sort by

307 publications mentioning hsa-mir-101-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-101-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 552
* [a]: anti-miR control vs miR-101 inhibitor, P<0.05; * [b]: miR-101 inhibitor vs miR-101 inhibitor+Scramble siRNA, miR-101 inhibitor+ Stmn1 siRNA1 or miR-101 inhibitor+ Stmn1 siRNA2, P<0.05. [score:11]
MDA-MB-231 cells that expressed low level of miR-101 were co -transfected with PCA-Stmn1 and miR-101 mimics, which showed higher capacity of proliferation, migration and invasion and lower level of apoptosis than that transfected with miR-101 mimics (Figure 11), implying that miR-101 overexpression -mediated the suppression of cell growth and metastasis was partially rehabilitated by up-regulation of Stmn1. [score:10]
Up-Regulation of Stmn1 Expression in Human Breast Cancer TissuesTo further explore the expression profiles of miR-101 target gene, Stmn1, in vivo, the protein and mRNA level of Stmn1 in breast cancer tissues were detected by western blot and qRT-PCR (Figure 9). [score:10]
These results show that up-regulation of miR-101 obviously promotes cell apoptosis and down-regulation of miR-101 significantly suppresses cell apoptosis at early stage. [score:9]
Mir-101 Regulates Endogenous Stmn1 Expression in Breast Cancer Cells in vitro Although Stmn1 was identified as a target gene for miR-101, it was unknown whether miR-101 could regulate endogenous Stmn1 expression. [score:9]
Compared with corresponding control, the level of STMN1 protein was significantly down-regulated by miR-101 mimics (P<0.05) and up-regulated by miR-101 inhibitor (P<0.05) (Figure 8E). [score:8]
Additionally, we found that the up-regulation of miR-101 -mediated the inhibition of cell growth and metastasis was partially recovered by overexpresson of Stmn1. [score:8]
We found that cell proliferation, migration and invasion capacity was lower and apoptosis level was higher in cells co -transfected by Stmn1 siRNA and miR-101 inhibitor than that transfected by miR-101 inhibitor (Figure 12), displaying that miR-101 low expression -mediated the promotion of cell growth and metastasis was partially attenuated by knockdown of Stmn1. [score:8]
These results show that re -expression of miR-101 significantly suppresses breast cell viability, while down-regulation of miR-101 evidently promotes breast cell proliferation in not only ER alpha -positive but also ER alpha -negative breast cancer cells and non-malignant mammary gland epithelial cells. [score:8]
Overexpresson of Stmn1 partially restored the inhibition of cell growth and metastasis induced by up-regulation of miR-101. [score:8]
The inhibition of cell growth and metastasis induced by up-regulation of miR-101 was partially restored by overexpresson of Stmn1. [score:8]
These data indicate that miR-101 may suppress gene expression through binding to seed sequence at the 3′-UTR of Stmn1, and Stmn1 may be a direct target of miR-101. [score:8]
0046173.g011 Figure 11Overexpresson of Stmn1 partially restored the inhibition of cell growth and metastasis induced by up-regulation of miR-101. [score:8]
Down-Regulation of miR-101 Expression in Human Breast Cancer TissuesIn order to explore the role of miR-101 in breast carcinogenesis, the expression patterns of miR-101 in 60 pairs of human breast cancer tissues and adjacent normal breast tissues were analyzed using qRT-PCR (Table 1; Figure 1). [score:8]
T47D cells were transfected with miR-101 mimics or inhibitor to see whether the dysregulation of miR-101 expression affected endogenous Stmn1 expression. [score:8]
This study demonstrates that down-regulation of miR-101 in different subtypes of human breast cancer tissues is linked to the increase of cellular proliferation and invasiveness via targeting Stmn1, which highlights novel regulatory mechanism in breast cancer and may provide valuable clues for the future clinical diagnosis of breast cancer. [score:7]
An online search of miR-101 targets by Targetscan, PicTar and miRanda provided a large number of putative miRNA targets. [score:7]
Further investigation revealed a significant inverse correlation between the expression of miR-101 and Stathmin1 (Stmn1), and miR-101 could bind to the 3′-untranslated region (UTR) of Stmn1 to inhibit Stmn1 translation. [score:7]
In addition, overexpression of miR-101 can also inhibit normal mammary gland epithelial cell proliferation that influences the differentiation state of the mammary gland via altering cyclooxygenase-2 expression [17]. [score:7]
Second, overexpression of miR-101 reduced the protein and mRNA level of Stmn1 and knockdown of miR-101 promoted the expression of Stmn1 in vitro. [score:6]
In fact, a specific miRNA has the potential to target multiple genes, miR-101 perform its function may through cooperative regulation of its other target genes. [score:6]
Thus, we speculated that miR-101 may exert its tumor suppressor function at least in part by regulating the expression of Stmn1 during the occurrence of breast cancer. [score:6]
Zhang et al. reported that the down-regulation of miR-101 in non-small cell lung cancer promoted cell proliferation and invasion and inhibited paclitaxel -induced apoptosis [14]. [score:6]
Our results demonstrated that miR-101 expression was significantly down-regulated in different subtypes of human breast cancer tissues. [score:6]
Although Stmn1 was identified as a target gene for miR-101, it was unknown whether miR-101 could regulate endogenous Stmn1 expression. [score:6]
In conclusion, miR-101 is significantly down-regulated in different subtypes of human breast cancer tissues, which promotes cellular proliferation, migration and invasion, but inhibits apoptosis in breast cancer cells. [score:6]
Stmn1 is a Direct Target of miR-101 To figure out the molecular mechanisms by which miR-101 may perform in breast carcinogenesis, we looked for its target genes. [score:6]
Up-regulation of miR-101 inhibited cell proliferation, migration and invasion, and promoted cell apoptosis in ER alpha -positive and ER alpha -negative breast cancer cells and normal breast cells. [score:6]
Down-Regulation of miR-101 Expression in Human Breast Cancer Tissues. [score:6]
Knockdown of Stmn1 attenuates the down-regulation of miR-101 -mediated enhancement of cell growth and metastasis. [score:5]
Ectopic expression of miR-101 could inhibit proliferation and invasion of gastric cancer cells [15], and sensitize the tumor cells to radiation in vitro and in vivo [16]. [score:5]
It seems that the down regulation of miR-101 is sensitive to different subtypes of breast cancer, suggesting that down-regulation of miR-101 is not restricted to a specific subtype of breast carcinoma and miR-101 may be involved in the occurrence of breast cancer. [score:5]
Furthermore, the luciferase activity was significantly up-regulated by the miR-101 inhibitor compared with the control, about 18.50% (P<0.05). [score:5]
0046173.g012 Figure 12Knockdown of Stmn1 attenuates the down-regulation of miR-101 -mediated enhancement of cell growth and metastasis. [score:5]
To further explore the expression profiles of miR-101 target gene, Stmn1, in vivo, the protein and mRNA level of Stmn1 in breast cancer tissues were detected by western blot and qRT-PCR (Figure 9). [score:5]
The decrease of miR-101 promoted cell proliferation, migration and invasion, and inhibited cell apoptosis by targeting Stmn1. [score:5]
Knockdown of Stmn1 weakened the effect of down-regulation of miR-101 on cell growth and metastasis. [score:5]
Additionally, Stmn1 siRNA and miR-101 inhibitor and were co -transfected into Hs518bst that expressed high level of miR-101. [score:5]
Wang et al. found that ectopic expression of miR-101 could inhibit proliferation, migration and invasion of gastric cancer cells in vitro [15]. [score:5]
In the present study, we defined the expression profile of miR-101 and its target gene, Stathmin1 (Stmn1), in breast cancer tissue and adjacent normal breast tissue, and studied the pathophysiological significance of miR-101 in breast cancer using in vitro cell mo del. [score:5]
We found that re -expression of miR-101 in breast cancer cell lines and non-malignant mammary gland epithelial cells inhibited cells proliferation, migration and invasion, but promoted apoptosis, and vice versa. [score:5]
In this study, we found that miR-101 expression was significantly down-regulated in ER/PR−, HER2−,ER/PR+, HER2+,ER/PR+, HER2− and ER/PR−, HER2+ breast cancer tissues compared with that in adjacent normal breast tissues. [score:5]
The expression pattern of Stmn1 was opposite with miR-101 in breast cancer tissues, indicating that miR-101 may be involved in regulating breast carcinogenesis by interacting with Stmn1 in vivo. [score:4]
These results showed that the expression of endogenous Stmn1 mRNA and protein were regulated by miR-101. [score:4]
To our knowledge, our study provides the first piece of evidence that miR-101 is involved in breast carcinogenesis, although many studies have showed that down-regulation of miR-101 is associated with in various cancers originated from lung, gastric, ovary, colon cancer, prostate and gliolastoma [11], [13], [14], [25]– [28]. [score:4]
More importantly, in vivo analysis found that Stmn1 mRNA and protein level in different subtypes of human breast cancer tissues, contrary to the down-regulation of miR-101, were significantly elevated. [score:4]
0046173.g001 Figure 1Down-regulation of miR-101 in breast cancer tissues. [score:4]
Down-regulation of miR-101 displayed opposite effects on cell growth and metastasis. [score:4]
Down-regulation of miR-101 in breast cancer tissues. [score:4]
In recent years, several published studies have shown that miR-101 is obviously down-regulated in different types of cancer, e. g. glioblastoma, non-small cell lung cancer or human colon cancer. [score:4]
Stmn1 is a Direct Target of miR-101. [score:4]
In our study, we identified Stmn1 as a target of miR-101 and three lines of evidence supported this finding. [score:3]
Our data not only suggest an important role of miR-101 in breast carcinogenesis, but also imply that therapeutic strategies aimed at restoration of miR-101 expression may be beneficial to patients with breast cancer. [score:3]
In the future, other targets of miR-101 besides Stmn1 still need to be identified in breast cancer. [score:3]
0046173.g003 Figure 3The effect of miR-101 constructs on the expression level of miR-101. [score:3]
These results indicate that miR-101 affects the binding of miR-101 and 3′-UTR of Stmn1, leading to the change of miR-101 translation. [score:3]
Third, Stmn1 3′-UTR -mediated luciferase activity is specifically responsive to transfection of miR-101 mimics and inhibitor. [score:3]
Taken together, these results indicate that miR-101 executes functions in breast cancer cells partially by targeting Stmn1. [score:3]
The expression level of miR-101 in individual sample was detected by TaqMan miRNA RT-Real Time PCR (A). [score:3]
The expression level of miR-101 was detected by TaqMan miRNA RT-Real Time PCR. [score:3]
0046173.g008 Figure 8The prediction and confirmation of the miR-101 target. [score:3]
To figure out the molecular mechanisms by which miR-101 may perform in breast carcinogenesis, we looked for its target genes. [score:3]
The histograms respectively represent the average percentage of apoptosis cells in cells treated by miR-101 mimics at early (B1), late stage (B2), and miR-101 inhibitor at early (B3) and late stages (B4). [score:3]
The results from the analysis of the trend of miR-101 expression in four different subtypes of breast cancer tissues were consistent with that in all breast cancer tissues. [score:3]
The experiment has been repeated for three times and the results were described as a ratio of A570 nm with miR-101 mimcs or miR-101 inhibitor vs its corresponding control. [score:3]
However, we found that the expression of miR-101 was obviously decreased in different subtypes of human breast cancer tissues and also not restricted to a specific subtype of breast carcinoma. [score:3]
These results suggest that miR-101 may act as a tumor suppressor and can be a novel candidate gene for the diagnosis and therapy to different subtypes of breast cancer. [score:3]
All these results further confirm that miR-101 functions as a tumor suppressor. [score:3]
The overall expression of miR-101 was significantly decreased in four subtypes of human breast cancer tissues (P<0.01; Figure 1C–F). [score:3]
To further test whether miR-101 may execute tumor-suppressive functions by targeting stmn1, we investigated the effect of Stmn1 on miR-101 -mediated cell behavior. [score:3]
Stmn1 Was Involved in the Effect of mir-101 on Cell Growth and MetastasisTo further test whether miR-101 may execute tumor-suppressive functions by targeting stmn1, we investigated the effect of Stmn1 on miR-101 -mediated cell behavior. [score:3]
MCF-7, MDA-MB-231, T47D and Hs518bst were infected with the miR-101 mimics, pre-miR control, miR-101 inhibitor or anti-miR control, respectively. [score:3]
Hereafter, the effect of miR-101 constructs on the expression level of miR-101 in MCF-7, T47D, MDA-MB-231 and Hs518bst was detected by qRT-PCR. [score:3]
Eur J Cancer 28 Varambally S, Cao Q, Mani RS, Shankar S, Wang X, et al (2008) Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. [score:3]
The diminution of miR-101 promoted the proliferation, migration and angiogenesis of cancer cells partly by targeting the Enhancer of Zeste homology 2 gene or cyclooxygenase-2 [11], [14]. [score:3]
These cells were transfected with miR-101 mimics, pre-miR control, miR-101 inhibitor or anti-miR control, respectively. [score:3]
T47D, MDA-MB-231, MCF-7 and Hs518bst cells were transfected with the pre-miR control, miR-101 mimics, anti-miR control, or miR-101 inhibitor, respectively, for 48 h. Then single cell suspension was prepared and stained with annexin V/PI and subjected to flow cytometry analysis (A). [score:3]
MCF-7, T47D, MDA-MB-231 and Hs518bst cells were respectively transfected by miR-101 mimics or inhibitor and cell numbers at 12 h, 24 h, 36 h, 48 h, 60 h and 72 h was counted, respectively, in MCF-7 (A), T47D (B), MDA-MB-231 (C) and Hs518bst (D). [score:3]
In order to explore the role of miR-101 in breast carcinogenesis, the expression patterns of miR-101 in 60 pairs of human breast cancer tissues and adjacent normal breast tissues were analyzed using qRT-PCR (Table 1; Figure 1). [score:3]
The cells were then transfected with miR-101 mimcs, pre-miR control, miR-101 inhibitor and anti-miR control, respectively. [score:3]
Among them, we focused on Stmn1 for the following reasons: (i) Targetscan, PicTar and miRanda prediction showed that there was a miR-101 responsive element in 3′-UTR of Stmn1, which is the highly conserved domain among different species (Figure 8A). [score:3]
MCF-7, T47D, MDA-MB-231 and Hs518bst cells were transfected with the pre-miR control, miR-101 mimics (A), anti-miR control or miR-101 inhibitor (B), respectively. [score:3]
MicroRNA-101 (miR-101) expression is negatively associated with tumor growth and blood vessel formation in several solid epithelial cancers. [score:3]
0046173.g005 Figure 5T47D, MDA-MB-231, MCF-7 and Hs518bst cells were transfected with the pre-miR control, miR-101 mimics, anti-miR control, or miR-101 inhibitor, respectively, for 48 h. Then single cell suspension was prepared and stained with annexin V/PI and subjected to flow cytometry analysis (A). [score:3]
Most importantly, miR-101 is differentially expressed between breast tumors and normal breast tissues [18]. [score:3]
The expression of Stmn1 was significantly increased as miR-101 decreased in human breast cancer tissues. [score:3]
T47D, MDA-MB-231, MCF-7 and Hs518bst cells were transfected with pre-miR control, miR-101 mimics, anti-miR control or miR-101 inhibitor, respectively. [score:3]
The average percentage of apoptosis cells was analyzed in cells transfected by miR-101 mimics and inhibitor at early and late stages (B). [score:3]
The effect of miR-101 constructs on the expression level of miR-101. [score:3]
T47D cells were co -transfected with Stmn1-pGL3 and miR-101 mimics or inhibitor (Figure 8C). [score:3]
The expression level of miR-101 in these cells was detected by TaqMan miRNA RT-Real Time PCR. [score:3]
The cells undergoing apoptosis at late stage varied with the breast cell lines after miR-101 inhibitor treatment. [score:3]
MCF-7, T47D, MDA-MB-231 and Hs518bst were respectively transfected with pre-miR control, miR-101 mimics (A), anti-miR control or miR-101 inhibitor (B). [score:3]
Quantitive RT-PCR analysis was used to determine the relative expression level of miR-101 and Stmn1. [score:3]
Deleting miR-101 target sites in the 3′-UTR of Stmn1 was used as control. [score:3]
Mir-101 Regulates Endogenous Stmn1 Expression in Breast Cancer Cells in vitro. [score:3]
An obvious inverse correlation between the expression of miR-101 and Stmn1 was demonstrated. [score:3]
The results showed that miR-101 expression level was markedly enhanced in cells transfected with miR-101 mimics compared with pre-miR control (P<0.01), and remarkably decreased in cells transfected with miR-101 inhibitor compared with pre-miR control (P<0.01) in MCF-7, T47D, MDA-MB-231 and Hs518bst cells (Figure 3). [score:3]
Interestingly, our results showed that the expression of miR-101 was also inversely correlated with the Stmn1 mRNA level not only in breast cancer cells, but also in breast cancer tissues. [score:3]
First, there is a miR-101 binding site in the 3′-UTR of Stmn1 predicted by Targetscan, PicTar and miRanda. [score:3]
The prediction and confirmation of the miR-101 target. [score:3]
The expression of miR-101 in control group was set to 1. The y-axis displays the relative log2 ratio of miR-101 normalized by U6. [score:3]
Thus, an evident inverse relationship was showed between the expression of miR-101 and Stmn1 in human breast cancer. [score:3]
Compared with the pre-miR control, the luciferase activity was significantly suppressed by the miR-101 mimics, about 20.00% (P<0.05). [score:2]
The relative proliferation rates in MCF-7, T47D, MDA-MB-231 and Hs518bst cells transfected with miR-101 inhibitor was increased about 21.82%, 12.56%, 18.20% and 17.5%, respectively, as compared with anti-miR control (P<0.05). [score:2]
The number of late apoptotic cells was reduced by the transfection with miR-101 inhibitor in MDA-MB-231 (4.58% vs 7.22%; P<0.01) compared to anti-miR control, and there was no significant difference in T47D, MCF-7 and Hs518bst cells. [score:2]
To validate whether Stmn1 is indeed the target gene of miR-101, a human Stmn1 3′-UTR fragment containing wild-type was cloned into the downstream of the firefly luciferase reporter gene in the pGL3 control vector (designated as Stmn1-pGL3) for the dual-luciferase assay (Figure 8B). [score:2]
Mir-101 Regulates the Breast Cell Viability in vitro To assess the possible function of miR-101 in the pathological process of breast cells, the effect of miR-101 on the growth of breast cells was detected using in vitro cell lines mo del. [score:2]
When cells were transfected by miR-101 inhibitor, the number of early apoptotic cells was decreased compared to anti-miR control in T47D (2.55% vs 4.57%; P<0.05), MCF-7 (5.92% vs 7.34%; P<0.05), MDA-MB-231 (2.73% vs 7.54%; P<0.01) and Hs518bst cells (7.43% vs 11.25%; P<0.01). [score:2]
In vitro Migration and Invasion AssaysMCF-7, MDA-MB-231, T47D and Hs518bst were infected with the miR-101 mimics, pre-miR control, miR-101 inhibitor or anti-miR control, respectively. [score:2]
T47D cells were co -transfected with pre-miR control, miR-101 mimics, anti-miR control or miR-101 inhibitor and Stmn1-pGL3 for dual-luciferase assay. [score:2]
Base mutation of seed sequence was also conducted to further confirm the binding site for miR-101 (Figure 8D). [score:2]
In general, the expression of miR-101 was significantly decreased in all human breast cancer tissues compared with that in adjacent normal breast tissues (P<0.01; Figure 1B). [score:2]
These effects may at least partially due to direct repression of Stmn1 by miR-101. [score:2]
Additionally, the level of Stmn1 mRNA detected by qRT-PCR was significantly decreased by miR-101 mimics (P<0.05) and increased by miR-101 inhibitor (P<0.05) compared with corresponding control (Figure 8F). [score:2]
Moreover, base mutation of seed sequence in the 3′-UTR of Stmn1 significantly reduced the binding capacity of miR-101 and 3′-UTR of Stmn1. [score:2]
Then the cell proliferation and viability in miR-101 mimics or inhibitor -treated cells were determined by MTT assay 48 h after transfection. [score:2]
Relative expression of miR-101 in breast cancer tissues and adjacent normal breast tissues was compared to U6 in corresponding tissue sample, i. e. the relative level of miR-101 was normalized to U6. [score:2]
The migration capacity was significantly enhanced in MCF-7, MDA-MB-231, T47D and Hs518bst cells transfected with miR-101 inhibitor compared with anti-miR control (P<0.05) (Figure 6). [score:2]
While MCF-7, MDA-MB-231, T47D and Hs518bst cells were transfected with miR-101 inhibitor, the invasive ability was obviously enhanced compared with anti-miR control (Figure 7). [score:2]
The results showed that the migration capacity in MCF-7, MDA-MB-231, T47D and Hs518bst cells transfected with miR-101 mimics was significantly lower than that transfected with pre-miR control (P<0.05). [score:1]
In situ Hybridization of miR-101 with DIG-labeled LNA Probe. [score:1]
After acetylation with 0.25% acetic anhydride in 0.1 M triethanolamine, pH 8.0 for 10 min, sections were prehybridized with hybridization buffer (Roche, Mannheim, Germany) at 40°C for 2 h and then hybridized with digoxigenin (DIG)-labeled LNA-miR-101 probe (LNA-miR-101 sequences: 5′-ttCagTtatCacaGtaCtgTa-3′) at 40°C overnight. [score:1]
MiR-101 belongs to a family of miRNAs that are involved in a series of cellular activities, e. g. cell proliferation, invasion, angiogenesis [11], [12]. [score:1]
Our results showed that the decrease of miR-101 was also not restricted to a specific subtype of breast carcer. [score:1]
MiR-101 expression was reduced in breast cancer samples of 85.71% (6/7 samples) of triple negative, 62.50% (5/8 samples) of ER/PR+, HER2+, 88.89% (8/9 samples) ER/PR+, HER2− and 83.33% (5/6 samples) of ER/PR−, HER2+, when compared with that in adjacent normal breast tissues, respectively (Figure 1A). [score:1]
These fingdings suggest that the level of miR-101 may be closely associated with the metastasis of breast cancer cells and non-malignant mammary gland epithelial cells. [score:1]
The miR-101 level was detected by TaqMan miRNA RT-Real Time PCR. [score:1]
The effects of miR-101 on cell migration of breast cells. [score:1]
Statistical analyses were performed to analyze the overall trend of miR-101 in all human breast cancer tissues (B), ER/PR−,HER2− (C), ER/PR+, HER2+ (D), ER/PR+, HER2− (E) and ER/PR−, HER2+ (F) breast cancer tissues. [score:1]
Mir-101 Regulates the Breast Cell Viability in vitro. [score:1]
0046173.g004 Figure 4The effects of miR-101 on proliferation of breast cells. [score:1]
The effects of miR-101 on cell invasion of breast cells. [score:1]
Stmn1 Was Involved in the Effect of mir-101 on Cell Growth and Metastasis. [score:1]
In situ Hybridization of miR-101 with DIG-labeled LNA ProbeThe sections (4 µm) of the breast cancer tissues and adjacent normal breast tissues were treated with proteinase K (20 µg/ml) for 15 min and refixed in 4% PFA for 15 min. [score:1]
The role of miR-101 in breast cancer cells was coincident with that in other cancers. [score:1]
The location of miR-101 in breast cancer tissues and adjacent normal breast tissues was subjected to in situ hybridization using DIG-labeled LNA probes specific to miR-101. [score:1]
0046173.g007 Figure 7The effects of miR-101 on cell invasion of breast cells. [score:1]
Firstly, the endogenous miR-101 level in T47D (ER alpha -positive), MCF-7 (ER alpha -positive), MDA-MB-231 (ER alpha -negative) and Hs518bst (non-malignant mammary gland epithelial cell) was detected by qRT-PCR. [score:1]
Mir-101 Affects Breast Cell Apoptosis in vitro To further explore the role of miR-101 in controlling the growth of breast cells, apoptosis in four breast cells were determined by flow cytometry (Figure 5). [score:1]
Therefore, here, we further explored the biological functions of miR-101 in breast cancer. [score:1]
The effect of miR-101 on the number of late apoptotic cells varied with the breast cell lines. [score:1]
Figure S2 The endogenous miR-101 level in breast cells. [score:1]
0046173.g002 Figure 2The distribution of miR-101 in breast tissues. [score:1]
Single-stranded cDNA was synthesized by using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and then amplified by using TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) together with miRNA-specific TaqMan MGB probes: miR-101 and U6 (Applied Biosystems, Foster City, CA, USA). [score:1]
The effects of miR-101 on proliferation of breast cells. [score:1]
Deleting putative miR-101 binding region in the 3′-UTR of Stmn1 (designated as Stmn1-pGL3-Mutant) and pGL3 empty vector were used as control, respectively. [score:1]
Mir-101 Modulates Migration and Invasion Capacity of Breast Cells in vitro In order to further research the role of miR-101 in controlling the metastasis of breast cells, we analyzed the effects of miR-101 on the migratory and invasive behavior of breast cancer cells and non-malignant mammary gland epithelial cell Hs518bst (Figure 6 and 7). [score:1]
These results imply that miR-101 is sensitive to different types of breast cancer, i. e. ER positive, HER2 positive and triple negative. [score:1]
All experiments were performed at least three times and calculated cell proliferation as stimulation index (SI) (ratio of A570 nm with miR-101 mimics or inhibitor vs pre-miR or anti-miR control). [score:1]
However, limited knowledge is available about the pathophysiological significance of miR-101 in breast cancer. [score:1]
A reverse correlation was also found between the level of miR-101 and Stmn1 in human breast cancer tissues. [score:1]
Additionally, the invasion assay indicated that the invasive capacity in MCF-7, MDA-MB-231, T47D and Hs518bst cells transfected with miR-101 mimics was significantly inhibited compared with pre-miR control (P<0.05). [score:1]
To assess the possible function of miR-101 in the pathological process of breast cells, the effect of miR-101 on the growth of breast cells was detected using in vitro cell lines mo del. [score:1]
The y-axis displays the relative log2 ratio of miR-101 normalized by U6. [score:1]
Strong signals of miR-101 were found in normal breast tissues. [score:1]
showed that the miR-101 level was higher in Hs518bst than MCF-7 (P<0.01) and MDA-MB-231 (P<0.01), similar with T47D (Figure S2). [score:1]
0046173.g006 Figure 6The effects of miR-101 on cell migration of breast cells. [score:1]
In order to further research the role of miR-101 in controlling the metastasis of breast cells, we analyzed the effects of miR-101 on the migratory and invasive behavior of breast cancer cells and non-malignant mammary gland epithelial cell Hs518bst (Figure 6 and 7). [score:1]
However, the role of miR-101 in human breast cancer remains elusive. [score:1]
To further explore the role of miR-101 in controlling the growth of breast cells, apoptosis in four breast cells were determined by flow cytometry (Figure 5). [score:1]
The distribution of miR-101 in breast tissues. [score:1]
0046173.g010 Figure 10The location of miR-101 in breast cancer tissues and adjacent normal breast tissues was analyzed by immunohistochemistry using anti-STMN1 antibody. [score:1]
The location of miR-101 in breast cancer tissues and adjacent normal breast tissues was analyzed by immunohistochemistry using anti-STMN1 antibody. [score:1]
[1 to 20 of 164 sentences]
2
[+] score: 362
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-214, hsa-mir-101-2
In eRMS, this circuit is dysregulated due to EZH2 over -expression, which leads to miR-101 down-regulation, thus maintaining the cells in an undifferentiated and proliferative state In this study, we report, for the first time, that the microRNA miR-101 is down-regulated in the most recurrent variant of pediatric soft tissue sarcoma, i. e., the embryonal rhabdomyosarcoma (eRMS), showing an inverse pattern of expression with the histone methyltransferase EZH2. [score:12]
Our results indicate that miR-101 is down-regulated in eRMS primary samples and cell lines, and knockdown or pharmacological inhibition of EZH2 up-regulates its levels. [score:10]
Of note, the transcript levels of the oncogene N-Myc, a recognized miR-101 target gene in cancer [20] and involved in the aggressiveness of RMS [21], were markedly reduced in miR-101-over -expressing RD cells (Additional file 3: Figure S3A), confirming a targeted effect of miR-101 forced expression also in our setting. [score:9]
Coherently with the evidence that in eRMS cells (i) EZH2 depletion inhibits proliferation (our previous report [11]) and (ii) forced induction of miR-101 down-regulates EZH2 (the present manuscript), we noticed a reduction in the growth rate of miR-101 over -expressing eRMS cells. [score:8]
In agreement with the effects of DZNep on miR-101 expression reported in Fig.   2b, DZNep -treated RD cells showed a down-regulation of the miR-101 target gene N-Myc (Additional file 3: Figure S3B). [score:8]
Then, we show that retroviral -mediated forced expression of a precursor of mature miR-101, which is known to target EZH2 (pre-miR-101-2), in eRMS cells results in the down-regulation of both mRNA and protein levels of EZH2. [score:8]
Moreover, forced expression of miR-101 for 72 h resulted in the up-regulation of protein levels of the cyclin -dependent kinase inhibitor p21 [Cip1] (Fig.   3c). [score:8]
Then, miR-101 directly inhibits EZH2 expression thus enforcing its own expression, driving late skeletal muscle differentiation. [score:8]
Moreover, our data also demonstrate that EZH2 inhibits miR-101 expression in eRMS cells by direct gene targeting. [score:8]
This evidence was confirmed by the induction of miR-101 expression also in tumor cells in which EZH2 was down-regulated through the treatment with DZNep, a compound which works inducing EZH2 degradation and already validated as an inhibitor of EZH2 by our group on the same context [11]. [score:8]
In eRMS, this circuit is dysregulated due to EZH2 over -expression, which leads to miR-101 down-regulation, thus maintaining the cells in an undifferentiated and proliferative state To ascertain whether miR-101 expression is compromised in eRMS, we measured its levels along with those of EZH2 in primary tumors. [score:7]
Sheng Y, Li J, Zou C, Wang S, Cao Y, Zhang J, et al. Downregulation of miR-101-3p by hepatitis B virus promotes proliferation and migration of hepatocellular carcinoma cells by targeting Rab5a. [score:6]
In muscle cells, when myogenesis is triggered, miR-101 is upregulated due to the lowering of EZH2 expression. [score:6]
Consistently, miR-101 over -expressing RD18 cells showed 50 % EZH2 down-regulation associated to cell cycle slow-down (5.4 ± 0.6 % increase of cells in the G1 phase and 14 ± 2 and 3.4 ± 0.6 % decrease in S and G2 phases, respectively) and a more modest but significant reduction of colony formation of about 20 and 15 % on either in culture dishes or soft agar (Additional file 4: Figure S4). [score:6]
We also show that miR-101 is up-regulated in eRMS cells following both genetic and pharmacological inhibition of EZH2. [score:6]
Similarly, treatment with DZNep, the prototype of EZH2 inhibitors [11] which induces EZH2 degradation (Additional file 1: Figure S1C), resulted in the up-regulation of miR-101 with respect to cells treated with vehicle (about 3.5-, 1.5-, and 5-fold increase in RD, JR1, and RD18, respectively) (Fig.   2b). [score:6]
presented here now unveil miR-101 low expression as a new epigenetic dysregulation in eRMS and highlight its tumor suppressor role in this tumor type. [score:6]
are means ± SD of two independent experiments Over -expression of miR-101 restrains the migration of embryonal RMS cells in vitroThe miR-101 tumor-suppressive activities have been also related to its ability to negatively modulate tumor cell migration [22– 24]. [score:5]
We obtained an about 6-fold increase of miR-101 expression by infecting RD and JR1 cells with a GFP-coding retroviral vector expressing the pre-miR-101-2 form (pS-pre-miR-101) [19] (Fig.   3a and Additional file 2: Figure S2 for the efficiency of infection). [score:5]
Over -expression of miR-101 in eRMS cell lines induced a 30 % down-regulation of EZH2 mRNA and reduced protein levels compared to cells infected with an empty retrovirus (pS-) (Fig.   3b,c). [score:5]
This phenomenon is associated to reduced H3K27me3 levels at the same regulatory locus, indicating that EZH2 directly targets miR-101 for repression in eRMS cells. [score:5]
Inhibition of EZH2 restores miR-101 expression in embryonal RMS. [score:5]
We demonstrate that knockdown of EZH2 by RNA silencing is sufficient to induce the up-regulation of the endogenous levels of miR-101 in eRMS cells, thus suggesting that EZH2 might repress miR-101 in this tumor type, as reported for other cancers [12, 25]. [score:5]
MiR-101 expression levels in RD, JR1, and RD18 cells infected with the control (−pS) and miR-101 expressing vector (pS-pre-miR-101) was analyzed by real-time polymerase chain reaction (RT-qPCR). [score:5]
Consistently with its tumor suppressor properties, when over-expressed miR-101 significantly reduced eRMS cell motility in vitro. [score:5]
As observed for miR-101 over -expression, EZH2 pharmacological inhibition reduced eRMS cell migration (70 and 35 % reduction for RD and JR1 cells, respectively) (Fig.   4b,d). [score:5]
Herein, we report that miR-101 is down-regulated in eRMS patients and in tumor cell lines compared to their controls showing an inverse pattern of expression with EZH2. [score:5]
Therefore, on one hand, these results demonstrate that miR-101 is able to regulate EZH2 levels also in the eRMS tumor cell context and, on the other hand, they shed light on the molecular mechanisms by which EZH2 could be up-regulated in eRMS. [score:5]
To that, miR-101 can behave as a tumor suppressor in several cancers by repressing EZH2 expression. [score:5]
RT-qPCR analysis of N-Myc in RD cells after miR-101 over -expression or EZH2 inhibition. [score:5]
This finding is in line with the evidence that (i) miR-101 expression increases in human SKMC induced to differentiate, i. e., cell cycle arrested, which confirms the recent observations obtained through microRNA profiling [18], and, in turn, (ii) EZH2 expression decreases in the same context, as previously reported by us and others [5, 6, 32]. [score:5]
In summary, our findings indicate that EZH2 represses miR-101 expression and that, in turn, miR-101 can restrain EZH2 expression in eRMS (Fig.   6d). [score:5]
Interestingly, miR-101 was the most up-regulated in RD and RD18 cells, showing an about 4-fold increase compared with cells transfected with a control non -targeting siRNA (CTR siRNA). [score:5]
Finally, the evidence that EZH2 binds the miR-101 gene promoter highlighted a direct effect of the oncogene on miR-101 expression further supporting a feedback loop involving the two molecular players. [score:4]
Based on our observations, it can be hypothesized that low levels of miR-101 in eRMS contribute to the up-regulation of EZH2, which sustains tumor cell proliferation. [score:4]
b MiR-101 level in RD, JR1, and RD18 cells daily treated for 72 h with either S-adenosyl-L-homocysteine hydrolase inhibitor 3-deazaneplanocin A (DZNep) (5 μM) or vehicle (i. e., water, referred as untreated condition: UN), normalized using snoU6 and expressed as fold increase over UN (1 arbitrary unit). [score:4]
As shown in Fig.   2a, EZH2 knockdown in eRMS cells increases the expression of miR-29b, miR-214, and miR-101 as soon as 72 h after siRNA transfection. [score:4]
Konno Y, Dong P, Xiong Y, Suzuki F, Lu J, Cai M, et al. MicroRNA-101 targets EZH2, MCL-1 and FOS to suppress proliferation, invasion and stem cell-like phenotype of aggressive endometrial cancer cells. [score:4]
We show that miR-101 is directly repressed by EZH2, a key player whose targeting has been suggested as a powerful epigenetic therapy to halt eRMS tumorigenicity. [score:4]
The antiproliferative effect of miR-101 forced expression in these cells might be related to the increase in p21 [Cip1] levels, which can regulate both G1 or G2 cell cycle blockade, the same effect that we previously observed upon EZH2 silencing [11]. [score:4]
MiR-101 has been reported to exert tumor suppressor functions in several human cancers by modulating EZH2 expression [12, 13, 28– 31]. [score:4]
This latter is a miR-101 target gene [12] and behaves as an oncogene in eRMS [11, 27]. [score:3]
The restoration of miR-101 expression is able to reduce proliferation and migration rates and to hamper both the clonogenic and anchorage-independent capabilities of eRMS tumor cells. [score:3]
Clearer is the role of miR-101 in inhibiting tumor cell migration [23, 33]. [score:3]
Our results also unveil an inhibitory effect of miR-101 on the tumorigenic potential of eRMS cells by blocking both the clonogenic capability and the anchorage-independent features typical of malignant cells. [score:3]
retro vector expressing the endogenous human miR-101-2 precursor (pS-pre-miR-101) and its negative control (pS-, empty) have been already described [17, 19]. [score:3]
Altogether, our data show that, in human eRMS, miR-101 is involved in a negative feedback loop with EZH2, whose targeting has been previously shown to halt eRMS tumorigenicity. [score:3]
As shown in Fig.   5c, d, miR-101 over -expression reduced the formation of colonies in soft agar of about 50 % in both RD and JR1 cells. [score:3]
In the last few years, many studies have shown that miR-101 levels are decreased in several tumors, including breast, lung, prostate, ovarian, colon, and liver cancers, and that often miR-101 exerts a tumor suppressive role [14– 17]. [score:3]
Similarly, miR-101 expression was lower in four eRMS cell lines (RD, RD18, JR1, RUCH2) than in differentiated human skeletal muscle cells (SKMC DM) (mean values 1.26 ± 0.49 vs 4.29 ± 0.55, respectively), instead being comparable to the level of miR-101 in proliferating skeletal myoblasts (SKMC GM) (Fig.   1b, left). [score:3]
Over -expression of miR-101 restrains the proliferation rate of embryonal RMS cells and reduces the endogenous levels of EZH2. [score:3]
MiR-101 expression is directly repressed by EZH2 in embryonal RMS. [score:3]
a RT-qPCR analysis of mature forms of miR-214, miR-29b, and miR-101 in RD, JR1, and RD18 cells 72 h post EZH2 siRNA transfection (RD were transfected with SMART pool siRNA EZH2 (asterisks), JR1 and RD18 were transfected with siRNA targeting 5′-UTR of EZH2, see “Methods” section). [score:3]
As a matter of fact, although miR-101 was barely detectable in murine myoblasts in proliferation, its expression was not modulated during myogenic cell differentiation [6]. [score:3]
Over -expression of miR-101 restrains the migration of embryonal RMS cells in vitro. [score:3]
After two rounds of infection with the control (−pS) and miR-101 expressing vector (pS-pre-miR-101), RD, JR1, and RD18 cells were analyzed by flow cytometry as reported [37]. [score:3]
Over -expression of miR-101 reduces embryonal RMS cell tumorigenic potential. [score:3]
These results suggest that miR-101 and EZH2 are inversely expressed in eRMS and indicate EZH2 as a repressor of miR-101 in eRMS cells. [score:3]
Interestingly, while the up-regulation of miR-29b and miR-214 was comparable among the three cell lines, the de-repression of miR-101 appeared more modest in JR1 compared to RD and RD18 cells, suggesting a context -dependent response. [score:3]
Two independent measurements were done in duplicateTo analyze whether miR-101 expression was affected by EZH2 modulation in eRMS, RD, JR1, and RD18 cell lines were silenced for EZH2 using either a pool of oligo siRNAs or oligo siRNA targeting the 5′UTR region of EZH2 mRNA, both previously validated (Additional file 1: Figures S1A and S1B) [11], and the expression of miR-101 together with that of other microRNAs known to be modulated by EZH2 in RMS, such as miR-214 and miR-29b [3, 8], was evaluated. [score:3]
Two independent measurements were done in duplicate To analyze whether miR-101 expression was affected by EZH2 modulation in eRMS, RD, JR1, and RD18 cell lines were silenced for EZH2 using either a pool of oligo siRNAs or oligo siRNA targeting the 5′UTR region of EZH2 mRNA, both previously validated (Additional file 1: Figures S1A and S1B) [11], and the expression of miR-101 together with that of other microRNAs known to be modulated by EZH2 in RMS, such as miR-214 and miR-29b [3, 8], was evaluated. [score:3]
are means ± SD of two independent experiments The miR-101 tumor-suppressive activities have been also related to its ability to negatively modulate tumor cell migration [22– 24]. [score:3]
To test this hypothesis, we performed chromatin immunoprecipitation (ChIP) experiments upon EZH2 silencing in RD and JR1 cells testing the occupancy of EZH2 on the promoter of miR-101-2 that codifies for the miR-101 precursor pri-miR-101-2 from which we derived the pre-miR-101-2 vector used for over -expression experiments [25, 26]. [score:3]
b RT-qPCR of miR-101 (left panel) and EZH2 (right panel) in eRMS cell lines (RD, RD18, RUCH2, and JR1; black and grey bars, respectively) and normal skeletal muscle cells (SKMC) cultured in either growth medium (GM) or differentiating medium (DM) (as described in “” section) were normalized to snoU6 or GAPDH levels, respectively, and were expressed as fold increase over SKMC GM cells (1 arbitrary unit). [score:3]
As reported in Fig.   5a,b, miR-101 over -expression reduced of 30 % of the ability to form colonies in both RD and JR1 cells. [score:3]
In turn, miR-101 forced expression reduces EZH2 levels as well as restrains the migratory potential of eRMS cells and impairs their clonogenic and anchorage-independent growth capabilities. [score:3]
miR-101 over -expression reduces EZH2 levels, cell proliferation, anchorage-independent growth, and cell proliferation in RD18 cells. [score:3]
Fig. 2Inhibition of EZH2 restores endogenous miR-101 levels in eRMS cells. [score:3]
Altogether, these data suggest a reciprocal regulation between EZH2 and miR-101 in eRMS cells and indicate that miR-101 induction hampers their proliferative potential. [score:2]
Altogether, these findings suggest that miR-101 and EZH2 regulate the migration of eRMS cells in an opposite manner. [score:2]
As reported in Fig.   3d, miR-101 over -expression determined a cell cycle G1/S blockade in RD cells whose percentage in G1 phase increased by 10 ± 3 % while in S and G2 phases decreased by 13 ± 2 and 2 ± 0.8 %, respectively, compared to pS- cells (Fig.   3d). [score:2]
We noticed that miR-101 was expressed at very low levels in eRMS primary samples compared to normal muscle tissues as controls (mean values: 0.23 ± 0.24 vs 5.7 ± 4.7, respectively) (Fig.   1a, left). [score:2]
Similar results were obtained by pharmacologically down -regulating EZH2, once again confirming the opposite functional roles of EZH2 and miR-101 in these tumor cells. [score:2]
To test whether miR-101 restoration might restrain the clonogenic ability of eRMS cells, we performed colony formation assays with RD and JR1 cells over -expressing miR-101. [score:2]
In the present work, since EZH2 is abnormally up-regulated in eRMS, we sought to evaluate whether miR-101 might be altered in this tumor. [score:2]
TaqMan microRNA assays (Applied Biosystems) were used for relative quantification of the mature miR-101 (hsa-miR-101; 002253), miR-29b (hsa-miR-29b; 0000413), and miR-214 (hsa-miR-214; 002293) expression levels, as described [9]. [score:2]
Interestingly, in JR1 cells in which miR-101 has been over-expressed, we noticed a cell cycle blockade in G2 phase (11.2 ± 1.8 % of increase), compared to pS- cells (Fig.   3d). [score:2]
Therefore, we sought to evaluate whether miR-101 ectopic over -expression might affect eRMS cell proliferation. [score:1]
Nevertheless, the myogenic role of miR-101 has not yet been defined. [score:1]
Representative cytofluorometric plots show the level of GFP fluorescence in RD, JR1, and RD18 cells infected with pS-pre-miR-101 or control pS- retrovirus for 72 h, and the percentage of GFP positivity is reported inside the plots within the right upper quadrant Q2 and in the tables on the right. [score:1]
Moreover, we unveil a new functional connection between miR-101 and EZH2 in this tumor context. [score:1]
