sort by

294 publications mentioning hsa-mir-22 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-22. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 708
We specifically demonstrate that EVI1 transcriptionally inhibits VSMC-specific gene expression by providing the following evidence: (1) suppression of EVI1 expression and its reporter activity by miR-22 mimics; (2) increase in gene expression of all 5 VSMC-specific contractile markers and 2 transcription factors by EVI1 knockdown; (3) increase in gene promoter activity of SMαA, SM22α, SRF, and Myocd by EVI1 inhibition; (4) requirement of SRF binding sites(s) for EVI1 -mediated SMαA and SM22α gene repression; and (5) direct binding and enrichment of EVI1 at the promoter regions of SMαA, SM22α, SRF, and Myocd confirmed by chromatin immunoprecipitation assay. [score:14]
It is important to note that RT-qPCR data showed that miR-22 inhibition downregulated VSMC gene expression, and this inhibitory effect of miR-22 was abolished by EVI1 knockdown (Figure VIIIA in the online-only Data Supplement). [score:11]
As expected, expression levels of both the EVI1 mRNA (Figure 4C) and protein (Figure 4D) were significantly downregulated by miR-22 mimics but upregulated by miR-22 inhibitor in VSMCs. [score:11]
RT-qPCR data showed that miR-22 expression in murine VSMCs was significantly upregulated by miR-22 mimics (Figure IA in the online-only Data Supplement) and downregulated by the miR-22 inhibitor (Figure IB in the online-only Data Supplement). [score:11]
miR-22 Is Significantly Downregulated, Whereas Its Target Genes (MECP2 and EVI1) Are Dramatically Upregulated in the Diseased Human Arteries. [score:11]
It is noteworthy that overexpression of miR-22 in the injured vessels significantly reduced the expression of its target genes, decreased VSMC proliferation, and inhibited neointima formation in wire-injured femoral arteries, whereas the opposite effect was observed with local application of a miR-22 inhibitor to injured arteries. [score:11]
In comparison with healthy arteries, diseased femoral arteries showed a significantly decreased gene expression level of miR-22 and dramatically increased expression levels of its target genes (MECP2 and EVI1) (Figure 8B). [score:9]
Altogether, our data suggest that, similar to overexpression of miR-22, EVI1 suppression in VSMCs simulates the effects of miR-22 overexpression on VSMC gene expression, proliferation, and migration. [score:9]
It is important to note that we observed that miR-22 expression is suppressed in the human femoral arteries with atherosclerotic plaques and have uncovered an inverse relationship between miR-22 and its target genes, MECP2 and EVI1, in healthy and diseased arteries. [score:9]
Once the miR-22 binding site within EVI1 3′-UTR was mutated, the miR-22 mimic–induced inhibition of EVI1 expression was abrogated (Figure 4F), suggesting that miR-22 directly downregulates EVI1 via its 3′-UTR binding site. [score:9]
Because the expression of miR-22 was significantly decreased, whereas expression of its target genes, MECP2 and EVI, was dramatically increased in femoral atherosclerotic lesions in comparison with healthy femoral arteries, inhibiting EVI1 may offer a therapeutic opportunity to decrease neointima formation and restenosis. [score:9]
miR-22 overexpression significantly increased expression of VSMC marker genes and inhibited VSMC proliferation and migration, whereas the opposite effect was observed when endogenous miR-22 was knocked down. [score:8]
The gene expression data showed that both miR-22 and EVI1 were successfully downregulated in VSMCs by miR-22 inhibitor and EVI1 small hairpin RNA, respectively (Figure VIIIA in the online-only Data Supplement). [score:8]
The expression level of EVI1 was significantly increased by miR-22 inhibitor in control VSMCs, whereas the same inhibitory effect was abolished in EVI1 knockdown VSMCs (Figure VIIIA in the online-only Data Supplement). [score:8]
Moreover, all 5 VSMC genes (SMαA, SM22α, CNN1, SM-myh11, SMTN-B), but not miR-22, were significantly upregulated by MECP2 inhibition (Figure VID in the online-only Data Supplement), supporting that MECP2 is the downstream target of miR-22. [score:8]
48, 49 In addition to upregulating miR-22 during VSMC differentiation from stem cells, [34] PDGF-BB signaling has also been reported to transcriptionally induce miR-15b expression to mediate VSMC dedifferentiation and inhibit miR-221 to promote proliferation in pancreatic cancer cells. [score:8]
We found that all were significantly downregulated by PDGF-BB and serum (Figure 2A) but upregulated by TGF-β1 (Figure 2B), suggesting that miR-22 was transcriptionally regulated during VSMC phenotypic modulation. [score:8]
It is important to note that we found that, whereas PDGF-BB treatment reduced expression of SM-myh11 and SMTN-B, the addition of miR-22 mimics significantly increased expression of both genes even with PDGF-BB treatment (Figure IC and IDin the online-only DataSupplement), suggesting that miR-22–induced contractile gene expression is PDGF-BB–independent. [score:7]
The y axis represents the expression level of miR-22 (relative to U6, %); the x axis represents the expression level of its target genes (MECP2 and EVI1) (relative to 18S, ‰). [score:7]
We found that miR-22 expression was significantly reduced, whereas MECP2 and EVI1 expression levels were dramatically increased, in diseased in comparison with healthy femoral human arteries. [score:7]
To better understand the functional role of miR-22 in postinjury arterial remo deling, we also conducted miR-22 loss-of-function experiments using LNA-miR-22 and found that miR-22 inhibition produces the opposite effects of miR-22 overexpression on VSMC marker expression and injury -induced neointima hyperplasia (Figure 7D through 7F). [score:7]
