29b mimic decreased angiogenesis by attenuating tube formation in both HUVECs and HBMECs (Figure 3A and data not shown); as well as expression of the angiogenesis-related factors, angiopoietin-2 (Ang-2) and vascular endothelial growth factor (VEGF) in U251 cells (Figure 3B). [score:3]
Accordingly, we investigated EMT-related protein expression and found that miR-29b attenuated mesenchymal marker expression, including Vimentin, Twist, and Snail, while enhancing that of the epithelial marker, E-cadherin. [score:3]
Moreover, in acute myeloid leukemia (AML), restoration of miR-29b in AML cell lines and primary samples resulted in the onset of apoptosis and dramatically reduced cellular tumorigenicity in a xenograft leukemia mo del [23, 24], which were supported other reports citing that synthetic miR-29b regulates apoptosis, cell cycle progression, and proliferation in leukemia cells [31]. [score:2]
miR-29b directly decreases malignant actions of BCL2L2 in GBM cells. [score:2]
The vector of mutant type is constructed out of “GGGTAGG” that have site directed mutagenesis of the BCL2L2 3′UTR for binding of miR-29b. [score:2]
Anti-miR-C was used as an inhibitor of miR-C. We next used luciferase assays to further elucidate the relationship between miR-29b and BCL2L2. [score:2]
To our knowledge, no study has examined the relationship between miR-29-regulated BCL2L2 and the malignant phenotype of GBM cells. [score:2]
From the data generated, we selected miR-29b, 494, 193a-3p, and 30e, which exhibited a >1.5-fold change in expression in response to IR treatment compared to that observed in control cells [21]. [score:2]
Indeed, both U251 and U87MG miR-29b -overexpressing cells demonstrated a dramatic decrease in neurosphere formation when compared to anti-miR-controls. [score:2]
To confirm this prediction, we had measured miR-29b and BCL2L2 protein or mRNA levels in various cancer cells and noted an inverse relationship between the two (Figure 5A), which supported BCL2L2 as a direct target of miR-29b. [score:2]
To first confirm the relationship between miR-29b and BCL2L2, we measured miR-29b and BCL2L2 protein or mRNA levels by quantitative real-time PCR and immunoblotting in various cancer cells, including gliomas (U251, U87MG, and U373) breast (MCF7 and MDA-MB-231), and lung (A549 and H460) cancer cell lines, and found that miR-29b was relatively downregulated in all except MDA-MB 231 cells (Figure 5A, top left). [score:2]
Anti-miR-C was used as an inhibitor of miR-C. We next used luciferase assays to further elucidate the relationship between miR-29b and BCL2L2. [score:2]
miR-29b regulates the maintenance of stemness in GBM cells. [score:2]
In contrast, cells treated with miR-29b inhibitor displayed slightly enhanced migration and invasion when compared to that observed in negative control (anti-miR-C) -treated U251 and U87MG cells (Figure 2A). [score:2]
miR-29b -dependent BCL2L2 gene regulation attenuates GBM tumorigenicity. [score:2]
Altogether, these data reveal a crucial role for miR-29b in limiting the aggressive phenotype of glioblastoma (Figure 7). [score:1]
Altogether, these data confirmed that miR-29b attenuated the mesenchymal properties of GBM cells by decreasing MMP-2 activity through Akt/ß-catenin signaling. [score:1]
First, we constructed pGL3UC- BCL2L2 vectors containing the wild-type miR-29b binding site (5′-GGTGCTA-3′, BCL2L2-WT) or a non -binding mutant (5′-GGGTAGG-3′, BCL2L2-mutant) (Figure 5B), and then co -transfected U251 cells with miR-C or miR-29b and either pGL3uc- BCL2L2-WT, BCL2L2-mutant, or the empty vector for 48 hr. [score:1]
HUVECs were transfected with miR-C, miR-29b, anti-miR-C, or anti-miR-29b, seeded onto Matrigel-coated 96 well plates for 24 hr later (1 × 10 [4] cells/well), and then monitored for 8 hr to assess tube formation. [score:1]
To determine if the miR-29b alone was more effective than the full miR-29a/b cluster, we evaluated BCL2L2 protein expression in a Tet-on inducible system with miR-29b or miR-29a/b cluster (Figure 5A, bottom right) [22]. [score:1]
Meanwhile, si- BCL2L2/anti-miR-29b-co -transfected cells were blocked oncogenic functions of anti-miR-29b by decreasing anti-miR-29b -induced migration, invasion, angiogenesis, and stemness, and exhibited no significant differences in comparison to si- BCL2L2 -transfected cells. [score:1]
miR-29b attenuates angiogenesis in HUVECs. [score:1]
After miR-C, miR-29b, anti-miR-control, and anti-miR-29b transfected into U251 and U87 cells for 24 hrs, transfectant cells were detached with trypsin-EDTA, counted cell numbers (1 × 10 [3]), and then resuspended onto 100 mm cell dish for 5–10 days. [score:1]
Subsequent functional analyses revealed that only miR-29b attenuates cell migration and MMP-2 activity; thus, we used an miR-29b mimic to investigate functions of miR-29b as tumor suppressor in GBM cells. [score:1]
Therefore, these data revealed that miR-29b potentiates mesenchymal-to-epithelial transition in GBM cells. [score:1]
Thus, miR-29b might present as a promising HCC therapy [19]. [score:1]
Synthetic miRNA mimics were synthesized by Samchully Pharmaceutical (Seoul, Korea) as RNA duplexes designed from the sequences of miR-29b (5′-UAGCAC CAUUUGAAAUCAGUGUU-3′), miR-494 (5′-UGAAACAUACACGGGAAACCUC-3′, miR-193a-3p (5′-AACUGGCCUACAAAGUCCCAGU-3′), and miR-30e (5′-UGUAAACAUCCUUGACUGGAAG-3′ using 5′-UGAAUUAGAUGGCGAUGU UTT-3′ for the control. [score:1]
Altogether, these results suggest that miR-29b likely functions to promote stemness maintenance in GBM cells. [score:1]
Therefore, miR-29b may be useful as therapeutic agent by attenuating aggressiveness of GBM. [score:1]
In turn, we have selected miR-29b to investigate functions of miR-29b as tumor suppressor in GBM cells. [score:1]
Thus, we decided to investigate the functions of miR-29b as tumor suppressor in GBM. [score:1]
To prepare the reporter construct, a DNA fragment of human BCL2L2 3′UTR containing the putative miR-29b binding site (127 bp) was amplified by PCR, and cloned into pGL3uc. [score:1]
Based on our findings, we propose that miR-29b might be useful as an anti-cancer therapeutic agent in GBM. [score:1]
A. U251 and U87MG cells were transfected with synthetic miR-29b (top) or anti-miR-29b (bottom) seeded onto 100 mm culture dishes (1 × 10 [3] cells/dish), and cultured for 7~10 days to generate neurospheres. [score:1]
Accordingly, we only used miR-29b mimic in the subsequent studies (Figure 5A, bottom right). [score:1]
miR-29b attenuates tumor angiogenesis. [score:1]
Figure 4 A. U251 and U87MG cells were transfected with synthetic miR-29b (top) or anti-miR-29b (bottom) seeded onto 100 mm culture dishes (1 × 10 [3] cells/dish), and cultured for 7~10 days to generate neurospheres. [score:1]
miR-29b limits cell migration and invasion by abrogating MMP-2 activity and mesenchymal traits via AKT-β-catenin signaling, respectively. [score:1]
Notably, miR-29b/pGL3uc- BCL2L2-WT co-transfectants exhibited lower luciferase activity, whereas no differences were observed between the pGL3uc- BCL2L2-mutant and empty control vector (Figure 5C). [score:1]
Arrowheads denote rounded miR-29b mimic -transfected cells and adherent fibroblastic-like anti-miR-29b -transfected cells. [score:1]
miR-C, miR-29b, anti-miR-C, and anti-miR-29b were transfected into HUVECs for 24 hrs, incubated them without serum free medium for 24 hrs, and transfectant cells were detached by trypsinization. [score:1]
The function of miR-29b mimic was confirmed using an anti-miR-29b. [score:1]
From this data, we identified miR-29b, 494, 193a-3p, and 30e as IR-regulated miRNAs that exhibited a > 1.5 fold change in treated U251 GBM cells compared to untreated controls [21]. [score:1]
Therefore, these data indicated that miR-29b potentiates mesenchymal-to-epithelial transition by decreasing MMP-2 activity via AKT/ß-catenin signaling in U251 cells (Figure 2D). [score:1]
[1 to 20 of 115 sentences]
6
[+] score: 387
Expression of mRNAs showed the same pattern of greater change at day 7. Correlation analysis between miRNA and their putative mRNA targets showed that for the four miRNAs with altered expression at day 1 or 3 post-surgery, there was an inverse correlation only between miR-29b-3p and its putative targets (genes containing either 6mer or 7mer-m8 seed sites). [score:9]
Since expression of the miR-29 family in the MSC chondrogenesis mo del was inversely correlated with expression of SOX9, we examined the role of SOX9 in the regulation of miR-29 expression. [score:8]
Overexpression of SOX9 in SW1353 cells leads to a decrease in expression of the miR-29 family, whilst knockdown of SOX9 increased their expression (Fig.   2c). [score:8]
An enrichment of potential miR-29 targets was identified in upregulated genes, when expression of the miR-29 family was low (data not shown) suggesting functional involvement of the miR-29 family. [score:8]
Expression of the miR-29 family was measured by qRT-PCR after overexpression or knockdown of SOX9; data were normalised to U6 RNA expression (mean ± SEM, Student’s t test, n = 3 (overexpression), n = 4 (siRNA). [score:8]
Of the genes whose expression was decreased when expression of the miRNA was increased, there was an enrichment of potential miR-29-3p targets identified and vice versa (Fig.   1a). [score:7]
Among these modulated miRNAs, the expression of miR-29b-3p, a member of miR-29 family, was increased at 1 day post-surgery when it was regulated in the opposite direction to its potential targets. [score:7]
Expression of miR-29b-3p was increased at day 1 and regulated in the opposite direction to its potential targets. [score:7]
The TGFβ, IL-1, and Wnt pathways regulate and/or are regulated by the miR-29 family highlighting a nonlinear system, with outcomes on the expression of matrix or matrix-degrading genes In summary, we have shown that the miR-29 family has a role in osteoarthritis, including early disease. [score:7]
Using whole knee joint RNA, only two miRNA altered significantly in expression 24 h after surgery and of these, miR-29b-3p was inversely correlated with expression of its putative targets. [score:7]
Cells were transfected for 6 h in serum- and antibiotic-free DMEM using Lipofectamine 2000 (Invitrogen), miR-29b-3p mimic at 30 nM (Qiagen), miR-29b-3p inhibitor at 50 nM (Qiagen), or non -targeting controls (All Stars at 30 nM (Qiagen), miScript Inhibitor control at 50 nM (Qiagen)). [score:7]
Having shown the miR-29 family to be expressed in mo dels of OA and cartilage development and regulated directly by Sox9, we explored the regulation of the miR-29 family in chondrocytes by cytokines and growth factors known to be important in cartilage homeostasis and OA. [score:7]
This latter can be seen through LPS repression of miR-29 expression, but also an increased expression of miR-29 upon treatment with an NFκB inhibitor, both pre-miR-29 and at the level of the pri-miR-29a/b1 promoter. [score:7]
These are positive regulators of the Wnt pathway, and targeting them is likely to suppress Wnt signalling, which is the outcome of miR-29 action (Fig.   5). [score:6]
Similarly, the induction of miR-29 precursors was also augmented by inhibiting NFκB (Fig.   4c), suggesting that NFκB acts as a negative regulator of miR-29 expression. [score:6]
Our data also show that there is no direct relationship between SOX9 and growth factor regulating the miR-29 family, in agreement with studies showing SOX9 -dependent and independent regulation of gene expression by growth factors [42]. [score:6]
Wnt3a also decreases SOX9 expression by approximately threefold, yet has no effect on miR-29 expression (data not shown). [score:5]
Data were normalized to 18S rRNA expression for primary and precursor miRNA and to U6 expression for mature miR-29 and then vehicle control (mean ± SEM, ANOVA, n = 3). [score:5]
Empty bars, control; black bars, treatment Similarly, miR-29-3p repressed NFκB signalling, inhibiting IL-1 induction of a κB-luc construct, whilst the inhibitor of miR-29b-3p augmented the response (Fig.   5b). [score:5]
Empty bars, control; black bars, treatmentSimilarly, miR-29-3p repressed NFκB signalling, inhibiting IL-1 induction of a κB-luc construct, whilst the inhibitor of miR-29b-3p augmented the response (Fig.   5b). [score:5]
This figure demonstrates that the miR-29 family adds an additional level of regulation across key pathways of cartilage homeostasis, and its dysregulation could either lead or contribute to disease. [score:5]
SW1353 cells were transfected with (CAGA)12-luc (a), κB-luc (b) or TOPFlash and FOPFlash vectors (c) and co -transfected with either 50 nM miR-29b-3p mimics, inhibitors or non-targetting controls. [score:5]
Figure 5a shows that a miR-29b-3p mimic repressed Smad signalling, inhibiting the TGFβ1 induction of the construct; conversely, an inhibitor of miR-29b-3p augmented TGFβ1 induction. [score:5]
The miR-29 family was regulated in both human and mouse mo dels of cartilage development though decreased expression of the miR-29 family in mo dels of chondrogenesis has been described before [37, 40, 41]. [score:5]
Mutation of miR-29 seed sites (1–5 sites, depending on gene), abolished this repression, demonstrating that all these genes are direct targets of the miR-29 family (Fig.   6a). [score:5]
Cells were transfected with miR-29b-3p mimics, inhibitors or non -targeting controls, and the transcriptome analysed on Illumina microarray. [score:5]
Whilst Wnt3a does not regulate miR-29 expression in primary HACs, miR-29 can repress canonical Wnt signalling, on the TOPFlash construct and the Axin2 gene. [score:4]
Transforming growth factor beta (TGFβ) is a key factor in OA and has been shown to regulate miR-29 expression in fibrosis [18]. [score:4]
Several Wnt-related genes are direct targets of the miR-29 family. [score:4]
The NFκB pathway is repressed by miR-29 though there are opposing effects on miR-29 expression regulated by either IL-1 or LPS. [score:4]
Amongst these, FZD3, FZD5, DVL3, FRAT2, and CK2A2 were validated as direct targets of the miR-29 family. [score:4]
In these data, we have identified and validated a number of genes as new direct targets of the miR-29 family. [score:4]
Interestingly, Axin2 expression, readout of canonical Wnt signalling, was decreased in hip OA cartilage compared to NOF (Fig.   6b) where miR-29 expression was increased (Fig.   1d). [score:4]
Constructs were transfected into DF1 fibroblasts with miR-29 mimics or non -targeting controls (50 nM) and assayed for luciferase activity after 24 h. Data were normalised to Renilla luciferase and then the non -targeting control (mean ± SEM, ANOVA, n = 6). [score:4]
From data above, we hypothesised that SOX9 was a negative regulator of miR-29 expression in chondrocytes. [score:4]
This intersection contained a number of known direct targets for miR-29 (e. g. COL1A1 and COL3A1), see Supplementary Table 3. Pathway analysis (DAVID) highlighted the Wnt signalling pathway, including DVL3, (Dishevelled 3); CSNK2A2, (casein kinase 2 alpha 2 polypeptide); FRAT2, (Frequently Rearranged In Advanced T-Cell Lymphomas 2, a GSK-3 binding protein); FZD3, (Frizzled family receptor 3) and FZD5, (Frizzled family receptor 5). [score:4]
Expression of the miR-29 family is regulated in cartilage during osteoarthritis. [score:4]
Negative regulation of canonical Wnt signalling by miR-29 has been shown to be via targeting of DNMT3A and 3B to demethylate WIF-1 in non-small-cell lung cancer [55]. [score:4]
Fig. 6The miR-29 family directly targets members of the Wnt pathway. [score:4]
Expression of the microRNA-29 family in chondrocyte differentiation and regulation by SOX9. [score:4]
This showed SOX9 as a negative regulator of miR-29 expression, and we further demonstrated that this was via the promoter for the miR-29a/b1 cluster. [score:4]
In monolayer culture, IL-1 increased expression of the primary miR-29a/b1 transcript, precursors of miR-29a and miR-29b1, and the mature miR-29a-3p and miR-29b-3p (Fig.   4a). [score:3]
The miR-29-3p mimic repressed Wnt3a induction of this construct (with no effect on the control FOPFlash), whilst it was augmented by the miR-29b-3p inhibitor (Fig.   5c). [score:3]
SOX9 represses expression of the miR-29 family in chondrocytes. [score:3]
Further, expression of the miR-29 family was significantly increased in human cartilage from end-stage OA. [score:3]
IL-1 induces the miR-29 family in a p38 MAPK -dependent manner, though the NFκB pathway represses miR-29 expression. [score:3]
LPS, another factor which induces NFκB, decreased the expression of pri- and pre-miR-29a and miR-29b1 at an early time point (4 h), with the mature miR-29a-3p and miR-29b-3p reduced at 24 h (Fig.   4d). [score:3]
The frequency of predicted miR-29 targets in mRNA with seed sites of either 6mer or 7mer m8 was calculated (see Material and Methods) across fold changes of gene expression. [score:3]
A p38 inhibitor (SB203580) blocked induction of the miR-29 family by IL-1, showing that this was, at least in part, dependent on the p38 pathway (Fig.   4c). [score:3]
One hundred nanogram of the plasmid and 10 ng of constitutive Renilla plasmid were co -transfected into SW1353 cells with 50 nM miR-29 mimic, inhibitor or control. [score:3]
However, microRNA-29 expression was not modulated by Wnt3a with no effect on the miR-29a/b1 promoter (data not shown). [score:3]
In other cell lines, NFκB has been shown to act as an inhibitor of miR-29 [52– 54]. [score:3]
Since expression of the miR-29 family is increased immediately post-surgery in the DMM mo del and is increased upon hip cartilage avulsion, this may be a response to injury, a known phenomenon for miRNAs in several areas of physiology and pathology, including cartilage, e. g. [38, 39]. [score:3]
Whilst this shows a correlation with miR-29 expression for IL-1, this is not true for TGFβ1 and LPS. [score:3]
It is moot if the same mechanism(s) increase expression of the miR-29 family in cartilage from end-stage human OA. [score:3]
Expression of primary miR-29b2/c, the precursor and mature miR-29b and miR-29c were significantly repressed by TGFβ1 in monolayer culture. [score:3]
SOX9 repressed expression of miR-29a-3p and miR-29b-3p via the 29a/b1 promoter. [score:3]
Fig. 2Expression of the miR-29 family in chondrocyte differentiation. [score:3]
Wnt3 -induced Axin2 expression was significantly, though minimally, repressed by miR-29 family mimics (Fig.   5c). [score:3]
Expression of the microRNA-29 family in osteoarthritis. [score:3]
b In man, the miR-29 family is expressed from two loci, with the primary miR-29a/b1 on chromosome 7 (the last intron of the primary transcript GenBank accession EU154353) and primary miR-29b2/c on chromosome 1 (the last exon of the primary transcript GenBank accession numbers EU154351 and EU154352) [29]; mature sequences of miR-29a, b and c (3p) have identical seed sequences. [score:3]
Figure 5a shows that TGFβ1 -induced ADAMTS4 expression was repressed by transfection of miR-29 family mimics, verifying the effect on an endogenous gene. [score:3]
The 3’ UTR of all these genes was cloned into a luciferase reporter and co-transfection of the miR-29-3p mimics resulted in significant repression of luciferase expression (Fig.   6a). [score:3]
Factors controlling expression of the miR-29 family. [score:3]
In micromass culture, IL-1 increased expression of all primary and precursor transcripts and the mature miR-29 family (Fig.   4b). [score:3]
Expression of the miR-29 family was highest in human articular cartilage tissue, decreasing with cell passage in monolayer culture. [score:3]
Interestingly, miR-29 gain- and loss-of-function microarray experiments in primary HACs highlighted a number of genes from the Wnt signalling pathway as potential targets of miR-29 in articular chondrocytes. [score:3]
Data were normalised to U6 RNA expression Expression of the miR-29 family was also measured across dedifferentiation of human articular chondrocytes upon serial passage in monolayer culture. [score:3]
Expression of primary miR-29a/b1 and the precursor and mature miR-29a-3p and miR-29b-3p were significantly repressed by TGFβ1 in micromass culture. [score:3]
We performed gain-of-function and loss-of-function experiments to identify miR-29 targets in primary HACs. [score:3]
Human primary chondrocytes were transfected with miR-29-3p family mimics or non -targeting control (50 nM) for 24 h, after culture in low serum (0.5 % v/ v FCS) for 24 h, cells were stimulated with TGFβ1 (4 ng/ml) (a), IL-1β (5 ng/ml) (b) or Wnt3a (100 ng/ml) (c) for 24 h. Gene expression (ADAMTS4 a; MMP3 b; Axin2 c) was measured by qRT-PCR and normalized to 18S rRNA (mean ± SEM, ANOVA, n = 3). [score:3]
In human MSC differentiation to form cartilage discs over 14 days, the miR-29 family decreased in expression to 7 days, returning to starting levels by 14 days (Fig.   2a). [score:3]
This gives a feed forward loop where TGFβ1 reduces levels of miR-29 which are repressing the Smad pathway and therefore allows a greater increase in Smad -dependent gene regulation. [score:2]
Whilst miR-29 expression is not regulated by Wnt3a, we measured the impact of miR-29 on canonical Wnt signalling, using the TOPFlash construct. [score:2]
These data identify the miR-29 family as microRNAs acting across development and progression of OA. [score:2]
Since TGFβ1 regulated expression of the miR-29 family, we measured the Smad 2/3/4 pathway using transient transfection of the p(CAGA) [12]-luc Smad-responsive plasmid. [score:2]
The miR-29 family regulates key signalling pathways. [score:2]
The miR-29 family negatively regulates Smad, NFκB, and canonical Wnt signalling. [score:2]
Fig. 3Regulation of the miR-29 family by TGFβ1. [score:2]
The miR-29 family is regulated by a number of factors known to be important in OA and has a functional impact on several relevant signalling pathways. [score:2]
The expression of miR-29a-3p, miR-29b-3p and miR-29c-3p was increased in osteoarthritis compared to NOF (Fig.   1d). [score:2]
Hence, we investigated the expression of the miR-29 family in a number of mo dels relevant to cartilage and OA and their regulation and function in chondrocytes. [score:2]
Fig. 5Regulation of intracellular signaling pathways by miR-29b-3p. [score:2]
The miR-29 family is regulated by TGF-β1 and IL-1 in chondrocytes. [score:2]
Expression of miR-29b-3p was validated by qRT-PCR in the knee undergoing both DMM and sham surgery compared to un-operated control at day 1 post-surgery (Fig.   1a). [score:2]
There is no simple relationship between regulation of SOX9 by these factors and that of miR-29. [score:2]
Axin2 gene expression in osteoarthritic hip cartilage compared to a fracture control is inversely correlated with that of miR-29 in the same tissue. [score:2]
The miR-29 family negatively regulated Smad, NFκB, and canonical WNT signalling pathways. [score:2]
The 3’ UTR of mRNAs containing the predicted binding site of miR-29-3p were subcloned into pmirGLO (Promega), using QuikChange (Agilent) to introduce mutations. [score:2]
Data from this study have identified a complex interplay between the miR-29 family and key signalling pathways which regulate cartilage homeostasis. [score:2]
Fig. 4Regulation of the miR-29 family by interleukin-1 and LPS. [score:2]
In a mouse mo del of cartilage injury and in end-stage human OA cartilage, the miR-29 family was also regulated. [score:2]
They showed SOX9 negatively regulating miR-29 which allowed an increase in FOXO3A leading to the differentiation of MSC into chondrocytes [37]. [score:2]
Expression of the miR-29 family and SOX9 was measured by qRT-PCR from RNA a obtained from human mesenchymal stem cells induced through chondrogenesis to form cartilage discs at day 0, 3, 7 and 14 (mean ± SEM, ANOVA, n = 6); empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
The action of the miR-29 family in articular chondrocytes. [score:1]
Empty bars, miR-29a; grey bars, miR-29b and black bars, miR-29c. [score:1]
These data show a complex role for the miR-29 family in cartilage homeostasis and OA. [score:1]
Empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
Empty bars, pri-miR29a/b1; light grey bars, pri-miR29-b2/c; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle control. [score:1]
Fig. 1Identification of the miR-29 family in osteoarthritis. [score:1]
TGFβ1 is known to repress the miR-29 family in a number of cell types (e. g. [18, 47], and this is the same in primary chondrocytes. [score:1]
We pursued the relationship between these three factors and the miR-29 family in primary HACs since the literature suggests that this is cell-type specific. [score:1]
Expression of the miR-29 family was measured in human articular cartilage from hip replacement surgery for OA or fracture to the neck-of-femur (NOF, control). [score:1]
The MMP3 gene, which is responsive to NFκB, as well as other transcription factors, was induced by IL-1 and significantly repressed by miR-29 family mimics (Fig.   5b). [score:1]
Fig. 7 A schematic of the role of the miR-29 family in cartilage. [score:1]
The miR-29 family in human and mouse consists of miR-29a, miR-29b (b1 and b2 which are identical mature miRNAs) and miR-29c, with the mature microRNAs differing only in two or three bases. [score:1]
Several of these have been validated, showing the functional capability of miR-29 on this pathway in cartilage. [score:1]
Figure 7 shows the relationships, we have identified amongst cytokines, growth factors and signalling pathways with the miR-29 family. [score:1]
Striped bars, control; empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
The impact of TGFβ1 on miR-29 expression in chondrocytes was investigated in monolayer culture and in three-dimensional micromass culture. [score:1]
In human osteoblasts, miR-29 is induced by canonical Wnt signalling and miR-29 potentiates Wnt signalling, demonstrating the cell type-specific nature of miR-29 function [27, 56]. [score:1]
Empty bars, pri-miR-29a/b1; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle controlThe Wnt pathway has also been implicated in OA [35]. [score:1]
All seed sites of the miR-29 family were altered to non -binding sequences (number of sites shown) to create mutant constructs. [score:1]
However, in both cases, all three mature members of the miR-29 family were repressed. [score:1]
Comparing the operated knee with contralateral control showed two miRNAs increased by DMM surgery >1.5-fold at day 1 (miR-144-3p and miR-29b-3p) and two miRNAs at day 3 (miR-370-5p and miR-21-5p). [score:1]
Empty bars, pri-miR-29a/b1; light grey bars, pri-miR-29b2/c; dark grey bars, pre-miR-29; black bars, mature miR-29, horizontal line at 1, vehicle control. [score:1]
Since the replay of chondrogenesis and altered cell differentiation can contribute to OA [31], expression of the miR-29 family was investigated in appropriate mo dels. [score:1]
Empty bars, pri-miR-29a/b1; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle control The Wnt pathway has also been implicated in OA [35]. [score:1]
Measurement of the miR-29-3p family in this mo del showed a significant increase in expression at 12–48 h post-explantation of cartilage, with a trend to increase for miR-29a and c at 6 h (Fig.   1c). [score:1]
Data were normalised to U6 RNA expressionExpression of the miR-29 family was also measured across dedifferentiation of human articular chondrocytes upon serial passage in monolayer culture. [score:1]
[1 to 20 of 120 sentences]
7
[+] score: 360
MiR-29b could directly target DNMT3A/3B, and thus inhibit their expression, while DNMT3A/3B could also inhibit the expression of miR-29b via CpG island promoter hypomethylation [24]. [score:12]
Low expression of miR-29b was significantly associated with DNA methylation, and treatment with DNA methyltransferase inhibitor upregulated its expression in gastric cancer cells. [score:10]
To clarify their relationship, we firstly studied the effect of miR-29b upregulation or downregulation on the expression of LASP1 in gastric cancer cells. [score:9]
Interestingly, we observed an inverse correlation between the miR-29b and LASP1 expression in gastric cancer tissues (Figure 6C), suggesting that the upregulation of LASP1 may be due to the downregulation of miR-29b in gastric cancer. [score:9]
In summary, this is the first study demonstrating that miR-29b is downregulated in gastric cancer due to DNA methylation, and acts as a tumor suppressor partly at least via directly targeting LASP1. [score:9]
As the clinical significance of miR-29b expression in gastric cancer has never previously been reported, we further study it and showed that both low miR-29b expression and miR-29b methylation were significantly associated with the poor differentiation and lymph node metastasis in gastric cancer, suggesting that the downregulation of miR-29b may contribute to gastric cancer progression. [score:8]
As shown in Figure 4A-4B, the mRNA and protein expression of LASP1 were significantly downregulated in gastric cancer cells after overexpression of miR-29b. [score:8]
Since we had found that LASP1 was a target gene of miR-29b in gastric cancer cells, we speculated that LASP1 might be involved in the miR-29b -mediated malignant phenotypes of gastric cancer cells, and our data confirmed this speculation that overexpression of LASP1 impaired the inhibitory effects of miR-29b on gastric cancer cells. [score:7]
Moreover, the gastric cancer patients with low expression of miR-29b showed shorter survival time, when compared with those with high miR-29b expression, suggesting that the downregulation of miR-29b is associated with poor prognosis (Figure 1B). [score:7]
Besides, miR-29b is involved in the development of Alzheimer disease through regulating the expression of BACE1 [16]. [score:7]
Based on the above findings, we suggest that the upregulation of LASP1 may be due to the downregulation of miR-29b, which further contributes to the malignant progression and poor prognosis in gastric cancer. [score:7]
To further confirm that high methylation contributes to miR-29b inhibition in gastric cancer cells, these gastric cancer cell lines were treated with DNA methyltransferase inhibitor 5-aza for 48 h. After treatment, we observed a significant increase in the miR-29b expression in these gastric cancer cell lines (Figure 1E). [score:7]
Our data indicated that low miR-29b expression was significantly associated with poor differentiation, lymph node metastasis, and advanced clinical stage in gastric cancer, suggesting that the miR-29b downregulation may contribute to gastric cancer progression (Table 1). [score:6]
We then showed that transfection with miR-29b inhibitor significantly increased the mRNA and protein expression of LASP1 in AGS and BGC-823 cells, when compared with the NC inhibitor group (Figure 4D-4E). [score:6]
Overexpression of LASP1 impaired the suppressive effects of miR-29b on the proliferation, migration, and invasion of gastric cancer cells. [score:5]
These findings demonstrate that LASP1 overexpression impaired the suppressive effects of miR-29b on the proliferation, migration, and invasion of gastric cancer cells. [score:5]
Figure 5 (A) Targetscan data indicate that LASP1 is a putative target gene of miR-29b. [score:5]
Figure 2Overexpression of miR-29b inhibits gastric cancer cell growth in vitro and in vivoAGS and BGC-823 cells were transfected with miR-29b mimic or miR-NC mimic, respectively. [score:5]
Overexpression of miR-29b inhibits gastric cancer cell migration and invasion. [score:5]
After that, AGS and BGC-823 cells were transfected with miR-29b inhibitor or NC inhibitor, respectively. [score:5]
For functional analysis of miR-29b and LASP1, AGS and BGC-823 cells were transfected with scramble miR mimic (miR-NC), miR-29b mimic, negative control (NC) inhibitor, miR-29b inhibitor, NC siRNA, LASP1 siRNA, or co -transfected with miR-29b mimic and pcDNA3.1-LASP1 ORF plasmid, using Lipofectamine 2000 (Thermo Fisher Scientific, Inc. [score:5]
Overexpression of miR-29b inhibits gastric cancer cell growth in vitro and in vivo. [score:5]
Kong et al. showed that miR-29b had suppressive effects on the proliferation and migration of gastric cancer cells by inhibition of KDM2A [19]. [score:5]
Besides, both miR-29b methylation and low miR-29b expression were associated with disease progression and poor prognosis in gastric cancer. [score:5]
To further confirm these findings, AGS and BGC-823 cells were transfected with miR-29b inhibitor or NC inhibitor respectively. [score:5]
Through bioinformatics prediction, we found that LASP1 was a potential target gene of miR-29b, and the targeting relationship between miR-29b and LASP1 was evolutionally conserved. [score:5]
In addition, overexpression of LASP1 impaired the suppressive effects of miR-29b on the malignant phenotypes of gastric cancer cells. [score:5]
As we then found that overexpression of miR-29b inhibited the proliferation, migration and invasion of gastric cancer cells in vitro and tumor growth in vivo, we suggest that miR-29b may be used as a potential therapeutic candidate for gastric cancer. [score:5]
Besides, Cui et al. reported that deregulation between miR-29b and DNMT3A was associated with the downregulation of CDH1, which further promoted gastric cancer cell migration and invasion [25]. [score:5]
In this study, we identified LASP1 as a novel target of miR-29b by using luciferease reporter gene assay, and the expression of LASP1 was negatively regulated by miR-29b in gastric cancer cell lines. [score:5]
GES-1. (D) Methylation-specific PCR was conducted to examine the methylation status of miR-29b in human gastric cancer cell lines (AGS, BGC-823, SGC-7901, and MGC-803) and normal human gastric mucosa epithelial cell line GES-1. (E) Gastric cancer cell lines were treated with DNA methyltransferase inhibitor 5-aza for 48 h, and real-time RT-PCR was conducted to examine the expression levels of miR-29b. [score:5]
Moreover, according to the result of multivariate analysis, low miR-29b expression and high LASP1 expression was not independent association with worse prognosis of GCs (Table 4). [score:5]
AGS and BGC-823 cells were transfected with scramble miR (miR-NC), miR-29b mimics, negative control (NC) inhibitor, miR-29b inhibitor, LASP1 siRNA, NC siRNA, or co -transfected with miR-29b mimics and pc-DNA3.1-LASP1 plasmid, or miR-29b mimics and blank pc-DNA3.1 vector, respectively, using Lipofectamine 2000 (Thermo Fisher), according to the manufacture's instruction. [score:5]
Taken together, miR-29b overexpression inhibits gastric cancer cell growth in vitro and in vivo. [score:5]
For instance, Zhang et al. reported that miR-29b could target AKT2 to inhibit the invasion of gastric cancer cells [18]. [score:5]
To further confirm whether LASP1 is a direct target gene of miR-29b in gastric cancer, the pGL3-LASP1-3’UTR and pGL3-LASP1-mut 3’UTR luciferase reporter plasmids were generated (Figrue 5A-5B). [score:4]
We speculated that the high methylation status may be a main cause for the downregulation of miR-29b in gastric cancer. [score:4]
In this study, we found that miR-29b was significantly downregulated in gastric cancer tissues and cell lines, consistent with previous findings [23]. [score:4]
These data indicates that the downregulation of miR-29b is partly at least due to the high methylation in gastric cancer cells. [score:4]
Overexpression of miR-29b inhibits gastric cancer cell growth in vitro and in vivoWe further investigated the regulatory effects of miR-29b on the growth of gastric cancer cells in vitro and in vivo. [score:4]
Taken together, miR-29b is downregulated in gastric cancer. [score:4]
Here we found that miR-29b was significantly downregulated in gastric cancer. [score:4]
Besides, miR-29b could reduce the cisplatin resistance of gastric cancer cells by directly targeting PI3K/Akt pathway [20]. [score:4]
Therefore, the downregulation of miR-29b in gastric cancer may be associated with DNMT3A/3B. [score:4]
High methylation contributes to the downregulated of miR-29b in gastric cancer. [score:4]
After transfection, the miR-29b levels were significantly reduced in the miR-29b inhibitor group compared with NC inhibitor group (Figure 4C). [score:4]
data showed that LASP1 was a potential target of miR-29b. [score:3]
However, whether other targets of miR-29b exist in gastric cancer still needs to be studied. [score:3]
org) were used to predicate the putative targets of miR-29b, according to the manufacture's instruction. [score:3]
Figure 1 (A) Real-time RT-PCR was conducted to examine the miR-29b expression levels in 84 cases gastric cancer tissues and adjacent non-tumor tissues. [score:3]
In addition, the expression of miR-29b in gastric cancer cell lines was examined. [score:3]
For instance, miR-29b could inhibit the migration and proliferation of vascular smooth muscle cells in neointimal formation[15]. [score:3]
LASP1 was then identified as a target gene of miR-29b in gastric cancer cells. [score:3]
The clinical significance of miR-29b expression in gastric cancer was further studied. [score:3]
Recent studies have shown that many miRs play suppressive or oncogenic roles in gastric cancer including miR-126 [9], miR-145 [10], miR-326 [4], miR-506 [11], and miR-29 [12]. [score:3]
Restoration of miR-29b caused a reduction in gastric cancer cell proliferation, migration, and invasion, and inhibited tumor growth in vivo. [score:3]
However, it still supports miR-29b and LASP1 expression as risk factors (HR>1) for patient survival (Table 4). [score:3]
Accordingly, we mainly aimed to explore the regulatory mechanism of miR-29b underlying gastric cancer development and progression. [score:3]
In recent years, the tumor suppressive effect of miR-29b has been gradually reported in some common human cancers including gastric cancer [14, 17, 18]. [score:3]
As indicated in Figure 1C, miR-29b was also significantly downregulated in gastric cancer cell lines including AGS, BGC-823, SGC-7901, and MGC-803, when compared with that in normal human gastric mucosa epithelial GES-1 cells. [score:3]
The expression of LASP1 was negatively mediated by miR-29b in gastric cancer cells. [score:3]
LASP1 is a target gene of miR-29b in gastric cancer cells. [score:3]
Recently, genetic variation in miR-29 has been suggested to have a critical role in genetic susceptibility to gastric cancer, and miR-29b has been demonstrated to play a suppressive role in gastric cancer [22]. [score:3]
The predicted miR-29b binding sites on the 3’-untranslated region (3’UTR) of LASP1 were cloned into the pGL3 vector (Promega Corporation, Madison, WI, USA) named pGL3-LASP1-3’UTR. [score:3]
MiR-29b is downregulated in gastric cancer. [score:3]
As shown in Figure 1A, miR-29b was significantly downregulated in gastric cancer tissues compared with adjacent non-tumor tissues. [score:3]
To reveal the function of miR-29b in gastric cancer, real-time PCR was conducted to examine the miR-29b expression in gastric cancer tissues and adjacent non-tumor tissues. [score:3]
Several target genes of miR-29b have been identified in gastric cancer, such as KDM2A [19] and AKT2 [18]. [score:3]
MiR-29b -overexpressing AGS and BGC-823 cells were transfected with pcDNA3.1-LASP1 plasmid or blank pcDNA3.1 vector, respectively. [score:2]
MiR-29b -overexpressing AGS and BGC-823 cells were transfected with pcDNA3.1-LASP1 ORF plasmid or blank pcDNA3.1 vector, respectively. [score:2]
data further indicated that the proliferation of gastric cancer cells was significantly reduced in the miR-29b group compared with miR-NC group, suggesting that miR-29b has suppressive effects on gastric cancer cell proliferation (Figure 2B). [score:2]
MiR-29b has suppressive effects on the migration and invasion of gastric cancer cells. [score:2]
Therefore, LASP1 is negatively regulated by miR-29b in gastric cancer cells. [score:2]
Therefore, miR-29b can directly bind to the 3’UTR of LASP1 mRNA in gastric cancer cells. [score:2]
The molecular mechanism of miR-29b underlying gastric cancer development and progression remains largely unclear. [score:2]
The mutant miR-29b binding sites on the 3’UTR of LASP1 were constructed using a QuikChange Site-Directed Mutagenesis kit (Stratagene; Agilent Technologies, Inc. [score:2]
The methylation status of miR-29b in gastric cancer tissues and adjacent non-tumor tissues was examined in using methylation-specific PCR (MSP). [score:1]
The mice (n=5 in each group) were injected subcutaneously in the dorsal flank with 1×10 [7] AGS and BGC-823 cells transfected with pLVTH-miR-29b lentiviral plasmid or blank pLVTH lentiviral plasmid. [score:1]
Association between miR-29b expression and clinicopathologic characteristics of gastric cancer patients. [score:1]
Figure 4AGS and BGC-823 cells were transfected with miR-29b mimic or miR-NC mimic, respectively. [score:1]
miR-29b+blank. [score:1]
AGS and BGC-823 cells were transfected with miR-29b mimic or miR-NC mimic, respectively. [score:1]
We observed that 52 gastric cancer tissues showed methylated miR-29b, while only 6 adjacent non-tumor tissues showed methylated miR-29b (P<0.0001). [score:1]
Moreover, we found that the methylation status of miR-29b was significantly higher in gastric cancer tissues and cell lines. [score:1]
For in vivo experiment, AGS and BGC-823 cells were stably transfected with the pLVTH-miR-29b lentiviral plasmid, or with blank pLVTH vector as control group, respectively. [score:1]
After that, the pYr-LVX-miR-29b or pYr-LVX-miR-NC lentiviral plasmid was then stably transfected into AGS and BGC-823 cells, which were then subcutaneously implanted into the nude mice. [score:1]
We further investigated the molecular mechanism underlying miR-29b expression in gastric cancer tissues and cell lines. [score:1]
In fact, it has been reported a crucial crosstalk between miR-29b and DNMT3A/3B via a double -negative feedback loop. [score:1]
After treatment, the miR-29b levels were significantly increased, which confirmed our speculation. [score:1]
Moreover, high methylation of miR-29b was also associated with the malignant progression of gastric cancer (Table 2). [score:1]
After that, we investigated the potential target genes of miR-29b in gastric cancer. [score:1]
Our data showed that the luciferase activity was decreased in cells co -transfected with miR-29b mimics and pGL3-LASP1-3’UTR luciferase reporter plasmid, which was eliminated by transfection with the pGL3-LASP1-mut 3’UTR luciferase reporter plasmid (Figure 5C-5D). [score:1]
Figure 3AGS and BGC-823 cells were transfected with miR-29b mimic or miR-NC mimic, respectively. [score:1]
[1 to 20 of 93 sentences]
8
[+] score: 356
In keeping with the findings in mice, ectopic expression of miR-29b inhibited the expression of α-SMA, collagen I, TIMP-1 and p-Smad3 in both HSC cell lines, suggesting that miR-29b negatively regulated fibrosis by targeting the process of collagen matrix synthesis through inhibiting the activation of HSCs. [score:12]
The signaling mechanism through which TGF-β1 regulates miR-29b expression was examined and we revealed that TGF-β1 downregulates miR-29b expression through the mechanism of Smad3. [score:9]
miR-29b inhibits liver fibrosis and suppresses the activation of HSCs through direct targeting PIK3R1 and AKT3. [score:8]
This was confirmed by the downregulation of protein expression of p-Smad3, α-SMA, collagen I and TIMP-1 (Figure 4C), inferring the suppressed activation of HSCs by miR-29b. [score:8]
Ectopic expression of miR-29b remarkably reduced protein expression of PIK3R1, AKT3 and phosphorylated AKT (p-AKT) in both cell lines (Figure 6C), suggesting that PIK3R1 and AKT3 are bona fide targets of miR-29b. [score:7]
miR-29b is downregulated in liver fibrosis and in activated hepatic stellate cells (HSCs) and down-regulation of miR-29b is mediated by Smad3. [score:7]
We found that TGF-β1 down-regulates miR-29b in HSC cells, which was associated with a marked upregulation of p-Smad3 and α-SMA. [score:7]
Introduction of miR-29b resulted in significant downregulation of α-SMA, collagen I and TIMP-1 expression, which is more likely the result of reduced activation of HSCs. [score:6]
Downregulation of miR-29 members has been reported to be implicated in various fibrotic diseases including cardiac fibrosis [17], lung fibrosis [18] and liver fibrosis [19]. [score:6]
In this study, we first determined whether aberrant expression of miR-29b exists in liver fibrosis, and found that miR-29b was significantly downregulated in fibrotic liver tissues from human and rodent mo del, and in activated HSCs. [score:6]
In addition, transduction of miR-29b was able to inhibit the activation of Smad3 both in vitro and in vivo, an important player in fibrogenic pathway, which indicated that miR-29b is not only a downstream target of TGF-β/Smad3 in liver fibrogenesis, but also a negative feedback-regulator of the TGF-β/Smad3 signaling axis in the pathogenesis of liver fibrosis. [score:6]
To verify whether miR-29b directly binds to the 3′-UTR of these candidate genes and causes translational inhibition, we constructed pMIR-report plasmids encoding a firefly luciferase transcript with either wild-type or mutant 3′-UTR of PIK3R1, AKT3, Col1A2 and Col3A1 (Figure 6B). [score:6]
miR-29b is expressed in primary quiescent HSCs, but down-regulated in activated HSCs. [score:6]
In conclusion, miR-29b was downregulated in liver fibrosis and was negatively regulated by Smad3 in vivo and in HSC cells. [score:5]
In particular, we demonstrated by a variety of in vitro and in vivo approaches that phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1) and protein kinase B (AKT3) are direct targets of miR-29b in HSCs responsible for signaling onset of HSCs activation and liver fibrosis. [score:5]
We then searched for the targets of miR-29b by in silico searches using two prediction algorithms miRanda and TargetScan. [score:5]
These results supported the specific inhibitory effect of miR-29b on PIK3R1 expression and AKT3 activation in liver fibrosis. [score:5]
These findings suggest a possible mechanism by which miR-29b suppresses liver fibrosis through negatively regulates PI3K/AKT signaling pathway via direct interaction with PIK3R1 and AKT3. [score:5]
Introduction of miR-29b significantly reduced protein expression of p-Smad3, collagen I, α-SMA and TIMP-1 (Figure 3D), inferring that the anti-fibrosis effect of miR-29b was mediated at least by suppressing genes involved in fibrogenesis (Figure 3E). [score:5]
However, the miR-29b expression showed a time -dependent decrease by TGF-β1 in LX1 cells (Figure 1F), indicating that miR-29b is a potential downstream target of TGF-β/Smad3 signaling. [score:5]
The potential miR-29b binding targets were predicted by TargetScan (www. [score:5]
In this study, we effectively delivered miR-29b plasmid into both normal and disease liver in which higher levels of miR-29b transgene were expressed as detected by in situ hybridization and by real-time PCR without any side effect (Figure 2). [score:5]
Similar down-regulation of miR-29b expression was also observed in activated primary HSCs isolated from the liver of rodent compared to their quiescent phenotype. [score:5]
Moreover, miR-29b dramatically decreased the protein expression of PIK3R1, AKT3 and p-AKT3 in HSC cells and in fibrotic animal mo dels, indicating the translational repression of PIK3R1 and AKT3 by miR-29b (Figure 6C-6D). [score:5]
Whist miR-133a had no inhibition effect on the reporter activity of the mutant 3′-UTR of PIK3R1 and AKT3 (Figure 6B), indicating the direct regulation of miR-29b at the 3′-UTR of PIK3R1 and AKT3 transcripts. [score:5]
Down-regulation of miR-29b is mediated by Smad3. [score:4]
Thus, miR-29b is a downstream target gene of Smad3 in liver fibrosis that is negatively regulated by TGF-β/Smad3 signaling. [score:4]
By chromatin immunoprecipitation (ChIP)-PCR assay, we revealed the directly binding of Smad3 to miR-29b promoter in LX1 cells with TGF-β1 treatment (Figure 1G), indicating that miR-29b is a direct transcriptional target of Smad3 in HSCs. [score:4]
miR-29b inhibits PIK3R1 and AKT3 by direct binding to their 3′-UTR regions. [score:4]
Introduction of miR-29b resulted in significant down-regulation of α-SMA, DDR2, FN1, ITGB1 and PDGFR-β mRNAs (Figure 4B). [score:4]