RD (a) and JR1 (b) cells were infected with pS-pre-miR-101 or control pS- retrovirus and, 72 h later, seeded to examine their clonogenic capability 2 weeks post seeding (see “Methods” section). [score:1]
qRT-PCR analysis of mature miR-101 (A) and EZH2 (B) 72 h post infection with pS-pre-miR-101 or control pS- retrovirus. [score:1]
Taken together, these results indicate that restoration of miR-101 in eRMS exerts an antitumor effect in vitro. [score:1]
This scenario might suggest that, in these tumor cells, EZH2 must be depleted in order to allow miR-101 increase. [score:1]
Briefly, cell suspensions of RD and JR1 cells infected with pS-pre-miR-101 and pS- or treated with DZNep/Vehicle for 72 h were prepared (3–4 × 10 [5] cells/ml) and 70 μl were applied into each well. [score:1]
d Proposed mo del depicting the interplay between EZH2 and miR-101 in both normal myogenic differentiation (left) and eRMS (right). [score:1]
They also demonstrate that the re-induction of miR-101 hampers the tumor features of eRMS cells. [score:1]
RD (a) and JR1 (c) cells were infected with pS-pre-miR-101 or control pS- retrovirus. [score:1]
Recently, miR-101 has been shown to be induced during human myoblast differentiation [18]. [score:1]
Although the precise role of miR-101 in myogenesis still requires in-depth investigation, results presented here indicate that a fine tuning regulation of the levels of EZH2 and miR-101 is critical for defying miR-101/EZH2 functional balance in eRMS, thus reinforcing the concept that epigenetic dysregulation is a key event in the pathogenesis of this tumor. [score:1]
RT-qPCR analysis of mature a miR-101 and b EZH2 in RD and JR1 cells 72 h post infection with pS-pre-miR-101 or control pS- retrovirus. [score:1]
To ascertain whether miR-101 expression is compromised in eRMS, we measured its levels along with those of EZH2 in primary tumors. [score:1]
c Western blots showing EZH2 and p21 [Cip1] levels in RD and JR1 cells 72 h post infection with pS-pre-miR-101 or control pS- retrovirus. [score:1]
Altogether, these results suggest a negative feedback loop between miR-101 and EZH2 in eRMS cells and point on miR-101 as a potential anticancer microRNA. [score:1]
a Levels of mature miR-101 (left panel) and EZH2 (right panel) were determined by RT-qPCR in primary embryonal rhabdomyosarcoma (eRMS) samples (black and grey bars, respectively) and in normal skeletal muscles (M1-4) used as control tissues (white bars). [score:1]
d Flow cytometry analysis after propidium iodide (PI) staining 72 h post infection with pS-pre-miR-101 or control pS- retrovirus on RD and JR1 cells was performed. [score:1]
However and interestingly, even if miR-101 increases in RD cells depleted of EZH2, its forced induction is unable to promote terminal differentiation in vitro and myosin heavy chain (MHC) -positive myotube-like fiber formation (data not shown). [score:1]
[1 to 20 of 98 sentences]
3
[+] score: 357
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-101-2
Although a high number of overlapping predicted targets suggest similar targeted biological pathways, a correlation analysis of the expression profiles of miR-101 variants and predicted mRNA targets in human brains at different ages, suggest specific functions for miR-101- and 5’-isomiR-101. [score:9]
Several findings indicate that miR-101 5’-trimming variants are functional silencing sRNA: i) both 5’-isomiR-101 mimic and endogenous 5’-isomiR-101 were loaded into Ago2 immunocomplexes, ii) biotin-streptavidin pull-down showed that 5’-isomiR-101 binds to both Ago2 and Rck/p54 RISC components iii) biotinylated 5’-isomiR-101 pull-down assays purified known miR-101 target mRNAs and iv) 5’-isomiR-101 mimic inhibited the expression of known miR-101 targets. [score:8]
These data indicate that under our experimental conditions modulation of gene expression by miR-101 or 5’-isomiR-101 may not involve mRNA degradation as the main mechanism, and suggest further that miR-101 inhibits gene expression more efficiently than 5’-isomiR-101. [score:7]
A. mRNA expression of miR-101 target genes following exogenous expression of miR-101 or 5’isomiR-101. [score:7]
This control sample was assigned a value of 1. B. Protein expression of miR-101 target genes following exogenous expression of miR-101 or 5’isomiR-101. [score:7]
TargetScan 5.2 detected that the majority of putative mRNA targets (>70%) were coincidental, suggesting that miR-101 and 5’-isomiR-101 may target highly overlapping pathways. [score:7]
miR-101 has mainly been studied for its tumor suppressive functions, by directly targeting EZH2, Cox-2, Mcl-1 and Fos [31, 39, 41, 44- 46]. [score:6]
In agreement, transfection of 5’-isomiR-101 resulted in a slight downregulation of two genes, for which miR-101 did not induce significant expression changes. [score:6]
We considered an age-related gene to be targeted by miR-101 or 5’-isomiR-101 sequences only if: i) there is a pair complementary between the miRNA seed and the gene according to TargetScan Custom prediction algorithm [37] and ii) there is a negative expression correlation between the miRNA sequence and the gene. [score:6]
html) was used to highlight additional information: i) The prediction of the deregulated genes as putative targets for miR-101 by different algorithms (-, indicates no prediction and na information not available) and ii) the presense of putative miR-101 target seed sites in regions other than the 3’-UTR (-, indicates no sites and na information not available). [score:6]
miR-101 induced a significant downregulation of 16 genes, eight being targeted by at least one prediction algorithm. [score:6]
It may be that miR-101 modulates gene expression mainly at the translational level, producing mild effects on RNA levels that are difficult to verify in a microarray approach. [score:5]
NYAP2 expression anti-correlated with that of 5’-isomiR-101, and SCN3B expression anti-correlated with that of miR-101 (considering an anti-correlation threshold < −0,7). [score:5]
Our data indicate that, although similar amounts of miR-101 and 5’-isomiR-101 were delivered into neuronal cells, 5’-isomiR-101 inhibited EZH2 mRNA expression by 20%, suggesting that this variant is functional. [score:5]
For some targets, both miR-101 and 5’-isomiR-101 significantly decreased protein expression with no changes in the respective mRNA levels. [score:5]
We found that comparable expression levels of exogenously transfected miR-101 or 5’-isomiR-101 in SH-SY5Y cells decreased the expression of all proteins. [score:5]
This control sample was assigned a value of 1. C. Expression of miR-101 target genes cells transfected with miR-101 and 5’-isomiR-101 biotynilated isomiRs. [score:5]
We chose this paradigm for two reasons: i/ miR-101 expression levels increased through aging, suggesting a role in this process (Figure  1F), and ii/ variants carrying each seed are not equally expressed at the different time-points (compare the oldest and the middle-aged individuals, Figure  1F), suggesting a seed-specific role in the modulation of the age-related genes. [score:5]
miR-101 has also been shown to modulate the expression of target genes involved in inflammatory processes [42], autophagy [47] and angiogenesis [30]. [score:5]
A. Distribution of the numbers and percentages of age-related genes (blue) targeted by miR-101 (red) and 5’-IsomiR-101 (green) seeds, according to TargetScan algorithm. [score:5]
In addition, our analysis showing the regulated expression of miR-101 in brain development and ageing and in a neurodegenerative process suggests important roles for this miRNA in nervous system physiology and pathology. [score:5]
In addition, 5’-isomiR-101 decreased the expression of five validated miR-101 targets, suggesting that it is a functional variant. [score:5]
We then identified the miR-101 or 5'-isomiR-101 predicted targets among the pool of age-related genes, using the TargetScan 5.2 algorithm (837 for miR-101 and 899 for 5’-isomiR-101, out of the 3801; the majority, 73%-78%, were common to the two miR-101 seeds). [score:5]
In addition, the non-overlapping anti-correlation between the expression profiles of miR-101 variants and a number of age-related genes in the human brain agrees with specific miR-101- and 5’-isomiR-101 gene targeting. [score:5]
Although selective functions of the seed variants may add complexity to miR-101 regulatory effect, it has been proposed that isomiRs function cooperatively to target common biological pathways [55]. [score:4]
In fact, miR-101 expression is regulated under a number of physiological and pathological conditions, including angiogenesis [30], tumors [31, 32] and neurodegeneration [16, 33, 34]. [score:4]
In the last condition, our earlier study identified miR-101 as an up-regulated gene in HD [16]. [score:4]
Figure 3 miR-101 and 5’-isomiR-101 differentially regulate gene expression. [score:4]
The negative correlation between the expression profiles of the mRNAs and those of miR-101 or 5’-isomiR-101 was considered the readout for miR-101 or 5’-isomiR-101 effective/detectable gene targeting. [score:4]
A tendency for EZH2 down-regulation by miR-101 was also detected in the microarrays (fold change = −1.2; q = 15%). [score:4]
Transfection of each miR-101 variant resulted in few significantly deregulated genes that showed few changes in expression (q<5%, fold change < −1,2 or > 1,2; Additional file 4: Table S2–Additional file 5: Table S3). [score:4]
In an attempt to identify possible differentially deregulated genes, SH-SY5Y cells were transfected with miR-101 or 5’-isomiR-101 mimics or a scrambled mimic in three independent experiments, and 48 h later overall gene expression was evaluated using Illumina microarrays (HumanHT Expression BeadChips). [score:4]
D. Expression of endogenous miR-101 and 5’isomiR-101 in Ago2-immunocomplexes in the human brain. [score:3]
Of these, DUSP1/MKP-1, APP and EZH2 mRNAs were predicted as possible targets of both miR-101 and 5’-isomiR-101. [score:3]
miR-101 is an interesting example, since it presents 5’-trimming isomiRs (5’-isomiR-101) expressed at levels similar to those of the reference sequence. [score:3]
miR-101 and miR-101 5’-isomiRs are expressed at different proportions in different human samples. [score:3]
SH-SY5Y cells stably expressing Ago2-FLAG were transfected with mIRIDIAN 3’-biotin-miR-101 or 3’-biotin-5’-isomiR-101. [score:3]
In D, E, F normalized counts are expressed as the ratio: (frequency of sequences presenting miR-101 or 5’isomiR-101 seed regions) / (frequency of sequences mapping onto miRNAs) * 10E6. [score:3]
are expressed as the Fold Change ratios obtained from the biotin-tagged miR-101 and 5’-isomiR-101 transfected cells versus the biotin transfected control cells. [score:3]
To assess the possible seed-specificity in the modulation of the age-related transcriptome, we analyzed the correlation between the expression of miR-101 variants and that of the age-related genes at different ages through life. [score:3]
Since miR-101 and 5’-isomiR-101 have a different seed region, we evaluated the predicted conserved targets for each variant, using the TargetScan 5.2 release [37], by searching for the presence of 8mer and 7mer sites that match miR-101 and 5’-isomiR-101 seed regions. [score:3]
These results indicate that the majority of anti-correlated targets were seed-specific, which supports the notion of a selective function of each miR-101 variant in modulating age-related genes (Additional file 6: Figure S3). [score:3]
These findings corroborate previous results showing that miR-101 repressed the expression of certain genes at the protein level [38- 40, 42], while only EZH2 mRNA showed decay [41]. [score:3]
Several targets have been validated for miR-101, including the cyclooxygenase 2 (COX-2) [39], the myeloid leukemia cell differentiation protein (MCL-1) [38], the amyloid precursor protein (APP) [40], the enhancer of zeste homolog 2 (EZH2) [41] and the MAP kinase phosphatase 1 (DUSP1/MKP-1) [42]. [score:3]
This analysis indicated that miR-101 5’-isomiRs are expressed at high proportions in different human cells, thus suggesting a physiological role for these variants. [score:3]
Reinforcing this idea, genes that are relevant in brain function including APP [48] and ATX1 [49] are proven targets of miR-101. [score:3]
miR-101 and 5’-isomiR-101 differentially repress COX-2, Mcl-1, APP, EZH2 and MKP-1 expression. [score:3]
Click here for file Anti-correlation of age-related genes and miR-101 and 5’-isomiR-101 expression profiles. [score:3]
In contrast, miR-101 expression significantly decreased EZH2 mRNA levels, by 40%. [score:3]
A. Normalized expression levels of all sequences mapping onto miR-101 (blue bars), 5’-isomiR-101 seed (red bars) and reference miR-101 seed (green bars) in Ago1-Ago3 IP and in total cell extracts (Total). [score:3]
For each miR-101-sequence-gene pair predicted by TargetScan Custom, a linear regression mo del was performed by the standard R function (’lm’). [score:3]
However, miR-101 produced a significantly higher down-regulation of the proteins studied compared with 5’-isomiR-101 (Figure  3B). [score:3]
B. Expression of exogenously transfected miR-101 or 5’-isomiR-101 in Ago2 immunocomplexes. [score:3]
After transfection of SH-SY5Y cells with the siGLO control sequence (Con) or the mIRIDIAN mimics for miR-101 or 5’-isomiR-101 the expression of COX-2, MCL-1, APP, EZH2 and DUSP-1 (MKP-1) was determined bys. [score:3]
Anti-correlation of age-related genes and miR-101 and 5’-isomiR-101 expression profiles. [score:3]
Overall, these data indicate that the silencing activity of miR-101 variants is related to their efficient loading into the RISC and further suggest that the amount of the different miR-101 variants expressed within a cell does not strictly correlate with the quantities detected in the Ago2 complexes. [score:3]
B. Expression profile of the more abundant miR-101 and 5’-isomiR-101 sequences, and two example age-related genes. [score:3]
The statistical differences between the numbers of commonly predicted miR-101 and 5’-isomiR-101 targets, considering or not the anti-correlation criterion was determined with the prop. [score:3]
A number of results suggest that 5’-isomiR-101 is less efficient than miR-101 in gene silencing: i) determinations of 5’-isomiR-101 and miR-101 with highly specific RT-PCR assays in IPs of endogenous Ago2 indicate that miR-101 is more efficiently loaded into the RISC, although the analysis of SH-SY5Y small RNA sequencing data suggests that 5’-isomiRs-101 are more abundant than the reference miR-101; ii) increased amounts of miR-101 were also detected in Ago2 IPs of SH-SY5Y cells transfected with equivalent quantities of miR-101 or 5’-isomiR-101 mimics; iii) biotinylated miR-101 bound increased amounts of both Ago2 and Rck/p54 RISC members compared with biotinylated 5’-isomiR-101 and iv) 5’-isomiR-101 showed a decreased ability to inhibit several miR-101 targets. [score:3]
D-F. miR-101 and 5’-isomiR-101 expression in the frontal cortex and the striatum of control individuals (C) and patients with HD [16]; in undifferentiated and differentiated SH-SY5Y cells and in the frontal cortex of individuals at different ages [26]. [score:3]
To discern the specific expression pattern of miR-101 5’-isomiRs, we evaluated the expression of miR-101 variants harboring each of the two main seeds in control brains and brains of patients with HD (Figure  1D). [score:3]
To further confirm that the target mRNAs were less represented in the RISC, we transfected SH-SY5Y cells with 3’biotinylated miR-101 and 5’-isomiR-101 mimics and subsequently pulled down the complexes with streptavidin. [score:3]
Our results show that among all the sequences mapping onto miR-101, 5’-trimming variants affecting a single nucleotide position are highly abundant in human samples and show variable expression depending on the sample. [score:3]
miR-101/ age-related genes expression-correlation studies in the human brain. [score:3]
We then examined whether transfected miR-101 and 5’-isomiR-101 mIRIDIAN were incorporated into the RISC, using SH-SY5Y cells stably expressing Ago2-FLAG. [score:3]
To further confirm 5’-isomiR-101 functionality we determined the effect of miR-101 and 5’-isomiR-101 mimics on the expression of COX-2, MCL-1, APP, EZH2 and MKP-1 at the protein level (Figure  3B). [score:3]
The expression of a total of 64 and 153 age-related genes anti-correlated with that of the ref-miR-101 or 5’-isomiR-101 respectively (r<−0.7), with a significantly lower number of common genes between the two miR-101 seeds (16%-39%, p<0.01). [score:3]
In SH-SY5Y cells, miR-101 repressed the expression of COX-2, MCL-1, EZH2, APP and MKP-1 at the same levels as those reported in other cell systems [38- 42]. [score:3]
Furthermore, the context -dependent variations in the relative amounts of miR-101 and 5’-isomiR-101 suggest that the mechanisms regulating their biogenesis and/or stability may differ depending on the biological process. [score:2]
These data suggest that miR-101 is modulated in the development and differentiation processes of the nervous system. [score:2]
To consider a gene regulated by a miR-101 variant, the p-value of the mo del should be less than 0,01 (F-test) and Pearson’s product moment correlation lower than −0.70. [score:2]
In trying to identify possible candidates that are differentially modulated by miR-101 and 5’-isomiR-101, high-throughput array -based approach failed to show significant regulation of mRNAs by either variant. [score:2]
In support of this idea, both types of miR-101 variants are strongly and similarly decreased (data not shown) when analyzing publicly available sRNA sequencing datasets in MCF-7 cells knocked down for Dicer [52]. [score:2]
We examined the presence of miR-101 5’-isomiRs in another brain area (amygdala) from four individuals without major histopathological lesions and no clinical neuropathology and in peripheral blood from four healthy individuals, and further analyzed several public high-throughput sequencing datasets from the GEO repository corresponding to human brains at different developmental stages [26] and different human cell lines [29] (Figure  1B). [score:2]
miR-101/freq. [score:1]
Both biotin-miR-101 and biotin-5’-isomiR-101 were able to interact with Ago2 and Rck/p54. [score:1]
Click here for file miR-101 and 5’isomiR-101 frequency distribution in different Agos. [score:1]
C. Abundance of miR-101 in human blood and brain (amygdala –am- of 4 individuals and frontal cortex –fc- of two individuals aging 25 and 66 years [26]) and in cell lines [29]. [score:1]
For the 5’ and 3’ trimming variants, the number of nucleotides upstream (up) or downstream (down) of the reference miRBase miR-101, are shown. [score:1]
This result suggests that miR-101 binds with RISC members more efficiently, which is in agreement with results shown in Figure  1B. [score:1]
SH-SY5Y cells were transfected with Siglo Green or the mIRIDIAN mimics for miR-101 or 5’-isomiR-101. [score:1]
SH-SY5Y cells were transfected with a negative control sequence (siGLO Green) or the mIRIDIAN mimics for miR-101 (dark bars) or 5’-isomiR-101 (light bars). [score:1]
B. Table showing several determinations of miR-101 sequences. [score:1]
This suggests that the biogenesis and/or stability of miR-101 isomiRs are dependent on the cell context. [score:1]
However, the proportion of species with 3’-nucleotide additions mapping as miR-101 or 5’-isomiR-101 did not correlate with the differential miR-101/5’-isomiRs-101 relative abundance detected in the samples examined (data not shown). [score:1]
A. Specificity of miR-101 and 5’-isomiR-101 detection. [score:1]
Another possible mechanism accounting for the differential abundance of all variants mapping onto miR-101 may be related to the stability of the mature forms. [score:1]
We used miRNA mimics for two abundant representative sequences containing ACAGUAC or UACAGUA seeds: The miRBase reference miR-101 UACAGUACUGUGAUAACUGAA, and one of the most abundant miR-101 5’-isomiRs presenting the same length as the reference miR-101 GUACAGUACUGUGAUAACUGA (Additional file 1: Figure S1). [score:1]
Thus, taking into consideration all the sequences mapping onto miR-101, two main types of seeds were found: ACAGUAC, which is reported in the miRBase, and UACAGUA, corresponding to the vast majority of miR-101 5’-isomiRs. [score:1]
Specifics determinations for miR-101 and 5’-isomiR-101 were performed. [score:1]
Finally, we measured the correlation between the expression levels of age-related genes and those of the most abundant reference seed sequence (miR-101, UACAGUACUGUGAUAACUGAA) or the most abundant 5’-isomiR sequence (5’-isomiR-101, GUACAGUACUGUGAUAACUGA). [score:1]
The different sequences annotating to miR-101, the respective frequencies and lengths are shown. [score:1]
The distribution of the different types of miR-101 isomiRs was confirmed in the prefrontal cortex of human brains at different ages in an independent sequencing experiment [26] (Figure  1A). [score:1]
In addition, the percentage of miR-101 sequences loaded onto each Ago was comparable. [score:1]
Figure 2 miR-101 and 5’-isomiR-101 bind Ago2 and Rck/p54. [score:1]
Furthermore, the proportion of each of the major seed regions differs according to the cell type, which suggests a differential modulation of the biogenesis and/or stability of the different miR-101 variants. [score:1]
RNA sequencing and miR-101 variability analysis. [score:1]
C. Detection of RISC components in miR-101 or 5’-isomiR-101 pull-down. [score:1]
Western blot determination of COX-2, MCL-1, APP, EZH2 and DUSP-1 (MKP-1) levels in SH-SY5Y were performed in cells transfected with a control sequence (Con) and the mIRIDIAN mimics for miR-101 or 5’-isomiR-101. [score:1]
Ago2 complexes were immunoprecipitated from human frontal cortex homogenates and miR-101, 5’-isomiR-101, miR-29a, U6 SNORD44 were determined by. [score:1]
Asterisks indicate statistical significance between miR-101 and 5’-isomiR-101 data : * (p ≤ 0.05), ** (p≤0.01) using Mann–Whitney test. [score:1]
Both 3’biotinylated-miR-101 and 3’biotinylated-5’-isomiR-101 interacted with the mRNA of the five genes analyzed in the present study, although higher mRNA levels were found in the 3’biotinylated-miR-101 pulldowns (Figure  3C). [score:1]
Total RNA was isolated from Ago2 and d-Ago2 IPs and subsequently we performed for miR-101, 5’-isomiR-101, miR-29a, SNORD44 and U6. [score:1]
mIRIDIAN 3’-biotin-miR-101 and 3’-biotin-5’-isomiR-101 were transfected in SH-SY5Y cells and then pulled down using streptavidin beads. [score:1]
Asterisks indicate statistical significance between miR-101 and 5’isomiR-101 data: ** (p≤0.01), * (p≤0.5) using the Mann–Whitney test. [score:1]
However, that study was an overall analysis of all the sequences mapping onto miR-101. [score:1]
SH-SY5Y cells were transfected with Biotin, mIRIDIAN 3’-biotin-miR-101 or 3’-biotin-5’-isomiR-101. [score:1]
Grouping the variants according to the two main seeds we found that in total cell homogenates the ratio miR-101/5’-isomiR-101 in THP-1 cells was close to 2. However, this ratio varied slightly depending on the Ago protein, with the highest levels being found in Ago2 and the lowest in Ago3. [score:1]
The numbers of assigned miR-101 or 5’-isomiR-101 predicted targets were calculated according to the first requirement (seed match) or both of them (seed match and anti-correlation). [score:1]
This suggests that although in terms of quantity miR-101 exceeded 5’-IsomiR-101 in all Agos, miR-101 species loaded more onto Ago2 than 5’-isomiR-101 variants. [score:1]
Thus, whether differential modulation of Dicer activity in diverse cell types and/or physiological conditions is underlying the relative abundance of 5’-trimming miR-101 isomiRs is an open question that deserves specific research. [score:1]
For the 5’ and 3’ trimming variants, the number of nucleotides upstream (up) or downstream (down) of the reference miRBase miR-101 (highlighted in blue), are shown. [score:1]
Figure 1 miR-101 and 5’-isomiR-101 are abundant in different cells and tissues. [score:1]
Our analysis suggests that the relative amount of the two main miR-101 seeds was not equivalent in the different Agos in monocytic human cells. [score:1]
The arrows point to the major cleavage sites producing the most abundant mature miR-101 variants. [score:1]
miRIDIAN™ hsa-miRNA-101 mimics and siGLO Green (transfection indicator) were from Dharmacon: hsa-miRNA-101 (mature sequence: UACAGUACUGUGAUAACUGAA), hsa-5’-isomiR-101 (mature sequence: GUACAGUACUGUGAUAACUGA), 3’biotinilated hsa-miRNA-101 (mature sequence: UACAGUACUGUGAUAACUGAA-Bio) and 3’biotinilated hsa-5’-isomiR-101 (mature sequence: GUACAGUACUGUGAUAACUGA-Bio). [score:1]
The different miR-101 isomiRs consisted in trimming variants, nucleotide additions at the 3’ end of the miRNA and nucleotide substitutions at different positions along the mature miRNA (Additional file 1: Figure S1, Additional file 2: Table S1, Figure  1A). [score:1]
Functional studies aiming to elucidate the possible relevance of the more abundant miR-101 isomiRs in the nervous system were performed in the neuronal cell line SH-SY5Y. [score:1]
The presence of both types of miR-101 variants in Ago2 immunocomplexes was confirmed in publicly available high-throughput sequencing data of endogenous Ago2 -associated sRNAs in HEK293T and mouse NIH-3T3 cells (GEO datasets GSM337571 and GSM849857 respectively). [score:1]
The different sequences annotating to miR-101, the respective frequencies and lenghts are shown. [score:1]
Considering all the sequencing datasets examined, the percentage of sequences mapping onto miR-101 varied between tissues and cell lines, with the brain presenting the highest levels (Figure  1C). [score:1]
In Figure  2C, a miRNA-101 transfected sample was used to normalize data and assigned a value of 1 (Arbitrary Units). [score:1]
miR-101 variants in the human frontal cortex. [score:1]
SH-SY5Y cells were transfected with miR-101 or 5’-isomiR-101 as previously described in three independent experiments, and total RNA was isolated 48 h later. [score:1]
We found all types of miR-101 in each Ago (the trimming, substitution and 3’-additions variants). [score:1]
These data suggest that high miR-101 levels may be important for adult brain physiology. [score:1]
Interestingly, the relative amounts of both types of miR-101 variants in the brain differed according to age. [score:1]
miR-101 and 5’-isomiR-101 interact with Ago2 and Rck/p54. [score:1]
The relative amount of Ago2 and Rck/p54 in 3’-biotin-5’-isomiR-101 versus 3’-biotin-miR-101 is shown in the middle panel. [score:1]
The amount of miR-101 or 5’-isomiR-101 in cells transfected with the corresponding miRNA mimics was similar (Figure  1A). [score:1]
Here we have characterized the expression and function of a highly abundant miR-101 5’-trimming variant (5’-isomiR-101). [score:1]
Sequencing data analysis of these brain areas showed that miR-101 was an abundant miRNA, represented by approximately 100 unique isomiRs (> 10 counts per sequence), although deeper sequencing performed in other brain samples identified more variants (Additional file 1: Figure S1, Additional file 2: Table S1). [score:1]
A. Relative frequencies of different miR-101 isomiRs in the frontal cortex (FC) and striatum (ST) of a control individual [16] and prefrontal cortex (pFC, 98 years and 2 days old) [26]. [score:1]
The mechanisms by which miR-101 variants are generated and a full characterization of the repertoire of targets modulated by miR-101 and 5’-isomiR-101 may shed light on the respective biological function. [score:1]
A scheme is included showing miR-101 precursor and mature forms (in red). [score:1]
In fact, the vast majority of miR-101 5’-isomiRs affected a single nucleotide upstream of the reference miR-101, therefore defining a new seed region. [score:1]
We detected a significant enrichment of either miR-101 or 5’-isomiR-101 in Ago2 IP. [score:1]
The sequences mapping onto miR-101 locus that represent the reference miR-101 sequence (in blue) and the 5’-isomiR-101 (in red) contained in a grey box. [score:1]
Click here for file miR-101 variants in the human frontal cortex. [score:1]
[1 to 20 of 139 sentences]
4
[+] score: 338
Our data suggest that the tumor suppressor miR-101 represses TNBC progression and sensitizes TNBC cells to paclitaxel treatment by directly targeting MCL-1. Our findings provide significant insights into the molecular mechanisms underlying breast carcinogenesis and may have relevance for the development of novel, targeted therapies for TNBC. [score:9]
In this study, we demonstrated that the overexpression of miR-101 enhanced the expression of apoptosis-related cleaved caspase 3 and PARP by targeting MCL-1 and that miR-101 could enhance the expression of paclitaxel -induced cleaved caspase 3 and PARP in TNBC cells. [score:9]
The upregulation of MCL-1 suppressed the expression of cleaved caspase-3 and cleaved PARP, and this effect on MCL-1 was weakened by miR-101. [score:8]
Accordingly, the inhibition of endogenous miR-101 by a miR-101 inhibitor (miR-101-LNA) resulted in the upregulation of endogenous MCL-1 mRNA and protein levels compared to the negative control (Figure 4C and 4D). [score:7]
E. In situ hybridization was used to detect the expression of miR-101, and immunohistochemistry was used to detect the expression of MCL-1 in transplanted tumor tissues in the scramble, miR-101 mimics, control and miR-101 inhibitor groups. [score:7]
The expression of miR-101 was decreased in human breast cancer tissues and inhibited cellular proliferation as well as invasiveness by targeting Stmn1 [11]. [score:7]
The results of and analyses showed that enhanced expression of miR-101 by miR-101 mimics in MDA-MB-435 and MDA-MB-468 cells led to the downregulation of endogenous MCL-1 mRNA and decreased protein levels. [score:6]
MiR-101 directly targets MCL-1. MCL-1 mediates the suppressive functions of miR-101 in TNBC cells. [score:6]
MiR-101 suppresses proliferation and induces apoptosis of TNBC by targeting MCL-1. MCL-1 mediates miR-101 -induced paclitaxel sensitivity in TNBC cells. [score:5]
Furthermore, miR-101 expression was negatively correlated with MCL-1 expression in TNBC tissues (R = 0.555, P < 0.001; Figure 4G). [score:5]
miR-101 expression was normalized using U6 RNA expression. [score:5]
D. The effect of miR-101 mimics or miR-101 inhibitors on the protein expression of MCL-1 was determined by in both the MDA-MB-435 and MDA-MB-468 cell lines. [score:5]
In this study, ectopic overexpression of miR-101 increased paclitaxel sensitivity, whereas the inhibition of miR-101 decreased paclitaxel sensitivity in MDA-MB-435 cells (Figure 3A). [score:5]
While it has been reported previously that suppression of miR-101 leads to the overexpression of MCL-1 in hepatocellular carcinoma and non-small-cell lung cancer [18, 22], the relationship between MCL-1 and miR-101 and their biological relevance in breast cancer have not yet been fully determined, especially in TNBC. [score:5]
G. The correlation between miR-101 and MCL-1 expression in breast cancer tissues was analyzed by comparing miRNA and mRNA expression. [score:5]
miR-101 overexpression significantly suppressed proliferation in vitro. [score:5]
Specifically, miR-101 suppressed tumor progression by targeting MCL-1 in hepatocellular carcinoma [23] and lung cancer [24]. [score:5]
C. MDA-MB-435 cells were transfected with miR-101 mimics, miR-101 inhibitors, an MCL-1 overexpression vector, MCL-1 siRNA or a combination. [score:5]
In MDA-MB-468 and MDA-MB-435 cells, MCL-1 overexpression could reverse the inhibition induced by miR-101. [score:5]
analysis showed that the overexpression of miR-101 significantly increased the expression of cleaved caspase-3 and PARP (Figure 3E). [score:5]
B. MDA-MB-435 cells were transfected with miR-101 mimics, miR-101 inhibitors, a MCL-1 overexpression vector, MCL-1 siRNA or a combination. [score:5]
For example, Wang and colleagues have demonstrated that miR-101 sensitizes human bladder cancer cells to gambogic acid -induced apoptosis by inhibiting EZH2 expression [30]. [score:5]
E. MDA-MB-435 cells were transfected with miR-101 mimics, miR-101 inhibitors, a MCL-1 overexpression vector, MCL-1 siRNA or a combination. [score:5]
In addition, MCL-1 overexpression also partly suppressed apoptosis -associated cleaved caspase-3 and PARP protein levels, which were increased by paclitaxel and/or miR-101 (Figure 6D). [score:5]
D. MDA-MB-435 cells were transfected with miR-101 mimics, miR-101 inhibitors, an MCL-1 overexpression vector, MCL-1 siRNA or a combination. [score:5]
These observations provide strong evidence that the overexpression of miR-101 significantly suppresses the growth of TNBC cells in vitro and in vivo. [score:5]
In this study, the expression of miR-101 was decreased and inversely correlated with MCL-1 expression in all basal-like cell lines and in the majority of TNBC tissues. [score:5]
Meanwhile, the inhibition of miR-101 suppressed cell apoptosis in MDA-MB-435 cells (Figure 2C). [score:5]
TargetScan was used to help identify miR-101 targets in human TNBC. [score:5]
Using two TNBC cell lines, we were able to show that miR-101 suppress the expression of MCL-1, both at the transcriptional and the post-transcriptional level. [score:5]
These results suggest that MCL-1 is a direct target of miR-101. [score:4]
In our study, we were able to show that miR-101 -mediated MCL-1 silencing sensitized TNBC cells to paclitaxel -induced apoptosis, whereas antagomir -mediated downregulation of endogenous miR-101 reversed the apoptotic effect. [score:4]
However, MCL-1 knockdown could erase the effect of the miR-101 inhibitor (Figure 5B). [score:4]
Our results showed that enhanced expression of miR-101 caused a significant reduction in MMP, an increase in green fluorescence and an increase in the rate of apoptosis in MDA-MB-435 cells after paclitaxel treatment (Figure 3B and 3C). [score:3]
C. MDA-MB-435 cells were transfected with paclitaxel, miR-101 mimics, miR-101 inhibitors or a combination. [score:3]
Figure 2 A. MDA-MB-435 and MDA-MB-468 cell lines were transfected with miR-101 mimics, miR-101 inhibitors or their controls. [score:3]
Then, the effects of intratumoral injection of 40 μL of scramble, miR-101 mimic or control, or miR-101 inhibitors in PBS on tumor volume was examined. [score:3]
MCL-1 is a target of miR-101 in breast cancer cells. [score:3]
MAGI-2 suppression by miR-101 reduces PTEN activity, leading to Akt activation in MCF-7 breast cancer cells [12]. [score:3]
Then, using ISH, we found that miR-101 expression was decreased in 56 of 86 samples (65.1%) (Figure 1C). [score:3]
Expression of miR-101 is decreased in TNBC. [score:3]
miR-101 recovered the effect of MCL-1 suppression on apoptosis in MDA-MB-435 cells. [score:3]
D. MDA-MB-435 cell lines were transfected with miR-101 mimics, miR-101 inhibitors, or control sequences. [score:3]
MicroRNA-101 (miR-101) expression is negatively associated with tumor growth and blood vessel formation in several solid epithelial cancers, including breast cancer. [score:3]
Researchers have confirmed that miR-101 acts as a tumor suppressor in gliomas [10]. [score:3]
miR-101 inhibition interrupted the induction of apoptosis in MDA-MB-435 cells by MCL-1 siRNA (Figure 5C). [score:3]
Furthermore, transfection of miR-101 mimics effectively suppressed the tumorigenicity of TNBC cells in a nude mouse mo del. [score:3]
revealed a decrease in miR-101 expression in 16 of 22 TNBC samples (72.7%) (Figure 1B). [score:3]
The 3′UTR of MCL-1 (pMIR-MCL-1) or the 3′UTR with mutated binding sites for miR-101 (pMIR-MCL-1-mut) was synthesized by Invitrogen (China) and inserted into pMIR-REPORT, which expresses the firefly luciferase plasmid (Promega). [score:3]
C. Representative images of miR-101 expression as determined by ISH. [score:3]
A. MDA-MB-435 and MDA-MB-468 cell lines were transfected with miR-101 mimics, miR-101 inhibitors or their controls. [score:3]
Conversely, inhibition of MCL-1 enhanced the levels of cleaved caspase-3 and cleaved PARP, and this effect on MCL-1 was abated by miR-101 (Figure 5E). [score:3]
No significant correlations between miR-101 expression and age or tumor size were found (Table 2). [score:3]
Additionally, MCL-1 overexpression could attenuate paclitaxel or paclitaxel combined with miR-101 -induced apoptosis in MDA-MB-435 cells (Figure 6C). [score:3]
C. MDA-MB-435 and MDA-MB-468 cell lines were transfected with miR-101 mimics, miR-101 inhibitors or their controls. [score:3]
E. MDA-MB-435 cell lines were treated with paclitaxel and transfected with miR-101 mimics, miR-101 inhibitors or a combination. [score:3]
In this study, we analyzed the expression of miR-101 by using a triple -negative breast cancer tissue microarray. [score:3]
The effect of transfection on the levels of miR-101 expression was determined by. [score:3]
These results indicated that MCL-1 overexpression could attenuate the effect of miR-101 on MMP in MDA-MB-435 cells. [score:3]
B. MDA-MB-435 cells were transfected with miR-101 mimics, an MCL-1 overexpression vector or a combination. [score:3]
In transplanted tumors, the expression of MCL-1 was decreased in the miR-101 -treated group (Figure 4E). [score:3]
D. MDA-MB-435 cells were transfected with miR-101 mimics, an MCL-1 overexpression vector or their combined groups. [score:3]
We found that the overexpression of miR-101 resulted in reduced MMP and increased green fluorescence in MDA-MB-435 cells (Figure 2D). [score:3]
The results from the luciferase reporter assays confirmed that MCL-1 represents a direct target gene of miR-101 in TNBC cells. [score:3]
B. miR-101 expression in 22 paired TNBC specimens and the corresponding paired normal adjacent tissues are shown in a column analysis. [score:3]
Additionally, the overexpression of MCL-1 could attenuate the effect of miR-101 on MMP in MDA-MB-435 cells (Figure 5D). [score:3]
Although studies have shown that MCL-1 is a target of miR-101 in lung cancer [18] and endometrial cancer cells [19], the roles of MCL-1 and miR-101 in drug sensitivity have not been identified. [score:3]
Figure 1 A. miR-101 expression was determined by quantitative RT-PCR in one normal mammary cell line, five tumor cell lines with a luminal transcriptional profile and three tumor cell lines with a basal-like transcriptional profile. [score:3]
B. MDA-MB-435 cells were transfected with paclitaxel, miR-101 mimics, miR-101 inhibitors or a combination. [score:3]
The miR-101 mimics, but not miR-ctr, specifically decreased luciferase expression of the MCL1-3′-UTR-wt reporter. [score:3]
There was still orange fluorescence after co-transfection with a MCL-1 -overexpressing vector and miR-101 in MDA-MB-435 cells (Figure 6B). [score:3]
C. MDA-MB-435 cells were transfected with miR-101 mimics, an MCL-1 overexpression vector or a combination. [score:3]
Analysis of the correlation between miR-101 expression and clinicopathological parameters in breast cancer. [score:3]
These results indicated that miR-101 had lower expression in basal-like cell lines compared to luminal cell lines. [score:2]
The miR-101 expression was decreased in seven of the eight breast cancer cell lines (BT-483, T47D, MCF-7, SKBR3, BT-474, MDA-MB-435, MDA-MB-231, and MDA-MB-468) compared to the normal human mammary epithelial cell line MCF-10A (Figure 1A). [score:2]
A. MiR-101 was predicted to bind to the MCL-1 3′-UTR using TargetScan and microRNA online software. [score:2]
In this study, miR-101 was considered a potential therapeutic target for TNBC. [score:2]
By contrast, the inhibition of miR-101 by miR-101-LNA significantly increased cell survival compared to the control (Figure 2A). [score:2]
B. A luciferase assay was performed on MDA-MB-435 cells co -transfected with miR-101 mimics, a scrambled control, miR-101 inhibitors, a control and a luciferase reporter containing MCL-1 3′-UTR (MCL-1-wt) or mutant constructs in which the five nucleotides of the miR-101 binding site were mutated (MCL-1-mut). [score:2]
MiR-101 sensitizes TNBC cells to paclitaxel -induced apoptosis by targeting MCL-1. DISCUSSION. [score:2]
Figure 4 A. MiR-101 was predicted to bind to the MCL-1 3′-UTR using TargetScan and microRNA online software. [score:2]
MiR-101 suppresses proliferation and induces apoptosis of TNBC. [score:2]
MiR-101 suppresses the proliferation, apoptosis and tumorigenic capacity of TNBC cells. [score:2]
A. The kinetics of the effect of miR-101 on breast cancer cell viability. [score:1]
Consistent with the in vitro results, the in vivo growth rate of MDA-MB-435 cells transfected with miR-101 mimics was significantly slower than the growth rate of the controls, while the miR-101-LNA group demonstrated a faster growth rate (Figure 2E). [score:1]
B. MDA-MB-435 and MDA-MB-468 cells were transfected with miR-101 mimics or scramble mimics (upper panel). [score:1]
Then, the mice were randomly assigned to one of four groups (n = 10 mice per group): miR-LNA, miR-101-LNA, miR-scramble or miR-101 mimics. [score:1]
The miR-101 mimic was co -transfected where indicated. [score:1]
Transfection of miR-101 sensitizes breast cancer cells to paclitaxel -induced apoptosis. [score:1]
The rate of apoptosis in MDA-MB-435 cells was increased following transfection with miR-101 mimics. [score:1]
However, the role of miR-101 in TNBC remains elusive. [score:1]
miR-101 miRCURYTM LNA custom detection probes (Exiqon, Vedbaek, Denmark) were used for ISH. [score:1]
Transfection of miR-101 sensitizes TNBC cells to paclitaxel by inducing apoptosis. [score:1]
These results show that miR-101 transfection increases chemotherapeutic drug -induced apoptosis in TNBC. [score:1]
In paclitaxel -treated MDA-MB-435 cells, miR-101 induced green fluorescence. [score:1]
Future studies are needed to further elucidate the signaling pathways that control miR-101 -mediated apoptosis in TNBC. [score:1]
Figure 3 A. The kinetics of the effect of miR-101 on breast cancer cell viability. [score:1]
After demonstrating the mechanism of miR-101 in in vitro and in vivo mo dels, we hypothesized that miR-101 could be involved in the pathogenesis of breast cancer. [score:1]
We assessed the effect of miR-101 and MCL-1 on breast cancer growth both in vitro and in vivo. [score:1]
Previous investigations led us to study MCL-1, a putative target of miR-101. [score:1]
[1 to 20 of 100 sentences]
5
[+] score: 334
We found that the protein expression of epithelial marker E-cadherin, senescence marker p21, pro-apoptosis factor Bax were markedly upregulated, and mesenchymal marker Vimentin and nuclear β-catenin levels (a stem cell-related gene) were greatly downregulated in both cell lines, following the transfection with EZH2, MCL-1 and FOS siRNA (Figure 4a and b), suggesting that suppression of multiple oncogenes including EZH2, MCL-1 and FOS by miR-101 attenuates cell proliferation and invasiveness, and abrogates CSC-like properties in aggressive EC cells. [score:11]
Although the interaction between miR-101 and EZH2 has been verified in other tumors [40, 41], our results suggest that miR-101 not only promotes cell apoptosis and senescence, but also suppresses the EMT and CSC properties of aggressive EC cancer cells, at least in part through attenuating EZH2 expression, with a consequential elevation of Bax, p21, epithelial markers and TIMP-3, downregulation of mesenchymal markers as well as suppression of Wnt/β-catenin signaling evidenced by decreased β-catenin levels in the nucleus (Figure 4a and b). [score:10]
Interestingly, we noticed that a group of genes (EZH2, MCL-1 and FOS) containing putative binding site(s) on their 3'-untranslated regions (3'-UTRs) (Additional file 3: Figure S3b) were also markedly downregulated (at least 2-fold by microarray analysis) in 101-transduced SPAC-1-L cells (Figure 3b), and fell into known miR-101 targets in human diseases except EC (Additional file 3: Figure S3c). [score:10]
Our data brings a new insight into the mechanisms by which loss of miR-101 expression promotes EC initiation and progression Figure 6In aggressive EC cells, miR-101 can downregulate three novel oncogenes (EZH2, MCL-1 and FOS), in turn suppresses tumor cell proliferation, EMT, cell migration, invasion and cancer stemness, and enhances chemosensitivity to paclitaxel (E-cadherin: E-cad; Vimentin: Vim). [score:8]
To evaluate whether suppression of EZH2, MCL-1 and FOS is responsible for the miR-101 -mediated tumor suppression, we knocked down these three genes using specific siRNAs in SPAC-1-L and HEC-50 cells, and found that decreased expression of these genes (Figure 4a and b) was able to significantly induce cell apoptosis and senescence (Figure 4c and d, upper panel), possibly accounting for the inhibitory effects of EZH2, MCL-1 and FOS siRNA on EC cell proliferation (Additional file 4: Figure S4). [score:8]