B, RT-qPCR analysis confirmed that miR-22 expression was significantly inhibited in VSMCs transfected with miR-22 inhibitor in all treatments. [score:7]
Our data have shown for the first time that ectopic expression of miR-22 in the injured arteries can reverse the process of VSMC phenotype switching and prevent postangioplasty restenosis, supporting a potential role for miR-22 and its target genes in a variety of proliferative vascular diseases. [score:7]
As expected, injury -induced MECP2, EVI1, HDAC4, and PCNA gene expression was blunted, whereas the expressions of VSMC genes (SMαA and SM-myh11) were enhanced by local ectopic expression of miR-22 (Figure 7A). [score:7]
Our study was also the first to identify an inverse relationship between the expression levels of miR-22 and its target genes, MECP2 and EVI1, in both healthy and diseased human femoral arteries, suggesting that miR-22 could be a potential therapeutic agent in coronary atherosclerosis. [score:7]
Because TGF-β1 treatment increased miR-22 expression (Figure 1E) and decreased expression of MECP2, EVI1, and HDAC4, these observations indicated these genes could be potential targets of miR-22. [score:7]
Figure 5. EVI1 inhibition reproduces the effects of miR-22 overexpression on VSMC-specific gene expression, proliferation, and migration. [score:7]
We observe that miR-22 expression is supressed in the human femoral arteries with atherosclerotic plaques and have uncovered an inverse relationship between miR-22 and its target genes in healthy and diseased arteries. [score:7]
Figure 8. Expression profiles of miR-22 and target genes in the healthy and diseased human arteries. [score:7]
12, 22 In comparison with uninjured arteries, injured arteries treated with control Cel-miR-67 AgomiRs displayed significantly decreased expression of miR-22 and VSMC genes (SMαA and SM-myh11) and significantly increased expression of cell proliferation marker gene, PCNA, and the identified miR-22 target genes (MECP2, HDAC4, and EVI1), whereas the opposite effects were observed in injured arteries treated with miR-22 AgomiR (Figure 7A). [score:7]
Ling B Wang GX Long G Qiu JH Hu ZL Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3. [score:6]
To further understand the functional significance of EVI1 in miR-22–induced VSMC phenotype switching, control VSMCs and EVI1 knockdown VSMCs were transfected with either a control inhibitor or a miR-22 inhibitor. [score:6]
RT-qPCR analysis verified that miR-22 was successfully overexpressed and knocked down in VSMCs by miR-22 mimics and inhibitor, respectively, in control, serum, and PDGF-BB treatments (Figure 3A and 3B). [score:6]
It is important to note that VSMC proliferation (Figure VIE in the online-only Data Supplement) and migration (Figure VIF in the online-only Data Supplement) were significantly decreased by MECP2 knockdown, demonstrating that MECP2 suppression can recapitulate the effects of miR-22 overexpression in VSMC phenotypic modulation. [score:6]
The transcriptional regulator and oncoprotein EVI1 was predicted as one of the target genes of miR-22 by Targetscan (Figure 4A). [score:6]
miR-22 Promoter, EVI1 3′–Untranslated Region Reporter, and Mutation of miR-22 Binding Site Within EVI1 3′–Untranslated Region Reporter. [score:6]
C, miR-22 expression was downregulated in the extended culture of murine VSMCs. [score:6]
Our previous study showed that miR-22 targets MECP2 during VSMC differentiation from stem cells, [34] leading to our hypothesis that MECP2 may also be a downstream target of miR-22 during VSMC phenotype switching. [score:5]
A recent study showed that miR-22 expression is regulated by a P53 -dependent mechanism during cardiac aging, [30] and such a mechanism may be responsible for miR-22 regulation during VSMC phenotypic modulation. [score:5]
Inhibition of HDAC4 mimics miR-22 overexpression during VSMC phenotype switching (Figure VIIB through VIID in the online-only Data Supplement). [score:5]
32, 33, 46, 47 A phenotypic screen with primary rat cardiomyocytes has suggested that miR-22 has prohypertrophic potential, [46] which was further confirmed by using transgenic mice: specifically, global or cardiac-specific deletion of miR-22 blunted stress -induced cardiac hypertrophy and remo deling, 32, 33 whereas cardiac-specific overexpression of miR-22 induced a prohypertrophic gene expression profile and elicited cardiac dilation and heart failure. [score:5]
Data from RT-qPCR and Western blot analyses showed that both MECP2 mRNA and protein expression levels are decreased in VSMCs by miR-22 overexpression (Figure VIA and VIB in the online-only Data Supplement). [score:5]
By performing miR gain- and loss-of function studies, we demonstrated that miR-22 promotes VSMC contractile gene expression and inhibits VSMC proliferation and migration. [score:5]
We next examined the clinical relevance of miR-22 expression and its target genes in human femoral arteries. [score:5]
The expression of 4 VSMC genes (SMαA, SM22α, SM-myh11, and SMTN-B) was also significantly increased in VSMCs transfected with miR-22 mimics (Figure IA in the online-only Data Supplement) and significantly decreased in VSMCs treated with the miR-22 inhibitor (Figure IB in the online-only Data Supplement). [score:5]
33, 46 miR-22 overexpression decreased the expression level of HDAC4 (Figure VIIA in the online-only Data Supplement). [score:5]
Furthermore, normal and diseased human femoral arteries were harvested, and various in vivo, ex vivo, and in vitro mo dels of VSMC phenotype switching were conducted to examine miR-22 expression during VSMC phenotype switching. [score:5]
B, Expression levels of miR-22 (relative to U6, %) and its target genes, MECP2 (relative to 18S, ‰) and EVI1 (relative to 18S, ‰), are shown for each HFA and DFA specimen (dots). [score:5]