miR-29b is down-regulated in human fibrotic liver tissues. [score:4]
It has been reported that miR-29b suppresses progression of renal fibrosis by down -regulating tropomyosin 1 and COL2A1 [23]. [score:4]
These findings are consistent with our recent reports in pulmonary fibrosis [16] and in renal fibrosis [15] that Smad3 mediates TGF-β1 -induced downregulation of miR-29b by binding to miR-29b promoter. [score:4]
The molecular mechanisms by which miR-29b exerted its antifibrotic function was by directly inhibiting PIK3R1 and AKT3, causing inactivation of the PI3K/AKT signaling pathway, and ultimately inducting apoptosis of activated HSCs. [score:4]
The induction of apoptosis in HSCs by miR-29b was also observed concomitantly with the inhibition of cellular proliferation, whereby apoptosis was executed by the regulation of casepase-9 and PARP (Figure 5). [score:4]
We have previously reported that miR-29b is a downstream target gene of Smad3 and it is negatively regulated by TGF-β/Smad signaling in renal fibrosis [15]. [score:4]
To induce miR-29b transgene expression, Doxycycline hyclate (Sigma-Aldrich, St. [score:3]
To further define the effect of endogenous transactivation of miR-29b and to understand the functional consequences and molecular basis in liver fibrosis, we examined its direct regulation of HSC biology, a principal mechanism implicated in the antifibrotic effect of miR-29b. [score:3]
Having shown that miR-29b is a crucial mediator in repressing liver fibrosis through suppressing the activation of HSCs, we looked for the possible downstream effectors participating in its function. [score:3]
miR-29b suppresses genes involved in fibrogenesis. [score:3]
The effect of miR-29b on protein expression of PIK3R1, AKT3 and p-AKT was examined in vivo by. [score:3]
Increased expression of miR-29b activated caspase-9, triggering the proteolytic cleavage of the PARP leading to cellular disassembly and apoptosis. [score:3]
If miR-29b plays a key part in liver fibrogenesis, it would be important to establish that its overexpression ameliorated severity of liver fibrosis. [score:3]
Importantly, miR-29b was an antifibrotic factor and ultrasound-microbubble -mediated miR-29b tranduction has prodigious therapeutic potential for liver fibrosis by inhibition of collagen production, stimulation of matrix degradation and repression the activation of HSCs. [score:3]
These findings imply that miR-29b reduces liver fibrosis by mechanisms of reducing the number of HSCs via causing cell cycle arrest and suppressing cell proliferation. [score:3]
Figure 4(A) Ectopic expression of miR-29b in HSC cell lines LX1 and HSC-T6 was confirmed by RT-PCR. [score:3]
Over -expression of miR-29b was confirmed in miR-29b -transfected mice in the liver by real-time RT-PCR (Figure 2C) and by miR-29b in situ hybridization (Figure 2D). [score:3]
Given the crucial role of miR-29b in suppressing liver fibrosis in vivo, we examined whether miR-29b plays any part in modulation of the activation of HSC in vitro. [score:3]
This information highlights the potential therapeutic mechanism and benefit of miR-29b in inhibiting the PI3K/AKT pathway to prevent and treat liver fibrosis. [score:3]
As determined by real-time PCR, miR-29b expression level was significantly lower in fibrotic tissues comparing to the normal liver tissues (P = 0.002) (Figure 1A). [score:3]
In our pilot study, the efficacy of miR-29b delivery to the liver in mice was detected by real-time PCR and consistent miR-29b expression was detected at week 1 and week 2 (Figure 2B). [score:3]
We have recently reported that miR-29b, a negative regulator for the Smad3 and type I collagen is a key regulator in renal fibrosis [15] and pulmonary fibrosis [16]. [score:3]
analysis revealed that miR-29b suppressed the G1-S transition promoter cyclin D1 and induced the G1 gatekeeper P21 [Cip1] (Figure 4G), further confirming the effect of miR-29b in blocking the cell cycle at the G1/S checkpoint. [score:3]
Cell cycle arrest caused by the overexpression of miR-29b was associated with induction of cyclin D1 and p21 [cip1] (Figure 4). [score:3]
To determine the mechanism by which miR-29b inhibited HSC cells proliferation, we examined the effect of miR-29b on cell cycle distribution. [score:3]
The luciferase reporter activity of PIK3R1ang AKT3 was suppressed by wildtype miR-29b. [score:3]
To test this, we used an ultrasound-microbubble -mediated gene transfer to introduce miR-29b into the liver in mice treated with CCl [4. ] We have previously shown that the use of ultrasound-microbubble -mediated gene transfer is able to effectively deliver Dox-inducible miR-29b plasmid into kidney to block activation of TGF-β/Smad signaling, thereby inhibiting progressive renal fibrosis in rat mo del [15]. [score:3]
We first assessed the expression of miR-29b in 20 human liver fibrosis tissues and 13 normal human liver biopsies. [score:3]
In contrast, CCl [4] -treated mice supplemented with miR-29b showed significant reduced expression of PIK3R1, total AKT3 and p-AKT, which paralleled the improvement in histological severity of liver fibrosis (Figure 3A). [score:3]
miR-29b reduces the activation of hepatic stellate cells in vitroGiven the crucial role of miR-29b in suppressing liver fibrosis in vivo, we examined whether miR-29b plays any part in modulation of the activation of HSC in vitro. [score:3]
miR-29b inhibits PIK3R1 and AKT3 in liver fibrosis in mice. [score:3]
As high expression level of miR-29b was demonstrated to last for 3 weeks after a single dose injection in the pilot study, tail vein injection was performed at about 2 and half weeks for 3 times in total in 8 weeks duration. [score:3]
Ectopic expression of miR-29b in LX1 cells caused a significant increase of apoptotic cells (P < 0.05, Figure 5A). [score:3]
Ectopic expression of miR-29b in LX1 led to a significant increase in the G1 phase population (P < 0.01; Figure 4F), and a corresponding reduction in the S phase cells (P < 0.01; Figure 4F). [score:3]
Among the miRNAs predicted to target genes, we revealed for the first time that PIK3R1 and AKT3 act as critical effectors of miR-29b in liver fibrosis. [score:3]
Collectively, our in vitro findings served as a direct evidence for the regulatory role of miR-29b in HSC activation. [score:3]
The Doxycycline-inducible miR-29b expressing plasmids (pTRE2-miR-29b/pTet-on) were transfected into the liver through tail vein injection followed by ultrasound treatment transcutaneously at the liver location (Figure 2A). [score:3]
miR-29b inhibits HSCs proliferation by causing cell cycle arrest in G1 phase. [score:3]
miR-29b inhibits HSC proliferation and arrests cell cycle in G1 phase. [score:3]
As determined by cell viability assay, miR-29b significantly suppressed cell growth in LX-1 and HSC-T6 cells (P < 0.001) (Figure 4D). [score:2]
We evaluated whether the downregulation of miR-29b in liver fibrosis was mediated by Smad3 and their potential interaction. [score:2]
Therefore, the antifibrotic effect of miR-29b in vivo is at least in part due to a decreased accumulation of activated matrix producing HSCs, reduced collagen production as well as increased matrix degradation, thereby blocking fibrosis development (Figure 3E). [score:2]
Moreover, ectopic expression of miR-29b caused a growth arrest in both LX-1 and T6 HSCs as evidenced by cell viability and colony formation assays. [score:2]
To determine whether these findings reflect the regulation of endogenous PIK3R1 and AKT3 by miR-29b, we transiently reintroduced pre-miR-29b into two HSC lines LX1 and HSC-T6. [score:2]
To clarify this hypothesis, an in vitro study on cultured HSCs is warranted to determine the direct effect by which miR-29b protects against fibrosis. [score:2]
In this study, we found a significant decrease in the expression of miR-29b in human and rodent liver fibrotic tissues compared to normal liver tissues. [score:2]
The expression level of mature miR-29b was quantified by TaqMan microRNA assays (Applied Biosystems). [score:2]
The mechanism of miR-29b downregulation in liver fibrosis is therefore evaluated. [score:2]
In keeping with this, protein expression of the active forms of key apoptosis genes including cleaved caspase-9 and cleaved PARP was enhanced in LX-1 cells transfected with pre-miR-29b compared to pre-miR-control by (Figure 5C). [score:2]
The growth suppressive effect of miR-29b in HSC cells was further confirmed by a colony formation assay, which showed the colonies formed in LX1 and HSC-T6 cells transfected with miR-29b were significantly less than those of control cells (Figure 4E). [score:2]
We confirmed the direct interaction of miR-29b in negatively regulating PIK3R1 and AKT3 at their 3′-UTR regions in HSC cells by luciferase activity assay (Figure 6A-6B). [score:2]
We found that miR-29b was abundant in quiescent HSCs, but was significantly decreased in activated HSCs (Figure 1D). [score:1]
The numbers of mice in the different experimental groups were: Olive oil -treated group, 6; CCl [4] -treated group, 8; CCl [4] and empty vector -treated group, 8; and, CCl [4] and pTRE [2]-miR-29b -treated group, 8. was performed using Transcription Factor ChIP kit (Diagenode, Liège, Belgium). [score:1]
We further determined the interaction between Smad3 and miR-29b. [score:1]
LX-1 cells (1×105 cells/well) transiently transfected with pre-miR-29b (20 nM) or miR-control (20 nM) were seeded in 24-well plates. [score:1]
We transduced pre-miR-29b in activated human (LX-1) and rat (T6) HSCs. [score:1]
These data suggested that miR-29b may play a role in liver fibrogenesis and its repression may be associated with HSCs activation. [score:1]
Here we showed that transfection of miR-29b could significantly increase the susceptibility of HSCs to caspase -mediated apoptosis, indicating that apoptosis is an additional mechanism of anti-fibrotic effect of miR-29b in HSCs [22]. [score:1]
Separately, CCl [4] treated mice were introduced with miR-29b using pTRE2-miR-29b-Tet-on plasmid or control vector by tail vein injection, followed by 5 min ultrasound treatment (2W/cm2) transcutaneously on liver location as described in Materials and Methods. [score:1]
We next examined whether introduction of miR-29b by gene transfer could ameliorate CCl [4] -induced liver fibrosis in vivo. [score:1]
miR-29b induces apoptosis in HSCs. [score:1]
Figure 6(A) miR-29b potential binding sites on the 3′-UTR of four candidate genes, PIK3R1, AKT3, Col1A2 and Col3A1. [score:1]
To test this, two activated HSC cell lines (LX-1 and HSC-T6) were transfected with pre-miR-29b or pre-miR-control (Figure 4A). [score:1]
As shown in Figure 3A, significant bridging fibrosis, fibrous septa and cirrhotic nodules were observed in liver sections in mice treated with CCl [4] and transduced with control vector for 8 weeks by Picrosirius red-staining; whilst, transduction of miR-29b caused marked reduction in the distribution of collagen fibers. [score:1]
These findings indicate that miR-29b induces cell death and promotes subsequent proliferative activity in HSCs. [score:1]
Gene transfer of miR-29b prevents CCl4 -induced liver fibrosis in mice. [score:1]
We found that the 3′-UTR of PIK3R1, AKT3, Col3A1 and Col1A2 contain putative binding sites for miR-29b (Figure 6A). [score:1]
miR-29b prevents carbon tetrachloride (CCl4) -induced liver fibrosis in mice. [score:1]
miR-29b transfection in HSCs. [score:1]
LX-1 and HSC-T6 cells (5 × 10 [4]/well) were plated in a 24-well plate and transfected with pre-miR-29b or control RNA. [score:1]
Ultrasound -mediated miR-29b transfer in the liver. [score:1]
Figure 1 (A) Level of miR-29b was significantly lower in human fibrotic liver tissues (n = 20) than in normal liver tissues (n = 13). [score:1]
The functional role and therapeutic potential for miR-29b in liver fibrogenesis were therefore characterized in vivo using an ultrasound-microbubble -mediated miR-29b transfer, and in vitro by overexpression of miR-29b in HSCs. [score:1]
miR-29b reduces the activation of hepatic stellate cells in vitro. [score:1]
miR-29b induces HSC apoptosis. [score:1]
In order to determine whether the observed suppressive effect of cell growth by miR-29b was due to an induction of apoptosis, cell apoptosis was evaluated by Annexin V/7-AAD double staining and flow cytometry. [score:1]
miR-29b precursor (pre-miR-29b) and the miRNA Mimic Negative Control (pre-miR-control) (Ambion Life Technologies, Austin, TX) were transiently transfected into HSCs (LX-1, HST-T6) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) for 48 h and 72 h, respectively. [score:1]
We have previously reported that a Smad response element (TGTCAGTCT) is located at ~22kb upstream of miR-29b, a highly conserved region [15]. [score:1]
In the eight-week CCl [4] -induced liver fibrosis mo del, transduction of miR-29b significantly repressed the severity of hepatic fibrosis as evidenced by reduced collagen deposition and collagen content (Figure 3A-3C). [score:1]
miR-29b inhibited HSC cell growth as determined by cell viability assay, and (E) by colony formation assay. [score:1]
Ultrasound -mediated gene transfer of miR-29b in CCl -induced liver fibrosis in C57BL6 mice. [score:1]
LX1 cells transfected with pre-miR-29b or miR-control were fixed in 70% ethanol-PBS for 24 hours. [score:1]
A mixed solution that contained pTRE2-miR-29b and Tet-on plasmids/Sonovue (Bracco Diagnostics, Princeton, NJ) in the ratio of 1:1 (vol:vol) or the control empty vectors (pTRE2-Tet-on/Sonovue) in 200 μl [15], was co -transfected into the liver through tail vein injection followed by 5 min ultrasound treatment (2W/cm2) transcutaneously at liver location (THERASONIC 450, Electro-Medical Supplies, Greenham, England). [score:1]
However, the biological role of miR-29b in liver fibrosis and its possible contribution acting as a protective factor against liver fibrogenesis remain largely unclear. [score:1]
Two pairs of primers were designed to detect the Smad3-containing promoter region of miR-29b by ChIP-PCR (lower panel) and a direct interaction be Smad3 and miR-29b was demonstrated. [score:1]
We revealed that miR-29b prevents hepatic fibrogenesis in mice by attenuating HSCs activation and inducing HSCs apoptosis. [score:1]
[1 to 20 of 116 sentences]
9
[+] score: 319
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2, hsa-mir-29c
Interestingly, while these two cell lines showed increased expression of several genes known to be validated targets of miR-29b, the only cell line where miR-29b was not downregulated (HTM3) showed no significant increase in the expression of these genes. [score:10]
In order to identify the pathways and regulatory elements more likely associated with the changes in gene expression induced by miR-29b, genes significantly (p<0.5) upregulated or downregulated by 1.5-fold in the array analysis were further analyzed using MetaCore algorithms. [score:10]
Although there was a high level of variability in the effects of chronic oxidative stress on the expression of the selected genes, the two cell lines where miR-29b had been found to be downregulated more than twofold under oxidative stress conditions showed a significant increase in the expression of several genes regulated by miR-29b. [score:9]
The variability observed in the levels of upregulation of each gene analyzed between the two cell lines where miR-29b was significantly downregulated is likely to result from the influence of multiple pathways involved in the regulation of the ECM under oxidative stress conditions. [score:8]
Pathway analysis indicated that a number of these genes are positively regulated by the transcription factor SP1, which is a validated target of miR-29b [23], suggesting that inhibition of SP1 by miR-29 may be an important factor in the overall effects on gene expression mediated by miR-29b. [score:8]
Targeting of the 3’ untranslated regions of BMP1, ADAM12, and NKIRAS2 mRNA by miR-29bComputational predictions indicate that miR-29b shares complementarity with sequences in the 3’UTR of three genes found to be downregulated by miR-29b according to the gene array analysis: BMP1, ADAM12, and NKIRAS2 (Figure 3A). [score:8]
Chronic oxidative stress induced a significant downregulation of miR-29b in two HTM cell lines that was associated with increased expression of several ECM genes known to be regulated by miR-29b. [score:7]
To investigate whether the downregulation of miR-29b observed in two cell lines could mediate alterations in gene expression induced by chronic oxidative stress, the effects of incubation at 40% oxygen on the expression of six genes known to be regulated by miR-29b (COL1A2, COL5A1, COL3A1, COL1A1, LAMC, and SPARC) were analyzed in the same three HTM cell lines used in the previous experiment. [score:7]
MiR-29b also downregulated numerous genes that have not been confirmed as direct targets of this miRNA. [score:7]
However, many of the gene expression changes induced by miR-29b affected genes that lack any predicted targeting sequence for miR-29b and appear to be secondary targets. [score:7]
This downregulation was associated with an increase in the expression of several ECM genes known to be regulated by miR-29b. [score:7]
The upregulation of these genes by chronic oxidative stress was inhibited by transfection with miR-29b mimic. [score:6]
In all cell lines, transfection with miR-29b mimic led to either a significant downregulation or decrease in the upregulation mediated by chronic oxidative stress of all genes analyzed compared to cultures transfected with control mimic (Figure 5). [score:6]
The upregulation of ECM genes mediated by chronic oxidative stress in cells lines HTM1 and HTM2 was inhibited by transfection with miR-29b. [score:6]
MiR-29b is also downregulated in myocardial infarct, and its downregulation has been shown to contribute to fibrosis in the heart [19]. [score:6]
For instance, one of the new targets identified in this study, NKRAS2, is a negative modulator of NFKB, and its downregulation by miR-29b could potentially facilitate the anti-apoptotic effects of NFKB. [score:6]
Furthermore, transient expression of miR-29a, which shares the same seed region of miR-29b and also regulates p53 through targeting of p85α and CDC42, did not result in increased apoptosis in osteoblasts [31]. [score:6]
Downregulation of miR-29b might contribute to increased expression of several ECM genes under chronic oxidative stress conditions. [score:6]
A: Predicted interactions between miR-29b with the 3’-unstranslated region (3’ UTR) of BMP1 (PicTar-Vert), ADAM12 (TargetScan), and NKRAS2 (PicTar-Vert). [score:5]
Targeting of miR-29b to the 3’-untranslated region of three novel putative targets was evaluated using the Psicheck luciferase system. [score:5]
Targeting of the 3’ untranslated regions of BMP1, ADAM12, and NKIRAS2 mRNA by miR-29b. [score:5]
Among these genes, BMP1, ADAM12, and NKIRAS2 were confirmed by luciferase analysis to contain 3’UTRs that can be directly targeted by miR-29b and should be considered targets of this miRNA. [score:5]
Figure 3Targeting of the 3’-unstranslated regions of BMP1, ADAM12, and NKIRAS2 by miR-29b. [score:5]
The increase in expression of these genes was inhibited by transfection with miR-29b mimic. [score:5]
The downregulation of miR-29b observed in two cell lines could contribute to some of the alterations in ECM metabolism and cell viability mediated by chronic oxidative stress in HTM cells. [score:4]
Genes significantly downregulated by miR-29b are labeled with blue dots. [score:4]
Transfection of HTM cells with miR-29b mimic resulted in downregulation of multiple ECM components, including collagens (COL1A1, COL1A2, COL4A1, COL5A1, COL5A2, COL3A1) LAMC1, and FBN as well as several genes involved in ECM deposition and remo deling, such as SPARC/osteonectin. [score:4]
Figure 2 Genes known to be regulated by SP1 that showed significant differences in expression after transfection with miR-29b mimic by array analysis. [score:4]
Downregulation of these gene transcripts by miR-29b was confirmed by Q-PCR in three HTM cells lines (Figure 3C). [score:4]
Our results showed that miR-29b negatively regulates the expression in HTM cells of multiple genes involved in ECM synthesis, deposition, and remo deling. [score:4]
These results suggest that downregulation of miR-29b could be a mechanism that mediates some of the alterations in ECM induced by chronic oxidative stress. [score:4]
Genes significantly upregulated in gene array analysis of cells transfected with miR-29b are labeled with red dots. [score:4]
Genes up-or down-regulated after transfection with hsa-miR-29b in HTM cells. [score:4]
In addition, incubation under chronic oxidative stress conditions (4 days, 40% oxygen) resulted in a significant downregulation of miR-29b in two of the three HTM cell lines analyzed. [score:4]
Three additional genes, BMP1, ADAM12, and NKIRAS2, were identified as direct targets of miR-29b. [score:4]
MiR-29b downregulated several ECM structural proteins, as collagens (COL5A2, COL5A1, COL4A1, COL3A1, COL1A1, and COL1A2) laminin C, fibrillin 1, and microfibrillar -associated protein 3; and extracellular matrix regulators, such as MMP14, LOXL2, SERPINH1, SPARC, TNFAIP6, and ADAM 12. [score:4]
Computational predictions indicate that miR-29b shares complementarity with sequences in the 3’UTR of three genes found to be downregulated by miR-29b according to the gene array analysis: BMP1, ADAM12, and NKIRAS2 (Figure 3A). [score:4]
Exposure to chronic oxidative stress conditions for 4 days resulted in a significant decrease in expression of miR-29b in two (HTM1 and HTM2) of the three cell lines analyzed. [score:3]
Functional network analysis of gene expression changes induced by miR-29b. [score:3]
Effects of chronic oxidative stress on the expression of miR-29b. [score:3]
Analysis of transcription factor regulation identified SP1 as the transcription factor most significantly (p=4.82 E-106) involved in the regulation of genes affected by miR-29b with 46 nodes (Figure 2). [score:3]
Members of the miR-29 family, including miR-29b, have been demonstrated to activate p53 by targeting p85α and CDC42 [31]. [score:3]
In addition to changes in the expression of ECM components, our results also showed that miR-29b had a protective effect and decreased cell death. [score:3]
In contrast, incubation at 40% oxygen had little effect on the expression of these genes in the cell line where miR-29b had not been found to be altered by chronic oxidative stress. [score:3]
Cotransfections of 293A cells with luciferase 3’untranslated region (UTR) constructs (0.3 µg), miR-29b mimic, or control mimic (20 pmolar) were accomplished using Effectene (Qiagen, Valencia, CA). [score:3]
Role of miR-29b on changes in expression of extracellular matrix genes induced by chronic oxidative stress. [score:3]
Genes showing changes in expression higher than 1.5 fold (p<0.05) after transfection with miR-29b mimic using Affymetrix U133A2 arrays were analyzed with Metacore pathway analysis. [score:3]
Thirty-one percent of these transcripts were predicted in at least one of the three miRNA databases as putative targets for miR-29b. [score:3]
Validation of gene expression changes after transfection with hsa-miR29b. [score:3]
To gain more insight into the potential role of miR-29b in the TM, we investigated the effects of chronic oxidative stress on the expression of miR-29b, analyzed the changes in gene expression mediated by miR-29b, and evaluated whether alterations in miR-29b expression might alter the effects induced by chronic oxidative stress in human TM (HTM) cells. [score:3]
Changes in gene expression induced by miR-29b in human trabecular meshwork cells. [score:3]
MiR-29 is a positive regulator of osteoblast differentiation and controls the expression of collagens in differentiated osteoblasts [14]. [score:3]
Strategies to increase miR-29 expression in TM cells may be beneficial to limit ECM deposition, prevent cell loss, and maintain normal levels of aqueous humor outflow facility. [score:3]
The asterisks indicates the miRNA databases that predicts these genes as putative targets for miR29b. [score:3]
Figure 5The role of miR-29b on changes in expression of extracellular matrix genes induced by chronic oxidative stress. [score:3]
In conclusion, miR-29b negatively modulated the expression of collagens and other key components of the ECM in TM cells and decreased cytotoxicity in the presence of chronic oxidative stress. [score:3]
Therefore, the variability observed in the effects of chronic oxidative stress on the expression of miR-29b could be relevant to understanding individual differences in susceptibility to pathophysiological alterations induced by chronic oxidative stress in the outflow pathway. [score:3]
The multiple effects on the expression of ECM components observed in HTM cells were consistent with the antifibrotic activity previously reported for miR-29b in the heart [19]. [score:3]
MiR-29b negatively regulates the expression of multiple genes involved in the synthesis and deposition of ECM in trabecular meshwork (TM) cells. [score:3]
Figure 1Pathway analysis of changes in gene expression induced by miR-29b. [score:3]
Analysis of miR-29b interaction with 3’ untranslated regions. [score:3]
Thus, miR-29 would be predicted to contribute to the regulation of ECM dynamics in the TM. [score:2]
Changes in expression of miR-29b induced by chronic oxidative stress were analyzed by Q-PCR in three independent HTM lines after 4 days at 40% oxygen compared to parallel cultures incubated at 5% oxygen. [score:2]
Specifically, miR-29b has been demonstrated to regulate multiple genes coding for ECM proteins, including multiple collagens, fibrillins, and elastin. [score:2]
However, our results suggest that miR-29b may be an important regulatory component of this process. [score:2]
The figures represent the logarithm of the fold change in gene expression between cells incubated at 40% oxygen transfected with either miR-29b mimic or mimic control compared to control cultures (5% oxygen, mimic control) for three individual cell lines. [score:2]
HTM cells were transfected with miR-29b mimic and gene expression was compared to that in cell cultures transfected with a control mimic. [score:2]
Some of these genes contained sequences in their 3’UTRs that are predicted to anneal to miR-29b and may potentially interact with miR-29b. [score:1]
Differences in gene expression induced by miR-29b were evaluated by gene array analysis using Affymetrix U133A2 chips. [score:1]
In these conditions miR-29b decreased significantly between 2- and 2.5-fold in two of the three cell lines analyzed and showed no significant change in a third line (Figure 4). [score:1]
P-values for the Q-PCR refer to the t-test between normalized C [T] values in cells transfected with miR-29b versus cells transfected with scramble. [score:1]
The experiments were conducted in cells transfected with either control mimic or miR-29b mimic. [score:1]
The balance between the activation of ECM production induced by oxidative stress and the protective effects of miR-29b could be a relevant factor in understanding how oxidative damage may lead to increased deposition of ECM and decreased cellularity in the outflow pathway and contribute to the elevation of intra-ocular pressure in glaucoma. [score:1]
Effects of miR-29b on cytotoxicity. [score:1]
To investigate whether miR-29b under chronic oxidative stress conditions could affect the changes in expression of several extracellular matrix (ECM) genes, three human trabecular meshwork (HTM) cell lines were transfected with miR-29b mimic or control mimic and incubated under oxidative stress conditions (40% O [2]) for 4 days. [score:1]
HTM cells were plated 24 h before transfection with hsa-miR-29b mimic or control mimic (scramble; 20-40pmolar [Dharmacon, Chicago, IL] with Lipofectamine 2000 [Invitrogen] or amaxa nucleofactor kit [Lonza, Basel, Switzerland]) following the manufacturer’s instructions. [score:1]
Figure 4 Changes in miR-29b induced by chronic oxidative stress. [score:1]
Figure 6 Effects of miR-29b on the cytotoxicity of human trabecular meshwork  (HTM) cells. [score:1]
HTM cells transfected with control mimic or miR-29b mimic were subjected to 40% or 5% oxygen and analyzed for cytotoxicity after 5 days. [score:1]
Because of the known pro-apoptotic effects of p53, this function of miR-29b would initially be expected to increase apoptosis under chronic oxidative stress conditions. [score:1]
To investigate the role of miR-29b on the changes in expression of genes involved in the synthesis and deposition of extracellular matrix (ECM) induced by chronic oxidative stress in human trabecular meshwork cells (HTM). [score:1]
The three canonical pathways most significantly affected by miR-29b are represented in Figure 1 and include cell adhesion–ECM remo deling (p=1.5 E-107); cytoskeleton remo deling (p=2 E-105), and cell adhesion–integrin -mediated cell adhesion and migration (p=4 E-105; Figure 1). [score:1]
The balance between the activation of ECM production induced by oxidative stress and the protective effects of miR-29b could be a relevant factor in understanding how oxidative damage may lead to increased deposition of ECM in the TM and contribute to the elevation of intra-ocular pressure in glaucoma. [score:1]
Thus, the pro-apoptotic effects reported for miR-29 may be dependent on the cell type or the specific stress conditions affecting the cells. [score:1]
C: Changes in expression of ADAM12, BMP1, and NKIRAS2 were measured by Q-PCR after transfection with miR-29b mimic or scramble. [score:1]
B: Luciferase activity in 293 cells cotransfected with psicheck vectors containing the 3’UTR or complementary sequence (R) from BMP1, ADAM12, or NKIRAS2 and miR-29b or scramble. [score:1]
Changes in gene expression induced by miR-29b in HTM cells were evaluated by gene array analysis using Affymetrix U133A2 arrays and confirmed by quantitative–PCR. [score:1]
Gene array analysis was conducted in three independent sets of transfections with either miR-29b mimic or mimic control of the same HTM cell line. [score:1]
MiR-29b mimic significantly reduced luciferase expression in cells cotransfected with the 3’UTR of BMP1, ADAM12, or NKIRAS2 compared to mimic control (scramble). [score:1]
It is also possible that additional targets of miR-29b that have not been characterized may be involved in the effects of miR-29b on cell survival in HTM cells. [score:1]
[1 to 20 of 90 sentences]
10
[+] score: 285
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2
In line with its acknowledged role as EZH2 positive modulator, silencing of MALAT1 by ASOs mimicked the molecular effects produced by EZH2 inhibition, as shown by: i) miR-29b upregulation, ii) reduced H3K27me3 at miR-29a/b-1 promoter, and iii) downregulation of miR-29b target genes upon MALAT1 inhibition. [score:13]
WB analysis indicated that transfection of EZH2 -targeting siRNAs in JJN3 and AMO-BZB cells triggered downregulation of validated miR-29b targets, such as SP1, CDK6, and to a lesser extent MCL-1 (Figure 2D), indicating that EZH2-depletion induced a functionally active miR-29b; downregulation of SP1, CDK6 and MCL-1 was also achieved after treatment of MM cells with EZH2 inhibitors (Figure 2E). [score:13]
We also show that EZH2 inhibition triggers a functionally active miR-29b, as demonstrated by downregulation of validated miR-29b targets in MM cells transfected with EZH2 -targeting siRNAs or treated with small molecule EZH2 inhibitors. [score:12]
As expected, MALAT1 -targeting ASOs strongly downregulated MALAT1 expression, while upregulated miR-29b (Figure 4B–4C). [score:11]
Moreover, treatment of MM cells with EZH2 inhibitors, such as the S-adenosyl-homocysteine hydrolase inhibitor 3-Deazaneplanocin (DZNep), GSK343 or EPZ005687 [25, 26], reduced H3K27me3 levels and triggered miR-29b upregulation in MM cell lines (Figure 2C). [score:8]
In the context of epigenetic alterations, aberrant deacetylation of miR-29a/b-1 promoter by histone deacetylases (HDACs), such as HDAC1, HDAC3 [21] and HDAC4 [19] represents a well-documented mechanism by which tumor cells silence miR-29b; consistently, pan HDAC -inhibitors have been found to upregulate miR-29b expression in MM [19], AML [21] and CLL [22]. [score:8]
Given that miR-29b seems to be an important effector of the anti-MM activity of small molecule EZH2 inhibitors, it is reasonable that the design of anti-tumor strategies targeting EZH2 should take into account the miR-29b status of tumor cells, and that upregulation of miR-29b after treatment may be likely predictive of response to these drugs. [score:8]
The effects of MALAT1 and EZH2 on miR-29b expression are summarized in Figure 6. Figure 6 The cartoon shows that MALAT1 and EZH2 negatively regulates miR-29b expression by increasing H3K27me3 of miR-29a/b-1 promoter, thus affecting levels of miR-29b oncogenic targets SP1, MCL-1 and CDK6. [score:8]
Since our results show upregulation of miR-29b upon EZH2 inhibition, we asked whether sensitivity of MM cells to EZH2 inhibitors could rely on miR-29b induction. [score:8]
Figure 5miR-29b antagonism impairs in vitro anti-MM activity of EZH2 inhibitors(A) QRT-PCR analysis of miR-29b expression levels in AMO-BZB transduced with GFP control or miR-29b inhibitors (antimiR-29b). [score:7]
MALAT1 knock-down upregulates miR-29b expression. [score:7]
QRT-PCR analysis indicated downregulation of EZH2 mRNA transcript (Figure 2A) and upregulation of miR-29b (Figure 2B) as early as 24 hours after EZH2 silencing. [score:7]
Inhibition of miR-29b abrogates in vitro anti-MM activity of EZH2 inhibitorsSmall molecule EZH2 inhibitors induce cell cycle arrest and apoptosis, and have demonstrated relevant anti-tumor activity in preclinical mo dels of MM [26]. [score:7]
In MM cells, ectopic miR-29b was shown to downregulate major tumor promoting or anti-apoptotic mRNA targets, including CDK6, MCL-1, SP1 [14], as well as mRNAs coding for epigenetic regulators, such as HDAC4 [19] and DNMT3A/B [20], thus triggering cell cycle arrest and apotosis. [score:7]
In this regard, we here provide formal proof that EZH2 exerts a negative control on miR-29b, since its genetic or pharmacological inhibition triggers miR-29b upregulation. [score:6]
Conversely, ectopic expression of EZH2 in AMO-BZB cells resulted in downregulation of miR-29b (Figure 2F). [score:6]
Interestingly, MALAT1 overexpression resulted in downregulation of miR-29b levels in MM cells (Figure 4A). [score:6]
The cartoon shows that MALAT1 and EZH2 negatively regulates miR-29b expression by increasing H3K27me3 of miR-29a/b-1 promoter, thus affecting levels of miR-29b oncogenic targets SP1, MCL-1 and CDK6. [score:6]
Finally, the findings that miR-29b blockade dramatically impairs the anti-MM activity of DZNep, GSK343 and EPZ005687 disclose relevant implications for the design of targeted therapeutic approaches against MM and other malignancies, in which the tumor suppressive role of miR-29b is well acknowledged. [score:5]
Intriguingly, miR-29b antagonism abrogated the inhibitory effects of these compounds on cell proliferation (Figure 5B) and cell viability (Figure 5C), thus suggesting that miR-29b is crucial in mediating EZH2 inhibitors’ activity. [score:5]
Graphic overview of the inhibitory effect played by EZH2 and MALAT1 on miR-29b expression. [score:5]
Similarly to EZH2 -targeting siRNAs, anti-MALAT1 ASOs reduced protein levels of validated miR-29b targets, such as SP1, MCL-1 and CDK6 in MM cells (Figure 4E). [score:5]
QRT-PCR analysis of EZH2 (A) and miR-29b (B) expression levels in AMO-BZB and JJN3 cells, 24 hours after transfection with 100 nM scrambled siRNAs (SCR) or EZH2 -targeting siRNAs (siEZH2#1 and siEZH2#2). [score:5]
Inhibition of EZH2 promotes miR-29b expression and reduces H3K27me3 marks at miR-29a/b-1 promoter. [score:5]
Figure 2QRT-PCR analysis of EZH2 (A) and miR-29b (B) expression levels in AMO-BZB and JJN3 cells, 24 hours after transfection with 100 nM scrambled siRNAs (SCR) or EZH2 -targeting siRNAs (siEZH2#1 and siEZH2#2). [score:5]
These results indicate that the lncRNA MALAT1 transcriptionally inhibits miR-29b expression by modulating the amount of H3K27me3 of its promoter. [score:5]
Inhibition of miR-29b abrogates in vitro anti-MM activity of EZH2 inhibitors. [score:5]
Inhibitory effect of EZH2 on miR-29b expression. [score:5]
To verify whether miR-29b upregulation induced by EZH2 silencing could depend on decreased promoter -associated H3K27me3, we analyzed H3K27me3 status of miR-29a/b-1 promoter by Chip. [score:4]
The comprehension of cancer-related mechanisms involved in downregulation of miR-29b is nowadays a matter of intense investigation, in order to rationally design new therapeutic tools restoring the expression of this relevant TS miRNA. [score:4]
Knock-down of the lncRNA MALAT1 induces expression of miR-29b in MM cells. [score:4]
Here, we aimed at identifying novel epigenetic mechanisms regulating miR-29b expression. [score:4]
Mechanistically, we here demonstrate that EZH2 binds the miR-29a/b-1 promoter, and H3K27me3 repressive marks at miR-29a/b-1 promoter may contribute to miR-29b silencing, since reduced H3K27me3 at miR-29a/b-1 promoter accompanies miR-29b upregulation upon EZH2 pharmacological blockade. [score:4]
In conclusion, our findings widen the spectrum of epigenetic abnormalities inducing downregulation of miR-29b in MM, and provide the molecular basis to rationally develop tailored epigenetic therapies against this still fatal malignancy. [score:4]
Genetic and epigenetic mechanisms may concur to downregulate miR-29b in human cancer [18]. [score:4]
We previously showed that miR-29b acts as TS miRNA in MM by targeting cell cycle regulators and anti-apoptotic genes [14]. [score:4]
To understand if the upregulation of miR-29b upon MALAT1 inhibition was due to reduced H3K27me3 marks at its promoter, we performed ChiP assay with an H3K27me3 antibody: reduced H3K27 trimethylation of miR-29a/b-1 promoter could be observed in MALAT1 -depleted cells, as compared with control (Figure 4D). [score:4]
Altogether, these results support a negative role of EZH2 on miR-29b expression and activity. [score:3]
AMO-BZB cells were transduced with specific miR-29b inhibitors (levels of miR-29b are reported in Figure 5A), and then treated with DZNep, EPZ005687 and GSK343. [score:3]
miR-29b antagonism impairs in vitro anti-MM activity of EZH2 inhibitors. [score:3]
To assess whether modulation of MALAT1 could affect miR-29b expression, we used both gain and loss of function experimental strategies. [score:3]
Correlation of endogenous miR-29b levels with EZH2 (A), EZH1 (B) and MMSET (C) mRNA levels, determined by high density microarray analysis of mRNA or miRNA expression in GSE73454 (for miR-29b) and GSE73452 (for EZH2 mRNA) datasets. [score:3]
QRT-PCR analysis of MALAT1 (B) or miR-29b (C) expression levels, 72 hours after treatment of AMO-BZB cells with 2.5 μM naked MALAT1 ASOs at the indicated concentrations. [score:3]
As expected, pharmacologic inhibition of EZH2 by DZNep decreased H3K27me3 at miR-29a/b-1 promoter (Figure 3B), thus suggesting that miR-29b induction occurs by reduced H3K27me3 repressive marks. [score:3]
Figure 1Correlation of endogenous miR-29b levels with EZH2 (A), EZH1 (B) and MMSET (C) mRNA levels, determined by high density microarray analysis of mRNA or miRNA expression in GSE73454 (for miR-29b) and GSE73452 (for EZH2 mRNA) datasets. [score:3]
miR-29b and EZH2 mRNA expression inversely correlates in primary MM PCs. [score:3]
To investigate the effects of EZH2 on miR-29b expression, we analyzed miR-29b levels in JJN3 and AMO-BZB MM cell lines transfected with scrambled siRNAs (as control) or two different EZH2 -targeting siRNAs. [score:3]
Among epigenetic abnormalities, we previously demonstrated that the class II histone deacetylase HDAC4 exerts a negative control on miR-29b, and its silencing increases acetylation at miR-29a/b-1 promoter region thus triggering miR-29b expression in MM cells [19]. [score:3]
Firstly, AMO-BZB cells were transduced with lentivirus expressing MALAT1, and levels of miR-29b were determined by qRT-PCR. [score:3]
In an attempt to identify novel epigenetic regulators contributing to the silencing of TS miR-29b in MM, firstly we evaluated the potential correlation between miR-29b and the mRNA expression levels of histone methyltransferases with an oncogenic role in MM [23], such as EZH1, EZH2 and MMSET. [score:2]
So far, the contribution of other MM-related epigenetic modifications to miR-29b regulation, such as histone methylation, has not been addressed. [score:2]
Our results underscore, for the first time, the role of the H3K27 methyltransferase EZH2 in the negative regulation of miR-29b in MM. [score:2]
Trypan blue exclusion assay (B) and CTG viability assay (C) were performed in AMO-BZB cells stably transduced with GFP control or miR-29b inhibitors (anti-miR-29b), 72 hours after treatment with 2 μM DZnep, 5 μM GSK343 or 5 μM EPZ005687. [score:1]
In this regard, it has been demonstrated by us and others that genetic and epigenetic aberrations drive the silencing of miR-29b in hematological malignancies, such as MM and acute myeloid leukemia (AML) [18]. [score:1]
Figure 4(A) QRT-PCR analysis of miR-29b and MALAT1 in AMO-BZB cells after transduction with an empty vector (V-CNT) or a vector containing MALAT1 cDNA (V-MALAT1). [score:1]
In this regard, we have demonstrated that miR-29b is a TS miRNA, whose reinforcement by synthetic miR-29b oligonucleotides triggers apoptosis both in vitro and in vivo in validated preclinical mo dels of human MM [14, 20]. [score:1]
Among TS miRNAs, our group and others demonstrated that miR-29b is a relevant anti-cancer miRNA in a wide variety of solid and hematologic malignancies [18]. [score:1]
Inverse correlation between EZH2 and miR-29b in MM patient-derived plasma cells. [score:1]
We further analyzed miR-29b levels in AMO-BZB cells treated with selective anti-MALAT1 antisense oligonucleotides (ASOs) [31], that trigger selective RNAse-H dependent degradation of MALAT1, or with a scrambled control. [score:1]
Noteworthy, we have here demonstrated, for the first time at our knowledge, a negative association between the H3K27 methyltransferase EZH2 and miR-29b in MM. [score:1]
By interrogating GEP and miRNA datasets, we found that miR-29b and EZH2 mRNA levels inversely correlated. [score:1]
[1 to 20 of 61 sentences]
11
[+] score: 276
Other miRNAs from this paper: hsa-mir-29b-2, mmu-mir-29b-1, mmu-mir-29b-2
Based on the fact that miR-29b target genes were upregulated in 231-S100A7 and downregulated in MCF7-S100A7 cells, we hypothesized that S100A7 differentially regulates miR-29b expression which subsequently affects cell proliferation in MDA-MB-231 and MCF7 cells through modulation of miR-29b target genes. [score:14]
In order to verify this, we first analyzed the expression levels of both mature miR-29b and its two primary microRNAs on chromosome 7 and 1. In agreement with our GFE analysis, we observed that S100A7 overexpression significantly downregulated miR-29b expression in MDA-MB-231 cells and upregulated miR-29b in MCF7 cells, in both mature (miR-29b) and primary (pri-mir-29b-1 and pri-mir-29b-2) forms (Figure  1B, C). [score:13]
Importantly, in agreement with our in vitro cell line data (Figure  1B, C), analysis of TCGA invasive breast cancer patient data [24] showed that S100A7 overexpression in ER [+] patients is more likely to correlate with miR-29b upregulation than ER [−] patients; and S100A7 overexpression in ER [−] patients is more likely to correlate with miR-29b downregulation than ER [+] patients (Additional file 1: Figures S1, S2 and S3). [score:11]
In the present study, we show that S100A7 significantly downregulates the expression of miR-29b in Estrogen Receptor (ER) -positive breast cancer cells (represented by MCF7), and significantly upregulates miR-29b in ER -negative cells (represented by MDA-MB-231). [score:9]
As shown in Figure  1A, miR-29b target genes were significantly enriched in the genes upregulated in 231-S100A7 and also in those downregulated in MCF7-S100A7 cells. [score:9]
miR-29b governs numerous genes’ expression by targeting their 3′ UTRs, leading to both translational suppression and instability of mRNAs. [score:9]
NF-κB has been shown to either directly or indirectly inhibit the expression of miR-29b, which is transcribed from mir-29b-1 on chromosome 7 and mir-29b-2 on chromosome 1 [18, 19]. [score:7]
Hence, with the discovery of S100A7 - miR-29b regulatory route, miR-29b may be potential to serve as an alternative target for S100A7 overexpression in breast cancer treatment. [score:6]
S100A7 downregulates PI3K p85α and CDC42 via targeting of miR-29b to activate and stabilize p53 in MCF7. [score:6]
Transient knockdown of miR-29b with miR-29b inhibitor (antagomir) partially rescued the expression of p85α and CDC42 (Figure  3C, D). [score:6]
By ChIP assay and qRT-PCR, we observed that S100A7 overexpression differentially altered the binding of NF-κB to the promoter of pri-mir-29b-1 and/or the expression of pri-mir-29b-2 suppressor, YY1, in MDA-MB-231 and MCF7 cells (Figure  2D-F). [score:6]
The anti-cancer effect of miR-29b has been shown to be related to its targeting of the 3′ UTRs of multiple key cancer regulators, thus suppressing the growth and metastasis of breast cancer. [score:6]
When we orthotopically injected these cells into nude mice mammary fat pad, miR-29b overexpression repressed S100A7 induced tumor growth of MDA-MB-231 cells (Figure  6A-C), whereas miR-29b knockdown rescued tumor growth from S100A7 suppression in MCF7 cells (Figure  6D, E). [score:6]
The clinical relevance of this was supported by patient data of the TCGA cohort, which showed that S100A7 upregulation is more likely to be associated with increased miR-29b expression in ER [+] breast cancer patients than ER [−] patients and vice versa. [score:6]
We first verified that, in breast cancer cells, inhibiting NF-κB activation with its inhibitor, QNZ, significantly enhanced the transcription of pri-mir-29b-1 and pri-mir-29b-2 (Figure  2A). [score:5]
Moreover, the differential regulation of miR-29b expression was associated with differential regulation of NF-κB activation by S100A7. [score:5]
Interestingly, we observed differential regulation of NF-κB activity by S100A7, which is similar to the differential regulation of miR-29b expression in MDA-MB-231 and MCF7 cells. [score:5]
Reversing the S100A7-caused changes of miR-29b expression by transfecting exogenous miR-29b or miR-29b-Decoy can inhibit the effects of S100A7 on in vitro cell proliferation and tumor growth in nude mice. [score:5]
Both direct and indirect transcriptional regulations by NF-κB led to the differential regulation of miR-29b levels by S100A7, in MDA-MB-231 and MCF7 cells. [score:5]
miR-29b expression has been shown to be inhibited by NF-κB in non-breast cancer cells [18, 19, 25]. [score:5]
It was shown that miR-29b targets p85α and CDC42 and consequently inhibits p53 activation and cell proliferation [22]. [score:5]
In the present study, we showed that S100A7 enhanced NF-κB activity in MDA-MB-231 and inhibited NF-κB activity in MCF7, which then directly and/or indirectly influences miR-29b transcription. [score:5]
S100A7 overexpression induced differential miR-29b expression changes in MDA-MB-231 and MCF7 cells. [score:5]
Moreover, other than regulation of cell proliferation, miR-29b has also been shown to inhibit breast cancer metastasis [16]. [score:4]
We showed that S100A7 induced upregulation of miR-29b in MCF7 cells was able to reduce the level of p85α and CDC42 proteins (Figure  3B). [score:4]
The distinct modulations of the NF-κB – miR-29b – p53 pathway make S100A7 an oncogene in ER -negative and a cancer-suppressing gene in ER -positive breast cancer cells, with miR-29b being the determining regulatory factor. [score:4]
The differential regulation of miR-29b by S100A7 in ER -positive and ER -negative breast cancer is supported by the gene expression analysis of TCGA invasive breast cancer dataset. [score:4]
Among the targets of miR-29b, PI3K p85α and CDC42 have been shown to regulate p53 activation [22]. [score:4]