MiR-101 directly targets EZH2, MCL-1 and FOSIn order to identify potential targets of miR-101, we combined in silico analysis and microarray gene expression analysis using 101 -transfected SPAC-1-L cells relative to NC-transduced control cells. [score:8]
We also observed that transfection EZH2, MCL-1 and FOS siRNA significantly inhibited the ability of SPAC-1-L and HEC-50 cells to invade and to form spheres (Figure 4c and d, lower panel), mimicking the tumor suppressive effects upon miR-101 overexpression. [score:7]
In conclusion, we demonstrate that miR-101 suppresses cancer cell growth, invasiveness and self-renewal by simultaneously downregulating multiple oncogenes in aggressive ECs. [score:6]
Previous studies have shown that miR-101 is downregulated in both endometrioid and serous EC tissues [20] and it inhibits serous EC cell proliferation [21]. [score:6]
In aggressive EC cells, miR-101 can downregulate three novel oncogenes (EZH2, MCL-1 and FOS), in turn suppresses tumor cell proliferation, EMT, cell migration, invasion and cancer stemness, and enhances chemosensitivity to paclitaxel (E-cadherin: E-cad; Vimentin: Vim). [score:6]
In accordance with these findings, our study further confirmed that miR-101 directly targets MCL-1 and FOS in aggressive EC cells, thus miR-101 may suppress multiple steps of EC metastasis through its combined effects on EZH2, MCL-1 and FOS. [score:6]
Quantitative analysis (qRT-PCR) demonstrated that miR-101 expression was downregulated in all 4 EC cell lines. [score:6]
When mutations were introduced into the potential 3'-UTR miR-101 binding sites, only mutation at position 114-21 for EZH2, position 451-8 for MCL-1 and position 524-31 for FOS 3'-UTR prevented the downregulation of reporter activities by miR-101 (Figure 3f). [score:6]
Our results provide the first evidence that, in aggressive EC cells, miR-101 governs multiple malignant phenotypes including proliferation, migration, invasion and cancer stemness, at least partly via downregulating the expression of EZH2, MCL-1 and FOS (Figure 6). [score:6]
We further detected 991 gene transcripts downregulated (P < 0.05) by miR-101 overexpression in SPAC-1-L cells using genome-wide arrays, and cross-referenced these genes with 28 predicted genes to determine the overlapping 14 genes (Figure 3a and b). [score:6]
Relative mRNA expression of EMT, invasion and stemness-related genes (normalized to GAPDH) in SPAC-1-L cells after miR-101 overexpression (f), or in HOUA-1 cells following miR-101 knockdown (g), were determined using qRT-PCRs. [score:6]
Along similar lines, loss of miR-101 expression in HOUA-I cells led to marked reduction of E-cadherin and increased expression of N-cadherin and Vimentin (Figure 2c). [score:5]
The silencing of these genes with specific siRNAs mimics the tumor suppressive effects of miR-101 overexpression in EC cells. [score:5]
Furthermore, we found that decreased miR-101 expression correlates inversely with increased EZH2, MCL-1 and FOS expression in EC tissues. [score:5]
We first examined the effect of miR-101 stable overexpression on SPAC-1-L cell migration using wound healing assay in the presence of proliferation inhibitor Mitomycin C. pCMV-101 -overexpressing SPAC-1-L cells had slower motility (wound closure) compared with pCMV-control vector (pCMV-NC) -transfected cells (Figure 2a). [score:5]
Furthermore, immunoblot analysis revealed that miR-101 overexpression markedly enhanced the expression of pro-apoptotic gene Bax, apoptosis marker cleaved-PARP and senescence marker p21 in either cell line (Figure 1k). [score:5]
Here, we report that miR-101 can suppress proliferation, the epithelial-mesenchymal transition (EMT) -associated migration and invasion, and stem cell-like phenotype of aggressive EC cells, at least through targeting EZH2, MCL-1 and FOS. [score:5]
Stable SPAC-1-L cell lines overexpressing miR-101 were established by transfection of miR-101 expression vector (pCMV-101), and the miRNA levels were analyzed using qRT-PCR (Additional file 2: Figure S2a). [score:5]
An inverse correlation between decreased miR-101 expression and elevated expressions of EZH2, MCL-1 and FOS in ECs. [score:5]
In order to identify potential targets of miR-101, we combined in silico analysis and microarray gene expression analysis using 101 -transfected SPAC-1-L cells relative to NC-transduced control cells. [score:5]
First, we identified 28 genes predicted to be targeted by miR-101 (Additional file 3: Figure S3a) by using three prediction softwares (TargetScan, miRNA. [score:5]
Overexpression of miR-101 inhibits aggressive EC cell migration, invasion and EMT. [score:5]
These data are consistent with our in vitro evidences showing that miR-101 targets EZH2, MCL-1 and FOS in aggressive EC cells, and suggest that the miR-101-EZH2/MCL-1/FOS signaling axis serves as a novel mechanism underlying endometrial tumorigenesis and metastasis, providing potential new therapeutic targets. [score:5]
Although previous findings support a tumor suppressor role of miR-101 in human malignancies, the overexpression of miR-101 has been also detected in other tumor tissues and miR-101 may exhibit its tumor-promoting properties in certain contexts [22- 25]. [score:5]
Among them, we again identified three cancer-related genes (NEK7, UBE2D1 and FLRT3) (Figure 3b), whose mRNA expressions were repressed by miR-101 overexpression in SPAC-1-L cells and induced by AS-101 in HOUA-I cells (Figure 3c). [score:5]
Among them, three oncogenes (EZH2, MCL-1 and FOS) were verified them as direct targets of miR-101. [score:4]
Transcripts of 991 genes were found to be downregulated by miR-101 mimic (right). [score:4]
These results were also confirmed in HOUA-I cells (Figure 3g), verifying that the suppressive effects of miR-101 is mainly due to direct interaction with binding sites in the EZH2, MCL-1 and FOS 3'-UTR at these perfect 8-mer sites (Additional file 3: Figure S3b). [score:4]
Since miR-101 and its targets appear to play an important role in EC progression, we compared the endogenous expression levels of miR-101, EZH2, MCL-1 and FOS between EC tissues and adjacent normal tissues by qRT-PCR analysis. [score:4]
Thus, it is not clear whether the negative regulation of MCL-1 and FOS contributes to the suppression of EC cell proliferation, invasion and CSC-like phenotype by miR-101. [score:4]
MiR-101 and its targets show inverse expression levels and in EC tissues. [score:4]
Moreover, upregulation of miR-101 in EC cells can remarkably reverse EMT -associated phenotypes, including reduced cell migration and invasiveness, restored sensitivity to Paclitaxel and impaired sphere formation. [score:4]
In addition to EZH2, two miR-101 targets (MCL-1 and FOS) tested in our present study, have been reported to regulate tumorigenesis and metastasis. [score:4]
These results show an inverse association between loss of miR-101 and upregulation of EZH2, MCL-1 and FOS. [score:4]
In particular, miR-101 can play a tumor-suppressive role in regulating tumor cell growth, migration, invasion, drug resistance and cancer stem cell (CSC) characteristics via suppression of oncogenic signaling pathways in breast [9], colon [10], lung [11], ovarian [12] and gastric cancers [13]. [score:4]
Figure 5(a) qRT-PCR analysis showed the downregulation of miR-101 in 22 pairs (#1-22) of EC tissues (C) and their adjacent normal tissues (N), depicted as normalized data (left, fold changes) and raw expression values (right, calculated with the 2 [−ΔΔCt] method). [score:4]
The inhibition of miR-101 by AS-101 in SPAC-1-L cells changed cell morphology from an epithelial to a more mesenchymal phenotype and increased cell invasion (Additional file 2: Figure S2d, e and f). [score:3]
In agreement with this, a negative correlation between endogenous miR-101 levels and EZH2, MCL-1 and FOS mRNA expression was found in EC cells (Figure 1a and Additional file 3: Figure S3d). [score:3]
Further qRT-PCR and IHC experiments clearly reveal that lower miR-101 expression is inversely correlated with higher EZH2/MCL-1/FOS protein levels in EC tissues. [score:3]
MiR-101 is downregulated in aggressive EC cell lines and modulates cell proliferation. [score:3]
Currently, little is known about the biological function of miR-101 and its actual targets in the aggressive type of EC. [score:3]
As expected, overexpression of miR-101 significantly decreased the clonogenic ability of both cells (Figure 1d and e). [score:3]
Taken together, these findings suggest that miR-101 suppresses the EMT -associated phenotypes of aggressive EC cells. [score:3]
Furthermore, we investigated whether suppression of miR-101 expression would induce EC cell migration. [score:3]
Predicted 28 potential targets of miR-101 were shown (left). [score:3]
Here, we showed that miR-101 levels was significantly downregulated in aggressive EC cell lines compared with immortalized human endometrial epithelial cells. [score:3]
A miR-101-specific inhibitor (AS-101) was introduced into HOUA-I cells to neutralize endogenous miR-101 activity (Additional file 2: Figure S2b). [score:3]
These data suggest that ectopic expression of miR-101 can reduce mesenchymal phenotype and invasive ability of aggressive EC cells. [score:3]
The role and its novel downstream targets of miR-101 in aggressive endometrial cancer have not yet been described. [score:3]
Mutant constructs containing point mutations in the miR-101 -binding sites were created using a quick-change site-directed mutagenesis kit (Stratagene, CA). [score:3]
We further indentified potential miR-101 targets by computational prediction and microarray screening. [score:3]
MiR-101 directly targets EZH2, MCL-1 and FOS. [score:3]
Our results suggest that miR-101 exerts its novel tumor suppressive activities in aggressive ECs by modulating multiple critical oncogenes. [score:3]
Although SPAC-1-L cells are highly invasive, this cell displays an epithelial-like morphology, thus we next examined whether the silencing of miR-101 expression can cause a gain in mesenchymal features. [score:3]
These results suggest that miR-101 can trigger apoptosis and/or senescence programs and in turn suppress the proliferative capacity of aggressive EC cells. [score:3]
Therefore, the restoration of miR-101, or in combination with EZH2, MCL1 and FOS inhibitors, might be a potential therapeutic strategy for blocking EC initiation, progression and drug resistance. [score:3]
Although most evidence indicates the tumor suppressor activity of miR-101 in cancer cells, conflicting evidences also indicate that miR-101 can act as an oncogenic miRNA in other malignancies [22, 23, 24, 25], consistent with the notion that a miRNA may exhibit diverse context -dependent functions through distinct pathways [26]. [score:3]
Formalin-fixed, paraffin-embedded blocks from 50 patients who underwent surgical resection of grade 3 endometrioid ECs at the Cancer Center, Sun Yat-Sen University, were analyzed for the expression of miR-101, EZH2, MCL-1 and FOS. [score:3]
Luciferase reporter assays confirmed that EZH2, MCL-1 and FOS were direct targets of miR-101 in SPAC-1-L (f) and HOUA-I cells (g). [score:3]
The greatest reduction of miR-101 levels was found in highly invasive SPAC-1-L and S cells (Figure 1a), indicating that miR-101 might be a tumor suppressor in aggressive subtype of EC. [score:3]
A schematic mo del depicting the mechanisms of miR-101 -mediated tumor suppression. [score:3]
Therefore we tested whether miR-101 overexpression can reduce CSC properties. [score:3]
Consistent with these observations, knockdown of miR-101 by AS-101 in HOUA-I cells induced cell scattering and invasiveness in Matrigel (Additional file 2: Figure S2g and h). [score:2]
Figure 1(a) Relative miR-101 expression of four aggressive endometrial cancer cell lines and immortalized endometrial epithelial cell line EM were examined with the quantitative real-time RT-PCR (qRT-PCR) assay. [score:2]
Knockdown of miR-101 by AS-101 conversely induced the mRNA and protein levels of EZH2, MCL-1 and FOS in HOUA-I cells (Figure 3d and 3e, right panel). [score:2]
Effects of ectopic expression of miR-101 on the proliferation of SPAC-1-L cells (b) and HEC-50 cells (c) were assessed with cell counting kit-8 assay. [score:2]
The inhibition of miR-101 by AS-101, but not anti-miRNA negative control (AC), significantly increased migratory abilities in a transwell chamber assays (Additional file 2: Figure S2c). [score:2]
Previous studies from hepatocellular carcinomas have suggested that MCL-1 [54] and FOS [49] were regulated by miR-101. [score:2]
MiR-101 inhibits aggressive EC cell migration, invasion and EMT. [score:2]
These changes were reversed by knockdown of miR-101 in HOUA-I cells (Figure 2g). [score:2]
In contrast, silencing of miR-101 in HOUA-I cells decreased apoptotic response to paclitaxel (Additional file 2: Figure S2i). [score:1]
In addition, upregulation of miR-101 sensitized SPAC-1-L cells to paclitaxel toxicity, as measured by cell counting kit-8 assay (Figure 2e). [score:1]
To gain further insight into the anti-proliferative effect of miR-101, we next evaluated whether the decreased proliferation upon miR-101 overexpression was a result of cellular senescence. [score:1]
As previously reported [20, 21], miR-101 levels were lower in 22 (#1-22) ECs than in normal tissues (Figure 5a). [score:1]
We evaluated the effects of miR-101 on cell migration and invasion of SPAC-1-L and HEC-50 cells with relatively lower levels of miR-101, or on HOUA-I cells, which expresses relatively higher levels of miR-101. [score:1]
The pCMV-miR-101-3p (pCMV-101) vector carrying pre-microRNA-101-3p and the control vector (pCMV-NC) (OriGene, Rockville, MD) were transfected into SPAC1-L cells by Lipofectamine PLUS Reagent (Invitrogen, Carlsbad, CA) as described previously [56]. [score:1]
Introduction of miR-101 in SPAC-1-L and HEC-50 cells caused senescence-like phenotypes, such as positive staining for SA-β-gal (Figure 1i and j) and enlarged, flattened cell morphology (Additional file 1: Figure S1b). [score:1]
The miR-101-EZH2/MCL-1/FOS axis serves as a novel mechanism underlying the invasive and stemness properties of EC cells. [score:1]
Increasing levels of miR-101 in invasive EC cells reduce cell proliferation, most likely due to miR-101 -induced apoptosis and senescence. [score:1]
However, other miRNAs (such as miR-101 and miR-145) are found in various human tumors and predicted to have broad biological functions [7, 8]. [score:1]
[1 to 20 of 85 sentences]
6
[+] score: 285
Furthermore, forced expression of miR-101 in A172 cells reduced GSK3β expression at both the mRNA and protein levels (Figure 3C), whereas suppression of miR-101 enhanced the expression of GSK3β (Figure 3D). [score:9]
Seven miRNAs (downregulated: miR-29c, miR-93, miR-101 and miR-130a; upregulated: miR-9, miR-182 and miR-221) were identified as differentially expressed (≥2-fold) in both A172-TR and U251-TR cell lines (Figure 1A). [score:9]
It has been reported that downregulation of miR-101 contributes to cisplatin resistance of non-small cell lung cancer cells by targeting ROCK2 [36], miR-101 sensitizes liver cancer cells to doxorubicin -induced cell death through targeting Mcl-1 [38], and miR-101 can enhance chemosensitivity in epithelial ovarian cancer [34]. [score:8]
In our study, GSK3β is found to be a direct target of miR-101, and miR-101 could sensitize resistant GBM cells to TMZ through downregulation of GSK3β. [score:7]
Upregulated miRNAs (miR-9, miR-182 and miR-221) were shown in red, downregulated miRNAs (miR-29c, miR-93, miR-101 and miR-130a) were shown in green. [score:7]
In the present study, we found that miR-101 was significantly downregulated in TMZ- resistant GBM cells, and its re -expression could reverse TMZ resistance through regulation of a serine/threonine protein kinase, glycogen synthase kinase 3β (GSK3β)[17, 18]. [score:7]
Among them, three miRNAs (miR-29c, miR-93 and miR-101) were downregulated and two (miR-9 and miR-182) were upregulated in the TMZ-refractory samples as compared with that in the primary tumor samples (p<0.05, Figure 1D). [score:6]
Our study has revealed that miR-101 is downregulated and involved in chemoresistance of GBM, it is therefore reasonable to infer that restoration of miR-101 expression may reverse chemoresistance to anti-cancer drugs. [score:6]
MicroR-101 (miR-101), which functions as a tumor suppressor, is downregulated in a variety of malignancies including GBM [14]. [score:6]
Figure 4 through downregulation of GSK3β A, B. Upon treatment with TMZ (200 μM), A172-TR cells transduced with miR-101 were forced to over-express GSK3β, and then apoptotic analysis (A) and colony formation assay (B) were performed. [score:5]
After exposure to TMZ, expression of both cleaved-PARP and cleaved-Caspase 9 were increased in cells transduced with miR-101, and significantly decreased after forced over -expression of GSK3β (Figure 4C). [score:5]
Since the expression of miR-101 was decreased in both TMZ-resistant GBM cells and human specimens, we next examined whether re -expression of miR-101 could sensitize the resistant GBM cells to TMZ. [score:5]
miR-101 sensitized resistant U251-TR cells to TMZ treatment, as demonstrated by the decreased colony number formation after ectopic expression of miR-101, whereas GSK3β rescued miR-101 -induced cell growth inhibition (*, p<0.05; Figure 4B and Supplementary Figure S3C). [score:5]
MicroR-101 high expression group (miR-101 high) was defined as patients with higher expression level of miR-101 than average and vice versa. [score:5]
To identify potential target genes of miR-101, we performed in silico analysis by using the publicly available databases miRanda, DIANA-microT and TargetScan (Supplementary Figure S2). [score:5]
C. The mRNA and protein expression of GSK3β in A172 cells after over -expression of miRNA-101. [score:5]
However, remarkable correlation of miR-101 expression with differentiation degree of tumor (p=0.017) and disease recurrence (p=0.008) was demonstrated (Table 1). [score:5]
GSK3β, the gene involved in the regulation of protein synthesis, glycogen metabolism, cell proliferation and survival, was predicted to be one of the potential target genes of miR-101. [score:4]
Figure 5 A, B. Patients with lower expression of miR-101 had both shorter progression-free survival (A; p=0.029) and overall survival (B; p=0.017) as compared to those with higher expression of miR-101. [score:4]
We also find that miR-101 could sensitize resistant GBM cells to TMZ through downregulation of GSK3β. [score:4]
Downregulation of miR-101 in GBM patients predicts worse prognosis. [score:4]
In summary, we have identified that miR-101 is downregulated in TMZ-resistant GBM, rendering GBM cells resistant to TMZ treatment. [score:4]
Collectively, these results indicated that GSK3β was a direct target of miR-101 in glioblastoma cells. [score:4]
Furthermore, we knocked down the endogenous GSK3β expression in A172 cells transduced with anti-miR-101 or scrambled antisense miRNA control (anti-control), and treated those cells with TMZ. [score:4]
through downregulation of GSK3βTo further evaluate the functional role of GSK3β in miR-101 -mediated chemosensitization, we over-expressed GSK3β in TMZ-resistant U251-TR cells transduced with miR-101, and treated those cells with TMZ. [score:4]
Taken together, these results suggested that downregulation of miR-101 predicted worse prognosis in GBM patients. [score:4]
A, B. Patients with lower expression of miR-101 had both shorter progression-free survival (A; p=0.029) and overall survival (B; p=0.017) as compared to those with higher expression of miR-101. [score:4]
In this paper, we show that miR-101 is downregulated in TMZ-resistant GBM cells and human specimens, which is consistent with previous reports in other cancers [25– 27]. [score:4]
Alternatively, downregulation of miR-101 in GBM patients predicts worse prognosis, suggesting its potential use as a new prognostic marker in GBM. [score:4]
GSK3β is a direct target of miR-101. [score:4]
Various studies have shown that downregulation of miRNA-101 is involved in chemoresistance of several cancers [35– 37]. [score:4]
To determine whether GSK3β is a direct target gene of miR-101, luciferase reporters fused to wild-type or mutant 3′-UTRs of GSK3β were constructed. [score:4]
Moreover, patients with lower expression of miR-101 showed a shorter overall survival as compared with those with higher expression of miR-101 (p=0.017). [score:4]
Collectively, these results suggested that miR-101 sensitized resistant GBM cells to TMZ through downregulation of GSK3β. [score:4]
Because of the largest fold change of miR-101 among the three downregulated miRNAs, we chosen miR-101 for the subsequent studies. [score:4]
The immunochemistry assay also showed that GBM samples with lower level expression of miR-101 exhibited obvious higher expression of GSK3β (*, p<0.05; Figure 3F). [score:4]
Studies show that downregulation of miR-101 can induce the proliferation, migration, and angiogenesis of GBM cells [15, 16]. [score:4]
Briefly, lentiviral plasmids pLV-THM expressing miR-101 or vector control was cotransfected with psPAX2 and pMD2. [score:3]
The expression of miR-101 and GSK3β was determined by qRT-PCR. [score:3]
The results showed that inhibition of miR-101 led to decreased cell apoptosis after TMZ treatment (Figure 2D and Supplementary Figure S3A). [score:3]
Besides of GSK3β, other genes such as VEGF and COX-2 have been reported to be targets of miR-101 [19, 20]. [score:3]
E. The inverse correlation between the expression of miR-101 mRNA and GSK3β mRNA in GBM samples (Spearman r: −0.307, p=0.01). [score:3]
In our study, we also found that miR-101 alone could suppress cell growth of GBM. [score:3]
It suggested that suppression of miR-101 might render GBM cells resistant to TMZ in vitro. [score:3]
The relative expression of miR-101 was shown in Supplementary Figure S1. [score:3]
Over -expression of miR-101 was confirmed by real-time qPCR analysis. [score:3]
The half maximal inhibitory concentration (IC50) values of U251-TR cells transduced with vector control and miR-101 are (165.0±52.5) μM and (22.4±4.5) μM, respectively (Figure 2A). [score:3]
By contrast, inhibition of miR-101 by transfection of A172 cells with anti-miR-101 oligonucleotides increased the activity of luciferase reporter fused to the wild-type 3′-UTRs of GSK3β but not the mutant (*, p<0.05; Figure 3B). [score:3]
Importantly, decreased expression of miR-101 is related to poor prognosis in patients with GBM, suggesting that miR-101 can be used as a prognostic molecular marker. [score:3]
As shown in the Figure 5A, patients with lower expression of miR-101 had a significantly shorter progression-free survival (p=0.029). [score:3]
D. The mRNA and protein expression of GSK3β in A172 cells after transfection with anti-miR-101. [score:3]
We also assessed the effect of miR-101 inhibition on TMZ resistance in A172 cells. [score:3]
Interestingly, our study proves that over -expression of miR-101 does sensitize resistant GBM tumor xenografts to TMZ treatment in vivo. [score:3]
The expression of miR-101 was found to be inversely correlated with GSK3β in the GBM samples (Spearman r: −0.307, p=0.01; Figure 3E). [score:3]
To predict the binding site of miR-101 and GSK3β, prediction algorithms, including TargetScan (http://www. [score:3]
As shown in Table 1, no association of miR-101 expression with age, gender, Karnofsky performance score (KPS), tumor size and treatment (resection, chemotherapy and radiotherapy) was found in patients with GBM. [score:3]
Results showed that forced miR-101 expression rendered U251-TR cells more sensitive to TMZ. [score:3]
On the other hand, over -expression of miR-101 can sensitize resistant GBM tumor xenografts to TMZ in vivo. [score:3]
Cell growth assay showed that suppression of miR-101 rendered A172 cells resistant to TMZ treatment, whereas knockdown of endogenous GSK3β remarkably sensitized these cells to TMZ (*, p<0.05; Figure 4D). [score:3]
Here, we describe that miRNA-101 may participate in the regulation of TMZ resistance in GBM. [score:2]
A, B. Upon treatment with TMZ (200 μM), A172-TR cells transduced with miR-101 were forced to over-express GSK3β, and then apoptotic analysis (A) and colony formation assay (B) were performed. [score:2]
Hence, we speculate that miR-101 may participate in the regulation of TMZ resistance in GBM. [score:2]
Clinicopathological characteristics of patients with glioma according to the expression of miR-101. [score:1]
As shown in Figure 3A, the predicted binding sites of miR-101 in the 3′-UTR of GSK3β were conserved from various species. [score:1]
To determine the prognostic value of miR-101 for GBM, Kaplan-Meier survival analysis of patients with GBM was conducted, and log-rank test were performed to evaluate the statistical significance between stratified groups according to the expression of miR-101. [score:1]
TMZ-resistant U251-TR cells stably transduced with either miR-101 or vector control were injected subcutaneously into two groups of nude mice (n = 5). [score:1]
As expected, the tumor growth curve showed that tumors derived from miR-101 group grew more slowly than those from the vector control group. [score:1]
The association of miR-101 expression and clinicopathological characteristics was analyzed by Chi-square or Fisher's two-tailed exact test. [score:1]
To further evaluate the functional role of GSK3β in miR-101 -mediated chemosensitization, we over-expressed GSK3β in TMZ-resistant U251-TR cells transduced with miR-101, and treated those cells with TMZ. [score:1]
Cells were co -transfected with synthetic miR-101 or anti-miR-101, the wild-type or mutant 3′UTR of GSK3β luciferase reporter vector pGL3-GSK3-3′UTR and pRL vector coding for the Renilla luciferase (Promega, Madison, WI, USA). [score:1]
TMZ-resistant U251-TR cells stably transduced with either miR-101 or vector control were injected subcutaneously into two groups of nude mice (n=5). [score:1]
To address this question, TMZ-resistant U251-TR cell lines were transduced with miR-101 and then treated with different concentrations of TMZ. [score:1]
We confirm that miR-101 also plays a key role in the TMZ resistance of GBM. [score:1]
As shown in Figure 2C, in the absence of TMZ, miR-101 alone could decrease the number of colonies of U251-TR cells. [score:1]
C. showed the numbers of colonies of U251-TR cells transduced with control or miR-101 in the presence or absence of TMZ (200 μM). [score:1]
A. The predicted binding sites of miR-101 in the 3′-UTR of GSK3β were conserved from various species. [score:1]
Cells were then infected with lentiviruses encoding miR-101 or vector control and prepared for the further experiments. [score:1]
It not only yields a better understanding of the underlying mechanisms of miR-101 in TMZ-resistant in GBM, but also paves a new way for novel and powerful anticancer therapeutics. [score:1]
D. A172 cells were transduced with anti-miR-101 or scrambled antisense miRNA control (anti-control), and treated with TMZ (200 μM) for 7 days. [score:1]
A. TMZ-resistant U251-TR cell lines were transduced with miR-101 and then treated with different concentrations of TMZ for 72 h. The percentage of cell survival over a range of drug concentration was plotted. [score:1]
Figure 2 A. TMZ-resistant U251-TR cell lines were transduced with miR-101 and then treated with different concentrations of TMZ for 72 h. The percentage of cell survival over a range of drug concentration was plotted. [score:1]
The miR-101 mimics, anti-miR-101, GSK3βsiRNA, and their scramble controls were synthesized by Sangon (Shanghai, China). [score:1]
Figure 3 A. The predicted binding sites of miR-101 in the 3′-UTR of GSK3β were conserved from various species. [score:1]
Upon TMZ treatment, the tumor volumes of miR-101 group and vector control group were (0.14 ± 0.09) cm [3] and (0.42 ± 0.08) cm [3], respectively (*, p<0.05; Figure 2E). [score:1]
These results indicated that miR-101 sensitized resistant GBM cells to TMZ in vivo. [score:1]
The flow cytometry assay showed that U251-TR cells transduced with miR-101 exhibited increased cell apoptosis compared with vector control; however, the increased cell apoptosis caused by miR-101 was attenuated significantly by ectopic over -expression of GSK3β (*, p<0.05; Figure 4A). [score:1]
F. The inverse correlation between miR-101 and GSK3β was confirmed by IHC analysis. [score:1]
To confirm the above findings, we analyzed the correlation between miR-101 and GSK3β in GBM samples (n=70). [score:1]
Moreover, miR-101 sensitized U251-TR cells to TMZ treatment, as indicated by significantly decreased number of colony formation (Figure 2C). [score:1]
In the absence of TMZ, the tumor volumes of miR-101 group and vector control group were (0.36 ± 0.07) cm [3] and (0.68 ± 0.10) cm [3], respectively (*, p<0.05; Figure 2E). [score:1]
[1 to 20 of 90 sentences]
7
[+] score: 266
On the other hand, knockdown of c-Jun or/and c-Fos led to a dramatic decrease of the transcription activity of p(−17.4/−16.4k) (Figure 4C) and TPA -induced expression of miR-101 (Figure 4D), suggesting that the expression of miR-101 depends on the activity of AP-1. Figure 4. AP-1 regulates miR-101 expression through the enhancer region of miR-101-2. (A) Effect of AP-1 overexpression on the luciferase activity of the various deleted versions of p(−17.4/−16.4k). [score:11]
On the other hand, knockdown of c-Jun or/and c-Fos led to a dramatic decrease of the transcription activity of p(−17.4/−16.4k) (Figure 4C) and TPA -induced expression of miR-101 (Figure 4D), suggesting that the expression of miR-101 depends on the activity of AP-1. Figure 4. AP-1 regulates miR-101 expression through the enhancer region of miR-101-2. (A) Effect of AP-1 overexpression on the luciferase activity of the various deleted versions of p(−17.4/−16.4k). [score:11]
Here we showed that miR-101, a direct target of AP-1, could attenuate the AP-1 signaling by directly inhibiting the expression of ERK2 and c-Fos. [score:9]
Furthermore, we identified the enhancer region for the miR-101-2 gene and classified AP-1 as a transactivator of miR-101 expression rested on the following evidence: Firstly, ectopic expression of AP-1 or stimulation with TPA, an AP-1 activator significantly increased miR-101 level and knockdown of AP-1 abrogated the TPA -induced miR-101 expression. [score:8]
These results indicate that miR-101 may suppress AP-1 activity by directly inhibiting the expression of ERK2 and c-Fos. [score:8]
Buechner J. Tomte E. Haug B. H. Henriksen J. R. Lokke C. Flaegstad T. Einvik C. Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastomaBr. [score:7]
Our results elucidate the regulation mechanism of miR-101 transcription and suggest an important role of the AP-1/miR-101 feedback loop in preventing the excessive activation of metastatic signals imposed by ERK2/AP-1. Although the tumor suppressive role of miR-101 has been reported in a wide variety of cancers, how the expression of miR-101 itself is regulated remains elusive. [score:7]
In a search for the potential targets regulated by miR-101, we found that two key members of the AP-1 signaling pathway, c-Fos and ERK2, are among the list of predicted targets. [score:6]
To explore the biological significance of the AP-1/miR-101 regulatory loop, the effect of miR-101 on the expression of several reported AP-1 target genes was firstly examined by qPCR. [score:6]
We have previously shown that miR-101 is significantly downregulated in hepatocellular carcinoma (HCC) cells, and the restoration of miR-101 dramatically promotes the apoptosis and suppresses the tumorigenicity of hepatoma cells in vitro and in vivo (6). [score:6]
As c-Fos has been previously reported as a direct target of miR-101 in hepatoma cells (8), we only performed luciferase reporter assays to verify whether miR-101 regulated ERK2 expression by binding to its 3′-UTR. [score:6]
To explore which AP-1 component involved in TPA -induced miR-101 expression, the expression of the Jun, Fos and ATF family members was determined in TPA -treated HepG2 cells. [score:5]
The levels of primary miR-101 (pri-miR-101), AP-1 family members and target genes of AP-1, including MMP1, MMP3,  MMP9,  CD44,  uPA,  uPAR,  CCND1 and IL-8, were quantified by Thunderbird SYBR qPCR Mix (QPS-201, TOYOBO, Japan) and normalized to β-actin expression. [score:5]
Studies from others also disclose that miR-101 not only inhibits the proliferation and colony formation of different cancer cells (10, 11) but also suppresses tumor cell migration, invasion and metastasis (4, 5, 7– 10). [score:5]
Among the TPA -induced AP-1 targets, MMP1,  MMP3,  MMP9,  CD44 and IL-8 were suppressed by miR-101 (Figure 6B and Supplementary Figure S7). [score:5]
Left panel: miR-101 suppresses the transcriptional activity of AP-1. Right panel: overexpression effect of miR-101. [score:5]
It is worth noting that downregulation of miR-101 is a common event in cancers and has been implicated in the development and progression of different malignancies. [score:5]
Although the tumor suppressive function of miR-101 has been largely explored, the transcriptional regulation and the regulatory network of miR-101 remain obscure. [score:5]
As AP-1 is an inducible transcription factor complex that can be activated by TPA (18), we therefore treated HepG2 and MHCC-97H cells with TPA to examine whether AP-1 regulated miR-101 expression. [score:4]
Figure 5. MiR-101 suppresses AP-1 activity by targeting c-Fos and ERK2. [score:4]
In this study, we disclose a novel AP-1/miR-101 regulatory circuitry, that is, AP-1 promotes the transcription of miR-101, whereas the expression of miR-101 reduces the levels of ERK2 and c-Fos and thereby attenuates the AP-1 signaling and in turn abrogates the AP-1-promoted migration and invasion of cancer cells. [score:4]
Considering that CD44 and MMPs are critical factors in regulating cell adhesion and Extracellular matrix (ECM)-degrading and gelatin zymography disclosed that both miR-101 and siAP-1 significantly inhibited the TPA-enhanced MMP9 activity (Figure 6C), we therefore evaluated whether miR-101 could inhibit AP-1 -mediated migration and invasion. [score:4]
Overexpression of miR-101 induced a dose -dependent decrease in luciferase activity, an effect mimicked knockdown of ERK2 (Figure  5A and B). [score:4]
In an attempt to explore the regulatory networks of miR-101, we revealed that AP-1 directly transactivated miR-101 and there existed a novel AP-1/miR-101 negative regulatory circuitry in hepatoma cells, whose disturbance enhanced the activity of MMP9 and thus promoted the migration and invasion of hepatoma cells. [score:4]
Our data suggest that frequent downregulation of miR-101 may also account for the abnormal activation of AP-1 signaling in human cancers. [score:4]
Taken together, we suggest a novel AP-1/miR-101 regulatory circuitry: AP-1 promotes the transcription of miR-101, whereas the expression of miR-101 reduces the level of ERK2 and c-Fos and thereby attenuates the AP-1 signaling (Figure 7E). [score:4]
Collectively, these results indicate that c-Jun and c-Fos may directly bind to the −17.4 to −16.4 k region and promote the expression of miR-101. [score:4]
Figure 6. The AP-1/miR-101 regulatory feedback loop regulates the migration and invasion of hepatoma cells. [score:3]
Consistently, inhibition of endogenous miR-101 by anti-miR-101 increased ERK2 and c-Fos protein levels and prolonged the TPA -induced activation of both ERK2 and c-Fos (Figure 5D). [score:3]
As expected, the expression of miR-101 increased at 12 h and peaked at 24 h after TPA treatment (Figure 2D and Supplementary Figure S2A) in both cell lines. [score:3]
Expression of miR-101a in the liver was set to 1. Figure 2. AP-1 is associated with transcription and enhancer activity of miR-101. [score:3]
Transfection of miR-101 significantly suppressed the Renilla luciferase activity of the psiCHECK-2 reporter with wild-type but not mutant 3′-UTR of ERK2 (Figure 5E). [score:3]
Furthermore, introduction of miR-101 suppressed TPA -induced ERK2 and c-Fos activation (phopho-ERK2 and phopho-c-Fos), as well as total ERK2 and c-Fos proteins (Figure 5C). [score:3]
Expression of miR-101a in the liver was set to 1. Figure 2. AP-1 is associated with transcription and enhancer activity of miR-101. [score:3]
The other MAPKs, including p38 and JNK, were largely unchanged when miR-101 was either overexpressed or depleted (Supplementary Figure S6A and B). [score:3]
The level of pri-miR-101-1 in the normal human liver (661N) was set to 1. (C) Expression of mature miR-101a and miR-101b in various mouse tissues. [score:3]
Allele loss is one of the main mechanisms of decreased miR-101 expression in prostate tumors, which was also implicated in a subset of other cancers like breast, gastric cancers and glioblastoma (5). [score:3]
HepG2 cells were non -transfected or transfected with the inhibitor of miR-101 (anti-miR-101) or its control (anti-NC) for 44 h, and then treated with TPA for 4 h before protein extraction. [score:3]
The results showed that introduction of miR-101 efficiently suppressed the TPA -induced transcription of pri-miR-101-2 (Figure 6A). [score:3]
Remarkably, miR-101 level was increased by ectopic expression of c-Fos and c-Jun, and was further enhanced by TPA treatment (Figure 4B and Supplementary Figure S5B). [score:3]
These data suggest a potential tumor suppressive role of miR-101. [score:3]
miR-101 transcription is directly activated by AP-1. A novel AP-1/miR-101 regulatory feedback loop is implicated in the migration and invasion of hepatoma cells. [score:3]
The miR-101 inhibitor (anti-miR-101) with a sequence complementary to the mature miR-101 and its control (anti-NC) were 2′- O-methyl -modified RNA oligoribonucleotides. [score:3]
Our findings that AP-1 pathway and miR-101 were regulated in a reciprocal fashion raised the possibility that AP-1 and miR-101 form a regulatory feedback loop. [score:3]
Moreover, TPA induced miR-101 expression in a dose -dependent manner (Figure 2E and Supplementary Figure S2B). [score:3]
To determine the relative abundance of different miR-101 primary transcripts, the expression levels of pri-miR-101-1 and pri-miR-101-2 were analyzed in normal human liver tissue (661N) and five human hepatoma cell lines (HepG2, Huh7, MHCC-97H, QGY-7703 and SMMC-7721). [score:3]
Several molecules, including enhancer of  zeste homolog 2 (EZH2),  myeloid cell leukemia sequence 1 (Mcl-1),  c-Fos and MYCN, have been experimentally validated as the targets of miR-101 (5, 6, 8, 11). [score:3]
Deregulation of microRNA-101 (miR-101) has been implicated in the development of different malignancies (4– 9). [score:3]
Whereas knockdown of either c-Fos or c-Jun (Supplementary Figure S5A) markedly reduced the antibody-precipitated DNAs (Figure 3B), suggesting the interaction between AP-1 and the miR-101 enhancer in vivo. [score:2]
These findings indicate that miR-101 may prevent the excessive activation of metastatic signals imposed by ERK2/AP-1 and the AP-1/miR-101 regulatory loop thus plays a vital role in maintaining cellular homeostasis. [score:2]
Our results suggest that the miR-101 feedback regulation on AP-1 signaling is an alternative mechanism in preventing the prolonged AP-1 activity. [score:2]
Kottakis F. Polytarchou C. Foltopoulou P. Sanidas I. Kampranis S. C. Tsichlis P. N. FGF-2 regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathwayMol. [score:2]
For miR-101 targeted 3′-UTR assays, HepG2 cells in a 48-well plate were co -transfected with 50 ng of the indicated psiCHECK-2 wild-type or mutant reporter plasmids and 50 nM of either miR-101 or control RNA (NC) duplex. [score:2]
In addition, studies in HCCs and bladder cancers have demonstrated that miR-101 is epigenetically repressed by EZH2 -mediated histone modification (10, 24), which may also lead to the aberrant regulation of AP-1 signaling by miR-101. [score:2]
Our results highlight the importance of AP-1/miR-101 regulatory loop in preventing the abnormal transcription of pro-metastatic genes and in maintaining cellular homeostasis. [score:2]
This observation suggests that AP-1/miR-101 may regulate multiple downstream genes and might affect different aspects of cellular function. [score:2]
For the AP-1 reporter assays, 50 nM of miR-101, siERK2 or NC were reversely transfected into HepG2 cells for 24 h, then 50 ng of the pAP-1-Luc reporter plasmids (Stratagene, La Jolla, CA, USA) harboring seven copies of AP-1 cis-element on its promoter were co -transfected with 15 ng of pRL-PGK (expressing Renilla luciferase). [score:2]
The transcription start site and exon borders of the miR-101-1 gene are taken from published data (24). [score:1]
miR-101 is mainly transcribed from the human miR-101-2 and mouse miR-101b lociThe mature miR-101 is processed from two primary miR-101 transcripts in human: pri-miR-101-1 encoded on chromosome 1 and pri-miR-101-2 encoded on chromosome 9 (Figure 1A). [score:1]
The mature miR-101 is processed from two primary miR-101 transcripts in human: pri-miR-101-1 encoded on chromosome 1 and pri-miR-101-2 encoded on chromosome 9 (Figure 1A). [score:1]
Consistently, the antagonism of miR-101 increased the MMP9 activity (Figure 7A) and in turn promoted the migration and invasion of TPA -treated HepG2 cells (Figure 7B–D). [score:1]
These results suggest that miR-101 is mainly transcribed from the miR-101-2 locus in human and the miR-101b in mouse. [score:1]
There are two genomic loci encode miR-101 in human, including miRNA-101-1 on chromosome 1 and miRNA-101-2 on chromosome 9. MiR-101-1 is located in intergenic region and miR-101-2 in the eighth intron of RCL1 gene. [score:1]
miR-101 is mainly transcribed from the human miR-101-2 and mouse miR-101b loci. [score:1]
Taken together, our study delineates a novel mechanism underlying the transactivation of miR-101 gene. [score:1]
To explore the role of miR-101 in AP-1 signaling, HepG2 cells were co -transfected with miR-101 duplex and the luciferase reporter vector harboring seven copies of AP-1 responsive elements (pAP-1-Luc). [score:1]
These data suggest that pri-miR-101-2 is the main precursor of miR-101 in human liver cancer cell lines and normal liver tissue. [score:1]
HepG2 cells transfected with NC or miR-101 were treated with DMSO or TPA for 24 h, then subjected for qPCR. [score:1]
Figure 1. MiR-101 is mainly transcribed from the human miR-101-2 and mouse miR-101b loci. [score:1]
HepG2 cells were co -transfected with NC or miR-101 duplex, and the luciferase reporter plasmid containing wild-type (WT) or mutant (MUT) ERK2 3′UTR. [score:1]
The mature miR-101 level was normalized to the level of U6 to yield a 2 [−△△Ct] value. [score:1]
Taken together, we disclose a novel AP-1/miR-101 regulatory circuit based on in vitro and in vivo assays. [score:1]
Based on the results from qPCR analysis in human hepatoma cell lines and mouse tissues, we showed that miR-101 was mainly transcribed from human miR-101-2 and mouse miR-101b gene loci. [score:1]
We found that in all samples, the level of pri-miR-101-2 was significantly higher than that of pri-miR-101-1 (Figure 1B). [score:1]
A 488-bp wild-type 3′-UTR fragment of human ERK2 mRNA that contained putative binding site for miR-101 was polymerase chain reaction (PCR) amplified from genomic DNA and inserted into XhoI and NotI sites downstream of the stop codon of Renilla luciferase gene in psiCHECK-2 vector (Promega, Madison, WI, USA). [score:1]
Organization of both miR-101-1 and miR-101-2 genes is highly conserved between human and mouse. [score:1]
The bioinformatic analysis predicted one conservative miR-101 binding site in ERK2 3′-UTR. [score:1]
In (B) and (D), HepG2 cells without transfection or transfected with anti-miR-101 or anti-NC were treated with or without TPA for 24 h, and then added to transwell chambers for 20 h, followed by analysis for migration (B) and invasion (D). [score:1]
Seed region of miR-101 was underlined. [score:1]
The mutant 3′-UTR, which contained the mutated sequence in the complementary site for the seed region of miR-101, was generated using fusion PCR based on the construct with wild-type 3′-UTR. [score:1]
The miRNA duplexes corresponding to mature miR-101 were designed as described previously (6). [score:1]
In (D)–(F), HepG2 cells without transfection or transfected with NC, miR-101 or siRNA duplex were treated with TPA for 24 h, then added to transwell chambers and incubated for 20 h, followed by staining with crystal violet. [score:1]
To verify this hypothesis, we reintroduced the mature miR-101 mimics into HepG2 cells and analyzed the pri-miR-101-2 level. [score:1]
Upper, putative miR-101 binding sequence in the 3′UTR of ERK2 mRNA. [score:1]
Figure 7. Disruption of the miR-101/AP1 feedback loop promotes the TPA -induced migration and invasion. [score:1]