Data from flow cytometry analyses showed that the percentages of live, early apoptotic, late apoptotic, and necrotic VSMCs were not significantly changed by either miR-22 overexpression (Figure IVA and IVC in the online-only Data Supplement) or inhibition (Figure IVB and IVD in the online-only Data Supplement), indicating that miR-22 was not involved in either extended serum starvation or H [2]O [2] -induced VSMC apoptosis. [score:5]
B and C, Locally enforced expression of miR-22 inhibited neointima formation in wire-injured femoral arteries. [score:5]
Indeed, we found that the P53-specific inhibitor, Pifithrin-α (15 µmol/L), actively reduced miR-22 expression in TGF-β1–treated VSMCs (Figure 2D). [score:5]
These findings suggest therapeutic potential for harnessing local ectopic expression of miR-22 to suppress neointima hyperplasia after arterial injury. [score:5]
Consequently, although the application of control AgomiRs (Cel-miR-67 AgomiR) in the injured artery exhibited pronounced neointima hyperplasia after 28 days, miR-22 overexpression significantly inhibited neointima formation, as evidenced by decreased intima area and intima/media ratio in the miR-22 AgomiR–treated injured artery, although the media area experienced no significant change (Figure 7B and 7C). [score:5]
It is more important that significant inverse relationships between miR-22 and its downstream targets, MECP2 and EVI1, were observed in both healthy and diseased femoral arteries (Figure 8C and Figure IX in the online-only Data Supplement). [score:5]
Our findings on the miR-22–EVI1 and miR-22–MECP2 signaling axes in vascular smooth muscle cell phenotypic modulation present miR-22 and its target genes (EVI1 and MECP2) as novel biomarkers for peripheral arterial diseases. [score:5]
We applied a wire-injury mouse mo del, and local delivery of AgomiR-22 or miR-22 inhibitor, as well, to explore the therapeutic potential of miR-22 in vascular diseases. [score:5]
The expression level of miR-22 was significantly decreased, whereas the expression levels of MECP2 and EVI1 were dramatically increased in DFA. [score:5]
D, TGF-β1 upregulated miR-22 in a P53-depedent manner. [score:4]
Here, we sought to determine whether either of these mechanisms was responsible for regulating miR-22 expression during VSMC phenotype switching in cultured VSMCs. [score:4]
[30] These important studies provide clear evidence to suggest that a fine balance of miR-22 expression and regulation is critical for maintaining adequate cardiac functions. [score:4]
MicroRNA-22 (miR-22) has recently been reported to play a regulatory role during vascular smooth muscle cell (VSMC) differentiation from stem cells, but little is known about its target genes and related pathways in mature VSMC phenotypic modulation or its clinical implication in neointima formation following vascular injury. [score:4]
Combined with the previous finding that another miR-22 target, MECP2, also modulates H3K9me3 enrichment within promoter regions of VSMC-specific genes, [34] these results imply that epigenetic modification within VSMC gene promoters may be one of the underlying pathways through which miR-22 regulates VSMC phenotype switching. [score:4]
A, miR-22 was significantly downregulated after injury in the in vivo mouse mo del. [score:4]
RT-qPCR data also showed downregulation of miR-22, and the VSMC markers (SmαA and SM-myh11), as well, in the explanted cultured thoracic aortic tissues (Figure 1B, ex vivo). [score:4]
Among them, 23 validated/predicted targets of miR-22 were selected for further study, because they are known to play key regulatory roles in both VSMC functions (differentiation, proliferation, migration, apoptosis, and cell cycle) 11, 43– 45 and vascular biology [34] (Figure V in the online-only Data Supplement). [score:4]
[53] A recent study showed that miR-22 expression is regulated by a P53 -dependent mechanism during cardiac aging. [score:4]
D, Serum (l eft) and PDGF-BB (r ight) downregulated miR-22 in cultured VSMCs. [score:4]
Expression of miR-22 was closely regulated during VSMC phenotypic modulation. [score:4]
E, Serum starvation and TGF-β1 upregulated miR-22 in cultured VSMCs. [score:4]
A, PDGF-BB and serum significantly downregulated miR-22, and its primary (pri-miR-22) and precursor (premiR-22) transcripts, as well. [score:4]
Taken together, we present in this study compelling evidence that miR-22 is a novel regulator of VSMC phenotype switching and vascular neointima lesion formation, which acts via its target genes, MECP2, HDAC4, and EVI1. [score:4]
Our data demonstrate that miR-22 and EVI1 are novel regulators of VSMC function, specifically during neointima hyperplasia, offering a novel therapeutic opportunity for treating vascular diseases. [score:4]
A transcriptional regulator and oncoprotein, EVI1 (ecotropic virus integration site 1 protein homolog), has been identified as a novel miR-22 target gene in VSMC phenotypic modulation. [score:4]
B, TGF-β1 significantly upregulated miR-22, pri-miR-22, and premiR-22. [score:4]
As expected, 2 previously reported miR-22 target genes, MECP2 (methyl-CpG binding protein 2) and histone deacetylase 4, exhibited a regulatory role in VSMC phenotypic modulation. [score:4]
It is important to note that VSMC proliferation, growth, and migration were significantly inhibited by miR-22 overexpression as demonstrated in bromodeoxyuridine incorporation analysis (Figure 3C), cell counting (Figure IIA in the online-only Data Supplement), transwell migration (Figure 3D), and wound-healing assays (Figure IIB in the online-only Data Supplement). [score:4]
[30] In this study, we have provided definitive evidence that miR-22 gene expression in VSMCs is regulated by PDGF-BB and TGF-β1 through modulation of gene promoter activity (Figure 2C). [score:4]