In addition, we reversed the effects of S100A7 on cell proliferation and tumor growth by overexpressing miR-29b in 231-S100A7 cells and knocking down miR-29b in MCF7-S100A7 cells, which reflected that miR-29b is not only sufficient but also necessary for determining the differential effects of S100A7 in breast cancer cells. [score:4]
In these different types of breast cancer cells, S100A7 differentially regulates NF-κB activation, which then differentially affects miR-29b expression and p53 functions. [score:4]
The binding of NF-κB to the promoter directly suppresses pri-mir-29b-1 transcription (Figure  2B). [score:4]
miR-29b transcription is inhibited by NF-κB, and NF-κB activation is differentially regulated by S100A7 in ER -positive and ER -negative breast cancer cells. [score:4]
We then compared the GFE analysis outcomes of these four sets and discovered a common imprint between MDA-MB-231 and MCF7 that is associated with opposite changes of genes: the expression changes of miR-29b targets. [score:4]
Since large portions of these regulated genes are associated with cell proliferation, miR-29b has been considered as a tumor suppressor in various cancers [14, 15, 19, 27], including breast cancer [16, 17]. [score:3]
Using MCF7, whose miR-29b was more significantly affected by S100A7, we showed that miR-29b targeted PI3K p85α and CDC42, which consequently increased p53 level by enhancing its activation and nuclear translocation. [score:3]
miR-29b is encoded by two genes, mir-29b-1 on chromosome 7 and mir-29b-2 on chromosome 1. It has been shown that NF-κB binds to the promoter of mir-29b-1 and inhibits its transcription [18]. [score:3]
Through bioinformatic analysis and in vitro assays, we found that miR-29b expression was reduced by S100A7 in ER [−] MDA-MB-231 and increased by S100A7 in ER [+] MCF7 cells, which at least partly explained the different roles of S100A7 in regulating proliferation of different types of breast cancer cells. [score:3]
S100A7 can either promote or suppress breast cancer cell proliferation through distinct modulation of the NF-κB – miR-29b – p53 pathway in ER [−] MDA-MB-231 and ER [+] MCF7 cells, respectively (summarized in Figure  7). [score:3]
Among the targets of miR-29b, PI3K p85α and CDC42 have been shown to be closely related to cancer growth [22, 31, 32]. [score:3]
And reversing miR-29b changes can suppress the effects of S100A7 in these cells. [score:3]
It has been reported that miR-29b activates p53 through targeting the 3′ UTR of the oncogenes, PI3K p85α and CDC42 [22] (Figure  3A). [score:3]
Figure 3 miR-29b targets p85α and CDC42, and determines the effects of S100A7 on p53 activation and stability in different cells. [score:3]
Training sets from microarray data are indicated by heat maps, and percentage of miR-29b targets are indicated with pie charts with significance of enrichment analysis. [score:3]
Directly, NF-κB can bind to the promoter of mir-29b-1 to block its transcription. [score:2]
Prolonged knock down of miR-29b by miR-29b-Decoy transfection reduced p53 activation in MCF7-S100A7 (Figure  3E). [score:2]
S100A7 induced differential regulation of miR-29b is important for its differential effects on cell proliferation of MDA-MB-231 and MCF7 in vitro and their tumor growth in vivoTo verify the importance of miR-29b in determining the differential effects of S100A7, we stably transfected 231-S100A7 and MCF7-S100A7 cells with exogenous miR-29b and miR-29b-Decoy, respectively, to reverse the changes of miR-29b caused by S100A7 (Figure  5A, C). [score:2]
To our knowledge, the distinct regulation of NF- κB - miR-29b by S100A7 is shown for the first time. [score:2]
Figure 1 S100A7 differentially regulates miR-29b transcription and NF-κB activation in MDA-MB-231 and MCF7 cells. [score:2]
In the present study, we described a novel role of the NF-κB – miR-29b – p53 pathway, which defines the distinct effects of S100A7 on regulating cell proliferation and tumor growth of ER [−] and ER [+] breast cancer. [score:2]
Figure 2 S100A7 differentially regulates miR-29b transcription in MDA-MB-231 and MCF7 cells. [score:2]
miR-29b has been considered a strong tumor suppressor in multiple cancers. [score:2]
miR-29b real-time PCR assay kit and miR-29b inhibitor were purchased from Life Technologies (Carlsbad, CA). [score:2]
miR-29b transcription is differentially regulated by S100A7 via NF-κB in MDA-MB-231 and MCF7. [score:2]
S100A7 induced differential regulation of miR-29b is important for its differential effects on cell proliferation of MDA-MB-231 and MCF7 in vitro and their tumor growth in vivo. [score:2]
miR-29b is considered to be a tumor suppressor in multiple types of cancers [14, 15], including breast cancer [16, 17]. [score:2]
Figure 7 Proposed mechanism of differential regulations of NF-κB – miR-29b – p53 pathway by S100A7 in different types of breast cancer cells. [score:2]
We intended to find out whether S100A7 affected miR-29b transcription via regulating NF-κB activation in MDA-MB-231 and MCF7. [score:2]
These data showed that S100A7 differentially regulates miR-29b transcription in ER [−] and ER [+] breast cancers. [score:2]
Figure 6 miR-29b determines the effects of S100A7 on tumor growth of MDA-MB-231 and MCF7 cells. [score:1]
Brian Brown (Mount Sinai School of Medicine) for sharing their miR-29b plasmids, thank the Division of Biomedical Informatics Cincinnati Children’s Hospital Medical Center for providing their bioinformatic engine “ToppGene”, thank Grace Amponsah for experimental assistance. [score:1]
Figure 5 Manipulating miR-29b could counteract the effects of S100A7 on cell proliferation in MDA-MB-231 and MCF7. [score:1]
231-S-miR-29b cell was generated by stably transfecting pcDNA3-miR29b plasmid shared by Dr. [score:1]
This showed that NF-κB activity was inversely correlated with miR-29b transcription in breast cancer cells. [score:1]
miR-29b-Decoy. [score:1]
231-V and 231-S-miR-29b are not significantly different. [score:1]
pri-mir-29b-1 promoter contains three NF-κB binding sites. [score:1]
The S100A7 induced proliferation increase in MDA-MB-231 was repressed by exogenous miR-29b (Figure  5B), and the decrease of proliferation in MCF7 was also partially rescued by miR-29b-Decoy (Figure  5D, 1: Figure S5). [score:1]
231-V and 231-S-miR-29b are not significantly different, neither are MCF7-V and MCF7-S-miR-29b-Decoy. [score:1]
This dramatic rise of miR-29b led to a significant increase of p53 phosphorylation, nuclear translocation (Figure  3E-G, 1: Figure S4) and total p53 protein level (Figure  3H) in MCF7-S100A7 cells. [score:1]
To verify the importance of miR-29b in determining the differential effects of S100A7, we stably transfected 231-S100A7 and MCF7-S100A7 cells with exogenous miR-29b and miR-29b-Decoy, respectively, to reverse the changes of miR-29b caused by S100A7 (Figure  5A, C). [score:1]
This demonstrated that miR-29b functions downstream of S100A7 and is important in determining the differential effects of S100A7 in breast cancer cells. [score:1]
Thus, it is suggested that miR-29b may be paired with S100A7 to serve as more accurate biomarkers for breast cancer diagnosis and prognosis. [score:1]
Breast cancer Cell proliferation S100A7 miR-29b p53 The inflammatory protein S100A7 (Psoriasin) was discovered as a marker of human psoriasis lesion [1, 2]. [score:1]
Thus, we confirmed that miR-29b is the determining factor of the differential effects of S100A7 in ER [−] and ER [+] breast cancer cells. [score:1]
MCF7-S-miR-29b-Decoy cell was generated by stably transfecting AB. [score:1]
[1 to 20 of 75 sentences]
12
[+] score: 256
Based on the inverse correlation between let-7a/miR-16/miR-29b and c-Myc and CCND2 expression, we hypothezed that down regulation of c-Myc would restore the expression of tumor-suppressive miRNAs, let-7a, miR-16 and miR-29b, subsequently down-regulate CCND2 in ES cell lines. [score:11]
Thus, the expression analysis data lead us to the prediction of new axis that c-Myc might repress the tumor suppressive miRNAs, let-7a, miR-16 and miR-29b, and the inhibition of these miRNAs might result in the up-regulation of CCND2 in ES cells. [score:10]
We also explored whether c-Myc would regulate the expression of let-7a, miR-16 and miR-29b and these tumor suppressive miRNAs suppress the expression CCND2. [score:10]
In the present study, knockdown of c-Myc using siRNA revealed the up-regulation of let-7a, miR-16 and miR-29b, indicating that these tumor suppressive miRNAs are also regulated by c-Myc as MRMs in ES cell lines. [score:8]
In summary, the present study showed that the down-regulation of let-7a, miR-16 and miR-29b were mediated by c-Myc and subsequently inhibited the expression of CCND2 in SKES1. [score:8]
As consistent with the data of in vitro experiments, the xenograft mo del of ES also indicated that let-7a, miR-16 and miR-29b induction had the ability to inhibit ES cells development ex vivo treatment by targeting CCND2 expression. [score:8]
Among the various families of miRNAs, the let-7a, miR-16 and miR-29b have become the prototypes for miRNAs that function as the tumor suppressors since these miRNAs could inhibit the expression of multiple oncogenes, including c-Myc [20– 22]. [score:7]
The significant suppression of let-7a, miR-16 and miR-29b expression in ES cells suggests the tumor suppressive roles of these miRNAs in ES. [score:7]
It is possible that let-7a, miR-16 miR-29b may have down-regulated CCND2 expression via indirect pathway. [score:7]
The results indicated that the expression of let-7a, miR-16 and miR-29b was coordinately up-regulated in ES cell lines, and made us to investigate genome-wide mRNA profiling by cDNA array to detect the possible targets of let-7a, miR-16 and miR-29b in ES cells. [score:6]
In the present study, miRNA array results demonstrated that the expression of let-7a, miR-16 and miR-29b were down-regulated in all of five ES cell lines. [score:6]
Among the predicted target genes of let-7a, miR-16 and miR-29b in the TargetScan (http://www. [score:5]
Although several miRNAs have been found to target CCND2, including let-7a [15], miR-16 [16] and miR-29b [17], the correlation of CCND2 expression and miRNAs in ES cells has been unknown. [score:5]
To test whether let-7a, miR-16 and miR-29b expression affected endogenous let-7a, miR-16 and miR-29b expression, we transfected let-7a, miR-16 and miR-29b mimic and their mutant oligonucleotides, as well as the negative control-miR, into SKES1 cells. [score:5]
c-Myc exhibited inverse correlation with let-7a, miR-16 and miR-29b, and these tumor suppressive miRNAs played important roles in SKES1 proliferation and tumorigenesis by targeting CCND2 both in vitro and ex vivo treatment. [score:5]
Furthermore, ex vivo treatment studies showed the inhibition of ES tumor cell growth in mice injected with ES cells overexpressing of let-7a, miR-16 or miR-29b. [score:5]
Although let-7a, miR-16 and miR-29b might influence the expression of several genes, we focused on CCND2 as the target of the miRNAs in ES cells. [score:5]
Inhibition of CCND2 expression by let-7a, miR-16 and miR-29b and CCND2-siRNA. [score:5]
Silencing of c-Myc with c-Myc siRNA and let-7a, miR-16, miR-29b directly target to CCND2 mRNA in SKES1. [score:4]
Down regulation of let-7a, miR-16, and miR-29b expression in ES cell lines. [score:4]
Our data suggests that c-Myc might negatively regulate let-7a, miR-16 and miR-29b expression in ES cells. [score:4]
Indeed, debilitation of c-Myc using siRNA revealed down-regulation of CCND2, and induced the correction of abnormal cell cycle progression, which were consistent with the results of the transfection experiments with let-7a, miR-16 and miR-29b in ES cells. [score:4]
CCND2 as a direct let-7a, miR-16 and miR-29b target in ES Cell lines. [score:4]
It is noteworthy that the down-regulation of CCND2 by challenge of let-7a, miR-16, miR-29b or siRNA against CCND2 did not induce apoptosis in ES cells, indicating that the repression of ES cell growth was acquired by the cell cycle retardation. [score:4]
Our results suggested that the same regulatory mechanism of CCND2 expression via let-7a, miR-16 and miR-29b might exist in ES cells. [score:4]
To study the roles of c-Myc in the regulation of let-7a, miR-16 and miR-29b in ES cells, we transfected the cells with siRNA targeting for c-Myc. [score:4]
The analysis using several algorithms, such as BLAST, and real-time PCR after miRNAs transfection, further suggested that CCND2 was directly targeted by let-7a, miR-16 and miR-29b. [score:4]
Several studies have shown that let-7a, miR-16 and miR-29b are down-regulated and are closely related to the abnormal potentials in malignant tumors [23– 25]. [score:4]
CCND2 as a direct let-7a, miR-16 and miR-29b target in ESThe region complementary to the let-7a, miR-16 and miR-29b seed region was found in the 3’-UTR of human CCND2. [score:4]
Suppression of ES cell growth by transfection of let-7a, miR-16, miR-29b and CCND2-siRNA. [score:3]
The present study demonstrated that forced elevation of let-7a, miR-16 and miR-29b resulted in the reduction of the expression of CCND2 protein in ES cells. [score:3]
The cell growth of SKES1 was inhibited by the transfection of let-7a, miR-16 and miR-29b in comparison with untreated and negative control miRNA transfected cells at 48 h after the transfection as determined by the cell counting (Fig 5A–5C). [score:3]
0138560.g004 Fig 4The expression of CCND2 protein was decreased in SKES1 transfected with let-7a (A), miR-16 (C), miR-29b (E) and CCND2-siRNA (G). [score:3]
Inhibition of cell cycle progression at G0/G1 phase by let-7a, miR-16 and miR-29b. [score:3]
The protein expression level of CCND2 in the let-7a, miR-16 and miR-29b -transfected cells (40nM) were reduced to 21.7%, 43.9% and 36.7% of that in the control cells, respectively (p < 0.05) (Fig 4B, 4D and 4F). [score:3]
Decreased CCND2 expression at the mRNA level following transfection with the let-7a, miR-16 and miR-29b mimic (Fig 3D–3F. [score:3]
S1 FigPredicted binding sites of let-7a (A), miR-16 (B), and miR-29b (C) in 3′-UTR of CCND2, as aligned by Basic Local Alignment Search Tool (BLAST), TargetScan 6.0 (microRNA. [score:3]
Predicted binding sites of let-7a (A), miR-16 (B), and miR-29b (C) in 3′-UTR of CCND2, as aligned by Basic Local Alignment Search Tool (BLAST), TargetScan 6.0 (microRNA. [score:3]
Inhibition of tumor growth in nude mice xenograft mo del by let-7a, miR-16 and miR-29b. [score:3]
Let-7a, miR-16 and miR-29b suppressed the ex vivo treatment tumor growth. [score:3]
Our data regarding the cell cycle analysis showed that let-7a, miR-16 and miR-29b inhibited the proliferation of ES cells via cell cycle retardation at G1/G0 phase. [score:3]
Since the transfection of let-7a, miR-16, and miR-29b resulted in the reduction of CCND2 expression, we next examine the effects of let-7a, miR-16, and miR-29b on the proliferation of ES cells. [score:3]
The expression of CCND2 protein was decreased in SKES1 transfected with let-7a (A), miR-16 (C), miR-29b (E) and CCND2-siRNA (G). [score:3]
A considerable complementarity between sequences within the seed regions of let-7a, miR-16 and miR-29b and sequences in the 3’-UTR of CCND2 was predicted, using the algorithms in BLAST and TargetScan. [score:3]
The results herein indicated that the expressions of let-7a, miR-16 and miR-29b were repressed whereas those of c-Myc and CCND2 were increased in all five ES cell lines compared with hMSCs. [score:2]
We next examined the functions of let-7a, miR-16 and miR-29b in the regulation of their possible target gene, CCND2, and the changes in the biological characteristics in ES cell lines. [score:2]
Consistent with the above data, the results demonstrated that CCND2 was the down-stream effector of let-7a, miR-16 and miR-29b, which were regulated by c-Myc. [score:2]
In the ES cell lines, the expression of let-7a was decreased by -24.15 ~ -46.15, miR-16 by -2.25 ~ -3.52, and miR-29b by -4.88 ~ -10.37 folds compared with hMSCs, respectively (Fig 2). [score:2]
In the SKES1, the expression of let-7a was decreased by -24.15, miR-16 by -2.81 and miR-29b by -5.2 folds compared with hMSCs, respectively. [score:2]
CCND2-siRNA transfected SKES1 cells, as same as let-7a, miR-16 and miR-29b transfected cells, showed significant inhibition of the cell proliferation compared with the negative control siRNA transfected cells (Fig 5D). [score:2]
Therefore, let-7a, miR-16 miR-29b may have affected CCND2 mRNA directly at least in part. [score:2]
SKES1 cells transfected with the miRNAs showed statistically smaller tumors in mice compared to untreated (1949.2 ± 57.9 mm [3]) and negative control miRNA transfected groups (1805 ± 83.9 mm [3]) (Fig 8F), indicating that let-7a (848 ± 85.1 mm [3]), miR-16 (636.8 ± 64.2 mm [3]) and miR-29b (711.8 ± 71.6 mm [3]) inhibited the growth of ES cells ex vivo treatment. [score:2]
On the contrary, the expression of let-7a (2.23 fold), miR-16 (1.35 fold), and miR-29b (1.56 fold) were significantly higher in c-Myc siRNA -transfected cells (20nM) compared with the untreated ES cells, as determined by real-time quantitative RT-PCR (Fig 3C). [score:2]
analysis showed that the expression levels of CCND2 dramatically decreased in all let-7a, miR-16, and miR-29b -transfected cells compared with negative control oligo -transfected cells (Fig 4A, 4C and 4E). [score:2]
We observed an increased let-7a, miR-16, miR-29b expression by 6.23 fold, 5.99 fold, 6.66 fold respectively compared with control-miR (Fig 3C. [score:2]
Briefly, 1x10 [6] SKES1 cells were seeded and incubated for 24 h, then let-7a-2-3p, miR-16-2-3p and miR-29b-1-5p mimic or siRNA for CCND2 was added to the cells followed by incubation for 48 h. The cells were washed with PBS, suspended in annexin V binding buffer, then added to an annexin V-FITC solution and propidium iodide (PI) for 20 min at room temperature. [score:1]
The programmed cell death was not induced by let-7a, miR-16 or miR-29b in ES cells. [score:1]
The region complementary to the let-7a, miR-16 and miR-29b seed region was found in the 3’-UTR of human CCND2. [score:1]
The cleavage of PARP protein, a marker of caspase -mediated apoptosis, was not observed in miRNAs (let-7a, miR-16 and miR-29b) transfectants as well as untreated cells and negative control transfectants, in marked contrast to ADM -treated (positive control) cells (Fig 6H). [score:1]
After actinomycinD treatment, the mRNA expression level of CCND2 after transfection of negative control-miR, let-7a, miR-16, miR-29b and their mutant was measured by qRT-PCR. [score:1]
The transfection of let-7a mimic, let-7a mutant, miR-16 mimic, miR-16 mutant, miR-29b mimic, miR-29b mutant and negative control mRNAs (Control-miR) (Invitrogen) was performed using Lipofectamine 2000 reagent (Invitrogen) in antibiotics-free OptiMEM (Invitrogen). [score:1]
Silencing of CCND2 using let-7a, miR-16 and miR-29b and CCND2-siRNA in SKES1. [score:1]
Densitometry quantification of CCND2 protein levels after transfection of let-7a (B), miR-16 (D), miR-29b (F) and CCND2-siRNA (H). [score:1]
Furthermore, the sequence analysis suggested possible association of let-7a, miR-16 and miR-29b with 3’UTR of CCND2 (S1 Fig). [score:1]
The experimental tumor bearing mice mo del was established by injection of SKES1 cells (1 x 10 [6]) transfected with let-7a-2-3p, miR-16-2-3p and miR-29b-1-5p miRNA suspended in 100 μl of normal saline in the gluteal region of mice. [score:1]
To examine the correlation between let-7a, miR-16 and miR-29b and CCND2 in ES cells, these miRNAs were transfected into SKES1 cells. [score:1]
Five groups were generated: (1) untreated control (n = 5); (2) transfected with negative control-miRNA (n = 5); (3) transfected with let-7a miRNA mimic (n = 5); (4) transfected with miR-16 miRNA mimic (n = 5); (5) transfected with miR-29b miRNA mimic (n = 5). [score:1]
However, the biological roles of let-7a, miR-16 and miR-29b in ES cells have not been clarified yet. [score:1]
The data demonstrated that the restoration of let-7a miR-16 and miR-29b resulted in the cell cycle retardation at G0⁄G1 phase in ES cells. [score:1]
The cells were plated in 6-well plates (5×10 [4] cells per well), and were transfected with or without let-7a-2-3p, miR-16-2-3p and miR-29b-1-5p mimic, negative control miRNA, or CCND2 siRNA and MISSION siRNA Universal Negative Control. [score:1]
Effects of let-7a, miR-16 and miR-29b on the induction of apoptosis in SKES1 cells. [score:1]
0138560.g005 Fig 5. Antiproliferation effect of let-7a (A), miR-16 (B), miR-29b (C) and CCND2-siRNA (D) in ES cells. [score:1]
The introduction of let-7a, miR-16 and miR-29b miRNAs into SKES1 cells resulted in the decreased growth of subcutaneous xenografted tumors in nude mice (Fig 8A–8E). [score:1]
The transfection of let-7a-2-3p mimic (Accession; MIMAT0010195), miR-16-2-3p mimic (Accession; MIMAT0004518) and miR-29b-1-5p (Accession; MIMAT0004514) mimic or negative control (NC) miRNA (Invitrogen) was performed using Lipofectamine 2000 reagent (Invitrogen) in antibiotics-free OptiMEM (Invitrogen) according to the manufacturer's instructions. [score:1]
The five groups included (A) untreated (n = 5), (B) transfected with negative control miRNA (n = 5), and (C) transfected with let-7a (n = 5), (D) transfected with miR-16 (n = 5) and (E) transfected with miR-29b (n = 5). [score:1]
0138560.g008 Fig 8The five groups included (A) untreated (n = 5), (B) transfected with negative control miRNA (n = 5), and (C) transfected with let-7a (n = 5), (D) transfected with miR-16 (n = 5) and (E) transfected with miR-29b (n = 5). [score:1]
Effects of let-7a, miR-16 and miR-29b miRNAs on the cell cycle in SKES1. [score:1]
[1 to 20 of 77 sentences]
13
[+] score: 253
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2, hsa-mir-29c
This showed that upregulated circIBTK promoted the expression of PTEN and inhibited the phosphorylation of AKT, and over expression of miR-29b significantly attenuated the circIBTK -induced increased expression of PTEN and deactivation of the AKT signaling pathway (Fig. 5f and Additional file 2: Figure S1e-S1f). [score:12]
Downregulation of circIBTK resulted in decreased expression of PTEN and thereby increased phosphorylation of AKT and knockdown of miR-29b significantly reversed the PTEN downregulation and activation of the AKT signaling pathway induced by circIBTK inhibition (Fig. 5g and Additional file 2: Figure S1g-S1h). [score:12]
The expression of miR-29b and nuclear circIBTK were normalized to the expression of U6 and the expression of IBTK and cytoplasmic circIBTK were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). [score:9]
Luciferase assay indicated that miR-29b mimics suppressed the expression of reporter gene carrying wt 3’UTR but not containing mut 3’UTR and miR-29b inhibitor promoted the expression of reporter gene carrying wt 3’UTR but not containing mut 3’ UTR (Fig. 5b and c). [score:8]
We also proved that miR-29b could activate the AKT signaling pathway by suppressing PTEN expression by directly targeting PTEN. [score:8]
Furthermore, PTEN expression decreased while phosphorylation of AKT increased in PBMCs transfected with miR-29b mimics and PTEN expression increased while phosphorylation of AKT decreased in PBMCs transfected with miR-29b inhibitor (Fig. 5d, e and Additional file  2: Figure S1a-S1d). [score:7]
The result showed that the expression of miR-29b was upregulated in SLE (Fig.   3a). [score:6]
Then miR-29b expression was upregulated in SLE and correlated with SLEDAI score, anti-dsDNA and complement C3 level in patients with SLE. [score:6]
MiR-29b mimic or miR-29 inhibitor was co -transfected with the luciferase reporters into PBMCs and resulting in miR-29b mimic reducing the luciferase reporter activity, while miR-29b inhibitor promoted the luciferase reporter activity. [score:5]
c, d of the cumulative densitometry data for western blot analysis of PTEN expression and AKT phosphorylation in PBMCs from patients with SLE, transfected with miR-29b inhibitor. [score:5]
Mir-29b expression was upregulated in SLE and correlated with clinicopathological variables in patients with SLE. [score:5]
The results showed that DNA methylation levels were increased when PBMCs were transfected with circIBTK expression plasmids or miR-29b inhibitor and decreased when PBMCs were transfected with circIBTK siRNA or miR-29b mimics (Fig. 4d and e). [score:5]
These data suggested that PTEN might be a target of miR-29b in PBMCs in SLE and miR-29b could activate the AKT signaling pathway by suppressing PTEN. [score:5]
Co-transfection of miR-29b inhibitor and circIBTK siRNA reversed the decrease in DNA methylation induced by si-circIBTK and the increase of DNA methylation induced by miR-29b inhibitor (Fig. 4d and e). [score:5]
The results showed that circIBTK expression was positively correlated with DNA methylation level and miR-29b expression was inversely correlated with DNA methylation level in SLE (Fig. 4b and c). [score:5]
CircIBTK was downregulated in SLE and might regulate DNA demethylation and the AKT signaling pathway via binding to miR-29b in SLE. [score:5]
d, e of PTEN expression and AKT phosphorylation in peripheral blood mononuclear cells (PBMCs) from healthy controls (HC), transfected with miR-29b mimics and PBMCs from patients with systemic lupus erythematosus (SLE), transfected with miR-29b inhibitor. [score:5]
To further explore the mechanism, PBMCs from patients with SLE were transfected with circIBTK expression plasmid or/and miR-29b mimics, and PBMCs from healthy controls were transfected with circIBTK siRNA or/and miR-29b inhibitor. [score:5]
In conclusion, circIBTK and miR-29b were abnormally expressed in PBMCs from patients with SLE and could regulate DNA methylation and activation of the AKT signaling pathway in PBMCs in SLE. [score:4]
Our data also demonstrated that circIBTK could inhibit DNA demethylation and activation of the AKT signaling pathway via the regulation of miR-29b in SLE. [score:4]
To assess the diagnostic value of miR-29b in SLE, we also performed ROC curve analysis with the relative miR-29b expression in the 42 patients with SLE and 35 healthy controls (Fig. 3f). [score:3]
There was strong positive correlation between miR-29b expression and the SLEDAI score in patients with SLE. [score:3]
What is more, co-transfection of miR-29b mimics and circIBTK expression plasmids significantly attenuated the increasing effect on DNA methylation induced by circIBTK and the decreasing effect on DNA methylation induced by miR-29b. [score:3]
e DNA methylation in PBMCs from HC, transfected with miR-29b inhibitor, circIBTK siRNA or NC oligonucleotides. [score:3]
g, h of the cumulative densitometry data for western blot analysis of PTEN/AKT signaling-related proteins in PBMCs from HC transfected with miR-29b inhibitor, circIBTK siRNA or NC oligonucleotides. [score:3]
Accordingly, there also was significant decrease in miR-29b expression when eight patients achieved significant clinical improvement after systematic treatment (Fig. 1g and 3e). [score:3]
We also tested correlation between DNA methylation level and circIBTK or miR-29b expression. [score:3]
org, we found PTEN might be a potential target of miR-29b (Fig.   5a). [score:3]
In patients with SLE compared to healthy controls, miR-29b levels were proved to be upregulated in CD4+ T cells [23]. [score:3]
As DNA demethylation and activation of the AKT signaling pathway are critical for the initiation and development of SLE, and circIBTK and miR-29b could regulate both DNA demethylation and activation of the AKT signaling pathway, this explains why circIBTK and miR-29 correlated with clinicopathological variables in patients with SLE and act as biomarkers of SLE. [score:3]
e, f of the cumulative densitometry data for western blot analysis of PTEN/AKT signaling-related proteins in PBMCs from patients with SLE, transfected with miR-29b mimics, circIBTK expression plasmids, NC oligonucleotides or empty vector. [score:3]
These results indicated that miR-29b could play a significant role in the pathogenesis of SLE, and might be a useful therapeutic target in SLE. [score:3]
Correlation between clinicopathological variables and miR-29b expression was tested to assess whether miR-29b might be a potential biomarker in the clinical estimate of the activity of SLE. [score:3]
We also proved that miR-29b levels were upregulated in PBMCs from patients with SLE compared to healthy controls. [score:3]
c, d Effects of miR-29b on the expression of luciferase reporter genes containing circIBTK wt/mt binding site. [score:3]
f of PTEN/AKT signaling-related proteins in PBMCs from patients with SLE, transfected with miR-29b mimics, circIBTK expression plasmids, NC oligonucleotides, or empty vector. [score:3]
Using software based on TargetScan and mi-Randa, miR-29b was found to have two potential binding sites on circIBTK (Fig. 2b). [score:3]
a, b of the cumulative densitometry data for western blot analysis of PTEN expression and AKT phosphorylation in PBMCs from HC transfected with miR-29b mimics. [score:3]
Con, control In order to explore the function of miR-29b in SLE, we then detected the expression of miR-29b using qRT-PCR in PBMCs obtained from 42 patients with SLE and 35 healthy controls. [score:3]
Our study explained the important role of circIBTK and miR-29 in SLE progression and suggested that circIBTK and miR-29 could act as biomarkers and therapeutic targets for SLE. [score:3]
CircIBTK and miR-29 could also act as biomarkers and therapeutic targets for SLE. [score:3]
b, c Effects of miR-29b on the expression of PTEN 3′ UTR-containing reporter genes. [score:3]
MiR-29b mimics, miR-29b inhibitor and NC oligonucleotides were obtained from GenePharma. [score:3]
Our results showed that miR-29b could induce DNA demethylation in SLE and miR-29b expression was inversely correlated with DNA methylation in SLE. [score:3]
b, c Correlation between global DNA methylation and expression of circIBTK or miR-29b analyzed with Spearman’s analysis. [score:3]
These data demonstrated that circIBTK could inhibit the activation of AKT signaling pathway in SLE by binding to miR-29b. [score:3]
Systemic lupus erythematosus Circular RNAs miR-29b DNA methylation AKT signaling Systemic lupus erythematosus (SLE) is a chronic and incurable autoimmune disease, which involves multiple organs, including skin, kidneys, and central nervous system [1, 2]. [score:3]
Accordingly, we transfected miR-29b inhibitor and circIBTK small interfering RNA (siRNA) into PBMCs from HC. [score:3]
g of PTEN/AKT signaling-related proteins in PBMCs from HC, transfected with miR-29b inhibitor, circIBTK siRNA or NC oligonucleotides. [score:3]
f ROC curve of relative miR-29b expressions for differentiating the 42 patients with SLE from 35 HC. [score:3]
d DNA methylation in PBMCs from patients with SLE, transfected with miR-29b mimics, circIBTK expression plasmids, NC oligonucleotides, or empty vector. [score:3]
MiR-29b expression levels were detected using the Hairpin-itTM Quantitation PCR Kit (GenePharma, Shanghai, China). [score:2]
As miR-29b can induce DNA demethylation according to many studies [23– 25], and DNA demethylation was common in patients with SLE [14, 15], we further explored whether DNA methylation in SLE could be regulated by circIBTK via miR-29b. [score:2]
CircIBTK regulated the AKT signaling pathway by binding to miR-29b. [score:2]
a Expression of miR-29b in peripheral blood mononuclear cells (PBMCs) from 42 patients with SLE and 35 healthy controls (HC) compared using the unpaired Student’s t test. [score:2]
Fig. 5CircIBTK regulated the AKT signaling pathway by binding to miR-29b. [score:2]
e miR-29b expressions in eight patients who achieved significant clinical improvement after systematic treatment; data were compared using the paired Student’s t test. [score:2]
Mir-29b expression was also positively correlated with anti-dsDNA titer and inversely correlated with complement C3 level (Fig. 3b, c and d). [score:2]
These results indicated that miR-29b could induce DNA demethylation and circIBTK could reverse miR-29b -induced DNA demethylation by regulating miR-29b in SLE. [score:2]
CircIBTK could induce DNA methylation via miR-29b in SLE. [score:1]
Then, we constructed reporter gene plasmids with PTEN 3’-UTR-containing wild-type (wt) or mutant (mut) miR-29b binding sites. [score:1]
Then, we performed luciferase reporter assays to determine whether miR-29b could directly bind to circIBTK. [score:1]
For circIBTK and miR-29b luciferase reporter assay, the circIBTK sequences containing wild-type miR-29b predicted binding sites were inserted into the region directly downstream of a cytomegalovirus (CMV) promoter -driven firefly luciferase cassette in a pCDNA3.1 vector. [score:1]
a miR-29b predicted binding sites and corresponding mutant sites in the 3′ UTR of phosphatase and tensin homolog (PTEN) mRNA (wt, wild-type; mut, mutant type). [score:1]
Like circIBTK, miR-29b also had the potential function of helping diagnose and estimate the activity and effectiveness of treatment of SLE. [score:1]
Fig. 4CircIBTK could induce DNA methylation via miR-29b in systemic lupus erythematosus (SLE). [score:1]
We found that miR-29b had no significant effect on luciferase activity (Fig. 2c and d). [score:1]
In this study, we found that circIBTK might function as a miR-29b sponge. [score:1]
b Predicted binding sites and corresponding mutant sites of circIBTK and miR-29b (wt, wild-type; mut, mutant type). [score:1]
For PTEN 3’ UTR and miR-29b luciferase reporter assay, the PTEN 3’ UTR sequences containing two wild-type miR-29b predicted binding sites were inserted into the region directly downstream of a CMV promoter -driven firefly luciferase cassette in a pCDNA3.1 vector. [score:1]
These results demonstrated that miR-29b could act as a biomarker to estimate the activity of SLE and verify the effectiveness of the treatment of SLE. [score:1]
This indicated that miR-29b might act as a potential diagnostic biomarker of SLE. [score:1]
According to some studies, miR-29b could induce DNA demethylation via various ways [23– 25]. [score:1]
CircIBTK served as a miRNA sponge for miR-29b. [score:1]
Correlation analysis was used to analyze the correlation between circIBTK or miR-29b and clinicopathological variables in patients with SLE. [score:1]
These results suggested that circIBTK might serve as a miRNA sponge for miR-29b. [score:1]
Fig. 2CircIBTK served as a miRNA sponge for miR-29b. [score:1]
[1 to 20 of 77 sentences]
14
[+] score: 249
We report here that downregulation of the microRNA miR-29 is likely regulating the induction of extracellular matrix protein expression with quiescence: as miR-29 levels decline with quiescence, levels of miR-29 targets increase, and miR-29 overexpression represses the levels of these targets. [score:13]
The genes encoding miR-29 targets followed a general pattern of increasing expression as fibroblasts are serum-starved, decreasing expression as they are restimulated, and highest expression in cells that were contact -inhibited for 7 or 14 days (Figure 3C). [score:11]
As expected, genes predicted to be miR-29 targets by TargetScan were more likely to be repressed by miR-29 overexpression than genes not predicted to be miR-29 targets (Figure 3B). [score:9]
Gene expression microarrays for quiescence and mir-29 targetsContact -inhibited fibroblast gene expression microarrays and serum starvation and restimulation arrays have been previous described [52, 54]. [score:9]
By analyzing the gene expression patterns of microRNA target genes with quiescence, we discovered a strong regulatory function for miR-29, which is downregulated with quiescence. [score:9]
In addition, although TGF-ß can regulate collagen expression independently of miR-29 [76, 77], the similar phospho-Smad3 levels in proliferating and quiescent fibroblasts implies that changes in TGF-ß activity are unlikely to significantly regulate collagen biosynthesis in quiescence, further emphasizing the importance of miR-29 as a regulator of quiescence -associated changes in ECM expression. [score:8]
miR-29 expression is strongly associated with proliferation (Additional File 1, Figure S4), and its predicted targets are upregulated by both methods of quiescence induction. [score:8]
We identified miR-29 targets in dermal fibroblasts by overexpressing miR-29 in asynchronously proliferating fibroblasts and analyzing the ensuing changes in gene expression by microarray analysis. [score:7]
microRNAs downregulated in quiescent cells included miR-18, miR-20, miR-29, and miR-7, and microRNAs upregulated with quiescence included let-7b, miR-125a, miR-30, miR-181, miR-26, and miR-199. [score:7]
If a competition exists for translational resources between the synthesis of proteins required for cell duplication and the synthesis of proteins targeted for secretory pathways, then miR-29 may be able to direct resources between those two processes depending on the proliferative state of the cell. [score:6]
These results suggest that the downregulation of miR-29 expression levels in quiescent fibroblasts is an important contributor to the induction of extracellular matrix genes with quiescence. [score:6]
Although exogenous TGF-ß can downregulate miR-29, immunoblots for Smad3 phosphorylation levels showed no significant difference in autocrine TGF-ß signaling between proliferating and quiescent fibroblasts (Additional File 1, Figure S5B), indicating that the TGF-ß signaling pathway is unlikely to be responsible for the reduction in miR-29 expression in quiescent fibroblasts. [score:6]
These three miR-29 targets were also strongly repressed at the protein level by transfection of miR-29 as compared to transfection of a negative control, non -targeting microRNA, while protein levels of GAPDH and α-tubulin (two proteins from genes not targeted by miR-29) were unaffected (Figure 3D). [score:6]
Target genes annotated by TargetScan 5.1 [55, 56, 112] were considered well-conserved miR-29 targets if P [CT ]>0.5. [score:6]
RCC2 -1.21 Cell cycle SERPINH1 -1.09 ECM SPARC -1.34 ECM TBC1D7 -1.12 N/AGenes listed were significantly repressed by miR-29 transfection according to a one-sided t-test at 5% FDR, had log [2 ]fold changes of <-1.0, and are evolutionarily conserved miR-29 targets as annotated by TargetScan. [score:5]
Immunoblotting for miR-29 targetsFibroblasts were reverse transfected with miR-29b or a negative control microRNA as above, but cells were plated at either 7,500 cells/cm [2 ](proliferating and mitogen-starved conditions) or 750,000 cells/cm [2 ](contact -inhibited condition). [score:5]
The microarray data generated for this study (the and the miR-29 overexpression microarrays) have been deposited in the NCBI Gene Expression Omnibus (GEO) [114] as one SuperSeries under the accession number GSE42614. [score:5]
miR-29 regulates collagen and collagen-chaperone genesGene ontology analysis of predicted, evolutionarily conserved miR-29 targets revealed an enrichment for multiple categories including collagen fibril organization and extracellular matrix formation (Additional File 1, Table S3), indicating that miR-29 most likely regulates extracellular matrix (ECM) biosynthesis in fibroblasts, consistent with previous reports on miR-29 in fibroblasts and other cell types [67- 72]. [score:5]
Gene expression microarrays for quiescence and mir-29 targets. [score:5]
Using microarrays and immunoblotting, we confirmed that miR-29 targets genes encoding collagen and other extracellular matrix proteins and that those target genes are induced in quiescence. [score:5]
We suggest an alternative possibility: relieved of the commitment to translate and fold extracellular matrix proteins like collagen, miR-29 -overexpressing cells may be able to commit more rapidly to the cell cycle. [score:5]
miR-29 targeting of DNA methyltransferases 3A and 3B, for example, can inhibit lung cancer cell tumorigenicity [104]. [score:5]
miR-29 can also induce apoptosis in cholangiocarcioma cells via the miR-29 target MCL-1 [105], and induce replicative senescence in HeLa cells by targeting B-MYB [106]. [score:5]
This may reflect the activity of a miR-29 target gene; indeed, one target, RCC2 (TD-60), is repressed about 57% upon miR-29 transfection (Figure 3A and Table 1), and it plays an essential role in progression through metaphase [79]. [score:5]
Gene ontology analysis of predicted, evolutionarily conserved miR-29 targets revealed an enrichment for multiple categories including collagen fibril organization and extracellular matrix formation (Additional File 1, Table S3), indicating that miR-29 most likely regulates extracellular matrix (ECM) biosynthesis in fibroblasts, consistent with previous reports on miR-29 in fibroblasts and other cell types [67- 72]. [score:4]
Because our data indicate that the activity of the TGF-ß signaling pathway is similar in proliferating and quiescent fibroblasts, it is not likely that TGF-ß is regulating the changes in miR-29 expression between these states. [score:4]
Fibroblasts were reverse transfected with miR-29b or a negative control microRNA as above, but cells were plated at either 7,500 cells/cm [2 ](proliferating and mitogen-starved conditions) or 750,000 cells/cm [2 ](contact -inhibited condition). [score:3]
Besides miR-29, however, there were few microRNAs with strongly anti-correlated target genes. [score:3]
Although miR-29 has been reported to be an oncogene (transgenic mice overexpressing miR-29 in their B cells develop B-cell chronic lymphocytic leukemia [107]) our microarray data revealed no clear candidate cell cycle genes that would explain the early re-entry phenotype we observed in our mo del system. [score:3]
For miR-29 overexpression microarrays, fibroblasts were transfected as described below with Pre-miR miR-29b or Negative Control #2 oligonucleotide duplexes (Life Technologies). [score:3]
To further explore the effects of miR-29 expression on the cell cycle, we transfected miR-29 or a negative control microRNA into asynchronously cycling fibroblasts. [score:3]
Autocrine TGF-ß is unlikely to mediate miR-29 expression changes in quiescence. [score:3]
We investigated three proteins encoded by miR-29 targets (collagen I, collagen III, and collagen VI) by immunoblot analysis of protein lysates isolated from proliferating cells and cells made quiescent by mitogen (PDGF) withdrawal or contact inhibition. [score:3]
Immunoblots to GAPDH and α-Tubulin are shown as examples of genes not targeted by miR-29 and as loading controls. [score:3]
The findings place miR-29 among the very few molecules discovered, along with FoxO [98- 100], and FoxP [101, 102] transcription factors, and the regulators of miR-29 itself, to regulate the induction (as opposed to the repression) of genes in quiescent cells. [score:3]
From this perspective, it is particularly interesting that miR-29 overexpression results in more rapid cell cycle entry. [score:3]
Immunoblotting for miR-29 targets. [score:3]
Reporter assays by multiple independent groups have found in several different cell types that miR-29 directly targets collagens COL1A1, COL3A1, and COL4A2 in a seed sequence -dependent manner [95- 97]. [score:3]
Autocrine TGF-ß is unlikely to mediate miR-29 expression changes in quiescenceTGF-ß signaling leads to an increase in collagen synthesis [73] and can repress miR-29 [69, 74, 75]. [score:3]
These genes were therefore highly anti-correlated with the pattern of expression for miR-29 itself (Additional File 1, Figure S4). [score:3]
The miR-29 family's targets had the most statistically extreme mean proliferation index, with a P value <10 [-4 ](the lowest P value possible based on the 10 [4 ]bootstrap resamplings taken). [score:3]
In addition, overexpression of miR-29 resulted in more rapid cell cycle re-entry from quiescence. [score:3]
miR-29 overexpression thus hastens re-entry into the cell cycle from a quiescent state. [score:3]
miR-29 regulates collagen and collagen-chaperone genes. [score:2]
We suggest that the role of miR-29 in hastening cell cycle re-entry, however, may reflect its effects not on validated cell cycle regulators, but instead on extracellular matrix proteins. [score:2]
When compared to cells transfected with a control non -targeting microRNA, cells transfected with miR-29 contained fewer cells in G [0]/G [1 ]and more cells in S phase at 20 and 24 h post transfection (Figure 4A, P = 1. [score:2]
Based on those studies and our microarray and immunoblot results, miR-29 likely also represses collagens directly in proliferating fibroblasts. [score:2]
Other possible candidates for miR-29 transcriptional regulation include NF-κB and sonic hedgehog [70, 103]. [score:2]
We sought to confirm whether miR-29 regulates not just transcript abundance, but also protein levels of extracellular matrix components in quiescent cells. [score:2]
We identified genes that both changed significantly in the microarray analysis and contained predicted miR-29 binding sites. [score:1]
At 28 and 32 h after transfection, cells transfected with miR-29 contained fewer cells in S phase and more cells in G [2]/M phase than those transfected with the control (P = 0. [score:1]
We also tested whether miR-29 has a role in the cell cycle transition between proliferation and quiescence by simultaneously restimulating serum-starved fibroblasts to proliferate with full serum medium and transfecting them with miR-29. [score:1]
Repression of RCC2 could explain the G [2]/M arrest phenotype seen with miR-29 transfection. [score:1]
TGF-ß signaling leads to an increase in collagen synthesis [73] and can repress miR-29 [69, 74, 75]. [score:1]
miR-29 hastens cell cycle re-entry from quiescence. [score:1]
miR-29's role in quiescence. [score:1]
We confirmed that exogenous addition of TGF-ß repressed miR-29 expression, as measured by qRT-PCR (Additional File 1, Figure S5A), in our dermal fibroblast mo del. [score:1]
miR-29 hastens cell cycle re-entry from quiescenceWe also tested whether miR-29 has a role in the cell cycle transition between proliferation and quiescence by simultaneously restimulating serum-starved fibroblasts to proliferate with full serum medium and transfecting them with miR-29. [score:1]
Figure 3 miR-29 repression of extracellular matrix protein production with quiescence. [score:1]
Thus, miR-29 transfection in proliferating cells led to G [2]/M arrest rather than increased mitosis. [score:1]
We monitored the functional roles of let-7 and miR-125 on cell cycle re-entry from quiescence using the same method we used for miR-29 as described above. [score:1]
Figure 4Cell cycle and cell size effects of microRNAs let-7, miR-125, and miR-29. [score:1]
As expected considering that cells in the G2/M phase tend to be larger than cells in other phases of the cell cycle, miR-29 transfection also led to larger cells (Figure 4D). [score:1]
Further experimentation revealed that miR-29 transfection resulted in fewer cells than the negative control transfection (Figure 4C, P = 0. [score:1]
miR-29's role in quiescenceOne of the functional changes that we previously observed in quiescent fibroblasts is an overall induction of extracellular matrix proteins [52]. [score:1]
Forty-eight hours post transfection, miR-29 transfection led to more cells in G [2]/M (Figure 4B). [score:1]
[1 to 20 of 66 sentences]
15
[+] score: 240
Mechanistically, miR-29 binds to seed regions in the 3′-untranslated region of HIV-1 mRNA and targets it to cellular P bodies resulting in viral mRNA degradation and suppression of translation 18. [score:9]
The mechanism of miR-29 downregulation in activated and memory CD4 T cells might involve nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) as stimulation with anti-TCR/CD28 antibodies (which downregulated miR-29) activates NF-κB, a repressor of miR-29 gene expression in myoblasts 47. [score:9]
Together, these results from human subjects are consistent with a protective role for miR-29 in HIV-1 control and suggest that downregulated miR-29 expression could represent a signature of progressive HIV-1 disease. [score:8]
Interestingly, we found that CD4 T cells from HIV-1-infected HLACs showed a marked downregulation of all miR-29 species (Fig. 4a), suggesting that virus -induced mechanisms downregulated miR-29 transcription. [score:7]