HepG2 cells were reverse transfected with miR-101 duplex for 24 h, followed by co-transfection with pAP-1-Luc and pRL-PGK plasmids. [score:1]
[1 to 20 of 86 sentences]
8
[+] score: 236
Thus, we hypothesized that miR-101 could inhibit ESCC through inhibiting COX-2. In this study, we validated the down-regulation of miR-101 in ESCC tissue specimens and cell lines; investigated the inhibitory effect of miR-101 on ESCC cell proliferation, migration and invasion in vitro; further examined the anti-tumor activity of miR-101 in vivo in a xenograft nude mouse mo del of ESCC; and verified that miR-101 inhibited ESCC via inhibiting COX-2 expression. [score:14]
It shows that miR-101 is down-regulated in ESCC tumor tissues and cell lines, and that it is able to inhibit cell proliferation, migration and invasion of ESCC cells in vitro as well as reduce xenograft tumor growth and the number of metastatic nodules on the surface of the liver in vivo by targeting COX-2. These results suggest that miR-101 is a tumor suppressor in ESCC, and that it might serve as a therapeutic target in ESCC. [score:12]
Thirdly, using the human ESCC cell line EC9706 stably transfected with miR-101, we further validated that COX-2 and PGE2 were downregulated at the protein level by the proposed target miR-101. [score:6]
Finally, there are no reports regarding miR-101 targeting COX-2 in ESCC, although the regulation of COX-2 expression by miRNAs has been extensively studied in a variety of human tumors [5, 60, 64– 70] and the miR-101 / COX-2 pathway has been reported in colon cancer [70], cervical cancer [57], gastric cancer [60] and prostate cancer [69]. [score:6]
First, miR-101 is located in the genomic loci with a high frequency of allelic losses in several types of cancers, and the down-regulation of miR-101 has been found in a variety of human malignancies including ESCC [26, 45– 61] Second, in our previous study, we found that COX-2 has an important effect on the proliferation and metastasis of ESCC [20– 23, 33, 62– 63]; in our preliminary experiment, among four putative miRNAs (miR-101, miR-143, miR-26a and miR-144) that could bind to the 3 ‘-UTR of COX-2 predicted by at least five databases (as shown above), only miR-101 could inhibit both the proliferation and metastasis of ESCC. [score:6]
Previously, we searched seven databases (Targetscan, Pictar, MiRanda, MiRwalk, Dianamt, Ebi and Microrna) and found four putative miRNAs that could bind to the 3 ‘- untranslated region (UTR) of COX-2 (according to at least five databases), which are miR-101, miR-144, miR-26a and miR-143. [score:5]
Compared to the adjacent normal tissues and Het-1A cell, the expression s levels of miR-101 were significantly downregulated in tumor tissues (Fig 1A) and 11 ESCC cell lines (Fig 1B). [score:5]
Effects of ectopically expressed miR-101 on the morphology and the expression level of miR-101 of EC9706 and EC109. [score:5]
Ectopic expression of miR-101 inhibited the metastasis of ESCC. [score:5]
miR-101 suppresses tumor proliferation and migration, and induces apoptosis by targeting EZH2 in esophageal cancer cells. [score:5]
analysis showed that overexpression of miR-101 in EC9706 cells significantly reduced COX-2 expression at the protein level (Fig 5B). [score:5]
Overexpression of miR-101 inhibited the proliferation of ESCC cell lines in vitro and in vivo. [score:5]
Overexpression of miR-101 in ESCC inhibits proliferation and metastasis. [score:5]
Similar results were also found in 11 ESCC cell lines, suggesting that miR-101 is downregulated in human ESCC. [score:4]
Moreover, the expression levels of miR-101 and, COX-2 as well as PGE2 were negatively correlated according to the western blot of luciferase reporter assay results, indicating that miR-101 inhibit ESCC through COX-2 and that the miR-101 / COX-2 pathway may be very important in ESCC. [score:4]
In this study, we selected EC9706 and EC109 cell lines as our mo del, since high COX-2 levels in those cells have been found and miR-101 has been reported to be down-regulated in EC109 cells [26]. [score:4]
To verify the regulatory effect of miR-101 on COX-2 expression in ESCC cells, we performed the following experiments. [score:4]
Downregulation of miR-101 was confirmed through comparison of 30 pairs of ESCC tumor and adjacent normal tissues (P < 0.001), as well as in 11 ESCC cell lines and a human immortalized esophageal cell line (P < 0.001). [score:4]
In addition, overexpression of miR-101 in the ESCC cell lines significantly inhibited the growth of xenograft tumors in nude mice, as compared with mice inoculated with vector EC9706 and EC109 cells (Fig 3F). [score:4]
Based on this information, luciferase reporters containing mutant binding sites were constructed (Fig 5A), in order to verify whether COX-2 is a direct target of miR-101 in human ESCC. [score:4]
Moreover, the luciferase reporter activity of WT or MT pMIR-COX-2 plasmid in EC9706 cells that overexpressed miR-101 showed that the reporter activity of WT pMIR-COX-2 was significantly decreased in cells that over-expressed miR-101, as compared to the control cells (P < 0.01; Fig 5F). [score:4]
Downregulation of miR-101 in tumor tissue specimens and cell lines of human ESCC. [score:4]
5. COX-2 is a direct target of miR-101 in ESCC. [score:4]
Among four these miRNAs, miR-101 has been reported to be down-regulated in an ESCC cell line [26]. [score:4]
Flow cytometry revealed that overexpression of miR-101 in the ESCC cell lines significantly induced both apoptosis and cell cycle arrest at the G0 / G1 phase (Fig 3C–3E). [score:3]
This finding was also confirmed by a luciferase reporter assay, suggesting that miR-101 directly targets COX-2 in ESCC. [score:3]
Relative expression of miR-101was detected by quantitative PCR in stably transfected EC9706-miR-101 (B) and EC109-miR-101 (C) relative to the parent cells and vectors-control cells. [score:3]
The expressions levels of miR-101 in clinical specimens of ESCC and the corresponding adjacent normal tissues obtained from 30 patients with ESCC, as well as in 11 ESCC cell lines and a human immortalized esophageal epithelia cell line (Het-1A) were determined. [score:3]
In the present study, we focused on miR-101, a tumor suppressive miRNA, for three reasons. [score:3]
First, the predicted binding sites of hsa-miR-101 in the 3 ‘-UTR of COX2 mRNA were determined according to computational prediction (TargetScan and microRNA databases). [score:3]
The colony formation of EC9706-miR-101 and EC109-miR-101 cells was significantly suppressed (Fig 3A). [score:3]
Both EC9706 and EC109 cells over -expressing ectopic miR-101 (Fig 2B and 2C). [score:3]
Taken together, all of the data from the in vitro and in vivo studies indicated that miR-101 inhibited the proliferation and metastasis of ESCC. [score:3]
Transfection of miR-101 in ESCC cell lines significantly suppressed cell proliferation, migration, and invasion (all P < 0.001). [score:3]
0140642.g001 Fig 1The expressions of miR-101 in 30 pairs of ESCC tumor tissues and corresponding normal tissues (A) and cell lines (B) were determined by quantitative real time RT-PCR as described in Materials and. [score:3]
Moreover, we confirmed the inhibitory effect of miR-101 on ESCC using an in vivo study. [score:3]
As miR-101 has low-to -null toxicity, it may represent a novel class of COX-2 -targeting molecules to be exploited for preventive and therapeutic purposes. [score:3]
The expressions of miR-101 in 30 pairs of ESCC tumor tissues and corresponding normal tissues (A) and cell lines (B) were determined by quantitative real time RT-PCR as described in Materials and. [score:3]
A comparison between 30 pairs of ESCC tumor and adjacent normal tissues showed that the expression levels of miR-101 were significantly less in ESCC tumor (P < 0.001). [score:3]
Therefore, the miR-101/COX-2 pathway might be a therapeutic target in ESCC. [score:3]
To explore the potential tumor-suppressive role of miR-101 in ESCC, the miR-101 precursor was cloned and stably transfected into the ESCC cell lines EC9706 and EC109. [score:3]
1. MiR-101 is down-regulated in ESCC. [score:3]
First, we examined the expression levels of miR-101 in ESCC. [score:3]
of the expression plasmids carrying miR-101 into EC9706 and EC109 cells was performed using Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer’s instructions. [score:3]
Furthermore, COX-2 was shown to be a target of miR-101. [score:3]
The luciferase reporter assay was used to verify COX-2 as a direct target of miR-101. [score:3]
Second, we investigated the correlation of miR-101 with COX-2 expression in EC9706, in which miR-101 was over-expressed in our previous study (data not shown). [score:3]
2. Morphology changes and miR-101 expression levels of in miR-101 -transfected ESCC cell lines. [score:3]
Real-time quantitative reverse transcription–polymerase chain reaction (RT-PCR) was used to quantify miR-101 expression in ESCC clinical tissues and cell lines. [score:3]
The expression levels of miR-101 in stable clones were verified via real-time RT-PCR. [score:3]
First, we observed that both EC9706 and EC109 cells over -expressing ectopic miR-101 exhibited a morphological change with a decrease of volume compared to the typical morphology of parent cells and the vector-control (Fig 2A). [score:2]
0140642.g002 Fig 2(A) EC9706 / EC109-miR-101 had change in volume (decreased) compared to the parent cells and cells expressing the vector-control under inverted microscope (40×). [score:2]
4. MiR-101 suppressed tumor metastasis in vitro and in vivo. [score:2]
MiR-101 inhibits ESCC via COX-2.. [score:2]
The CCK8 assay data showed that the proliferation of the EC9706 and EC109 cell lines stably transfected with miR-101 was significantly inhibited (Fig 3B). [score:2]
3. MiR-101 suppresses tumor proliferation in vitro and in vivo. [score:2]
The specific primers for establishing expression plasmids of miR-101 were as follows: miR-101 sense: 5 ‘-CG G / GATCC (BamHI) TTCAGCCTCACCACTTGCTG-3 ‘; anti-sense: 5 ‘- CAACATGGCTGCACCAACAAC A / AGCTT (HindIII) GGG– 3 ‘ (the restriction sites are underlined in each primer). [score:1]
To the best of our knowledge, this is the first study to examine the miR-101 / COX-2 pathway in ESCC. [score:1]
The reaction mixture was used for real-time RT-PCR of miR-101. [score:1]
Second, we showed that miR-101 can reduce cell proliferation by inducing apoptosis and cell cycle arrest at the G0 / G1 phase, as well as decrease the migration and invasion abilities of ESCC cells. [score:1]
In addition, the proliferation, migration and invasion abilities of miR-101 -transfected cells increased with PGE2 supplementation in the culture medium (Fig 5D and 5E; P < 0.001). [score:1]
Stably transfected cells (1.5 × 10 [6] in 0.2 mL) were injected subcutaneously into the right (EC9706 / EC109-miR-101) and left (EC9706 / EC109-vector) dorsal flank of severe combined immunodeficiency mice (SCID; Institute of Laboratory Animal Sciences, Chinese Academy of Medical Sciences), five mice per group. [score:1]
No visible metastatic nodules on the lung, kidney, or spleen were found in either the vector group or the miR-101 group. [score:1]
0140642.g003 Fig 3(A) Representative results of colony formation of parent (column 1), vector (column 2), and miR-101–transfected (column 3) EC9706 and EC109. [score:1]
In this study, we found the proliferation, migration, and invasion abilities of EC9706 cells stably transfected with miR-101 increased significantly after the addition of PGE2 (a primary product of COX-2). [score:1]
Precursors of miR-101 (440 bp) were cloned into the pSilencer 4.1-CMV vector (Ambion, Geneworks), in accordance with the manufacturer’s instructions. [score:1]
The antitumor effect of miR-101 was verified in a xenograft mo del. [score:1]
There were two groups (EC9706 / EC109-vector and EC9706 / EC109-miR-101) in the animal study and each group had five mice. [score:1]
Fold changes for the expression levels of miR-101 were calculated using the comparative cycle threshold method (2 [-ΔΔCT]). [score:1]
To measure the expression levels of mature miR-101, real-time quantitative RT-PCR was performed as described previously [32]. [score:1]
In summary, this study provides new insights into the role of miR-101 in human ESCC. [score:1]
The transwell chamber assay showed that the migration and invasion ability of ESCC cells stably transfected with miR-101 was significantly suppressed, compared with the parent cells or vector-control cells (Fig 4A and 4B). [score:1]
0140642.g005 Fig 5(A) The predicted binding sites of hsa-miR-101 in the 3’-UTR of COX-2 mRNA and their mutant counterparts. [score:1]
This study investigated the effect of miR-101 on ESCC through modulating COX-2 expression in ESCC. [score:1]
[1 to 20 of 74 sentences]
9
[+] score: 216
QRT-PCR analyses showed that the expression of Wnt genes, including Wnt1, Wnt6, Wnt10a and Wnt10b, were up-regulated by miR-101 overexpression, and ectopic EZH2 expression eliminated the promoting effect of miR-101 overexpression on Wnt genes expression (Fig. 5A,B). [score:14]
Furthermore, we found that miR-101 and EZH2 overexpression did not change the expression of total β-catenin both at the mRNA and the protein levels, but miR-101 overexpression increased the expression of activated β-catenin (β-catenin*), and ectopic EZH2 expression blocked the promoting effect of miR-101 overexpression on activity of β-catenin (Fig. 5C,D). [score:13]
Our results suggest that EZH2 is a target gene of miR-101; the expression of EZH2 was gradually down-regulated during osteogenic differentiation induction, and enforced expression of EZH2 could inhibit osteogenic differentiation 31, demonstrating that EZH2is required for the promoting effect of miR-101 in regulating the osteogenic differentiation of hBMSCs. [score:13]
We restored the expression of EZH2 inmiR-101 -overexpressing hBMSCs by transfecting the cells with EZH2 ORF constructs without 3′-UTRs (Fig. 4B), and qRT-PCR analyses showed that the expression of osteogenic marker genes, including RUNX2, ALP, and OPN, were suppressed by EZH2 rescue in the miR-101 -overexpressing cells (Fig. 4C). [score:11]
The results showed that the overexpression of miR-101 significantly decreased the luciferase activity of the EZH2wt-3′-UTRs (114-121) compared to miR-control transfected cells (Right panel; Fig. 3B), whereas it had no effect on the EZH2wt-3′-UTRs (59-65) (Right panel; Fig. 3A), indicating that miR-101 suppressed the expression of EZH2 by binding to target sites in their 3′-UTRs (114–121). [score:8]
To identify the biological role of miR-101 in the regulation of hBMSC differentiation, cells were infected with miR-101lentivirusto establish stably miR-101 -overexpressing hBMSCs or transfected with anti-miR-101oligonucleotideto inhibitmiR-101expression. [score:8]
To address these issues, the expression of Wnt genes and the activity of β-catenin were analyzed in the context of miR-101 overexpression ormiR-101 overexpression in conjunction with an EZH2 vector. [score:7]
The results showed a gradual upregulation of the miR-101 expression during the osteogenic induction differentiation of hBMSCs (Fig. 1C), suggesting that miR-101 might be involved in regulating the osteogenic differentiation of hBMSCs. [score:7]
MiR-101 directly targets EZH2 and inhibits its expression. [score:7]
To demonstrate that the Wnt/β-catenin axis is responsible for miR-101-triggered osteogenic differentiation, the TOPFlash assay showed that miR-101 overexpression significantly increased the activity and ectopic EZH2 expression blocked the promoting effect of miR-101 overexpression on TOPFlash activity (Fig. 5E). [score:6]
Notably, the qRT-PCR analysis showed that neither miR-101 overexpression noranti-miR-101 transfection had significant effects on theEZH2 mRNA levels (Fig. 3D), suggesting that miR-101 specifically regulatedEZH2expression at the posttranscriptional level. [score:6]
In addition, miR-101 overexpression apparently promoted osteogenic differentiation, which was indicated by the up-regulated osteogenic marker genes RUNX2, ALP, OPN and OCN. [score:6]
In order to determine the target genes of miR-101, candidates were searched using theTargetScan6.2 (http://www. [score:5]
The results showed that ICG-001 can suppress the activity of ALP and TOPFlash in hBMSCs and miR-101 -overexpressing hBMSCs, demonstrating that the promoting effect of the Wnt/β-catenin pathway activity and osteogenic differentiation of hBMSCs caused by miR-101 can be blocked by ICG-001 (Fig. 5F,G). [score:5]
Furthermore, compared to the negative control, up-regulation of miR-101 induced ALP activity and the matrix mineralization level, while miR-101 silencing resulted in a decrease in their expression (Fig. 2C,D). [score:5]
Furthermore, showed that overexpression of miR-101 substantially decreased the expression of EZH2, while anti-miR-101 transfection increased theEZH2 protein levels (Fig. 3C). [score:5]
Finally, to pinpoint the role of the Wnt/β-catenin signaling pathway in miR-101 -induced osteogenic differentiation of hBMSCs, ICG-001, an inhibitor of β-catenin, was used to inhibit the activity of β-catenin 18. [score:5]
MiR-101 silencing significantly reduced osteoblastic differentiation, which was indicated by lower expression levels of the osteoblastic marker genes RUNX2, ALP, OPN and OCN, as well as decreased ALP activity and matrix mineralization levels; miR-101 overexpression was sufficient to promote this complex process. [score:5]
miR-101 promotes the osteogenic differentiation of hBMSCs by targeting EZH2 and regulating the Wnt/β-catenin pathway. [score:4]
To ascertain the exact role of EZH2 in miR-101-regulated osteogenic differentiation, the expression of EZH2 was first examined at different time points during osteogenic differentiation. [score:4]
miR-101 is upregulated during the osteogenic differentiation of hBMSCs. [score:4]
These results support the bioinformatics predictions and indicate that EZH2 may be a direct target of miR-101. [score:4]
Here, our results showed that miR-101 expression gradually increased during the osteogenic differentiation of hBMSCs, suggesting that miR-101 was involved in regulating this complex process. [score:4]
Next, we evaluated whether EZH2 up-regulation was required for promoting the effect of miR-101 in regulating osteogenic differentiation. [score:3]
Our results provide new insight indicating that miR-101 possesses great potential as a novel class of therapeutic targets for bone regeneration. [score:3]
miR-101 regulates the osteogenic differentiation of hBMSCs by regulating the Wnt/β-catenin pathway. [score:3]
The constructs containing the pre-miR-101 or EZH2 siRNA sequences were cloned into the lentivirus -based expression plasmid pLenti-6.3 (Invitrogen, USA). [score:3]
Overall, our data demonstrate that miR-101 promotes the osteogenic differentiation of hBMSCs by targeting EZH2, which results in the activation of the Wnt/β-catenin signaling pathway (Fig. 7). [score:3]
Site-directed mutagenesis of the miR-101 seed sequence in the 3′-UTR (Mut) was performed using the QuikChange™ Site-Directed Mutagenesis Kit (Stratagene, USA). [score:3]
The expression level of miR-101 was verified by qRT-PCR (Fig. 2A). [score:3]
The results showed that miR-101 targets the EZH2 gene at the positions 59–65 and 114-121 (Both left panel of Fig. 3A,B). [score:3]
EZH2 is a target of miR-101. [score:3]
These results showed that miR-101 activated the Wnt/β-catenin signaling pathway in hBMSCs by targeting EZH2. [score:3]
Expression of miR-101 is increased during osteogenic differentiation of hBMSCs. [score:3]
Next, the expression of miR-101 was examined at different time points during osteoblast differentiation. [score:3]
To test Wnt signaling, miR-101 overexpressing cells were co -transfected with either the Wnt signaling reporter TOPFlash or the negative control FOPFlash according to the protocol (Millipore, USA). [score:3]
Taken together, these results indicate that miR-101 plays a positive role in the regulation of the osteogenic differentiation of hBMSCs. [score:2]
To analyze the relationship between miR-101 andEZH2, a luciferase reporter assay containing the wild-type (wt) or mutant (mut) miR-101 target sites in the EZH23′-UTRwas performed in HBMSCs. [score:2]
EZH2 mediates the miR-101-regulated osteogenic differentiation of hBMSCs. [score:2]
How to cite this article: Wang, H. et al. MiR-101 Targets the EZH2/Wnt/β-Catenin the Pathway to Promote the Osteogenic Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells. [score:2]
EZH2 mediates miR-101-regulated osteogenic differentiation of hBMSCs. [score:2]
Mo del for how miRNA-101 facilitates osteogenic differentiation of hBMSCs. [score:1]
These results suggested that miR-101 promotes in vivo bone formation by hBMSCs. [score:1]
Co-transfection of EZH2-siRNA with anti-miR-101 almost completely blocked the negative effect of anti-miR-101 on ALP activity (Fig. 4F), and EZH2-siRNA significantly increased ALP activity, indicating enhanced osteoblastic differentiation. [score:1]
Fig. 6B showed that bone volume fraction (BV/TV) in miR-101 group was higher than miR-NC group and control group. [score:1]
To silence mirR-101 in hBMSCs, the cells were transfected with anti-miR-101 or anti-NC using Lipofectamin2000 reagent (Invitrogen, USA). [score:1]
miR-101 promotes the osteogenic differentiation of hBMSCs. [score:1]
In our present study, we demonstrate that the activity of the Wnt/β-cateninaxis plays an essential role in the triggering of osteogenic differentiation by miR-101. [score:1]
Thus, miR-101 promotes osteogenic differentiation at least partly through the activity of the Wnt/β-cateninaxis. [score:1]
Consistent with the above results, BMD of newly formed bone in miR-101 group was higher than miR-NC group and control group. [score:1]
miR-101 promotes in vivo bone formation by hBMSCs. [score:1]
The miR-101, anti-miR-101 and EZH2 siRNA were purchased from Origene (Beijing, China). [score:1]
[1 to 20 of 52 sentences]
10
[+] score: 201
Overexpression of miR-101 inhibits glioma cell invasion, migration, and proliferation in vitroIn order to test the expression level of miR-101 in glioma, we collected 20 clinical specimens, including 10 grade IV cases, 10 grade III cases, 10 grade II cases, 10 grade I cases and 4 cases of brain injury brain tissues. [score:7]
Figure 1Overexpression of miR-101 inhibits glioma cell invasion, migration, and proliferation in vitro A. miR-101 expression levels in normal brain tissue and glioma tumor tissues were detected by qRT-PCR analysis. [score:7]
The results showed that overexpression of miR-101 only reduced the SOX9 expression level but did not change the SOX9 expression pattern (Figure 3E). [score:7]
It is noteworthy that a study illustrated that miR-101 directly targets SOX9 in human hepatocellular carcinoma (HCC), and miR-101 could suppress SOX9 -dependent tumorigenicity and promotes favorable prognosis of HCC [49]. [score:6]
Study indicated that miR-101 could repress lung cancer invasion and proliferation by inhibiting interaction of fibroblasts and cancer cells by directly targeting CXCL12 [27]. [score:6]
Our data confirmed that miR-101 could inhibit proliferation, migration and invasion of human glioblastoma by directly targeting SOX9. [score:6]
Our data suggested that miR-101 regulated glioma cells proliferation and invasion both in vitro and in vivo by directly targeted SOX9. [score:5]
Overexpression of miR-101 inhibits glioma cell invasion, migration, and proliferation in vitro. [score:5]
In GBM, research showed that miR-101 could act as a tumor suppressor by targeting Kruppel-like Factor 6 in glioblastom a stem cells [46]. [score:5]
Thus, miR-101 overexpression significantly inhibited the glioma proliferation both in vitro and in vivo. [score:5]
Furthermore, qRT-PCR analysis showed that SOX9 was obviously down-regulated in miR-101-U87 tumor compared with the miR-NC-U87 tumor in tumor xenograft mo del (Supplementary Figure 3), indicating that SOX9 might be a potential target gene of miR-101. [score:5]
A working mo del of miR-101 inhibits glioma cell proliferation, invasion and migration by targeting SOX9. [score:5]
The TargetScan Program suggested that the 3′UTR region of the SOX9 gene containing the binding sites of miR-101 (Figure 3A), and the expression level of SOX9 in glioma (II-III) tissue was higher than that of the normal brains tissue (Figure 3B and Supplementary Figure 5). [score:5]
Overexpression of miR-101 suppresses the tumor growth in vivo. [score:5]
Overexpression of miR-101 suppresses the tumor growth in vivoIn order to investigate the role of miR-101 in glioma, we further tested the effect of miR-101 overexpression on tumor growth in vivo. [score:5]
The tumor suppressing function of SOX9 in vitro and in vivoTo acknowledge the targeting relationship between SOX9 and miR-101 in GBM, we also studied the SOX9 function in glioma. [score:5]
So we conclude that miR-101 and SOX9 regulation axis regulates proliferation, migration and invasion of human GBM by regulating Akt, Wnt, BMI1 signal pathway (Figure 5). [score:4]
Several researches have shown that miR-101 was remarkly downregulated in samples from patients and cell lines of human cancers such as lung cancer [28], breast cancer [29], laryngeal squamous cell carcinoma [30], embryonal rhabdomyosarcoma [31] and glioblastoma [32]. [score:4]
In order to test the regulating manner between miR-101 and SOX9, we used qRT-PCR and to compare the expression level of SOX9 in the two glioma cell lines transfected with miR-101 or miR-control as shown in Figure 3C. [score:4]
The predicted miR-101 target site GUACUGU was mutated into GAUGACA by site-directed mutagenesis. [score:4]
This study suggests us that miR-101 and SOX9 are key regulators in human glioblastoma and provides new therapeutic targets for glioma therapy. [score:4]
All these results suggested that SOX9 was a direct target of miR-101 in glioma. [score:4]
SOX9 is a direct target of miR-101. [score:4]
Furthermore, Tran-swell migration assays illustrated that overexpression of miR-101 significantly suppressed glioma cell migration and invasion (Figure 1F-1I). [score:4]
D. detected the level of Ki67 in overexpression-miR-101 and miR-NC xenograft tumor tissues, 200 ×. [score:3]
A. Predicted miR-101 target sequences in 3′UTR of SOX9 and mutant containing eight mutated nucleotides in 3′UTR of SOX9 (SOX9-mut). [score:3]
These findings make miR-101 as a new target for glioma therapy and verify the importance of SOX9 in glioma tumorigenesis. [score:3]
Both mRNA level and protein level of SOX9 was obviously decreased upon miR-101 overexpression (Figure 3E and 3D). [score:3]
In order to test the expression level of miR-101 in glioma, we collected 20 clinical specimens, including 10 grade IV cases, 10 grade III cases, 10 grade II cases, 10 grade I cases and 4 cases of brain injury brain tissues. [score:3]
These studies prompt that SOX9 might involves in miR-101 tumor suppressing process. [score:3]
B. The expression level of miR-101 in U87MG, U251MG, A172 and T98 glioma cells were detected by qRT-PCR analysis. [score:3]
Figure 3 A. Predicted miR-101 target sequences in 3′UTR of SOX9 and mutant containing eight mutated nucleotides in 3′UTR of SOX9 (SOX9-mut). [score:3]
The infected cells expressed high level of miR-101 both in U87MG and U251MG glioma cells (Figure 1C). [score:3]
MiR-101 directly targets SOX9 in GBM. [score:3]
To acknowledge the targeting relationship between SOX9 and miR-101 in GBM, we also studied the SOX9 function in glioma. [score:3]
A. miR-101 expression levels in normal brain tissue and glioma tumor tissues were detected by qRT-PCR analysis. [score:3]
C. U87MG and U251MG cells were co -transfected with miR-101 and luciferase reporters containing either the predicted miRNA target site in SOX9 3′UTR or its corresponding mutant form, the values obtained from the Has-miR-101 vector and PGL3 were set as 100%. [score:3]
E. qRT-PCR analysis of SOX9 expression in U87MG and U251MG cells transfected with miR-101 or negative control. [score:3]
We further used immunofluorescence to compare the SOX9 expression between miR-control U87MG and miR-101-U87MG cells (Supplementary Figure 2). [score:3]
Figure 2Overexpression of miR-101 suppresses the tumor growth in vivo A. and B. Determination of the tumor growth, tumor volume was calculated every five days after injection (n = 5). [score:3]
MiR-101 has been reported to be down-regulated in several human cancers. [score:3]
Bioinformatics methods were adopted to predict the potential targets of miR-101 in human GBM. [score:3]
We found that the luciferase activity in the Luc-SOX9-UTR -transfected cells was prominent decreased compared with the luciferase activity in the miR-101 target site mutant SOX9 3′UTR and negative control cells (Figure 3C). [score:2]
In a word, miR-101 was an important regulator in different cancers including malignant glioma. [score:2]
Our data suggested that miR-101 level in glioma tissue is much lower compared to normal brain tissue (Figure 1A),and the expression level of miR-101 in U87MG, U251MG, A172 and T98 glioma cells are lower than that of HEB cells (Figure 1B). [score:2]
To construct the miR-101 overexpression vector, the primers of miR-101 were synthesized by Shanghai Generay Biotech Co. [score:2]
As shown in Figure 1J and 1K, the cell proliferation rate was decreased in the miR-101 group compared with that of the control group at 24 to 96 hours after transfection (* P < 0.05 for each) in both U87MG and U251MG glioma cells lines, indicating that miR-101 could significantly inhibit the glioma proliferation. [score:2]
Immunohistochemical staining results showed that the number of Ki67 positive cells in miR-101-U87MG tumors was less than that in miR-control-U87MG tumors (Figure 2D and Supplementary Figure 1). [score:1]
The Hsa-miR-101 vector (GenePharma Co. ) [score:1]
The miR-101-U87MG cells and their respective control cells were implanted into the left and right flanks (3.0×10 [6] cells per flank) of nude mice by subcutaneous injection, respectively. [score:1]
Nude mice were subcutaneously injected with 3.0×10 [6] cells per flank miR-101 or miR-NC stable transfected U87MG cells. [score:1]
In order to investigate the role of miR-101 in glioma, we further tested the effect of miR-101 overexpression on tumor growth in vivo. [score:1]
s were taken to examine the effect of miR-101 on cell proliferation. [score:1]
Amplified miR-101 was then subcloned into pCDH1vector between EcoRI and BamH I sites (Promega, Madison, WI, USA). [score:1]
At 30 days post-injection, data showed that the mean volumes of xenograft tumors of miR-101-U87 cells were significantly smaller than that of miR-control-U87MG cells (n = 5 animals per group, P = 2.89×10 [−3]; Figure 2A, 2B and 2C). [score:1]
After pre-transplant preparation of the recipient mice and anesthesia with 10% chloral hydrate, isolated miR-101-U87MG cells (3.0×10 [6] in 5 mL PBS) and their respective control cells were implanted into the left and right flanks (cells per flank) of nude mice by subcutaneous injection to establish the xenograft mo del. [score:1]
Furthermore, miR-101 could reverse the hypomethylation of the LMO3 promoter in glioma cells [48]. [score:1]
Wound-healing assay was performed to detect the effect of miR-101 on cell migration, and the miR-101 -overexpressing cells showed considerably slower migration compared with the miR-control cells either in U87MG and U251MG glioma cells lines (Figure 1D and 1E). [score:1]
To test miR-101 function in glioma cell lines, U87MG and U251MG were infected with a lentivirus encoding the mature sequence of miR-101. [score:1]
The expression level of miR-101 in glioma cells, glioma tissues and traumatic brain injuries tissues was measured by real-time quantitative RT-PCR (qRT-PCR). [score:1]
There are miR-NC group and miR-101 group for the U87MG cell lines. [score:1]
Glioma cells were infected with a lentivirus encoding the miR-101 mimic oligonucleotide (200nM), negative control (NC) and fluorescent GAPDH positive control (GenePharma, Shanghai, China). [score:1]
J. and K. Growth curves of miR-101-U251MG and NC-U251MG, miR-101-U87MG and NC-U87MG cell lines. [score:1]
[1 to 20 of 63 sentences]
11
[+] score: 191
For miRNA over -expression studies, 253J or 253J-BV cells were transiently transfected with 1000 ng of precursor miRNA expression vector for hsa-mir-101-1 (HmiR0009-MR04-B), hsa-mir-126 (HmiR0153-MR04-B) or control vector (CmiR0001-MR04, all from Genecopoeia) for 48 h. To inhibit miRNA expression, 253J or 253J-BV cells were transiently transfected with 1000 ng of miRNA inhibitor vector against hsa-miR-101-3p (HmiR-AN0021-AM01), hsa-miR-126-3p (HmiR-AN0099-AM01) or control vector (pEZX-MR04, Genecopoeia) for 48 h. All transient transfection was performed in triplicate with the transfection reagent DharmaFECT1 (Dharmacon, Lafayette, CO) according to the manufacturer's protocol. [score:11]
miR-101-3p contributes to 1,25D [3] inhibition of 253J-BV cell migration and invasionTo study the role of miR-101-3p and miR-126-3p in 1,25D [3] inhibition of bladder cancer cell migration and invasion, the expression of miRNAs were enhanced by transfection with specific pre-miRNA vectors to miR-101-3p and miR-126-3p or suppressed by transfection with specific miRNA inhibitor vectors for 48 h in 253J-BV cells. [score:11]
To study the role of miR-101-3p and miR-126-3p in 1,25D [3] inhibition of bladder cancer cell migration and invasion, the expression of miRNAs were enhanced by transfection with specific pre-miRNA vectors to miR-101-3p and miR-126-3p or suppressed by transfection with specific miRNA inhibitor vectors for 48 h in 253J-BV cells. [score:9]
LncRNA SPRY4-IT1 directly interacts with and inhibits miR-101-3p expression, leading to EZH2 upregulation and enhanced proliferation and metastasis in bladder cancer T24T cells [71]. [score:9]
Overexpression of miR-101 inhibits the proliferation and invasion of bladder cancer cell line T24, potentially through the regulation of c-FOS expression [69]. [score:8]
Figure 61,25D [3] regulates miR-101-3p expression via transcriptional regulation of miR-101-3p A. miR-101-3p promoter construct was cloned into the promoter-less luciferase expression vector pGL4.21 immediately upstream of the luciferase gene. [score:7]
1,25D [3] promotes the expression of miR-101-3p and miR-126-3p in 253J-BV cellsUsing miRNA PCR arrays, we found that 253J and 253J-BV cells have distinct miRNA expression profiles, which were regulated differently by 1,25D [3] [37]. [score:6]
Compared with the transfection with control vectors, transfection with pre-miRNA vector increased the expression levels of miR-101-3p or miR-126-3p and miRNA inhibitor decreased the expression level of the corresponding miRNA. [score:6]
miR-101-3p inhibitor partially abrogated the inhibitory effect of 1,25D [3] on 253J-BV cell migration (Figure 5E and 5F) and invasion (Figure 5G). [score:5]
C. - G. 253J-BV cells were transfected with control vector, pre-miR-101-3p, pre-miR-126-3p, or the miRNA inhibitor vector for miR-101-3p or miR-126-3p for 24 h. The expression of miR-101-3p C. or miR-126-3p D. was examined by qRT-PCR. [score:5]
Successful modulation of the expression levels of miR-101-3p (Figure 5C) and miR-126-3p (Figure 5D) following the transfection with pre-miRNA or miRNA inhibitor was validated by qRT-PCR. [score:5]
1,25D [3] regulates miR-101-3p expression via transcriptional regulation of miR-101-3p. [score:5]
miR-101 suppresses migration and invasion in ICC cells through targeting VEGF-C, at least in part [67]. [score:5]
1,25D [3] regulates miR-101-3p expression via transcriptional regulation of miR-101-3pThe miR-101-3p promoter was constructed as reported previously [47]. [score:5]
1,25D [3] regulates miR-101-3p expression via transcriptional regulation of miR-101-3p. [score:5]
In breast cancer cells, miR-101 promotes apoptosis and inhibits cell proliferation, which is associated with increased expression of EYA1 [65]. [score:5]
miR-101 is also down-regulated in bladder cancer tissue samples [68]. [score:4]
To generate site mutations in the predicted VDRE of miR101-3p promoter luciferase reporter, TT dinucleotides in VDRE were replaced with AG using PCR -based site-directed mutagenesis (Q5 site-directed mutagenesis kit, New England bioLabs, Beverly, MA)(Figure 6B). [score:4]
These results indicate that 1,25D [3] differentially regulates miR-101-3p expression, at least partially, at the transcriptional level. [score:4]
These findings demonstrate that 1,25D [3] regulates miR-101-3p expression, at least in part, at the transcriptional level. [score:4]
On the other hand, transfection of pre-miR-101-3p further suppressed migration and invasion in 253J-BV cells (Figure 5E-5G). [score:3]
1,25D [3] enhanced the expression of miR-101-3p (Figure 5A) and miR-126-3p (Figure 5B) in 253J-BV but not 253J cells. [score:3]
miR-101-3p contributes to 1,25D [3] inhibition of 253J-BV cell migration and invasion. [score:3]
The NheI- and Xho-digested amplicon was cloned into the promoter-less luciferase expression vector pGL4.21 (Promega, Madison, WI) immediately upstream of the luciferase gene to produce the plasmid pGL4.21/miR101-3p. [score:3]
The suppression of migration and invasion is partially through the transcriptional induction of miR-101-3p by 1,25D [3]. [score:3]
These findings indicate that miR-101-3p contributes, at least partially, to 1,25D [3] inhibition of metastatic potential in 253J-BV cells. [score:3]
Treatment with 1,25D [3] increases the binding of VDR to these VDREs, suggesting that VDR can bind to VDREs in miR-101-3p promoter to induce its expression in 253J-BV cells. [score:3]
In contrast, pre-miR-101-3p further reduced, while miR-101-3p inhibitor further promoted, migration and invasion in 253J-BV cells treated with 1,25D [3]. [score:3]
Cyclooxygenase-2 is another target of miR-101 that has been shown to contribute to enhanced sensitivity of bladder cancer cells to cisplatin [70]. [score:3]
To examine whether 1,25D [3] regulates miR-101-3p through VDRE-A, we introduced a site mutation in VDRE-A (TT to AG, Figure 6B). [score:3]
miR-101 expression is reduced in various cancer tissues and cell lines such as breast cancer, gastric cancer, and intrahepatic cholangiocarcinoma (ICC) [65- 67]. [score:3]
A. miR-101-3p promoter construct was cloned into the promoter-less luciferase expression vector pGL4.21 immediately upstream of the luciferase gene. [score:3]
1,25D [3] promotes the expression of miR-101-3p and miR-126-3p in 253J-BV cells. [score:3]
These findings indicate that miR-101-3p contributes to 1,25D [3] regulation of bladder cancer cell migration and invasion. [score:2]
miR-101-3p is involved in 1,25D [3] regulation of migration and invasion in 253J-BV cells. [score:2]
Site mutation in the predicted VDRE abolished 1,25D [3] -induced miR-101-3p promoter activity, confirming the contribution of the identified VDRE. [score:2]
The regulation of miR-101-3p may be through multiple mechanisms. [score:2]
To clarify the role of VDR in the regulation of the miR-101-3p gene, we searched for putative VDREs within the miR-101-3p promoter region by MAPPER: a search engine for the computational identification of putative transcription factor binding sites in multiple genomes [48]. [score:2]
Cells were treated with EtOH or 1,25D [3] for 24 h. The expression of miR-101-3p A. and miR-126-3p B. was assessed by qRT-PCR assays. [score:2]
These studies support the contribution of miR-101 in cancer development and metastasis. [score:2]
Site mutation of the predicted VDRE-A diminished the induction of miR-101-3p promoter activity by 1,25D [3] (Figure 6B), indicating that 1,25D [3] indeed promotes miR-101-3p through VDRE-A. Further, we performed ChIP-qPCR to examine the binding between VDR and putative VDREs in chromatin associated with the miR-101-3p promoter region in 253J-BV cells. [score:2]
Putative VDRE-A was identified within the miR-101-3p promoter region constructed (Figure 6B). [score:1]
B. Position of putative VDRE-A in miR-101-3p promoter region was identified and shown. [score:1]
The effect of transfection on the expression levels of miR-101-3p and miR-126-3p was evaluated by qRT-PCR as described above. [score:1]
The wild type and mutant of miR-101-3p containing VDRE-A reporters were transiently transfected into 253J-BV cells. [score:1]
From the list of differentially regulated miRNAs, we selected miR-101-3p and miR-126-3p based on their potential role in migration and invasion to investigate their role in the regulation of migration and invasion by 1,25D [3] in bladder cancer cells [38- 41]. [score:1]
results show that 1,25D [3] enhances the promoter activity of miR-101-3p in 253J-BV cells but not in 253J cells. [score:1]
We found that 1,25D [3] induced miR-101-3p promoter activity in 253J-BV cells but not in 253J cells (Figure 6A). [score:1]
253J and 253J-BV cells were transfected with 100 ng of the pGL4.21/miR101-3p or pGL4.21 constructs along with 20 ng of a renilla luciferase control construct (Promega). [score:1]
The miR-101-3p promoter was constructed as reported previously [47]. [score:1]
Cells were transfected with pGL4.21 vector or pGL4.21/miR-101-3p promoter vector. [score:1]
We identified potential VDREs in the promoter region of miR-101-3p. [score:1]
miR-101 has been reported to be involved in the progression of several cancer types. [score:1]
253J-BV cells were transfected with the pGL4.21/miR101-3p or its mutant pGL4.21 constructs along with a Renilla luciferase control construct (Promega). [score:1]
[1 to 20 of 54 sentences]
12
[+] score: 182
In control experiments, upregulation of miR-101 and the concomitant downregulation of Ezh2 was also observed in two independent HDF strains, HFF-1 and PFF (Additional file 3: Figure S3), indicating that the regulation of these components is a conserved feature in the senescence response of human dermal fibroblasts to UVB irradiation. [score:8]
However, the downregulation of miR-101 was not sufficient to block the phenotype of UVB -induced senescence, suggesting that other UVB -induced processes contribute to the senescence response, partially redundant with upregulation of miR-101. [score:7]
However, the downregulation of miR-101 was not sufficient to block the phenotype of UVB -induced senescence, suggesting that other UVB -induced processes induce the senescence response in a pathway redundant with upregulation of miR-101. [score:7]
We confirmed that Ezh2 is regulated by miR-101 in human fibroblasts, and found that both overexpression of miR-101 and downregulation of Ezh2 independently induce senescence in the absence of UVB irradiation. [score:7]
After UVB irradiation, Ezh2 protein levels were rapidly reduced, even prior to the induction of miR-101 (Figure  3), strongly suggesting that several different UVB -dependent pathways converge to downregulate Ezh2, the upregulation of miR-101 being just one of several triggers for this process. [score:7]
The strong upregulation of miR-101 induced a significant downregulation in the level of Ezh2 mRNA (Figure  7B) and protein (Figure  7C). [score:7]
For miR-101 knockdown, cells were reverse transfected with miRCURY LNA™ microRNA Power Inhibitor and miRCURY LNA™ microRNA Power Inhibitor Negative Control A for negative control (Exiqon, Denmark) using siPORT™ NeoFX™ Transfection Agent (Ambion, Austria) according the manufacturer’s protocol. [score:6]
Using reverse transfection, miR-101 was overexpressed in human diploid fibroblasts, which resulted in a clear upregulation of miR-101 (Figure  7A). [score:6]
Overexpression of miR-101 and downregulation of Ezh2 independently induced senescence in the absence of UVB irradiation. [score:6]
miR-101 is known to suppress expression of the histone methyltransferase Ezh2 [34, 35]. [score:5]
Using reverse transfection, the levels of miR-101 were significantly reduced in control HDF (Figure  8A) and miR-101 knockdown efficiently abrogated miR-101 upregulation in UVB -treated fibroblasts (Figure  8B). [score:5]
Although knockdown of miR-101 was very efficient also in UVB treated cells, no corresponding increase in the level of Ezh2 mRNA or protein was observed, suggesting that expression of the Ezh2 gene is regulated by additional signals, which remain to be established. [score:5]
However, Ezh2 mRNA was not significantly upregulated in miR-101 depleted cells, irrespective of (Figure  8A,B); and miR-101 knockdown failed to increase Ezh2 protein levels in both cases (data not shown). [score:5]
Expression levels for miR-15a, miR-20a, miR-20b, miR-93, and miR-101 are shown in Figure  3, along with their established target mRNAs. [score:5]
Expression levels of miR-101 and Ezh2 mRNA of non-irradiated cells after miR-101 knockdown were determined by real-time qPCR. [score:4]