[62] Our finding that the miR-22/EVI1 signaling axis plays an important role in VSMC phenotypic modulation and arterial remo deling may offer a possible mechanistic basis for the beneficial effect of AES on in-stent restenosis, and suggests that correcting the dysregulation of miR-22 and EVI1 in atherosclerotic arteries through a site-specific delivery of miR-22 mimics to the stented vessels by using a miR-22–coated balloon or stent, or ultrasound-triggered nano delivery technology, could be a potential treatment to prevent or inhibit in-stent restenosis. [score:4]
The regulatory mechanisms of miR-22 expression in VSMCs are only partially known. [score:4]
Total RNA, including miR (miR-22) and mRNA (SMαA, SM-myh11, and CNN1), was harvested from freshly cultured VSMCs (cultured until day 7 and then split, designated P0), and VSMCs with the indicated passage number (P0, P3, P8, P9, or P12) were subjected to RT-qPCR analysis to obtain relative expression levels. [score:3]
VSMCs transfected with miR-22 mimics, inhibitor, or respective controls (Ctrl), as indicated, were subjected to serum starvation for 48 hours. [score:3]
In addition to MECP2, HDAC4 is another reported target of miR-22. [score:3]
Mechanistically, we have confirmed that MECP2, HDAC4, and EVI1 are the authentic downstream targets of miR-22 during VSMC phenotype switching. [score:3]
r is the Spearman rank correlation coefficient between the expression levels of MECP2/EVI1 and miR-22. [score:3]
miR-22 binding site mutation was introduced into pmiR-Luc-EVI1 by using the QuikChange site-directed mutagenesis kit (Agilent Technologies) according to the manufacturer’s instructions and designated as pmiR-Luc-EVI1-mutant. [score:3]
It is noteworthy that our identification of the miR-22/EVI1 signaling axis in human atherosclerotic plaques presents potential clinical application toward treating cardiovascular disease. [score:3]
We show that local transfer of miR-22 onto the injured arteries can restore synthetic VSMCs to a contractile phenotype, providing a basis for using site-specific delivery of miR-22 mimics via miR-22–coated stents to prevent or inhibit in-stent restenosis. [score:3]
miR-22 Expression Is Modulated During VSMC Phenotype Switching In Vivo, Ex Vivo, and In Vitro. [score:3]
Figure 7. Modulation of miR-22 expression in the injured arteries influences neointima formation. [score:3]
Hence, extending our studies to a hyperlipidemia -induced atherogenic animal mo del is required to validate the therapeutic potential of miR-22 in other cardiovascular diseases. [score:3]
EVI1 as Novel Gene Target of miR-22. [score:3]
We demonstrate that miR-22 controls vascular smooth muscle cell phenotype and injury -induced arterial remo deling by modulating multiple target genes (MECP2, HDAC4, and EVI1). [score:3]
Figure 1. miR-22 expression is closely modulated during VSMC phenotype switching. [score:3]
A, RT-qPCR analysis confirmed miR-22 overexpression in VSMCs transfected with miR-22 mimics on PDGF-BB and serum treatment. [score:3]
Our previous publication suggested that miR-22 is transcriptionally regulated by PDGF-BB and TGF-β1 during VSMC differentiation from stem cells, but no direct evidence has been obtained. [score:3]
Potential Downstream Targets of miR-22 During VSMC Phenotype Switching. [score:3]
EVI1 Is a Novel Target Gene and Responsible for miR-22–Mediated VSMC Phenotype Switching. [score:3]
Altogether, these data confirm that expression of miR-22 is altered during phenotype switching in vivo, ex vivo, and in vitro. [score:3]
Figure 4. EVI1 is the novel target of miR-22 in VSMCs. [score:3]
The MECP2 3′-UTR reporter [34] activity was also significantly inhibited by miR-22 mimics (Figure VIC in the online-only Data Supplement). [score:3]
Conserved miR-22 binding site(s) were found within 270 genes by using Targetscan. [score:3]
It is important to note that increased miR-22 expression via perivascular transfection of miR-22 AgomiR was specific to injured arteries, yet absent in other organs/tissues (eg, heart, skeletal muscle, spleen, liver, kidney, and lung) (data not shown). [score:3]
miR-22 loss of function was conducted by local application of LNA-miR-22 (locked nucleic acid–modified miR-22 inhibitor) in the injured arteries. [score:3]
Role of miR-22 in Heart Disease and Vascular Remo deling. [score:3]
The luciferase activity of EVI1 3′-UTR reporter was significantly repressed by miR-22 mimics but enhanced by miR-22 inhibition (Figure 4E). [score:3]
Furthermore, miR-22 expression in cultured VSMCs was reduced in response to platelet-derived growth factor BB (PDGF-BB) and serum stimulation (Figure 1D), whereas the opposite effect was seen in the serum-starved VSMCs (Figure 1E). [score:3]
VSMCs transfected with miR-22 gene promoter (pGL3-miR-22) were subjected to serum starvation for 24 hours, followed by incubation with vehicle (TGF-β1–, Pifithrin-α–) or TGF-β1 (5 ng/mL) for 24 hours in the absence or presence of 15 µmol/L P53-specific inhibitor, Pifithrin-α. [score:3]
[47] In a more clinically relevant study, pharmacological inhibition of miR-22 promoted cardiac functional recovery after myocardial infarction by eliciting cardiac autophagy. [score:3]
Gurha P Wang T Larimore AH Sassi Y Abreu-Goodger C Ramirez MO Reddy AK Engelhardt S Taffet GE Wehrens XH Entman ML Rodriguez A microRNA-22 promotes heart failure through coordinate suppression of PPAR/ERR-nuclear hormone receptor transcription. [score:3]
This inverse relationship between miR-22 and MECP2 and EVI1 was evident in both healthy and diseased human femoral arteries. [score:3]
These data suggested that miR-22 also targets HDAC4 in mature VSMCs. [score:3]
To test our hypothesis that miR-22 plays a role in VSMC phenotype switching, we transfected murine and human VSMCs with miR-22 mimics or miR-22 inhibitor and then subjected the transfected cells to various analyses. [score:3]