Importantly, the ability of IL-21 to overcome HIV-1 -induced miR-29 downregulation was consistent with its ability to also suppress HIV-1 infection when added to HLACs after CD4 T cells have been infected with HIV-1 (Fig. 1e). [score:6]
While splenic CD4 T cells activated with plate-bound anti-CD3 and anti-CD28 antibodies downregulated miR-29, IL-21 treatment still promoted miR-29 expression in these cells (Supplementary Fig. 6a). [score:6]
Using miRNA species-specific quantitative PCR, we detected markedly upregulated expression of all mature miR-29 species in CD4 T cells in IL-21 -treated splenic CD4 T cells from HIV-1 -negative donors (Fig. 2a). [score:6]
Abrogation of IL-21 -mediated miR-29 induction on STAT3 blockade coupled with enriched STAT3 binding to putative regulatory sites within MIR29 genes support STAT3 as a positive regulator of miR-29 expression in CD4 T cells during HIV-1 infection. [score:5]
Intracellular delivery of miR-29 antagomir LNA and inhibition of miR-29 activity in CD4 T cells was confirmed by the enhanced expression of TBX21 and IFNG, two miR-29-repressed genes 31 (Supplementary Fig. 8). [score:5]
Evidence that not all ECs express protective human leucocyte antigen (HLA) class I alleles 32 and that expression of classical HIV-1 restriction factors are indistinguishable between Progs and ECs 46 suggests that an IL-21–miR-29 axis might represent a non-classical HIV-1 restriction mechanism in these individuals. [score:5]
Pharmacological inhibition of STAT3 with the inhibitor WP1066 but not other downstream IL-21R signalling pathways abrogated IL-21 -mediated induction of miR-29, implicating STAT3 in MIR29 gene induction (Fig. 2c and Supplementary Fig. 7b). [score:5]
Similar to CD4 T cells from HIV-1-infected HLACs (Fig. 4a), we detected marked downregulation of miR-29b expression in CD4 T cells from untreated HIV-infected Progs compared with uninfected and ECs subjects (Fig. 5a). [score:5]
Conversely, using the human CD4 T-cell line CEM-GXR25 that expresses GFP driven by HIV-1 LTR in a Tat -dependent manner 25, we confirmed that constitutive inhibition of endogenous miR-29 by lentivirus-encoded antisense ‘miR-29-ZIP' enhanced infection with CXCR4-tropic HIV-1 [NL4-3] (Supplementary Fig. 5b). [score:5]
IL-21 did not modulate expression of miR-142-5p, which is expressed in haematopoietic cells 26 (Fig. 2a), indicating that it acted selectively on the miR-29 locus and not on miRNAs generally. [score:5]
Consistent with its reported ability to inhibit HIV-1 production and infectivity in HEK293T and HeLa cell lines 17 18, we found that overexpression of miR-29b in human Jurkat T-cell lines using lentiviral vectors significantly inhibited infection of HIV-1 [NL4-3]-luciferase as measured by enzymatic luciferase activity 24 (Supplementary Fig. 5a). [score:5]
MicroRNA-29 also downregulates HIV nef transcripts and nef protein expression which, as nef is essential for optimal HIV-1 production, compromises overall HIV-1 production 17. [score:5]
We quantified miR-29 expression in peripheral blood CD4 T cells from uninfected, treatment naïve HIV-infected progressors (Prog) and EC who suppress HIV in the absence of antiretroviral drugs 32. [score:5]
Indeed, as we report here, severely reduced miR-29 expression is a hallmark of progressive HIV-1 disease 43 45. [score:5]
Consequently, we wondered whether IL-21 regulated expression of the HIV-1-restrictive miR-29 family 17 18, a cluster of highly conserved and co-regulated miRNA that includes miR-29b1/29a and miR-29b2/29c on human chromosome 7 and 1, respectively 23. [score:5]
Relationship between miR-29 expression and HIV-1 disease in humans. [score:5]
These results indicate that IL-21 is able to overcome miR-29 downregulation during HIV-1 infection and that HIV-1 infection did not impair IL-21R signalling in CD4 T cells. [score:4]
IL-21 reverses HIV-1 -induced miR-29 downregulation. [score:4]
Because IL-21 impaired HIV-1 infection when administered before or after viral exposure, we asked whether it can reverse HIV-1 -associated downregulation of miR-29. [score:4]
Taken together, these results implicate an IL-21–miR-29 axis in direct HIV-1 suppression in CD4 T cells and suggest that pretreatment with IL-21 can limit the magnitude of the initial HIV-1 infection in vivo. [score:4]
These results demonstrate that endogenous miR-29 critically regulates the extent of HIV-1 infection of CD4 T cells and suggest that miR-29 likely inhibits early HIV-1 replication steps. [score:4]
On binding to its heterodimeric receptor composed of IL-21Rα and γ [c]-chain, IL-21 activates STAT3, PI3-kinase as well as the MAPK/Erk pathways 3. Thus, to elucidate how IL-21 regulated miR-29 expression, we blocked individual signalling pathways downstream of IL-21R in IL-21 -treated splenic CD4 T cells. [score:4]
The molecular details of miR-29 gene regulation are not well defined but appear to be disease and cell-type specific and likely involves proximal and long-range distal acting cis elements 23. [score:4]
Indeed, we confirmed that splenic CD4 T cells from an HIV-1-infected subject significantly upregulated miR-29 in response to IL-21 treatment (Fig. 4b). [score:4]
These results identify IL-21 as a regulator of miR-29 biogenesis and suggest that IL-21 -mediated inhibition of primary HIV-1 infection was effected through miR-29. [score:4]
By contrast, TCR/CD28 activation of CD4 T cells, which promotes HIV infection 1, downregulated miR-29 (Supplementary Fig. 6a). [score:4]
To address this question, we compared miR-29 expression in purified CD4 T cells isolated from untreated or IL-21 -treated HLACs that were equally infected with HIV-1. As shown in Fig. 4a, treatment with IL-21 completely restored expression of all miR-29 species. [score:4]
To elucidate how IL-21 promoted miR-29 expression, we assessed whether it regulated early steps in miR-29 biogenesis. [score:4]
HLACs were particularly invaluable to our study because mitogen-activated CD4 T cells not only downregulated miR-29 but typically also produce cytokines including IL-2 and IL-15, which promote lentivirus entry 50, potentially obscuring the antiviral effect of IL-21. [score:4]
The oligonucleotides utilized to target miR-29b were: 29bZIP-F: 5′-CCGGTAGCACCTTTAGAAATCATTG-CTCTCGAGAACACTGATTTCAAATGGTGCTATTTTTG-3′; 29bZIP-R: 5′-AATTCAAAA-ATAGCACCATTTGAAATCAGTGTTCTCGAGA-GCAATGATTTCTAAAGGTGCTA-3′. [score:3]
Quantification of pri-miR-29 transcripts revealed that IL-21 promoted the first step in the miR-29 biogenesis pathway as stimulation with IL-21 increased expression of pri-miR-29 transcripts peaking at about 4 h (Fig. 2b and Supplementary Fig. 7a). [score:3]
Even though memory CD4 T cells contained lower levels of miR-29 compared with naïve T cells, they significantly upregulated miR-29 in response to IL-21 (Supplementary Fig. 6b). [score:3]
Interestingly, we found that humanized mice treated with exogenous IL-21 were largely protected from early HIV-1 infection and reduced viral load in these animals correlated with higher miR-29 expression in splenic CD4 T cells. [score:3]
Notably, among untreated HIV-infected Progs, miR-29b expression inversely correlated (Spearman correlation coefficient (r)=−0.5080; P=0.0314) with plasma HIV titres (Fig. 5b). [score:3]
Not only did IL21 mRNA levels correlate with miR-29 in splenic CD4 T cells (Fig. 7e), we observed a significant inverse correlation between miR-29 expression and plasma HIV-1 titres (Fig. 7f). [score:3]
In further support of its STAT3 dependency, the STAT3-activating cytokines IL-6 and IL-10 also promoted miR-29 expression. [score:3]
Consistent with their ability to activate STAT3, IL-6 and IL-10 also induced miR-29 and suppressed HIV-1 infection in HLACs (Supplementary Fig. 9b). [score:3]
To understand the contribution of miR-29 to IL-21 -mediated suppression in early HIV-1 protection in BLT humanized mice, we evaluated the expression of miR-29 and IL-21 in splenic CD4 T cells from IL-21 -treated and HIV-1-infected animals. [score:3]
We similarly assessed miR-29 expression in total, naïve and memory CD4 T cells, which include highly HIV-1-permissive CD4 T cells 27 28. [score:3]
d. of duplicate wells) of mature miR-29a, miR-29b, miR-29c and miR-142-5p in purified total human splenic CD4 T cells from untreated (medium) or IL-21 -treated HLACs after 12 h. (b) Kinetics of expression (average±s. [score:3]
To determine whether IL-21 -mediated suppression of HIV-1 infection required miR-29, purified splenic CD4 T cells were nucleofected with synthetic miR-29 ‘antagomir' locked nucleic acids (LNA). [score:3]
In this study, we report a novel antiviral activity of IL-21 that is mediated by miR-29 and results in suppressed HIV-1 infection in primary lymphoid CD4 T cells. [score:3]
Collectively, these findings demonstrate a novel and rapid miR-29 -mediated antiviral activity of IL-21 that acts through STAT3 in target CD4 T cells to limit initial HIV-1 infection. [score:3]
IL-21 -mediated HIV-1 suppression requires miR-29. [score:3]
Of note, in contrast to interferon-α (IFNα) that suppressed HIV-1 replication through classical cell-intrinsic restriction factors 22, the antiviral activity of IL-21 coincided with its ability to induce miR-29 compared with other Th1 and Th17 effector cytokines (Supplementary Fig. 9a). [score:2]
Our study is the first to describe an IL-21/STAT3 axis as a regulator of miR-29 transcription. [score:2]
Mir-29 is required for IL-21 -mediated viral suppression. [score:2]
Compared with control-LNA antagomirs, mir-29-LNA antagomirs significantly abrogated the ability of IL-21 to inhibit HIV-1 infection in CD4 T cells (Fig. 3a), indicating that the antiviral activity of IL-21 was at least in part mediated by miR-29. [score:2]
MicroRNA-29 is associated with control of HIV-1 disease. [score:2]
Quantitative PCR analysis with primers across an ∼15 kb upstream of MIR29 showed significantly enriched STAT3 binding to two putative regulatory regions upstream of MIR29B1/29A after IL-21 treatment (Fig. 2d). [score:1]
Together, these results strongly suggest that the IL-21-activated STAT3 transcription factor contributes to the induction of miR-29 genes in CD4 T cells. [score:1]
Given the ability of IL-21 to promote HIV-1 resistance in CD4 T cells through miR-29, it is likely that depletion of IL-21-producing T cells compromises this line of defense against HIV-1, which would suggest that higher pre-infection levels of IL-21-producing cells would indicate better HIV-1 prognosis. [score:1]
Our preceding results strongly supported a significant contribution of an IL-21–miR-29 axis in HIV-1 control prompting us to next determine the relationship between miR-29 and HIV-1 infection in human subjects. [score:1]
To determine specifically whether STAT3 regulates miR-29 transcription, we performed chromatin immunoprecipitation (ChIP) assay with anti-STAT3 antibody on untreated or IL-21 -treated primary human splenic CD4 T cells (Figs 2d,e). [score:1]
Notably, the STAT3 -binding regions we identified overlapped with highly conserved sequences and predicted DNase I hypersensitivity sites in MIR29 genes 47. [score:1]
Pri-miR-29 induction preceded the accumulation of mature miR-29 species, which peaked at about 12 h (Fig. 2b). [score:1]
IL-21 promotes antiviral miR-29 biogenesis. [score:1]
In uncovering an antiviral IL-21–miR-29 axis that impairs early HIV-1 infection, our present study suggests that endogenous IL-21 and strategies that exogenously augment IL-21 or induce pre-existing cellular sources of IL-21 would be beneficial in not only promoting adaptive antiviral immunity but also contribute to limiting the magnitude of the initial HIV-1 infection. [score:1]
Because IL-21 was administered 2 weeks after SIV infection at peak viremia in that study 51, it is possible that already established lentiviral infections escape protective mechanisms induced by IL-21 (including miR-29) rendering this cytokine ineffective at curbing virus dissemination. [score:1]
d. of duplicate wells) of pri-miR-29 (normalized to ACTB) and mature miR-29 (normalized to U6) species in purified CD4 T cells isolated from IL-21 -treated splenocytes. [score:1]
For microRNA depletion, total splenic CD4 T cells were purified using the untouched human CD4 T cell isolation kit (Miltenyi Biotec, #130-096-533) and then nucleofected using the unstimulated human T-cell protocol (VPA-1002; programme U-014; Nucleofector II) with 30 pmol of pooled antagomir LNA against miR-29 (Exiqon #4101448-101, #4100754-101) or control antagomir (Exiqon #199006-101), rested for 4–6 h and re-combined with the CD4 -depleted (Miltenyi Biotec, #130-045-101) splenic HLAC fraction. [score:1]
These results are significant as they demonstrate induction of miR-29 by IL-21 in HIV-1 permissive CD4 T cells that account for productive HIV-1 infection. [score:1]
How to cite this article: Stanley, A. et al. IL-21 induces antiviral microRNA-29 in CD4 T cells to limit HIV-1 infection. [score:1]
Induction of miR-29 by IL-21 is STAT3 dependent. [score:1]
Similarly, fewer HIV-1 late reverse transcripts (RT) and integrated HIV-1 DNA were detected in IL-21 -treated samples (Figs 3c,d), suggesting that the IL-21–miR-29 axis interfered with early HIV-1 replication steps. [score:1]
IL-21 induces antiviral miR-29 through STAT3. [score:1]
[1 to 20 of 70 sentences]
16
[+] score: 235
Since, we did not find upregulation of miR-29b expression in human thyroid samples in which PATZ1 was downregulated (data not shown) it is possible that, similarly to what occurs for other tumour suppressor genes silenced by oncogenic RAS 50 51, the Ras-directed downregulation of PATZ1 proceeds in two steps: PATZ1 may be first downregulated by miR-29b in a Ras -driven reversible step. [score:18]
Also in these cell clones miR-29b was upregulated and PATZ1 downregulated, showing that miR-29b overexpression and PATZ1 downregulation are persistent events in chronic thyroid cell transformation induced by Ras oncogene. [score:12]
In breast cancer, miR-29b expression is negatively associated with the HER2 sub-type, and its overexpression inhibits breast cancer cell proliferation and induces apoptosis mainly downregulating STAT3 protein levels 43. [score:10]
miR-29b and PATZ1 expression levels are inversely correlated in thyroid cells expressing the Ha-Ras [V12] oncogeneInterestingly, miR-29b is one of the most upregulated miRNAs in FRTL5 following expression of a Ras oncogene in an inducible cell system, in which a chimeric form of Ha-Ras oncoprotein, ER-Ras, can be activated by tamoxifen 26, as assessed by screening the www. [score:10]
In agreement with the ability of miR-29b to target PATZ1, we found that PATZ1 and miR-29b expressions were inversely correlated at both RNA and protein level in a thyroid cell system in which the expression of the oncogenic Ha-Ras [V12] was induced by a tamoxifen-inducible construct, as well as in FRTL5 cells in which Ha-Ras [V12] was stably expressed. [score:9]
From these data we can assume that miR-29b has oncogenic activity by downregulating the tumour suppressor activity of PATZ1, in agreement with the ability of miR-29b to enhance cell migration and invasion in nasopharyngeal carcinoma progression by regulating SPARC and COL3A1 expression 39. [score:9]
Moreover, it has also been reported that miR-29b expression is upregulated in rat thyroid cells following cell growth induced by thyreotropin and its overexpression promotes thyroid cell proliferation. [score:8]
As shown in Fig. 1d, overexpression of miR-29b significantly reduced luciferase activity of the reporter vector, compared to scramble transfected controls, suggesting that the inhibition of PATZ1 protein expression by miR-29b acts, either in a direct or an indirect manner, on the 3′-UTR of PATZ1. [score:8]
All these signals were drastically reduced (80% reduction) in thyroid cells overexpressing miR-29b, suggesting that all expressed PATZ1 variants may be targets of this miRNA. [score:7]
Consistently, increased miR-29b expression was found in experimental murine PTU -induced and human goiters, thus indicating its upregulation as a critical event in the regulation of thyroid cell proliferation 33. [score:7]
Equally, miR-29b expression inhibits glioblastoma cell proliferation, migration, invasion, angiogenesis and stemness maintenance, while promoting apoptosis, by targeting DNMT3A-3B and BCL2L2 44 45. [score:7]
In Fig. 1a, we show the miR/PATZ1 alignment: the mirSVR downregulation score is −0.1870, predicting PATZ1 as a very likely candidate target of miR-29b. [score:6]
Among them, we concentrated on miR-29b since it was one of the most upregulated miRNAs in FRTL5 rat thyroid cells following expression of the Ha-Ras [V12] oncogene 28. [score:6]
Interestingly, miR-29b is one of the most upregulated miRNAs in FRTL5 following expression of a Ras oncogene in an inducible cell system, in which a chimeric form of Ha-Ras oncoprotein, ER-Ras, can be activated by tamoxifen 26, as assessed by screening the www. [score:6]
To explore a possible interaction between miR-29b and PATZ1 downstream of oncogenic Ras, we analysed the expression of PATZ1 and miR-29b in the same tamoxifen-inducible FRTL5 cell system, in which the expression of the Ha-Ras [V12] oncogene was induced at different time points. [score:5]
Next, to further assess the inhibition of PATZ1 protein by miR-29b, we used a PGL-3-CTRL vector containing the 3′-UTR sequence common to the hPATZ1-001 and 004 transcripts, which includes a predicted miR-29b target site, cloned downstream the firefly luciferase gene. [score:5]
The expression of miR-29b and PATZ1 was also analysed in two previously established independent clones of FRTL5 cells stably expressing high levels of the human Ha-Ras [V12] oncogene 26. [score:5]
Indeed, mir-29b inhibits the progression of esophageal squamous cell carcinoma by targeting MMP-2 42. [score:5]
miR-29b and PATZ1 expression levels are inversely correlated in thyroid cells expressing the Ha-Ras [V12] oncogene. [score:5]
Still, miR-29b is expressed at higher levels in indolent human B-cell CLL (chronic lymphocytic leukaemia) with respect to normal CD19 + B cells and, consistently, transgenic mice overexpressing miR-29b in B cells developed B-CLL 41. [score:5]
Conversely, PATZ1 was down-regulated after treatment with tamoxifen at both mRNA (Fig. 2c) and protein levels (Fig. 2d), confirming the functional miR-29b/PATZ1 interaction in thyroid cells. [score:4]
Indeed, PATZ1 protein levels were downregulated following thyroid cell transfection with miR-29b synthetic precursor (Fig. 2a). [score:4]
Interestingly, differently from HEK293 and PC Cl3 cells, transfection of miR-29b precursor into FRTL5 cells, another rat thyroid cell line, resulted in downregulation of PATZ1 at mRNA level (Fig. 2b). [score:4]
As shown in Fig. 2, consistent with the data extracted from the above website, miR-29b was upregulated following induction of Ha-Ras [V12] as early as after 24 h of treatment with tamoxifen (Fig. 2c). [score:4]
Here, we focused on miR-29b since it has been previously found up-regulated in thyroid cell proliferation 33 and transformation 28. [score:4]
To rule out the possibility that such effects could be due to tamoxifen treatment, we treated both ER-Ras FRTL5 and parental FRTL5 cells with tamoxifen, showing that miR-29b is induced and PATZ1 downregulated only in the presence of oncogenic Ras activity (Fig. 2d). [score:4]
Conversely, PATZ1 transcript levels were significantly downregulated only in FRTL5 cells, suggesting that miR-29b ability to reduce PATZ1 mRNA stability is cell context -dependent. [score:4]
As these cells are transformed by the native human Ha-Ras oncogene, it is ruled out the possibility that induction of miR-29b, as well as downregulation of PATZ1 could be an artefact of the chimeric Ras oncoprotein. [score:4]
Both these variants were downregulated after transfection of the miR-29b (see Supplementary Fig. S3). [score:4]
miR-29b targeting of PATZ1 in rat thyroid cells. [score:3]
However, it is worth to note that miR-29b acts as a tumour suppressor in other cancer tissues. [score:3]
Similar tumour suppressor activity for miR-29b in colon 46, lung 47 and ovarian 48 cancer tissues was reported. [score:3]
Here, we show that enforced miR-29b expression in thyroid and non-thyroid cells significantly reduces PATZ1 protein levels. [score:3]
miR-29b and PATZ1 expression levels were normalized for endogenous U6 and G6PD levels, respectively. [score:3]
All together these results confirm that miR-29b targets PATZ1 in thyroid cells and suggest that PATZ1 is a downstream effector of the oncogenic Ras signalling. [score:3]
Taking together the qRT-PCR results from both the inducible and stable clones we found a strong negative correlation (r = −0.797), meaning a functional dependence between miR-29b and PATZ1 expression. [score:3]
These data are consistent with data extracted from the DIANA-TarBase v7.0 database 34, where PATZ1 is indicated as an experimental validated target of has-miR-29b-3p as assessed by immunoprecipitation in BCBL-1 lymphoma cells 35. [score:3]
Notably, it was the miR-29 isoform more expressed in this Ras -driven rat thyroid cell transformation system. [score:3]
Moreover, miR-29b enhances migration of human breast cancer cells and is overexpressed in breast metastases in comparison with the breast cancer tissue 40. [score:3]
PATZ1 is a target of miR-29b. [score:3]
The ability of miR-29b to target PATZ1 was also confirmed in a thyroid cell system using the rat thyroid cell line PC Cl3. [score:3]
Validation of PATZ1 as a target of miR-29b. [score:3]
It is likely that the cellular context determines the oncogenic or the antioncogenic activity of miR-29b, as previously reported for other miRNAs 49. [score:1]
Interestingly, the mRNA levels of PATZ1 in Ha-Ras [V12] stable clones show a perfect negative correlation (r = −1) with the levels of miR-29b (Fig. 2c). [score:1]
This reporter vector was transfected in HEK293 cells along with synthetic precursor of miR-29b, or scramble miRNA control, and luciferase activity was assessed 72 h after the transfection. [score:1]
PATZ1 protein levels were reduced up to the 60% in cells transfected with miR-29b in comparison with the cells transfected with the scrambled oligonucleotide. [score:1]
The mean ± SE of one experiment performed in triplicate and three independent experiment performed in duplicate is reported for miR-29b and PATZ1, respectively. [score:1]
However, Independently from the role of miR-29b, the results reported here suggest that PATZ1 may be a negative effector of the oncogenic Ras signalling in thyroid carcinogenesis. [score:1]
HEK293 transfections were performed by Lipofectamine 2000 (Invitrogen) according to manufacturer’s instruction, with 100 nM Scramble or 100 nM miR-29b miRNA precursors (Ambion, Austin, TX) together with PGL-3-CTRL vector or the PATZ1-3′UTR luciferase reporter plasmid. [score:1]
[1 to 20 of 49 sentences]
17
[+] score: 230
Importantly, inhibition of endogenous miR-29b, and to a lesser extent miR-200c, in two different cell lines representing the basal subtype of breast cancer, SUM102PT and SUM149PT, led to increased expression of ADAM12-L. These findings support a role for the endogenous miR-29b and/or miR-200c in the regulation of ADAM12-L gene expression at the post-transcriptional level via targeting of the unique 3′UTRs of ADAM12-L. Since the translation product of ADAM12-L differs from the protein product of ADAM12-S in its biochemical properties, cellular localization, and most likely substrate specificity and function, better understanding of the mechanisms controlling expression of each splice variant is an important step in the research on ADAM12 in breast cancer. [score:14]
Down-regulation of ADAM12-L by miR-29b/c and miR-200b/c occurred at the post-transcriptional level and was mediated through direct targeting of the ADAM12-L 3′UTR, resulting in either target mRNA degradation or decreased translation, depending upon the cell line studied. [score:11]
In humans, ADAM12-L was identified as one of the direct targets of miR-29b in trabecular meshwork cells, and increased expression of ADAM12-L in response to oxidative stress -induced down-regulation of miR-29b may contribute to the elevation of intra-ocular pressure in glaucoma [47]. [score:9]
To further test this hypothesis, we asked whether inhibition of the endogenous miR-29b or miR-200c in SUM102PT and SUM149PT, two basal cell lines with low to moderate expression of miR-29b and miR-200c (see Figure  1D), is sufficient to increase the level of ADAM12-L. We transfected these cells with miRNA hairpin inhibitors to miR-29b and miR-200c (or with control hairpin inhibitor) and assessed the level of ADAM12-L mRNA by qRT-PCR. [score:9]
Thus, low expression levels of miR-200 family members, together with low expression of miR-29, may create permissive conditions for high expression of ADAM12-L in claudin-low tumors and cell lines. [score:7]
Furthermore, the miR-29 family members directly target Krüppel-like factor 4 (KLF4), a transcription factor required for the maintenance of breast cancer stem cells, and down-regulation of miR-29 family members results in increased stem-like properties in vitro and in vivo [35]. [score:7]
Mutation of the single miR-29 target site in the ADAM12-L 3′UTR blunted the effect of miR-29b/c on the reporter activity, confirming direct targeting of the ADAM12-L 3′UTR region by miR-29b/c. [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
We have selected to study two representative miRNAs from each family: miR-29b (a potent inhibitor of breast tumor metastasis [34]) and miR-29c (associated with a significantly reduced risk of dying from breast cancer [41]), miR-30b and miR-30d (both significantly down-regulated in ER -negative and progesterone receptor (PR) -negative breast tumors [42]), and miR-200b and miR-200c (both representing key negative regulators of EMT and anoikis resistance [30- 32]). [score:7]
In contrast, miR-29b/c consistently produced strong down-regulation of ADAM12-L expression at the mRNA and protein levels in both SUM159PT and BT549 cell lines, and they decreased the ADAM12-L 3′UTR reporter activity in SUM159PT cells. [score:6]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
To determine whether miR-29b/c, miR-30b/d, or miR-200b/c might regulate ADAM12-L expression in breast cancer patients in vivo, we examined the relationship between these miRNAs and ADAM12-L mRNA in a cohort of 100 breast cancer patients for which mRNA/miRNA expression data were publicly available (GEO: GSE19536) [44]. [score:6]
To assess the clinical relevance of our results on the regulation of ADAM12-L expression in breast cancer cell lines, we analyzed publicly available expression data for a cohort of 100 breast cancer patients and found negative correlations between ADAM12-L mRNA and miR-29b, miR-200b, and miR-200c. [score:6]
Down-regulation of miR-29 members also results in increased expression of the transcription factor KLF4 and expansion of stem-like cell populations in vitro and in vivo [35]. [score:6]
Inhibition of endogenous miR-29b and miR-200c in SUM149PT and SUM102PT cells led to increased ADAM12-L expression. [score:5]
Inhibition of the endogenous miR-29b and miR-200c with miRNA hairpin inhibitors increased the level of ADAM12-L mRNA in SUM149PT and SUM102PT cell lines. [score:5]
In the context of breast cancer, miR-29b has been recently identified as a part of a GATA3-miR-29b axis, which regulates the tumor microenvironment and inhibits metastasis [34]. [score:4]
These results are consistent with a role of miR-29b and miR-200c (and possibly miR-200b) in the regulation of ADAM12-L expression in breast tumors. [score:4]
Similar to miR-29, the miR-200 family is down-regulated in claudin-low tumors and cell lines. [score:4]
The miR-29 family, in particular miR-29b, is enriched in luminal breast cancers and inhibits metastasis by repressing regulators of angiogenesis, collagen remo deling, and tumor microenvironment [34]. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
The ADAM12-L 3′UTR is a direct target of miR-29 and miR-200 family members. [score:4]
miR-29 has been also implicated in the regulation of Adam12 expression in response to transforming growth factor β (TGFβ) in experimental renal fibrosis in mice [46]. [score:4]
The miR-29 family is down-regulated in claudin-low cell lines and tumors, in which ADAM12-L, but not ADAM12-S, is strongly elevated. [score:4]
Decreased ADAM12-L protein and mRNA levels after transfection of miR-29b/c suggested that these miRNAs might be directly targeting the ADAM12-L 3′UTR. [score:4]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
Disruption of the predicted miR-29 target site by site-directed mutagenesis largely diminished the effects of miR-29b/c. [score:4]
ADAM12-S expression was not significantly altered by transfection with miR-29b/c mimics. [score:3]
In SUM102PT cells, miR-29b inhibitor increased the ADAM12-L level by ~80%, and this effect was significant. [score:3]
The miR-29 family was reported previously to target the Adam12 transcript in NIH3T3 cells [45]. [score:3]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
miRNA profiling of 51 breast cancer cell lines has previously established that miR-29b/c, miR-30d, and miR-200b/c are under-expressed in claudin-low breast cancer cell lines (ref. [score:3]
In parallel experiments, we examined the effects of miR-29b/c on ADAM12-L protein expression by immunoblotting. [score:3]
The levels of the ADAM12-S splice variant were not changed by miR-29b/c, consistent with the lack of any predicted miR-29 target sites in the ADAM12-S 3′UTR. [score:3]
Thus, increased expression of ADAM12-L in claudin-low cell lines and tumors could be facilitated, at least in part, by low levels of miR-29 family members. [score:3]
miR-29b/c and miR-200b/c also significantly decreased the activity of an ADAM12-L 3′UTR reporter, and this effect was abolished when miR-29b/c and miR-200b/c target sequences were mutated. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
The roles of endogenous miR-29b and miR-200c were tested by transfecting cells with miRNA hairpin inhibitors. [score:3]
To determine whether low levels of miR-29b/c are required for high expression of ADAM12-L in claudin-low cell lines, we utilized SUM159PT and BT549 cells, two representative claudin-low cell lines with low endogenous levels of miR-29b/c (see Figure  1D). [score:3]
Adam12 is the only splice variant known to exist in mice and, similar to human ADAM12-L, it contains a miR-29 target site. [score:3]
The 3′UTR of human ADAM12-L contains well conserved potential target sites for miR-29b/c, miR-30b/d, and two poorly conserved potential sites for miR-200b/c (Figure  1C). [score:3]
In SUM149PT cells, miR-29b and miR-200c inhibitors increased ADAM12-L levels by ~50% and ~30%, respectively, and these effects were statistically significant (Figure  5B). [score:3]
Analysis of a publicly available gene expression dataset for 100 breast tumors revealed a statistically significant negative correlation between ADAM12-L and both miR-29b and miR-200c. [score:3]
Figure 2 ADAM12-L, but not ADAM12-S, is a target for miR-29b/c. [score:3]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
Loss of miR-29b promotes a mesenchymal phenotype and increases metastasis. [score:1]
Importantly, we found a significant negative correlation between ADAM12-L and both miR-29b and miR-200c in breast invasive carcinomas. [score:1]
We found that miR-29b/c mimics decreased the level of ADAM12-L by ~70%, and that this effect was statistically significant (Figure  2A). [score:1]
Among these three miRNAs, miR-29b and miR-200c appear to be the most strongly correlated with ADAM12-L in breast tumors. [score:1]
Transfection of miR-29b/c mimics strongly decreased ADAM12-L mRNA levels in SUM159PT and BT549 cells, whereas ADAM12-S levels were not changed. [score:1]
We observed that both miR-29b and miR-29c strongly diminished the level of ADAM12-L protein in both cell lines (Figure  2B). [score:1]
We established that transfection of miR-29b/c and miR-200b/c mimics strongly decreased the level of ADAM12-L protein in claudin-low SUM159PT, BT549, SUM1315MO2, and Hs578T cells, while miR-30b/d mimics had a more modest effect. [score:1]
Figure 5 Relationship between endogenous miR-29b, miR-200c, and ADAM12-L in breast tumors and breast cancer cell lines. [score:1]
Since the miR-29 and miR-200 families play important roles in breast cancer progression, these results may help explain the different prognostic and chemopredictive values of ADAM12-L and ADAM12-S in breast cancer. [score:1]
There was a significant negative correlation between miR-29b and ADAM12-L (P = 0.0001), between miR-200c and ADAM12-L (P = 0.0002), and a weaker but significant correlation between miR-200b and ADAM12-L (P = 0.0464) (Figure  5A). [score:1]
miR-29b/c, miR-30b/d, miR-200b/c, or control miRNA mimics were transfected into SUM159PT, BT549, SUM1315MO2, or Hs578T breast cancer cells. [score:1]
Importantly, both miR-29b/c and miR-200b/c strongly decreased steady state levels of ADAM12-L protein in all breast cancer cell lines tested. [score:1]
[1 to 20 of 58 sentences]
18
[+] score: 220
Taken together, the present study shows that bladder outlet obstruction, such as that seen in elderly men with enlarged prostate glands, leads to reduced expression of miR-29b and miR-29c in the bladder and that this is associated with increased expression of miR-29 targets, including the matrix proteins elastin and Sparc. [score:7]
Human detrusor cells were transfected with miR-29c inhibitor and eight validated miR-29 targets, most of which were represented among the top 50 predicted targets in Figure 3A, were examined using western blotting. [score:7]
We also demonstrate that genetic depletion of miRNAs, including miR-29, increases bladder elastin expression and stiffness independently of outlet obstruction and that miR-29 inhibitor transfection in vitro replicates several of the expression changes associated with miR-29 repression in outlet obstruction. [score:7]
Together, these circumstances may well explain the more widespread apparent impact of miR-29 repression in outlet obstruction (8/8 examined target proteins increased) compared to inhibitor transfection (4/8 examined target proteins increased). [score:6]
Four of the eight selected miR-29 targets, including Eln (elastin or tropoelastin), Fos (also known as c-Fos), Sparc (osteonectin) and sprouty homolog 1 (Spry1), were significantly increased following inhibitor transfection (Figure 3D, left row). [score:5]
To address the functional impact of miR-29, we transfected a miR-29 inhibitor and mimic in vitro and conditionally deleted Dicer in vivo [5] and examined the effect of these interventions on tropoelastin expression and on tissue mechanical properties. [score:5]
Currently, we can only speculate on the role of these proteins in outlet obstruction, but it is of considerable interest that the miR-29 target Spry1 [14], which is an established ERK1/2 inhibitor [49], increases after prolonged outlet obstruction. [score:5]
For tropoelastin, whose mRNA correlated inversely and significantly with miR-29 in outlet obstruction, we found that transfection of a miR-29c inhibitor resulted in increased tropoelastin expression. [score:5]
Of the 30 miRNAs that are highly expressed in the mouse detrusor [5, 41] none except miR-29 is predicted to target tropoelastin. [score:5]
Some predicted and confirmed miR-29 targets, including Fbn1, which is an integral part of the elastic fiber meshwork, and Lamc1, a protein present in the basement membrane, were increased in outlet obstruction but were not significantly affected at the protein level following inhibitor transfection (not shown). [score:5]
To address whether reduced miR-29b/c following outlet obstruction was associated with altered expression of target mRNAs we did an mRNA microarray experiment. [score:5]
Additional regulatory inputs on miR-29 expression include c-Myc and NF-κB [11], and recent work has provided considerable insight into c-Myc -mediated repression, which appears to depend on a repressor complex consisting of c-Myc, histone deacetylae 3 (Hdac3) and enhancer of zeste homologue 2 (Ezh2) [18]. [score:4]
Detrusors from smooth muscle-specific Dicer knockout mice were used to examine if reduction of miR-29 in vivo increases tropoelastin expression. [score:4]
We found that Dicer knockout reduced miR-29b and miR-29c by about half and increased tropoelastin expression. [score:4]
The extracellular matrix molecule elastin is one of the best established targets of miR-29, and its message has 14 binding sites dispersed over the coding sequence and the 3’UTR [12]. [score:3]
The initial association found for miR-29b/c is illustrated in Figure 3A which shows that miR-29b/c targets were elevated at 10 days (vs. [score:3]
MiR-29b and miR-29c were among the 63 differentially expressed miRNAs in outlet obstruction (q=0; n=6−8; GEO accession number GSE47080). [score:3]
MiR-1 (not shown), miR-29b, and miR-29c returned significant associations with target mRNA levels. [score:3]
Time courses of expression for miR-29c and miR-29b from the microarray experiment are depicted in Figure 2A and 2B. [score:3]
Real-time quantitative PCR for miR-29c and miR-29b (Figure 2C and D) confirmed reduced expression of both miRNAs at 10 days. [score:3]
Repression of miR-29 after outlet obstruction is associated with increased levels of miR-29 target proteins. [score:3]
Outlet obstruction and transforming growth factor β (TGF-β1) stimulation leads to reduced expression of miR-29. [score:3]
0082308.g005 Figure 5(A) Western blots for eight miR-29 targets in sham-operated control bladders and at 6 weeks of obstruction. [score:3]
We also examined if the reduction of miR-29 correlated with altered miR-29 target mRNAs, including tropoelastin and Sparc. [score:3]
6 weeks) of the top 50 mRNA targets of miR-29 when miR-29 was repressed at 10 days and when miR-29 recovered after de-obstruction (c. f. Figure 2A and B). [score:3]
Stimulation with TGF-β1 for 48h led to reduced expression of miR-29c and miR-29b (Figure 2E and F). [score:3]
The experimental support for an impact of miR-29 on protein synthesis in the bladder following outlet obstruction extends well beyond a significant correlation between miR-29b/c and target mRNAs. [score:3]
Expression of (E) miR-29c and (F) miR-29b in vehicle -treated (control) and TGF-β1 -treated human urinary bladder smooth muscle cells. [score:3]
sham) of miR-29 target messenger RNAs (mRNA; black circles) and proteins (white circles). [score:3]
Considerably more time was moreover allowed for de-repression of miR-29 targets in the in vivo setting (6 wk vs. [score:3]
We first examined expression of miR-29b and miR-29c following 5 weeks of Dicer deletion and found both miRNAs to be reduced (Figure 6A, B). [score:3]
It may be argued that a miRNA other than miR-29 is responsible for altered tropoelastin expression in Dicer KO bladders. [score:3]
Outlet obstruction and TGF-β reduce miR-29 expression. [score:3]
0082308.g002 Figure 2Time courses of (A) miR-29c and (B) miR-29b expression following rat bladder outlet obstruction. [score:3]
This revealed a pronounced increase around individual cells and around muscle bundles in obstructed bladders, consistent with its increased mRNA level and with the fact that it is a miR-29 target [48]. [score:3]
We next set out to determine miR-29 expression. [score:3]
Real-time quantitative PCR to confirm reduced expression of miR-29. [score:3]
We next tested whether TGF-β1 reduces miR-29 expression using cultured smooth muscle cells from human bladder. [score:3]
Repression of miR-29 during outlet obstruction is associated with increased levels of miR-29 target messenger RNAs (mRNAs). [score:3]
The matricellular protein Sparc is a confirmed miR-29 target [13] that influences collagen fibril morphology and function [47]. [score:3]
Bladder outlet obstruction increases miR-29 target protein levels. [score:3]
Type I and type III collagens are however established targets of miR-29 [10], and their mRNAs were largely unchanged at 10 days and at 6 weeks (Col1a1 at 10 days: up by 15%, q=2.7, p=0.05; Col3a1 at 10 days: up by 12%, q=8.7, p=0.12). [score:3]
Unlike other miRNAs, miR-29 also targets a large battery of collagens, including collagens I and III [10]. [score:3]
This would repress miR-29, and hence it would be more difficult to see an effect of miR-29 inhibition. [score:3]
Our studies support a mo del in which multiple signaling pathways converge on repression of miR-29 in outlet obstruction, facilitating matrix protein expression and leading to altered mechanical properties of the urinary bladder. [score:3]
Time courses of (A) miR-29c and (B) miR-29b expression following rat bladder outlet obstruction. [score:3]
MiR-29 target mRNAs change in outlet obstruction. [score:2]
Thus, several independent lines of evidence support a regulatory role of miR-29 in tropoelastin synthesis in the bladder, consistent with the large number of miR-29 binding sites in its mRNA [10, 12]. [score:2]
Several of the miR-29 targets that we studied, including Col15a1, Tdg and Spry1, have not been considered previously in the context of hypertrophic growth and remo deling of the bladder. [score:2]
Taken together these findings strongly support the view that the aforementioned repressor complex, assembled upon accumulation of c-Myc/Ezh2 in outlet obstruction, regulates miR-29b in the detrusor. [score:2]
SMAD proteins belong to a conserved family of TGF-β signal transducers that are regulated by phosphorylation [17], and the repression of miR-29 by TGF-β was shown to involve SMAD3 [16]. [score:2]
The matricellular protein Sparc has three miR-29 binding sites clustered in its proximal 3’ UTR, and, similar to elastin, this protein is effectively regulated by miR-29 in vitro [13]. [score:2]
Real-time quantitative polymerase chain reaction (n=5-7) for miR-29b (A), miR-29c (B) and elastin (Eln, C) in control (Ctrl) and Dicer knockout (KO) mouse bladders. [score:2]
A correlation between the c-Myc mRNA and miR-29b was moreover seen, and we directly demonstrate accumulation of c-Myc and Ezh2 using western blotting. [score:2]
Our starting hypothesis was that TGF-β/SMAD3 signaling would repress miR-29 in outlet obstruction. [score:1]
Figure S2 Flow chart showing the mo del proposed for miR-29 repression in outlet obstruction and for miR-29 -mediated matrix remo deling and altered passive mechanical properties. [score:1]
The reduced level of miR-29 leads to increased levels of mRNAs encoding extracellular matrix proteins (3), including elastin and Sparc (osteonectin), but possibly also collagens and fibrillin-1. The resulting protein synthesis and matrix deposition (4) leads to increased detrusor stiffness (5) (and increased elastic modulus) which counteracts (6) further distension. [score:1]
Together, these findings support the view that repression of miR-29, independent of surgical obstruction of the urethra, leads to matrix remo deling. [score:1]
We therefore hypothesized that outlet obstruction leads to SMAD3 phosphorylation repressing miR-29, and that this in turn has an impact on protein synthesis and mechanical properties of the bladder. [score:1]
Studies using cultured cells support the idea that transforming growth factor-β (TGF-β), a central mediator in fibrogenesis, represses miR-29 [16]. [score:1]
Therefore, reduction of miR-29b and miR-29c could well promote collagen production at an unchanged mRNA level at these times. [score:1]
sham), a time point when miR-29 was reduced (c. f. Figure 2A and B). [score:1]
The miR-29 cluster has gained recognition as a modulator of extracellular matrix production [7- 10]. [score:1]
This hypothesis was based on a handful of prior studies demonstrating increased mRNA levels for different TGF-β isoforms shortly after outlet obstruction (e. g. 24), and on the documented repression of miR-29 by TGF-β/SMAD3 [11]. [score:1]
Eln correlated significantly with miR-29c (Figure 3E) and with the mean of miR-29b and miR-29c (not shown). [score:1]
Thus we measured the eight validated miR-29 target proteins (the same ones measured after inhibitor transfection) at 6 weeks of obstruction. [score:1]
When miR-29b/c increased on de-obstruction (vs. [score:1]
c-Myc and NF-κB are also known to repress miR-29 [11, 18], and both pathways have previously been shown to be activated in outlet obstruction and by mechanical distension [37- 39]. [score:1]
The proposed mo del fits the data presented in this article, but alternative interpretations are possible and steps upstream of miR-29 repression need in vivo corroboration. [score:1]
SMAD3 activation, which is known to be involved in TGF-β -mediated repression of miR-29, was not significantly increased at 10 days when miR-29b and miR-29c appeared to be maximally repressed. [score:1]
The Myc mRNA declined below the control level on de-obstruction, resulting in a significant and inverse correlation with miR-29b (Figure 4B). [score:1]
c-Myc -mediated repression of miR-29 involves a complex consisting of c-Myc (Myc), histone deacetylase 3 (Hdac3) and enhancer of zeste homolog 2 (Ezh2) which binds to conserved sequences in the promoters of the miR-29a/b1 and miR-29b2/c genes [18]. [score:1]
MiR-29 -mediated extracellular matrix remo deling has been demonstrated in the infarcted heart [10] and during aortic aneurysm progression [7- 9], but miR-29 also plays roles in cell proliferation, muscle differentiation and apoptosis [11]. [score:1]
This in turn (2) activates multiple signaling pathways including c-Myc, NF-κB and TGF-β/SMAD3 that in turn repress miR-29. [score:1]
We therefore propose that c-Myc/Hdac3/Ezh2 and NF-κB are jointly responsible for repression of miR-29b and miR-29c at 10 days and that SMAD3 is responsible for the sustained repression of miR-29c. [score:1]
Combined, these findings provide support for our hypothesis that miR-29 reduction contributes to increased protein synthesis in the bladder following outlet obstruction and that this in turn influences matrix properties and stiffness (Figure S2). [score:1]
We hypothesized that miR-29 repression may contribute to increased detrusor stiffness in outlet obstruction. [score:1]
We propose that bladder distension leads to repression of miR-29 via three distinct mechanisms and that this has an impact on tropoelastin and Sparc synthesis and on tissue mechanical properties. [score:1]
To address this hypothesis we examined if SMAD proteins are phosphorylated and whether miR-29 is reduced in outlet obstruction. [score:1]
Sparc correlated with the mean of miR-29b and miR-29c (Figure 3F). [score:1]
De-repression of Sparc may thus also contribute to a miR-29 -mediated change of detrusor stiffness in outlet obstruction. [score:1]
It comprises three miRNAs (miR-29a, miR-29b, and miR-29c) derived from two independent genes [10]. [score:1]
Our lack of evidence for SMAD2/3 activation at 10 days, when miR-29b and miR-29c appeared maximally repressed, forced us to consider alternative mechanisms. [score:1]
In view of this outcome we tested if Eln and Sparc mRNAs were individually correlated with miR-29 in outlet obstruction. [score:1]
Added to the correlation between miR-29c and Col4a1 mRNA this favors a causal relationship between the repression of miR-29 and the increase of Col4a1 in outlet obstruction. [score:1]
Independent confirmation of reduced (C) miR-29c and (D) miR-29b in the obstructed bladder by real-time quantitative polymerase chain reaction (n=6). [score:1]
This supported the possibility that c-Myc and NF-κB, but not SMAD3, might be involved in the repression of miR-29b and miR-29c at 10 days. [score:1]
The impact of miR-29 in outlet obstruction is likely underestimated by measuring levels of mRNAs because an important mechanism of miRNAs is translational repression. [score:1]
[1 to 20 of 88 sentences]
19
[+] score: 217
Since ectopic expression of miR-29b suppressed hPGRN expression, we used locked nucleic acid (LNA) -mediated miRNA silencing to determine whether loss of endogenous miR-29b activity enhances hPGRN expression in stably transfected hPGRN-3T3 cells. [score:9]