B. UVB -treated cells miR-101 and Ezh2 expression levels from UVB treated cells after miR-101 knockdown were determined by real-time qPCR. [score:4]
After the last exposure the cells were reverse transfected as described with miR-101 power inhibitors for knockdown, negative control or not treated. [score:4]
These experiments suggest that indeed miR-101 has the potential to downregulate Ezh2 mRNA and protein levels in HDF, and this can lead to growth arrest and entry into premature senescence. [score:4]
Accordingly, the phenotype of UVB -induced cellular senescence was not significantly affected by preventing the UVB -induced upregulation of miR-101 (Figure  8C). [score:4]
Thereby, eight miRNAs (miR-15a, miR-17, miR-20a, miR-20b, miR-34, miR-93, miR-101, miR-155) were identified for which regulated mRNA targets were found with high confidence. [score:4]
For example, we tried by knockdown of miR-101 to rescue the expression levels of Ezh2 in UVB irradiated cells. [score:4]
Together the results obtained in this study suggest important roles for microRNAs miR-15, miR-20a/b, miR-93 and miR-101, and their mRNA targets, during UVB -induced senescence of human diploid fibroblasts. [score:3]
In consequence, overexpression of miR-101 was sufficient to reduce the rate of proliferation of human diploid fibroblasts (Figure  7D) and induced a significant increase in the number of SA-β-gal positive cells (Figure  7E). [score:3]
Figure 7 miR-101 overexpression induces premature senescence in HDFs. [score:3]
Expression levels of (A) miR-101 and (B) Ezh2 mRNA were determined by real-time qPCR. [score:3]
To achieve the overexpression of microRNA in HDFs, cells were reverse transfected with Pre-miR™ miRNA Precursor for miR-15a, miR-20a, miR-93, miR-101, and Pre-miR™ miRNA Precursor Molecules-Negative Control #2 for negative control (Applied Biosystems, Austria) using siPORT™ NeoFX™ Transfection Agent (Ambion, Austria) according the manufacturer’s protocol. [score:3]
Together, these experiments indicate that reduction of miR-101 was not sufficient to rescue Ezh2 expression in UVB -treated cells. [score:3]
Bioinformatic analysis of miRNA-mRNA networks was performed to identify new functional mRNA targets with high confidence for miR-15a, miR-20a, miR-20b, miR-93, and miR-101. [score:3]
Cells were reverse transfected as described with miR-101 precursors for overexpression, negative control or with the transfection reagent (siPORT™ NeoFX ™) at day 0, 3, 5 and 7. At day 9 RNA and protein were isolated. [score:3]
Whereas the majority of analyzed potential mRNA targets for miR-101 displayed a positive correlation with miR-101 levels (red lines in Figure  6A), the biological meaning of these interactions remains to be established. [score:3]
The inverse relationship between miR-101 and Ezh2 expression levels was noticed before [51, 52] and Ezh2 has been shown by others to play a role in cellular senescence [53, 54]. [score:3]
of the bioinformatic analysis suggested BIRC5, NAT13, and CXCL12 as potential targets for miR-101. [score:3]
Subsequent analysis was focused on miR-101 and its putative target gene Ezh2. [score:3]
To address the role of miR-101 in UVB -induced cellular senescence, we attempted to experimentally reduce miR-101 levels by transfection of miR-101 inhibitory RNAs. [score:3]
In a first set of experiments, we analyzed consequences of overexpression of miR-101. [score:3]
Expression levels of miR-101 were normalized to endogenous 5S rRNA (Exiqon, Denmark). [score:3]
Figure 6 Correlation network of miR-101 and its high confidence target genes. [score:3]
In these experiments, data obtained by the miRNA array for miR-15a, miR-20a, miR-20b, miR-93, and miR-101 were confirmed (Figure  2); whereas miR-17, miR-34 and miR-155 were also regulated in UVB -treated cells in accordance with the miRNA array results, the observed differences did not reach statistical significance (data not shown). [score:2]
Consistent with this observation, knockdown of miR-101 also failed to significantly reduce the percentage of SA-β-gal positive cells after (data not shown). [score:2]
C. Growth curve analysis of miR-101 knockdown cells. [score:2]
Regulation of UVB -induced senescence: the role of miR-101 and Ezh2. [score:2]
Figure 8 Depletion of miR-101 fails to prevent UVB -induced senescence. [score:1]
miR-101 levels were determined by real-time qPCR as described (right panel). [score:1]
A role of miR-101/Ezh2 in UVB -induced senescence?. [score:1]
This treatment was started one day before and continued thereafter, in order to keep miR-101 levels constantly low. [score:1]
In addition, miR-101 and Ezh2 were identified as key players in UVB -induced senescence of HDF. [score:1]
The here reported data demonstrate for the first time the implication of miR-101/Ezh2 signaling in UVB -induced senescence of human dermal fibroblasts. [score:1]
of the analysis are presented here for miR-101. [score:1]
Subsequent analysis revealed several well established miRNA-mRNA regulatory interactions including miR-101/Ezh2, thereby validating the assay. [score:1]
To address the functionality of the miR-101-Ezh2 interaction in UVB -induced senescence of HDF and their importance for UVB -induced senescence, we addressed the potential of these molecules to affect cellular senescence in HDF. [score:1]
When this communication was under revision, it was reported by others that miR-101 controlled Ezh2 function in cellular senescence of mouse embryonic fibroblasts [55]. [score:1]
In the present communication, functional interactions between miR-101 and Ezh2 in UVB -induced senescence of HDF were analyzed in more detail. [score:1]
Our analysis confirmed a high confidence interaction between miR-101 and Ezh2 in UVB -induced senescence (Figure  6A), thereby validating the analytical procedure. [score:1]
[1 to 20 of 53 sentences]
13
[+] score: 179
Importantly, cell lines with higher miR-27b, miR-101, or miR-128 expression tended to have lower VEGF-C expression, while cell lines with lower expression of miR-27b, miR-101 or miR-128 had higher VEGF-C expression. [score:9]
Collectively, these results suggest ectopic expression of miR-27b, miR-101 or miR-128 significantly inhibits migration and invasion activity of gastric cancer cells in vitro, and provide further evidence that metastasis due to VEGF-C is likely due to downregulation of key miRNAs. [score:8]
Collectively, these findings highlight the role of miRNAs in suppressing carcinogenesis, tumor development, and progression and suggest that aberrant overexpression of VEGF-C may be due to the decreased miR-27b, miR-101, or miR-128 expression in gastric cancers. [score:8]
Additionally, miR-27b and miR-128 expression inversely correlated to VEGF-C expression in gastric cancers (Figure 3G2 and 3G4 p = 0.0492, r = −0.2414 or p = 0.0031, r = −0.3900), although there was no statistically significant inverse correlation between miR-101 level and VEGF-C expression (Figure 3G P = 0.3224, r = −0.068). [score:7]
MiR-27b, miR-101, or miR-128 directly down-regulates VEGF-C expression through posttranscriptional repression in gastric cancer cells. [score:7]
MiR-101 was also down-regulated in gastric cancer tissues and cell lines; however, there was no significant inverse correlation between its expression level and VEGF-C expression in gastric cancer tissues. [score:7]
As the results showed, miR-101 merely restrained its expression by about 30% via a fine-tuning manner; however, miR-27b or miR-128 has inhibited VEGF-C expression by ∼45% or more respectively. [score:7]
MiR-27b, miR-101, or miR-128 directly down-regulates VEGF-C expression. [score:7]
The luciferase assays showed that miR-27b, miR-101, or miR-128 rather than miR-144 or miR-186 (Figure 3A and 3B) displayed more effectively inhibited luciferase activity with an inhibitory rate of more than 30% in pmiR-VEGF-C and miRNAs co -transfected cells, indicating that miR-27b, miR-101, and miR-128 were candidate miRNAs for VEGF-C. Specifically, miR-27b, miR-101, or miR-128 transfection decreased luciferase expression by 41.65 ± 4.60%, 30.36 ± 15.99%, and 51.20 ± 7.3%, respectively in MKN-45 cells (Figure 3C, p = 0.0020, p = 0.0179, or p = 0.0037). [score:6]
MiR-101 suppressed bladder cancer cell migration and invasion by down -regulating VEGF-C expression [22]. [score:5]
Spearman's correlation was applied for analyzing the association between miR-27b, miR-101, or miR-128 and VEGF-C expression, MVD or LVD, as well as the association between VEGF-C expression and MVD or LVD. [score:5]
A. and B. However, there was no significant difference in the overall survival and disease-free survival between the miR-27b C. and D., miR-101 E. and F. or miR-128 G. and H. lower and higher expression groups. [score:5]
Thus, we believe that miR-101 inhibits VEGF-C expression by a fine-tuning manner. [score:5]
We identified three miRNAs that target and suppress VEGF-C: miR-27b, miR-101, or miR-128. [score:5]
Our data showed that miR-27b and miR-101, miR-27b and miR-128, or miR-101 and miR-128 co-transfection led to significant decreases in luciferase activity (miR-27b and miR-101: 42.58% ± 4.83%, p = 0.002; miR27b and miR-128: 45.59% ± 5.99%, p = 0.0027; miR101 and miR-128: 53.39% ± 2.27%, p = 0.0003), decreases of VEGF-C mRNA expression by 70% ± 4.50%, 66.55% ± 5.67%, or 47.18% ± 5.4% (p = 0.0012, p = 0.0017, or p = 0.0058, respectively) and decreases of VEGF-C protein expression by 52.92% ± 33.83%, 34.04% ± 7.59%, or 31.94% ± 6.99% (p = 0.0205, p < 0.0001, or p < 0.0001, respectively) in MKN-45 cells (Figure 3C- 3E). [score:5]
Collectively, our data suggest VEGF-C is down-regulated by miR-27b, miR-101, or miR-128. [score:4]
Compared to human non-tumorous gastric mucosa (n = 5), higher expression of VEGF-C mRNA and protein and decreased expression of miR-27b, miR-101 or miR-128 were detected in 3 gastric cancer cell lines by and RT-qPCR, respectively F.. [score:4]
In addition to reduced VEGF-C expression in gastric cells transfected with miR-27b, miR-101, or miR-128, migration and invasion abilities were also attenuated, indicating that autocrine regulation of gastric cancer cells is critical for tumorigenesis [8]. [score:4]
Dual-luciferase reporter gene assay showed that miR-27b, miR-101, or miR-128(decreased 38.68% ± 10.86%, 30.36% ± 10.29%, 47.76% ± 13.61%, p = 0.0115, p = 0.0156, or p = 0.0111) respectively, but not miR-144 or miR-186 displayed strong inhibitory effect on the luciferases expression in MKN-45 cells. [score:4]
Collectively, these data suggest miR-27, miR-101, and miR-128 suppress the migration and proliferation of HUVECs at least in part by down -regulating VEGF-C secretion. [score:4]
Expression of VEGF-C and miR-27b, miR-101 or miR-128 and their correlation with patients’ survival in gastric cancers. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration or invasion activity of gastric cancer cells in vitroPrevious studies suggest the VEGF-C/VEGFR-3 axis is critical in enhancing cancer cell migration and invasion and promotes metastasis [13]. [score:3]
Similarly, Derfoul et al. demonstrated that miR-101 and miR-214 co-operatation could not reduce Ezh2 levels further while both miR-214 and miR-101 could suppress Ezh2 protein level [26]. [score:3]
Here we demonstrated that miR-27b, miR-101, and miR-128 inhibited HUVEC migration, proliferation and tube formation by reducing secretion of VEGF-C by gastric cancer cells. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration and proliferation activity in HUVECs. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the migration or invasion activity of gastric cancer cells in vitro. [score:3]
MiR-27b, miR-101, or miR-128 suppresses the tube formation of HUVECs. [score:3]
However, there was no significantly correlation between miR-101 level and VEGF-C expression (G3). [score:3]
MiR-27b, miR-101, miR-128, miR-27b/miR-101, miR-27b/miR-128 or miR-101/miR-128 co-transfection could significantly suppress the luciferase activity in pmiR-VEGF-C transfected MKN-45 cells C.. [score:3]
Overexpression of miR-27b, miR-101, or miR-128 attenuated proliferation and tube formation of HUVECs. [score:3]
Overexpression of miR-27b, miR-101, or miR-128 abolished the migration, invasion activity of gastric cancer cells and the migration activity of HUVECs in vitro. [score:3]
They also suggested that Ezh2 overexpression may also arise from deletion of miR-214 allele without concomitant deletion of miR-101 in a subset of breast tumors. [score:3]
MiR-27b, miR-101, miR-128 or miR-27b/miR-101, miR-27b/miR-128, miR-101/miR-128 co-transfection could significantly decrease the VEGF-C protein expression in MKN-45 cells E.. [score:3]
Importantly, VEGF-C expression positively correlated with MVD and LVD (Figure 5A3 and A4 p = 0.0003 or p = 0.0027), and miRNA-27b, miR-101, or miR-128 levels inversely correlated with MVD (Supplementary Figure S7A-C p = 0.0471, p = 0.0442, or p = 0.0018); no correlation between the level of the three miRNAs and LVD was found (Supplementary Figure S7D-F p > 0.05). [score:3]
Inhibition of miR-27b, miR-101, or miR-128 affected VEGF-C secretion was confirmed by ELISA. [score:3]
MiR-27b, miR-101, miR-128 or miR-27b/miR-101, miR-27b/miR-128, miR-101/miR-128 co-transfection could significantly reduce the VEGF-C mRNA expression in MKN-45 cells D.. [score:3]
To determine whether miR-27b, miR-101, or miR-128 inhibits VEGF-C -induced endothelial cell migration, transwell monolayer permeability assays were used to detect the changes in migration activity of HUVECs, which were treated with the culture supernatants of gastric cancer cells transiently transfected with the three miRNAs or a negative control. [score:2]
Gastric cancer cells were co -transfected with miR-27b and miR-101, miR-27b and miR-128, or miR-101 and miR-128. [score:1]
Figure 3 through posttranscriptional repression in gastric cancer cellsScheme representation of the potential binding site of miR-27b, miR-101, or miR-128 in the VEGF-C 3′UTR A.. [score:1]
The efficacy of miR-27b, miR-101, and miR-128 was significant as indicated by reduced VEGF-C protein levels (36.38 ± 27.62%, 40.56 ± 20.50%, or 43.22 ± 22.27% reduction) (Figure 3E, p = 0.0108, p = 0.0026, or p = 0.0036, respectively). [score:1]
As shown in Figure 4A, miR-27b, miR-101, or miR-128 -transfected cells showed a considerable decrease in migration activity by 64.9% ± 4.27%, 45.16% ± 3.71%, or 46.38% ± 0.56% (p = 0.0001, p < 0.0001, or p = 0.0003, respectively) and a decrease in invasion capacity by 45.83% ± 4.83%, 39.13% ± 9.46% or 63.64% ± 3.49% (Figure 4B p = 0.0004, p = 0.0133, or p = 0.0002, respectively) than that of the negative control group in MKN-45 cells. [score:1]
HUVECs cultured with the media supernatant from cancer cells transfected with miR-27b, miR-101, miR-128 mimics, or negative control, were incubated with 50 μM EdU for 4 h. Samples were fixed, permeabilized, and stained for EdU. [score:1]
Figure 4Overexpression of miR-27b, miR-101, or miR-128 abolished the migration, invasion activity of gastric cancer cells and the migration activity of HUVECs in vitroIn migration assay, the migration activity of the miRNAs -transfected MKN-45 cells was significantly decreased when compared to the negative control A.. [score:1]
Based on these studies, we investigated whether miR-27b, miR-101, and miR-128 could inhibit migration and invasion. [score:1]
We evaluated 48 samples of gastric cancer tumors for expression of miR-27b, miR-101, and miR-128. [score:1]
VEGF-C levels were significantly reduced by 82.23% ± 2.07%, 81.54% ± 1.76%, or 52.33% ± 1.94% respectively in MKN-45 cells transfected with miR-27b, miR-101, or miR-128 (Figure 5A1 and Supplementary Figure S4B) (all p < 0.05). [score:1]
Five tumor-suppressing miRNAs including miR-27b, miR-101, miR-128, miR-144, and miR-186, which have potential binding sites in the 3′-UTR of VEGF-C (Figure 3A and Supplementary Figure S1A), were selected for further investigation. [score:1]
Scheme representation of the potential binding site of miR-27b, miR-101, or miR-128 in the VEGF-C 3′UTR A.. [score:1]
Other mechanisms underlying the synergistic effect of miR-27b, miR-101 and miR-128 on VEGF-C expression need further investigation in the future. [score:1]
These results suggest that miR-27b, miR-101, or miR-128 attenuates tube formation of HUVECs induced by secreted VEGF-C from gastric cancer cells in vitro. [score:1]
[1 to 20 of 50 sentences]
14
[+] score: 178
In conclusion, the results of the present study indicated that the downregulation of miR-101 in NPC cell lines and ectopic expression of miR-101 suppressed the cell viability and enhanced the radiosensitivity of NPC cells by directly targeting STMN1. [score:11]
Additionally, forced expression of STMN1 rescued the downregulation of autophagy -associated protein LC3II and upregulation of p62 protein (Fig. 4D), and decreased the lipidation of LC3 (Fig. 4E), which represented decreased activity of autophagy in the presence of miR-101 24 h following irradiation. [score:9]
In the present study, it was demonstrated that miR-101 was downregulated in NPC cell lines and that the ectopic expression of miR-101 significantly suppressed NPC-cell viability and enhanced their radiosensitivity. [score:8]
These results indicated that STMN1 is one of the key functional targets of miR-101, with respect to the effect of miR-101 on the growth inhibition, radiosensitivity enhancement and autophagy inhibition of NPC cells. [score:7]
The ectopic expression of miR-101 was able to significantly suppress the mRNA and protein expression of STMN1 (Fig. 3A and B). [score:7]
It was demonstrated that the overexpression of miR-101 significantly suppressed the luciferase activity of the wt 3′UTR of STMN1 but not the mut reporter gene (Fig. 3C, upper panel), indicating the specificity of miR-101 to target the STMN1 3′UTR. [score:7]
This suggested that miR-101 may suppress cell proliferation and enhance radioresistance of NPC cells by directly targeting STMN1. [score:6]
Further studies have indicated that miR-101 is downregulated in numerous types of cancer, including gastric (13), lung (14) and colon cancer (15), and a loss of miR-101 expression is involved in carcinogenesis (16) and angiogenesis (17). [score:6]
The results of the present study demonstrated that miR-101 was downregulated in NPC cell lines and that IR induced the expression of miR-101. [score:6]
The ectopic expression of miR-101 suppressed the viability of, and enhanced the radiosensitivity of NPC cells. [score:5]
A loss of miR-101 expression is frequently observed in certain types of human cancer and is associated with therapeutic resistance, which suggests that miR-101 may act as a tumor suppressor (18). [score:5]
In addition, the overexpression of miR-101 significantly reduced the mRNA and protein expression of STMN1. [score:5]
Subsequently, luciferase reporter vectors that contained wild-type or mutant miR-101 target sequences of the STMN1 3′UTR were constructed (Fig. 3C, lower panel) and a luciferase reporter assay was performed to determine whether STMN1 was a direct target of miR-101. [score:5]
Studies have also indicated that the ectopic expression of miR-101 is able to sensitize non-small cell lung cancer cells to radiation by targeting DNA -dependent protein kinase and ataxia telangiectasia mutated (ATM) (18). [score:5]
Furthermore, the co -expression of STMN1 markedly rescued the growth suppression and radiosensitivity of CNE-2 cells transfected with the miR-101 mimic (Fig. 4B and C). [score:5]
STMN1 was additionally identified as a direct functional target of miR-101 involved in cell growth, radiosensitivity and radiation -induced autophagy. [score:4]
These data demonstrated that miR-101 enhanced radiosensitivity by directly targeting STMN1. [score:4]
STMN1 is a direct target of miR-101 and is involved in NPC-cell radioresistance and growth. [score:4]
To confirm that the miR-101-enhanced radiosensitivity is due to the direct targeting of STMN1, CNE-2 and 5-8F cells were transfected with STMN1 siRNA or control siRNA. [score:4]
These results indicated that STMN1 is a direct target of miR-101 in NPC cells. [score:4]
miR-101 is downregulated in NPC cell lines and affects the radiation response of NPC cells. [score:4]
miR-101 suppresses NPC-cell viability and sensitizes NPC cells to radiation. [score:3]
A study by Frankel et al (7) indicated that miR-101 may act as an inhibitor of autophagy, a catabolic pathway which involves self-degradation and the recycling of macromolecules and cellular organelles. [score:3]
Restoration of STMN1 expression rescues the effect of miR-101 on cell viability, radiosensitivity and radiation -induced autophagy. [score:3]
The effects of radiation on miR-101 expression of NPC cells were also examined. [score:3]
These results suggested that miR-101 enhanced the radiosensitivity of NPC cells in a manner that may be associated with the suppression of cell viability and persistence of DNA damage. [score:3]
In the present study, it was demonstrated that expression of miR-101 was increased in response to IR. [score:3]
In the present study, a luciferase reporter gene assay verified STMN1 as a direct target of miR-101. [score:3]
Additionally, the present study aimed to identify functional targets of miR-101 in order to elucidate the mechanism by which it exerts its effects in NPC and thereby propose a strategy for enhancing NPC cell radiosensitivity and improving treatment of NPC. [score:3]
To investigate the molecular mechanism by which miR-101 increased the radiosensitivity of NPC cells, STMN1 was identified as a potential target of miR-101 based on the three publicly available databases [TargetScan (http://www. [score:3]
Several targets of miR-101, such as histone-lysine N-methyltransferase (28) and ATM (29), have been identified. [score:3]
As demonstrated in Fig. 1B, the levels of IR -induced miR-101 expression in both cell lines increased upon IR. [score:3]
The present study aimed to elucidate the function of miR-101 in NPC by analyzing miR-101 expression in NPC cell lines and investigating the effects of ectopic expression on NPC-cell proliferation and radiosensitivity. [score:3]
As indicated in Fig. 2C, the ectopic expression of miR-101 led to a markedly increased persistence of γ-H2AX foci 24 h post-IR compared with that of the control groups. [score:2]
These results suggested that miR-101 has significant roles in the development and radiosensitivity of NPC. [score:2]
This identified an miR-101/STMN1 pathway which may contribute to the elucidation of the molecular mechanisms by which miR-101 regulates the radiosensitivity of NPC cells. [score:2]
The ectopic expression of miR-101 significantly reduced the proliferation of NPC cells compared with that of the controls (Fig. 2A). [score:2]
To determine the functional relevance of STMN1 regulation by miR-101, the effect of STMN1 on miR-101 -mediated growth suppression and radiosensitivity was evaluated. [score:2]
This further supported the hypothesized anti-tumor effects of miR-101 in NPC. [score:1]
Further investigation will be performed to determine whether miR-101-enhanced radiosensitivity is correlated with the inhibition of autophagy in NPC. [score:1]
Forty-eight hours following transfection with miR-101 mimic or miRNA mimic negative control, 1×10 [5] cells were seeded in chamber slides and incubated overnight. [score:1]
These results indicated that miR-101 may influence the IR response of NPC cells. [score:1]
However, the association between miR-101 and the modulation of radioresistance in NPC remains to be elucidated. [score:1]
As indicated in Fig. 1A, the miR-101 levels were significantly decreased in all four NPC cell lines (P<0.01), particularly in the 5-8F and CNE-2 cell lines. [score:1]
The STMN1 wild-type (wt) and mutant (mut) 3′UTRs, which contain the putative miR-101 binding site, were created and cloned into the Renilla luciferase vector (pLUC-REPORT vector; Promega, Madison, WI, USA). [score:1]
CNE-2 cells were co -transfected with miR-101 mimic or miRNA mimic negative control and with pCMX-IRES2-eGFP-STMN1 plasmid or the empty vector. [score:1]
CNE-2 and 5-8F cells were pretreated by either miR-101 mimic or STMN1 siRNA transfection for 48 h and subsequently seeded onto six-well plates in triplicate at specific cell densities, followed by exposure to the indicated doses of radiation (0, 2, 4, 6 or 8 Gy) using 6 MV X-rays generated from linear accelerators (Varian 2300EX; Varian, Palo Alto, CA, USA) at a dose rate of 3 Gy/min. [score:1]
miR-101 mimic, miRNA mimic negative control oligonucleotides, STMN1 siRNA and siRNA negative control were all purchased from Ribobio. [score:1]
In the present study, the expression of miR-101 in four NPC cell lines and the human immortalized nasopharyngeal epithelial cell line NP69 was investigated. [score:1]
[1 to 20 of 49 sentences]
15
[+] score: 175
In this study, we demonstrated that TPA -induced ERK signaling pathway in HepG2 cells can up-regulate expression of tumor suppressor gene miR-29c and miR-101. [score:8]
MiR-101 was shown to promote apoptosis and suppress FOS oncogene expression in human hepatoma cells and to act as tumor suppressor gene in carcinogenesis of human hepatoma [15, 16]. [score:6]
To study how TPA induced miR-101 expression in HepG2 cells, we examined miR-101 expression in both parental HepG2 and PKCα knockdown HepG2 cells under TPA treatment. [score:6]
Our study provides us an excellent mo del to examine how expression of miR-101 is normally regulated and leads a new direction of investigation to elucidate possible defective regulatory pathway of miR-101 expression in human hepatoma cells. [score:6]
Therefore, down regulation of miR-101 in HCC may increase PRC2 complex, enhance methylation of histone H3 lysine 27 at specific genome loci and epigenetically regulate gene expression at genome wide level. [score:5]
Specific inhibitor of ERK completely blocked TPA induced miR-101 expression. [score:5]
To examine the effect of miR-101 on these two targets, we first analyzed and identified the miR-101 recognition sequence in the 3' UTR regions of EZH2 and EED using our in-house TargetScan program (Fig. 3B). [score:5]
Expression levels of miR-101 was normalized to miR-16 and expressed as fold change using DMSO -treated sample as baseline. [score:5]
Expression levels of miR-101, miR-29c and miR-122 were normalized to miR-16 and expressed as fold-change using time 0 as baseline. [score:5]
Therefore, we hypothesized that down regulation of miR-101 in HCC may increase PRC2 complex, enhance methylation of histone H3 lysine 27 at specific genome locus and epigenetically regulate gene expression at genome wide level. [score:5]
Based on this hypothesis, the first question should be answered is how expression of miR-101 is down regulated during development of human cancers. [score:5]
As shown in Fig. 3C, when the luciferase gene carried 3' UTR region of either EZH2 or EED's transcript, the luciferase activity was inhibited by over -expressing miR-101-1 or miR-101-2 but not by the control miR-LacZ. [score:5]
The expression level of miR-101 was normalized to miR-16 and expressed as fold change using control sample as baseline. [score:5]
To further identify signaling pathway downstream of PKCα is crucial for TPA induced miR-101 expression, we examined whether the ERK signaling is involved using specific ERK signaling pathway inhibitors. [score:5]
Our results suggest that in human HepG2 cells the genomic loss may not be responsible for down regulation of miR-101 expression. [score:4]
MiR-101 targets two subunits of PRC2 complex, enhancer of zeste homolog 2 (EZH2) and EED, and was shown to play as a tumor suppressor gene in human prostate, breast and liver cancers. [score:4]
However, we cannot rule out the possibility that activation of PKCα may also down regulate SUZ12 expression in a miR-101-independent manner. [score:4]
As shown in Fig. 3A, TPA induced miR-101 expression was largely abolished in the PKCα knockdown HepG2 cells. [score:4]
Then we showed that TPA not only up regulated miR-101 expression, but also reduced protein level of EZH2, EED and H3K27me3 in HepG2 cells. [score:4]
To experimentally validate that the predicted target sequences of miR-101 can be suppressed by both miR-101-1 and miR-101-2, we cloned these two miR-101 precursor sequences into the pMIR-REPORT™ and perform luciferase activity assay. [score:4]
Using lenti-virus -mediated shRNA to knockdown endogenous PKCα expression, we observed that TPA induced growth arrest, elevation of miR-101 and reduction of EZH2, EED and H3K27me3 proteins were all PKCα dependent. [score:4]
One interesting question raised from our observation is why TPA also down regulated SUZ12 even though only 3' UTR of EZH2 and EED's transcript carry miR-101 target sequence. [score:4]
In this study, we examined TPA regulated miRNA expression profile in human hepatoma HepG2 cells and discovered that miR-101 was induced by TPA in HepG2 cells. [score:4]
The targets of miR-101 include EZH2 and EED, two key component of PRC2 complex. [score:3]
We found that pretreatment of U0126 completely blocked TPA induced miR-101 expression in HepG2 cells (Fig. 4A). [score:3]
These results indicate that the expressed miR-101 in HepG2 cells is fully functional and no obvious abnormality is associated with microRNA processing machinery in HepG2 cells. [score:3]
EZH2 and EED have been shown as the target gene(s) of miR-101 [17, 22]. [score:3]
MiR-101 can be expressed from two genomic loci, miR-101-1 on chromosome 1p31 and miR-101-2 on chromosome 9p24. [score:3]
Therefore, this is the first time to show that PKCα and ERK pathway play important role to activate miR-101 expression, reduce PRC2 complex and H3K27me3 level. [score:3]
In our study, we showed unequivocally that activation of PKCα and ERK by TPA can induce expression of miR-101 in HepG2 cells. [score:3]
Two essential components of PRC2 complex, EZH2 and EED, have been shown as target of miR-101 [17]. [score:3]
If TPA -induced miR-101 expression is PKCα -dependent, all TPA -induced miR-101 down stream effects such as reduced level of EZH2 and EED protein and methylation of histone 3 lysine 27 should also be PKCα -dependent. [score:3]
Cells were co -transfected microRNA expression vector pLenti-6.4 containing miR-101-1, miR-101-2, or miR-LacZ, with pMIR-REPORT constructs of EED-3'UTR(1~221) and EZH2-3'UTR(1~263), and Rous sarcoma virus-β-galctosidase vector to monitor transfection efficiency. [score:3]
Similar phenomenon has also been observed when miR-101 was ectopically overexpressed in human prostate cancer cells [17]. [score:3]
This result clearly indicates that TPA -induced miR-101 expression in HepG2 cells is PKCα dependent. [score:3]
Two miRNAs, miR-101, and miR-29c, were found significantly down regulated in human hepatoma tissues and induced over 4-fold in HepG2 cells upon TPA treatment (Fig 2B; Table 2). [score:2]
Two miRNAs, miR-101, and miR-29c, were shown to be significantly down regulated in human hepatoma tissues and induced over 4-fold in HepG2 cells under TPA treatment. [score:2]
The target sequence of miR-101 located in the 3' UTR of both EZH2 and EED's mRNA was identified by bioinformatic analysis and was validated by reporter luciferase activity assay. [score:2]
MiR-101 recently has been shown to act as an important tumor suppressor gene in various human cancers including prostate and liver cancer [16, 17, 22]. [score:2]
LCC designed and performed luciferase assay to validate target of miR-101. [score:2]
The rapid induction of miR-101 by TPA treatment indicates that the induction of miR-101 may be the primary response of TPA treatment in HepG2 cells (Fig 2C). [score:1]
Only one study convincingly showed that genomic deletion of miR-101 at both loci occurs in a significant number of human prostate cancer and was associated with cancer progression [17]. [score:1]
Since induction kinetics of miR-101 by TPA was much faster than miR-29c suggests that the induction of miR-101 may be the primary response of TPA treatment. [score:1]
Both predicted miR-101 precursors generate identical mature miR-101. [score:1]
Our study also provided first experimental evidence to show that induction of endogenous miR-101 indeed is accompanied with lower EZH2, EED and SUZ12 level and histone 3 lysine 27 trimethylation in human hepatoma cells. [score:1]
Precursors of respective miR-101 and negative controls were purchased from Ambion (Austin, TX). [score:1]
We also showed the induction of miR-101 by TPA is PKCα and ERK dependent. [score:1]
MiR-101-1 is an intergenic miRNA gene located in chromosome 1p31.3. [score:1]
TPA -induced miR-101 and its downstream effects are all PKCα -dependent in HepG2 cells. [score:1]
Both loci produce identical mature miR-101. [score:1]
Seed FamilyHCCP-valueHCC(T/N) [a]TPA(T/C) [b] hsa-miR-1011p31.39p24.1 ACAGUAC miR-101 2.30E-04 -2.17 13.36 hsa-miR-29c 1q32.2 AGCACCA miR-29 5.90E-03 -2.31 7.26 a, tumor versus normal fold-change; b, TPA versus DMSO (control) fold changeThe induction kinetics of both miR-101 and miR-29c in HepG2 cells after TPA treatment were examined. [score:1]
MiR-101-1:5'-TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTACAGTACTGTGATAACTGAAGGATGGCA-3' and miR-101-2: 5'-ACCACCATTCTTCAGTTATCACAGTACTGTACCTTTCAGATATACAGCATCGGTACCATGATAACCGAAAAAGGACAGT-3' were cloned into SmaI/XmaI sites of pLenti-6.4. [score:1]
The authors suspected that miR-101 reduced the level of EZH2 and lead to destabilization of SUZ12. [score:1]
There are two predicted miR-101 precursor hairpin structures, miR-101-1 and miR-101-2, in the human genome. [score:1]
No genomic deletion at either miR-101 locus was detected in HepG2 cells (data not shown). [score:1]
TPA -induced miR-101 in HepG2 is mediated by ERK signaling pathway. [score:1]
Seed FamilyHCCP-valueHCC(T/N) [a]TPA(T/C) [b] hsa-miR-1011p31.39p24.1 ACAGUAC miR-101 2.30E-04 -2.17 13.36 hsa-miR-29c 1q32.2 AGCACCA miR-29 5.90E-03 -2.31 7.26 a, tumor versus normal fold-change; b, TPA versus DMSO (control) fold change The induction kinetics of both miR-101 and miR-29c in HepG2 cells after TPA treatment were examined. [score:1]
[1 to 20 of 57 sentences]
16
[+] score: 142
Although in Eca109 cells, over expression of miR-101 was found to suppress EZH2 expression, we did not detect significant correlation between the expression of miR-101 and EZH2 in clinical samples of ESSC tumor tissues and we found that miR-101 -induced inhibition of Eca109 migration and invasion was not reversed by overexpressing EZH2. [score:13]
It was found that 75% (30/40), 62.5% (25/40), and 85% (34/40) of samples showed downregulation of miRNAs (i. e. miR-98, miR-101 and miR214) with upregulation of EZH2 protein in tumor versus normal tissues, respectively. [score:7]
MiR-98, miR-101 and miR-214 posttranscriptionally down-regulates EZH2 expression in ESCC cell line. [score:6]
MiR-98, miR-101 and miR214 expression is down-regulated in. [score:6]
Using luciferase assay and western blot, we further demonstrated that miR-98, miR-101 and miR-214 could target the 3’-URT of EZH2 and suppress EZH2 expression in ESCC cells. [score:6]
In the present study, we found that miR-101 expression was down-regulated in primary ESCC tumor tissues and was significantly correlated with the tumor stage and lymph node metastasis. [score:6]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 inhibit the expression of EZH2 in nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma, respectively [21- 26]. [score:5]
On the other hand, it was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 could inhibit the expression of EZH2 in some tumors. [score:5]
Expression of miR-98 and miR-101 was found to be downregulated in tumor tissues compared with the matched normal tissues in 67.5% (27/40) of samples. [score:5]
It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 were involved in the regulation of EZH2 expression in some human tumors such as nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma [21- 26]. [score:4]
MiR-26a, miR-98, miR-101, miR-124,miR-138 and miR-214 were reported to be decreased in some human tumors and posttranscriptionally regulate the expression of EZH2 [21- 26]. [score:4]
showed that the expression of miR-98 (A), miR-101 (B) and miR-214 (C) were significantly decreased in tumor tissue compared with the matched normal tissue; while that of miR-138 (D) was significantly increased in tumors tissue, and there was no significantly difference in the expression of miR-26a (E) and miR-124 (F) between the two groups. [score:4]
The discrepancies might be attributable to the regulation of EZH2 expression by multiple miRNAs, amongst which miR-101 only plays a minor role. [score:4]
Considering that the expression and function of miRNAs may vary in different types of tumors, here we set out to investigate whether these miRNAs (miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214) regulate tumor metastasis via altering EZH2 expression in human ESCC. [score:4]
MiR-98, miR-101 and miR-214 inhibit the migration and invasion of ESCC cell line. [score:3]
We further investigated the relationship of the expression level of miRNAs (miR-98, miR-101 and miR214) with EZH2 expression. [score:3]
In the present study, we first examined the expression levels of MiR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 in clinical samples of ESCC and matched normal tissues using qPCR. [score:3]
Figure 2A-C shows the mean expression levels of miR-98, miR-101 and miR-214, which were significantly lower in tumor tissues than in matched normal tissues. [score:3]
We further detected the expression of EZH2 protein and mRNA by western blot and qRT-PCR in Eca109 cells transfected with miRNAs (miR-98, miR-101 or miR-214). [score:3]
We further analyzed the relationship of miR-98, miR-101 and miR214 expression with the clinical features including age, gender, pathological grade, tumor location, tumor stage and lymph node metastasis in ESCC. [score:3]
On the other hand, there appeared to be no significant association between the expression of miR-101 and EZH2 mRNA and protein (Figure 3E-F). [score:3]
These results indicate that miR-98, miR-101 and miR-214 could inhibit the migration and invasion of ESCC cells. [score:3]
Figure 5 MiR-98, miR-101 and miR-214 inhibits the migration and invasion of ESCC cells. [score:3]
MiR-101 was reported to be down-regulated in human colon cancer, nasopharyngeal carcinoma, neuroblastoma and prostate cancer, and could repress the proliferation, invasion and metastasis of tumor cells [22, 23, 36, 37]. [score:3]
Further studies are needed to test whether miR-101 might inhibit ESCC metastasis via an EZH2-independent signal pathway. [score:3]
We found that expression levels of miR-98, miR-101 and miR-214 were significantly lower in tumor than in normal tissues. [score:3]
There was no significant association between the expression of miR-101 and EZH2 protein (E) and mRNA (F). [score:3]
These results indicate that the 3'-UTR of EZH2 mRNA is a functional target of miR-98, miR-101 and miR-214 in ESCC cells. [score:3]
showed that the level of EZH2 protein (D) was significantly decreased in cells transfected with miRNAs (including miR-98, miR-101 and miR-214) as compared to the cells transfected with control microRNA, while the expression level of EZH2 mRNA (E) exhibited no significantly difference between cells transfected with miRNAs and those transfected with control microRNA. [score:2]
MiR-101 expression was also significantly correlated with tumor stage and lymph node metastasis (Table 1). [score:2]
Figure 2 MiR-98, miR-101 and miR-214 expression is decreased in as compared to matched normal tissues. [score:2]
Overexpression of EZH2 reverses the inhibition of migration and invasion of ESCC cells by miR-98 and miR-214To investigate the functional connection between miRNAs (miR-98, miR-101 and miR-214) and EZH2 in the regulation of ESCC metastasis, we further evaluated the migration and invasion capacity of cells cotransfected with these miRNAs and pcDNA-EZH2 (or empty pcDNA) plasmid. [score:2]
Combining these findings, we propose that miR-98, miR-101 and miR-214 regulate the accumulation of EZH2 protein in ESCC. [score:2]
These results suggest that the miR-98, miR-101 and miR214 might be involved in metastasis of ESCC. [score:1]
The sequences of miR-98 were:Sense: 5 [′]- UGAGGUAGUAAGUUGUAUUGUU −3 [′],Anti-sense: 5 [′]- AACAAUACAACUUACUACCUCA −3 [′], The sequences of miR-101 were:Sense: 5 [′]- UACAGUACUGUGAUAACUGAA −3 [′],Anti-sense: 5 [′]- UUCAGUUAUCACAGUACUGUA −3 [′], The sequences of miR-214 were:Sense: 5 [′]- ACAGCAGGCACAGACAGGCAGU −3 [′],Anti-sense: 5 [′]- ACUGCCUGUCUGUGCCUGCUGU −3 [′], A scrambled microRNA with no homology to any known human microRNA was used as negative control:Sense: 5 [′]-GUUGAACUGUUAAGAACCACUGG-3 [′],Anti-sense: 5 [′]-CCAGUGGUUCUUAACAGUUCAAC-3 [′], All microRNA mimics were synthesized by Genephama Biotech (Shanghai, China). [score:1]
MiR-98, miR-101 and miR-214 inhibit the migration and invasion of ESCC cell lineTo investigate the role of miR-98, miR-101 and miR-214 in ESCC metastasis, we detected the migrant and invasive capacity of Eca109 cells transfected with miRNA mimics or control miRNA. [score:1]
However, the percentage of cells that travelled through the micropore or invaded through the matrigel were comparable between cells cotransfected with miR-101 and pcDNA-EZH2 plasmid and cells cotransfected with miR-101 and pcDNA plasmid (Figure 6A and B). [score:1]
qPCR analysis confirmed that Eca109 cells transfected with miRNA mimics (i. e miR-98, miR-101 or miR-214) exhibited significantly higher mature miRNA level than those treated with controls 48 hr posttransfection (Additional file 2: Figure S2). [score:1]
MiR-98, miR-101 and miR214 are correlated with pathological grade, tumor stage and lymph node metastasis. [score:1]
The sequences of miR-98 were: Sense: 5 [′]- UGAGGUAGUAAGUUGUAUUGUU −3 [′], Anti-sense: 5 [′]- AACAAUACAACUUACUACCUCA −3 [′], The sequences of miR-101 were: Sense: 5 [′]- UACAGUACUGUGAUAACUGAA −3 [′], Anti-sense: 5 [′]- UUCAGUUAUCACAGUACUGUA −3 [′], The sequences of miR-214 were: Sense: 5 [′]- ACAGCAGGCACAGACAGGCAGU −3 [′], Anti-sense: 5 [′]- ACUGCCUGUCUGUGCCUGCUGU −3 [′], A scrambled microRNA with no homology to any known human microRNA was used as negative control: Sense: 5 [′]-GUUGAACUGUUAAGAACCACUGG-3 [′], Anti-sense: 5 [′]-CCAGUGGUUCUUAACAGUUCAAC-3 [′], All microRNA mimics were synthesized by Genephama Biotech (Shanghai, China). [score:1]
As shown in Figure 4A-C, cells cotransfected with miRNAs (ie, miR-98, miR-101 or miR-214) and Luc-EZH2 plasmid showed a significant decrease of reporter activity in comparison with those cotransfected with control microRNA and Luc-EZH2 plasmid. [score:1]
showed that cells transfected with miR-98 + Luc-EZH2 (A), miR-101 Luc-EZH2 (B), miR-214 Luc-EZH2 (C) exhibited a significant decrease of reporter activity in comparison with those cotransfected with control microRNA + Luc-EZH2 plasmid. [score:1]
However, the reporter activity were comparable between cells cotransfected with miRNAs (miR-98, miR-101 ormiR-214) and Luc-EZH2-mut plasmid and cells cotransfected with control microRNA and Luc-EZH2-mut plasmid (Figure 4A-C). [score:1]
Mutant EZH2 3 [′]-UTR, which carried a substitution of four nucleotides (AGGU to UCCA for miR-98, UACU to AUGA for miR-101, and CAGC to GUCG for miR-214) within the core binding sites of EZH2 3 [′]-UTR, was obtained using overlapping extension PCR. [score:1]
[1 to 20 of 44 sentences]
17
[+] score: 136
Therefore, up-regulation of miR-101 by cigarette smoke or cadmium could affect lung fluid homeostasis and therefore mucus clearance by suppressing CFTR but also immune responses by preventing dephosphorylation of MAPKs due to inhibition of MKP-1. Future studies need to be done to investigate the effect of smoking cessation on CFTR expression and miRNAs regulating its expression. [score:11]
It is therefore possible that expression and regulation of miRNA-101 is cell-type specific but also depends on the disease state (normal or cancerous). [score:6]
We can speculate that high expression of miR-101 observed in the lung samples could contribute to the sustained activation of Erk1/2 (phosphoErk1/2) observed in COPD patients [22] due to lack of dephosphorylation by MKP-1. Regarding miR-144, this miRNA has been found to be elevated in cancer [23]- [25], and was recently identified to be among the top three miRNAs up-regulated in the lung of COPD patients [7]. [score:6]
Taken together, our results indicate that up-regulation of miR-101 and/or miR144 could contribute to the suppression of CFTR observed in COPD patients. [score:6]
Expression of miR-101 and miR-144 decreases expression of CFTR protein. [score:5]
The expression of three miRNAs predicted to target CFTR (miR-101, miR-144, and miR-145) was determined. [score:5]