Zhang G Xia S Tian H Liu Z Zhou T Clinical significance of miR-22 expression in patients with colorectal cancer. [score:3]
Therefore, extending our studies to other human arteries (eg, coronary/carotid arteries) would be a promising next step for exploring the therapeutic application of miR-22 in various cardiovascular diseases. [score:3]
VSMCs were transfected with miR-22 mimics, miR-22 inhibitor, or respective negative control miR (miRNA ctrl), followed by 24 hours of serum starvation. [score:3]
It is interesting to note that a similar decreased expression pattern was observed for miR-22 (Figure 1C). [score:3]
In this study, we provide compelling evidence that EVI1 is the target gene of miR-22–mediated VSMC phenotype modulation and is a transcriptional repressor for multiple VSMC contractile genes. [score:3]
Moreover, VSMC contractile gene expression, proliferation, and migration, but not apoptosis, were modulated by miR-22. [score:3]
Opposite from miR-22 (Figure 1C), EVI1 gene expression was dramatically increased in the extended passages (P8, P9, and P12) of cultured murine VSMCs (Figure 4B). [score:3]
miR-22 has been primarily identified as a tumor suppressor, but later studies have identified miR-22 as a prohypertrophic miR. [score:3]
Gurha P Abreu-Goodger C Wang T Ramirez MO Drumond AL van Dongen S Chen Y Bartonicek N Enright AJ Lee B Kelm RJ Jr Reddy AK Taffet GE Bradley A Wehrens XH Entman ML Rodriguez A Targeted deletion of microRNA-22 promotes stress -induced cardiac dilation and contractile dysfunction. [score:3]
Spearman rank correlation analyses were conducted to characterize the relationships between the gene expression levels of miR-22 and its target genes, MECP2 (methyl-CpG binding protein 2) and EVI1. [score:3]
D through F, miR-22 inhibition promotes neointima formation in the injured arteries. [score:3]
A, The predicted miR-22 binding site within EVI1 3′-UTR by Targetscan. [score:3]
Thus, these data provide critical information about the functional relevance of miR-22 and its target genes in human atherosclerotic lesions. [score:3]
Conversely, an increased capacity to proliferate, grow, and migrate was observed in VSMCs transfected with the miR-22 inhibitor (Figure 3E and 3F, Figure IIC and IID in the online-only Data Supplement). [score:3]
A through C, Local enforced expression of miR-22 reduces neointima formation in the injured femoral arteries. [score:3]
Taken together, we demonstrate that EVI1 is a novel target gene that is at least partially responsible for miR-22 -mediated VSMC phenotype switching. [score:3]
EVI1 indicates ecotropic virus integration site 1 protein homolog; miR-22, microRNA-22; RT-qPCR, reverse transcription quantitative polymerase chain reaction; 3′-UTR, 3′-untranslated region; and VSMC, vascular smooth muscle cell. [score:3]
A, Perivascular delivery of miR-22 AgomiRs reversed the gene expression profiles in wire -induced femoral artery injury. [score:3]
miR-22 mimics, inhibitor, or respective controls (Ctrl) were cotransfected with EVI1 3′-UTR reporter into VSMCs, as indicated. [score:3]
Figure 2. miR-22 is transcriptionally regulated in VSMC phenotypic modulation. [score:2]
Although the majority of miR-22 studies were conducted in cancer cells or cardiac cells, we recently reported an important role for miR-22 in VSMC differentiation from stem cells both in vitro and in vivo, [34] inferring a regulatory role for miR-22 in VSMC biology. [score:2]
F, Transwell migration assays showed significantly increased migration of VSMCs transfected with the miR-22 inhibitor under both PDGF-BB and serum stimulation. [score:2]
Furthermore, our data also show that TGF-β1 transcriptionally regulates miR-22 in VSMCs via a P53 -dependent mechanism. [score:2]
These data demonstrate that TGF-β1 can regulate miR-22 transcription in VSMCs, likely through a P53 -dependent mechanism. [score:2]
VSMC Apoptosis Is Not Regulated by miR-22. [score:2]
E, BrdU assays revealed significantly increased absorbance and therefore proliferation of VSMCs transfected with the miR-22 inhibitor on PDGF-BB and serum treatment. [score:2]
The mutation site in EVI1 mutant and corresponding sequences in wild-type EVI1 and mmu-miR-22 are underlined and bold. [score:2]
miR-22 Is Transcriptionally Regulated During VSMC Phenotypic Modulation. [score:2]
We specifically show that miR-22 is transcriptionally regulated by serum, PDGF-BB, and TGF-β1. [score:2]
C and D, EVI1 was negatively regulated by miR-22. [score:2]
Transcriptional Regulation of miR-22. [score:2]
Our observation first establishes the TGF-β1/P53/miR-22 signaling axis and uncovers the regulatory role of PDGF-BB, TGF-β1, and P53 signaling pathways in VSMC phenotypic modulation. [score:2]
C, PDGF-BB significantly decreases, whereas TGF-β1 significantly increases miR-22 gene promoter activity. [score:1]
RT-qPCR analysis was used to examine the mRNA (SMαA and SM-myh11) and miR (miR-22) levels in the freshly isolated aortas and the aortas cultured in DMEM containing 20% serum for 3 days. [score:1]
Xu D Takeshita F Hino Y Fukunaga S Kudo Y Tamaki A Matsunaga J Takahashi RU Takata T Shimamoto A Ochiya T Tahara H miR-22 represses cancer progression by inducing cellular senescence. [score:1]
F, miR-22 binding site was required for miR-22–mediated EVI1 gene repression. [score:1]
Amplified DNA fragments were cloned into the Kpn I and Mlu I sites of the pGL3-basic vector (Promega), designated as pGL3-miR-22. [score:1]
40– 42 To explore any potential roles of miR-22 in VSMC apoptosis, serum-starved VSMCs were subjected to extended serum starvation (96 hours) (Figure IVA and IVB in the online-only Data Supplement) or incubation with 10 µmol/L H [2]O [2] (Figure IVC and IVD in the online-only Data Supplement) to induce apoptosis. [score:1]