Expression of pre-miR-29b-1 or pre-miR-29b-2 suppressed the expression of luciferase with hPGRN 3′UTR (Fig. 2B), suggesting that both genes indeed can produce functional mature miR-29b to regulate hPGRN 3′UTR. [score:8]
With such mutations present in hPGRN 3′UTR, luciferase expression failed to be regulated by miR-29b produced from the vector expressing its precursor (Fig. 3D). [score:7]
MiR-29b regulates several other mRNA targets as well [33], [34], [36], [37], consistent with the notion that each miRNA targets many mRNAs in different cellular and developmental settings [27]. [score:7]
Both overexpression and locked nucleic acid (LNA) knockdown experiments demonstrated a role for miR-29b in regulating progranulin expression through its 3′UTR. [score:7]
We also confirmed that miR-29b interacts directly with the hPGRN 3′UTR and regulates the expression level of endogenous hPGRN. [score:5]
Thus, miR-29b is a good candidate miRNA that may directly regulate progranulin expression. [score:5]
We cloned mPGRN 3′UTR into the luciferase reporter construct and found that indeed miR-29b also suppressed luciferase expression through mPGRN 3′UTR (Fig. 2C). [score:5]
As expected, the effect of miR-29b on progranulin expression is not as dramatic as that of transcription factors, consistent with the notion that in many cases, miRNAs fine tune gene expression [20], [27]. [score:5]
MiR-29b is downregulated in several types of tumor cells [32]– [34], which is in reverse correlation with the increased progranulin expression in tumor cells [35]. [score:5]
Firefly luciferase expression vectors (PGL3; 200 ng), miR-29b-pSuper or pSuper empty vector (200 ng), and Renilla luciferase expression vector (50 ng) were cotransfected into the cells with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. [score:5]
We identified miR-29b with a miRNA target prediction program that takes into account the secondary structures of target mRNAs and seed region complementarity [28]. [score:5]
These experiments demonstrate that miR-29b interacts directly with the binding site in hPGRN 3′UTR to regulate luciferase reporter expression. [score:5]
miR-29b also suppressed the expression of luciferase with mPGRN 3′UTR. [score:5]
miR-29b Suppresses Expression of the Luciferase Reporter Containing the hPGRN 3′UTR. [score:5]
In addition to vector -based expression of pre-miR-29b-1, which produces mature miR-29b after being transfected into HEK293 cells, we also used miRNA mimics, which are double-stranded RNA oligonucleotides that are chemically modified with Dharmacon ON-TARGET (Themo Scientific Dharmacon). [score:5]
Moreover, miR-29b mimics were unable to suppress luciferase expression with a different mutant hPGRN 3′UTR in which GTG in the miR-29b binding site was mutated to CAC (Fig. 3C, D). [score:5]
Cotransfection of normal but not the mutant pre-miR-29b-1 suppressed luciferase reporter expression (Fig. 3B). [score:5]
of miR-29b and its putative target site in hPGRN 3′UTR was carried out with the QuickChange Multi Site-Directed kit (Stratagene) according to the manufacturer's instructions. [score:4]
Thus, hPGRN expression can be regulated by manipulating the activity of endogenous miR-29b. [score:4]
MiR-29b suppresses the expression of the luciferase reporter with hPGRN 3′UTR. [score:4]
miR-29b directly targets hPGRN 3′UTR through the seed region. [score:4]
Thus, miR-29b is novel regulator of progranulin expression, raising the possibility of manipulating the activities of miR-29b and other miRNAs in the adult brain to treat FTD associated with progranulin deficiency. [score:4]
Mutagenesis of miR-29b and its putative target site in hPGRN 3′UTR was carried out with the QuickChange Multi Site-Directed kit (Stratagene) according to the manufacturer's instructions. [score:4]
To examine whether the interaction between miR-29b and hPGRN 3′UTR is direct or indirect, we generated mutations in miR-29b. [score:4]
Thus, miR-29b-1 acts through hPGRN 3′UTR to regulate luciferase expression. [score:4]
As expected, an increased level of miR-29b led to a lower level of hPGRN in the medium (Fig. 5B), correlating with the decreased expression in hPGRN-3T3 cells. [score:3]
Cotransfection of miR-29b-1 and the luciferase vector without hPGRN 3′UTR did not affect luciferase expression (data not shown). [score:3]
Indeed, we found that indeed the expression levels of endogenous intracellular hPGRN (Fig. 5D) and secreted hPGRN (Fig. 5E) were decreased by miR-29b mimics. [score:3]
In the case of progranulin, the potential effects of miR-29b knockdown on other mRNA targets and biological processes must be considered. [score:3]
miR-29b Suppresses the Production and Secretion of hPGRN. [score:3]
Moreover, miR-29b is highly expressed in adult brains and in postmitotic neurons [29]. [score:3]
0010551.g004 Figure 4(A) The relative levels of mature miR-29b in hPGRN-3T3 cells were increased by transient expression of the miR-29b precursor or miR-29b mimic. [score:3]
Transfection of miR-29b but not miR-9 mimics decreased luciferase reporter expression (Fig. 2D). [score:3]
Identification of a miR-29b target site in the 3′UTR of hPGRN mRNA. [score:3]
In the nervous system, miR-29b is developmentally regulated, with the highest level in adult mouse brain [29]. [score:3]
For mutagenesis of the miR-29b target site in hPGRN 3′UTR, 5′-GACCCTGTGGCCAGACACTTTTCC CTATCCACAG-3′ was used. [score:3]
Here we provide multiple lines of experimental evidence to demonstrate that miR-29b is a novel regulator of hPGRN production. [score:2]
The level of secreted hPGRN increased to a similar extent after miR-29b knockdown (Fig. 6B). [score:2]
The next day, the medium was changed to fresh Dulbecco's modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS), and the cells were transfected 2 h later with 100 pmol of control or miR-29b miRNA mimics (Dharmacon) using Lipofectamine 2000 (Invitrogen) as directed by the manufacturer. [score:2]
Knockdown of endogenous miR-29b led to increased production and secretion of hPGRN. [score:2]
Thus, the regulatory interaction between miR-29b and hPGRN may exist during tumorigenesis as well. [score:2]
To examine whether miR-29b also regulates the expression of endogenous hPGRN, we transfected the human cell line HEK293 cells with miR-29b mimics and measured the levels of intracellular and secreted hPGRN. [score:2]
Although 3′UTR sequences tend to drift more rapidly during evolution [27], the putative binding sites for miR-29b in PGRN 3′UTRs are also highly conserved in mammals, with only one nucleotide difference between humans and rodents (Fig. 1D), suggesting an evolutionarily conserved miRNA–mRNA interaction with potentially important regulatory functions. [score:2]
miR-29b Knockdown Increases the Levels of Intracellular and Secreted hPGRN. [score:2]
Next, we examined the regulation of endogenous hPGRN by miR-29b. [score:2]
miR-29b Directly Interacts with the Predicted Binding Site in the hPGRN 3′UTR. [score:2]
The 3′UTR of hPGRN mRNA Contains a Predicted miR-29b Binding Site. [score:1]
In pre-miR-29b-1, we mutated two nucleotides in the miR-29b seed region from CC to GG (Fig. 3A). [score:1]
The decrease in the level hPGRN protein as we observed is likely due to a decrease in hPGRN mRNA stability since we found by quantitative RT-PCR that the level of hPGRN mRNA was also decreased by miR-29b mimics (Figure 5C). [score:1]
Mutant 2 was used for experiment with the miR-29b mimic. [score:1]
To validate the interaction between miR-29b and the hPGRN 3′UTR, we cloned hPGRN 3′UTR into the reporter vector to serve as the 3′UTR of the luciferase coding region (Fig. 2A). [score:1]
Luciferase activity was reduced by miR-29b but not by mutant miR-29b. [score:1]
Since hPGRN and mPGRN mRNAs contain conserved binding sites for miR-29b (Fig. 1D), and the effects of miRNAs depend on the secondary structures of surrounding mRNA sequences, we also examined whether miR-29b could also interact with mPGRN mRNA. [score:1]
Moreover, we also mutated the miR-29b binding site in hPGRN 3′UTR in which GTG was changed to ACA (Fig. 3C). [score:1]
This program predicted a putative binding site for miR-29b in the hPGRN 3′UTR, which contains about 300 nucleotides (Fig. 1A, B). [score:1]
Transfection of hPGRN-3T3 cells with the pre-miR-29b-1 vector significantly increased the level of mature miR-29b (Fig. 4A). [score:1]
The miR-29b seed sequences and their predicted binding sites in the hPGRN 3′UTR are shown underlined. [score:1]
0010551.g006 Figure 6(A) qRT-PCR confirmed that mature miR-29b level was decreased by about 80% in hPGRN-3T3 cells transfected with miR-29b-specific LNA. [score:1]
0010551.g003 Figure 3(A) The seed region of miR-29b and the opposite strand in the stem-loop in the precursor were mutated. [score:1]
MiR-29b precursors were amplified from HEK293FT genomic DNA using 5′-GTCGA CCTGACTGCCATTTG-3′ and 5′-ATCGA TGCTCTCCCATCAATA-3′ for pre-miR-29b-1 on chromosome 7 and 5′-GTCGACT GTGTTTATTTTAAACACAA-3′ and 5′-ATCGATTGAATCTCCCTTCT TTCTT-3′ for pre-miR-29b-2 on chromosome 1. SalI and ClaI restriction enzyme sites were placed at the ends of the PCR products for subcloning into the pSuper basic vector (OligoEngine). [score:1]
Again, miR-29b significantly reduced the level of intracellular hPGRN in hPGRN-3T3 cells (Fig. 4D). [score:1]
Transfection of miR-29b-specific LNA probes reduced endogenous miR-29b levels by about 80% (Fig. 6A). [score:1]
Mutant 1 was used for experiment with the miR-29b vector. [score:1]
Mature miR-29b can be produced from two precursors encoded by two genes located on chromosomes 7 and 1, respectively. [score:1]
To ensure that mutant pre-miR-29b-1 maintains its stem loop structure so that it can be properly processed to produce mature miR-29b, we also mutated GG in the opposite strand of the stem into CC (Fig. 3A). [score:1]
0010551.g005 Figure 5(A, B) hPGRN-3T3 cells were transfected with miR-29b or negative control mimics, and the relative hPGRN levels in total cell lysates (A) and medium (B) were determined by ELISA. [score:1]
n = 4. (A) qRT-PCR confirmed that mature miR-29b level was decreased by about 80% in hPGRN-3T3 cells transfected with miR-29b-specific LNA. [score:1]
We also used miR-29b mimics to increase the level of mature miR-29b (Fig. 4A). [score:1]
We also cloned the 421-nucleotide genomic fragment that contains pre-miR-29b-1 into the pSuper vector (Fig. 2A). [score:1]
For mutagenesis of miR-29b, 5′-CCCAAGA ACACTGATTTCAAATCCTGCTAGAC AATCAC-3′ and 5′-AATCTA AACCAGG ATATGAAACCAGCTTCCTGAAGAA GC-3′ were used. [score:1]
These findings raise the possibility that miR-29b may specifically interact with hPGRN 3′UTR. [score:1]
In this study, we identified a miR-29b binding site in the 3′UTR of hPGRN mRNA. [score:1]
miR-29b levels were normalized to miR-126 or U6 levels. [score:1]
hPGRN 3′UTR was cloned into the luciferase vector containing the SV40 promoter, which was cotransfected with the vector encoding pre-miR-29b-1 and H1 promoter. [score:1]
0010551.g001 Figure 1(A) Schematic representation of hPGRN mRNA (NM_002087.2 showing with the predicted miR-29b binding site in the 3′UTR. [score:1]
[1 to 20 of 76 sentences]
20
[+] score: 204
Other miRNAs from this paper: hsa-mir-29b-2
In addition, by overexpressing miR-29b in osteosarcoma cells, we experimentally validated the direct inhibition of CDK6 translation by miR-29b. [score:8]
Finally, we showed that miR-29b inhibited CDK6 expression and consequently inhibited proliferation and migration in cultured osteosarcoma cells. [score:7]
To overexpress CDK6, an expression plasmid designed to specifically express the full-length open reading frame (ORF) of CDK6 without the miR-29b-responsive 3′-UTR was constructed and transfected into MG-63 cells. [score:7]
In conclusion, our results demonstrated that miR-29b directly recognizes and binds to the 3′-UTR of the CDK6 mRNA transcript and inhibits CDK6 translation in osteosarcoma cells. [score:6]
One such miRNA is miR-29b, the expression of which is frequently downregulated in human cancers (Mott et al., 2007; Garzon et al., 2009; Mott et al., 2010) and in osteosarcoma (Jones et al., 2012; Dai et al., 2013). [score:6]
Interestingly, we observed that the restoration of CDK6 expression can successfully attenuate the anti-proliferation and anti-migration effects of miR-29b on osteosarcoma cells, although miR-29b has many other targets. [score:5]
These results suggest that the targeting of CDK6 is a major mechanism by which miR-29b exerts its tumor-suppressive function. [score:5]
However, the underlying molecular mechanisms through which downregulation of miR-29b contributes to the development and progression of osteosarcoma remain to be fully elucidated. [score:5]
When MG-63 cells were simultaneously transfected with pre-miR-29b and the CDK6 overexpression plasmid, CDK6 dramatically attenuated the migration suppression by miR-29b (Fig.   5C). [score:5]
In this study, we found that overexpressing miR-29b can inhibit proliferation and migration of osteosarcoma cells and that CDK6 reduction can mimic the effect of miR-29b induction. [score:5]
Moreover, the potential role of miR-29b as a tumor suppressor of osteosarcoma through targeting CDK6 in the processes of proliferation and migration has been experimentally validated. [score:5]
In particular, it has been shown that miR-29b can function as a tumor suppressor to inhibit cancer cell proliferation (Zhang et al., 2014). [score:5]
As anticipated, overexpression of miR-29b significantly suppressed the CDK6 protein levels in MG-63 cells (Fig.   3B). [score:5]
Figure 3 CDK6 protein expression is inhibited by miR-29b via binding to the CDK6 3′-UTR in osteosarcoma cells. [score:5]
Moreover, compared with cells transfected with pre-miR-29b alone, those transfected with both pre-miR-29b and the CDK6-ORF-overexpression plasmid exhibited significantly higher proliferation rates (Fig.   4H), suggesting that miR-29b-resistant CDK6 is sufficient to rescue the suppression of CDK6 by miR-29b and to attenuate the anti-proliferation effect of miR-29b on osteosarcoma cells. [score:4]
After determining the levels of miR-29b in the same 6 pairs of osteosarcoma tissues and adjacent noncancerous tissues, we found that miR-29b levels were significantly downregulated in osteosarcoma tissues (Fig.   2B). [score:4]
Indeed, miR-29b has been reported to be downregulated in several types of human cancer, including hepatocellular carcinoma (Fang et al., 2011), myeloid leukemia (Mott et al., 2010) and chronic lymphocytic leukemia (Sampath et al., 2012). [score:4]
Taken together, these results demonstrated that miR-29b specifically regulates CDK6 expression at the post-transcriptional level, which is the most common mechanism for animal miRNAs. [score:4]
MiR-29b suppresses the proliferation of osteosarcoma cells via targeting CDK6. [score:4]
Our studies reveal the importance of miR-29b targeting CDK6 as a novel regulatory pathway in osteosarcoma progression. [score:4]
Then, we identified CDK6 as a direct target gene of miR-29b. [score:4]
MiR-29b suppresses the migration ability of osteosarcoma cells via targeting CDK6. [score:4]
Validation of CDK6 as a direct target of miR-29b. [score:4]
Identification of conserved miR-29b target sites in the 3′-UTR of CDK6. [score:3]
Furthermore, we determined CDK6 mRNA expression levels by qRT-PCR after transfecting the cells with pre-miR-29b. [score:3]
Similar to miR-29b overexpression, transfection of CDK6 siRNA markedly reduced the cell proliferation ability of MG-63 cells (Fig.   4D). [score:3]
In conclusion, the results of bioinformatics prediction taken together with the inverse correlation between miR-29b and CDK6 protein levels, but not mRNA levels, indicated that CDK6 is a target of miR-29b in human osteosarcoma tissues. [score:3]
Furthermore, miR-29b plays a tumor suppressive role in cancer by influencing cell survival, tumor growth, apoptosis, cell cycle distribution, migration and angiogenesis (Cortez et al., 2010; Fang et al., 2011; Kole et al., 2011; Wang et al., 2011; Rossi et al., 2013). [score:3]
Here, we overexpressed miR-29b by transfecting cells with pre-miR-29b, which is a synthetic RNA oligonucleotide that mimics the miR-29b precursor. [score:3]
To test the direct binding of miR-29b to the target gene CDK6, a luciferase reporter assay was performed as previously described (Chen et al., 2009). [score:3]
Therefore, we searched for miRNAs that can target CDK6 and identified miR-29b as a novel candidate. [score:3]
We next analyzed the biological consequences of the miR-29b -driven repression of CDK6 expression in osteosarcoma cells. [score:3]
There were three predicted hybridizations between miR-29b and the 3′-UTR of CDK6, and the minimum free energy values of these hybridizations are −19.8, −18.7 and −23.0 kcal/mol, respectively, which are well within the range of genuine miRNA-target pairs (Fig.   2A). [score:3]
These results suggest that miR-29b may be involved in the pathogenesis of osteosarcoma as a tumor suppressor. [score:3]
The correlation between miR-29b and CDK6 was further examined by evaluating CDK6 expression in the human osteosarcoma cell line MG-63 after overexpression of miR-29b. [score:3]
As shown in Figure  3C, overexpression of miR-29b did not affect CDK6 mRNA levels in MG-63 cells. [score:3]
This mutated luciferase reporter was unaffected by overexpression of miR-29b (Fig.   3E). [score:3]
Figure 2 Inverse correlation between the miR-29b and CDK6 protein expression levels in osteosarcoma tissues. [score:3]
Taken as a whole, this study delineates a novel regulatory network employing miR-29b and CDK6 to regulate proliferation and migration in osteosarcoma cells. [score:3]
The efficient overexpression of miR-29b in MG-63 cells is shown in Fig.   3A. [score:3]
The inverse correlation between miR-29b and CDK6 expression level in osteosarcoma tissues and normal adjacent tissues was further analyzed. [score:3]
Taken together, these results demonstrate that miR-29b inhibits cell migration by silencing CDK6. [score:3]
For luciferase reporter assays, MG-63 cells were cultured in 12-well plates, and each well was transfected with 0.8 µg of firefly luciferase reporter plasmid, 0.8 µg of a β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (40 pmol) of pre-miR-29b or the scrambled negative control RNA using Lipofectamine 2000 (Invitrogen). [score:2]
Figure 5 MiR-29b represses cell migration via targeting CDK6 in osteosarcoma cells. [score:2]
Twenty-four hours post-transfection, the cells were assayed using a luciferase assay kit, and the luciferase activities were normalized to the β-galactosidase levels of the control (*** P < 0.001) To determine whether the negative regulatory effects of miR-29b on CDK6 expression were mediated through the binding of miR-29b to the presumed sites in the 3′-UTR of the CDK6 mRNA, a 1500 bp fragment of CDK6 3′-UTR containing the three presumed miR-29b binding sites was placed downstream of the firefly luciferase gene in a reporter plasmid. [score:2]
Figure 4 MiR-29b represses cell proliferation via targeting CDK6 in osteosarcoma cells. [score:2]
Among the numerous candidate regulatory miRNA of CDK6, we selected miR-29b for further investigation because we only focused on miRNAs that had multiple target sites within the 3′-UTR of CDK6. [score:2]
Furthermore, we introduced point mutations into the corresponding complementary sites in the 3′-UTR of CDK6 to eliminate the predicted miR-29b binding sites (All three binding positions were mutated). [score:2]
Twenty-four hours post-transfection, the cells were assayed using a luciferase assay kit, and the luciferase activities were normalized to the β-galactosidase levels of the control (*** P < 0.001)To determine whether the negative regulatory effects of miR-29b on CDK6 expression were mediated through the binding of miR-29b to the presumed sites in the 3′-UTR of the CDK6 mRNA, a 1500 bp fragment of CDK6 3′-UTR containing the three presumed miR-29b binding sites was placed downstream of the firefly luciferase gene in a reporter plasmid. [score:2]
Briefly, a 1500 bp fragment of human CDK6 3′-UTR containing the three presumed miR-29b binding sites was directly synthesized by Realgene (Nanjing, China). [score:2]
miR-29b osteosarcoma proliferation migration tumorigenesis Osteosarcoma is the most common primary bone malignancy, mainly occurring in children and adolescents (Marina et al., 2004; Longhi et al., 2006). [score:1]
As expected, MG-63 cells transfected with pre-miR-29b showed decreased proliferation (Fig.   4A). [score:1]
As expected, luciferase activity was markedly reduced in the cells transfected with pre-miR-29b (Fig.   3D). [score:1]
In this study, we found that the levels of miR-29b were lower in osteosarcoma tissues than in noncancerous tissues. [score:1]
Cellular miR-29b levels were increased approximately 25-fold when MG-63 cells were transfected with pre-miR-29b. [score:1]
In each well, equal amounts of pre-miR-29b or scrambled negative control RNA were used. [score:1]
The results revealed that the inverse correlation of miR-29b with the CDK6 protein (Fig.   2C) was stronger than that with the CDK6 mRNA (Fig.   2D) in the osteosarcoma tissues. [score:1]
Synthetic pre-miR-29b and scrambled negative control RNAs (pre-miR-control) were purchased from Ambion (Austin, TX, USA). [score:1]
Furthermore, cells transfected with pre-miR-29b alone displayed repressed migration ability (Fig.   5C). [score:1]
The correlation between miR-29b and CDK6 protein or mRNA levels were further illustrated using Pearson’s correlation scatter plots. [score:1]
Firefly luciferase reporters containing either wild-type (WT) or mutant (MUT) miR-29b binding sites in the CDK6 3′-UTR were co -transfected into osteosarcoma cells with either the pre-miR-control or pre-miR-29b. [score:1]
To test the binding specificity, a 1500 bp fragment of mutant CDK6 3′-UTR containing three mutant miR-29b binding sites was synthesized and inserted into an equivalent luciferase reporter. [score:1]
The recombinant plasmid was transfected into MG-63 cells along with pre-miR-29b or pre-miR-control. [score:1]
These findings suggested that the binding sites strongly contribute to the interaction between miR-29b and CDK6 mRNA. [score:1]
Detection of an inverse correlation between miR-29b and the CDK6 protein in osteosarcoma tissues. [score:1]
Furthermore, two of the three miR-29b binding sequences in the CDK6 3′-UTR are highly conserved across species. [score:1]
[1 to 20 of 66 sentences]
21
[+] score: 191
Specifically, in the heart, miR-29 family up-regulation is associated with cardiac development and growth regulation [59] whereas its down-regulation is involved in cardiac tissue remo deling after myocardial infarction [43]. [score:9]
Age -dependent miR-29 family up-regulation correlates with regulation of collagen and methylation levels in Nothobranchius furzeri heartMiR-29 family, one of the most upregulated miRNAs, was further evaluated for its well-known role during aging and cardiovascular diseases. [score:8]
Red dots show miR-29-sponge up-regulated genes, blue dots show Wild Type up-regulated genes. [score:7]
The increased expression levels of col1a1, col1a2 and col15a1, all known direct targets of miR-29, further confirmed an accumulation of collagen deposition in the miR-29-sponge heart (Fig.   6 panel C). [score:6]
In HCF derived from old donors, all miR-29 family members were upregulated (Figure  S1 panel A), with a parallel decrease of col3a1 expression (Figure  S1 panel B) and global 5mC level (Figure  S1 panel C). [score:6]
Consistently, the DNMT inhibitor RG108 exerted the same effect of miR-29a or miR-29b mimics (Fig.   9 panel C), further suggesting a potential role for miR-29 family in preventing hypoxia -dependent hypermethylation via down-regulation of DNMTs 66, 67. [score:6]
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Interestingly, the analysis of miRNA expression performed in different Nfu organs, including brain, liver, heart and skin, revealed miR-29 family together with miR-27d as one of the only two consistently up-regulated miRNAs during aging in all the four tissues (Figure  S5) [34]. [score:6]
Age -dependent miR-29 family up-regulation correlates with regulation of collagen and methylation levels in Nothobranchius furzeri heart. [score:5]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Noteworthy, the ROS scavenger N-acetyl cysteine (NAC) counteracted the effect of H [2]O [2] on expression of miR-29 expression (Figure  S2 panel A and Fig.   4 panel A) suggesting a link between miR-29 and oxidative stress. [score:5]
To functionally analyze the role of miR-29 in the heart we generated a transgenic zebrafish mo del where miR-29 biological activity was antagonized by the stable expression of a competitive inhibitor (a 3′-UTR containing seven repeats of the miR-29 binding site: miR-29-sponge) under the control of the actin beta-2 promoter (actb2:eGFP-sponge-29) of Danio renio 35, 62. [score:5]
Full-length blot is presented in Supplementary Figure 6. (B) qRT-PCR mRNA analysis of hypoxia associated genes: erythropoietin alpha (epoa); hexokinase2 (hk2); heme oxygenase1a (hmox1a); lactate dehydrogenase A (ldha); cyclin -dependent kinase inhibitor 1B (p27) in Wild Type (black circles; n = 4) and miR-29-sponge (gray squares; n = 4) Zebrafish hearts expressed as fold-change versus Wild Type samples. [score:5]
miR-29 family knock-down changes global methylation level and collagen expression in Zebrafish. [score:4]
Of note, the knock-down of miR-29 family in zebrafish transgenic animal embryo by expression of a specific sponge (miR-29-sponge) [35] compromised cardiac function and morphology, enhancing both fibrosis and global DNA methylation. [score:4]
Genes regulated by miR-29 depletion ( ± 0.5 log2 fold change, basemean > 5, fdr < 0.05) derived from mRNASeq of zebrafish samples were imported into the Ingenuity Pathways Analysis Software (Qiagen - Version 39480507) to reveal top disease affected categories by genetic networks. [score:4]
Biological function gene ontology of up-regulated genes in miR-29-sponge Zebrafish hearts (red bars). [score:4]
Given the up-regulation of miR-29 during aging in multiple organs, this protective action could represent a general phenomenon. [score:4]
List of genes is provided also in supplemental table  5. (B) Volcano plot of differentially regulated genes expressed in the heart of Wild Type and miR-29-sponge Zebrafish. [score:4]
Figure 3Age -dependent miR-29 family up-regulation affects collagen and methylation levels in N. furzeri heart. [score:4]
Despite age -dependent upregulation, antagonism of miR-29 exacerbates brain aging indicating that miR-29 has a protective role in neurons [35]. [score:4]
Intriguingly, after treatment with H [2]O [2], the transcripts coding for miR-29 target genes, including col1a1, col11 and dnmt1, dnmt3a and dnmt3b, were down regulated while NAC partially restored their normal mRNA levels (Fig.   4 panels B and C). [score:4]
Moreover, gene ontology analysis of biological functions obtained by Gene set enrichment analysis (GSEA) pointed out an up-regulation of cellular response to stress and methylation (Fig.   7 panel D; red bar graph) as well as a down-modulation of response to oxidative stress and cardiac morphology and functions (Fig.   7 panel D; blue bar graph), which fully correlate with our experimental evidences on miR-29 sponge fish in comparison to Wild Type. [score:4]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Myocardial infarction, in fact, induces a down-regulation of miR-29 which event, in turn, is partially responsible for fibrosis [43]. [score:4]
MiR-29 family, one of the most upregulated miRNAs, was further evaluated for its well-known role during aging and cardiovascular diseases. [score:4]
Interestingly, these miRNAs control the expression of collagen genes and are themselves controlled by TGF-β [44] suggesting for a direct link between miR-29 family and the progress of inflammatory responses. [score:4]
Figure 9Hypoxia affects miR-29 family and its related targets. [score:3]
Similarly, expression of miR-29 counteracts age -dependent oxidative damage in the brain [35]. [score:3]
Figure 4Oxidative stress affects miR-29 family and its targets. [score:3]
Of note, exogenous expression of miR-29a/b mimics rescued the hypoxic and fibrotic phenotype (Fig.   9 panel B) suggesting a possible protective role of miR-29 family to counteract hypoxia-related collagen deposition and consequently fibrosis. [score:3]
Noteworthy, transfection of miR-29a or miR-29b mimics or treatment with the DNMT inhibitor RG108 significantly protected cardiac cells from the detrimental effects of hypoxia. [score:3]
Oxidative stress induces expression of microRNA-29 family. [score:3]
Upon miR-29 knockdown, no significant changes were detected in terms of survival during the first year of age (data not shown). [score:2]
Ingenuity pathway analysis on genes regulated by miR-29 depletion ( ± 0.5 log2 fold change, basemean > 5, fdr < 0.05) revealed a predicted activation of the hypertrophic response in miR-29 sponge fish, perfectly fitting with the observed cardiac phenotype (Fig.   7 panel C). [score:2]
Interestingly, 350 transcripts were found up regulated in the miR-29-sponge compare to Wild type hearts (suppl. [score:2]
Taken altogether, these data suggested that miR-29 family is regulated by ROS. [score:2]
In the cardiovascular system, miR-29 family has multiple roles: i) is known to be involved in atrial fibrillation [69]; ii) may act as a negative regulator of fibrosis counteracting miR-21 function 43, 70, 71; iii) controls cardiomyocytes apoptosis and aortic aneurism formation 30, 72. [score:2]
In addition, miR-29 has been described to be up regulated during cardiac aging in mouse [30]. [score:2]
In the present study, by using human cardiac fibroblasts, we demonstrated for the first time that miR-29 family is regulated by oxidative stress level. [score:2]
To further explore the effect of miR-29 family depletion on the cardiac molecular phenotype, RNA sequencing (RNA-seq) was performed on the whole heart of wt and miR-29-sponge fish. [score:1]
Calibration bar = 1 mm (B) Representative echocardiography of Wild Type (left panels) and miR-29-sponge (right panels) Zebrafish hearts showing end-diastolic area (EDA; first and third panel) and end-systolic area (ESA; second and fourth panel) Calibration bar = 1 mm. [score:1]
Hence, we propose here that the physiological accumulation of oxidative stress during aging may control miR-29 family establishing a protective mechanism to limit cardiac fibrosis. [score:1]
Figure 8Hypoxic markers accumulate in miR-29-sponge Zebrafish hearts. [score:1]
This evidence prompted us to investigate miR-29 family expression in cardiac fibroblasts maintained in the presence of 1% O [2], the standard in vitro hypoxic condition. [score:1]
Specifically, miR-29 sponge fish showed a FAC of 16%, whereas control animals had values of about 30% (Fig.   5 panel D). [score:1]
For long RNA sequencing, RNA was isolated from 3 zebrafish hearts for each condition (wt and miR-29-sponge) using the miRNeasy micro Kit (Qiagen) combined with on-column DNase digestion (DNase-Free DNase Set, Qiagen) to avoid contamination by genomic DNA. [score:1]
In order to assess cardiac function in Wild type and miR-29-sponge zebrafish, animals were anesthetized with low-dose tricaine solution (0.04 mg/mL) and placed in a Petri dish filled with a custom-made sponge, with the ventral side upward. [score:1]
HCFs were transfected by Lipofectamine RNAiMAX Transfection Reagent (Life Technologies) according manufacture’s instruction with miRVana miRNA mimic for hsa-miR-29a-3p, hsa-miR-29b-3p or scramble (Ambion). [score:1]
In these experiments, we detected a transient down-modulation of miR-29a and miR-29b leading to collagen deposition and fibrosis, a molecular scenario similar to that observed in the heart of the miR-29-sponge transgenic fish. [score:1]
To investigate the effect of hypoxia on miR-29 family and its targets, HCFs were exposed to 1% O [2] concentration for 48 hours. [score:1]
The sensitivity of miR-29a and miR-29b to O [2] reduction was confirmed also by pri-miR-29 analysis. [score:1]
In this perspective, miR-29 family members are of particular interest for cardiac pathophysiology. [score:1]
miR-29 family resulted sensitive to 200 µM H [2]O [2] already after 24 h of treatment (Figure  S2 panel A and Fig.   4 panel A). [score:1]
Specifically, supplemental figure  S4 panel C shows a significant decrease of pri-miR-29a/b after hypoxia whereas the level of pri-miR-29b/c remained stable. [score:1]
Morphologically, we found a significant cardiac spherization in fish injected with miR-29-sponges detectable by 2D-echo analysis (Fig.   5 panel B) and visible hypertrophy that were confirmed by histological examinations (Fig.   5 panel E). [score:1]
Indeed, our results suggest that the miR-29 family strongly affects gene transcription possibly via age-associate DNA methylation changes in Nfu. [score:1]
Because of its biological relevance in cardiac pathophysiology, we focused our attention on miR-29 family. [score:1]
Moreover, miR-29 family play a role during DNA methylation / demethylation control [57] and cellular reprogramming [58]. [score:1]
Hematoxylin/eosine-stained sections were prepared to visualize ventricle of wt and miR-29-sponge zebrafish. [score:1]
To investigate the potential relationship between the accumulation of ROS in the heart (see Fig.   1 panels D and E) and the increase in miR-29 family member expression (Fig.   3 panel A), differentiated H9C2 rat cardiomyoblasts and human cardiac fibroblasts (HCF) were exposed to H [2]O [2] [46]. [score:1]
Hypoxia induces hypermethylation and fibrosis by miR-29 family down-modulation. [score:1]
Figure 7Identification of miR-29 associated cardiac transcriptome. [score:1]
Calibration bar = 25 µm (B) Collagen deposition quantification in sections derived from Wild Type (black circles; n = 8) and miR-29-sponge (gray squares; n = 8) Zebrafish hearts. [score:1]
[1 to 20 of 64 sentences]
22
[+] score: 187
Translational Inhibition of Collagens Expression in a Chondrogenic Cell Line Stably Overexpressing miR-29b. [score:9]
These data suggest that miR-29b targets mainly COL2A1 in chondrocyte and induces translational suppression. [score:7]
Noteworthy, mutation of the target sequence in the COL2A1 3′-UTR completely reversed the decreased luciferase activity provoked by pre-miR-29b whereas a partial reversal was observed for mutations of the two COL1A2 3′-UTR target sequences. [score:7]
Such possible translational suppression is consistent with the weak inhibitory effect reported for miR-29b on COL1A1 mRNA level in the IMR-90 lung fibroblast cell line, which contrasted the 3- to 5-fold variations observed at the protein level [71]. [score:7]
Sox-9, a master regulator of chondrocyte differentiation [61], was shown to downregulate miR-29b both during chondrogenesis from a murine mesenchymal stem cell line [43] and when it was transiently overexpressed in human SW1353 chondrosarcoma cell line [53]. [score:7]
Although miR-29b was shown to downregulate mRNAs for COL2A1 in mouse chondrocytes [43], for COL1A1 in MC3T3 osteoblasts [66], and for COL1A1 and COL3A1 in human aortic smooth muscle and adventitial fibroblasts [70], we report increased levels of COL2A1 and COL1A2 mRNAs in ATDC5 cells overexpressing miR-29b. [score:6]
These data show that in our experimental conditions a doubling of miR-29b level was sufficient to misregulate collagen synthesis in ATDC5 cells and suggests that collagen type II dysregulation was related to the translational step rather than to the transcriptional one, or to mRNA stability. [score:5]
Amongst the 3′-UTRs of mRNAs known to be expressed in human OA chondrocytes [40– 42], the 3 algorithms confirmed those encoding chains of the fibrillar collagens COL2A1 (collagen type II, α1[II]), COL1A1 (collagen type I, α1[I]), and COL1A2 (collagen type I, α2[I]) as possible targets of the miR-29b seed sequence. [score:5]
Control experiments showed a significant expression of mature miR-29b in our system (Figure 3(c)) and no significant decrease of the mRNA level of the chimeric transcripts Luc::hCOL2A1 upon miR-29b overexpression (Figure 3(d)). [score:5]
In conclusion, this work demonstrates that miR-29b is overexpressed in dedifferentiated and OA chondrocytes and targets selectively COL2A1 over COL1A2 but not COL10A1. [score:5]
We found a significant increase of miR-29b expression in human OA chondrocytes that was consistent with its ability to target COL2A1 very efficiently and COL1A2 partially, while leaving COL10A1 unaffected in the luciferase assays. [score:4]
In contrast, a significant 1.3- to 1.7-fold decrease of luciferase activity was observed for hCOL1A2 3′-UTR with the less marked reduction being noted for the dual mutation of miR-29b putative target sequences (Figure 4(b)). [score:4]
By acting probably as a posttranscriptional regulator with a different efficacy on COL2A1 and COL1A2 expression, miR-29b can contribute to the collagens imbalance associated with an abnormal chondrocyte phenotype. [score:4]
As the other collagens studied are poorly affected, our data strongly support a contribution of miR-29b upregulation to the loss of the differentiated chondrocyte phenotype associated with OA. [score:4]
Direct Targeting of Human Chondrocyte Collagens mRNAs-3′-UTRs by miR-29b. [score:4]
This result demonstrates that COL2A1 is a main direct target gene of miR-29b. [score:4]
Altogether our data are consistent with miR-29b upregulation being associated with an overall loss of the dedifferentiated chondrocyte phenotype. [score:4]
Therefore, our data are consistent with miR-29b being a negative regulator of collagen type II expression in chondrocytes. [score:4]
We therefore focused our effort on miR-29b although we cannot exclude that changes in miR-29a and miR-29c expression could have been observed using the more sensitive RT-qPCR technique for their screening. [score:3]
Generation of microRNA-29b Overexpressing ATDC5 Stable Transfectants. [score:3]
Using the ATDC5 chondrogenic cell line we also demonstrated that the stable overexpression of pre-miR-29b reduced the synthesis of fibrillar collagens while provoking a major accumulation of COL2A1 and a weak accumulation of COL1A2, but neither of COL1A1 nor of COL10A1, mRNAs. [score:3]
In silico analysis suggested 3′-UTRs of human COL1A2 and COL2A1, but not of COL10A1, as putative targets of miR-29b-3p with the highest probability score obtained for the miR-29b-hCOL2A1 pair. [score:3]
A control experiment confirmed that miR-29b expression was doubled in the stably transfected cells (Figure 5(c)). [score:3]
The pcDNA3.1-pre-miR-29b and pcDNA3.1-pre-miR-199a (chosen as a IL-1 responsive control) plasmids were used to express miR-29b and miR-199a from their human precursors, hsa-pre-miR-29B1 (81 bp sequence, referred to as MI0000105 in miRbase v17) and hsa-pre-miR-199a-1 (71 pb sequence, referred to as MI0000242 in miRbase v17), respectively. [score:3]
Noteworthily, no target sequence for miR-29b was identified in the 3′-UTR of COL10A1 mRNA. [score:3]
As day 14 corresponds to the exponential phase of chondrogenesis and collagen type II synthesis in the ATDC5 cell line [37], the accumulation of COL2A1 mRNA strongly suggests its reduced translation efficiency by miR-29b. [score:3]
Moreover, COL1A2 was chosen over COL1A1 because it was more affected by miR-29b overexpression in hepatic stellate cells [44]. [score:3]
Using the RT-qPCR technique, the expression of miR-29a, miR-29b, and miR-29c was reported to be increased in both chondrocytes from OA patients and femoral cartilage of mouse in the hip avulsion injury mo del [53]. [score:3]
Amongst the 43 miRs varying in either IL-1 β -induced or subculture -induced chondrocyte dedifferentiation, we focused on miR-29b, which is known to target various collagens thereby contributing to fibrosis of soft tissues [26]. [score:3]
MiR-29b was shown previously to target directly COL2A1 mRNA-3′-UTR in mouse mesenchymal stem cells [43] and COL1A1 and COL1A2 mRNA-3′-UTRs in hepatic stellate cells [44]. [score:3]
Identification of Putative mRNA Targets of miR-29b in Chondrocytes. [score:3]
This cell type was chosen because of its low level of expression of both miR-29b and collagens mRNAs (data not shown). [score:3]
Reporter assays showed that miR-29b targeted COL2A1 and COL1A2 3′-UTRs although with a variable recovery upon mutation. [score:3]
Increased Expression of miR-29b in Human OA Chondrocytes. [score:3]
However, a differential expression of miR-29 members has been reported [55] as a consequence of transcription of their precursors from two distinct genomic loci and variable posttranscriptional degradation [58]. [score:3]
Indeed, miR-29b level increased in both mo dels of chondrocyte phenotype loss and it is thought to target several collagens in soft [26] or hard [43, 53] tissues. [score:3]
Therefore, the subcellular localization and availability of mature miR-29b into the chondrocyte might greatly differ between both techniques with a subsequent impact on the probability of miR-29b to pair with target sequences in the 3′UTR of collagens mRNAs. [score:3]
Members of the miRNA-29 family are highly conserved between human, mouse, and rat and the identity of their seed regions suggests large overlapping of their mRNA target sites [54]. [score:3]
Potential miR-29b targets identified in silico in 3′-UTRs of collagens mRNAs were tested with luciferase reporter assays. [score:2]
Therefore the amount of COL2A1 to be targeted by miR-29b was likely much higher in our stably transfected ATDC5 cells than in the transiently transfected cells of Yan et al. The major increase of COL2A1 mRNA and the weak increase of COL1A2 but not of COL10A1 mRNAs were in line with the efficacy of premiR-29b in our luciferase assay. [score:2]
Taken together, these data strongly suggest that miR-29b interacted directly with the 3′-UTR of human COL2A1 mRNA and less markedly with the 3′-UTR of COL1A2. [score:2]
As shown in Figure 5(a), ATDC5 cells overexpressing miR-29b exhibited a decreased Sirius red staining compared to controls, whatever the culture system used during chondrogenic differentiation. [score:2]
Constructs for Luciferase Reporter Assays and microRNA-29b Expression. [score:2]
Although we did not perform gain- or loss-of-function experiments in chondrocytes, the increased level of miR-29b in both mo dels of chondrocyte phenotype loss has to be considered with the known changes of collagens expression in these mo dels. [score:2]
Mutant plasmids for hCOL1A2 or hCOL2A1 3′-UTRs were produced by PCR-directed mutagenesis of the putative miR-29b seed sequences (Figure 4(a)). [score:2]
When the cotransfection assay was repeated with pGL3-Luc plasmids mutated in their putative target sequences for miR-29b (Figure 4(a)), no significant loss of luciferase activity was detected for hCOL2A1 3′-UTR (Figure 4(b)). [score:2]
Firstly, we performed a stable transfection to induce endogenous pre-miR-29b production and not a transient transfection with a miR-29-a/b mimic. [score:1]
Thus, further studies are required to investigate whether the control of COL2A1 by miR-29b depends on Sox-9 expression changes in chondrocytes. [score:1]
HeLa cells were transfected with 500 ng of pGL3-Luc::hCOL2A1, pGL3-Luc::hCOL1A2, or pGL3-Luc::hCOL10A1 plasmid and 500 ng of pcDNA3.1-pre-miR-29b or pcDNA3.1-pre-miR199a or empty pcDNA3.1 and 5 ng of the pRL plasmid encoding Renilla luciferase (Promega) using EXGEN500™ (Euromedex) in 12-well plates. [score:1]
We showed that miR-29b level increased in a panel of OA patients matched for age, sex, and BMI with non-OA controls. [score:1]
A more precise estimation of the miR-29b level in our cell mo dels was performed by quantitative RT-PCR. [score:1]
Control plasmids were produced containing the putative miR-29b seed sequences in a reverse orientation (antisens, AS). [score:1]
Moreover, by microarray analysis, only miR-29b was reported recently to increase very early (day 1) in the knee joints of mouse induced for OA by destabilization of the medial meniscus (DMM) [53]. [score:1]
Undifferentiated ATDC5 cells were transfected with 500 ng of empty pcDNA3.1 or pcDNA3.1-pre-miR-29b using EXGEN500 (Euromedex). [score:1]
Based on the collagens switch wi dely reported either in dedifferentiated [50] or OA [32] chondrocytes, we next focused our studies on miR-29b. [score:1]
Nonetheless, changes of miR-29b level in joint tissues may have some pathological relevance to the OA joint since miR-29b was also reported to promote osteoblast differentiation [66] and to favour mineral deposition in cells achieving terminal differentiation [67] and possibly cellular senescence [68]. [score:1]
However, there was a large scattering of miR-29b levels and we failed to find any correlation with collagen type II or type I or X mRNA levels in OA chondrocytes. [score:1]
A major consequence is that the miR29-a/b mimic was probably mainly located in the cytoplasm, whereas the overproduced pre-miR-29b recapitulates the physiological processing of miR-29b from the nucleus. [score:1]
As the level of miR-29b was enhanced in our in vitro mo dels of phenotype loss, we anticipated that miR-29b might contribute to the abnormal collagens profile reported in OA chondrocytes. [score:1]
Then, we checked for the direct interaction of human miR-29b with the 3′-UTRs of human COL2A1 and COL1A2 in HeLa cells, using a 3′-UTR luciferase -based reporter assay and COL10A1 as a “negative” control (Figure 3(a)). [score:1]
Recombinant plasmids encoding either the human pre-miR-29b (pcDNA3.1-pre-miR-29b) or the pcDNA3.1-empty vector as a negative control were used to generate stably transformed chondrogenic ATDC5 cell lines. [score:1]
Our data led us to suggesting that miR-29b could, at least in part, contribute to the control of the collagen switch in chondrocyte. [score:1]
[1 to 20 of 62 sentences]
23
[+] score: 170
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2, hsa-mir-29c
By comparing the expression levels of 96 candidate target genes before and after miR-29b treatment, we found 75 genes that showed significant changes (p < 0.05) of either increased expression (10 genes) or decreased expression (65 genes). [score:9]
Direct inhibition of SPARC by miR-29b is annotated with a solid line Similar to other cancer types, it has been theorized that GBM arises from neural stem cells (NSCs) that undergo genetic mutations in tumour suppressor genes and oncogenes [17]. [score:7]
The brain-enriched miR-29 subfamilies are known to be exclusively expressed in the developing brain, and they are aberrantly down-regulated in GBM. [score:6]
In the present study, we showed that the restoration of down-regulated miR-29b in GBM cells exerts anticancer effects by inhibiting cell cycle arrest. [score:6]
Direct inhibition of SPARC by miR-29b is annotated with a solid line We used open source miRNA profiling data from 2 previously published studies to compare the levels of expression of miR-29b between GBM and normal brain tissues [13, 14]. [score:6]
Log2(FC) indicates log2(fold change of non-tumour brain tissues to GBM) Fig.  1Comparison of miR-29b expression levels between glioblastoma (GBM, n = 9) and normal brain tissues (Normal, n = 6) showing significant down-regulation of miR-29b in GBM (p = 0.02). [score:6]
a Endogenous expression of miR-29b in A172, which is successfully overexpressed after transfection of miR-29b. [score:5]
Overall, miR-29b acts as a tumour suppressor, which can inhibit cell growth and induce apoptosis in vitro. [score:5]
Another study showed that miR-29b exerts a critical suppressive role on colorectal cancer mediated by the inhibition of Tiam1 and EMT [23]. [score:5]
Expression of miR-29b is suppressed in GBM. [score:5]
Error bars represent the mean ± SEM for n > 3. Significance was determined using Student’s t test To elucidate miR-29b target genes in GBM, we analysed A172 cells using the Human miR-29 Targets RT [2] Profiler PCR Array (QIAGEN #PAHS-6012Z) (Additional file 1: Table S3). [score:5]