Expression of miR-144 and miR-101 Suppresses CFTR Protein in HBE Cells. [score:5]
In order to confirm that miR-101 and miR-144 directly target CFTR, the CFTR 3′UTR was subcloned into the reporter psiCHECK-2 vector. [score:4]
We also determined the role of miR-101 and miR-144 in regulating CFTR expression. [score:4]
Since cadmium is a contaminant of cigarette smoke, it is possible that cadmium present in cigarette smoke was responsible for the up-regulation of miR-101 and miR-144. [score:4]
We further show that miR-101 is up-regulated in the lung of mice subjected to cigarette smoke and in COPD patients. [score:4]
Interestingly, miR-101 was reported to play a role in inflammation by targeting MAPK phosphatase-1 (MKP-1), a dual specific phosphatase that deactivates MAPKs, which functions as a negative regulator of the innate immune system [20], [21]. [score:4]
Cigarette Smoke and Cadmium Induce Up-regulation of miR-101 and miR-144. [score:4]
Interestingly, the cytokine IL-17A was recently identified to up-regulate miR-101 via activation of the Akt pathway in cardiac fibroblasts [21]. [score:4]
Since both cigarette smoke and cadmium activate the Akt pathway [26]- [28], it is possible that up-regulation of miR-101 occurs via a similar pathway in the lung. [score:4]
We focused on miR-101 since this miRNA was the most highly up-regulated by cigarette smoke in vitro. [score:4]
On the other hand, the fact that both miR-101 and miR-144 target the same region suggests that this 3′UTR region is highly regulated by miRNAs. [score:4]
Since miR-101 and miR-144 are predicted to target the CFTR gene, we evaluated the effect of these miRNAs on the expression of CFTR protein. [score:3]
The expression of mature miR-101 and miR-144 was confirmed by quantitative RT-PCR. [score:3]
Effect of the air pollutants cigarette smoke and cadmium on expression of miR-101, miR-144, and miR-145. [score:3]
As indicated in Figure 3, expression of miR-101 reduced the reporter activity by ≈40%. [score:3]
MiR-101 and miR-144 Target CFTR 3′UTR. [score:3]
Mature miR-101 and miR-144 could be detected six hours post-transfection and were still highly expressed 48 hours after transfection (Fig. 2B and data not shown). [score:3]
MiR-101 and miR-144 target the same region of CFTR 3′UTR and share the same seed sequence indicating that these two miRNAs do not act synergistically or additionally. [score:3]
Since we previously showed that miR-101 targets CFTR, we next investigated the expression of the CFTR protein. [score:3]
MiR-101 is Overexpressed in the Lung of Mice Subjected to Cigarette Smoke. [score:2]
Therefore, we investigated whether miR-101 was upregulated in the lung of these COPD patients. [score:2]
MiR-101 targets 3′UTR of CFTR. [score:2]
MiR-101 is Highly Expressed in the Lung of COPD Patients. [score:2]
Gillen et al. recently reported that CFTR can be regulated by several miRNAs including miRNA-144 but did not observe any effect of miR-101 on CFTR [10]. [score:2]
Mutations in the CFTR 3′UTR (CFTR 3′UTR Mut: GU to CA) eliminated the effect of miR-101 and -144 on reporter activity (Figs. 3 and 4). [score:2]
As observed in Figure 6, miR-101 (purple staining) was strongly expressed in bronchial epithelial cells in patients with severe COPD (GOLD 4) when compared to control patients (GOLD 0). [score:2]
Detection of miR-101 in the lung of control (GOLD 0) and GOLD 4 COPD patients. [score:1]
Cells were transfected with 50 ng of psiCHECK containing wild-type (WT) or mutated (Mut) CFTR 3′UTR and 30 nM of pre-miR-101. [score:1]
0050837.g002 Figure 2 HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
HEK-293 cells were transfected with 50 ng of psiCHECK-CFTR or psiCHECK empty vector and either scrambled pre-miR, pre-miR-101, or pre-miR-144. [score:1]
HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
Both pollutants increased miR-101 and miR-144 but had no effect on miR-145. [score:1]
The locked nucleic acid (LNA) modified cDNA probe complementary to human mature miR-101 was used (Exiqon Inc, MA). [score:1]
Total RNA was isolated and expression of mature miR-101, miR-144, and miR-145 was measured by quantitative RT-PCR. [score:1]
Paraffin-embedded, formalin-fixed lung tissues from control (GOLD 0) (A&B) or patients with severe COPD (GOLD 4) (C&D) were incubated with an LNA probe anti-miR-101 (purple staining). [score:1]
0050837.g006 Figure 6 Paraffin-embedded, formalin-fixed lung tissues from control (GOLD 0) (A&B) or patients with severe COPD (GOLD 4) (C&D) were incubated with an LNA probe anti-miR-101 (purple staining). [score:1]
0050837.g003 Figure 3 Cells were transfected with 50 ng of psiCHECK containing wild-type (WT) or mutated (Mut) CFTR 3′UTR and 30 nM of pre-miR-101. [score:1]
MiR-101 (purple staining) was found to be highly expressed in bronchial epithelial cells and in alveolar cells in the lung of mice subjected to cigarette smoke when compared to mice exposed to filtered air (Fig. 5A). [score:1]
Exposure of HBE cells to cigarette smoke resulted in ≈80- and 4-fold increases of miR-101 and miR-144, respectively, while cadmium induced miR-101 and miR-144 by ≈40 and 6 fold (Fig. 1). [score:1]
Detection of miR-101 in the lung of mice subjected to cigarette smoke. [score:1]
[1 to 20 of 46 sentences]
18
[+] score: 131
Other miRNAs from this paper: hsa-mir-101-2
A growing number of studies have implicated that miR-101 may function as a tumor suppressor gene to inhibit the expression of tumor-promoting genes. [score:7]
Notably, studies have shown that miR-101 is evidently downregulated in NSCLC, and it inhibits cell proliferation and invasion. [score:6]
miR-101 is an miRNA, which has been previously demonstrated to regulate a variety of biological processes by modulating the expression of several target genes (22, 23). [score:6]
Overall, the results of the current study show that miR-101 overexpression effectively promotes CDDP -induced apoptosis and inhibits colony formation in the A549 NSCLC cell line. [score:5]
Overexpression of miR-101 inhibits A549 cell colony formation. [score:5]
Previously, it has been found that miR-101 is expressed in several types of cancer, including liver, prostate and breast, and emerging evidence indicates that miRNAs may act as cancer suppressors (15– 17). [score:5]
Emerging evidence suggests that miR-101 induces apoptosis, suppresses tumorigenicity, inhibits migration and invasion, and is crucial in promoting chemosensitivity (15, 17, 24– 26). [score:5]
In order to explore whether miR-101 expression affects the chemosensitivity of lung tumors, the human A549 cell line was used for transfection with the miR-101 overexpression vector. [score:5]
It was also found that miR-101 overexpression led to cell death, caspase 3 -dependent apoptosis to CDDP and inhibited cell colony formation. [score:5]
Batchu et al reported that miR-101 enhances the chemosensitivity of pancreatic ductal adenocarcinoma (PDAC) cells by inhibition of mammalian target of rapamycin (mTOR) signaling via proline-rich Akt substrate 40 (PRAS40) (20). [score:5]
In addition, it has been reported that miR-101 induces apoptosis and suppresses tumorigenicity in vitro and in vivo, and inhibits the migration and invasion of gastric cancer cells (15). [score:5]
Moreover, miR-101 enhances paclitaxel -induced apoptosis in NSCLC cells by directly repressing the enhancer of zeste homolog 2 expression (18, 19). [score:4]
In addition, miR-101 has been demonstrated to be downregulated in several types of human cancer, including lung cancer. [score:4]
The expression levels of miR-101 were confirmed by qPCR, as shown in Fig. 1A. [score:3]
As shown in Fig. 3A and B, miR-101 overexpression increased the number of apoptotic cells following treatment with CDDP. [score:3]
Pre-miR-101 (miR-101) -transfected cells showed a higher miR-101 expression than the untransfected negative control (Con) and empty vector -transfected (miR-Con) groups. [score:3]
Overall, miR-101 overexpression enhanced chemosensitivity to CDDP in the A549 NSCLC cancer cell line via caspase 3 -dependent apoptosis. [score:3]
This observation suggested that the overexpression of miR-101 facilitates the cytotoxic activity of CDDP in A549 cells. [score:3]
These results clearly indicated that the overexpression of miR-101 enhances CDDP -induced cell death in A549 cells. [score:3]
Previously, Batchu et al reported that miR-101 enhances the chemosensitivity of PDAC cells by inhibition of mTOR signaling via PRAS40 (20). [score:3]
These results established that miR-101 transfer in combination with CDDP therapy may be a target to reverse chemotherapeutic resistance. [score:3]
Overexpression of miR-101 correlates with cytotoxic activity of CDDP in A549 cells. [score:3]
Overexpression of miR-101 in A549 cells increases CDDP -induced cell death. [score:3]
Furthermore, miR-101 was shown to significantly promote CDDP -induced apoptosis and suppress the colony formation by activating the caspase 3 -dependent apoptosis pathway. [score:3]
Xu et al reported that miR-101 enhanced apoptosis induced by CDDP in the HepG2 cell line by inhibiting autophagy (21). [score:3]
However, limited knowledge is available concerning whether miR-101 expression affects the chemosensitivity of NSCLC, and the underlying molecular mechanism remains unclear. [score:3]
Overexpression of miR-101 promotes CDDP -induced caspase 3 -dependent apoptosis. [score:3]
As shown in Fig. 4, overexpression of miR-101 in A549 cells caused a significant reduction in the number and diameter of the colonies at day 14 compared with those of the Con and miR-Con groups. [score:2]
The results showed that the viability of A549 cells with miR-101 overexpression was significantly decreased compared with that of the miR-Con or Con groups at the same concentration of CDDP (Fig. 1B). [score:2]
The evidence that high miR-101 levels result in drug sensitivity indicated that miR-101 may regulate the sensitivity of chemotherapeutic drugs in NSCLC. [score:2]
Transfection of A549 cells with plasmids, pre-miR-101 or scrambled pre-miR control (GenePharma, Shanghai, China), was performed using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA, USA). [score:1]
The present study has demonstrated for the first time that miR-101 sensitizes the A549 NSCLC cell line to CDDP. [score:1]
Further investigations with regard to the miR-101 regulation of chemosensitivity are likely to provide insights into the mechanistic details of this regulatory network. [score:1]
miRNA-101 (miR-101) belongs to a family of miRNAs that are involved in a series of cellular activities, such as cell proliferation, invasion and angiogenesis (13, 14). [score:1]
In addition, the role of miR-101 in chemosensitivity has been previously identified. [score:1]
To date, the mechanism by which miR-101 enhances chemosensitivity remains unclear. [score:1]
To explore whether miR-101 expression may alter CDDP -induced apoptosis, apoptosis was measured by TUNEL staining. [score:1]
In the present study, we provide further evidence that miR-101 enhances the chemosensitivity of A549 NSCLC cells to CDDP. [score:1]
In addition, western blot analysis demonstrated that miR-101 was involved in caspase 3 -dependent apoptosis, as shown in Fig. 3C. [score:1]
In order to explore the role of miR-101 in A549 cells, transfection with plasmids, pre-miR-101 or scrambled pre-miR control, was performed. [score:1]
CDDP led to an increased level of cleaved caspase 3 in A549-miR-101 cells, to a greater extent than that in A549 or A549-miR-Con cells. [score:1]
The results of the flow cytometry revealed that the mean rates of cell death were 1.3, 39.6, 41.4 and 93.0% for the Con, CDDP, CDDP plus miR-Con and CDDP plus miR-101 groups, respectively (Fig. 2). [score:1]
In order to explore the manner in which the modulation of miR-101 in the A549 cell line affected CDDP -induced cell death, pre-miR-101 transfected cells and the Con and miR-Con groups were treated with CDDP and analyzed by flow cytometry. [score:1]
The cytotoxic activity, proliferation and apoptosis of CDDP were then examined in A549-miR-101 and A549-mock cells. [score:1]
A549 cells that had been mock -transfected or transfected with pre-miR-101 were seeded respectively into 96-well plates at a density of 5×10 [3] cells/well and allowed to grow overnight. [score:1]
In conclusion, the present study demonstrated for the first time that miR-101 functions as an inducer of chemotherapeutic sensitivity in NSCLC by activating the caspase 3 -dependent apoptosis pathway. [score:1]
[1 to 20 of 46 sentences]
19
[+] score: 130
Given that our previous findings about TAL1-transcriptionally regulated miRNA expression [27] did not recognize miR-101 as a possible transcriptional TAL1 target, the low expression of the miRNA found in primary T-ALL samples and cell lines foresees a tumor-suppressive role for miR-101 in T-cell transformation, which might be in part mediated through down-regulation of TAL1 rather than EZH2. [score:13]
Over -expression of miR-520d, miR-101, miR-140, miR-485 and miR-448 in different T-ALL cell lines resulted in down-regulation of TAL1 transcript (Figure 4A) and/or protein (Figure 4B-4C) expression levels in a range of 20-60%. [score:8]
The tumor suppressive function of miR-101 in inhibiting cell proliferation, migration, invasion and tumor growth, has been demonstrated in prostate [43], bladder [44], gastric [45, 48], and renal cell [49] carcinoma, pancreatic ductal adenocarcinoma [50] and melanoma [52], mainly due to targeting of the histone methyltransferase EZH2. [score:7]
Figure 5 A. Western blot and densitometric and analysis of TAL1 expression in CCRF-CEM cells upon nucleofection with microRNA inhibitors (si101 against hsa-miR-101 or si520d against hsa-miR-520d-5p), a siRNA against TAL1 (siT1) or a non -targeting siRNA control (siNT). [score:7]
A. Western blot and densitometric and analysis of TAL1 expression in CCRF-CEM cells upon nucleofection with microRNA inhibitors (si101 against hsa-miR-101 or si520d against hsa-miR-520d-5p), a siRNA against TAL1 (siT1) or a non -targeting siRNA control (siNT). [score:7]
In our work, we showed that TAL1 is a direct target of miR-101 in T-ALL cell lines, in accordance with studies indicating a possible tumor suppressor role of miR-101 has in hematological malignancies. [score:6]
For miR-101 or miR-520d-5p knockdown, 2μM of miRCURY LNA™ microRNA Inhibitors (Exiqon) and non -targeting control were used. [score:6]
Adult T-cell leukemia/lymphoma patient cells have increased expression of EZH2 that is inversely correlated with the expression of miR-101 [47]. [score:5]
Figure 6 A. Expression of miR-101, miR-520d-5p, miR-140-5p and miR-448 was determined by qRT-PCR and normalized to SNORD38B expression in TAL1 -positive (SUP-T1, CCRF-CEM, TAIL7, PF-382) and TAL1 -negative (HPB-ALL, P12-ICHIKAWA, TALL-1) T-ALL human cell lines. [score:5]
In addition, predicted targets for miR-101 besides TAL1 include MCL1 and RUNX1, being the latest a downstream TAL1 target and part of the TAL1+ gene signature described for T-ALL patients. [score:5]
A. Expression of miR-101, miR-520d-5p, miR-140-5p and miR-448 was determined by qRT-PCR and normalized to SNORD38B expression in TAL1 -positive (SUP-T1, CCRF-CEM, TAIL7, PF-382) and TAL1 -negative (HPB-ALL, P12-ICHIKAWA, TALL-1) T-ALL human cell lines. [score:5]
We verified that inhibition of miR-520d-5p and miR-101 rescued endogenous TAL1 protein expression by 20 to 40% on average (Figure 5A-5B). [score:5]
For instance, miR-101 may be involved in TAL1 inhibition especially within SP thymocytes (where it is most highly expressed). [score:5]
Subsequently, we compared the expression of the miRNAs between TAL1 -positive and -negative T-ALL cell lines and verified that they were (miR-101, 520d-5p) or tended to be (miR-140-5p and miR-448; not reaching statistical significance), more expressed in the TAL1 -negative cell lines. [score:4]
Down-regulation mediated by these miRNAs in the TAL1 transcript was observed for miR-520d, miR-101, miR-140 and miR-448 in PF-382 cells and for miR-520d and miR-140 in SUP-T1 cells (Figure 4A). [score:4]
In the context of hematopoietic malignancies, miR-101 was found down-regulated in samples of Burkitt lymphoma [46] and pediatric B-ALL patients [20, 51]. [score:4]
Mutation of the only binding sequence for miR-101 in TAL1 3′UTR (Figure 2A) fully restored luciferase expression in the presence of the miR-Vec-101 (Figure 3A) demonstrating that the mutated sequence corresponds to the recognizing element of miR-101 in TAL1 3′UTR. [score:4]
Moreover, T-ALL patient samples expressed lower levels of miR-101, miR-140-5p, miR-448 and miR-485-5p as compared to normal bone marrow cells (Figure 6C), which still express TAL1 (data not shown). [score:4]
Whether and how regulation of any of these genes by miR-101 and miR-140-5p is biologically relevant for thymocyte development and leukemogenesis, and may complement effects on TAL1, has not been addressed so far. [score:3]
Interestingly, miR-101 [20, 43- 52], miR-140-5p [53- 56], miR-520-5p [57], and miR-485-5p [58- 60], are all reported as putative tumor suppressors in different cancers. [score:3]
Figure 2Details of binding of A. miR-101; B. miR-520d-5p and D. miR-140-5p to TAL1 3′UTR are depicted according to DianaMicroT [71] target prediction algorithm. [score:3]
Therefore, miR-520d-5p and miR-101 affect TAL1 mostly at the level of translation in T-ALL cells. [score:3]
Inhibition of miR-520d-5p and miR-101 increases endogenous TAL1 protein levels in T-ALL cells. [score:3]
Details of binding of A. miR-101; B. miR-520d-5p and D. miR-140-5p to TAL1 3′UTR are depicted according to DianaMicroT [71] target prediction algorithm. [score:3]
In agreement, we found that miR-101 and miR-140-5p were less expressed in T-ALL patient samples than in more differentiated thymocytes (Figure 6B). [score:3]
For further analysis we selected microRNAs that significantly lowered the luciferase expression in 25-50%: miR-101, miR-520d-5p, miR-140-5p, miR-448 and miR-485-5p (see Figure 2 for miRNA binding details). [score:3]
We listed the microRNA sequences relevant for this study in Supplementary Table 3. Regarding the miRNAs of interest, the only nomenclature difference from the miR-Vec library [33] refers to miR-101, which is currently named miR-101-3p according to miRBase version 21 [65]. [score:1]
Results were normalized to scramble (SCR) miRNA on WT TAL1 3′UTR: A. miR-101, B, C. miR-520d, and D, E. miR-140. [score:1]
[1 to 20 of 28 sentences]
20
[+] score: 123
Luciferase in vitro experiments confirmed that both miR-101 and miR-494 targeted and functionally suppressed CFTR construct mRNA translation with a moderate and strong action, respectively, and this activity was almost lost after mutation of the putative 3' UTR target-sites. [score:10]
Our preliminary in silico analysis found that both miR-101 and miR-494 may target SEC24 3’-UTR and two other genes, TGFB1 and MBL2, which are known to modify the development and/or the severity of lung disease in CF [2], suggesting the existence of a coordinated network of gene expression control by microRNAs. [score:8]
As for Duchenne muscular dystrophy [27], [28], quantification of selected miRNAs might be used as a sensitive biomarker tool of CF severity and functional suppression of CFTR -targeting miRNAs, such as miR-101 and/or miR-494, could prove a strategy to efficiently restore CFTR synthesis in patients carrying mutations leading to insufficient protein expression. [score:8]
In particular, after the in silico identification of a list of putative miRNAs able to target CFTR mRNA, we demonstrated by in vitro analysis that miR-101 and miR-494 were able to markedly suppress CFTR expression either alone and in combination. [score:7]
Furthermore, miR-101 and miR-494 seem to act synergistically on CFTR-reporter inhibition with a more than additive effect on the post-translational control and this could have a physiological relevance in the complex disease phenotypes observed in CF. [score:7]
Therefore, alteration of miR-101 and/or miR-494 levels in CF patients could influence the disease clinical expression with particular implications in CF lung function, such as increased susceptibility to infections, chronic airways inflammation and response to specific therapies. [score:5]
Interestingly, our results are corroborated by expression profiling experiments of different human miRNAs from CF patients airway epithelial samples in which both miR-101 and miR-494 looked up-regulated (Relative Quantification ≥1.5) compared to non-CF individuals confirming an inverse correlation with CFTR levels [13]. [score:5]
The CFTR luciferase vectors with mutated target sites for miR-101 or miR-494 (pCFTR-3′UTR-mut101 and pCFTR-3′UTR-mut494, respectively) were generated using the Quickchange II Site-directed mutagenesis kit (Stratagene, Foster City, CA) and synthetic oligonucleotides (Sigma-Aldrich):mut101-F 5′-CTGACTCTTAAGAAGACTGCATTATATTTATTA GAG ATAGAAAATATCACTTGTC-3′ and mut101-R 5′-GACAAGTGATATTTTCT ATC TCTAATAAATATAATGCAGTCTTCTTAAGAGTCAG-3′; mut494-F 5′-CTCTAGGAAATATTTATTTTAATAA ACTT AC GAACATATATAACAATGCTG-3′ and mut494-R 5′-CAGCATTGTTATATATGTT CG TAA GTTTATTAAAATAAATATTTCCTAGAG-3′. [score:4]
Both miR-101 and miR-494 significantly suppressed luciferase expression compared to control microRNA with a corresponding decrease of about 40% (p<0.01) and 60% (p<0.001) as shown in Figure 2B. [score:4]
The CFTR luciferase vectors with mutated target sites for miR-101 or miR-494 (pCFTR-3′UTR-mut101 and pCFTR-3′UTR-mut494, respectively) were generated using the Quickchange II Site-directed mutagenesis kit (Stratagene, Foster City, CA) and synthetic oligonucleotides (Sigma-Aldrich): mut101-F 5′-CTGACTCTTAAGAAGACTGCATTATATTTATTA GAG ATAGAAAATATCACTTGTC-3′ and mut101-R 5′-GACAAGTGATATTTTCT ATC TCTAATAAATATAATGCAGTCTTCTTAAGAGTCAG-3′; mut494-F 5′-CTCTAGGAAATATTTATTTTAATAA ACTT AC GAACATATATAACAATGCTG-3′ and mut494-R 5′-CAGCATTGTTATATATGTT CG TAA GTTTATTAAAATAAATATTTCCTAGAG-3′. [score:4]
We combined all these information with thermodynamic and on-line available expression data and, finally, we selected miR-101 and miR-494 microRNAs as the more likely regulators of the CFTR mRNA. [score:4]
Notably, when miR-101 and miR-494 were co -overexpressed, a synergistic effect between miRNAs was observed, as highlighted by the strong reduction of the pCFTR-3’UTR reporter activity of approximately 80% (p<0.001). [score:3]
Mir-101 and mir-494 target the CFTR 3’-UTR. [score:3]
Ribonucleotide sequences of the putative miR-101 and miR-494 responsive elements in aligned human, rhesus and mouse CFTR 3’UTRs paired with the mature human miR-sequence (from TargetScan 5.1 database). [score:3]
We identified a few miRNA-3’-UTR possible pairing with similar expression profiles and selected miR-101 and miR-494 for further analysis, since they showed the best possibility of positive interaction. [score:3]
HEK293 were plated at a density of 3×10 [5] per well in 24-well plates and transiently transfected after 4–5 hours with 50 ng of Renilla luciferase expression constructs (pRLTK, pCFTR-3’UTR, pCFTR-3’UTR-mut101 or pCFTR-3′UTR-mut494), 12.5 ng of reference Firefly luciferase reporter (pGL3-SV40, Promega) and miRNA duplexes at 100 nM final concentration (hsa-mir-101 miRIDIAN Mimics MI0000739/MIMAT0000099, hsa-mir-494 miRIDIAN MimicsMI0003134/MIMAT0002816, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. [score:3]
These data suggest that modifications of the specific miRNA binding-sites in the CFTR 3’UTR are able to reduce the inhibitory function of miR-101 and miR-494 (Figure 3B). [score:3]
In particular, the activity of the reporter construct mutated at the specific miR-101 seed (pCFTR-3’UTR-mut101) was unaffected by the concomitant transfection of miR-101 and led to a significant decreased luciferase value only with miR-494 over -expression (p<0.001). [score:3]
Specificity of miR-101 and miR-494 CFTR suppression by recognition of the seed sequence. [score:3]
In particular, miR-101 responsive element is a 7mer-A1 having an exact match to positions 2–7 of the miRNA (the seed) and an immediate downstream 'A' which is across from microRNA nucleotide 1 while miR-494 target site is a 8-mer element that shares an exact complementarity to position 2–8 of the mature microRNA followed by an 'A'. [score:3]
Both miR-101 and miR-494 are conserved in Homo sapiens, Macaca mulatta and Mus musculus and each miRNA sequence has a single putative target site within the CFTR 3’UTR at position 1508–1514 and 1140–1147, respectively (Figure 1A). [score:3]
The most likely candidate miRNAs targeting the CFTR 3’UTR which overlapped in at least three prediction programs resulted miR-101, miR-144, miR-199-3p, miR-345, miR-376b, miR-377, miR-380, miR-494, miR-509-3p, miR-600 and miR-645. [score:3]
0026601.g003 Figure 3Specificity of miR-101 and miR-494 CFTR suppression by recognition of the seed sequence. [score:3]
Thus, miR-101 and miR-494 functionally interact with the CFTR 3’-UTR and suppress the corresponding protein product. [score:3]
To verify whether miR-101 and/or miR-494 were able to target CFTR, HEK293 cells were co -transfected either with a reporter construct containing 741 base pairs of the human CFTR 3’UTR downstream of the Renilla luciferase open reading frame (Figure 2A) or with a control Renilla plasmid together with either a synthetic microRNA mimics (miR-101 or miR-494) or the negative control microRNA (miR-Ctr). [score:3]
Future investigations will be addressed to confirm this hypothesis such as the characterization of the entire CFTR 3’-UTR in a panel of CF subjects carrying the same mutations and different clinical phenotype looking for sequence variants in the miR-responsive elements that could dramatically alter CFTR regulation as well as mutations in the miR-101 and miR-494 genes which could explain their altered expression. [score:2]
The MRE specificity in the CFTR 3’UTR was evaluated by site-directed mutagenesis of the nucleotides at positions 3, 4, 6, 7 of the miR-101 seed sequence (TACTGTA to TA GAG AT) and at position 2, 3, 6, 8 of the miR-494 target site (ATGTTTCA to A ACTT AC G) (Figure 3A). [score:2]
The 3′-UTR region of CFTR (813–1553 bp of 3HSAR032708) containing the predicted target sites of miR-101 and miR-494 was amplified from human genomic DNA using a proof reading Phusion High-Fi delity PCR master mix (Finnzymes, Espoo, Finland) with the following primers CFTR 3′UTR-F 5′-GC TCTAGAAGACCTTTGAACTAGAGTTTAGC-3′ and CFTR 3′UTR-R 5′-GC TCTAGAACACAAATGTATGGATTTTATTG -3′. [score:2]
At the same time, pCFTR-3’UTR-mut494 reporter activity was significantly reduced by miR-101 (p<0.05) while miR-494 transfection was nearly inactive. [score:1]
The miR-101: CFTR mRNA heteroduplex displayed a mfe value of −14.2 kcal/mol whereas miR-494: CFTR hybrid structure showed a −13.5 kcal/mol value (Figure 1B). [score:1]
Numbers indicate the predicted miR-101 and miR-494 seed sequences (in bold) using the numbering of the human CFTR 3’UTR (3HSAR032708 from UTRdb database). [score:1]
We speculate that microRNAs are largely responsible for how badly the illness affects patients since even minimal alterations in miR-101 and/or miR-494 levels could negatively influence the stability of the CFTR transcript which in turn might have an effect on the amount and maturation of CFTR protein and so on the degree of CF severity. [score:1]
Levels of luciferase activity in HEK293 cells co -transfected with increasing doses of miR-101 or miR-494 together with the CFTR wild-type 3’-UTR vector. [score:1]
Data are presented as the normalized activity of miR -transfected cells (miR-101 or miR-494) relative to cells transfected with miR-Ctr. [score:1]
A fragment of 741 bp of the CFTR 3’-UTR, encompassing the putative responsive elements for miR-101 and miR-494, was cloned in pRLTK vector downstream to the Renilla luciferase coding sequence. [score:1]
As far as mir-101 concerns, recent evidences underline its role in the biosynthesis of pro-inflammatory cytokines [23] and its function in central nervous system [24] providing a possible explanation for both lung excessive inflammation and neural symptoms observed in CF patients [25]. [score:1]
No repression was observed with pCFTR-3’UTR constructs in which the putative miRNA -binding sites for miR-101 or miR-494 were altered (Figure 3B). [score:1]
[1 to 20 of 37 sentences]
21
[+] score: 104
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-101-2
Knockdown of EZH2 improved miR-101 transcription, and overexpression of EZH2 suppressed GA-stimulated upregulation of miR-101. [score:9]
Knockdown of EZH2 improved miR-101 transcriptional activity and overexpression of EZH2 suppressed GA-stimulated upregulation of miR-101. [score:9]
Total RNA was extracted from the tumor tissues and RT-qPCR illustrated that GA decreased EZH2 mRNA expression and increased miR-101 expression, but these effects were significantly suppressed by knockdown of GAS5 (Fig.   6c). [score:8]
miR-101 has been regarded as tumor-suppressive miRNA, and it could directly target 3’-UTR of EZH2 mRNA and inhibit proliferation, migration, and angiogenesis of tumor cells [42]. [score:8]
We blocked EZH2 expression in T24 and EJ cells by stable transfection of EZH2 shRNA (Fig.   5a), subsequently RT-qPCR indicated that miR-101 expression was upregulated (Fig.   5b). [score:8]
The results suggested that downregulation of EZH2 enhanced miR-101 expression by improving miR-101 transcriptional activity. [score:6]
Furthermore, Gambogic acid (GA), a promising natural anticancer compound, could induce bladder cancer cell apoptosis though regulating the expression of both GAS5 and miR-101 Overexpression of GAS5 effectively increases the binding of E2F4 to EZH2 mRNA promoter, resulting in repression of EZH2 transcription that promotes tumor cell apoptosis. [score:6]
Forty eight hours later, RT-qPCR revealed that GA upregulated miR-101 expression. [score:6]
These results suggested that overexpression of EZH2 restored GA -induced upregulation of miR-101. [score:6]
Furthermore, Gambogic acid (GA), a promising natural anticancer compound, could induce bladder cancer cell apoptosis though regulating the expression of both GAS5 and miR-101 GA and DMSO were purchased from Sigma (St Louis, MO, USA). [score:4]
Thus, upregulation of GAS5 results in a positive feedback loop between EZH2 and miR-101. [score:4]
But a recent study discovered that EZH2 suppressed miR-101 transcription reversely in hepatocellular carcinoma [25]. [score:3]
Interestingly, previous study has also showed EZH2 inhibited miR-101 transcription in hepatocellular carcinoma [43]. [score:3]
c Then, total RNA was extracted from the tumor tissues, and expressions of GAS5, EZH2 mRNA and miR-101 were detected by RT-qPCR (c). [score:3]
Friedman JM The putative tumor suppressor microRNA-101 modulates the cancer epigenome by repressing the polycomb group protein EZH2Cancer Res. [score:3]
Forty eight hour later, miR-101 expression levels were assessed (e), and 40 h later, miR-101 transcriptional activities were detected (f). [score:3]
It indicated that transcriptional activity of miR-101 was significantly increased by knockdown of EZH2 (Fig.   5c). [score:2]
Kottakis F FGF-2 Regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathwayMol. [score:2]
In our present study, we found that EZH2 negatively regulated miR-101 transcription in BC. [score:2]
a– c EZH2 shRNA was stably transfected into BC cells, RT-qPCR was performed to assess EZH2 mRNA (a) and miR-101 (b) expression, luciferase reporter assay was performed to detect miR-101 transcriptional activity (c). [score:2]
Fig. 5 a– c EZH2 shRNA was stably transfected into BC cells, RT-qPCR was performed to assess EZH2 mRNA (a) and miR-101 (b) expression, luciferase reporter assay was performed to detect miR-101 transcriptional activity (c). [score:2]
Meanwhile, this study shows that EZH2 negatively regulated miR-101 transcription in BC, and as we known, miR-101 is a repressor of EZH2. [score:2]
Our prior recent work had revealed the regulation of EZH2 at the posttranscriptional level by miR-101 [14]. [score:2]
Our findings add to the accumulating evidence that suggests there is a positive feedback loop between EZH2 and miR-101. [score:1]
[1 to 20 of 24 sentences]
22
[+] score: 99
The expression of the same genes up-regulated in SH-SY5Y control cells after the inhibition of miR-101, decreased in LMNA-KD cells after the overexpression of miR-101. [score:10]
Consistently, after inhibiting miR-101, SH-SY5Y control cells showed down-regulation of the tumor suppressor EDN1 and CD44 genes, and increased expression of the tumor progression ENPP2 gene with respect to LMNA-KD cells transfected with the miR-101 mimic (Fig. 7C). [score:10]
We also verified the effect of the N-Myc transcription factor on the LMNA gene expression by analyzing the expression of LMNA gene in SH-SY5Y in which we overexpressed MYCN either by inhibiting miR-101 or by ectopically transducing a MYCN construct. [score:9]
Consistent with the changes observed in the two cell lines we found an increased expression of miR-101, miR-34a, miR-424, miR-21, and a decreased expression of miR-504 and miR-92a in the NB patient group with high LMNA expression compared with the specimen group with low LMNA expression (Fig. 3B). [score:8]
Since miR-101 is a specific miRNA known to target also MYCN gene [19, 22], we inhibited miR-101 in SH-SY5Y control cells to modulate MYCN expression. [score:7]
Among the most differentially expressed miRNAs between SH-SY5Y and LAN-5 cell lines, we chose miR-101, miR-34a, miR-424, miR-21, miR-504 and miR-92a which clearly represent the phenotypic differences between the two cell lines as concerns tumorigenicity and NB tumor progression, regulation of cell cycle, differentiation and targeting of MYCN. [score:6]
Transfection of SH-SY5Y control cells with the miR-101 inhibitor decreased the expression levels of miR-101 by approximately 50% (Fig. 7B, left panel). [score:5]
MYCN expression is increased by miR-101 inhibitor in SH-SY5Y NB cells. [score:5]
As control, we overexpressed miR-101 in LMNA-KD cells in order to verify the effect on MYCN gene expression. [score:5]
As expected, the analysis of the intrinsic expression of miR-101 in both cell lines, revealed miR-101 less expressed in LMNA-KD cells by 50% compared to SH-SY5Y control cells (Fig. 7A). [score:4]
In addition, only miR-101 expression was decreased in LMNA-KD compared to control cells; while the expression of miR-34a did not change (data not shown). [score:4]
C. qRT-PCR analysis of the indicated genes in hsa-miR-101 mimic -transfected LMNA-KD cells (black) and hsa-miR-101 inhibitor -transfected CTR cells (white). [score:3]
Hsa-miR-101 inhibitor and mimic. [score:3]
We evidenced hsa-miR-101–3p and hsa-miR-34a-5p as specific miRNAs targeting MYCN gene [19]. [score:3]
We transfected the has-miR-101 inhibitor (MH11414, Ambion) and the mimic (MC11414, Ambion) at a final concentration of approximately 50 nM. [score:3]
Modulation of hsa-miR-101 modifies the expression of MYCN gene and in turn of stemness and cancer-related genes. [score:3]
Transfection of LMNA-KD cells with the miR-101 mimic resulted in approximately 90-fold increased expression of miR-101 (Fig. 7B, right panel). [score:3]
The analysis of the MYCN transcripts resulted significantly increased or decreased after transduction of miR-101 inhibitor or mimic, respectively (Fig. 7C). [score:3]
The choice to modulate MYCN by miR-101 mediated regulation is based on the analysis of the miRNA array performed in SH-SY5Y and LAN-5 cells (see supplementary table 1). [score:2]
B. TaqMan MicroRNA Assay, with the hsa-miR-101 levels in CTR cells transfected with the inhibitor (white, left panel) or in LMNA-KD cells transfected with the mimic (black, right panel). [score:2]
On the other hand, certain miRNAs, such as miR-101, influence MYCN transcription [19]. [score:1]
[1 to 20 of 21 sentences]
23
[+] score: 97
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
In accordance with the latter findings, we found that Mcl-1, EZH2, and STMN1 genes were significantly down-regulated following miR-101 overexpression in c-Myc [39] and AKT/Ras [21] mouse HCC cell lines (Supplementary Figure 9), suggesting that these genes are miR-101 targets in mouse liver tumors. [score:8]
Of note, preliminary results from our group indicate that co -expression of miR-101 and a Mcl-1 form lacking the 3′ untranslated region (thus impeding the binding of Mcl-1 to miR-101) via hydrodynamic transfection leads to the impairment of miR-101 tumor suppressor activity in AKT/Ras and c-Myc mice. [score:7]
Overexpression of miR-101 efficiently inhibits c-Myc and AKT/Ras induced liver tumor development. [score:6]
For instance, transgenic mice overexpressing viral genes, such as HBX [34] or HCV Core [35] transgenic mice, might be used to test whether miR-101 inhibits hepatitis virus -driven HCC development. [score:6]
These data, together with the downregulation of Mcl-1 in c-Myc and AKT/Ras cell lines, suggest that Mcl-1 may be a crucial target of miR-101 in AKT/Ras and c-Myc hepatocarcinogenesis. [score:6]
Different from all the other tumor suppressor miRNAs tested, overexpression of miR-101 completely prevented both c-Myc and AKT/Ras driven liver tumor formation in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
Consistent with our observation, overexpression of miR-101 is able to inhibit the growth of human HCC cell lines with different genetic background, including HepG2 [36], QGY-7703 [36], BEL-7402 [37], Hep3B [40], and Huh7 [40] cells. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
Overexpression of miR-101 completely suppresses liver tumor formation induced by c-Myc and AKT/Ras oncogenes. [score:5]
miR-101 has been shown to be downregulated in multiple tumor types, including HCC [36]. [score:4]
miR-101 targets many genes associated with tumorigenesis, such as Mcl-1 [36], EZH2 [37] and STMN1 [38]. [score:3]
Previous studies showed that Mcl-1, an antiapoptotic member of the Bcl-2 family, is a bona fide target of miR-101 in HCC [36]. [score:3]
Overexpression of miR-101 in the liver might represent a novel and efficient strategy for HCC prevention and treatment. [score:3]
Importantly, we found that miR-101 strongly inhibited both c-Myc and AKT/Ras induced hepatocarcinogenesis. [score:3]
Similarly, none of the AKT/Ras/miR-101 injected mice showed any sign of tumor development at the same time point (Figure 5C and 5D). [score:2]
Nonetheless, additional investigations are needed to identify crucial miR-101 targets in liver tumor development. [score:2]
In accordance with the latter hypothesis, in the present study we showed that miR-101 effectively prevents liver tumor development initiated by c-Myc and AKT/Ras oncogenes, providing strong evidence that miR-101 may be an ideal candidate for miRNA -based chemoprevention of HCC. [score:2]
Upon dissection, no liver tumor nodules were identified, and livers of c-Myc/miR-101 injected mice appeared to be completely normal histologically (Figure 5A). [score:1]
Among the 8 miRNAs, 4 miRNA (miR-101, miR-29, miR-107 and miR-122) had available human miRNA array data. [score:1]
Thus, additional investigations in other murine liver cancer mo dels are necessary to further establish the tumor suppressor role of miR-101 in HCC [33]. [score:1]
In summary, the present data indicate that miR-101 possesses a broad anti-tumor activity against mouse liver tumors induced by different oncogenes. [score:1]
Indeed, AKT/Ras/miR-101/Mcl1 and c-Myc/miR-101/Mcl-1 injected mice developed large tumors within 6 weeks post injection, whereas AKT/Ras/miR-101/pT3 and c-Myc/miR-101/PT3 mice were completely healthy at the same time point (Supplementary Figure 10A and 10B). [score:1]
Specifically, all c-Myc/miR-101 injected mice appear to be healthy 8 weeks post injection (Figure 5A and 5B). [score:1]
Furthermore, mo dels of chemically -induced HCC, such as the diethylnitrosamine (DENA) mo del, might be helpful to evaluate the tumor suppressor activity of miR-101 in the context of liver injury and inflammation. [score:1]
Figure 5 (A) Macroscopic (upper panel) and microscopic (lower panel) appearance of livers from c-Myc/pT3 mice and c-Myc/miR-101 mice stained with H&E (100X), insets (400 X). [score:1]
Livers from AKT/Ras/miR-101 injected mice were slightly pale, and clusters of lipid-rich preneoplastic hepatocytes were detected at the microscopic level (Figure 5A). [score:1]
[1 to 20 of 28 sentences]
24
[+] score: 80
Other miRNAs from this paper: mmu-mir-101a, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
Introduction of miR-101 in RCC cells downregulated DNA-PKcs expression, and inhibited AKT activation, HIF-2α expression and cell proliferation. [score:10]
Reversely, over -expression of antagomiR-101 downregulated miR-101, and further enhanced DNA-PKcs expression and RCC cell proliferation. [score:8]
Importantly, in 786-0 cells, AKT Ser-473 phosphorylation (Fig. 6E), HIF-2α expression (Fig. 6E) as well as cell proliferation (Fig. 6F,G) were significantly inhibited by miR-101 over -expression, but were further potentiated with introduction of antagomiR-101 (Fig. 6E–G). [score:7]
These results indicate that miR-101 downregulation might be at least one key reason for DNA-PKcs overexpression in RCC cells. [score:6]
These results suggest that miR-101 downregulation could be the key reason of DNA-PKcs overexpression and DNA-PKcs mediated oncogenic behaviors in RCC cells. [score:6]
miR-101 downregulation correlates with DNA-PKcs overexpression in RCC. [score:6]
To study whether low level of miR-101 is responsible of DNA-PKcs overexpression in RCC cells, we exogenously expressed miR-101 into 786-0 cells 32. assay results confirmed miR-101 over -expression in stable 786-0 cells with the miR-101 construct 32 (Fig. 6C). [score:6]
On the other hand, introduction of antagomiR-101 32 expectably downregulated miR-101 in 786-0 cells (Fig. 6C), leading to even higher DNA-PKcs expression (Fig. 6D,E). [score:6]
Stable 786-0 cells expressing miR-101, antagomiR-101, miRNA control (“miR-C”) or vector control (pSuper-puro, “Vector”) were subjected to real-time PCR assay, relative miR-101 expression and DNA-PKcs mRNA expression was shown (C,D). [score:6]
miRNA-101 (miR-101) expression pSuper-puro-GFP vector and antagomiR-101 expression vector as well as miR-control (“miR-C”) and pSuper-puro-GFP vector were gifts from Dr. [score:5]
In the current study, we showed that miR-101 level was significantly lower in human RCC tissues, and in established or primary RCC cells, which might be a reason for DNA-PKcs over -expression. [score:3]
A recent study by Yan et al. showed that miR-101 targeted 3′UTR of DNA-PKcs mRNA, leading to DNA-PKcs mRNA degradation 19. [score:3]
Relative miRNA-101 (miR-101) expression in human RCC tissues (“Tumor”) and surrounding normal renal tissues (“Normal”) as well as in established (A498 and 786-0)/primary human RCC cells or in HK-2 cells was shown (A,B). [score:3]
DNA-PKcs is shown to be negatively regulated by miRNA-101 19. [score:2]
Note that AKT Thr-308 phosphorylation was again not affected by miR-101 nor antagomiR-101 (Fig. 6E). [score:1]
We thus analyzed level of miR-101 in human RCC tissues and RCC cells. [score:1]
Cells were always tested for miR-101. [score:1]
[1 to 20 of 17 sentences]
25
[+] score: 72
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, hsa-mir-101-2
In prostate cancer cell lines it was demonstrated that miR-101 inhibits COX-2 by translational repression via binding to the 3′ untranslated region (UTR) of COX-2 mRNA [25]. [score:7]
In this study we analyzed the expression of COX-2, miR-101 and miR-16 -both with COX-2 inhibiting effects- and miR-21 -with pro-angiogenic and pro-inflammatory effects- in relation to expression of various angiogenic factors in human HCC in cirrhotic and noncirrhotic liver. [score:7]
In contrast, miR-101 is considered a tumor suppressor gene and its expression was inversely correlated with COX-2 expression in colon cancer and gastric cancer [18], [19]. [score:6]
The aims of the study are (1) to analyze expression of Cox-2 mRNA, Cox-2 protein, miR-16, miR-21 and miR-101 in HCC and adjacent liver parenchyma in cirrhotic and noncirrhotic liver, (2) to investigate the relation between COX-2 expression, miR-21 expression and angiogenic factors in these tissues and (3) to investigate the association between miR-16 and miR-101 and COX-2 expression. [score:5]
The study aimed at analysing (1) the correlation between COX-2 expression and angiogenic factors, (2) the correlation between COX-2 expression and miR-101/miR-16 and (3) the correlation between angiogenic factors and miR-21 in cirrhotic and non-cirrhotic HCC, both in tumor tissue and adjacent liver parenchyma. [score:5]