After wire injury, 100 µL of 30% pluronic gel containing vehicle (mock transfection, Mock), 2.5 nmol control LNA (scrambled LNA, Scrbl-LNA), or LNA-miR-22 per artery per mouse was immediately applied and packed around injured femoral arteries. [score:1]
Functional Role of miR-22 in VSMC Phenotype Switching. [score:1]
These observations prompted us to investigate whether or not EVI1 is a novel target gene of miR-22 during VSMC phenotype switching. [score:1]
We measured expression of miR-22, its primary (Pri-miR-22) transcript, and its precursor (Pre-miR-22) transcript. [score:1]
BrdU indicates bromodeoxyuridine; miR-22, microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-qPCR, reverse transcription quantitative polymerase chain reaction; and VSMC, vascular smooth muscle cell. [score:1]
Total RNA was harvested and subjected to RT-qPCR analysis to examine miR-22 and its transcripts. [score:1]
By using various in vivo, ex vivo, and in vitro mo dels of VSMC phenotypic modulation, we identified a novel role of miR-22 as a mediator of VSMC phenotype switching and neointima formation. [score:1]
Seven days (D) or 4 weeks (E and F) later, injured segments of femoral arteries were harvested for RT-qPCR analyses (D), H&E staining (E), and morphological quantification (F) (n=5 mice for Mock and n=10 mice for LNA-miR-22 and Scrbl-LNA). [score:1]
These findings are consistent with the notion that miR-22 promoted VSMC phenotype switching from its proliferative, synthetic state to a contractile phenotype after vascular injury. [score:1]
To determine the therapeutic potential of miR-22 in postinjury arterial remo deling, 2.5 nmol of miR-22 or Cel-miR-67 AgomiRs (negative control) was perivascularly applied to femoral arteries immediately after wire -induced injury as described in our previous studies. [score:1]
EVI1 indicates ecotropic virus integration site 1 protein homolog; H&E, hematoxylin and eosin; MECP2, methyl-CpG binding protein 2; miR-22, microRNA-22; and RT-qPCR, reverse transcription quantitative polymerase chain reaction. [score:1]
Similar findings from human aortic SMCs also supported that miR-22 plays an important role during human VSMC phenotypic modulation (Figure III in the online-only Data Supplement). [score:1]
EVI1 indicates ecotropic virus integration site 1 protein homolog; HDAC4, histone deacetylase 4; H&E, hematoxylin and eosin; LNA, locked nucleic acid; MECP2, methyl-CpG binding protein 2; miR-22, microRNA-22; PCNA, proliferating cell nuclear antigen; and RT-qPCR, reverse transcription quantitative polymerase chain reaction. [score:1]
# P<0.05 (miR-22 AgomiRs versus Cel-miR-67 AgomiRs in the injured arteries). [score:1]
To explore the potential function of miR-22 in VSMC phenotype switching, we examined in vivo, ex vivo, and in vitro mouse mo dels of VSMC phenotype switching. [score:1]
miR-22 indicates microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-qPCR, reverse transcription quantitative polymerase chain reaction; TGF-β1, transforming growth factor β1; and VSMC, vascular smooth muscle cell. [score:1]
The induction of miR-22 in VSMCs was further enhanced by transforming growth factor β1 (TGF-β1) treatment 24 hours and 48 hours after serum starvation (Figure 1E). [score:1]
However, the role for miR-22 in VSMC phenotypic modulation had not been explored until our present study. [score:1]
We show that microRNA-22 (miR-22) is a novel mediator of vascular smooth muscle cell phenotypic modulation and neointima formation. [score:1]
B, miR-22 was decreased in the ex vivo cultured thoracic aortas. [score:1]
C, Spearman rank correlation analyses were performed to characterize the relationships between the gene expression levels of MECP2/EVI1 and miR-22 in HFA and DFA specimens. [score:1]
Reverse transcription quantitative polymerase chain reaction (RT-qPCR) data showed that miR-22 was significantly decreased in the injured versus uninjured femoral arteries (Figure 1A, in vivo). [score:1]
Huang ZP Chen J Seok HY Zhang Z Kataoka M Hu X Wang DZ MicroRNA-22 regulates cardiac hypertrophy and remo deling in response to stress. [score:1]
Therapeutic Potential of miR-22 for Postinjury Arterial Remo deling. [score:1]
Figure 3. miR-22 modulates VSMC proliferation and migration. [score:1]
miR-22 mimics or control miR mimics (miRNA ctrl) were cotransfected into VSMCs with wild-type reporter (pmiR-EVI1-WT) or the reporter containing mutated miR-22 binding site (pmiR-EVI1-mutant). [score:1]
Mouse Femoral Artery Denudation Injury and Perivascular Delivery of miR-22 AgomiRs or LNA-miR-22. [score:1]
DMEM indicates Dulbecco’s modified Eagle’s medium; miR-22, microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-qPCR, reverse transcription quantitative polymerase chain reaction; TGF-β1, transforming growth factor β1; and VSMC, vascular smooth muscle cell. [score:1]
# P<0.05 (LNA-miR-22 versus Mock and Scrbl-LNA). [score:1]
BrdU indicates bromodeoxyuridine; EVI1, ecotropic virus integration site 1 protein homolog; miR-22, microRNA-22; PDGF-BB, platelet-derived growth factor BB; RT-qPCR, reverse transcription quantitative polymerase chain reaction; shRNA, small hairpin RNA; and VSMC, vascular smooth muscle cell. [score:1]
VSMCs transfected with miR-22 gene promoter (pGL3-miR-22) were subjected to serum starvation for 24 hours, followed by mock treatment (Ctrl) or incubation with PDGF-BB (10 ng/mL) or TGF-β1 (5 ng/mL) for 6 hours. [score:1]
Local delivery of miR-22 in the injured arteries prevents adverse arterial remo deling, suggesting that the site-specific delivery of miR-22 mimics as a potential therapy for in-stent restenosis. [score:1]
EVI1, miR-22 sequence (mmu-miR-22), and the miR-22 binding site mutant (EVI1 mutant) are depicted in this illustration. [score:1]