Among them, SPARC was found to be of particular interest, as its expression was remarkably reduced (21.14-fold decreased) after miR-29b treatment from being highly expressed in the GBM cell line. [score:5]
Using PCR array, we found that exogenous miR-29b inhibits the expression of COL1A2, COL3A1, COL4A1, ELN, ITGA11, MMP24, and SPARC, which mediates an anticancer effect. [score:5]
miR-29b was found to be significantly down-regulated in GBM (Fig.   1, log [2] (Normal/GBM) = 1.34, p = 0.02, FDR = 0.06). [score:4]
This study aims to elucidate the role of miR-29b in GBM development and the feasibility of therapeutic targeting using conjugated nanoparticles. [score:4]
We have previously shown that miR-29b plays a pivotal role in neurogenesis by regulating the inhibitor of β-catenin and T cell factor (ICAT) -mediated Wnt/β-catenin signalling in NSCs, which impacts their self-renewal and proliferation [9]. [score:4]
Here, we demonstrate that miR-29b is a tumour suppressor that is deregulated in GBM, and its restoration can exert an anti-cancer effect. [score:4]
Targets of miR-29b in GBM cells. [score:3]
miR-29b may serve as a putative therapeutic molecule when its expression is restored using a nanoparticle delivery system in GBM. [score:3]
a Volcano plots showing miR-29b targeted genes analysed with a PCR array using naïve- and miR-29b -treated A172 cells. [score:3]
We used open source miRNA profiling data from 2 previously published studies to compare the levels of expression of miR-29b between GBM and normal brain tissues [13, 14]. [score:3]
For RNA interference, non -targeting control siRNA (#D-001610-01-05, Dharmacon, Lafayette, CO, USA) and syn-hsa-miR-29b-3p (#MSY0000100, Qiagen, Hilden, Germany) were purchased, and Lipofectamine [®] RNAiMAX Reagent (#13776-150, Invitrogen, Carlsbad, CA, USA) was used to transfect cells. [score:3]
After confirmation of miR-29b expression levels in GBM tissues by analysis of open source data, the anticancer effect of miR-29b was tested by the introduction of syn-hsa-miR-29b-3p in the A172 GBM cell line. [score:3]
This is in line with a previous study on breast cancer cells showing that C1QTNF6, SPARC, and COL4A2 were targeted by miR-29b [22]. [score:3]
Among the possible functional mediators of miR-29b, SPARC is of particular interest, as its expression was remarkably reduced after miR-29b treatment in GBM. [score:3]
miR-29b may be used as a therapeutic molecule when its expression is restored, which indicates its potential role in the molecular therapy of patients with GBM. [score:3]
Based on our previous study, we focused on miR-29b for its function in inhibiting the self-renewal and proliferation of neural stem cells, which can significantly affect neurogenesis [9]. [score:3]
Expression of miR-29b was followed by a significant induction of apoptosis and S-phase arrest in A172 cells, while the fraction of G1 and G2/M phase remained unaltered (Fig.   2e). [score:3]
A normalized count of miR-29b from open source miRNA-seq data was used [13, 14] Introduction of miR-29b into A172, a PTEN -deficient GBM cell line, showed successful overexpression (Fig.   2a). [score:3]
To identify the targets of human miR-29b in GBM cells, we performed polymerase chain reaction (PCR) using the RT [2] Profiler™ PCR Array kit (#PAHS-6012Z, SA Biosciences, Frederick, MD, USA). [score:3]
Among the microRNAs that are known to be deregulated in GBMs, miR-29b attenuates stemness in NSCs during brain development [9]. [score:3]
Expression of miR-29b significantly induced apoptosis (R4, 19.6%), and S-phase cell cycle arrest (R2, 12.82%) in A172 cells. [score:3]
To screen the miR-29b expression levels in GBM tissues, we curated and combined the open source data from two previous studies comparing GBM tissues (n = 9) and non-tumour brain tissues (n = 6) using miRNA-seq [13, 14]. [score:3]
Also, miR-29b is generally recognized as a fundamental regulator of EMT [5]. [score:2]
Therefore, we postulated that there might be a certain role of miR-29b in brain tumour development considering the similarity of tumour progenitor cells with neural stem cells. [score:2]
Introduction of nanoparticle loaded with miR-29b exerts anti-cancer effects on GBM-derived tissues in culture. [score:1]
Insignificant changes were observed in fractions representing G1-phase (R1), and G2/M-phase (R3) We cultured GBM tissue slices (n = 3) for testing the anticancer effects of miR-29b ex vivo. [score:1]
Cell cycle analysis showed a significant S-phase arrest after miR-29b treatment (Fig.   2d). [score:1]
While miR-29a localizes to the cytoplasm, miR-29b and miR-29c are found in the nucleus [10, 11]. [score:1]
In brief, 80 μl of InViVojection™ reagent was mixed with 10 μl of 10× PBS in the dark, and 10 μl of miR-29b (100 μM stock) or control siRNA was added. [score:1]
FACS analysis with Annexin V staining revealed a marked increase in the apoptotic cell fraction after miR-29b treatment (Fig.   2b). [score:1]
Fig.  4Mediators of the effects of miR-29b on glioblastoma cells. [score:1]
Accumulating evidence has shown that the miR-29 family is involved in multiple cancer types [5]. [score:1]
Based on our previous study, we investigated miR-29b for its function in inhibiting the self-renewal and proliferation of neural stem cells, which can significantly affect neurogenesis [9]. [score:1]
Although the induction of apoptosis is the predominant anti-cancer role of miR-29b, analysis of the mediators of the miR-29b effect suggests that diverse mechanisms can contribute to tumour suppression, which need to be evaluated in the future. [score:1]
The LIVE/DEAD cell staining confirmed a decrease in the viability of the miR-29b -treated cells (Fig.   2c). [score:1]
An established human-derived GBM tissue slice culture system confirmed the anticancer effect of miR-29b-conjugated nanoparticles. [score:1]
Restoration of miR-29b induces cell death and growth arrest in a GBM cell line. [score:1]
a Transmission electron microscopy (TEM) images of cultured tissues showing incorporation of nanoparticles loaded with miR-29b (arrow). [score:1]
Glioblastoma miR-29b Anti-cancer effect Nanoparticle Glioblastoma multiforme (GBM) is known as one of the most fatal forms of brain cancer in humans, with an average survival duration of approximately 14 months [1]. [score:1]
Fig.  2Anticancer effects of miR-29b on the A172 cell line. [score:1]
, Seoul, Korea) for the delivery of control siRNA and miR-29b into tissue slice cultures according to the manufacturer’s instructions. [score:1]
A total of 1 × 10 [5] A172 cells were plated in 6-well dishes and incubated with 30–50 nM control siRNA or syn-hsa-miR-29b-3p with Lipofectamine [®] RNAiMAX Reagent according to the manufacturer’s protocol for 3 days at 37 °C. [score:1]
The delivery of miR-29b into cancer cells in cultured tissue could be effectively achieved using nanoparticles (Fig.   3a). [score:1]
b Restoration of miR-29b induces apoptosis in more than 50% of cells as shown by FACS analysis with Annexin V staining. [score:1]
In vitro studies of cell viability and apoptosis and ex vivo study using GBM tissue slice cultures from 3 patients and nanoparticle delivery of miR-29b were performed. [score:1]
In humans, the genetic loci encoding miR-29 consist of two gene clusters, the miR-29a/b-1 locus on chromosome 7q32 and the miR-29b-2/c locus on 1q23. [score:1]
We discovered an increase in apoptotic cell populations with the introduction of miR-29b in the GBM cell line. [score:1]
In brief, 5 × 10 [4] A172 cells were seeded onto a 0.1% gelatine-coated slides, and 20 μM syn-hsa-miR-29b-3p was added to a final concentration of 30–50 nM. [score:1]
Fig.  3Anticancer effects of miR-29b on glioblastoma tissue slice cultures. [score:1]
d Cell cycle analysis by quantitation of the DNA content showing significant S phase arrest (p < 0.05) in miR-29b -treated cells. [score:1]
There was a marked decrease in proliferation and significant increase in apoptosis after miR-29b treatment (Fig.   3b, c). [score:1]
[1 to 20 of 62 sentences]
24
[+] score: 168
We here demonstrate that synthetic miR-29b mimics specifically bind the 3'UTR of DNMT3A and DNMT3B, resulting in downregulation of both DNMTs at mRNA and protein level; conversely, miR-29b inhibition by antagomiRs led to increased DNMTs expression levels. [score:8]
Our results are in line with previous reports showing that enforced expression of miR-29b reduces global DNA methylation in AML and NSCLC cells, restoring the expression of methylation-silenced tumor suppressor genes (TSGs). [score:7]
SKMM1 cells were stably transduced with a lentiviral vector carrying the antagomiR-29b; miR-29b levels after transduction are reported in Supplemental Fig. 2. Of note, miR-29b inhibition indeed led to up-regulation of both DNMT3A and DNMT3B protein levels, as assessed by western blotting analysis (Fig. 2D, right panel). [score:6]
On the basis of these findings we investigated whether miR-29b inhibition could up-regulate de novo DNMTs expression. [score:6]
We observed significant tumor growth inhibition (p<0.05) in mice treated with miR-29b mimics, together with 2-fold increase of miR-29b levels (Fig. 5D) and down-regulation of both DNMT3A and DNMT3B mRNA levels (Fig. 5E) as assessed by qRT-PCR analysis of the excised tumors. [score:6]
In conclusion, we provide evidence that miR-29b controls the methylation profile of MM cells suggesting that miR-29b down-regulation may play a relevant role in MM pathophysiology by reducing TSGs expression. [score:6]
It was possible to conclude that miR-29b is a direct regulator of DNMT3A and DNMT3B expression in MM cells. [score:5]
Moreover, synthetic miR-29b mimics potentiated the growth -inhibitory effects of the DNMT -inhibitor 5-azacitidine [47], suggesting new strategies based upon DNA-demethylating agents/miRNAs combination in the treatment of MM. [score:5]
Raw microarray expression levels for DNMT3A, DNMT3B and miR-29b are reported in Supplemental Fig. 4. Notably, such integrated analysis highlighted an inverse correlation between miR-29b and DNMT3B expression levels (p=0,0012), whereas no correlation between miR-29b and DNMT3A could be demonstrated (Fig. 3). [score:5]
Indeed, bioinformatic analysis revealed that DNMT3A and DNMT3B are miR-29b targets, according with previous studies which reported the ability of members of the miR-29 -family to target DNMTs in solid tumors and AML [24, 38]. [score:5]
In silico search for target prediction [31, 32] indicates that both DNMT3A and DNMT3B are bona fide targets of miR-29b. [score:5]
As shown in Fig. 5A, repeated intratumor injection of NLE-formulated synthetic miR-29b (1mg/Kg; 5 injections, 3 days apart), significantly inhibited growth of MM xenografts. [score:3]
miR-29b targets de novo DNMTs in MM cells. [score:3]
In our experimental mo del, in vitro transfection of synthetic miR-29b mimics in MM cells promoted apoptosis and cell cycle perturbations, and similar effects were observed when DNMT3A and DNMT3B were silenced by shRNAs, just confirming the thought that these enzymes are valuable targets for anti-tumor treatment. [score:3]
Figure 3 Correlation of endogenous miR-29b levels with DNMT3A (A) and DNMT3B (B) mRNA levels determined by high density microarray of mRNA and miRNA expression in a panel of 17 MM cell lines. [score:3]
To obtain MM cells stably expressing antagomiR-29b, we used the lentiviral vector miRZip29b anti-miR-29b construct (System Biosciences); lentiviral particles production and transduction were performed according to the above indicated protocols. [score:3]
In order to additionally support the clinical translation of our experimental approach, we also studied the in vivo activity of miR-29b mimics using the novel SCID- synth-hu mo del of human MM [29]. [score:3]
Importantly, the growth -inhibitory effect well correlated with miR-29b accumulation in tumor tissues (Fig. 5B), as assessed by q-RT-PCR in retrieved xenografts. [score:3]
Histological and immunohistochemical analysis of retrieved 3D biopolymeric scaffolds after treatment with synthetic miR-29b showed indeed increased expression of cleaved caspase-3 and reduced Ki-67 (Fig. 6). [score:3]
In vitro transfection of synthetic miR-29b mimics decreased cell growth in a time -dependent manner and potentiated 5-azacitidine anti-proliferative effects at 72 hours (percentage of growth inhibition at 72 hours were 45%, 35% and 65% for miR-29b, 5-azacitidine and combination treatment respectively; Fig. 4B). [score:3]
Correlation of endogenous miR-29b levels with DNMT3A (A) and DNMT3B (B) mRNA levels determined by high density microarray of mRNA and miRNA expression in a panel of 17 MM cell lines. [score:3]
To validate this interaction in MM cells, INA-6 cells were co -transfected with synthetic miR-29b or scrambled oligonucleotides (NC), together with an expression vector carrying the 3'UTR of DNMT3A or DNMT3B mRNA cloned downstream to the luciferase reporter gene. [score:3]
In the present study, we evaluated whether miR-29b could inhibit de novo DNMTs expression. [score:3]
In vivo tumor growth of SKMM1 xenografts intratumorally -treated with NLE (MaxSuppressor [TM] In Vivo RNA-LANCER II)-miR-29b or controls. [score:3]
Tumor suppressive role of miR-29b has been previously reported in solid tumors [24, 44] and haematologic malignancies [45], although it remains controversial in CLL [46]. [score:3]
All together, these findings indicate that miR-29b exerts anti-tumor activity in vivo, providing a strong rationale for clinical development of synthetic miR-29b mimics in MM. [score:2]
Approximately one month later, when sIL6R became detectable in mice sera, NLE-miR-29b or -NC were injected directly into the scaffold (total of 7 injections, 2 days apart). [score:2]
A follow-up study will shade light on TSGs under miR-29b regulation by DNA-methylation control. [score:2]
To investigate the relationship between the miRNA network and de novo DNMTs in MM, we studied the regulatory role of miR-29b on DNMTs expression and global DNA methylation in MM cells. [score:2]
MiR-29b targets DNMT3A and DNMT3B and reduces global DNA methylation levels in MM cells. [score:2]
Interestingly, the integrated analysis of miRNA/mRNA profiling revealed an inverse correlation between miR-29b and DNMT3B in a panel of 17 MM cell lines, underscoring a key role of miR-29b on DNMT3B regulation. [score:2]
Then, we studied the effects induced by synthetic miR-29b mimics, alone or in combination with the demethylating agent 5-azacitidine, on cell growth and cell cycle regulation of MM cells. [score:2]
miR-29b expression was normalized on RNU44 (Applied Biosystems, Assay Id 001094). [score:2]
Notably, miR-29b mimics resulted in epigenetic changes, as demonstrated by an approximately 2-fold decrease in global DNA methylation in MM cells. [score:1]
The global DNA methylation levels of MM cell lines transfected with syntehtic miR-29b mimics or scrambled oligonucleotides (NC) were estimated according to our previous report [33]. [score:1]
Inverse correlation between miR-29b and DNMT3B in MM cell lines. [score:1]
Immunoblot of DNMT3A and DNMT3B 24 hours after transfection of INA-6 with synthetic miR-29b or scrambled oligonucleotides (left panel) or in SKMM1 cells transduced with antagomiR-29b (anti-miR-29b) or the empty vector (right panel). [score:1]
In the present report, we also provide insights into biological effects triggered by synthetic miR-29b mimics in vitro and in vivo. [score:1]
The in vivo anti-tumor potential of miR-29b was demonstrated in different clinically relevant murine mo dels of human MM. [score:1]
Inverse correlation between miR-29b and DNMT3B levels in MM cell lines. [score:1]
P values 72hours after electroporation were obtained using two-tailed t test (P= 0,0039 for NC vs miR-29b; P=0,0028 for NC+AZA vs miR-29b+AZA). [score:1]
Quantitative RT-PCR of miR-29b levels in INA-6 cells transfected with synthetic miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
In vivo analysis of miR-29b-effects in the SCID-synth-hu mo del. [score:1]
NLE-formulated miR-29b or NC were injected in groups of three animals, after detection of sIL6R in the mouse sera. [score:1]
Cell cycle analysis of NCI-H929 cells transfected with synthetic miR-29b mimics or scrambled oligonucleotides (NC) and then treated with 5μM azacitidine (5-AZA) or vehicle for 24, 48 or 72 hours. [score:1]
Figure 2A shows miR-29b levels after transfection. [score:1]
Quantitative RT-PCR of miR-29b levels in retrieved xenografts after intratumor injection of miR-29b mimics or scrambled oligonucleotides. [score:1]
To assess the relevance of the interaction between miR-29b and de novo DNMTs, we analyzed the correlation between miR-29b and DNMT3A or DNMT3B mRNA levels in a panel of 17 MM cell lines. [score:1]
SKMM1 MM cells were injected in a cohort of 15 mice and when tumors became palpable, mice were randomized into 3 groups and treated intratumorally with synthetic miR-29b mimics, miR-NC or vehicle alone. [score:1]
Mice carrying palpable subcutaneous OPM1 tumor xenografts were treated with 20 μg of NLE-formulated miR-29b or scrambled oligonucleotides (NC) by intravenous tail vein injections (arrows indicate the day of injection). [score:1]
GDMi values of U266 and NCI-H929 cells transfected with synthetic miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
In this mo del, delivery of systemic miR-29b mimics induced significant anti-tumor effects, as demonstrated by immunohistochemical analysis of retrieved scaffolds, demonstrating the ability of miR-29b to overcome the protective role of BMSCs. [score:1]
Following 3 injections (3 days apart), a significant anti-tumor effect of NLE-formulated miR-29b was detected (Fig. 5C). [score:1]
In vivo anti-tumor activity of miR-29b mimics after intratumoral or systemic delivery in MM mouse-mo dels. [score:1]
Synthetic miR-29b mimics exert anti-MM activity in vivo. [score:1]
MiR-29b levels after transfection are reported in supplemental Fig. 3. As shown in Fig. 2E, miR-29b transfection resulted in a robust reduction of the global methylation levels of MM cell lines, thus supporting its role in the epigenetic control of MM cells. [score:1]
Our findings demonstrate that the delivery of synthetic miR-29b mimics exerts anti-MM activity in vivo. [score:1]
1×10 [6] cells were electroporated with scrambled (miR-NC) or synthetic pre-miR-29b (miR-29b) at a final concentration of 100nM, using Neon® Transfection System (Invitrogen), with 1050 V, 30 ms, 1 pulse. [score:1]
Data are the average of two independent triplicate experiments performed on two NC and two miR-29b injected animals °P<0,01. [score:1]
Quantitative RT-PCR of DNMT3A or DNMT3B in retrieved xenografts after system injection of miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
Our experimental platform was based on xenografts of MM cells that were exposed to synthetic miR-29b mimics delivered via NLE, a novel lipid -based delivery system. [score:1]
MM cells were electroporated as above described using 10μg of the firefly luciferase report; for each plate, 100 nM of the synthetic miR-29b or miR-NC were used. [score:1]
Moreover, miR-29b mimics appear a promising agent in the treatment of MM, alone or in combination with demethylating drugs. [score:1]
Synthetic miR-29b mimics impair cell cycle progression and potentiate 5-azacitidine effects. [score:1]
Xenografted mice were randomized to receive synthetic miR-29b or miR-NC (1mg/kg per mouse), each formulated with NLE particles, via tail vein. [score:1]
Quantitative RT-PCR of DNMT3A and DNMT3B 24 hours after transfection with synthetic miR-29b or scrambled oligonucleotides (NC) in INA-6 cells. [score:1]
These findings also suggested that miR-29b could induce epigenetic modifications in cancer cells. [score:1]
Data are the average of two independent triplicate experiments performed on two NC and two miR-29b injected animals. [score:1]
Cell growth curves of NCI-H929 cells transfected with synthetic miR-29b (miR-29b) or scrambled oligonucleotides (NC) with 5μM azacitidine (5-AZA) or vehicle (RPMI medium). [score:1]
Data are the average of two triplicate experiments performed on two NC and two miR-29b injected animals. [score:1]
Quantitative RT-PCR of miR-29b levels in retrieved xenografts after system injection of miR-29b mimics or scrambled oligonucleotides (NC). [score:1]
Mice were randomized in 3 groups and treated with synthetic miR-29b mimics or miR-NC or vehicle alone or PBS. [score:1]
In a first mo del, we explored the in vivo anti-tumor potential of miR-29b on MM xenografts in SCID mice by intratumor delivery of synthetic miR-29b -mimics. [score:1]
Palpable subcutaneous tumor xenografts were treated every 3 days (indicated by arrows) for a total of 4 injections, with 20 μg of formulated miR-29b or miR-NC (NC). [score:1]
In vitro transfection of MM cells with synthetic miR-29b. [score:1]
We next explored the potential anti-tumor activity of systemic delivered formulated miR-29b mimics. [score:1]
To achieve an efficient delivery of miR-29b or miR-NC, we formulated synthetic miR-29b -mimics with NLE particles [28], a novel in vivo delivery system for oligonucleotides. [score:1]
In vivo tumor growth of OPM1 xenografts after systemic delivery of miR-29b or scrambled oligonucleotides (NC). [score:1]
Consistently, miR-29b transfection reduced DNMT3A and DNMT3B mRNA (Fig. 2C) and protein levels (Fig. 2D, left panel), as assessed by q-RT-PCR and western blotting analysis. [score:1]
[1 to 20 of 79 sentences]
25
[+] score: 155
As miRNAs downregulate their targets on a posttranscriptional level, we also analyzed HDAC4, CDK6, and SMAD1 protein expression during osteogenic differentiation (up to day 12) of USSC 86b and in response to ectopic expression of miR-26a, miR-26b, and miR-29b in native USSC86b. [score:10]
Detailed data for all experimental validation studies are presented in Additional file 2. In summary, we identified osteo -inhibitory targets for miR-10a, miR-22, miR-26a, miR-26b, and miR-29b with the highest targeting impact resulting from miR-26a, miR-26b, and miR-29b expression. [score:9]
Figure  3 summarizes the results of experimental validations from all 22 predicted miRNA-target interactions: CDK6 was targeted by miR-22, miR-26a, miR-26b, and miR-29b; CTNNBIP1 was regulated by miR-10a and miR-29b; SMAD1 and TOB1 were both recognized by miR-26a and miR-26b; and HDAC4 was targeted by miR-29b. [score:8]
Several miRNAs modulate osteogenic differentiation: miR-125b negatively regulates osteoblastic differentiation through targeting VDR, ErbB2, and Osterix [28, 29]; miR-133 (targeting RUNX2) and miR-135 (recognizing SMAD5) inhibit differentiation of mouse osteoprogenitors [30]; miR-26a and miR-29b facilitate osteogenic differentiation of human adipose tissue-derived stem cells (hADSCs), and positively modulate mouse osteoblast differentiation [31, 32]. [score:8]
Functional analyses demonstrated that miR-26a, miR-26b and miR-29b positively modulate osteogenic differentiation of USSC, most likely by downregulating osteo -inhibitory target proteins. [score:8]
miR-26a/b and miR-29b are upregulated during osteogenic differentiation of USSC and share target genes inhibiting osteogenesis. [score:8]
Consistent with the view that miRNAs regulate networks [38], Table  1 demonstrates target gene redundancy: certain proteins were predicted to be targeted by more than one miRNA and other miRNAs (e. g. miR-29b) putatively regulate up to 11 proteins (Table  1). [score:7]
In the mouse osteoblast mo del, miR-29b is a positive regulator of osteogenic differentiation, able to increase differentiation on ectopic expression, with HDAC4, TGFB3, ACVR2A, CTNNBIP1 and DUSP2 as validated targets [32]. [score:6]
It is likely that miR-26a/b and miR-29b influence a common set of target genes with each miRNA making additional contributions through targeting exclusive genes e. g. HDAC4 and CTNNBIP1, which are regulated by miR-29b but not by miR-26a/b. [score:6]
In Western blot analyses demonstrated that endogenous levels of CDK6 and HDAC4 were downregulated during osteogenic differentiation of USSC and reduced following ectopic expression of miR-26a/b and miR-29b. [score:6]
Since miR-26a/b and miR-29b regulate osteo -inhibitory and osteo-promoting factors in parallel, the osteo -inhibitory effects of CDK6 and HDAC4 likely outweigh the osteo-promoting effects of SMAD1; this finding is further supported by the unaltered abundance of SMAD1 in miR-26a/b transfected USSC. [score:6]
Among these inhibitors, CDK6, CTNNBIP1, HDAC4, TGFB3, and TOB1 were experimentally identified as targets of miR-26a, miR-26b, and miR-29b. [score:5]
miRNA expression profiling followed by target validation indicated that miR-26a, miR-26b, and miR-29b had the highest impact on osteogenic differentiation in our USSC lines. [score:5]
In contrast to osteo-promoting SMAD1, osteo -inhibitory CDK6 protein expression was indeed reduced 48h post transfection with miR-26a, miR-26b, and miR-29b mimics. [score:5]
Our experimental target validations indicate that miR-26a, miR-26b, and miR-29b likely have the strongest impact on osteogenic differentiation of USSC by reducing osteo -inhibitory CDK6 and HDAC4 proteins. [score:5]
Among these putative targets, CDK6, CTNNBIPI, TOB1, and HDAC4 contained the most predicted miRNA binding sites, whereas DUSP2, TGFB3, and SMAD6 each contained a solitary putative miR-29b target site. [score:5]
In summary, we detected a subset of miRNAs, notably miR-26a, miR-26b and miR-29b, which is consistently upregulated during osteogenic differentiation of USSC. [score:4]
CTNNBIP1 was also regulated by miR-10a and CDK6 [45] was targeted by miR-22, miR-26a, miR-26b and miR-29b. [score:4]
miR-22 and miR-29b interacted with fragment CDK6-1. Figure 2 Experimental validation of target gene predictions. [score:3]
miR-22 and miR-29b interacted with fragment CDK6-1. Figure 2 Experimental validation of target gene predictions. [score:3]
We thus tested whether overexpression of miR-26a/b and miR-29b using miRNA mimics influences DAG -induced osteogenic differentiation. [score:3]
Among the most prominently expressed miRNAs were miR-10a, miR-152, miR-22, miR-26a/b, miR-29b, miR-30b/c, miR-345, and miR-532-5p. [score:3]
The most redundant miRNA-target network involved miR-26a/b and miR-29b and, to a lesser extent, miR-22, miR-10a, and miR-137 (Table  1); subsequent analyses focused on these six miRNAs. [score:3]
As with HDAC4, our results confirm that miR-26a, miR-26b, and miR-29b target CDK6. [score:3]
Summarizing results from both CDK6-3 [′]-UTR fragments, significant regulatory miRNA effects were seen for miR-22, miR-26a, miR-26b, and miR-29b, whereas miR-137 had no significant effect. [score:2]
This finding indicates a comparatively strong regulatory influence of miR-26a/b and miR-29b on CDK6. [score:2]
Functional overexpression analyses using microRNA mimics revealed that miR-26a/b, as well as miR-29b strongly accelerated osteogenic differentiation of USSC as assessed by Alizarin-Red staining and calcium-release assays. [score:2]
Here we show a comparable function for miR-29b in osteogenic differentiation of human somatic stem cells confirming human CTNNBIP1 and HDAC4 as miR-29b targets in our HEK293T-cell based validation assay. [score:2]
Similarly, the HDAC4 protein level was reduced upon transfection with miR-29b mimic, consistent with our target validation assays. [score:2]
USSC SA5/73 and USSC 86b were each transfected with (i) a small unspecific negative control RNA, (ii) an equimolar batch of miR-26a and miR-26b, (iii) miR-29b, and (iv) an equimolar batch of miR-26a, miR-26b, and miR-29b mimics (SA5/73 only), each followed by DAG induction. [score:1]
Validations for DUSP2, SMAD6 and TGFB3 failed to give strongly positive results, with TGFB3 only weakly affected by miR-29b. [score:1]
This result is consistent with the observation that miR-29b contributes to osteogenic differentiation of mouse osteoblasts [32]. [score:1]
Alizarin-red staining of native uninduced USSC and DAG -induced cells are shown in comparison to DAG -induced cells transfected with a negative control smallRNA, miRNA mimics miR-26a/b (equimolar batch), miR-29b, and miR-26a/b/29b (equimolar batch). [score:1]
Transfection of USSC SA5/73 with miR-26a/miR-26b/miR-29b mimics further increased differentiation (Figure  6A). [score:1]
The HDAC4 protein level was also reduced following transfection with miR-29b (Figure  5B). [score:1]
Here we identified strong interactions between CDK6-2 and miR-26a and miR-26b and moderate interactions with miR-29b. [score:1]
Functional impact of miR-26a/b and miR-29b on osteogenic differentiation of USSC. [score:1]
Transfection with miR-29b -mimic also resulted in accelerated osteogenic differentiation of both lines (Figures  6A and 6B). [score:1]
We clearly demonstrated the combined functional impact of miR-26a/b and miR-29b, which had individually been identified as modulators of osteogenic differentiation in hADSC [31] and mouse osteoblasts [32]. [score:1]
The strongest effect on osteogenic differentiation was observed by transfecting an equimolar mixture of miR-26a, miR-26b, and miR-29b mimics. [score:1]
Figure 6. Impact of miR-26a/b and miR-29b on osteogenic differentiation on (A, scale bars 200μm) USSC SA5/73 at day 7 and (B, scale bars 500μm) on osteogenic differentiation of USSC 86b at day 7 post induction of DAG -induced differentiation was analyzed. [score:1]
[1 to 20 of 41 sentences]
26
[+] score: 153
By directly targeting the matrix metalloproteinase-2 (MMP-2) expression, miR-29b has been shown to suppress angiogenesis, invasion, and metastasis of HCC in animal mo del and confirmed in clinical samples [33]. [score:8]
In support of this, miR-29b was recently proved to be an epi-miR that targets epigenetic enzymes such as DNA methyltransferases (DNMTs), leading to the re -expression of tumor suppressors [36]. [score:7]
We found that fucoidan increased miR-29b to suppress the DNMT3B, which resulted in the upregulation of MTSS1. [score:6]
Figure 4Fucoidan increases miR-29b to target the 3′-UTR region of DNMT3B and repress its expression in human HCC cells. [score:5]
One important downstream target of miR-29b is the DNMT3B (DNA methyltransferase 3B), which silences tumor suppressors [18]. [score:5]
In HCC, reduced expression of miR-29b was found in clinical samples and significantly associated with worse disease-free survival of patients [14]. [score:5]
MiR-29b is the most highly expressed miR-29 family member (miR-29a/b/c) and its aberrant expression is common in the majority of human cancers [36]. [score:5]
org/) to predict the targets of miR-29b, the result showed that DNMT3B had the highest score and appeared to be a potential miR-29b target gene. [score:5]
Overexpression of miR-29b has also been reported to suppress MMP-2 level in prostate and lung cancer cells [37, 38]. [score:5]
In addition to Myc and NF-κB, miR-29b expression is also suppressed by TGF-β [36]. [score:5]
It has been shown that miR-29b expression suppressed EMT, angiogenesis, migration and invasion in various types of cancers including HCC [19, 33, 34]. [score:5]
The results showed that fucoidan increased the expression of tumor suppressive miRs such as miR-29 family and miR-1224 (Table 1). [score:5]
Many reports demonstrate that miR-29 family exerts various effects in preventing cancer progression and carcinogenesis, such as apoptosis induction [14], cell cycle regulation, epigenetic modification, and metastasis inhibition [15]. [score:4]
As expected, similar and compatible results were observed in these two kinds of HCC cells transfected with miR-29b mimic (Figure 4B), indicating that fucoidan increased miR-29b expression to negatively regulate DNMT3B in HCC cells. [score:4]
Besides inhibiting TGF-β signaling, fucoidan profoundly regulates the miR-29b-DNMT3B-MTSS1 axis. [score:4]
Induction of miR-29b by curcumin to decrease DNMT3B and epigenetically regulate PTEN in hepatic stellate cells was also reported, representing a novel mechanism for the suppression of liver fibrosis [39]. [score:4]
On the other hand, besides the induction of tumor-suppressive miR-29 family, fucoidan also represses the oncogenic miR-17/92 cluster [43], representing its multiple functions in miRs regulation. [score:4]
As such, it is possible that the induction of miR-29b by fucoidan in HCC cells might attribute to the down-regulation of TGF-βR. [score:4]
Furthermore, our results demonstrate that miR-29b directly represses DNMT3B expression by binding to its 3′-UTR region, indicating the repression of DNMT3B by fucoidan in HCC cells is through miR-29b induction. [score:4]
Our results demonstrate the profound effect of fucoidan not only on the regulation of miR-29b-DNMT3B-MTSS1 axis but also on the inhibition of TGF-β signaling in HCC cells. [score:4]
miR-ID Increased Fold-Changes miR-ID Decreased Fold-Changes miR-29b 8.5 miR-17 15.7 miR-29a 7.7 miR-92a 13.6 miR-29c 7.3 miR-18a 12.0 miR-1224 6.6 miR-192 7.2 miR-133b 2.0 miR-127 2.4 miR-200c 1.7 miR-154 1.9 miR-200a 1.4 miR-21 1.7 miR-205 1.3 miR-680 1.3 miR-208a 1.2 miR-377 1.2 miR-669b 1.2 miR-153 1.1 Figure 3Fucoidan increases the expression of miR-29b. [score:3]
Considering the marked activation of miR-29 expression by fucoidan in human HCC cells, we investigated the changes of miR-29b downstream target in fucoidan -treated HCC cells to further delineate the underlying molecular events. [score:3]
miR-ID Increased Fold-Changes miR-ID Decreased Fold-Changes miR-29b 8.5 miR-17 15.7 miR-29a 7.7 miR-92a 13.6 miR-29c 7.3 miR-18a 12.0 miR-1224 6.6 miR-192 7.2 miR-133b 2.0 miR-127 2.4 miR-200c 1.7 miR-154 1.9 miR-200a 1.4 miR-21 1.7 miR-205 1.3 miR-680 1.3 miR-208a 1.2 miR-377 1.2 miR-669b 1.2 miR-153 1.1 Figure 3Fucoidan increases the expression of miR-29b. [score:3]
As shown in Figure 3, the miR-29b expressions in fucoidan -treated normal cell line (L02) and HCC cells were all significantly increased in a dose -dependent manner. [score:3]
Decreased expression of miR-29 has been reported in multiple cancers, including HCC [16, 17]. [score:3]
The increase of miR-29b expression by fucoidan was further confirmed by real-time quantitative PCR. [score:3]
In agreement with the marked increase of miR-29b expression by fucoidan illustrated in Table 1 and Figure 3, the luciferase activity of the wild-type, but not the mutated, DNMT3B 3′-UTR reporter was obviously repressed to around 50% in SK-Hep1 and HepG2 cells after treatment with fucoidan for 48 h (Figure 4B). [score:3]
At a dose of 200 μg/mL, fucoidan induced 3.5-, 8.2- and 6.8-fold increase of miR-29b expression in L02, SK-Hep1 and HepG2 cells, respectively. [score:3]
Ectopically expressing miR-29b enhances epithelial marker E-cadherin and reduces mesenchymal marker N-cadherin in prostate cancer cells [40]. [score:3]
Regarding the important roles of dysregulated miR-29 family and miR-17/92 cluster reported in many cancers [36, 43], nutraceuticals able to regulate these miRs will be attractive for integration into conventional cancer therapy. [score:3]
In accordance with these studies, we find that fucoidan induces miR-29b and suppresses MMP-2 in HCC cells. [score:3]
In agreement with these studies, enhanced E-cadherin and reciprocal reduced N-cadherin were observed in fucoidan -treated HCC cells, suggesting its potential role in miR-29b -mediated EMT inhibition. [score:3]
The miR-29 family consists of miR-29a, miR-29b and miR-29c with shared regulatory capacity. [score:2]
In this study, we explored the effects of fucoidan on the regulation of miR-29b in human HCC cells. [score:2]
We used site-directed mutagenesis to generate pGL3-DNMT3B 3′-UTR-mut, in which miR-29b binding site were replaced with mutant site. [score:2]
For analyzing the expression of mature miR-29b, cDNA was synthesized using sequence-specific primers and the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). [score:2]
The expressions of miR-29b, miR-29a and miR-29c in fucoidan -treated HepG2 cells were increased 8.5-, 7.7- and 7.3-fold, respectively, as compared to the control (Table 1). [score:2]
Further investigation is worth to delineate the association of fucoidan -induced change of TGF-β signaling and miR-29b expression in cancer cells. [score:1]
The DNMT3B 3′-UTR of around 300 bps, which contained miR-29b binding site, was cloned into the downstream region of the luciferase gene to create pGL3-DNMT3B 3′-UTR. [score:1]
Agents able to modulate the miR-29b-DNMT3B-MTSS1 axis may improve the treatment of HCC. [score:1]
L02, SK-Hep1 and HepG2 cells were treated with fucoidan (0, 100 and 200 μg/mL) for 48 h and the relative miR-29b expression levels were measured by quantitative RT-PCR. [score:1]
The 3′-UTR of DNMT3B gene matches the seed sequence of miR-29b, representing the putative binding site. [score:1]
DNMT3B Forward: AGGGAAGACTCGATCCTCGTC Reverse: GTGTGTAGCTTAGCAGACTGG MTSS1 Forward: CAGTCCCAGCTTCGGACAAC Reverse: TGAGAGCAGATCCAATCTCCC E-cadherin Forward: CGAGAGCTACACGTTCACGG Reverse: GGGTGTCGAGGGAAAAATAGG N-cadherin Forward: TCAGGCGTCTGTAGAGGCTT Reverse: ATGCACATCCTTCGATAAGACTG GAPDH Forward: GGAGCGAGATCCCTCCAAAAT Reverse: GGCTGTTGTCATACTTCTCATGG miR-29b Forward: TGGTTTCATATGGTGGTTTA Reverse: ATAACCGATTTCAGATGGTG U6 Forward: GTGCTCGCTTCGGCAGCACATATAC Reverse: AAAAATATGGAACGCTTCACGAATTTG Total RNA was isolated from HepG2 cells treated with vehicle or fucoidan at dose of 200 μg/mL for 48 h. The samples were then analyzed by using Affymetrix GeneChip miRNA 2.0 array (Affymetrix, Santa Clara, CA, USA) containing 4560 probe sets for human small RNAs. [score:1]
To validate the repression of DNMT3B by miR-29b in HCC cells, we created luciferase reporter constructs containing the 300-bp 3′-UTR of DNMT3B (nt 1182–1209 of DNMT3B mRNA) with wild-type or mutated miR-29b -binding site as reported previously (Figure 4A). [score:1]
MiR-29b is generally recognized as an important regulator of EMT, a pathway involved in cancer invasion and metastasis [36]. [score:1]
U6 was used as the internal control for evaluation of miR-29b expression. [score:1]
[1 to 20 of 46 sentences]
27
[+] score: 153
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2, hsa-mir-29c, hsa-mir-339
With these results it was verified that hBACE1 is a direct target of pre-miR-29b (Figs 2, 3 and 4), what was further validated by the downregulation of hBACE1 gene expression by polycations/pre-miR-29b in vitro. [score:9]
We further verified that a single treatment with CS/pre-miR-29b or PEI/pre-miR-29b dramatically decreased the amount of hBACE1 expression (suppressed in 78.5 ± 4.5% and 86.1 ± 1.2%, respectively) and the generation of Aβ [42] peptide (44.2 ± 6.0% and 47.2 ± 11.4%, respectively) by downregulating hBACE1 protein in N2a695 cells (Figs 2, 3 and 5). [score:8]
Our results demonstrated that hBACE1 mRNA levels were also significantly altered following recombinant pre-miR-29b transfection, suggesting a post-transcriptional mechanism that involves direct degradation/destabilization of hBACE1 mRNA and is likely that it promotes inhibition of hBACE1 protein translation. [score:6]
Downregulation of human BACE1 expression induced by polyplex/pre-miR-29b. [score:6]
In addition, in N2a695 cells, pre-miR-29b treatment caused concentration -dependent inhibition of hBACE1 expression (Fig. 3). [score:5]
Hence, according to previous results obtained by our research group 43, we decided to explore the possibility of using polycations -based carrier systems to efficiently deliver the recombinant pre-miR-29b to N2a695 neuronal cell line, to suppress hBACE1 expression. [score:5]
Furthermore, the correlation between hBACE1expression and pre-miR-29b provides further support for the hypothesis that pre-miR-29b contributes, at least in part, to overall changes in hBACE1 expression in AD. [score:5]
Pre-miR-29b inhibits hBACE1 translation and affect hBACE1 mRNA level. [score:5]
Taken together, these data demonstrate effective delivery of recombinant pre-miR-29b to N2a695 cells using polyplexes and that a specific suppression of hBACE1 expression occurs when these polyplexes delivered pre-miR-29b. [score:5]
These findings reinforce the fact that the ability of recombinant pre-miR-29b to regulate endogenous hBACE1 protein expression is likely direct, because it binds to the 3′UTR of hBACE1 mRNA, complementary to the miR-29b seed region (Fig. 4). [score:5]
Previously published studies have demonstrated the importance of using the miR-29 family as a potential major suppressor to silence BACE1 protein expression. [score:5]
To ascertain whether recombinant pre-miR-29b could effectively suppress human BACE1 (hBACE1) expression, we used mouse neuroblastoma (N2a) cells stably transfected with cDNAs encoding human APP695 (N2a695 cells) 44. [score:5]
Once again, these findings indicate that recombinant pre-miR-29b regulates Aβ [42] production through mechanisms dependent of hBACE1 expression. [score:4]
Thus, to directly examine whether recombinant pre-miR-29b also reduces endogenous Aβ [42] levels, the N2a695 cells (Fig. 5A) were transfected according to the best transfection conditions mentioned above (CS/pre-miR-29b and PEI/pre-miR-29b at 8.72/9.9 and 6.32/8.72 nM, respectively) to reduce the expression of hBACE1. [score:4]
Data analysis showed that CS/pre-miR-29b 6.32 nM significantly decreased hBACE1 mRNA expression to 76.4 ± 0.6% (Fig. 4A) relatively to N2a695 cells treated with PEI/pre-miR-29b 8.72 nM (77.9 ± 4.5%), at 72 h of transfection (Fig. 4B). [score:3]
Therefore, endogenous Aβ [42] levels were inhibited by recombinant pre-miR-29b in this neuronal cell line. [score:3]
As a matter of fact, in this study and for the first time, it was demonstrated that the overexpression of recombinant pre-miR-29b induces a marked decrease in the levels of the protein hBACE1 and, consequently, a significant decrease in the level of the endogenous Aβ [42]. [score:3]
With the successful implementation of this methodology and comparing with previously published data (~62% to miR-339-5p 45; ~35% to miR-29c 21; ~50% to miR-29a/b-1 16), we obtained the highest decrease ever reported for the hBACE1 expression levels (around 78% to CS/pre-miR-29b and 86% to PEI/pre-miR-29b) in AD mo del cells. [score:3]
Quantification of fluorescence intensity for BACE1 protein expression in cells transfected with: (B) CS/pre-miR-29b, (C) PEI/pre-miR-29b, and (D) Lipo/pre-miR-29b. [score:3]
According to the results obtained in this study, we developed an integrative platform that allows biosynthesis, purification and transfection of the recombinant pre-miR-29b using polyplexes to decrease the hBACE1 and endogenous Aβ [42] expression levels. [score:3]
On the other hand, 72 h after transfection, hBACE1 protein expression was decreased by approximately 78% in cells transfected with CS/pre-miR-29b, and by 86% in those transfected by PEI/pre-miR-29b complexes (Figs 2 and 3). [score:3]
Recombinant pre-miR-29b modulates Aβ [42] generation in vitroPrevious studies showed a causal relationship between miR-29b expression and BACE1 activity, and, consequently, Aβ peptides generation 16. [score:3]
After 12 h, CS/pre-miR-29b, PEI/pre-miR-29b and Lipofectamine/pre-miR-29b (Lipo/pre-miR-29b) were added to the cells at pre-miR-29b concentration of 3.84 to 9.9 nM and transfection was carried out during 6 h. The culture medium was replaced by fresh medium supplemented with 1% FBS and 1% antibiotic, to allow the cells to remain metabolically active, expressing hBACE1 and Aβ. [score:3]
Therefore, endogenous hBACE1 levels are significantly inhibited by pre-miR-29b delivery in N2a695. [score:3]
How to cite this article: Pereira, P. A. et al. Recombinant pre-miR-29b for Alzheimer´s disease therapeutics. [score:3]
Thus, hBACE1 protein expression was significantly reduced following transfection with both synthetic miR-29b (around 48% reduction) and recombinant pre-miR-29b (around 82% reduction) by comparing with the transfection of untreated cells (Fig. 3C). [score:3]
Previous studies showed a causal relationship between miR-29b expression and BACE1 activity, and, consequently, Aβ peptides generation 16. [score:3]
Thus, the endotoxins level in the final pre-miR-29b sample conforms the gui delines of regulatory agencies like Food and Drug Administration (<0.06 EU/mL for the cerebrospinal fluid). [score:2]
The amount of unbound pre-miR-29b was quantified by UV spectrophotometry 41. [score:1]
The pre-miR-29 loaded polyplexes were formulated using the following conditions: CS/pre-miR-29b with N/P ratio of 30 and to PEI/pre-miR-29b with N/P ratio of 3.5 (see section). [score:1]
Furthermore, it was also performed RT-qPCR for RNA from N2a695 cells transfected with scrambled RNA or with synthetic miR-29b, at 24, 48 and 72 h (Fig. 4C). [score:1]
Our results suggest that recombinant pre-miR-29b can represent a novel biopharmaceutical product for the therapeutic modulation of hBACE1 levels, once this study has new implications for hBACE1 biology and offer a new perspective on the treatment of AD. [score:1]
Effect of recombinant pre-miR-29b on modulation of Aβ levels in N2a695 cells. [score:1]
As expected, RT-qPCR results (Fig. 4) revealed that hBACE1 mRNA levels in N2a695 cells were also significantly reduced after treatment with CS/pre-miR-29b and PEI/pre-miR-29b relatively to untreated cells and cells transfected with the unrelated RNA control (Fig. 4). [score:1]
Western blot analysis of endogenous hBACE1 and β-actin levels in the cell lysate of N2a695 cells treated with different concentrations of pre-miR-29b, at 24, 48 and 72 h.. [score:1]
To accomplish this purpose, we recently described a novel purification methodology based on arginine-affinity chromatography to selectively purify the pre-miR-29b from different RNA species with high recovery yield, purity and good integrity, revealing to be an efficient and reproducible technique to obtain an appropriate RNA quality with potential applicability for transfection studies 29. [score:1]
Pre-miR-29b biosynthesis and purification by arginine affinity chromatography. [score:1]
Along with the role that pre-miR-29b plays in the regulation of the BACE1 levels, it was also evaluated the involvement of this miRNA in the functional regulation of the amyloid pathway. [score:1]
Thus, the decrease in hBACE1 protein levels is likely due to a decrease in hBACE1 mRNA stability or by reducing the transcription rate since we found by RT-qPCR that the level of hBACE1 mRNA was also decreased by recombinant pre-miR-29b and synthetic miR-29b delivery (Fig. 4) 45. [score:1]
At 48 h after transfection, a significant reduction of hBACE1 mRNA levels was also verified, being 48.5 ± 4.4% and 53.8 ± 8.1%, respectively for CS/pre-miR-29b 3.84 nM and PEI/pre-miR-29b 9.9 nM (Figs 4A,B). [score:1]
As presented in Fig. 1, at 48 and 72 h after transfection, cellular viability is clearly not affected by the presence of the CS/pre-miR-29b and PEI/pre-miR-29b since the majority of cells remained viable (>94% viability), suggesting that these carriers are suitable for therapeutic applications. [score:1]
pre-miR-29b protection by polyplexes formulation and delivery to neuronal cells. [score:1]
As expected, hBACE1 mRNA levels were also decreased in comparison with untreated control and cells transfected with an unrelated RNA control, in the cells transfected with synthetic miR-29b (41.3 ± 3.6%), at 72 h (Fig. 4C). [score:1]
The pre-miR-29b (a final concentration of 2 μg/mL) and polycation (a concentration of 10 mg/mL) stock solutions were prepared in sodium acetate buffer (0.1 M sodium acetate/0.1 M acetic acid, pH 4.5). [score:1]
In addition, it was also verified a decrease of the endogenous Aβ [42] levels (approximately 44% to CS/pre-miR-29b and 47% to PEI/pre-miR-29b) in these cells. [score:1]
The pre-miR-29b used in the experiments was produced in a bacterial cell culture of Rhodovulum sulfidophilum DSM 1374 strain (BCCM/LMG, Belgium) modified with the plasmid pBHSR1-RM [53] containing the sequence of pre-miR-29b, as previously described by Pereira and collaborators 33. [score:1]
As a result, endogenous Aβ [42] levels were significantly reduced by 45.2 ± 6.0% and 40.07 ± 1.3% with CS/pre-miR-29b 8.72 and 9.9 nM, respectively. [score:1]
This result suggests that the application of pre-miR-29 lead to a significant decrease in the levels of two major risk factors commonly associated with the neurodegeneration in AD. [score:1]