In a series of 30 patients with gastric cancer more advanced tumor stages were associated with lower miR-101 expression which was inversely related to COX-2 mRNA expression [19]. [score:5]
All these data provide support for a possible role of miR-101 as a negative regulator of COX-2 protein expression and therefore we analyzed this interaction also in the HCC tumor tissue. [score:4]
MiR-101 expression in HCC and liver parenchyma and correlation with Cox-2 expression. [score:4]
MiR-101 expression did not correlate with COX-2 expression neither at the mRNA level nor at the protein level. [score:4]
The lack of correlation between miR-16, miR-101 and COX-2 expression is in contrast to findings in other tumor types like gastric and colon cancer. [score:3]
miR-16, miR-21 and miR-101 gene expression levels were quantified in HCC tumor tissue. [score:3]
Plots representing relative expression of COX-2 mRNA (A), COX-2 protein (B), miR-16 (C), miR-21 (D) and miR-101 (E) in in normal liver, HCC tumor tissue (T) and tumor-adjacent parenchyma (Ad) in noncirrhotic and in cirrhotic liver. [score:3]
In colon cancer cell lines a discrepancy was encountered between COX-2 protein levels and COX-2 mRNA expression; of six miRNAs examined only miR-101 demonstrated an inverse relation with the COX-2 protein/mRNA ratio in these cell lines [18]. [score:3]
Relative expression levels of miR-101 were lower in adjacent liver parenchyma in cirrhotic liver as compared to adjacent parenchyma in non-cirrhotic liver (Figure 1E). [score:2]
Expression levels of miR-16, miR-21 and miR-101 were determined by qRT-PCR using RNU49 as housekeeping gene with miRNA qRT-PCR assays (Applied Biosystems, Foster City, USA) as described previously [22]. [score:2]
MiR-101 expression was lower in cirrhotic versus noncirrhotic adjacent liver parenchyma. [score:2]
Expression of COX-2 mRNA, COX-2 protein, miR-16, miR-21 and miR-101 were compared using a two-tailed Mann-Whitney-U test (non-related samples) in cirrhotic versus noncirrhotic liver of HCC and adjacent parenchyma separately. [score:2]
The inverse correlation between miR-101 and COX-2 protein –as found in colorectal cancer by others- was not found in our HCC tumor samples. [score:1]
However, we could not corroborate these findings since our data showed no inverse correlation between COX-2 and miR-101 in HCC. [score:1]
Especially miR-21, miR-101 and miR-16 seem to be relevant for the present study. [score:1]
MiR-16 and miR-101 levels do not correlate with COX-2 mRNA and protein levels. [score:1]
We found that neither miR-101 nor miR-16 had a correlation with COX-2 mRNA or COX-2 protein. [score:1]
[1 to 20 of 22 sentences]
26
[+] score: 60
a Over -expression of miR-31 restores chemo-response by reducing stathmin expression; miR-101/stathmin pathway contributes to radioresistance in human NPC; down-regulation of miR-193b promotes migration and proliferation of tumor cells by targets stathmin; miR-223 regulates stathmin by JNK signaling pathway to regulate MPM cell motility; b up-regulation of miR193b reduces proliferation and migration by inhibiting stathmin and uPA; silencing of miR-210 promotes proliferation of cancerous cells; transfection of miR-142 and miR-223 decreases expression of stathmin and IGF-1R to inhibit proliferation of cancerous cells; c microrna-9 inhibits cell proliferation, vasculogenic mimicry and tumor growth through controlling stathmin expression; miR-101 suppresses autophagy via targets stathmin and down-regulation of miR-101 is linked to the increase of cellular proliferation and invasiveness. [score:32]
Moreover, down-regulation of miR-101 results in the acceleration of cell proliferation and aggressiveness via targeting stathmin, indicating that stathmin is a functional target of miR-101 [77] (Fig.   5c). [score:8]
Interestingly, miR-101 expression inhibits the autophagy of hepatocellular carcinoma HepG2 cells by modulating the activity of stathmin, and enhances apoptosis of hepatocellular carcinoma cells by inhibition of autophagy [76]. [score:7]
Adenovirus -mediated gene transfer of anti-stathmin ribozyme inhibits cell proliferation and clonogenicity in both ER -positive and ER -negative breast cancer cells [48] and knockdown of stathmin can attenuate the miR-101 -mediated enhancement of cell growth and metastasis [77]. [score:4]
Stathmin is identified as an effective functional target of miR-101, which is related to cell proliferation, radioresistance of nasopharyngeal carcinoma (NPC) cells. [score:3]
The miR-101 exert a critical action in radioresistance by modulating the expression of stathmin via miR-101/stathmin pathway [70]. [score:3]
Another study shows that the expression of miR-101 is negatively correlated with the aggressiveness, growth and angiogenesis in malignant epithelial cancers. [score:3]
[1 to 20 of 7 sentences]
27
[+] score: 58
Other miRNAs from this paper: mmu-mir-101a, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
When we exogenously overexpressed miR-101 in HepG2 cells (Figure 6E), DNA-PKcs mRNA (Figure 6F) and protein (Figure 6G) expressions were correspondingly downregulated. [score:8]
DNA-PKcs upregulation and miRNA-101 downregulation in human HCC cells and tissues. [score:7]
DNA-PKcs upregulation in human HCC cells and tissues, correlated with miRNA-101 downregulation. [score:7]
These results demonstrate DNA-PKcs overexpression in human HCC tissues, which is correlated with miRNA-101 downregulation. [score:6]
Figure 6DNA-PKcs (Protein and mRNA) and miRNA-101 (“miR-101”) expressions in surgery-isolated fresh human HCC tumor tissues (“Tumor tissues”) and surrounding normal liver tissues (“Liver tissues”) were shown A, C. and D. Protein expression of DNA-PKcs (vs. [score:5]
DNA-PKcs (Protein and mRNA) and miRNA-101 (“miR-101”) expressions in surgery-isolated fresh human HCC tumor tissues (“Tumor tissues”) and surrounding normal liver tissues (“Liver tissues”) were shown A, C. and D. Protein expression of DNA-PKcs (vs. [score:5]
Results in Figure 6D demonstrated clearly that miR-101 level in HCC tissues was significantly lower than that in surrounding normal liver tissues, which might be responsible for DNA-PKcs mRNA/protein upregulation in HCCs (Figure 6A and 6C). [score:4]
Meanwhile, results in Supplementary Figure S3B and S3C demonstrated low miR-101 expression yet high DNA-PKcs mRNA expression in established or primary HCC cells, as compared to the non-cancerous HL-7702 cells. [score:4]
These miR-101 -expressing HepG2 also showed spontaneous cell apoptosis (Figure 6J). [score:3]
Puromycin (5.0 μg/mL, Sigma) was then added to establish stable cells (10-14 days), which were always checked for miR-101 and DNA-PKcs expressions. [score:3]
miRNA-101 (miR-101) expression pSuper-puro construct was described in our previous study [24]. [score:3]
Existing evidences have shown that miR-101 could direct bind to and sequester DNA-PKcs mRNA [36]. [score:2]
Tubulin) was quantified B. Stable HepG2 cells transfected with miR-101 construct, nonsense miRNA-control construct (“miR-C”), or the empty vector (pSuper-puro, “Vector”), were subjected to real-time PCR assay E-F. or Western blotting assay G. to test DNA-PKcs and miRNA-101 expressions. [score:1]
[1 to 20 of 13 sentences]
28
[+] score: 56
These findings provided strong evidence that miR-101 can down-regulate EZH2 expression by directly targeting the 3′-UTR of EZH2 mRNA. [score:9]
Initially, we examined the expression of miR-101, miR-124, miR-26a, let-7 by qPCR between PCSCs and non-PCSCs, and found that miR-101 expression was significantly down-regulated in PCSCs (Figure 4A). [score:8]
Down-regulation of miR-101, miR-124, miR-26a, let-7 have been reported in leading to EZH2 over -expression in various kinds of cancer [17– 26]. [score:6]
In summary, EZH2 is essential for PCSCs growth, partly through regulating cyclin E2, and EZH2 expression is regulated by miR-101. [score:5]
We examined the expression of miR-101, miR-124, miR-26a, let-7 between PCSCs and non-PCSCs, and found that miR-101 expression was inversely correlated with EZH2’s mRNA level. [score:5]
EZH2 Was a Direct Target of miR-101 in Prostate Cancer Stem Cells. [score:4]
These findings indicated that miR-101 bound to 3′-UTR of EZH2 and repressed EZH2 expression. [score:3]
By comparison to the negative control, miR-101 mimic significantly suppressed the luciferase activity of the reporter plasmid (Figure 4C). [score:3]
As shown, miR101 mimic reduced the EZH2 expression (Figure 4B). [score:3]
Furthermore, we found that activity of the luciferase reporter with EZH2 3′-UTR was significantly inhibited in PCSCs transfected with miR-101 mimic compared with those transfected with negative and blank controls. [score:2]
To validate whether EZH2 was regulated by miR-101 in PCSCs, we transfected miR-101 mimic into PCSCs. [score:2]
The specific miR-101 sequence was as follows: UACAGUACUGUGAUAACUGAA. [score:1]
PCSCs were transfected with psi-CHECK2 plasmid by Lipofectamine 2000 and then cotransfected with miR-101 mimic or a negative control. [score:1]
Next, we transfected miR-101 mimic or the negative control into PCSCs along with the psi-CHECK2. [score:1]
Considering the role of EZH2 in PCSCs and the relationship between EZH2 and miR-101, introduction of miR-101 to silence EZH2 could be a potential therapeutic strategy for prostate cancer. [score:1]
And PCSCs transfected with miR-101 mimic showed a dramatic decrease in EZH2 protein level. [score:1]
As previously confirmed, miR-101, miR-124, miR-26a, let-7 can interact with EZH2 in many types of cancer, including glioblastoma, prostate, gastric, breast and bladder cancer [17– 26]. [score:1]
[1 to 20 of 17 sentences]
29
[+] score: 49
Of note, the trend in expression of individual miRNAs within the miRNA hub, such as up-regulation of the miR-34a-5p, -148a-3p, and -183-5p hub and down-regulation of the miR-101-3p, -125b-5p, and -223-3p hub, is similar, supporting that their co-presence or co-absence may have synergistic effects. [score:9]
Overexpression of miR-101-3p, -125b-5p, or -223-3p individually blocked the formation of PCs, and this inhibitory effect was synergized when they were over-expressed together. [score:7]
Together, these data show that the hub of miR-101-3p, -125b-5p, and -223-3p suppressed PC differentiation largely by inhibiting PRDM1. [score:5]
We next examined the cooperative effects of the down-regulated miRNAs, including miR-101-3p, -125b-5p, and -223-3p, on human PC differentiation. [score:4]
miR-101-3p, -125b-5p, and -223-3p Coordinately Regulate Human PC Differentiation by Targeting PRDM1. [score:4]
In the 3′UTR of PRDM1, one miR-125b-5p site in the first half of the 3′UTR and one miR-101-3p site and three miR-223-3p sites in the second half of the 3′UTR were predicted by TargetScan (Fig. 7A). [score:3]
Furthermore, NF-κB signaling induces Prdm1 39, which in turn switches off the expression of miR-101-3p, -125b-5p, and -223-3p. [score:3]
Cooperative Effect of miR-101-3p, -125b-5p, and -223-3p on Inhibiting PC Formation. [score:3]
Simultaneous introduction of miR-101-3p, -125b-5p, and -223-3p exacerbated the inhibitory effects of each miRNAs (Fig. 7D,E). [score:3]
We then examined if miR-101-3p, -125b-5p, and -223-3p phenotypically influenced human PC differentiation by co -regulating PRDM1. [score:2]
Disruption of the miR-101-3p site and the second and third, but not the first, miR-223-3p binding sites de-repressed the luciferase activity (Fig. 7A). [score:1]
Likewise, induction of PRDM1 in a previously established WI-L2 stable line also led to the binding of PRDM1 to miR-101- 3p, -222- 3p, and -223- 3p (Fig. 4C, Fig. S3C). [score:1]
Additionally, according to known PRDM1 consensus binding sequences 23, several PRDM1 binding sites were predicted in the human miR-101- 3p, -125b- 5p, -222- 3p, and -223- 3p loci (Fig. S3A). [score:1]
Isolated human blood B cells stimulated with IL-21 + anti-CD40 were transduced with either control lentiviral vector or lentiviral vectors producing miR-101-3p, -125b-5p, and/or -223-3p. [score:1]
To further elucidate if repression of PRDM1 by a mixture of miRNAs attributes to the reduced PC differentiation, we co-transduced another lentiviral vector that encodes GFP alone (Ctrl) or GFP-PRDM1 with or without the vectors producing miR-101-3p, -125b-5p, and -223-3p in stimulated human blood B cells. [score:1]
miR-101-3p, which is not conserved across species, was not reduced (Fig. 4B). [score:1]
[1 to 20 of 16 sentences]
30
[+] score: 48
It was recently demonstrated that EZH2 is frequently upregulated in primary HCCs, and miRNA expression profiling in HCC cells with EZH2-knockdown revealed that a set of miRNAs, including miR-139-5p, miR-125b, let-7c, miR-101, and miR-200b, are epigenetically suppressed by EZH2 in HCC (Au et al., 2012). [score:9]
Reduced expression of miR-101 and upregulation of EZH2 occur in parallel during the progression of prostate cancer, and genomic loss of miR-101 is more frequently seen in metastatic disease than localized cancers. [score:8]
MicroRNA-101 exerts tumor-suppressive functions in non-small cell lung cancer through directly targeting enhancer of zeste homolog 2. J. Thorac. [score:5]
Varambally et al. (2008) reported that EZH2 is a target of miR-101, and genomic loss of miR-101 is an important cause of EZH2 overexpression in cancer. [score:5]
The enhancer of zeste homolog 2 (EZH2), a potential therapeutic target, is regulated by miR-101 in renal cancer cells. [score:4]
Enhancer of Zeste homolog 2 (EZH2) is overexpressed in recurrent nasopharyngeal carcinoma and is regulated by miR-26a, miR-101, and miR-98. [score:4]
Moreover, the loss of miR-101 and resultant overexpression of EZH2 appears to alter the global chromatin structure in cancer (Friedman et al., 2009). [score:3]
The putative tumor suppressor microRNA-101 modulates the cancer epigenome by repressing the polycomb group protein EZH2. [score:3]
MicroRNA-101 is down-regulated in gastric cancer and involved in cell migration and invasion. [score:3]
Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. [score:3]
The inverse association between miR-101 and EZH2 has now been seen in bladder, gastric, lung, and renal cancer (Friedman et al., 2009; Wang et al., 2010; Zhang et al., 2011a; Sakurai et al., 2012). [score:1]
[1 to 20 of 11 sentences]
31
[+] score: 43
Other miRNAs from this paper: mmu-mir-101a, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
ICOS and miR101 expression are similarly expressed in reactive and AITL T [FH] Physiologically, in mice, Roquin limits ICOS expression by promoting the degradation of ICOS mRNA in a dose -dependent manner [24], [25]. [score:7]
0064536.g004 Figure 4Expression of ICOS and miR101 expression in human reactive and neoplastic T [FH] cells. [score:5]
ICOS and miR101 expression are similarly expressed in reactive and AITL T [FH]. [score:5]
Level of miR101 was low and similar in both neoplastic and reactive T [FH] cells (Figure 4B), in accordance with recent finding in mouse showing that BCL6 could repress inhibitors of specific T [FH] expressing gene including miR101 [28]. [score:5]
Expression of ICOS and miR101 expression in human reactive and neoplastic T [FH] cells. [score:5]
Altogether, by comparing reactive and AITL T [FH] cells, we have shown here that neither alteration of ROQUIN gene nor deregulation of miR101 expression is likely to be a frequent recurrent abnormality in AITL. [score:4]
We therefore looked for miR101 expression in our T [FH] cells. [score:3]
It has been suggested that Roquin repressive effect on ICOS transcripts requires miR101 expression [25]. [score:3]
The level of ICOS mRNA expression is maintained even in the presence of ROQUIN transcripts both in human reactive and tumor T [FH] cells (A) Level of miR101 (has-miR-101) is low and similar in both tumor and reactive T [FH] cells (p = 0,8 unpaired t-test, NS) (B). [score:3]
Analyses of gene expression profiles focused on probesets matching to ROQUIN (228996_at), ICOS (210439_at), and on miR101 (has-miR-101). [score:3]
[1 to 20 of 10 sentences]
32
[+] score: 42
The top five differentially upregulated miRNAs in HCC (Table  5) were: miR-142 (1 million-fold), miR-7704 (257-fold), miR-101 (147-fold), miR-23a (124-fold), and miR-22 (85-fold); whereas, the top five downregulated were: miR-122 (513-fold), Let-7g (358-fold), miR-378c (187-fold), miR-185 (68-fold), and miR-451a (58-fold). [score:7]
miR-101, miR-22, and circR-0015774 were the top upregulated sncRNAs, whereas miR-122, piR-952, and circR-0035409 were the most frequently downregulated. [score:7]
The top five differentially upregulated miRNAs in LGDN (Table  2) were: miR-141 (625-fold), miR-101 (208-fold), miR-22 (111-fold), miR-16 (61-fold), and miR-486 (35-fold); whereas, the top five downregulated were: miR-451a (513-fold), miR-378c (104-fold), miR-361 (95-fold), miR-122 (81-fold), and miR-30c (78-fold). [score:7]
The top five differentially upregulated miRNAs in eHCC (Table  4) were: miR-101 (215-fold), miR-22 (94-fold), miR-10b (34-fold), miR-19b (34-fold), and miR-192 (29-fold). [score:4]
The top five differentially upregulated miRNAs in HGDN (Table  3) were: miR-101 (266-fold), miR-22 (170-fold), miR-16 (54-fold), miR-192 (45-fold), and miR-19b (34-fold). [score:4]
The top five differentially upregulated miRNAs in cirrhosis (Table  1) were: miR-7704 (403-fold), miR-22 (143-fold), miR-101 (113-fold), miR-486 (75-fold), and miR-192 (32-fold). [score:4]
This was also suggested in our study as miR-101 was continually overexpressed in all disease stages when compared to normal liver tissue. [score:4]
In summary, miR-101, miR-22, miR-122, circR-0015774, circR-0035409, MT-TS1, MT-TP, sno115-31, and snoRD37 may serve as biomarkers for liver pathogenesis, since they were differentially expressed. [score:3]
miR-101 regulates proliferation, migration, and invasion in various cancers 29– 32; suggesting importance in the ordered transformation from normal to malignant phenotype. [score:2]
[1 to 20 of 9 sentences]
33
[+] score: 39
Other miRNAs from this paper: hsa-mir-101-2
Wang et al. revealed that miR-101 was down-regulated in different subtypes of breast cancer, and subsequently showed that miR-101 could inhibit tumor growth and stimulate breast cancer cells to apoptosis by targeting STMN1 [31]. [score:8]
Over -expression of miR-101 has a tumor-suppressive effect in breast cancer, and miR-101 has been shown to negatively regulate oncogenes including EZH2 and STMN1 [22], [27]. [score:6]
MiR-101, a miRNA commonly down-regulated in cancer, has been implicated in several key cancer-related processes including cell growth, migration, invasion and apoptosis. [score:4]
Sachdeva et al. demonstrated that miR-101 stimulated estrogen-independent growth via upregulation of phosphorylated AKT [28]. [score:4]
MiR-101 is frequently expressed at low levels in multiple malignancies including breast cancer, hepatocellular carcinoma, glioblastoma, prostate and gastric cancers [23]– [27]. [score:2]
Recently, several studies supporting the considerable role of miR-101 in the development of breast cancer have been reported. [score:2]
Frankel et al. revealed that miR-101 could act as a key regulator of autophagy, which may sensitize breast cancer cells to 4-hydroxytamoxifen (4-OHT) -mediated cell death [30]. [score:2]
In this study, we did not observe the significant association between the 5 tagging SNPs (rs555146, rs578481, rs705509, rs7536540, rs1011210) in the vicinity of miR-101-1 gene and the risk of breast cancer. [score:1]
Genomic loci for miR-101 have been identified on chromosome 1p31.3 (miR-101-1) and chromosome 9p24.1 (miR-101-2). [score:1]
This study revealed that the rs7536540 polymorphism located in the primary region of miR-101-1 was significantly decreased the risk of liver cirrhosis and hepatocellular carcinoma (OR = 0.63, 95% CI 0.42–0.93 and OR = 0.63, 95% CI 0.46–0.85 under the dominant mo del). [score:1]
However, to date, little is known about the role of miR-101 -associated SNPs in breast cancer risk. [score:1]
MiR-101 belongs to a family of miRNAs involved in various cellular activities, including cell proliferation, invasion and apoptosis [22]. [score:1]
Summary of associations between 11 SNPs in miR-101 and breast cancer risk. [score:1]
Furthermore, Sachdeva et al. reported that miR-101 may promote MCF-7 cell growth in an estrogen-independent manner by enhancing AKT activation, suggesting a link between miR-101 and estrogen-independent signaling in estrogen receptor (ER) -positive tumor cells [28]. [score:1]
Based on this, 7 tagging SNPs (rs555146, rs578481, rs705509, rs7536540, rs1011210, rs12049119, rs489500) in the miR-101-1 region and 7 tagging SNPs (rs462480, rs17718377, rs4742051, rs1537146, rs10974820, rs2236495, rs1053872) in miR-101-2 region were selected. [score:1]
In this study, we hypothesized that polymorphisms of miR-101 are associated with the susceptibility of breast cancer in women. [score:1]
Tagging SNPs located within the vicinity of mature miR-101-1 and miR-101-2 genes (10 kB upstream and downstream) were selected using the International HapMap Project (http://www. [score:1]
To date, only one published association study investigated the effect of miR-101 polymorphisms on risk of hepatitis B-related liver disease [32]. [score:1]
[1 to 20 of 18 sentences]
34
[+] score: 34
Another miRNA that directly targeted NOTCH1 was miR-101, which was downregulated in T-ALL patient specimens and T-ALL cell lines [55]. [score:7]
Of these five targets, four miRNAs (miR-101, miR-140-5p, miR-448 and miR-485-5p) were downregulated in T-ALL patient specimens and T-ALL cell lines [55]. [score:6]
MiR-101 repressed proliferation and invasion, and induced apoptosis in Jurkat cells by direct downregulation of NOTCH1 expression [19]. [score:6]
By performing computational target prediction, luciferase reporter system, and mutagenesis assays; five candidate miRNAs (miR-101, miR-520d-5p, miR-140-5p, miR-448 and miR-485-5p) were found to directly target TAL1. [score:5]
MiR-101 acts as a tumor suppressor through the repression of proliferation and invasion, induction of apoptosis, and enhancement of chemotherapeutic sensitivity in T-ALL cells in vitro mediated by inhibiting NOTCH1 [19]. [score:4]
In this study, miR-101 expression was significantly decreased in Jurkat cells following treatment with Adriamycin. [score:3]
In contrast, the tumor suppressive miRNA, miR-101 was reported to enhance drug sensitivity of Jurkat cells [19]. [score:3]
[1 to 20 of 7 sentences]
35
[+] score: 34
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
miR-151a-3p (ΔΔCt = -2.01, P = 8.29E-06), MiR-181b-5p (ΔΔCt = -3.39, P = 1.04E-10), miR-320a (ΔΔCt = -2.47, P = 5.02E-12), miR-328 (ΔΔCt = -2.28, P = 4.33E-06), miR-433 (ΔΔCt = -2.33, P = 0.0001), miR-489 (ΔΔCt = -2.10, P = 1.25E-06), miR-572 (ΔΔCt = -2.47, P = 2.66E-08) and miR-663a (ΔΔCt = -2.06, P = 0.00002) were downregulated, while miR-101-3p (ΔΔCt = 1.43, P = 0.003), miR-106b-5p (ΔΔCt = 1.30, P = 0.008), miR-130a-3p (ΔΔCt = 2.35, P = 1.89E-09), miR-195-5p (ΔΔCt = 1.43, P = 0.0016) and miR-19b-3p (ΔΔCt = 1.87, P = 6.88E-09) were upregulated in the ASD individuals. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572, and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-130a-3p, miR-195-5p, and miR-19b-3p were upregulated. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
The differentially expressed miRNAs in this study, which included miR-101, miR-106b, miR-130a, miR-151a, miR181b, miR-328, miR-433, miR-489 and miR-572, were previously reported to have altered expression in schizophrenia [31- 35], supporting the contention that ASD and schizophrenia share common neurobiological features [36]. [score:5]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
[1 to 20 of 6 sentences]
36
[+] score: 33
Strillacci A MiR-101 downregulation is involved in cyclooxygenase-2 overexpression in human colon cancer cellsExp. [score:5]
Hao YEnforced expression of miR-101 inhibits prostate cancer cell growth by modulating the COX-2 pathway in vivoCancer Prev. [score:5]
The overexpression of hsa-miR-483-5p and hsa-miR-101 in ACC has been confirmed in the validation cohort. [score:3]
We have found significant overexpression of hsa-miR-101 (Fig.   4a) and hsa-miR-483-5p (Fig.   4b) and in ACC relative to ACA plasma EV samples (p < 0.0001 and p < 0.0052, respectively). [score:3]
Hsa-miR-101 was expressed in 1 of 6 ACA and 5 of 6 ACC samples, whereas hsa-miR-483-5p in 2 of 6 ACA and in all ACC samples. [score:3]
Among others, miR-101 may have tumor suppressor role e. g. in stomach [38], colorectal [39], prostate [40], tumors that is not suprising for a miRNA considering their tissue specific action. [score:3]
To the best of our knowledge, the overexpression of hsa-miR-101 in ACC has not been reported so far. [score:3]
Wang H-J MicroRNA-101 is down-regulated in gastric cancer and involved in cell migration and invasionEur. [score:3]
Among these, hsa-miR-101 (002253) and hsa-miR-483-5p (002338) were selected for validation by real-time RT-qPCR on altogether 34 samples (18 ACA and 16 ACC patients). [score:1]
ROC data of hsa-miR-101 have not yielded promising sensitivity and specificity values. [score:1]
Both, hsa-miR-101 and hsa-miR-483-5p, relative to spike-in control cel-miR-39 have been analyzed by ROC analysis. [score:1]
Raw and normalized qRT-PCR data are presented in Supplementary Dataset files  2 and 3. Figure 4Results of RT-qPCR validation of hsa-miR-101 (a) and hsa-miR-483-5p (b) normalized to the housekeeping cel-miR-39, (mean ± SD, **p < 0.01, ***p < 0.001; unpaired t-test; n = 18 ACA, n = 16 ACC. [score:1]
By using Fisher’s exact test, we evaluated miRNAs which were not expressed in all samples of a group and we found 2 miRNAs showing a tendency being different between ACA and ACC samples: hsa-miR-101 and hsa-miR-483–5p. [score:1]
[1 to 20 of 13 sentences]
37
[+] score: 32
[39] ANRIL correlated with advanced tumor–node–metastasis stage and greater tumor diameter[40] ZFAS1 an independent prognostic factor for poor survival of NSCLC patients[41] SNHG1 associated with a poor overall survival inhibited miR-101-3p and activated of Wnt/β-catenin signaling pathway[42] RGMB-AS1 correlated with differentiation, TNM stage, and lymph node metastasis by regulating RGMB expression though exon2 of RGMB[43] Table 2 LncRNA Function in NSCLC probable mechanism cition TUSC7 associated with worse overall survival[44] CASC2 independent predictor for overall survival of NSCLC[45] GAS5 indicated a poor prognosis and regulated cell proliferation[46] TUG1 related to the proliferation of NSCLC cells TUG1 RNA could bind to PRC2 in the promotor region of CELF1 and negatively regulated CELF1 expressions[47] AK126698 inhibited the proliferation and migration inhibited the activation of Wnt/β-catenin pathway[48] GAS5-AS1 regulated NSCLC cell migration and invasion through regulation of EMT[49] As is well-known, DNA damage repair (DDR) mechanisms, such as single-strand break, double-strand break, bulky adducts, base mismatches and base alkylation, are playing important roles to maintain genomic stability. [score:16]
[39] ANRIL correlated with advanced tumor–node–metastasis stage and greater tumor diameter[40] ZFAS1 an independent prognostic factor for poor survival of NSCLC patients[41] SNHG1 associated with a poor overall survival inhibited miR-101-3p and activated of Wnt/β-catenin signaling pathway[42] RGMB-AS1 correlated with differentiation, TNM stage, and lymph node metastasis by regulating RGMB expression though exon2 of RGMB[43] Table 2 LncRNA Function in NSCLC probable mechanism cition TUSC7 associated with worse overall survival[44] CASC2 independent predictor for overall survival of NSCLC[45] GAS5 indicated a poor prognosis and regulated cell proliferation[46] TUG1 related to the proliferation of NSCLC cells TUG1 RNA could bind to PRC2 in the promotor region of CELF1 and negatively regulated CELF1 expressions[47] AK126698 inhibited the proliferation and migration inhibited the activation of Wnt/β-catenin pathway[48] GAS5-AS1 regulated NSCLC cell migration and invasion through regulation of EMT[49] As is well-known, DNA damage repair (DDR) mechanisms, such as single-strand break, double-strand break, bulky adducts, base mismatches and base alkylation, are playing important roles to maintain genomic stability. [score:16]
[1 to 20 of 2 sentences]
38
[+] score: 30
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-301a, hsa-mir-378a, hsa-mir-381, hsa-mir-340, hsa-mir-146b, hsa-mir-181d, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-590, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-378c, hsa-mir-23c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Namely, HHV-6A specifically induced an early up-regulation of miR-590 (1 d. p. i. ), miR-15a and miR-21 (3 d. p. i. ), a sustained up-regulation of miR-29b, miR-101 (3 and 6 d. p. i. ), miR-301a and miR-548e (1 and 6 d. p. i. ) and a late up-regulation of miR-340 and miR-381 (6 d. p. i. ) By contrast, HHV-6B infection specifically up-modulated the expression of miR-301b (2 and 3 d. p. i. ) and miR-548e (1 and 3 d. p. i. ), whereas it down-regulated miR-590 (2 and 3 d. p. i. ) and miR-15a (6 d. p. i. ). [score:15]
In particular, both HHV-6A and 6B induced an early up-regulation of miR-301a and miR-548e (1 d. p. i. ), an increase of miR-101 and a decrease of miR-let-7c and miR-340 at 3 d. p. i., and a down-regulation of miR-23 at late time-points p. i. (6 d. p. i. ). [score:7]
The up-regulated miR-101 and miR-381 are involved in the polarization and activation of the cells of the innate immune compartment, regulating the inflammatory response (Zhu et al., 2010; Essandoh et al., 2016; Wen et al., 2016); the increased miR-548 may represent a mechanism facilitating viral pathogenesis as it negatively correlates with IFNγR1 levels (Xing et al., 2014). [score:5]
MicroRNA-101 targets MAPK phosphatase-1 to regulate the activation of MAPKs in macrophages. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 30
In a previous study we quantified the expression levels of 742 miRNAs in 30 cancer and 20 normal endometrium samples, among these, the commonly down-regulated miRNA mir-34c showed no significant down-regulation in the EAC samples, and mir-101 were up-regulated in the EAC samples compared to normal [11]. [score:11]
Even though mir-101 is down-regulated in many cancer forms, the up- or down-regulation of mir-101 is not obvious in EAC, both as it is a part of the TrkB-STAT3 regulatory response, where mir-101 gets up-regulated by increased TrkB levels, and TrkB protein levels is increased in many endometrial carcinoma samples [30]. [score:11]
The stage of the endometrial carcinoma also makes a big difference on the mir-101 level, since it is up-regulated in stage 1 compared to normal, however down-regulated in higher stages compared to normal [31]. [score:5]
In the material used in this study we found an up-regulation of mir-101 (fold change 5,1; p = 1,19e-7) in EAC compared to healthy tissue [11]. [score:3]
[1 to 20 of 4 sentences]
40
[+] score: 29
A microarray study comparing miRNA expression in heart tissue samples from several human heart diseases revealed let-7c to be significantly upregulated and miR-101 to be significantly downregulated in human DCM, although the changes were less than two-fold [48]. [score:11]
In contrast, our study detected a downregulation of let-7c and an upregulation of miR-101, but the changes were quite subtle. [score:7]
miR-101 has been addressed in several studies as a potent tumor suppressor and inhibitor of autophagy and is obviously expressed in many different tissues [74, 75]. [score:7]
Among other miRNAs, let-7c, miR-21, miR-92 and miR-101 were deregulated in DCM diseased tissue in contrast to healthy controls [48]. [score:4]
[1 to 20 of 4 sentences]
41
[+] score: 29
The relative expression of serum miR-142-3p and miR-101-3p levels in serum were analysed over time post-transplantation. [score:3]
To investigate whether the overall immunosuppression intensity in the heart-transplanted patients could modulate the serum levels of miR-142-3p and miR-101-3p, correlation between the levels of calcineurin inhibitors and miR-142-3p or miR-101-3p in the circulation of heart transplant patients was analysed. [score:3]
Calcineurin inhibitor level does not correlate with miR-142-3p and miR-101-3p in serum. [score:3]
ACR = 3.5 mg/L, p = 0.1) and (B) There is no correlation between CRP level in heart transplant patients and miR-142-3p fold change (n = 11; R [2] = 0.06 and P = 0.47) or miR-101-3p fold change (n = 11; R [2] = 0.01 and P = 0.75). [score:1]
MiR-142-3p and miR-101-3p had the best diagnostic performance among the seven microRNAs tested, making them the potential candidates as non-invasive biomarkers for ACR surveillance post heart-transplantation. [score:1]
MiR-142-3p and miR-101-3p levels stratified by time post-transplantation. [score:1]
Moreover, in the diagnostic test that combines sensitivity and specificity, the levels of miR-142-3p and miR-101-3p are shown to have the best performance among the seven microRNAs tested that yield AUC-ROC score of 0.78 and 0.75, respectively. [score:1]
Patients with and without acute cellular rejection could be discriminated by miR-142-3p (AUC = 0.78, CI [95%] = 0.67 to 0.89), miR-101-3p (AUC = 0.75, CI [95%] = 0.62 to 0.87), miR-424-5p (AUC = 0.73, CI [95%] = 0.60 to 0.86), miR-27a-3p (AUC = 0.72, CI [95%] = 0.59 to 0.85), miR-339-3p (AUC = 0.71, CI [95%] = 0.57 to 0.84), miR-144-3p (AUC = 0.70, CI [95%] = 0.56 to 0.83) and miR-326 (AUC = 0.69, CI [95%] = 0.56 to 0.82). [score:1]
Second, there was no correlation between CRP level and miR-142-3p or miR-101-3p levels (Fig 4B). [score:1]
MiR-142-3p and miR-101-3p had the best diagnostic test performance among the microRNAs tested. [score:1]
The present study validates that seven microRNAs, miR-142-3p, miR-339-3p, miR-326, miR-144-3p, miR-101-3p, miR-27a-3p and miR-424-5p are present in serum samples from heart transplant patients and adequately distinguish ACR from NR. [score:1]
To assess the relationship between miR-142-3p and miR-101-3p serum levels with kidney function in heart transplant patients, correlation between creatinine levels and miR-142-3p and miR-101-3p was analysed. [score:1]
All seven microRNA tested could significantly discriminate between ACR and NR, with AUC of 0.78, 0,75, 0.73, 0.72, 0.71, 0.70 and 0.69 for miR-142-3p, miR-101-3p, miR-424-5p, miR-27a-3p, miR-339-3p, miR-144-3p, and miR-326, respectively (Fig 2). [score:1]
However, from the ROC analysis, miR-142-3p and miR-101 have the best diagnostic test performance among the seven microRNAs tested. [score:1]
These results are encouraging as there is no association between either of these factors and the levels of miR-142-3p and miR-101-3p. [score:1]
The serum level of miR-101-3p was significantly higher in the ACR group for samples taken in the first 3 months post transplantation, but not in the later time points (Fig 3B). [score:1]
Creatinine levels do not correlate with miR-142-3p and miR-101-3p. [score:1]
0170842.g002 Fig 2 Patients with and without acute cellular rejection could be discriminated by miR-142-3p (AUC = 0.78, CI [95%] = 0.67 to 0.89), miR-101-3p (AUC = 0.75, CI [95%] = 0.62 to 0.87), miR-424-5p (AUC = 0.73, CI [95%] = 0.60 to 0.86), miR-27a-3p (AUC = 0.72, CI [95%] = 0.59 to 0.85), miR-339-3p (AUC = 0.71, CI [95%] = 0.57 to 0.84), miR-144-3p (AUC = 0.70, CI [95%] = 0.56 to 0.83) and miR-326 (AUC = 0.69, CI [95%] = 0.56 to 0.82). [score:1]
ROC analysis of miR-101-3p. [score:1]
This study demonstrated two microRNAs, miR-142-3p and miR-101-3p, that could be relevant as non-invasive diagnostic tools for identifying heart transplant patients with acute cellular rejection. [score:1]
ACR = 10.4 ug/L, p = 0.4) and (B) There are no correlations between miR-142-3p fold change and tacrolimus (n = 29; R [2] = 0.05; p = 0.25) or cyclosporin (n = 6; R [2] = 0.07; p = 0.61) and there are no correlations between miR-101-3p fold change and tacrolimus (n = 29; R [2] = 0.01; p = 0.10) or cyclosporine (n = 6; R [2] = 0.05; p = 0.68). [score:1]
In summary, our study shows that miR-142-3p and miR-101-3p can accurately discriminate heart transplant patients with ACR from those with no rejection. [score:1]
Increased serum level of miR-142-3p and miR-101-3p is not indicative of general inflammation. [score:1]
[1 to 20 of 23 sentences]
42
[+] score: 28
For bats, 3 out of 4 up-regulated miRNA (miR-101-3p, miR-16-5p, miR-143-3p) likely function as tumor suppressors against various kinds of cancers, while one down-regulated miRNA (miR-221-5p) acts as a tumorigenesis promoter in human breast and pancreatic cancers. [score:9]
The summary of the six DE miRNA common to all species is described in Fig.   5. Briefly, all DE candidates were single copy miRNA across all libraries, and 4 DE miRNA (miR-101-3p, miR-16-5p, miR-143-3p and miR-155-5p) were up-regulated in bats while 2 (miR-125-5p and miR-221-5p) were down-regulated. [score:7]
It is reported that miR-101, which functions as a tumor suppressor, is down-regulated in several cancers. [score:6]
Among the 4 up-regulated miRNA, the expression of miR-101 in bat was at least three times than that in other mammals (Fig.   5). [score:6]
[1 to 20 of 4 sentences]
43
[+] score: 28
miR-101 was found down-regulated in gastric cancer tissues, and its ectopic expression significantly inhibited cellular proliferation, migration, and invasion of GC cells but its gene target has not been identified yet [115]. [score:10]
The most up-regulated miRNAs are: miR-21, miR 17-92 cluster, miR-135a/b, miR-471 and miR-675, whereas miR-143, miR-14, let-7 and miR-101 showed a decreased expression in CRC. [score:6]
Up-regulation of EZH2 through miR-101 induces the concomitant deregulation of epigenetic pathways and results in cancer progression [99]. [score:5]
miR-101 locus is lost in metastatic prostate cancer, which leads to up-regulation of EZH2, indicating that miRNA-101 acts as a EZH2 repressor [98]. [score:4]
Another report demonstrated that miR-101 plays a major role in EMT through enhancement of a histone methyl transferase Zeste homolog (EZH2) whose expression was found elevated in a subset of aggressive, clinically localized prostate cancers and almost all metastatic prostate cancers. [score:3]
[1 to 20 of 5 sentences]
44
[+] score: 25
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
We found that all 15 miRNAs were involved in cancer and tumorigenesis, 12 of them (all except miR-101, miR-15a and miR-29c) were in carcinoma, malignant tumor and primary tumor and 8 of them (all except let-7 g, miR-101, miR-150, miR-15a, miR-16, miR-29c and miR-342) were in angiogenesis as were shown in the last column of Table 5. Furthermore, we examined which associated miRNAs among the 15 cancer-related miRNAs were involved in the canonical pathways associated with cancer. [score:1]
C. A sub-network depicting miRNA:mRNA interactions predicted from other cancer -associated miRNAs: let-7 g, miR-101, miR-133a, miR-15a, miR-16, miR-29b and miR-29c. [score:1]
Networks were also developed for the seven miRNAs (let-7 g, miR-101, miR-133a, miR-15a, miR-16, miR-29b and miR-29c) closely related to cancer and their associated mRNAs (Figure 2C). [score:1]
We found that all 15 miRNAs were involved in cancer and tumorigenesis, 12 of them (all except miR-101, miR-15a and miR-29c) were in carcinoma, malignant tumor and primary tumor and 8 of them (all except let-7 g, miR-101, miR-150, miR-15a, miR-16, miR-29c and miR-342) were in angiogenesis as were shown in the last column of Table 5. Furthermore, we examined which associated miRNAs among the 15 cancer-related miRNAs were involved in the canonical pathways associated with cancer. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 25
In our study, cfa-miR-101 has been down-regulated significantly by direct RA administration, but not by CYP26B1 inhibitor. [score:7]
Down-regulated miRNAs (cfa-miR-29 cluster, cfa-miR-19a, cfa-miR-101 and cfa-miR-137) in adult canine testis treated with DMSO, RA (Group 1) or CYP26B1 inhibitor (Group 2). [score:6]
A previous investigation [31] on miRNAs analyses with fetal gonad development identified that miR-101 is expressed in ovine fetal testis at gestational day 42 and not expressed at gestational day 75. [score:4]
Species of miRNA which were significantly down-regulated were cfa-miR-19a, cfa-miR-29b, cfa-miR-29c, cfa-miR-101 and cfa-miR-137 (Figure 6). [score:4]
The cfa-miR-101 may not have seed regions on target genes needed for spermatogenesis or RA -induced spermatogenesis. [score:3]
Another study [32] identified the increase of miR-101 in differentiating chicken ovary and suggested that miR-101 can repress TGF-β signaling in that tissue. [score:1]
[1 to 20 of 6 sentences]
46
[+] score: 25
Dysregulation of MIR101, MIR141, and MIR152 to the HIV-1 Gag protein contributes to HIV-1 budding and release via DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation at the late infection stage Briefly, dysregulation of; dysregulation of MIR9 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways; dysregulation of MIR139-5p, MIRLET7i, and MIR10a contributes to the HIV-1 integration/replication stage through DNA hypermethylation and immune system dysfunction; dysregulation of MIR101, MIR141, and MIR152 contributes to the HIV-1 virus assembly/budding stage through DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation; dysregulation of MIR302a contributes to not only microvesicle -mediated transfer of miRNAs but also dysfunction of NF-κB signaling pathway in hepatocarcinogenesis. [score:7]
We found that dysregulation of; dysregulation of MIR9 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways; dysregulation of MIR139-5p, MIRLET7i, and MIR10a contributes to the HIV-1 integration/replication stage; dysregulation of MIR101, MIR141, and MIR152 contributes to the HIV-1 virus assembly and budding mechanisms; dysregulation of MIR302a contributes to not only microvesicle -mediated transfer of miRNAs but also dysfunction of NF-κB signaling pathway in hepatocarcinogenesis. [score:6]
Therefore, the expression changes of MIR101, MIR141, and MIR152 (p-value < 0.037, p-value < 0.108, and p-value < 0.126, respectively) contributed to the expression change of Gag (p-value < 0.090). [score:5]
At the late infection stage, we determined that regulation of MIR101, MIR141, and MIR152 to Gag (p-value < 1☓10 [-16]) results in dysfunction of the infected cells through a signaling cascade of 5 proteins, PRMT1, inositol 1,4,5-trisphosphate receptor type 1 (ITPR1), autocrine motility factor receptor (AMFR), tripartite motif containing 25 (TRIM25), and ubiquitin-conjugating enzyme E2N (UBE2N) (Fig.   7). [score:2]
Dysregulation of MIR101, MIR141, and MIR152 to HIV-1 budding and releasing through DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation at the virus assembly/budding infection stage. [score:2]
Therefore, we suggested that the UBE2N -associated ubiquitin transfer is induced by a signaling cascade leading to dysregulation of MIR101, MIR141, and MIR152. [score:2]
It has been also suggested that MIR101 [110], and MIR152 [111] induce aberrant DNA hypermethylation in the hepatitis B virus infection. [score:1]
[1 to 20 of 7 sentences]
47
[+] score: 24
This deviant DNA methylation causes damping of miRNA tumour suppressors such as let-7, miR-101, and miR-202 that target MYCN; miR-9 that targets tyrosine kinase (Trk) C, RE-1 silencing transcription factor (REST), DNA -binding protein inhibitor (ID2), and Matrix metalloproteinase-14 (MMP-14); miR-34a that targets E2F transcription factor 3 (E2F3), B-cell lymphoma 2 (Bcl-2) and MYCN; miR-340 that targets SRY (sex determining region Y)-box 2 (SOX2); miR-184 that targets v-akt murine thymoma viral oncogene homolog 2 (Akt2); and miR-335 that targets Mitogen-Activated Protein Kinase 1 (MAPK1), leucine-rich repeat 1 (LRG1), and Ser/Thr Rho kinase 1 (ROCK1) [101] (Figure 1). [score:17]
Buechner J. Tømte E. Haug B. H. Henriksen J. R. Løkke C. Flægstad T. Einvik C. Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastomaBr. [score:7]
[1 to 20 of 2 sentences]
48
[+] score: 24
miRNAs Expression Mo del Target Effect on cardiac fibrosis Reference miR-21 ↑ MI Cardiac fibroblasts PTEN MAPK ↑ MMP2 expression, matrix remo deling, fibroblast survival, interstitial fibrosis Roy et al., 2009; Thum et al., 2008 miR-29 ↓ I/R, MI TGF-β ↑ MMP2 expression, excessive reparative fibrosis van Rooij et al., 2008; Kriegel et al., 2012; Nicolini et al., 2015; Yang et al., 2015 miR-30-133 ↓ I/R CTGF ↑ Collagen production Duisters et al., 2009; Nicolini et al., 2015 miR-22 ↓ MI TGF-βRI ↑ Collagen deposition Hong et al., 2016 miR-101 ↓ MI c-Fos TGF-β ↑ Collagens, fibronectin, MMP-2, MMP-9 Pan et al., 2012 MI, myocardial infarction; PTEN, phosphatase and tensin homolog; MAPK, mitogen-activated protein kinase; I/R, ischemia/reperfusion; TGF-β, transforming growth factor beta; CTGF, connective tissue growth factor; TGF-βRI, transforming growth factor beta receptor type I. In addition to cardiac disease, the potential of targeting miRNAs in other fibrotic diseases is also of current clinical importance. [score:15]