After wire -induced injury, 100 µL of 30% pluronic gel containing 2.5 nmol control AgomiR (Cel-miR-67 AgomiR) or miR-22 AgomiR per artery per mouse was immediately applied and packed around the injured femoral arteries. [score:1]
E, miR-22 repressed EVI1 3′-UTR reporter activity. [score:1]
First, we chose the mouse wire-injury mo del to study the therapeutic potential of miR-22 for treating postangioplasty restenosis, because it partially mimics balloon angioplasty and intraluminal stent placement, but further investigation using a stent mo del would increase the translational feasibility of our current findings. [score:1]
Paraffin sections from both groups (n=15 mice for Cel-miR-67 and n=13 mice for miR-22 AgomiRs) were prepared and subjected to H&E staining. [score:1]
[1 to 20 of 187 sentences]
2
[+] score: 361
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
Ling et al. [36] demonstrated that miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of epidermal growth factor receptor 3. In prostate cancer, Pasqualini et al. [37] showed that miR-22 and miR-29a were less abundant in the cancerous tissue compared with the benign counterpart and functioned as tumor suppressors by modulating cancer associated targets LAMC1 and Mcl-1. In colon and liver cancer, Yang et al. [34] demonstrated that miR-22 had a tumor-suppressive effect by inhibiting cyclin A2 expression. [score:13]
[28] To confirm whether downregulation of MMP14 and Snail by miR-22 could result in inhibition of migration and invasion of GC cells, we knocked down the expression of endogenous MMP14 or Snail by their small interfering RNAs (siRNAs) to mimic the effects of miR-22 overexpression. [score:11]
Inhibition of miR-22 promotes cell proliferation, invasion and migration in GC cells in vitroTo be logical and direct demonstration of the consequences of the low expression levels of miR-22 in GC, we performed miR-22 inhibition experiments by anti-miR-22 transfection in the AGS cell line, in which miR-22 expression was higher than other three GC cell lines (Figure 1f). [score:10]
On the other hand, miR-22 downregulation promotes GC invasion and metastasis by upregulating Snail, causing E-cadherin downregulation and then inducing EMT (Figure 7). [score:10]
Ectopic expression of miR-22 suppresses cell proliferation, migration and invasion in GC cells in vitroTo better understand the mechanistic role of miR-22 in gastric carcinogenesis, we performed miR-22 overexpression experiments by miR-22 transfection in the SGC-7901 cell line, in which miR-22 expression was lowest among four GC cell lines (Figure 1f). [score:9]
Our results indicate that miR-22 is downregulated in GCs and downregulation of miR-22 is correlated with GC progression and poor survival, and suggest an invasion and metastasis inhibition function of miR-22 in GC. [score:9]
Our results also indicated that MMP14 or Snail knockdown suppressed GC cells migration and invasion, which phenocopied the effects of miR-22 overexpression in vitro, and ectopic expression of MMP14 or Snail restored the effects of miR-22 on cell migration and invasion in GC cells. [score:8]
When compared with the predicted targets by TargetScan, 36 target genes, which have miR-22 seed sites, were screened via TargetScan and microarray analysis (Figure 4a). [score:8]
As the function of miRNAs in tumor development is dependent on targeting their key target genes, it is crucial important to identify the targets of miR-22. [score:8]
Guo et al. [19] showed miR-22 was downregulated in GC, and it inhibited cell migration and invasion via targeting transcription factor Sp1. [score:8]
To be logical and direct demonstration of the consequences of the low expression levels of miR-22 in GC, we performed miR-22 inhibition experiments by anti-miR-22 transfection in the AGS cell line, in which miR-22 expression was higher than other three GC cell lines (Figure 1f). [score:8]
As MMP14 and Snail transcripts were identified as direct targets of miR-22, we examined the relationship between their mRNA expression and miR-22 expression in the 61 GC tissues using qRT-PCR. [score:8]
When the mRNA and protein levels of both MMP14 and Snail were significantly reduced by siRNAs in SGC-7901 cell (Figures 5a, c, d and f), invasion and migration of the cells were correspondingly significantly inhibited (Figures 5g and h), suggesting that the inhibitory effects of miR-22 on cells migration and invasion could, at least partially, act through its inhibition of MMP14 and Snail activities. [score:7]
In vitro functional analysis and expression of MMP14 and Snail in GC cells, and ectopic expression of MMP14 or Snail restores inhibitory effects of miR-22 on cell migration and invasion in GC cells. [score:7]
The results showed that miR-22 appeared to be elevated in human MDS and leukemia and its deregulation expression correlated with poor survival of patients and TET2 downregulation. [score:7]
Among these candidate targets, MMP14 and Snail were predicted as novel targets of miR-22 and were selected as our target genes in GC for further study, as they have been shown to associate with prognosis and metastasis in patients with GCs. [score:7]
In vitro functional analysis and expression of MMP14 and Snail in GC cells, and ectopic expression of MMP14 or Snail restores inhibitory effects of miR-22 on cell migration and invasion in GC cellsMMP14 has been suggested to involve in cancer invasion and metastasis by degrading the ECM and increasing the secretion of pro-MMP2 and pro-MMP9. [score:7]
MiR-22 is downregulated in primary tumor tissues of GC and downregulation of miR-22 is correlated with GC progression and poor survival. [score:7]
Furthermore, our results indicated that miR-22 directly targeted ECM remo deling member MMP14 and EMT inducer Snail, leading to repressed cell proliferation and inhibited cell invasion and migration in GC cells. [score:6]