The hydrodynamic diameter and zeta potential of the pre-miR-29b -loaded polyplexes were determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS particle analyzer (Malvern Instruments, Worcestershire, UK), equipped with a He-Ne laser, at 25 °C. [score:1]
Recombinant pre-miR-29b modulates Aβ [42] generation in vitro. [score:1]
Recombinant pre-miR-29b effect on BACE1 levels in N2a695 cells at different concentrations of the pre-miR-29b for 72 h.. [score:1]
In addition, the PCR product corresponding to the purified pre-miR-29b was sequenced to confirm the identity and orientation of the amplicon (Figure S1 in Supporting Information). [score:1]
Thus, in order to explore the effect of recombinant pre-miR-29b administration, N2a695 cells were transfected with CS/pre-miR-29b, PEI/pre-miR-29b and Lipo/pre-miR-29b using different concentrations of the pre-miR-29b (3.84, 6.32, 8.72 and 9.9 nM). [score:1]
The PEI/pre-miR-29b molar ratio is 0.35:1 (mol/mol) and the CS/pre-miR-29b molar ratio is 3:1 (mol/mol). [score:1]
Briefly, all the pre-miR-29b loaded polyplexes were formulated using the method of simple complexation which is based on the electrostatic interactions that occur between molar concentrations of positive charge, present in the protonated amine groups of each polycation (N), and the negative charge of the phosphate groups of RNA backbone (P), as described by Pereira and co-workers 41. [score:1]
Transfection of N2a695 cells with polyplexes/pre-miR-29b. [score:1]
In order to promote encapsulation, cationic polymer solution (100 μL) was added dropwise to the pre-miR-29b solution (400 μL), under stirring during 30 s, to particle formation 41. [score:1]
In addition, cells were also transfected with scrambled miRNA (5′-UUCUCCGAACGUGUCACGUTT-3′; 3′-TTAAGAGGCUUGCACAGUGCA-5′) and a synthetic miR-29b in the mature form (5′-UAGCACCAUUUGAAAUCAGUGUU-3´) using CS, as controls (at a final concentration of 9.9. nM). [score:1]
As a positive control, Lipofectamine 2000 transfection reagent was used (Lipo/pre-miR-29b), according to the protocol recommended by the manufacturer. [score:1]
Our findings, together with those from other groups, suggest a fundamental role of miR-29 in AD, and emphasize the potential application of miR-29 in prognosis prediction and AD therapy. [score:1]
Effect of recombinant pre-miR-29b on hBACE1 mRNA levels in N2a695 cells following 24, 48 and 72 h treatment with: (A) CS/pre-miR-29b and (B) PEI/pre-miR-29b (C) Synthetic miR-29b and Scrambled RNA. [score:1]
Furthermore, the concentrations of recombinant pre-miR-29b used in this study were much lower than those reported in other works using synthetic miRNA (25 to 250 nM) 16 21, thus a smaller amount of recombinant pre-miR-29b is required to obtain a higher silencing level of hBACE1. [score:1]
Then, the pre-miR-29b isolation was achieved using arginine as a specific ligand in affinity chromatography 33. [score:1]
[1 to 20 of 63 sentences]
28
[+] score: 145
Gene ontology terms that are significantly enriched in a cluster are marked to the right of the heatmap miR-29 targets involving extracellular matrix are stabilized during quiescenceTo identify potential regulators responsible for a coordinated change in the stability and expression of genes, we used predicted miRNA targets from TargetScan [24] as gene set references and identified gene sets for which the differences in corrected decay constants (see ) between conditions were different for the genes in each miRNA target set as compared to genes outside of the target set [25]. [score:13]
We observed that experimentally-validated miR-29 targets exhibited an even stronger gene expression-stability signature of upregulation of gene expression and transcript stabilization with quiescence than the set of computationally predicted targets (Fig.   4b). [score:12]
Regulators of gene expression such as miR-29 serve as candidate targets for affecting the expression of extracellular matrix expression, for instance, in fibrotic disease. [score:12]
Since miRNA target prediction can include many false positives and targets that are only regulated in specific biological contexts, we refined this target set even further by focusing on the specific transcripts that we found to be regulated when miR-29 was introduced into primary human dermal fibroblasts [26]. [score:9]
Downregulation of miR-29 during quiescence resulted in a relief of negative regulation of these miR-29 targets, and thus, they are expressed at higher levels in quiescent than proliferating cells. [score:9]
Enrichment tests and violin plots displaying the differences in decay constants P [constant] – CI7 [constant] for targets of each miRNA were performed using the GSEAMA package (David Robinson – Princeton University) implemented in R. The difference in decay constants between P and CI7 fibroblasts from miR-29 targets were compared to non-targets using a Chi-squared test for independence to test whether miR-29 targets versus non-targets had a higher proportion of genes that decayed faster during proliferation as compared to quiescence. [score:9]
The decay and gene expression profiles of computationally-predicted miR-29 collagen-related targets show a strong pattern of stabilization of miR-29 targets in the quiescent state, and higher expression of the associated genes in the quiescent compared with the proliferating state (Fig.   4a). [score:8]
Our data identified examples of both cases where a portion of miRNA targets were more stable during quiescence (including miR-29 targets), and a portion of targets were less stable during quiescence. [score:7]
Moreover, miR-29, a negative regulator of collagen gene expression, is downregulated during quiescence induction. [score:7]
Gene expression and RNA decay constant changes for computationally predicted a and experimentally validated b miR-29 targets. [score:5]
Upregulation of miR-29 during proliferation leads to negative regulation of these same transcripts, which share a common biological function, by decreasing their stability. [score:5]
Analysis of miR-29 target decay rates suggests that microRNA -induced changes in RNA stability are important contributors to the quiescence gene expression program in fibroblasts. [score:5]
Out of the 485 differentially stabilized transcripts, mRNA targets of miR-29, let-7, miR-137, and miR-130 were stabilized with quiescence while miR-17 and miR-200 targets were stabilized with proliferation. [score:5]
The number of transcripts in the distribution is displayed in parentheses after the miRNA family name on the y-axis Fig. 4Gene expression and stability change heatmap for collagen-related miR-29 targets. [score:5]
In summary, miR-29 levels decrease with quiescence and this relief of negative regulation correlates with our observation of increased stability of miR-29 targets. [score:4]
By monitoring transcript decay rates, we can now conclude that the observed miR-29 regulation of quiescence targets reflects changes in mRNA stability. [score:4]
Notably, a stability-regulated cluster was defined by targets of the quiescence -associated miRNA, miR-29, giving further insight into its mechanism of action. [score:4]
We decided to focus on miR-29 targets based on our previous demonstration that miR-29 plays an important functional role in quiescence [26]. [score:3]
In this current analysis, targets of the miR-29 family (miR-29abcd) were significantly more stable during quiescence (χ [2], 1, p < 0.05). [score:3]
Additionally, targets of a quiescence -associated microRNA (miR-29) were significantly enriched in the fraction of transcripts that were stabilized during quiescence. [score:3]
In our previous study, targets of the miR-29 family were more likely to change in abundance with quiescence than the targets of any other microRNA investigated [26]. [score:3]
miR-29 targets are significantly stabilized with quiescence, and are enriched for genes that encode proteins that are found in the ECM or are involved in ECM remo delling. [score:3]
miR-29 targets involving extracellular matrix are stabilized during quiescence. [score:3]
Quiescence mRNA stability miR-29 Gene expression Post-transcriptional regulation Cell-cycle Cellular quiescence is a state of cell cycle arrest that is characterized by the unique ability of cells to exit and re-enter the cell division cycle upon presentation of the appropriate stimulus. [score:2]
The results are also consistent with our findings that miR-29 hastens cell cycle re-entry from quiescence [26]. [score:1]
These results are consistent with our own analysis in which the levels of miRNAs were monitored by microarray and miR-29 levels were discovered to decline relative to other miRNAs in quiescent cells [26]. [score:1]
[1 to 20 of 26 sentences]
29
[+] score: 142
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2, hsa-mir-29c
These data suggest that miR-29b-1 may negatively regulate the expression of these markers and that its overexpression probably affects cell proliferation, self-renewal and chemosensitivity of 3AB-OS CSCs by directly or indirectly targeting their mRNAs. [score:10]
Herein we show that miR-29b-1 overexpression sensitized 3AB-OS cells to chemotherapeutic drug -induced apoptosis and concomitantly decreased the expression of the anti-apoptotic genes Bcl-2 and IAP-2. The overexpression of Bcl-2 and IAP-2 has been identified in a variety of human cancers (50, 51) and it has been reported that miR-29s target Bcl-2 in both hepatocellular carcinoma (HCC) and OS cell line (52, 24). [score:9]
Furthermore, miR-29b-1 overexpression significantly downregulated protein and mRNA levels of its putative targets CCND2, E2F1 and E2F2. [score:8]
Our previous studies (11) have shown that, among the up-/downregulated miRNAs present in 3AB-OS cells, miR-29b-1 was highly downregulated. [score:7]
To perform these studies we upregulated miR-29b-1 in 3AB-OS cells; then, we examined the effects of this overexpression on cell proliferation, sarcosphere-forming ability, clonogenic growth, chemosensitivity, migration and invasive ability of 3AB-OS-miR-29b-1-GFP cells. [score:6]
Deregulation of miRNAs was recently reported in human OS (21– 23) and it has been demonstrated that downregulation of miRNA-29 family members (miR-29a/b/c; miR-29s) is a frequent event evidenced in OS tissues (23). [score:5]
To predict the possible molecular target of miR-29b, we employed a number of avaible databases (TargetScan 5.1, MiRanda, PICTAR, miRbase and DIANA-microT). [score:5]
Overall, these findings suggested that the deep downregulation of miR-29b-1 found in 3AB-OS CSCs might play a key role in regulating their stemness. [score:5]
Genes that contain the miR-29b -binding site(s) in the 3′-UTR were obtained using the TargetScan 5.1, MiRanda, PICTAR, miRbase and DIANA-microT target prediction algorithms, as previously described (11). [score:5]
MiR-29b-1 overexpression reduces the expression of stemcell, cell cycle and anti-apoptotic markers in 3AB-OS CSCs. [score:4]
Thus, the potent downregulation of miR-29b-1 in 3AB-OS cells might be at the root of their altered G1-S transition. [score:4]
As targeting CSCs might permit a successful cure of OS, we believe that the knowledge of the role of miR-29b-1 in the regulation of cell growth, self-renewal and apoptosis in 3AB-OS CSCs might provide a new avenue for therapeutic interventions. [score:4]
We have previously shown (11) that, in comparison with parental MG63 cells, 3AB-OS cells revealed miR-29b markedly downregulated. [score:4]
In this study, we also found that miR-29b-1 overexpression, in 3AB-OS CSCs, consistently reduced their sarcosphere-forming ability and colony formation. [score:3]
Herein, our results showing that miR-29b-1 overexpression did not influence migratory and invasive capacities of 3AB-OS cells, agree with the role of the context in determining the effects of the family of miR-29s. [score:3]
In conclusion, our study demonstrated that miR-29b-1 overexpression causes 3AB-OS CSCs proliferation, self-renewal and chemosensitivity. [score:3]
Vector construction for miR-29b-1 expression and stable transfection. [score:3]
Intriguingly, among them, CD133 and N-Myc are putative targets of miR-29b and CD133 is a recognized stem cell marker used for the identification and isolation of putative cancer stem cell populations from various malignant tumors, including OS (29, 30). [score:3]
Thereafter, we assessed the effect of miR-29b-1 overexpression on 3AB-OS cell proliferation. [score:3]
Overall, the results show that miR-29b-1 suppresses stemness properties of 3AB-OS CSCs and suggest that developing miR-29b-1 as a novel therapeutic agent might offer benefits for OS treatment. [score:3]
We analyzed the effects of miR-29b-1 overexpression in a three-dimensional (3D) culture mo del on Matrigel. [score:3]
MiR-29b-1 overexpression reduces cell growth in 3AB-OS CSCs. [score:2]
In Fig. 2B cell count shows that miR-29b-1 overexpression markedly reduced the growth rate, whereas it did not induce loss of cell viability as shown by trypan blue exclusion assay. [score:2]
MiR-29b-1 overexpression enhances the chemosensitivity of 3AB-OS CSCs. [score:2]
For miR-29b-1, total RNA extraction was performed using the Direct-zol RNA MiniPrep (Zymo Research, Euroclone); a DNase I treatment step was included. [score:2]
MiR-29b-1 overexpression decreases self-renewal in 3AB-OS CSCs. [score:2]
MiR-29b-1 overexpression does not influence migratory and invasive capacities of 3AB-OS CSCs. [score:2]
A 498-bp insert from the Homo sapiens chromosome 7 genomic sequence (GenBank EU154353.1) containing the mir-29b-1 gene (MI0000105) were obtained through PCR from 100 ng of genomic DNA derived from the human HT29 colon cancer cell line. [score:1]
Moreover, at this time, 3AB-OS-GFP clusters even generated multi-cellular sphere structures not evidenced in 3AB-OS-miR-29b-1-GFP clusters. [score:1]
Thus, in the present study, we examined the potential role of miR-29b-1 in 3AB-OS cells, by evaluating the in vitro effects of its functional overexpression. [score:1]
Indeed, after 2 and 5 days in culture 3AB-OS-miR-29b-1-GFP cells formed spherical masses of cells smaller than that of 3AB-OS-GFP cells, suggesting a decrease of cell proliferation. [score:1]
3AB-OS cells were plated in 6-well dishes until they reached 90% confluence and then transfected with pCDH-CMV-MCS-EF1-copGFP-T2A-PURO-miR-29b-1 or empty vector as a control (hereafter indicated as 3AB-OS-miR-29b-1-GFP cells and 3AB-OS-GFP cells, respectively), using Lipofectamine 2000 (Invitrogen, Life Technologies Ltd. [score:1]
To examine the potential role of miR-29b-1 in 3AB-OS CSCs, as described in, we stably transfected 3AB-OS cells with either empty vector (3AB-OS-GFP cells) or vector containing miR-29b-1 (3AB-OS-miR-29b-1-GFP cells). [score:1]
Moreover, real-time RT-PCR analysis (Fig. 6B) shows that, similarly, the level of mRNAs related to the above reported proteins were markedly lower in 3AB-OS-miR-29b-1-GFP cells than in 3AB-OS-GFP cells. [score:1]
Moreover, in comparison with 3AB-OS-GFP cells, 3AB-OS-miR-29b-1-GFP cells also showed potently decreased stemness marker levels (Oct3/4, Sox2, Nanog, CD133 and N-Myc). [score:1]
Our results demonstrated that in 3AB-OS-miR-29b-1-GFP cells proliferation was markedly reduced in both two- and three-dimensional culture systems. [score:1]
3AB-OS-miR-29b-1-GFP cells and 3AB-OS-GFP cells, were cultured to 150,000 cells/well in 6-well plates (Corning Costar, Euroclone, Pero, Italy) in culture medium. [score:1]
Fig. 4A and B (left panels) show that exposure of the cells to doxorubicin or cisplatin, two of the major drugs used for the chemotherapy of osteosarcoma (3, 4), resulted in significant time -dependent reduced viability of 3AB-OS-miR-29b-1-GFP cells with respect to 3AB-OS-GFP cells. [score:1]
Overall, the results suggest that in 3D culture 3AB-OS-miR-29b-1-GFP cells grow more slowly than 3AB-OS-GFP cells. [score:1]
The green fluorescence was measured as described in the above ‘Vector construction for miR-29b-1 expression and stable transfection’ paragraph. [score:1]
In Fig. 6A western blot analysis shows that in 3AB-OS-miR-29b-1-GFP cells protein levels of important stem cell markers (Oct3/4, Sox2, Nanog, CD133, N-Myc), cell cycle-related markers (CCND2, E2F1, E2F2) and anti-apoptotic markers (Bcl-2 and IAP-2) were markedly lower than in 3AB-OS-GFP cells. [score:1]
The corresponding mir-29b-1 PCR fragments was digested with EcoRI/ NotI and cloned into a plasmid, named pCDomH, derived from the pCDH-CMV-MCS-EF1-copGFP (System Biosciences, Mountain View, CA, USA) in which we inserted a fragment containing puromycin resistance that was obtained from the pmiRZip vector (System Biosciences) through a PstI/ KpnI digestion. [score:1]
On analyzing sarcosphere-forming ability through subsequent passages (secondary and tertiary spheres), we found (Fig. 3B) that the number of sarcospheres generated from both cell lines in each passage remained consistent; however, 3AB-OS-miR-29b-1-GFP cells formed ~1.4-fold less sarcospheres than 3AB-OS-GFP cells, demonstrating that miR-29b-1 decreases the self-renewal capacity of sarcosphere-forming cells. [score:1]
These data suggest that miR-29b-1 controls the growth and self-renewal capacity of 3AB-OS CSCs. [score:1]
Real-time RT-PCR analysis in both 3AB-OS-miR-29b-1-GFP and 3AB-OS-GFP cells, in comparison with untransfected cells, shows increase in the expression of miR-29b-1 up to 1.55-fold (P<0.01) in 3AB-OS-miR-29b-1-GFP cells, while no significant variations were measured in 3AB-OS-GFP cells (Fig. 1B). [score:1]
In agreement, studies of DNA content profiles, by flow cytometry analysis of propidium iodide stained cells, show that 3AB-OS-miR-29b-1-GFP cells were mostly in the G0/G1 phase, while untransfected and 3AB-OS-GFP cells were predominantly in S-G2/M (Fig. 2C). [score:1]
Moreover, it has been shown (53) that miR-29b acts as an antimetastatic miRNA for prostate cancer cells at multiple steps in a metastatic cascade. [score:1]
After eight days, cell cluster density continued to increase in size, often appearing darker and denser; however, 3AB-OS-miR-29b-1-GFP clusters were much smaller than 3AB-OS-GFP clusters. [score:1]
As shown in Fig. 2E, 3AB-OS-miR-29b-1-GFP cells grew slower than 3AB-OS-GFP cells. [score:1]
Even 3AB-OS-miR-29b-1-GFP sarcospheres increased in size and number, but they were fewer in number and much smaller (mean diameter of 78.6±23 μm, containing ~875 cells/sphere). [score:1]
pCDomH plasmid, containing mir-29b-1, was sequence verified (BioRep S. r. l., Milan, Italy). [score:1]
To perform our study, preliminarily selected cells were used to evaluate the efficiency of miR-29b-1 transfection and expression. [score:1]
These results suggest that miR-29b-1 may increase the sensitivity of 3AB-OS cells to different chemotherapeutic agents. [score:1]
In Fig. 2A, phase contrast microscopy shows that cell number markedly decreased in 3AB-OS-miR-29b-1-GFP cells with respect to 3AB-OS-GFP and untransfected cells. [score:1]
In particular, after days 5 in culture, 3AB-OS-GFP cells formed sarcospheres having a mean diameter of 70.5±14.2 μm, at a frequency of ~1/14 (36.6±4.5 spheres/500 cells), while 3AB-OS-miR-29b-1-GFP cells formed smaller sarcospheres (mean diameter of 61.2±11.3 μm) at a frequency of ~1/19 (26.3±6.5 spheres/500 cells). [score:1]
Fig. 4C shows that 3AB-OS-miR-29b-1-GFP cells were also much more sensitive to etoposide -induced apoptosis than 3AB-OS-GFP cells. [score:1]
Moreover, analysis of the proliferation marker Ki-67 shows that 3AB-OS-miR-29b-1-GFP cells resulted to be less Ki-67 -positive than untransfected and 3AB-OS-GFP cells (Fig. 2D). [score:1]
[1 to 20 of 57 sentences]
30
[+] score: 122
Moreover, miR-29 targets Mcl-1 in human hepatocellular carcinoma cells and acute myelogenous leukemia cells, and its expression is down-regulated in both types of cancer [14]. [score:8]
The regulation of miR-29 expression has been previously studied, and NFκB was shown to negatively regulate miR-29 expression [19], [20]. [score:7]
However, further examination of the expression levels of miR-29 family members in pDCs from SLE patients is necessary to determine whether such factors are abnormally expressed in the diseased state. [score:7]
The results indicated that miR-29 overexpression inhibited both Bcl-2 and Mcl-1 expression (Figure 6B). [score:7]
Transfection of miR-29 enhanced its expression level by approximately 16-fold in comparison to the control group, whereas transfection of the miR-29 inhibitor dramatically reduced its expression level (Figure S4). [score:7]
Further analysis showed that 6 miRNAs were predicted to target Bcl-2 family members, and functional screening demonstrated that miR-29b and miR-29c were involved in TLR -inhibited Dex -induced pDC apoptosis. [score:5]
Mcl-1, the target of miR-29b, was the only member of the Bcl-2 family that was abundantly expressed in fresh pDCs. [score:5]
In our study, we found that the expression of miR-29b and miR-29c were both inhibited by TLR9 stimulation. [score:5]
Considering that the NFκB pathway is activated by TLR9 in human primary pDCs, it is reasonable to hypothesize that TLR -inhibited miR-29 expression facilitates the function of NFκB in alleviating Dex -induced pDC apoptosis. [score:5]
miR-29b and miR-29c Promote pDC Apoptosis by Targeting Mcl-1 and Bcl-2. miR-29 promotes pDC apoptosis by targeting Mcl-1 and Bcl-2.. [score:5]
pDCs were transfected with control (Ctrl), miR-29b mimic, miR-29c mimic, miR-29b inhibitor or miR-29c inhibitor. [score:5]
As other molecules may also be involved in Dex -induced pDC apoptosis, overexpression of miR-29b or miR-29c could not completely eliminate the inhibitory effect of CpG on Dex -induced apoptosis. [score:5]
In this study, we demonstrated that down-regulation of miR-29 was correlated with drug resistance in pDCs, supporting the idea that miR-29 is a pro-apoptotic factor during this process. [score:4]
Although miR-29b and miR-29c show relative low expression levels in fresh pDCs, they could be induced to relatively medium levels during Dex stimulation (Table S3). [score:3]
To verify the effect of miR-29b and miR-29c in pDC apoptosis during Dex stimulation alone, we transfected miR-29b or miR-29c inhibitors to verify their effect on pDC apoptosis after stimulation with Dex alone. [score:3]
Therefore, in addition to its previously proposed role as a TLR7/9 antagonist, miR-29 could also represent a new target for anti-autoimmune drug discovery. [score:3]
Figure S5 Inhibition of miR-29b or miR-29c partly ameliorated Dex -induced pDC apoptosis. [score:3]
To further verify the relationship between miR-29b/c and their targets, we evaluated their expression kinetics. [score:3]
Previous reports have demonstrated that both Mcl-1 and Bcl-2 are inhibited by miR-29 in various cell types [14], [15]. [score:3]
However, there was no difference in the expression of miR-16 between the Dex- and Dex+CpG -treated samples, indicating that TLR stimulation does not function through miR-16; instead, our results indicated that miR-29b and miR-29c may participate in pDC apoptosis. [score:3]
Both miR-29b and miR-29c were inhibited by TLR9 stimulation (Figure 6C), and as their miRNA levels decreased, the protein levels of Mcl-1 and Bcl-2 increased. [score:3]
We also found that the 3′-UTRs of Mcl-1 and Bcl-2 were targets of miR-29 (Figure 6A). [score:3]
miR-29b and miR-29c are involved in TLR -inhibited Dex -induced pDC apoptosis. [score:3]
The inhibition of miR-29b and miR-29c was shown to promote pDC survival (Figure S5). [score:3]
Several reports have demonstrated that all 3 miR-29 paralogs are expressed at increased or decreased levels in different types of cancers in comparison to corresponding normal tissues [16]– [18]. [score:3]
In accordance with previous reports, TLR9 stimulation greatly enhanced pDC survival in the presence of Dex, and overexpression of miR-29b/c promoted pDC apoptosis, indicating that these miRNAs play important roles during this process (Figure 5A and B). [score:3]
0069926.g005 Figure 5 (A, B) Primary pDCs were transfected with control (Ctrl), miR-1, miR-101, miR-148, miR-29b, or miR-29c mimics. [score:1]
Primary pDCs were transfected with control (Ctrl) or miR-29b mimics and stimulated with CpG. [score:1]
Notably, miR-29 has been hypothesized to positively associate with p53 to induce apoptosis. [score:1]
In support of this notion, miR-29 -deficient mice were shown to have significantly greater numbers of Th1 cells and increased IFN-γ production [20]. [score:1]
A total of 120 miRNAs were induced by Dex, including many known pro-apoptotic miRNAs, such as those of the let-7 family, miR-16, -23a, -31, -98, and -101, the miR-29 family, the miR-30 family, and the miR-320 family, among others. [score:1]
Our study further found that miR-29b and miR-29c induced less apoptosis in comparison to Dex treatment alone (Figure 5). [score:1]
miR-29b and miR-29c Rescue Dex -induced pDC Apoptosis during CpG Stimulation. [score:1]
These results further indicated that miR-29b and miR-29c are involved in pDC apoptosis. [score:1]
[1 to 20 of 34 sentences]
31
[+] score: 118
Only two potential targets, PIK3R1 and MMP-2, were significantly suppressed by altering the expression of a miRNA; specifically, overexpression of miR-29b or miR-221 suppressed PIK3R1, and overexpression of miR-29b suppressed MMP-2. (Figure 6A, B). [score:15]
Because HuCCT1 cells were more sensitive to Gem than were HuH28 cells, HuCCT1 cells were used as the standard in this comparison; expression of 10 miRNAs (miR-29b, 130a, 141, 200a, 200b, 200c, 205, 221, 222 and 429) was downregulated in HuH28 cells, while expression of eight others (miR-99b, 125a-5p, 143, 377, 452, 589, 597, and 708) was upregulated. [score:11]
We analyzed the expression of each of the six putative target genes after having modified the expression of each of the respective microRNAs; again, a miRNA mimic for miR-29b, miR-205, or miR-221 was transfected into cells to mimic miRNA overexpression; separately, an anti-miR-125a-5p oligonucleotide was transfected into cells to inhibit miR-125a-5p activity. [score:11]
Selective siRNA -mediated downregulation of either of two software-predicted targets, PIK3R1 (target of miR-29b and miR-221) or MMP-2 (target of miR-29b), also conferred Gem sensitivity to HuH28. [score:10]
Fang et al. revealed that miR-29b suppresses tumor cell invasion and metastasis by downregulating MMP-2 expression [22]. [score:8]
Both of HuH28 and HuCCT1 cells did not have any gene polymorphisms in PIK3R1 and MMP-2. Based on these findings, we reasoned that miR-29b and miR-221 restored Gem sensitivity to HuH28 cells, at least in part, by suppressing PIK3R1, MMP-2, or both; specifically, miR-29b could potentially suppress both genes, while miR-221 could suppress only PIK3R1. [score:7]
In conclusion, our analysis of miRNA expression profiles in CCA cells revealed that miR-29b, miR-205, and miR-221 expression levels were related to the Gem resistance of HuH28 cells, and that ectopic overexpression of any one of these miRNAs could restore Gem sensitivity to these cells. [score:7]
Among these 18 miRNAs, ectopic overexpression of each of three downregulated miRNAs in HuH28 (miR-29b, miR-205, miR-221) restored Gem sensitivity to HuH28. [score:6]
We found that miR-29b was downregulated in the more GEM-resistant CCA cell line, HuH28, and that ectopic overexpression of miR-29b caused by transfection with a miRNA mimic conferred GEM sensitivity to the HuH28 cells. [score:6]
Ectopic overexpression of miR-29b (A), miR-205 (B), or miR-221 (C) via transfection of a corresponding miRNA mimic and downregulation of miR-125a-5p (D) via transfection of an anti miRNA oligonucleotide made HuH28 cells more sensitive to Gem. [score:6]
0077623.g004 Figure 4 Ectopic overexpression of miR-29b (A), miR-205 (B), or miR-221 (C) via transfection of a corresponding miRNA mimic and downregulation of miR-125a-5p (D) via transfection of an anti miRNA oligonucleotide made HuH28 cells more sensitive to Gem. [score:6]
Similar to our results, some previous results also indicate that miR-29b suppresses growth of a human uterine carcinoma line (HeLa cells) and of prostate cancer cells by downregulating p85 alpha and MMP-2, respectively [18], [25]. [score:6]
Based on these analyses, we predicted that six genes— erythroblastic leukemia viral oncogene homolog 3 (ERBB3), KIT, Leukemia inhibitory factor (LIF), matrix metalloproteinase 2 (MMP-2), phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1) and vascular endothelial growth factor A (VEGFA) — were putative oncogenic targets of miR-29b, miR-205, and/or miR-221. [score:6]
Our results indicated that expression levels of miR-29b, miR-125a-5p, miR-205, and miR-221 may be useful as diagnostic markers of sensitivity to, and that PIK3R1 and MMP-2 could become molecular targets of anti-tumor therapies for patients with CCA. [score:5]
Here, we identified two miR-29b target genes, PIK3R1 and MMP-2, that are, at least partly, responsible for the resistance of CCA. [score:3]
Transfection of a mimic of miR-29b, miR-205, or miR-221 or inhibition of miR-125a-5p via a complementary oligonucleotide significantly restored Gem sensitivity to HuH28 cells near clinical therapeutic concentration, 1×10 [−4] M (Figure 4). [score:3]
MicroRNA-29b is one of the representative anti-onco-miRNAs in many kind of cancers [16]– [18]. [score:1]
The p values between miR-29b, miR-205 and miR-221 mimic transfection versus non-silencing miRNA mimic (relative cell viability was 82 ± 4 % at 1×10 [−4] M Gem) and anti-miR-125a-5p oligonucleotide transfection versus negative control oligonucleotide (relative cell viability at 1×10 [−4] M Gem was 70 ± 6 %) were smaller than 0.001. [score:1]
[1 to 20 of 18 sentences]
32
[+] score: 116
c Validation of miRNA profiling was assessed by RT-qPCR, which confirmed differential expression of these miRNAs in the two groups, being hsa-miR-29a and hsa-miR-29b down-regulated and hsa-miR-513a-5p, and hsa-miR-628-3p up-regulated in MYC translocation -negative BL cases Table 2 miRNA profiling (p-value and fold change) TargetID p value Fold change (Absolute value) Regulation in MYC-neg hsa-miR-513a-5p 0,031124841 1,02109958 Down hsa-miR-628-3p 0,004815838 1,01011474 Down hsa-miR-29a 0,0142882 1,086645638 Up hsa-miR-29b 0,001516702 1,5403288 Up By contrast, when we applied the previously described miRNA signature able to discriminate BL from diffuse large B-cell lymphomas (DLBCL) constituted by 30 miRNAs containing MYC-regulated and nuclear factor-kB pathways -associated miRNAs [36], we failed to discriminate BL cases according to the presence of MYC translocation, this ruling out bona fide the possible presence of DLBCLs morphologically mimicking classical BL in the present series (i. e. BL/DLBCL) [1]. [score:13]
c Validation of miRNA profiling was assessed by RT-qPCR, which confirmed differential expression of these miRNAs in the two groups, being hsa-miR-29a and hsa-miR-29b down-regulated and hsa-miR-513a-5p, and hsa-miR-628-3p up-regulated in MYC translocation -negative BL cases Table 2 miRNA profiling (p-value and fold change) TargetID p value Fold change (Absolute value) Regulation in MYC-neg hsa-miR-513a-5p 0,031124841 1,02109958 Down hsa-miR-628-3p 0,004815838 1,01011474 Down hsa-miR-29a 0,0142882 1,086645638 Up hsa-miR-29b 0,001516702 1,5403288 UpBy contrast, when we applied the previously described miRNA signature able to discriminate BL from diffuse large B-cell lymphomas (DLBCL) constituted by 30 miRNAs containing MYC-regulated and nuclear factor-kB pathways -associated miRNAs [36], we failed to discriminate BL cases according to the presence of MYC translocation, this ruling out bona fide the possible presence of DLBCLs morphologically mimicking classical BL in the present series (i. e. BL/DLBCL) [1]. [score:13]
Thus, hsa-miR-29 family members down-regulation may represent an appealing possible mechanisms able to determine MYC up-regulation and sustain its expression at mRNA and protein level also in the absence of a translocation. [score:9]
Interestingly, when we compared the miRNA profiling of MYC translocation -positive versus MYC translocation -negative BL cases, we identified four miRNAs differentially expressed, of which hsa-miR-513a-5p and hsa-miR-628-3p were up-regulated and two miR-29 family members (hsa-miR-29a and hsa-miR-29b) were down-regulated in BL cases lacking the MYC translocation. [score:8]
This miRNA family may represent a novel target for tailored therapies as in vitro and mouse studies suggest increasing miR-29 expression by combined inhibition of HDAC3 and EZH2. [score:7]
Actually, hsa-miR-29b that is up-regulated in DLBCL, is down-regulated also in BL and mostly in MYC translocation negative cases. [score:7]
A significant down-regulation of the miR-29 family members was observed in MYC-translocation negative cases, whereas the remaining two miRNAs were hyper-expressed in the absence of translocation (p < 0.05). [score:6]
Over -expression of the selected genes is in accordance with down-regulation of the miR-29 family observed in MYC-translocation negative cases; (b-c). [score:6]
In addition, it has been recently demonstrated that hsa-miR-29b directly binds to DNMT3A and DNMT3B, and regulates indirectly DNMT1 by targeting Sp1, a transactivator of the gene [36, 45]. [score:6]
Interestingly, in MYC translocation -negative cases we found over -expression of DNA-methyl transferase family members, consistent to hypo -expression of the hsa-miR-29 family. [score:5]
Interestingly, in MYC translocation -negative BLs we found over -expression of DNA methyltransferase (DNMT) family members, consistent to hypo -expression of hsa-miR-29 family. [score:5]
Wu DW, Hsu NY, Wang YC, Lee MC, Cheng YW, Chen CY, et al. c-Myc suppresses microRNA-29b to promote tumor aggressiveness and poor outcomes in non-small cell lung cancer by targeting FHIT. [score:5]
In this scenario, over -expression of DNMT family members, due to hypo -expression of hsa-miR-29 family members, may elicit a role in inducing carcinogenesis [46]. [score:5]
Since a direct regulation of DNMT family members and MYCN by hsa-miR-29b has been previously demonstrated [36, 37], DNMT1, DNMT3A, DNMT3B and MYCN mRNA expression analysis was performed in a total of 10 MYC translocation -positive and 10 MYC translocation -negative cases by RT-qPCR. [score:5]
Interestingly, miR-29 family members have been related to malignant transformation, and it has been demonstrated that their down-regulation contributes to MYC -induced lymphomagenesis in vivo and in vitro mo dels [42, 43]. [score:4]
MYC-translocation negative cases show a dramatic hyper -expression of the gene; altogether RT-qPCR results confirmed the bioinformatics predictions, which suggest a regulation of these by the miR29 family. [score:4]
The difference in has-miR29 family members expression we detected between MYC translocation -positive and MYC-translocation negative BL samples might be related to the lower MYC protein level among cases lacking the MYC-translocation. [score:3]
Validation of the results was performed on all the dysregulated miRNAs so identified (hsa-miR-29a, hsa-miR-29b, hsa-miR-513a-5p, and hsa-miR-628-3p). [score:2]
Hsa-miR-628-3p and hsa-miR-513a-5p are less referred in the literature, whereas, more is known about the miR-29 family [41]. [score:1]
Collectively, fold changes of hsa-miR-29a, hsa-miR-29b, hsa-miR-513a-5p, and hsa-miR-628-3p obtained by microarray results were confirmed by RT-qPCR (Fig.   4c). [score:1]
Interestingly, a link between the miR-29 family by MYC has been recently reported [44], as repression of miR-29 by MYC through a corepressor complex with HDAC3 and EZH2 is observed in aggressive B-cell lymphomas [43]. [score:1]
[1 to 20 of 21 sentences]
33
[+] score: 100
Moreover, NRF2 activates miRNA-29-coding genes [167, 168], which further attenuate DNMT3B expression causing further feed forward epigenetic upregulation of NRF2 expression (Figure 2). [score:8]
miRNA-29 via targeting DNMT3B and miRNA-148a via targeting DNMT1 may decrease FTO promoter methylation associated with higher FTO expression resulting in decreased m [6]A levels in mRNAs. [score:7]
Importantly, miRNA-29b promotes osteogenesis by directly down -regulating these negative regulators of osteoblast differentiation through binding to target 3′-UTR sequences [264]. [score:6]
Milk-derived exosomal miRNAs that target DNMT1 (miRNA-148a, miRNA-21) and DNMT3B (miRNA-148a, miRNA-29b) have been suggested to play a fundamental epigenetic role for milk -induced FoxP3 expression and Treg stabilization [130, 193, 194]. [score:5]
Thus, miRNA-29b is a key regulator of development of the osteoblast phenotype by targeting anti-osteogenic factors [264]. [score:5]
Obesity in pregnant sheep leads to increased miRNA-29 expression in the liver tissue of offspring lambs, along with decreased markers of insulin signaling, suggesting fetal programming of miRNA-29 expression [322]. [score:5]
Key miRNAs that are abundantly expressed in lactating bovine MECs that promote lactation performance, lipid and protein synthesis include the DNMT -targeting miRNA-148/152- and the miRNA-29 family [116, 117, 122]. [score:5]
miRNA-29 promotes myogenesis via inhibition of Rybp, which acts as a negative regulator of skeletal myogenesis [262]. [score:4]
Zhou L. Wang L. Lu L. Jiang P. Sun H. Wang H. A novel target of microRNA-29, Ring1 and YY1 -binding protein (Rybp), negatively regulates skeletal myogenesis J. Biol. [score:4]
Arnold N. Koppula P. R. Gul R. Luck C. Pulakat L. Regulation of cardiac expression of the diabetic marker microRNA miR-29 PLoS ONE. [score:4]
Kurtz et al. [321] showed that miRNA-29 was upregulated in the livers of DIO mice and in Zucker diabetic fatty (fa/fa) rats. [score:4]
The generation of DNMT -targeting miRNAs (miRNA-152, miRNA-148a, miRNA-29, miRNA-21) is thus a fundamental epigenetic mechanism increasing lactation-specific gene transcription thereby enhancing lactation performance as well as milk yield in domestic animals. [score:3]
The miRNA-29 family is among the most abundantly expressed miRNAs in pancreas and liver and is regarded as a diabetogenic risk marker [318, 319, 320]. [score:3]
Notably, bovine milk-derived miRNA-29b, which shares the identical seed sequence as human miRNA-29b, has been shown to increase dose -dependently in the serum of healthy human adults after consumption of pasteurized cow’s milk and increased RUNX2 expression in PBMCs of the milk consumers [79]. [score:3]
The treatment of dairy cow MECs with 5-aza-2′-deoxycytidine decreased the methylation levels of the MIR29B promoter and increased the expression of miRNA-29b [122]. [score:3]
In this mo del, miRNA-29 functioned through regulation of the transcription factor FOXA2 (FOXA2 -mediated regulation of PPARGC1A, HMGCS2 and ABHD5). [score:3]
Global or hepatic insufficiency of miRNA-29 potently inhibited obesity and prevented the onset of diet induced insulin resistance [171]. [score:3]
Notably, it has been demonstrated in bovine MECs that the expression of both AKT and SREBP1 underlie epigenetic miRNA-29/DNMT -mediated demethylation of their corresponding promoter regions [122]. [score:3]
In fact, it has been reported that bovine milk miRNA-29b and miRNA-200c are dose -dependently absorbed and modify gene expression in peripheral blood mononuclear cells (PBMCs) of human milk consumers [79]. [score:3]
Kurinna S. Schäfer M. Ostano P. Karouzakis E. Chiorino G. Bloch W. Bachmann A. Gay S. Garrod D. Lefort K. A novel Nrf2-miR-29-desmocollin-2 axis regulates desmosome function in keratinocytes Nat. [score:2]
These results confirmed strong regulatory functions for the miRNA-29 family in diabesity. [score:2]
In this regards, milk-miRNA-148a and miRNA-29b -mediated DNMT suppression resulting in DNA demethylation features just the opposite epigenetic signaling compared to metformin -induced DNA methylation. [score:2]
Li Z. Hassan M. Q. Jafferji M. Aqeilan R. I. Garzon R. Croce C. M. van Wijnen A. J. Stein J. L. Stein G. S. Lian J. B. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation J. Biol. [score:2]
Fabbri M. Garzon R. Cimmino A. Liu Z. Zanesi N. Callegari E. Liu S. Alder H. Costinean S. Fernandez-Cymering C. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B Proc. [score:2]
However, pasteurization and homogenization of cow’s milk caused a substantial loss of miRNAs (63% loss of miRNA-200c, 67% loss of miRNA-29b in skim milk). [score:1]
The miRNA-29 family (miRNA-29a, miRNA-29b and miRNA-29c) has been detected in bovine colostrum and bovine milk [40, 44, 64, 79]. [score:1]
Persistent transfer of milk exosomal miRNA-29 via cow’s milk consumption may thus represent a critical epigenetic factor in the pathogenesis T2DM. [score:1]
It is thus conceivable that milk-derived exosomal miRNA-148a and miRNA-29 support the epigenetic program of myogenesis. [score:1]
Heating in the microwave caused a 40% loss of miRNA-29b but no loss of miRNA-200c [63]. [score:1]
miRNA-29b levels in PBMCs of healthy volunteers increased in a dose -dependent manner after consumption of pasteurized cow’s milk [79]. [score:1]
It has been demonstrated that cow’s milk consumption increases miRNA-29b levels in PBMCs in a dose -dependent manner [79]. [score:1]
It is of critical importance to appreciate that the nucleotide seeding sequences of miRNA-148a-3p, miRNA-21-5p, and miRNA-29b-1-3p of Homo sapiens and Bos taurus are identical (mirbase. [score:1]
In fact, the miRNA-29 family (miRNA29a, miRNA29b, and miRNA29c) has intriguing complementarities to the 3′-UTRs of DNMT3A and DNMT3B, two key de novo methyltransferases involved in DNA methylation [123]. [score:1]
[1 to 20 of 33 sentences]
34
[+] score: 98
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-2, hsa-mir-29c
Thus, the understanding of molecular pathways and targets regulated by the tumor-suppressive miR-29 family may provide new insights into the EMT process in cervical SCC and facilitate the development of more effective strategies for future therapeutic interventions for this disease. [score:9]
Thus, down-regulation of the miR-29 family and dysregulation of HSP47 and ECM components are key events contributing to the pathogenesis of diseases, suggesting that these molecules are potential therapeutic targets. [score:9]
Interestingly, members of the miR-29 family have been shown to be involved in regulating ECM proteins and multiple studies have indicated that aberrant expression of miR-29 family members contributes substantially to the development of disease (26). [score:7]
Moreover, increased expression of the MYC oncogene silences miR-29b-1/miR-29a expression and NF-κB signaling, which is known to be activated in inflammation-related cancers, and directly represses miR-29b-1/miR-29a promoter activity (19). [score:6]
Restoration of miR-29 family members directly suppresses TGF-β1 and TGF-β2 and disrupts the expression of ECM proteins (32). [score:6]
Expression analysis of miR-29 family miRNAs in cervical SCC clinical specimens showed that miR-29a was the most highly downregulated miRNA in the clinical specimens, thus, we focused on miR-29a in this study. [score:6]
Recent studies of miRNA expression signatures of hypopharyngeal SCC and maxillary SCC have indicated that expression of miRNA-29 family miRNAs (miR-29a/b/c) is significantly reduced in cancer tissues, suggesting that these miRNAs may contribute to the oncogenesis and metastasis of cervical SCC (13, 14). [score:5]
Furthermore, restoration of miR-29a in cervical cancer cells inhibited cancer cell migration and invasion, suggesting that miR-29 a functions as a tumor suppressor and may contribute to metastasis in cervical SCC. [score:5]
Aberrant expression of the miR-29 family miRNAs has been reported in several types of human cancers; however, the expression status varies according to the cancer type. [score:5]
According to gene expression data and in silico database analysis, a total of 29 genes were selected as candidate miR-29 a targets. [score:5]
In contrast, upregulation of the miR-29 family was reported in breast cancer, colon cancer and acute myeloid leukemia (16). [score:4]
In conclusion, downregulation of miR-29 a is a frequent event in cervical SCC. [score:4]
The TGF-β pathway is a prominent inducer of the EMT and expression of the miR-29 family has been shown to have an inverse relationship with the TGF-β pathway. [score:3]
Expression of miR-29 -family miRNAs in clinical cervical SCC specimens. [score:3]
Decreased expression of the miR-29 family has been observed in cholangiocarcinoma, nasopharyngeal cancer, non-small cell lung cancer, hepatocellular carcinoma, malignant peripheral nerve sheath tumors and mantle cell lymphoma. [score:3]
However, there was no significant difference in the expression of miR-29b (Fig. 1B). [score:3]
In cervical cancer, it was reported that miR-29 targets the HPV-related gene (17). [score:3]
The reason for this is not yet clear, and further elucidation of the molecular mechanisms controlling the expression of miR-29 family miRNAs in cancer cells is necessary. [score:3]
Although the miR-29b-1/miR-29a and miR-29b-2/miR-29c formed cluster miRNAs are located within the same chromosomal regions, and share transcriptional units, the expression of miR-29b was not reduced in cancer tissues compared to normal tissues in this study. [score:2]
Previous reports have indicated that the miR-29 family plays a dominant role in the regulation of extracellular matrix (ECM) genes. [score:2]
Thus, it will be necessary to identify the transcription factors that contribute to the silencing of the miR-29 family in cervical SCC. [score:1]
We evaluated the expression of miR-29 -family miRNAs in 18 clinical specimens and 11 non-cancer tissues. [score:1]
The sequences and chromosomal locations of miR-29 -family miRNAs (miR-29a/b/c) in the human genome are shown in Fig. 1A. [score:1]
These miRNAs were clustered at two different human genomic loci, miR-29b-1 and miR-29a at 7q32.3 and miR-29b-2 and miR-29c at lq32.2. [score:1]
Analysis of the promoter region of miR-29 family miRNAs in the human genome has revealed that the miR-29b-1/miR-29a promoter region contains two putative E-box sites (MYC -binding sites), a Gli -binding site and four NF-KB -binding sites (18). [score:1]
[1 to 20 of 25 sentences]
35
[+] score: 93
The fibrosis -associated downregulation of miR-29 is of particular interest because these miRNAs target the transcripts of a large number of ECM proteins including several collagens, elastin, and fibrillin. [score:6]
Consistent with prior reports [21, 23], we observed downregulation of miRNAs belonging to the miR-29 family (miR-29a, miR-29b, and miR-29c) among a larger set of dysregulated miRNAs in the livers of mice treated with CCl [4] for up to eight weeks (Fig 1B and 1C). [score:5]
Antisense -mediated inhibition of miR-29 also strongly de-repressed endogenous type I collagen expression (S1 Fig). [score:5]
miR-29 family members have been shown to inhibit the synthesis of collagen and other important ECM proteins and the anti-fibrotic effects of miR-29 expression in multiple tissues including liver, lung, heart, and muscle have been demonstrated [10, 23, 28– 30]. [score:5]
Second, miR-29 is detectably expressed in normal hepatocytes and we observed that exposure of these cells to the profibrotic cytokine TGF-β decreased expression of miR-29a/b/c (Fig 1D). [score:5]
While such tight regulation of miR-29 production could limit the utility of this approach in settings where supraphysiologic miRNA levels are required to reach the therapeutic threshold, it also provides natural protection against potential toxicity from virally-derived miR-29 overexpression. [score:4]
The mutations created in each of the miR-29 target sites in the luciferase reporter construct used in b are shown in red. [score:4]
Third, the importance of maintaining normal miR-29 expression in hepatocytes is highlighted by a previous report which showed that hepatocyte specific knockout of miR-29 was associated with increased susceptibility to liver fibrosis [28]. [score:4]