In other works, the downregulation of miRNAs was also observed in cardiac disease mo dels including reductions in miR-133, miR-590, miR-30, miR155, miR-22, miR-29, and miR101 (van Rooij et al., 2008; Duisters et al., 2009; Shan et al., 2009; Pan et al., 2012; Kishore et al., 2013; Hong et al., 2016). [score:6]
MicroRNA-101 inhibited postinfarct cardiac fibrosis and improved left ventricular compliance via the FBJ osteosarcoma oncogene/transforming growth factor-B1 pathway clinical perspective. [score:2]
Studies evaluating the miR-101 family have similarly demonstrated a protective role in healthy tissue and the importance of designing strategies to increase their expression following cardiac injury. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 24
The miRNAs expressed at the highest levels coincided with those reported by previous studies, and were similar to those expressed by NBC in our study, though several divergences emerged between CLL and NBC, such as the previously reported overexpression of miR-150-5p, miR-29a-3p, miR-155-5p, or miR-101-3p, underexpression of miR-181a-5p, or miR-181b-5p [14– 19], and others not firmly established yet, including the highly divergent miR-451a, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, within the overexpressed, and miR-126-3p, miR-365a-3p, miR-199a-3p, or miR-582-5p, within the underexpressed. [score:13]
However, 41 miRNAs were differentially expressed between CLL and NBC according to the Student t test (cut-off 2-fold, p<0.05), being 29 overexpressed in CLL, including miR-150-5p, miR-29a-3p, miR-29b-3p, let-7a-5p, miR-26a-5p, miR-451a, miR-155-5p, miR-101-3p, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, and 12 underexpressed, including miR-181a-5p, miR-222-3p, miR-126-3p, miR-365a-3p, miR-181b-5p, miR-199a-3p, or miR-582-5p (Table 1). [score:7]
In CLL, several miRNAs have been recurrently found overexpressed compared to normal B cells (NBC), such as miR-155 [14– 19], miR-150 [14, 16, 19], miR-101 [14, 18, 19], miR-21 [14, 18], miR-29a [18, 19], or miR-29c [16, 19], or underexpressed, such as miR-181a, miR-181b [15, 18, 19], and miR-223 [15, 16, 19]. [score:4]
[1 to 20 of 3 sentences]
50
[+] score: 23
It is possible that miR-101 down-regulation might contribute significantly to AD pathology by: 1) increasing APP expression; 2) promoting NFT formation through the increase in Tau phosphorylation; 3) contributing to inflammation through the upregulation of COX-2 expression. [score:11]
Several independent studies showed that miR-101 was downregulated in human AD cortex [23], [57], [67]. [score:4]
Cyclooxydenase-2 (COX-2) and APP are known miR-101 targets implicated in AD [15]. [score:3]
We plotted two miRNAs out of the 17 reported (miR-195-5p, miR-101-3p) in Table 6 that showed consistent expression changes with increased density of plaques (Table 6, Figure 4A ). [score:3]
0094839.g004 Figure 4(A) We plotted two miRNAs (miR-195-5p, miR-101-3p) detected in CSF from Table? [score:1]
miR-101 was decreased in CSF, and correlated with increases in neurofibrillary tangles and plaque density. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
MicroRNA-101, down-regulated in hepatocellular carcinoma, promotes apoptosis and suppresses tumorigenicity. [score:5]
miR-101 has a downstream target of v-fos oncogene and it is involved in cell invasion and migration in overexpressed HCC cell lines (Li et al., 2009b). [score:5]
4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), a tobacco carcinogen, down-regulate miR-34, miR-101, miR-126, and miR-199 (Kalscheuer et al., 2008). [score:4]
MicroRNA-101 regulates expression of the v-fos FBJ murine osteosarcoma viral oncogene homolog (FOS) oncogene in human hepatocellular carcinoma. [score:3]
ProliferationKutay et al., 2006; Wong et al., 2008; Li et al., 2009c; Su et al., 2009; Pineau et al., 2010 miR-101/b-2 Downstream target of v-fos oncogene. [score:3]
Targeting DNA-PKcs and ATM with miR-101 sensitizes tumors to radiation. [score:3]
[1 to 20 of 6 sentences]
52
[+] score: 22
Other miRNAs from this paper: hsa-mir-22, hsa-mir-130a, hsa-mir-101-2, oar-mir-22
It is unclear how miR-101 regulates SOX9 expression or function at the transcriptional and/or post-transcriptional level during fetal testicular development, but it is possible that miR-101 acts to fine-tune SOX9 expression [42]. [score:7]
One of the predicted targets of miR-101 is SOX9, which is expressed at higher relative amounts in sheep fetal testes compared to ovaries, suggesting miR-101 regulates SOX9 expression and/or function. [score:7]
However, the 8 bp seed sequence of miR-101 predicted to target 3'UTR of SOX9 (~450 bp down stream; 5'-GUACUGU-3') is conserved (TargetScan v5.1). [score:5]
At GD42, when fetal ovaries and testes differentiate, miR-101 and several members of the Let7 family are preferentially expressed in testes and ovaries, respectively. [score:3]
[1 to 20 of 4 sentences]
53
[+] score: 22
Other miRNAs from this paper: mmu-mir-101a, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
In line with our previous findings [26], we showed that SphK1 was dramatically downregulated in HepG2 cells by SphK1 shRNA or over -expression of miRNA-101 (Figure 4D). [score:6]
shRNA- or miRNA-101 -mediated SphK1 downregulation also induced HepG2 cell viability reduction and apoptosis (Figure 4E and 4F). [score:4]
Stable HepG2 cells expressing SphK1-shRNA, scramble control shRNA (“sc- shRNA”) or miR-101 as well as wt-SphK1, or the empty vector (pSuper-puro, “Vector”), were subjected to Western blot assay or real-time PCR assay to test mRNA and protein expressions of SphK1 (D and G). [score:3]
As reported, the miR-101 precursor [26] was sub-cloned into pSuper-puro-GFP vector to generate miR-101 expression construct. [score:3]
Here we found that SphK1 silence (by shRNA or miR-101) significantly inhibited STAT3 activation (pSTAT3 at Y705) in HepG2 cells (Supplementary Figure S3A). [score:3]
miR-101 or SphK1 expression in the stable cells was always tested. [score:3]
[1 to 20 of 6 sentences]
54
[+] score: 22
Elevated miR-18b expression in human nasopharyngeal carcinoma accelerates cell growth, and knockdown of C-Jun causes a dramatic decrease of miR-18b expression [36]; AP-1 binds to miR-101 promoter and activates its expression where miR-101 can further suppress the c-Fos and subsequently attenuate the AP-1 signaling [37]; miR-187 is expressed at high level in ovarian cancer, and it inhibits the expression of disabled-2 tumor suppressor who can suppress tumorigenicity by reducing c-Fos expression [38, 39]. [score:22]
[1 to 20 of 1 sentences]
55
[+] score: 22
Interestingly, tumor suppressor miR-101 and miR-217 acted as post-transcriptional regulators of MALAT1, whose silencing induced cell cycle arrest by p21 and p27 upregulation, and b-MYB inhibition. [score:9]
miR-101 and miR-217 overexpression or MALAT1 knockdown via miRNA mimics and siRNAs respectively, inhibited migration and invasion capabilities of ESCC cells, and were accompanied by deregulation of MALAT1 downstream metastasis -associated genes MIA2, HNF4G, ROBO1, CCT4, and CTHRC1 [88]. [score:7]
Furthermore, Ago2 -dependent post-transcriptional regulation of MALAT1 by miR-101 and miR-217 significantly impaired proliferation, migration, and invasion of Esophageal Squamous Cell Carcinoma Cells (ESCC) cells, highlighting the MALAT1 -dependent tumor suppressor role of these miRNAs [88]. [score:4]
Additionally, by sponging miR-101, MALAT1 abolished miR-101 -dependent negative regulation of the autophagic program in glioma cells, thus prompting cell proliferation [185]. [score:2]
[1 to 20 of 4 sentences]
56
[+] score: 22
MiR-150 was reported to function as a key regulator in the tumorigenesis and progression of CN by targeting c-Myb [39]; miR-92a played a critical role in the CN development and an anti-miR-92a antagomir could lead to the apoptosis of CN cells [40]; miR-199a-3p, the 3p arm of the pre-miRNA for miR-199a, exhibited a higher expression in CN tissues, resulting a significantly lower survival rate for the patients [41]; miR-142-3p, the 3p arm of the pre-miRNA for miR-142, could suppress the CN cell growth via downregulating three CN -associated proteins CD133, Lgr5, and ABCG2 [42]; an inverse correlation observed between the levels of miR-101 and the EP4 receptor protein in CN suggested that miR-101 might serve as a therapeutic target for the cancer [43]; miR-146b, with its expression inhibited, would lead to a high CsSR protein receptor level and reduce CN proliferation [44]. [score:18]
Chandramouli A MicroRNA-101 (miR-101) post-transcriptionally regulates the expression of EP4 receptor in colon cancersCancer Biol. [score:4]
[1 to 20 of 2 sentences]
57
[+] score: 22
Recent works have reported that miR-101 downregulation is involved in COX-2 overexpression in human colon cancer cells (CRC) [24], miRNA-26b regulates the expression of COX-2 in desferrioxamine -treated carcinoma of nasopharyngeal epithelial cells [25] and binding of miR-16 to AREs of TNF-α, IL-6, IL-9 and COX-2 mRNA transcripts could promote their degradation [20], [26]. [score:9]
The miRNAs (miR-16, miR-26b, miR-101, miR-199a, miR-122 and miR-21) were selected by using miRWalk computational analyses, that covers miRNA-targets interactions information produced by 8 established miRNA prediction programs on 3' UTRs of all known genes of Human, Mouse and Rat, i. e., RNA22, miRanda, miRDB, TargetScan, RNAhybrid, PITA, PICTAR, and Diana-microT, and comparing the obtained results with data collected from the literature. [score:5]
In the context of colon cancer cell lines and colon tumors, miR-101 inhibited COX-2 translation [24]. [score:5]
The expression profile of six miRNAs (miR-16, miR-26b, miR-101, miR-199a, miR-122 and miR-21) was analyzed in HCC cell lines (Table 1). [score:3]
[1 to 20 of 4 sentences]
58
[+] score: 22
Upregulated miRNAs predicted to target ATXN1, e. g., miR-101, -130a, -19a, -302 ATXN1 mRNA and protein levels analyzed with RT-PCR and western blot. [score:6]
Other miRNAs (e. g., miR-101, −130a, −19a, −302) predicted to target ATXN1 for degradation were also found to be upregulated. [score:6]
More specifically, that study showed that miR-19a, miR-101, and miR-130a co-regulate the 3′-UTR of ATXN1 through the inhibition of ATXN1 translation [48]. [score:6]
Human cerebellum and cortex, SCA1 patients and healthy controls[50] miR-144 slightly downregulated in SCA1 cerebellum but strongly induced in the cortex qRT-PCR, TaqMan miRNA assays (Applied Biosystems) for miR-144 and miR-101. [score:3]
Interestingly, miR-101 affected both the mRNA and protein levels, whereas miR-19a and miR-130a decreased the protein levels only. [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 21
miR-101 was found to be down-regulated in ALK(+) and (−) human ALCL and CD4/NPM/ALK transgenic mouse mo dels, but its forced expression increased the number of cells arrested in G1 phase of the cell cycle only in ALK(+) and not in ALK(−) ALCL cell lines The serine/threonine kinase mTOR was shown to be targeted by miR-101, and its inhibition led to reduced tumor growth in engrafted ALCL mouse mo dels, suggesting that mTOR inhibitors may offer a viable therapeutic strategy [31]. [score:12]
This attenuated cell proliferation was also likely to be a result of downregulation of miR-101 targets, such as the pro-survival protein Mcl-1 [31]. [score:6]
2.3.1. miR-101, miR-29a and miR-150: Suppressors of Cell Proliferation and Survival. [score:3]
[1 to 20 of 3 sentences]
60
[+] score: 21
miRNA target has-miR302a MECP2 hsa-miR29a TET1, TET2, TET3 has-miR29a/c DNMT3A, DNMT3B has-miR29b-1/2 DNMT1 (Indirect via SP1) hsa-miR148a DNMT3B hsa-miR148a DNMT1 hsa-miR152 DNMT1 has-miR302a DNMT1 (Indirect via AOF2) hsa-miR342 DNMT1 hsa-miR17-92 DNMT1 hsa-miR26a-1/2 EZH2 hsa-miR101-1/2 EZH2/EED hsa-miR214 EZH2 hsa-miR128-1/2 BMI-1 hsa-miR199a-1/2 BRM hsa-miR433 HDAC6 hsa-miR449a HDAC1 hsa-miR138 SIRT1In the first column we report a list of miRNAs which are known to target epigenetic regulators and in the second column the corresponding targets. [score:10]
When instead mir-101 is expressed and PRC2 repressed, malignant phenotypes are suppressed and the prognosis improves. [score:5]
In particular, it was shown that when mir-101 is repressed and PRC2 upregulated the formation of malignant phenotypes of Hepatocellular Carcinoma cells is increased, leading to poorer prognosis in patients. [score:4]
It was also shown that the switch of this DNFL may be triggered by the oncogene c-Myc, which is able to mediate and increase the repression of mir-101 by PRC2. [score:1]
The Ezh2/Eed - mir101 loop. [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 20
Other miRNAs from this paper: hsa-mir-127, hsa-mir-101-2
More specifically, miR-101-3p and miR-127-5p target the β-F1-ATPase mRNA and inhibit translation without affecting mRNA content. [score:7]
S4 Fig(A) Both miR-101-3p (left) and miR-127-5p (right) can regulate β-F1-ATPase protein translation (microrna. [score:4]
There was a significant 1.50±0.01 fold increase in miR-127-5p expression (t [(11)] = 3.551; P<0.01) in skeletal muscle of obese individuals compared to lean controls (Fig 5A), but no difference in miR-101-3p expression (t [(11)] = 1.273; P = 0.1160). [score:4]
0160057.g005 Fig 5(A) Expression of miR-127-5p (left) and miR-101-3p (right) were quantified in lean (n = 6) and obese (n = 6) subjects. [score:3]
Both miR-101-3p and miR-127-5p have been reported to regulate β-F1-ATPase translation [19, 23], and were investigated in the present study as putative intermediates (S4A Fig). [score:2]
[1 to 20 of 5 sentences]
62
[+] score: 20
However in 501mel cells, miR-101 downregulated reporter gene expression at the two highest concentrations used suggesting that it may play a role in melanocytes or melanoma cells. [score:6]
with miR-101 resulted in some downregulation of the reporter whereas other miRNAs tested did not show statistically significant effects compared to the mouseMitf-3′UTR-luciferase vector alone. [score:3]
The microRNA miR-101 has a highly conserved binding site but did not affect reporter gene expression in HEK293 cells. [score:3]
The other miRNAs tested, miR-27, miR-32 and miR-101 did not show significant effects on luciferase expression in this assay (Fig. 2B). [score:2]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
In addition, seven species contain a conserved second miR-101/144 binding site. [score:1]
All Mitf 3′UTR sequences in 11 vertebrate species analysed contain the miR-27, miR-25/32/92/363/367 and the miR-101/144 binding sites (Fig. 1B). [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
[1 to 20 of 10 sentences]
63
[+] score: 20
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-155, hsa-mir-101-2
Thus, we hypothesized that declined miR-101 expression in human KLRG1 [+] T cells leaded to elevated expression of co-repressor CtBP2, which subsequently suppressed the effector cytokine production of KLRG1 [+] T cells, resulting in impaired T cell antitumor immunity in tumor microenvironment. [score:7]
In this work, we demonstrated that KLRG1 [+] CD8 T cells expressed lower levels of miR-101, miR-155 and miR-200b. [score:3]
Figure 5(A) Relative expression of micro RNAs miR-101, miR-155 and miR-200b of FACS sorted KLRG1 [+] and KLRG1 [−] CD8 T cells by. [score:3]
Among these reduced miRNAs, we focused on miRNA-101. [score:1]
And miR-101/CtBP2 pathway might be involved in the impaired antitumor immunity restricted by KLRG1. [score:1]
miRNA-101/CtBP2 pathway involved in KLRG1-restricted antitumor immunity. [score:1]
Taken together, our results indicated miRNA-101 might contribute to impaired antitumor immunity restricted by KLRG1 through repressing CtBP2. [score:1]
We have reported that miRNA-101 increased cancer cell stemness by repressing the corepressor gene C-terminal binding protein-2 (CtBP2) [22]. [score:1]
We have previously reported that miRNA-101 increased cancer cell stemness by repressing CtBP2 [22]. [score:1]
We have recently demonstrated that miRNA-101 increased cancer cell stemness by repressing CtBP2 [22]. [score:1]
[1 to 20 of 10 sentences]
64
[+] score: 19
For example, miR-129-5p induces interferon-β which down-regulates E6 and E7 expression [19], miR-26a and miR-342-3p inhibit cell proliferation and invasion through each protein tyrosine phosphatase type IVA 1 and the mitogen-activated protein kinase (MAPK) pathway or forkhead box M1 [20, 21], and miR-101 regulates the cell cycle by inhibiting the G1-to-S transition [22]. [score:11]
Riquelme I. Tapia O. Leal P. Sandoval A. Varga M. G. Letelier P. Buchegger K. Bizama C. Espinoza J. A. Peek R. M. miR-101–2, miR-125b-2 and miR-451a act as potential tumor suppressors in gastric cancer through regulation of the PI3K/AKT/mTOR pathway Cell. [score:4]
Liang X. Liu Y. Zeng L. Yu C. Hu Z. Zhou Q. Yang Z. MiR-101 inhibits the G1-to-S phase transition of cervical cancer cells by targeting Fos Int. [score:4]
[1 to 20 of 3 sentences]
65
[+] score: 19
Because EZH2 is a target of miR-25 (Esposito et al., 2012), miR-26a (Sander et al., 2008), miR-30d (Esposito et al., 2012), miR-101 (Varambally et al., 2008), and (Derfoul et al., 2011), downregulation of miR-25, miR-26a, miR-30d, miR-101, and in human cancers are associated with EZH2 upregulation and malignant phenotypes. [score:9]
Loss-of-function TET2 mutations occur in patients with myeloproliferative neoplasms, MDS and AML (Shih et al., 2012a), while upregulation of TET2 -targeting miRNAs, such as miR-7, miR-29b, miR-29c, miR-101, and, occur in AML patients with wild-type TET2 (Cheng et al., 2013). [score:7]
Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. [score:3]
[1 to 20 of 3 sentences]
66
[+] score: 18
Both miR-145 and miR-495 target SOX9 in mesenchymal stem cells (9, 28), and miR-101 targets SOX9 in hepatocellular carcinoma (29). [score:5]
miR-101 and miR-145 were very lowly expressed, indeed barely detected, in any cell type of the intestinal epithelium (Fig. 1 b). [score:3]
Based on these differences, we conclude that it is likely that both miR-145 and miR-101 are robustly expressed in a non-epithelial mucosal tissue, but not in IECs. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
Zhang Y., Guo X., Xiong L., Kong X., Xu Y., Liu C., Zou L., Li Z., Zhao J., and Lin N. (2012) MicroRNA-101 suppresses SOX9 -dependent tumorigenicity and promotes favorable prognosis of human hepatocellular carcinoma. [score:2]
At 70% confluency, cells were transfected with 100 n m LNA against miR-30bcd, miR-320a, or miR-101*. [score:1]
Locked Nucleic Acids were purchased from Exiqon (Woburn, MA) including hsa-miR-101* (catalog no. [score:1]
[1 to 20 of 7 sentences]
67
[+] score: 18
The other candidate EZH2 binding miRNAs displayed a very similar pattern of expression: for example, the expression kinetics of miR-139 was similar to that of miR-101, and the expression pattern of miR-31 and miR-200b was comparable to that of miR-138 throughout differentiation (S4 Fig). [score:7]
miR-101 has been identified to directly target EZH2, acting as an EZH2 silencer involved in a negative feedback circuit with EZH2 [31, 32]. [score:4]
Expression of EZH2 can be modulated by direct binding of miRNAs, including miR-101, miR-138 and miR-214, to EZH2 [33, 34, 52]. [score:4]
B. Relative expression of miR-101, miR-138, miR-214 and miR-124 during hepatocytes differentiation from hPSC- iEZH2 cell line doxy induced the first 8 days of differentiation. [score:3]
[1 to 20 of 4 sentences]
68
[+] score: 18
Other miRNAs from this paper: hsa-mir-22, hsa-mir-203a, hsa-mir-137, hsa-mir-101-2, hsa-mir-203b
Lei Q. Shen F. Wu J. Zhang W. Wang J. Zhang L. MiR-101, downregulated in retinoblastoma, functions as a tumor suppressor in human retinoblastoma cells by targeting EZH2Oncol. [score:7]
EZH2 is upregulated in prostate cancer through amplification of the EZH2 gene [100], deletion of its negative regulator miR-101 [101], and transcriptional regulation by MYC [102] and ETS gene family members [103]. [score:6]
Cao P. Deng Z. Wan M. Huang W. Cramer S. D. Xu J. Lei M. Sui G. MicroRNA-101 negatively regulates Ezh2 and its expression is modulated by androgen receptor and HIF-1α/HIF-1βMol. [score:3]
Wu C. Ruan T. Liu W. Zhu X. Pan J. Lu W. Yan C. Tao K. Zhang W. Zhang C. Effect and mechanism of curcumin on EZH2 - miR-101 regulatory feedback loop in multiple myelomaCurr. [score:2]
[1 to 20 of 4 sentences]
69
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
MicroRNA-101 downregulates Alzheimer’s amyloid-b precursor protein levels in human cell cultures and is differentially expressed. [score:5]
Similarly, many researchers found that the amyloid precursor protein (APP) expression is also influenced by miRNA-101, miRNA-16, miRNA-106a, and miRNA-644 (Patel et al., 2008; Delay et al., 2011; Long and Lahiri, 2011; Liu et al., 2012). [score:3]
Recently, Valera et al. (2017) demonstrated that overexpression of miRNA-101 in oligodendroglial cell cultures resulted in a significant increase of α-synuclein via disruption of autophagy. [score:3]
Several studies demonstrated that miRNA-148a, miRNA-17-5p, miRNA-137, miRNA-181c, miRNA-101, miRNA-184, miRNA-15a, miRNA-185, and miRNA-210 are few of those miRNAs that are expressed in AD (Lukiw, 2007; Cogswell et al., 2008; Hébert et al., 2008; Geekiyanage and Chan, 2011; Wang et al., 2011). [score:3]
The predicted target of miRNA-101 was autophagy-related gene RAB5A. [score:3]
The stereotaxic injection with anti-miRNA-101 into the striatum of a mouse mo del of multiple system atrophy resulted in reduced oligodendroglial α-syn accumulation and enhanced autophagy (Valera et al., 2017). [score:1]
[1 to 20 of 6 sentences]
70
[+] score: 18
miR-101 targets ataxin 1, responsible for SCA1, at both the mRNA and protein levels; miR-433 targets fibroblast growth factor 20 which induces α-synuclein expression, which was previously shown to cause Parkinson’s disease when overexpressed [38]. [score:11]
For example, miR-101 and miR-433, both significantly downregulated in our dataset, have been linked to spinocerebellar ataxia type 1 (SCA1) and Parkinson’s disease, respectively [36], [37]. [score:6]
Other brain-specific miRNAs [14] included in our dataset include miR-101, -127, -128, and -132. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 17
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
Comparison of hsa-miR-18a, hsa-miR-18b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-556-3p, hsa-miR-424, hsa-miR-136, hsa-miR-340, hsa-miR-302b expression obtained by miRNA expression profile and qRT-PCR on tumors collected from human IGROV-1 ovarian tumor-bearing mice treated daily i. p. with CpG-ODN or saline (control group). [score:5]
Of the 9 miRNAs, hsa-miR-18a and hsa-miR-18b were selected based on their reported role in the pathogenesis of ovarian cancer [25]; [26], and hsa-miR-101 and hsa-miR-302b for their described involvement in DNA repair processes and sensitivity to chemotherapy [20]; the remaining 5 miRNAs were randomly selected. [score:1]
RT-qPCR using the RNA profiled in microarray analysis validated all 9 miRNAs (Fig. S1), whereas RT-qPCR using the RNA of the replica confirmed 6 of 9 miRNAs (p<0.05), with a trend observed for hsa-miR-18b and hsa-miR-101 but not for hsa-miR-136 (Fig. 2). [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 17
Notably the microRNAs upregulated in the control fascia accounting for the greatest differential in read count are heavily enriched in previously validated anti-fibrotic extracellular matrix targeting microRNAs (Table  1), including let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [27, 28], miR-27a-3p, miR-27b-3p [29, 30], miR-10a-5p [31], miR-26a-5p [32– 35], miR-101-3p [36– 39], and miR-10b-5p [40], as well as anti-proliferative microRNAs including, miR-126-3p [41– 47], miR-99a-5p [48– 54], miR-125a-5p [55– 59], and miR-139-5p [60– 62]. [score:6]
Tu X Zhang H Zhang J Zhao S Zheng X Zhang Z Zhu J Chen J Dong L Zang Y Zhang J MicroRNA-101 suppresses liver fibrosis by targeting the TGFβ signalling pathwayJ Pathol. [score:4]
Our studies confirmed enrichment of microRNAs miR-10b, miR-7f, miR-101, miR-26a, miR-26b, miR-29a, and miR-30 in non-diseased palmar fascia samples. [score:3]
Pan Z Sun X Shan H Wang N Wang J Ren J Feng S Xie L Lu C Yuan Y Zhang Y Wang Y Lu Y Yang B MicroRNA-101 inhibited postinfarct cardiac fibrosis and improved left ventricular compliance via the FBJ osteosarcoma oncogene/transforming growth factor-β1 pathwayCirculation. [score:2]
Zhao S, Zhang Y, Zheng X, Tu X, Li H, Chen J, Zang Y, Zhang J. Loss of microRNA-101 Promotes Epithelial to Mesenchymal Transition in Hepatocytes. [score:1]
Established anti-fibrotic microRNAs identified in our analysis include let-7 [23– 25], miR-29a-3p [26], miR-26b-5p, miR-30d-5p [28, 29], miR-27b-3p [30, 31], miR-10a-5p [33], miR-26a-5p [37– 40], miR-101-3p [41– 44], miR-27a-3p and miR-10b-5p [45]. [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 17
PLoS ONE 6, e18409 91 He X. P. (2012) Downregulation of miR-101 in gastric cancer correlates with cyclooxygenase-2 overexpression and tumor growth. [score:6]
Ectopic expression of miR-101 has been shown to significantly inhibit cell growth, cellular migration and invasion of gastric cancer cells via mediating EZH2, COX-2, MCL-1, FOS genes (Ref. [score:5]
This indicates that miR-101 may function as a tumour suppressor in gastric cancer, as it has an inhibitory role in cellular proliferation and metastasis. [score:5]
92) demonstrated that miR-101 gain of function led to a strong depletion of endogenous EZH2 and consequent rescue of E-cadherin membranous localisation. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 16
Studies have revealed that the sensitivity of GA -treated human bladder cancer cells to apoptosis triggered by methyl jasmonate is relevant to the down-regulation of enhancer of zeste homologue 2 (EZH2) level by the elevation in the expression of miR-101, which directly targets EZH2. [score:9]
Studies have been carried out to investigate their relation and found that methyl jasmonate down-regulated EZH2 level by the elevation in the expression of miR-101. [score:4]
For example, methyl jasmonate and miR-101 share a common target, EZH2. [score:3]
[1 to 20 of 3 sentences]
75
[+] score: 15
Meanwhile, the expression of miR-101 could be down-regulated in GC tissues and cells, and the ectopic expression of miR-101 significantly inhibits cellular proliferation, migration and invasion of GC cells by targeting EZH2, Cox-2, Mcl-1 and Fos [42]. [score:12]
Chem 2012 in press 42 Wang H. J. Ruan H. J. He X. J. Ma Y. Y. Jiang X. T. Xia Y. J. Ye Z. Y. Tao H. Q. MicroRNA-101 is down-regulated in gastric cancer and involved in cell migration and invasionEur. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 15
miR-101 is downregulated in both endometriod and serous EC and has been found to inhibit proliferation of EC cells in the aggressive serous type. [score:6]
Specific to EC, miR-101 suppression of EMT can partly be linked to enhanced expression of EZH2, a histone-lysine N-methyltransferase enzyme that participates in histone methylation and, ultimately, transcriptional repression. [score:5]
Presently, EMT is suppressed in EC through the action of four miRNAs: miR-194, miR-101, miR-23a, and miR-124. [score:3]
Notably, increasing miR-101 levels in EC cells reverses EMT (154). [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 15
Second, it represses the expression of two COX-2 inhibiting microRNAs miR101 and miR199a and indirectly promote COX-2 expression [11]. [score:8]
We have previously demonstrated that the epithelial sodium channel (ENaC) in the endometrial epithelial cells can be activated by embryo-derived protease, which subsequently triggers a sequence of events in endometrial epithelial cells, including Ca [2+] increase, phosphorylation of CREB (Ca [2+]/cAMP responsive element binding protein), downregulation of miR101 and miR199a, upregulation of COX-2 and eventually PGE [2] production and release to the stroma, leading to decidualization and embryo implantation [10, 11]. [score:7]
[1 to 20 of 2 sentences]
78
[+] score: 15
Moreover, the upregulation of miR-142-5p, miR-221, miR-30, miR-32, miR-374, miR-99a, miR-122 and miR-101 and the downregulation of miR-145, miR-195 and miR-98 observed in JEV-infected PK-15 cells in our study have been reported in the brains of mice infected with West Nile virus (WNV), another mosquito-borne flavivirus [34]. [score:7]
In this study, we identified a subset of miRNAs (including miR-10a-5p, miR-10a-3p, miR-10b, miR-101, miR-126-5p, miR-142-5p, miR-155-5p, miR-17-3p, miR-18a, miR-19a, miR-181a, miR-196b, miR-221-3p, miR-98, let-7d-3p, let-7d-5p) that are significantly differentially expressed after challenge with JEV. [score:3]
Zhu Q. -Y. Liu Q. Chen J. -X. Lan K. Ge B. -X. MicroRNA-101 targets MAPK phosphatase-1 to regulate the activation of MAPKs in macrophages J. Immunol. [score:3]
In this study, the miRNAs associated with autophagy, including miR-30a/c, miR-374a, miR-195, miR-101, miR-181a, miR-98, miR-142, miR-196, miR-210, miR-17 and miR-155, were identified. [score:1]
These include miR-10, miR-101, miR-106a, miR-126, miR-142-3p, miR-146, miR-150, miR-155, miR-17-92 cluster (seven members: miR-17-5p, -17-3p, -18a, -19a, -20a, -19b and -92a), miR-181a, miR-196b, miR-21, miR-221, miR-223, miR-326, miR-34,miR-424, miR-9, miR-98, the let-7 family (nine members: let-7, mir-48, -84, -241, -265, -793, -794, -795 and -1821), and so on [47, 48, 49]. [score:1]
[1 to 20 of 5 sentences]
79
[+] score: 15
Wang et al. showed that the expression of miR-101 is frequently reduced in CC (Table 1) [11], which suggests that activation of miR-101 by novel approaches could become a promising target for the inhibition of CC cell proliferation. [score:7]
In prostate cancer, there is an increase in the expression of EZH2, which appears to be due to decreased expression of miR-101 [24]. [score:5]
The miR-101 plays a significant role in cell proliferation, migration, and angiogenesis through the inhibition of enhancer of zeste homolog 2 (EZH2) (Figure 1) [23]. [score:3]
[1 to 20 of 3 sentences]
80
[+] score: 15
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
The identity of the 12 miRNAs is as follows: miR-21, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-451, miR-101, miR-424, miR-342-3p, miR-122a, and miR-663. [score:1]
Finally, we found 7 HBV-related miRNAs that are involved in HCC occurrence after removing 5 non-specific miRNAs (miR-21, miR-451, miR-101, miR-424, and miR-122a). [score:1]
[1 to 20 of 5 sentences]
81
[+] score: 15
Prior to the present study, three molecular mechanisms were identified that could be responsible for overexpression of EZH2 in prostate cancer--amplification of the EZH2 gene [8], the deletion of its negative regulator miR-101 [5], and transcriptional regulation of EZH2 by ETS gene family members [12, 13]. [score:5]
miR-101 was shown to specifically target EZH2 for down regulation in prostate cancer cells, and the miR-101 locus was deleted in 37.5% of localized prostate cancers and 66.7% of castrate-resistant metastatic prostate cancer cases. [score:4]
More recently, Varambally et al. used a bioinformatics approach to nominate miR-101 as a potential microRNA that can target EZH2 mRNA for silencing [5]. [score:3]
Interestingly, two of these mechanisms (EZH2 amplification and miR-101 deletion) are encountered more frequently in advanced and castrate resistant prostate cancers than in primary untreated prostate cancers, and ETS family gene fusions and ERG protein overexpression are rarely seen in isolated PIN lesions or PIN lesions associated with ERG -negative carcinomas [34]. [score:3]
[1 to 20 of 4 sentences]
82
[+] score: 14
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
[1 to 20 of 3 sentences]
83
[+] score: 14
Accumulating evidences further indicate that numerous miRNAs can impede cancer progression via direct suppression of VEGF-C. miR-27b, miR-101, miR-128, miR-206 and miR-1826 have been reported to inhibit tumor growth, lymphangiogenesis and metastasis by targeting VEGF-C in a variety of human cancer cells [20– 22, 38– 40]. [score:8]
Furthermore, miR-101 has been documented to suppress migration and invasion via negatively regulating VEGF-C expression in bladder cancer and cholangiocarcinoma cells, respectively [22]. [score:6]
[1 to 20 of 2 sentences]
84
[+] score: 14
After determining the expression levels of these miRNAs in the same 7 pairs of NSCLC tissues and normal adjacent tissues, we observed that 8 miRNAs (miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101 and miR-9) were downregulated in the NSCLC tissues, while the other 5 miRNAs (miR-125, miR-98, miR-196, miR-23 and miR-499) were upregulated (Fig. S1). [score:9]
In addition to let-7, miR-181 26, miR-30 29, miR-9 27 28, miR-132 32 33, miR-101 30 and miR-212 31 have also been shown to directly bind the 3′-UTR of LIN28B and repress the translation of this protein. [score:4]
A total of 13 miRNAs, including miR-203, miR-30, let-7, miR-132, miR-181, miR-212, miR-101, miR-9, miR-125, miR-98, miR-196, miR-23 and miR-499, were identified as candidate miRNAs by all three computational algorithms (Table S2). [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 14
In addition, SERPINB3 3′-UTR mutants including mutated binding sites for miR-101, miR-1668 and miR-1681 were also generated by point mutation in order to confirm the modulation of eGFP expression by each miRNA (Figure 3B). [score:4]
In the presence of miR-101, miR-1668 and miR-1681, the intensity and percentage of GFP -expressing cells (44.8% in control vs. [score:3]
For the dual fluorescence reporter assay, the fusion constructs containing the DsRed gene and either miR-101, miR-1668 and miR-1681 were designed to be co-expressed under control of the CMV promoter (pcDNA-DsRed-miRNA). [score:2]
[A] Diagram of miR-101, miR-1668 and miR-1681 binding sites in SERPINB3 3′-UTR. [score:1]
27.5% in miR-101, 24.2% in miR-1668, 14.8% in miR-1681) decreased (p<0.01). [score:1]
16.1% in miR-101, 13.5% in miR-1668, 14.3% in miR-1681) as a control (Figure 3D). [score:1]
org/miRDB/) revealed three putative binding site for miR-101, miR-1668 and miR-1681 (Figure 3A). [score:1]
[C] After co-transfection of pcDNA-eGFP-3′UTR for the SERPINB3 transcript and pcDNA-DsRed-miRNA for the miR-101, miR-1668 and miR-1681, the fluorescence signals of GFP and DsRed were detected using fluorescent microscopy. [score:1]
[1 to 20 of 8 sentences]
86
[+] score: 14
miR-21 and miR-101 regulate PLAP-1 expression in periodontal ligament cells. [score:4]
Another study indicated that miR-101 and miR-21 are also involved in the osteogenic differentiation of PDLCs; both miRNAs regulate the expression of PERIODONTAL LIGAMENT-ASSOCIATED PROTEIN 1 (PLAP-1) (Figure 4A) by enhancing the mineralization capacity of PDLCs (Li et al., 2012). [score:4]
Cell type microRNA mRNA target Differentiation DPSCs miR-135 Nd MyogenicLi et al., 2015 miR-143 DPSCs miR-720 DNMT3a, NANOG OsteogenicHara et al., 2013 PDLSCs miR-21 PLAP-1 OsteogenicLi et al., 2012 miR-101 DPCs miR-424 VEGF, KDR Angiogenic (endothelial cells)Liu et al., 2014 DPSCs miR-196 HOX C8 OsteogenicGardin et al., 2016 DPSCs miR-218 RUNX2 OsteogenicGay et al., 2014 GMSCs PDLSCs DPSCs miR-816-3a WNT5A, EGRF Control of cell fateVasanthan et al., 2015 miR-7-5p DPSCs miR-32 DSPP OdontoblasticWang et al., 2011 miR-586 miR-885-5 WNT5A, WNT FAMILY MEMBER 5A; EGRF, EPIDERMAL GROWTH FACTOR RECEPTOR; DSPP, DENTIN-SIALOPHOSPHOPROTEIN; DNMT3A, DNA METHYLTRANSFERASE 3A; NANOG, NANOG HOMEOBOX; PLAP-1, PERIODONTAL LIGAMENT-ASSOCIATED PROTEIN 1; VEGF, VASCULAR ENDOTHELIAL GROWTH FACTOR; KDR, VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR-2/KINASE INSERT DOMAIN RECEPTOR; and RUNX2, RUNT-RELATED TRANSCRIPTION FACTOR2. [score:3]
Decreasing levels of miR-21 and miR-101 lead to an increase in PLAP-1 expression. [score:3]
[1 to 20 of 4 sentences]
87
[+] score: 14
Of the most up-expressed miRNA (miRNA-181a-3p) in HepG2/DOX, one target gene RBM22 supported by three softwares (Mireap, miRDB and PicTar), was expected to be the common targets of seven other significantly differentially expressed miRNAs including miR-21, miR-101, miR-217, miR-590-5p, miR-181b, miR-181c, and miR-181d. [score:9]
It is also the common candidate target of other ten significantly differentially expressed miRNAs, i. e. miR-203, miR-195-5p, miR-497-5p, miR-424-5p, miR-16, miR-15b-5p, miR-27a, miR-27b, miR-101 and miR-590-3p. [score:5]
[1 to 20 of 2 sentences]
88
[+] score: 13
Similarly, only common targets of miR-101 and a frequently expressed isomiR of miR-101 have been identified, despite the fact that these two miRNAs, show marked differences in expression between cell types (37) (Supplementary Table S5). [score:7]
We found four other convincing examples of 5′ isomiR switching (miR-101, 106a, 140 and 4454) between human cell types out of a screen of 295 of the most highly expressed miRNAs in miRGator (29) (Supplementary Table S5). [score:3]
Llorens F. Banez-Coronel M. Pantano L. Del Rio J. A. Ferrer I. Estivill X. Marti E. A highly expressed miR-101 isomiR is a functional silencing small RNABMC Genom. [score:3]
[1 to 20 of 3 sentences]
89
[+] score: 13
Among them, 17 are differential in LHR+ S KOV3 cells vs LHR- S KOV3 cells, i. e. negative control, including six upregulated (miR-101-1, -101-2, -199b, -559, -573 and -7-3) and 11 downregulated (miR-103-2, -200c, -151, -29c, -301b, -548a2, -552, -561, -566, -613 and -642) (Table S1a). [score:7]
In total, 65 microRNAs were identified to exhibit differential expression in either LHR expressing S KOV3 cells or LH -treated cells, a few of which have been found in the genomic fragile regions that are associated with abnormal deletion or amplification in cancer, such as miR-21, miR-101-1, miR-210 and miR-301a. [score:5]
Interestingly, more positively correlated microRNA-mRNA pairs than negatively correlated pairs were observed for all microRNAs with the exception of nine, miR-181B2, miR-582, miR-497, miR-559, miR-561, miR-101-1, miR-187, miR-572 and miR-301A (Figure 5). [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 13
MYC induced by H. pylori CagA in gastric cancer cells can suppress the expression of let-7a and let-7c through two epigenetic approaches: (1) MYC stimulates EZH2 expression by reducing its negative regulators, miR-26a and miR-101; (2) MYC interacts with DNMT3B and EZH2 on the let-7 promoter, and consequently the let-7 gene is silenced through both DNA and histone methylation. [score:8]
A positive feedback loop exists between MYC and EZH2: MYC stimulates EZH2 expression by reducing its negative regulators, miR-26a and miR-101; EZH2 can also increase the abundance of MYC by repressing miR-494. [score:4]
For instance, miR-139-5p, miR-125b, miR-101, let-7c, miR-200b were found to be epigenetically repressed by EZH2, and miR-449 was repressed by HDACs in human hepatocellular carcinoma (HCC) [30, 31]. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 13
A significant number of differentially expressed miRNAs of HL60 (downregulated-miR-101, 126, 27b, 7; up regulated- let-7a, let-7d, miR-181a, -181a*, -181b and miR-199b) were mapped to chromosome 9 (Figure 8). [score:7]
Many miRNAs that were previously reported to be involved as tumor suppressors, such as let-7 g, miR-101, 16 and 192 were found to be down regulated in the leukemia cell lines. [score:4]
Some of the differentially regulated miRNAs of K562, such as miR-101, miR-27b and miR-24 were also encoded by chromosome 9. The genomic locations of some of these miRNAs were distant from the ABL gene locus. [score:2]
[1 to 20 of 3 sentences]
92
[+] score: 13
To test this hypothesis, we used some of the same sensor constructs analysed in Figure 3 and overexpressed the encoded sensor mRNAs specific for miR-22-3p, miR-101-3p and miR-197-3p in 293 cells. [score:3]
As shown in Figure 1A, and detailed in Supplementary Table S1, we observed that several of these highly expressed miRNAs were either more highly RISC associated (e. g., miR-197-3p, miR-191-5p, miR-92a-3p and miR-92b-3p) or significantly less RISC associated (e. g., miR-22-3p, miR-27b-3p and miR-101-3p) than the average miRNA. [score:3]
The indicated analysis of miR-22-3p and miR-101-3p expression levels was normalized to miR-138, which does not show differential RISC association. [score:3]
However, this was not observed at 3 days after transfection (miR-22-3p levels were 1.03 ± 0.56 relative to control cells; miR-101-3p levels were at 0.98 ± 0.19; and miR-197-3p levels were 1.16 ± 0.47. [score:1]
As shown in Figure 1C, we were able to fully confirm the preferential RISC association of miR-92a-3p/miR-92b-3p and miR-197-3p, and the weak RISC association of miR-101-3p and miR-22-3p, by analysis. [score:1]
Specifically, miR-22-3p and miR-101-3p, both of which are normally weakly RISC associated in 293 cells (Figure 1), increased their RISC association by ∼2-fold and by ∼6-fold, respectively (Figure 5A). [score:1]
However, the level of 3′ tailing varied wi dely, with >20% of all reads specific for miR-101-3p bearing 3′ tails while <0.3% of the reads specific for miR-22-3p were tailed. [score:1]
[1 to 20 of 7 sentences]
93
[+] score: 12
It was demonstrated in vitro that the direct translational inhibition of COX-2 mRNA is mediated by miR-101. [score:6]
Impairment of miR-101 levels could represent one of the leading causes of COX-2 overexpression in CRC cells [44]. [score:3]
An inverse correlation was reported between COX-2 and miR-101 expression in CRC cell lines. [score:3]
[1 to 20 of 3 sentences]
94
[+] score: 12
It was demonstrated in vitro that the direct translational inhibition of COX-2 mRNA is mediated by miR-101. [score:6]
An inverse correlation was reported between COX-2 and miR-101 expression in CRC cell lines. [score:3]
Impairment of miR-101 levels could represent one of the leading causes of COX-2 overexpression in CRC cells [69]. [score:3]
[1 to 20 of 3 sentences]
95
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-101, miR-378 and 143 expression patterns. [score:3]
The expression of miR-101 also varied among the tissues; it could be detected in liver, stomach, salivary glands, pancreas, spleen, lymph node and testes but not in thymus and bladder tissues. [score:3]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 4 sentences]
96
[+] score: 12
CFTR is a predicted target of miR-101 and miR-144, and this group further demonstrated that cadmium upregulates the expression of miR-101 and miR-144 (Hassan et al., 2012), suggesting that cadmium, through miRNA induction, may be involved in the pathogenesis of cystic fibrosis. [score:8]
MiR-101 and miR-144 regulate the expression of the CFTR chloride channel in the lung. [score:4]
[1 to 20 of 2 sentences]
97
[+] score: 12
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-101-2, hsa-mir-376b
However, studies have shown that ATG4 can be regulated by miR-34a that specifically targets ATG4B, [11] miR-376b that target intracellular levels of ATG4C, [12] and the tumor suppressor miR-101 that inhibits autophagy by targeting ATG4D. [score:12]
[1 to 20 of 1 sentences]
98
[+] score: 12
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-200a, hsa-mir-101-2
We previously demonstrated that forced expression of miR-101 can sensitize HCC cells to chemotherapeutic treatment by directly targeting the EZH2 oncogene [2]. [score:6]
We previously determined that miR-101 can inhibit the progression of HCC via downregulation of enhancer of zeste homolog 2 (EZH2; polycomb group protein) [2]. [score:6]
[1 to 20 of 2 sentences]
99
[+] score: 11
CUR also suppressed EZH2 expression by induction of miR-let 7c and miR-101. [score:5]
CDF induced the expression let-7a, b, c, d miRs, miR-26a, miR-101, miR-146a, and miR-200b, c in pancreatic cancer. [score:3]
In in vitro cell lines assays, CDF increased expression of let-7, miR-26a, and miR-101 [185]. [score:2]
miRs such as: miR-21, miR-22, miR-34, miR-101, miR-146a miR-200 and let-7 have been associated with the CSC phenotype. [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 11
Guo and colleagues showed that miR-101 over -expression decreased c-Met expression at both mRNA and protein levels inhibiting T24 cell lines migration and invasion [56, 57]. [score:7]
Hu Z. Lin Y. Chen H. Mao Y. Wu J. Zhu Y. Xu X. Xu X. Li S. Zheng X. MicroRNA-101 suppresses motility of bladder cancer cells by targeting c-Met Biochem. [score:4]
[1 to 20 of 2 sentences]