Numerous extracellular matrix (ECM) proteins including several collagens, elastin and fibrillin are validated targets of the miR-29 family [10– 15], which includes miR-29a, miR-29b and miR-29c. [score:3]
Primary and mature miR-29 expression levels in murine liver and isolated human hepatocytes. [score:3]
S2 Fig In vitro and in vivo miR-29 expression levels associated with AAV. [score:3]
Nevertheless, use of a clinically relevant delivery system to restore hepatic miR-29 expression and reverse existing liver fibrosis, the likely clinical scenario in which this therapy would be implemented, has not yet been demonstrated. [score:3]
In vitro and in vivo miR-29 expression levels associated with AAV. [score:3]
This is significant because activated stellate cells and their derivatives are responsible for most if not all of the ECM production in liver fibrosis and restoration of normal miR-29 expression in activated stellate cells could repress ongoing ECM protein synthesis and thus provide significant anti-fibrotic protection. [score:3]
While elucidation of specific therapeutic mechanisms and further refinement of delivery methods will aid ongoing efforts to develop clinically viable strategies, the antifibrotic protection associated with parenchymal transgene expression suggests that therapeutic miR-29 delivery may be effective in treating a variety of fibroproliferative disorders. [score:3]
eGFP treated mice exhibited normal hepatic miR-29 expression (Fig 3C), lacked any histologic evidence of fibrosis (Fig 3D and 3E) and had only a slight increase in total collagen (Fig 3F). [score:3]
Mutating the binding sites or inhibiting endogenous miR-29 with antisense oligonucleotides de-repressed a COL1A1 3' UTR luciferase reporter construct upon transfection into primary fibroblasts (S1 Fig). [score:3]
miR-29, a potent regulator of ECM production, is down regulated in fibrotic livers and TGF-β treated hepatocytes. [score:3]
Here we report that AAV -mediated restoration of miR-29 expression in a mouse mo del of liver fibrosis provides significant anti-fibrotic protection. [score:3]
Liver injury and associated hepatocyte proliferation are known to rapidly dilute AAV vector genomes [27] and 8 weeks after injection (12 weeks total CCl [4]) viral genomes were very low in both control and miR-29 treated animals (Fig 4B) and miR-29a expression was repressed in both scAAV8. [score:3]
scAAV8 transduction and miR-29 expression levels in murine liver. [score:3]
We determined that miR-29 family members are also expressed in purified human hepatocytes and that stimulation of hepatocytes with TGF-β, a potent fibroproliferative cytokine, resulted in decreased mature miR-29a/b/c without a significant reduction in pri-miR-29a (Fig 1D), similar to the pattern observed in liver samples of CCl [4] treated mice. [score:3]
The primary transcript of miR-29a was significantly increased after 1 and 4 weeks of CCl [4] exposure suggesting that altered processing and/or decreased stability of the mature miRNA contributes to the observed reduction in mature miR-29 (Fig 1C). [score:1]
miR29. [score:1]
miR-29. [score:1]
AAV vectors are being used in several clinical trials [24] and our data provides the first evidence that a clinically relevant miR-29 delivery platform can reverse established liver fibrosis. [score:1]
Our findings highlight the potential of clinically viable miR-29 -based therapies for treating established organ fibrosis in chronically injured tissues. [score:1]
In humans and mice these miRNAs are encoded by two distinct transcripts (miR-29a/miR-29b-1 and miR-29b-2/miR-29c) and fibrosis -associated decreases in mature miR-29 levels have been reported in diverse tissues [10, 16– 22]. [score:1]
In support of this possibility, the transfer of functional miRNAs, including miR-29, to other cells via gap junctions or exosomes has been described [33– 38]. [score:1]
To facilitate therapeutic delivery of miR-29 to injured livers we adapted a previously described AAV vector system [25]. [score:1]
Importantly though, the residual genomes were sufficient to maintain normal miR-29a levels (Fig 3C) and it therefore appears that processing of virally-derived miR-29 transcripts can counteract the decrease in endogenous miR-29 levels that otherwise occurs in the setting of chronic liver injury. [score:1]
eGFP was sufficient to maintain normal miR-29 levels and thereby block de novo fibrosis in the setting of chronic liver injury. [score:1]
miR-29 family members indicated with arrows. [score:1]
Coordinated Regulation of Extracellular Matrix Synthesis by the MicroRNA-29 Family in the Trabecular Meshwork. [score:1]
Activated stellate cells and their derivatives are responsible for most if not all of the ECM production in liver fibrosis and previous studies have shown that inflammatory stimuli decrease miR-29 levels in purified stellate cells [21]. [score:1]
[1 to 20 of 35 sentences]
36
[+] score: 84
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
miR-29b targets DNA methyltransferase (DNMT) isoforms and inhibition of miR-29b expression may lead to hypermethylation and epigenetic silencing of several tumor suppressors [7] (Table  2). [score:9]
The TCL1 oncogene is a target of the miR-29 family and in CLL patients low miR-29c expression was associated with high TCL1 expression [30]. [score:7]
Inhibition of miR-29b promoted DNA hypermethylation in AML and contributed to methylation status in AML cells, suggesting its potential role as a therapeutic target in AML. [score:5]
miR-29b expression was inversely associated with MLLT11 expression, which is a poor prognostic biomarker for AML patients. [score:5]
Consistent with this, altered expression of MCL-1 and CDK6 was reported in primary AML blasts following ectopic expression of miR-29b [88]. [score:5]
Highlighted in red and green are the miRNAs that are found most frequently associated with an unfavorable or favorable outcome, respectively, across different human leukemiasThe miR-29 family, which includes miR-29a, miR-29b and miR-29c, was also significantly down-regulated in a subset of CLL patients and was associated with an unfavorable prognosis. [score:4]
The miR-29 family was significantly down-regulated in a subset of CLL patients and was associated with an unfavorable prognosis [7]. [score:4]
miR-29b targeted DNA methyltransferase DNMT3A, DNMT3B, and Sp1 (a transcriptional regulator of DNMT1) [89]. [score:4]
Highlighted in red and green are the miRNAs that are found most frequently associated with an unfavorable or favorable outcome, respectively, across different human leukemias The miR-29 family, which includes miR-29a, miR-29b and miR-29c, was also significantly down-regulated in a subset of CLL patients and was associated with an unfavorable prognosis. [score:4]
The miR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 represent the most frequently deregulated miRNAs reported in CLL, and these microRNAs have been associated with disease progression, prognosis, and drug resistance [1] (Table  1). [score:4]
It is worth noting that miR-146a expression was reversely correlated with prognosis in both ALL and AML patients [65] while the opposite role of miR-29b in AML prognosis has been reported. [score:3]
In addition, miR-29a and miR-29b affected the expression of genes involved in apoptosis, cell cycle progression, and cellular proliferation. [score:3]
The same is true for miR-29b in that AML patients with low miR-29b expression had an unfavorable overall survival [110]. [score:3]
miR-29 family members miR-29a, miR-29b, and miR-29c have acted as oncogenes and tumor suppressors in myeloid malignancies [88]. [score:3]
In 40 non-M3 AML patients, high expression of miR-26a, miR-29b and miR-146a was associated with short overall survival [65]. [score:3]
In addition, evidence showed that miR-29 targets the oncogene T-cell leukemia 1 gene, TCL1A, which was overexpressed in patients with unmutated immunoglobulin heavy chain variable regions (IgVH) and involved in translocations and inversions characteristic of mature T-cell prolymphocytic leukemia (PLL). [score:3]
Analyzing 53 AML patients, increased expression of miR-26a, miR-29b, miR-146a, and miR-196b was associated with an unfavorable overall survival [65]. [score:3]
The ability of miR-29b to target DNA methyltransferases may explain the role of miR-29b in decitabine response. [score:3]
Low miR-29b and elevated MLLT11 expression are found in patients with poor overall survival [110], but whether the cooperation between miR-29b and MLLT11 caused the poor prognosis needs to be further confirmed. [score:3]
Higher expression of miR-29b was found in older AML patients with single-agent decitabine response compared with non-response patients [132]. [score:2]
Recent evidence showed elevated expression of the miR-29 family (miR-29a, miR-29b and miR-29c), miR-150 and miR-155 in CLL-derived exosomes compared to healthy donors [162]. [score:2]
A distinct miRNA signature is characterized by an alteration of miR-29, miR-125, miR-142, miR-146 and miR-155 expression, which has been reported to play a role in AML progression and pathogenesis [87]. [score:1]
Interestingly, injection of precursor miR-29b oligonucleotides in mice engrafted with K562 cells reduced their tumor sizes [87]. [score:1]
[1 to 20 of 23 sentences]
37
[+] score: 77
Our data also revealed that ITGB1 is a novel target of miR-29 s. We therefore hypothesized that hTERT can enhance ITGB1 expression, which occurs, at least in part, by the down regulation of miR-29a expression, to promote the invasion and metastasis of gastric cancer cells. [score:8]
In addition, we also found that miR-29b(c) could directly target ITGB1 and that the overexpression of miR-29b(c) could decrease ITGB1 at the protein level (Supplementary Fig. 3). [score:6]
Considering these results, we concluded that miR-29 reduced the expression of ITGB1 via the direct targeting of the 3′UTR of ITGB1. [score:6]
The expression of miR-29 was found to be abnormal in a variety of tumor cells and its expression is closely linked to that of a number of oncogenes, as it is involved in tumor progression 32 33. [score:5]
hTERT may regulate ITGB1 expression via miR-29, which binds to the 3′UTR of ITGB1. [score:4]
These results indicated that miR-29 may play a causal role in the process of hTERT regulation of ITGB1expression and the process of GC metastasis. [score:4]
Bioinformatics analyses revealed that miR-29, miR-124, miR-183 and miR-506 might regulate the expression of ITGB1. [score:4]
The above results indicated that miR-29 family members may play a critical role in the regulation of ITGB1 expression by hTERT. [score:4]
As mentioned above, our results indicated that hTERT may regulate ITGB1 expression via miR-29, but this hypothesis needed confirmation by further experiments. [score:4]
Interestingly, miR-29 was the only miRNA that was found to regulate ITGB1 expression by bioinformatics analyses. [score:4]
We also found by western blot that the protein levels of ITGB1 decreased after the introduction of miR-29 family members mimics, which indicates that miR-29 reduced the protein expression level of ITGB1 (Fig. 2d and Supplementary Fig. 3). [score:3]
We then examined the expression of miR-29 and ITGB1 in the tumors of patients with gastric cancer. [score:3]
Our data also demonstrated that ITGB1 is a novel target of miR-29 s. ITGB1, which is an important oncogene, plays a critical role in tumor invasion and metastasis. [score:3]
The results showed that the expression of miR-29 s in GC tissues was significantly lower than that in paracancerous tissues (Fig. 3a and Supplementary Fig. 4). [score:3]
However, the correlation between tumor phenotypes and miR-29b or miR-29c was not statistically significant, despite results showed that miR-29b and miR-29c was highly expressed in GC patients (Supplementary Fig. 4 and Supplementary Fig. 5). [score:3]
To determine whether miR-29 modulates ITGB1 directly, we cloned the 3′UTR of ITGB1 into luciferase reporters and co -transfected either miR-29 (miR-29a, miR-29b and miR-29c) or a control mimic. [score:2]
MiR-29 can also target a variety of oncogenes, which results in a decrease in the proliferation of tumor cells as well as metastasis 34 35. [score:2]
To investigate whether the loss of miR-29a would suppress the proliferation of GC cells, a proliferation curve generated from an MTT assay showed that miR-29 significantly inhibited the proliferation of human gastric cancer SGC-7901 cells in vitro (Fig. 4e). [score:2]
We also generated a mutant reporter (Luc-ITGB1-mu), in which the predicted miR-29 binding site to ITGB1 was mutated (ITGB1-mu) (Fig. 2b). [score:1]
The miR-29 family includes miR-29a, miR-29b and miR-29c 31. [score:1]
The three miRNAs within the miR-29 family contain the same seed region AGCACCA. [score:1]
The miR-29 family is composed of three family members (miR-29a, miR-29b and miR-29c), and they all share the same seed region. [score:1]
However, only miR-29a was closely associated with lymph node metastasis, while miR-29b and miR-29c were not significantly associated with any clinical data (Supplementary Fig. 5 and Table 1). [score:1]
Then, it was revealed that the luciferase activity was partially relieved after transfection with miR-29 mimics (Fig. 2c), which suggests that miR-29 decreased the luciferase activity of Luc-ITGB1 but did not affect Luc-ITGB1-mu. [score:1]
We investigated the expression levels of miR-29 s in 58 GC tissues and in paracancerous tissues by qRT-PCR. [score:1]
[1 to 20 of 25 sentences]
38
[+] score: 76
Inverse correlation of up-regulated miR-29b as a methylation suppressor, with expression of DNMT3A in the non-aggressive cell lineThe miRNA (miR)-29 family (29a, 29b, and 29c) has intriguing complementarities to 3′-UTRs of DNA methyltransferase (DNMT) 3A and -3B (de novo methyltransferases), two key enzymes involved in DNA methylation, that are frequently up-regulated in solid tumors and associated with the poor prognosis. [score:11]
This finding also suggests that a combination of chemical demethylation treatment with DNMT inhibitors (decitabine or azacitidine) with enforced expression of miR-29b in breast cancer might have a synergistic hypomethylation effects that may result in a better disease response in breast cancer along with more robust gene re -expressions especially for the epigenetically silenced TSGs. [score:9]
Additionally, in SKBR3 cell line with up-regulation of miR-29b and steady down-regulation of DNMT3A, an almost 10 fold increase of number of the differentially expressed genes after demethylation treatment was found compared to MDA-MB231 (Fig. 8e vs. [score:8]
Inverse correlation of up-regulated miR-29b as a methylation suppressor, with expression of DNMT3A in the non-aggressive cell line. [score:8]
It was shown that expression of miR-29s, especially miR-29b, is directly targeting both DNMT3A and -3B and is inversely correlated to their expression in lung cancer tissues [69], [70]. [score:8]
In SKBR3, along with the over -expression of miR-29b, miR-455 was also up-regulated whereas miR-152 did not show any significant change. [score:6]
To understand the molecular mechanism of miR-29b deregulation, we analyzed the co -expression profiles of two important upstream suppressors (miR-152 and miR-455) [71]. [score:6]
In the present study, after demethylation treatment with DAC, the expression of miR-29b was inversely correlated with DNMT3A expression in SKBR3 (Fig. 8). [score:5]
Both of miR-29b suppressors, miR-152 and miR-455, were over-expressed in MDA-MB231 cell line. [score:5]
These data suggest a prominent inhibitory effect of miR-152 rather than miR-455 on the regulation of miR-29b emphasizing the controlling effect of miRNAs in certain types of cancer. [score:4]
Role of has-miR-29b (MIRN29b) as a methylation suppressor during chemical methylation treatment. [score:3]
The presented approach might become a useful mo del for other human solid tumor malignancies, alone or in combination with other treatments such as enforced targeted therapies for miR-29b and/or IL6 (IL6 or IL6 receptor antagonists). [score:3]
[1 to 20 of 12 sentences]
39
[+] score: 75
Regarding the molecular mechanism underlying the oncolytic adenovirus -mediated MCL1 suppression, we demonstrated that OBP-301 upregulated MCL1 -targeted miRNAs, such as miR-15, miR-16 and miR-29, and miR-29 overexpression efficiently suppressed MCL1 expression in human osteosarcoma cells. [score:14]
OBP-301 -mediated microRNA-29 up-regulation suppresses MCL1 expression and enhances chemotherapy -induced apoptosis. [score:8]
OBP-301 -mediated microRNA-29 upregulation suppresses MCL1 expression through E2F1 activation. [score:8]
Regarding the function of miR-29 in tumor development, the miR-29 family is frequently downregulated in human cancers 42 including osteosarcomas 43, suggesting the tumor-suppressive role of the miR-29 family. [score:7]
Moreover, miR-29 negatively regulates the expression of stemness-related markers, such as Oct3/4, Sox2 and Nanog, and subsequently suppresses the proliferation, sphere formation and chemoresistance of human osteosarcoma stem cells 43. [score:6]
The present study demonstrated that a tumor-specific replication-competent oncolytic adenovirus OBP-301 induced miR-29 upregulation via E2F1 activation, which resulted in suppression of anti-apoptotic BCL2 family protein MCL1 in chemotherapy-resistant human osteosarcoma cells. [score:6]
To investigate the underlying mechanism of OBP-301 -mediated MCL1 suppression, we determined whether OBP-301 upregulates MCL1 -targeted miRNAs (miR-15, miR-16, miR-29) via E2F1 activation in human osteosarcoma cells. [score:6]
miR-15, miR-16, and miR-29 suppress MCL1 expression in human malignant tumor cells 22. [score:5]
Moreover, a recent report has suggested that miR-16 and miR-29 are downregulated and miR-15 is associated with chemosensitivity in human osteosarcoma cells 23. [score:4]
How to cite this article: Osaki, S. et al. Ablation of MCL1 expression by virally induced microRNA-29 reverses chemoresistance in human osteosarcomas. [score:3]
Our findings suggest that miR-29 -mediated suppression of anti-apoptotic factor MCL1 was a critical factor for the enhancement of chemosensitivity in human osteosarcoma cells. [score:3]
These results suggest that OBP-301 enhances chemotherapy -induced apoptosis through miR-29 -mediated MCL1 suppression in human osteosarcoma cells. [score:3]
In fact, our data demonstrated that administration of a miR-29 mimic enhanced the chemotherapy -induced apoptosis like MCL1 siRNA. [score:1]
Therefore, OBP-301 -mediated miR-29 activation may have broad therapeutic potential in addition to chemosensitization through MCL1 depletion. [score:1]
[1 to 20 of 14 sentences]
40
[+] score: 74
Columns A and B contain the number of target genes of miR-29b-3p and miR-520c-3p Since these results based mainly on target genes of miR-29b-3p, we repeated the analysis considering also target genes with lower supporting evidence and thus increased the number of target genes from the other two miRNAs in the analysis (Additional file 2: Table S4). [score:9]
We defined target genes using miRTarBase [20] and, by restricting to only high confidence target genes, identified 84 genes (77 target genes for miR-29b-3p and 7 for miR-520c-3p, no target gene was reported for miR-1183). [score:9]
Columns A and B contain the number of target genes of miR-29b-3p and miR-520c-3pSince these results based mainly on target genes of miR-29b-3p, we repeated the analysis considering also target genes with lower supporting evidence and thus increased the number of target genes from the other two miRNAs in the analysis (Additional file 2: Table S4). [score:9]
NEDD9 is also a validated target gene of the ACM-specific miRNA miR-29-3p and of miR-18a-5p, a miRNA also more than two-fold up-regulated in ACM which regulation did however not reach significance levels (adjusted p-value = 0.08). [score:7]
The resulting p-values from these tests are listed in Table  5. Of these, the average M-values of miR-29b-3p target genes and the combination of all of the miRNAs’ target genes were significant suggesting that the identified miRNAs are functional and that a tendency of repression is already detectable on mRNA levels. [score:5]
n. a. : test not performed Differential expression was confirmed for miR-29b-3p but failed for miR-520c-3p, whose expression was below the detection levels in all tested samples (Table 2). [score:5]
Recently, also desmocollin-2 (DSC2), was identified as a direct target of miR-29b in mouse keratinocytes [36], suggesting a potential direct involvement of this miRNA in ACM. [score:5]
We identified the 3 miRNAs miR-520c-3p, miR-29b-3p and miR-1183 to be significantly differentially expressed at a 5% FDR (i. e. with a p [adj] < 0.05; Fig.   1b), all of them being more than 4-fold higher expressed in ACM than in control samples (Table  2; the complete results are provided in Additional file 1). [score:5]
n. a. : test not performedDifferential expression was confirmed for miR-29b-3p but failed for miR-520c-3p, whose expression was below the detection levels in all tested samples (Table 2). [score:5]
We also found evidence for a potential contribution of miR-29b-3p to ACM development by targeting proteins involved in extracellular matrix organization. [score:4]
Summarizing, we identified 3 miRNAs (miR-520c-3p, miR-29b-3p and miR-1183) to be differentially expressed between ACM patient-derived and control CStCs and confirmed the de-regulation of miR-29b-3p in an extended data set including samples from in total 8 ACM patients and 5 controls. [score:4]
Two of them (miR-29b and miR-1183) have previously been related to a pathway associated with ACM or other cardiac diseases. [score:3]
miRNAs from the miR-29 family have been shown to play a role in cardiac fibrosis after myocardial infarction targeting collagen, fibrillin and elastin genes [35]. [score:3]
Using our mirhostgenes R-package we identified potential host genes for 2 of the: the two lincRNAs C1orf132 and AC058791.1 for miR-29b-3p and the protein coding gene SP4 for miR-1183. [score:1]
[1 to 20 of 14 sentences]
41
[+] score: 70
By contrast, the expression of its two main receptors, TNFRSF1A (TNF-R1) and TNFRSF1B (TNF-R2), is expected to be upregulated at ST and IT as a result of the downregulation of mmu-miR-690, -805 and -574-5p (at ST) and mmu-miR-29b, -29c, -152, -218 and 690 (at IT). [score:9]
MiR-29 has been reported to be involved in various human cancers [54]- [57] and in tumour suppression by targeting the T-cell leukemia/lymphoma 1 (Tcl1) oncogene mRNA [54], by reverting DNA methylation by targeting DNA methyltransferases 3A (Dnmt3a) and 3B (Dnmt3b) mRNA [58] and by regulating p53 pathway through Cdc42 and p85α [59]. [score:7]
At IT, expressions of mmu-miR-29b, -29c, -152, -200a and -690 that potentially target laminin γ chain LAMC1 are inhibited. [score:7]
Evidence that miR-29b attenuates expression of collagen genes by blocking their mRNA translation has already been described [103], [104] and an inverse correlation between the expression of mmu-miR-29b and -29c and the synthesis of collagen type I and III is further evidenced here. [score:7]
For miR-146b, which was up-regulated at the 3 time-points, and for miR-29b and -29c, which are thought to be regulators of extracellular matrix remo delling and are downregulates at IT and LT, increasing concentrations were tested to evaluate the sensitivity and the specificity of the assays (Figure 4). [score:5]
At IT, repression of mmu-miR-29b and -29c should induce an increase expression of MMP-15 and -24 (Figure 4A-D) but also of MMP-2. Moreover, these miRNAs can prospectively target MMP-2 and MMP-15. [score:5]
Downregulation of mmu-miR-29 members is strongly correlated with (WP458) especially with the extracellular matrix components directly involved in fibrosing processes. [score:5]
This suggests that downregulation of mmu-miR-29 members coud be one of the causes of the subepithelial fibrosis observed in chronic asthma. [score:4]
Despite their close sequence similarity, miR-29 members showed different inhibitory patterns. [score:3]
0016509.g004 Figure 4Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
Dose-response analysis of the effect of miR-29b, -29c and -146b on their predicted target in lung cells. [score:3]
This hypothesis is further reinforced by our functional data showing that 3′UTRs of both human and mouse Mmp-15 and -24 are similarly targeted by miR-29b and -29c. [score:3]
We selected 8 miRNAs (those described in Tables 4 and 5 and mmu-miR-29b) and, at least, 2 of their potential targets for functional testing in vitro (Figures 4 and 5). [score:3]
Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
As discussed further in the section, mmu-miR-29 appears to be a miRNA family displaying a protective role against fibrosis. [score:1]
MiR-29b mimic reduced efficiently and dose -dependently the luciferase activity from constructs containing the 3′UTRs of mouse Mmp-15 and Mmp-24 while miR-29c had only a limited effect at high concentration on Mmp-24 3′UTR (Figure 4A, B). [score:1]
MiR-29 regulates also muscle cell differentiation probably, in part, under a feed-back control of NF-κB-YY1 pathway [61]. [score:1]
[1 to 20 of 17 sentences]
42
[+] score: 67
The Mir29b‐1 gene was targeted for mutation using custom‐made Transcriptional Activator‐Like Effector Nucleases (TALENs, Cellectis Bioresearch) which targeted the sequence TTTAAATAGT GATTGTC tagcaccatttgaaa TCAGTGTTCTTGGTGGA where each TALEN monomer binds the target sequences underlined on opposite strands, separated by a spacer (lowercase). [score:7]
Neuromodulin (Gap43), another predicted target of miR‐29 that can reduce eNOS activation by inhibiting calcium/calmodulin, was up‐regulated from 2.9 FPKM in wild‐type rats to 6.8 FPKM in Mir29b‐1/a [−/−] rats (P = 0.04) according to the RNA‐seq analysis of gluteal arterioles (Dataset EV3). [score:6]
Figure 4miR‐29 regulates genes involved in determining NO levels, including Lypla1 Mir29b‐1/a mutation in rats led to differential expression of several genes relevant to the regulation of NO bioavailability in gluteal arterioles. [score:6]
The expression profiles of 18,615 detected genes correctly clustered the samples by genotype, indicating the Mir29b‐1/a mutation had substantial and reproducible effects on the gene expression profile in gluteal arterioles (Appendix Fig S7). [score:5]
Of the 12 predicted miR‐29 target genes with known involvement in NO regulation (Dataset EV2), lysophospholipase I (Lypla1) was up‐regulated from 65 FPKM in wild‐type rats to 104 FPKM in Mir29b‐1/a [−/−] rats (P = 0.005, adjusted P = 0.05; Fig  4A). [score:5]
Mir29b‐1/a mutation in rats led to differential expression of several genes relevant to the regulation of NO bioavailability in gluteal arterioles. [score:4]
Intraluminal delivery of anti‐miR‐29b‐3p in arterioles from non‐ DM human subjects or rats or targeted mutation of Mir29b‐1/a gene in rats led to impaired EDVD and exacerbation of hypertension in the rats. [score:4]
Of the 286 genes relevant to NO regulation (Dataset EV2), 179 were detected in the RNA‐seq analysis, of which 32 were differentially expressed between Mir29b‐1/a [−/−] and wild‐type littermates (adjusted P < 0.05; Fig  4A). [score:3]
The mutation of Mir29b‐1/a gene led to preferential differential expression of genes related to nitric oxide including Lypla1. [score:3]
The residual miR‐29b‐3p might be expressed from the separate Mir29b‐2 gene. [score:3]
A mutant rat line, SS‐Chr 13BN‐ Mir29b1 [em1Mcwi], hereafter referred to as Mir29b‐1/a mutant or Mir29b‐1/a [−/−] rat, was generated, having a TALEN‐induced 4‐bp deletion within the TALEN target spacer, TTTAAATAGT GATTGTC tagca—ttgaaa TCAGTGTTCTTGGTGGA confirmed by Sanger sequencing and predicted to disrupt the rno‐miR‐29b‐3p sequence. [score:3]
We used a Transcriptional Activator‐Like Effector Nucleases (TALEN) method to target the Mir29b‐1/a gene on the genetic background of SS‐Chr13 [BN] rats (Geurts et al, 2010). [score:2]
Taken together, these data indicated the mutant rat, which we designated Mir29b‐1/a [−/−], was a mo del of robust miR‐29a‐3p and miR‐29b‐3p knockdown. [score:2]
Mir29b‐1/a mutation preferentially influenced genes relevant to the regulation of NO bioavailability. [score:2]
miR‐29b‐3p mimic increased, while anti‐miR‐29b‐3p or Mir29b‐1/a gene mutation decreased, nitric oxide levels in arterioles. [score:2]
The genes shown were differentially expressed between Mir29b‐1/a [−/−] rats (KO) and wild‐type (WT) littermates with adjusted P‐values < 0.05. [score:2]
Real‐time PCR analysis did not reproducibly detect Gap43 mRNA in the small amount of gluteal arteriole samples but confirmed Gap43 mRNA was up‐regulated in the carotid artery of Mir29b‐1/a [−/−] rats (Appendix Fig S8). [score:1]
The development of hypertension was significantly exacerbated in Mir29b‐1/a [−/−] rats. [score:1]
miR‐29b is encoded by Mir29b‐1 and Mir29b‐2 genes. [score:1]
Four nucleotides overlapping with the seed region of miR‐29b‐3p were deleted in the SS‐Chr 13BN‐ Mir29b1 [em1Mcwi] (i. e., Mir29b‐1/a mutant or Mir29b‐1/a [−/−]) rat. [score:1]
Abundance of miR‐29b‐3p and miR‐29a‐3p in the EC elute from the gluteal arterioles of Mir29b‐1/a [−/−] rats. [score:1]
We developed Mir29b‐1/a mutant rats to further examine the role of miR‐29 in normal endothelial function. [score:1]
We identified and established a colony of rats with deletion of four base pairs in the genomic segment of the Mir29b‐1/a gene that encodes nucleotides 6–9 in the sequence of mature miR‐29b‐3p (Fig  2C). [score:1]
Treatment with Lypla1 si RNA improved EDVD in arterioles obtained from T2 DM patients or Mir29b‐1/a mutant rats or treated with anti‐miR‐29b‐3p. [score:1]
[1 to 20 of 24 sentences]
43
[+] score: 66
After overexpression of miR-29 was confirmed, we examined mRNA expression for 23 of 25 predicted target genes, excluding 2 with no defined function. [score:7]
Based on computational predictions from both miRBase and TargetScan, there are a total of 25 predicted target mRNAs for miR-29 within our data displaying decreased expression. [score:7]
For this specific cell type in vitro, one of many in the developing lung, miR-29 was shown to directly modulate expression of predicted target mRNAs. [score:6]
A number of genes identified as predicted miR-29 targets were also validated in a miR-29 overexpression mo del using BASC cells. [score:5]
Figure 4 Effects of hyperoxia on the expression of miR-29 and predicted mRNA targets. [score:5]
Expression of the MiR-29 family is increased during normal mouse lung development, and is known to play an important role in the pathogenesis of lung diseases such as pulmonary fibrosis [28, 29]. [score:5]
MiR-29 targeted gene expression in BASC cells following transfection with miR-29 mimics. [score:5]
Direct miR-29 targets were further validated in vitro using bronchoalveolar stem cells. [score:4]
To investigate direct targets of miR-29, we identified candidate mRNAs by overlapping computational prediction with opposite expression patterns in our miRNA and mRNA data. [score:4]
MiR-29 was prominently increased in the lungs of hyperoxic mice, and several predicted mRNA targets of miR-29 were validated with real-time PCR, western blotting and immunohistochemistry. [score:3]
MiR-29 was then overexpressed in vitro by transfection of miR-29a and miR-29c mimics into bronchoalveolar stem cells (BASC), isolated and cultured in our laboratory as previously described [31]. [score:3]
Figure 5 Validation of predicted miR-29 targets. [score:3]
Relative miR-29 expression in BASC cells after transfection of miR-29 mimics. [score:3]
MiR-29 modulates predicted target mRNAs in mouse bronchoalveolar stem cells (BASCs). [score:2]
MiR-29 modulates development in the neonatal mouse lung exposed to hyperoxia through Ntrk2. [score:1]
Analysis of normal lung has shown the presence of miR-29 in subsets of cells in the alveolar wall and entrance to the alveolar duct [28]. [score:1]
Transfection of miR-29 mimics. [score:1]
After 24 hours following transfection, mRNAs were isolated and miR-29 expression measured by RT- PCR. [score:1]
[1 to 20 of 18 sentences]
44
[+] score: 64
Later Wang et al. confirmed that nuclear factor κB (NF-κB) up-regulated YY-1 resulted in the recruitment of EZH2 and HDAC1 to the miR-29 promoter in myoblasts, leading to the down-regulation of miR-29 and maintaining cells in an undifferentiated state. [score:7]
The miR-29, which targets DNMT3, is down-regulated by HDACs in AML. [score:6]
The regulatory mo dels of miR-29 and other miRNAs suggest that the well-known transcription factor MYC, which is one of the most commonly overexpressed oncogenes in cancer, has some functions in the aspect of epigenetic regulation (Figure 1). [score:5]
Likewise, HDACs can induce miR-29 silencing in acute myeloid leukemia (AML), which in turn increases the expression of its target gene DNMT3 [15, 44]. [score:5]
The inhibition of NF-κB activity by inhibitor of nuclear factor κB α (IκBα) would remarkably decrease the level of YY1, and consequently neither EZH2 nor HDAC1 could be recruited to miR-29 promoter [14]. [score:5]
Interestingly, HDAC inhibition could restore the expression of miR-29b in only one third of chronic lymphocytic leukemia (CLL) samples [16]. [score:5]
Therefore, the down-regulation of miR-29b is MYC -dependent [15]. [score:4]
The miR-29 family, which targets DNA methyltransferase 3 (DNMT3), is the first reported epi-miRNA, and is also the most extensively studied miRNA that is regulated by histone modification [9]. [score:4]
Without MYC, however, the lack of binding of HDAC3 and EZH2 to the miR-29 promoter results in increased miR-29 expression [10]. [score:3]
Therefore, miR-29 is restored and in turn targets YY1 to ensure differentiation. [score:3]
In addition to these effects in solid tumors, miR-29 deregulation by epigenetic mechanisms can also be found in human hematological cancers. [score:2]
Besides the crosstalk between DNA and histone methylation, indirect crosstalk between DNA methylation and histone deacetylation also occur through miRNA mediation, such as miR-1 and miR-29. [score:2]
For instance, MYC can induce epigenetic regulation of miR-29 repression through histone deacetylation and tri-methylation in B-cell lymphomas (BCL), since it can recruit histone deacetylase 3 (HDAC3) and enhancer of zeste homolog 2 (EZH2) to the miR-29 promoter, forming a MYC/HDAC3/EZH2 co-repressor complex. [score:2]
This study demonstrated that NF-κB might be an upstream regulator of the epigenetic status of miR-29 in skeletal myogenesis. [score:2]
Notably, MYC can directly bind to miR-29b promoter and stimulate the activity of NF-κB/Sp1/HDAC. [score:2]
For the other two-thirds of CLL cases, the identification of other histone modifications that contribute to epigenetic silencing of miR-29b still needs to be accomplished. [score:1]
Therefore, MYC plays an indispensable role in the epigenetic repression of miR-29 by inducing histone deacetylation and histone tri-methylation. [score:1]
Subsequently, various histone modifying enzymes such as EZH2 and HDACs can be recruited to the miR-29b promoter. [score:1]
Meanwhile, EZH2 can also repress miR-494 to create a positive feedback loop, which in turn increases MYC abundance and then sustains miR-29 repression in BCL [10]. [score:1]
However, the constitutively activated NF-κB–YY1 in rhabdomyosarcoma (RMS) could induce epigenetic repression of miR-29 and thereby block differentiation. [score:1]
For instance, in acute myeloid leukemia (AML), the transcriptional complex NF-κB/Sp1 can interact with HDAC1 and HDAC3 to form the NF-κB/Sp1/HDAC complex on miR-29b enhancer, which resulted in the silencing of miR-29b. [score:1]
In summary, binding of MYC or NF-κB on the miR-29 promoter seems to be a primary event in miR-29 silencing, and thereby induces the initial step of its chromatin modification. [score:1]
[1 to 20 of 22 sentences]
45
[+] score: 61
The expression of maternally expressed gene 3 (MEG3), which is down-regulated in HCC, may be regulated by microRNA-29 low expression in tumor (LET) is also down-regulated in HCC and contributes to hypoxia -mediated invasionATB- lncRNA activated by TGF-β is highly expressed in HCC and strongly associated with poor prognosis in HCC patientsTherefore, the discovery of the impact of non-coding RNAs in HCC and CRC has led to useful applications in the clinical management of HCC, future treatment being represented by a cocktail of T-cell modulators and vaccines enriched with the molecular targets of blockers in cancer-signaling pathways [68, 89; 92- 97] In contrast to miRNAs, which were largely studied for their roles in carcinogenesis, lncRNAs are less described. [score:18]
The expression of maternally expressed gene 3 (MEG3), which is down-regulated in HCC, may be regulated by microRNA-29 low expression in tumor (LET) is also down-regulated in HCC and contributes to hypoxia -mediated invasionATB- lncRNA activated by TGF-β is highly expressed in HCC and strongly associated with poor prognosis in HCC patients Therefore, the discovery of the impact of non-coding RNAs in HCC and CRC has led to useful applications in the clinical management of HCC, future treatment being represented by a cocktail of T-cell modulators and vaccines enriched with the molecular targets of blockers in cancer-signaling pathways [68, 89; 92- 97] In contrast to miRNAs, which were largely studied for their roles in carcinogenesis, lncRNAs are less described. [score:18]
We have revealed common small non-coding RNA molecules (miR-26a, miR-195, miR- miR-126, miR-122, miR-21, miR-155, miR-9, miR-135b, miR-29b, miR-142-3p, miR-210, miR-181, miR- 224) in HCC and CRC, which suppress the expression of multiple genes involved in tumor- stromal interactions, immune invasion and tumor angiogenesis. [score:5]
In order to determine the role of miRs in a cell program, it was shown that miR-29b sensitizes HCC cells to apoptosis by directly targeting two anti-apoptotic molecules such as Bcl-2 and Mcl-1. Similarly, miR-29b deregulation is involved in CRC. [score:5]
Tumorigenesis in CRC E-cadherin[41, 42] miR-135b HCC cell metastasis; CRC proliferation HSF1, MSH2[44, 45] miR-29b Apoptosis promotion Bcl-2 and Mcl-1, MMP-2[47, 48] miR-142-3p HCC and CRC proliferation RAC1, CD 133, Lgr 5, ABCG2[60, 62, 107] miR-210 HCC metastasis; overexpressed in CRC VMP1, CPEB2[51, 52] miR- 181a Oncogenic role in HCC; poor survival in patients with CRC CDX2, GATA6, NLK, EGFR[64, 65] miR- 224 Oncogenic role in HCC; prognostic marker in CRC SMAD4, API-5[49, 63]Previous studies indicated that miR-34a inhibits tumor growth, miR-21 promotes apoptosis resistance of tumor cells proliferation while the miR-200 family is strongly associated with the epithelial- mesenchymal transition (EMT) [18, 19]. [score:5]
Tumorigenesis in CRC E-cadherin[41, 42] miR-135b HCC cell metastasis; CRC proliferation HSF1, MSH2[44, 45] miR-29b Apoptosis promotion Bcl-2 and Mcl-1, MMP-2[47, 48] miR-142-3p HCC and CRC proliferation RAC1, CD 133, Lgr 5, ABCG2[60, 62, 107] miR-210 HCC metastasis; overexpressed in CRC VMP1, CPEB2[51, 52] miR- 181a Oncogenic role in HCC; poor survival in patients with CRC CDX2, GATA6, NLK, EGFR[64, 65] miR- 224 Oncogenic role in HCC; prognostic marker in CRC SMAD4, API-5[49, 63] Previous studies indicated that miR-34a inhibits tumor growth, miR-21 promotes apoptosis resistance of tumor cells proliferation while the miR-200 family is strongly associated with the epithelial- mesenchymal transition (EMT) [18, 19]. [score:5]
The down-regulation of miR-29b angiogenesis by affecting the endothelial cells. [score:4]
miR-122, miR-30a-3p, miR-145-5p and miR-29b are circulating miRNAs that may be used as non-invasive biomarkers for the detection of cancer. [score:1]
[1 to 20 of 8 sentences]
46
[+] score: 60
Indeed, miR-29b targets specific fibrotic molecules including collagens or α-smooth muscle actin, and its abundance is reduced in many fibrotic pathologies as its expression is inhibited by TGFβ [22, 27]. [score:7]
Furthermore, other reports point to the fact that miRNAs may induce the same direction of regulation of their mRNA targets depending on the timeframe and conditions [56– 60], providing an explanation of a possible indirect mechanism of miR-29b-NAV1 regulation. [score:7]
It is notable, though, that the regulation of NAV1 by miR-29b-3p did not follow the classical regulation pattern (up regulation of a miRNA causes down regulation of a target or vice versa) in the partial UUO mo del. [score:7]
In contrast, in the in vitro experiment NAV1 followed the predicted regulation and confirming that it may be a direct target of miR-29b. [score:5]
This combined systems biology -based approach followed by an in vitro validation pointed to the consistent dysregulation of specific miRNAs, let-7a-5p and miR-29-3p and to new potential targets, E3 ubiquitin-protein ligase (DTX4) and neuron navigator 1 (NAV1) in UPJ obstruction that would not be identified otherwise. [score:4]
Moreover, significant upregulation of neuron navigator 1 NAV1 was observed in HK2 cells treated with the miR-29b-3p antagomir (Fig.   2d). [score:4]
In vitro and in vivo validation identified consistent dysregulation of let-7a-5p and miR-29-3p and new potential targets, E3 ubiquitin-protein ligase (DTX4) and neuron navigator 1 (NAV1), potentially involved in fibrotic processes, in obstructive nephropathy in both human and mice that would not be identified otherwise. [score:4]
Expression of E3 ubiquitin-protein ligase DXT4 (DTX4) (a), leiomodin-1 (LMOD1) (b), a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 (ADAMTS19) (c) and neuron navigator 1 (NAV1) (d) was assessed by RT-PCR in HK2 cells treated or not with antagomirs against let-7a, miR-125b-5p, miR-16-5p, miR-26a-5p or miR-29b-3p. [score:3]
Obstructive nephropathy miRNAs/microRNAs Microarrays let-7a-5p and miR-29b-3p DTX4 and NAV1 Congenital obstructive nephropathy is the main cause of end stage renal disease (ESRD) in children [1]. [score:3]
Expression of let-7a (a), miR-125b-5p (b), miR-16-5p (c), miR-26a-5p (d) and miR-29b-3p (e) was assessed by RT-PCR in HK2 cells treated or not with antagomirs. [score:3]
There is evidence connecting dysregulated miRNAs including miR-21 and miR-29 with kidney fibrosis [17– 22], an important feature in severe UPJ obstruction. [score:2]
Nevertheless, further investigation is needed to determine if NAV1 is a direct target of miR-29b in vivo and if it is an interesting molecule in the context of UPJ obstruction. [score:2]
Our data revealed let-7a and miR-29b as molecules potentially involved in the development of fibrosis in UPJ obstruction via the control of DTX4 in both man and mice that would not be identified otherwise. [score:2]
These five miRNAs were let-7a-5p miR-16-5p, miR-29b-3p, miR-125b-5p and miR-26a-5p (Table  3). [score:1]
Among these, miR-29b is a well-known player in renal pathologies and especially fibrosis. [score:1]
Antagomirs for miR-125b-5p, miR-16-5p and miR-29b-3p showed no effect on DTX4, LMOD1 and ADAMTS19, respectively (Fig.   2a–c). [score:1]
67488993) and hsa-miR-29b-3p (ref. [score:1]
In the presence of antagomirs, the detected signal of let-7a, miR-16-5p, miR-125b-5p, miR-26a-5p and miR-29b-3p was significantly decreased (Fig.   1). [score:1]
MiRNAs let-7a-5p, miR-125b-5p, miR-16-5p, miR-26a-5p and miR-29b-3p were consistently modified in mice and humans. [score:1]
The protective role of miR-29b in fibrosis was further demonstrated in vivo since restoring miR-29b levels in a diabetic nephropathy animal mo del reversed accumulation of renal extracellular matrix [28]. [score:1]
[1 to 20 of 20 sentences]
47
[+] score: 59
The expression patterns of miR-29 family expression demonstrated that the expression levels were spiked upward immediately after retraction, leveled off 1 hour postretraction (T1), and then gradually increased until the end of study (T4) (Fig 5). [score:7]
Interestingly the expression profiles of miRNA-29 family in this study were similar to the reported activity of osteoclasts as their expression significantly increased after day 35 of canine retraction implicating secretory miRNA-29 family expression in GCF were associated with osteoclast activity during the tooth movement. [score:7]
Franceschetti et al[17] found an increase in expression of all three members of miRNA-29 family during osteoclastogenesis, and repression of osteoclastogenesis process by inhibition of miRNA-29. [score:5]
This study we focused on miR-29 family due to their expression patterns in human periodontal ligament under loading[26] and their direct association with osteoclast function[16, 17]. [score:4]
The expression profile of miRNA-29 family in GCF during tooth movement in human. [score:3]
Note that the significant differences of miRNA-29b expression are detected between T0 and T1 (1-hr), T0 and T3 (7-day) (P<0.05). [score:3]
Increased expression profiles of secretory miRNA-29 family were detected during canine retraction. [score:3]
This study was performed to elucidate the presence of miRNAs with exosomes in human gingival crevicular fluid (GCF), and the expression profile of miRNA-29 during orthodontic tooth movement. [score:3]
In addition, expression of secretory specific miRNAs such as miRNA-29 family seems to be correlated with osteoclast function suggesting the potential of secretory miRNA-29 family during the canine retraction. [score:3]
To study the profiles of secretory miR-29 family expression during maxillary canine retraction to close extraction spaces, seventy orthodontic patients aged 10–17 years old were screened and fifteen orthodontic patients was recruited for the study. [score:3]
We reported that different orientation of forces affected the expression pattern of miRNA-29 in human periodontal ligament cells[26]. [score:3]
Along the course of canine retraction, after normalization with internal miRNA controls (Let-7d, g and i), the change in miRNA-29 family expression patterns from pretreatment (T0) to 6 weeks postretraction (T4) showed statistical significance consistently (P<0.05). [score:3]
Coordinated regulation of extracellular matrix synthesis by the microRNA-29 family in the trabecular meshwork. [score:2]
miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. [score:2]
Kagiya and Nakamura[16] found an increase in miRNA-29b during osteoclast differentiation in TNF-α/RANKL -treated cells, suggesting this miRNA plays a role in TNFα -regulated osteoclast differentiation. [score:2]
Previous reports showed an increase in miRNA-29b during osteoclast differentiation in TNF- α/ RANKL -treated cells[16] and promoted osteoclastogenesis by regulating osteoclast commitment and migration[17]. [score:2]
The finding implicated that miRNA-29 promoted osteoclastogenesis. [score:1]
Analyzing all the time points together, no statistical significant difference was found between miRNA-29a, miRNA-29b and miRNA-29c (P>0.05) indicating the similarity in profile changes of the miRNA-29 family. [score:1]
In our laboratory, miR-29 sponge mouse demonstrated delayed tooth movement with reduced numbers of osteoclasts (data not shown). [score:1]
Significant changes were found between T0 and T4 in all of the miRNA-29 family however, the significant changes between T0 and 1 hour postretraction (T1), and T0 and 7-d postretraction (T3) were only observed in miRNA-29b (P<0.05) (Fig 5). [score:1]
[1 to 20 of 20 sentences]
48
[+] score: 51
All these studies indicate the same molecular mechanism: miRNA-29 regulates multiple target levels of expression with a role in extracellular matrix, and therapeutic inhibition of miR-29 improves the structure and integrity of the vessel wall. [score:8]
Besides acting on the structural components of the extracellular matrix, miRNA-29 also targets anti-apoptotic MCL-1 protein and, paradoxically, MMP-2. In fact, a decrease in MCL-1 protein was found in mice with Marfan, and inhibition of miRNA-29 prevented apoptosis, which may contribute to the therapeutic effects of inhibition of miRNA-29[68]. [score:7]
In human aneurysms, miRNA-29b (but not miRNA-29a and miRNA-29c) showed high expression in thoracic aneurysms in one study whereas, in another study, it was not