23, 24, 29, 30 To determine whether MMP14 and Snail are direct targets of miR-22, wild-type and mutant 3′ untranslated regions (3′UTRs) of MMP14 and Snail were cloned into the downstream of firefly luciferase coding region in pGL-3 luciferase reporter vector. [score:6]
MiR-22 downregulation promotes GC invasion and metastasis by upregulating MMP14, causing MMP2 activation and then inducing ECM remo deling (Figure 7). [score:6]
37, 38 Yang et al. [38] showed that miR-22 was significantly downregulated in ESCC tissues and inhibited the ESCC cells migration and invasion in vitro. [score:6]
It is probable that the upregulation of MMP14 or Snail by suppression of miR-22 contributed to tumor progression in GC. [score:6]
As shown in Figures 4e–g, overexpression of miR-22 resulted in significant reduction in MMP14 and Snail mRNA transcription as well as protein expression. [score:5]
Moreover, we used SGC-7901 and HGC-27 cells co -transfected with miR-22 and MMP14 or Snail to test whether overexpression of MMP14 or Snail could reverse the inhibitory effects of miR-22 on migration and invasion of GC cells. [score:5]
As predicted, MMP14 and its target MMP2 expression were markedly decreased in the GC cells after transfection with miR-22, and were restored when the GC cells were co -transfected with pcDNA3.1-MMP14 and miR-22 mimics (Figure 5k). [score:5]
Snail expression was markedly decreased and Snail targets E-cadherin was markedly increased in the GC cells after transfection with miR-22, and were restored when the GC cells were co -transfected with pcDNA3.1-MMP14 and miR-22 mimics (Figure 5l). [score:5]
In addition, low-level expression of miR-22 in GC was significantly associated with a more aggressive GC phenotype, and miR-22 low expression correlated with poor overall survival. [score:5]
Wang et al. [18] demonstrated that miR-22 suppressed the proliferation and invasion of GC cells by inhibiting CD151. [score:5]
To better understand the mechanistic role of miR-22 in gastric carcinogenesis, we performed miR-22 overexpression experiments by miR-22 transfection in the SGC-7901 cell line, in which miR-22 expression was lowest among four GC cell lines (Figure 1f). [score:5]
Overexpression of miR-22 inhibited cell proliferation in SGC-7901 at 48 h, 72 h after transfection. [score:5]
Ectopic expression of miR-22 suppresses cell proliferation, migration and invasion in GC cells in vitro. [score:5]
These findings suggest that miR-22 regulate cell proliferation, migration and invasion through different target genes and are thereby intimately involved in the development and progression of GC. [score:5]
These results suggested that MMP14 and Snail could be direct targets of miR-22. [score:4]
[40] MiR-22 exhibits complex dysregulation in different circumstances and different subcellular distributions, therefore, miR-22 expression may be oppositely changed in the progressions of different tumors. [score:4]
In the wound-healing assay, high miR-22 expression significantly suppressed the ability of cells to migrate (Figures 2c and d). [score:4]
Song et al. [39] demonstrated that miR-22 exerted its metastatic potential by silencing antimetastatic miR-200 through direct targeting of the Ten eleven translocation (TET) family of methylcytosine dioxygenases, thereby chromatin remo deling toward miR-200 transcriptional silencing. [score:4]
These data clearly demonstrated that MMP14 and Snail contribute to cell invasion and migration in GC and were direct and functional targets of miR-22. [score:4]
To identify the roles of miR-22 in the development of GC, we analyzed the expression level of miR-22 in 61 pairs of frozen GCs and matched adjacent normal mucosa (NM) tissues by quantitative real-time PCR (qRT-PCR). [score:4]
When the 61 tumors were stratified, based on clinicopathological features, we found that miR-22 expression was significantly decreased in primary tumors that subsequently metastasized compared with those that did not metastasize (P<0.01; Figure 1c), and low-level expression of miR-22 in GC was significantly associated with a more aggressive tumor phenotype (P< 0.01, stage I/II versus III/IV; Figure 1d). [score:4]
In GCs, integrative network analysis by Tseng et al. [41] showed that compared with the normal gastric tissues, miR-22 was one of the 23 downregulated miRNAs in cancerous tissues. [score:3]
MiR-22 was transiently inhibited in AGS cells with anti-miR-22 (Figure 3a). [score:3]
To further determine whether miR-22 can decrease endogenous MMP14 and Snail expression, we transfected miR-22 mimics in SGC-7901 and HGC-27 cells. [score:3]
Then, we analyzed the effect of ectopic miR-22 expression on cellular invasion and migration potential of SGC-7901 cells. [score:3]
Then, we analyzed the effect of inhibition of miR-22 levels on cellular proliferation, invasion and migration potential of AGS cells. [score:3]
MiR-22 inhibited the growth of SGC-7901-engrafted tumors and repressed the peritoneal dissemination and distal pulmonary metastases in vivoTo further investigate the contribution of miR-22 in vivo, we selected SGC-7901 cell, which possesses the lowest expression of miR-22 to perform the tumor xenograft studies, peritoneal dissemination and pulmonary metastasis via BALB/c nude mice mo dels. [score:3]
Collectively, these results indicated that ectopic miR-22 significantly suppressed cell proliferation, migration and invasion in vitro. [score:3]
In conclusion, we identified that miR-22 is a potent tumor suppressor in GC. [score:3]
The relationships between miR-22 and MMP14, or Snail expression level were analyzed by correlation coefficients and linear regression analysis. [score:3]
AGS cells were transfected with miR-NC or anti-miR-22 inhibitor. [score:3]
Overexpression of miR-22 was confirmed by qRT-PCR, as shown in Figure 2a. [score:3]
These findings demonstrated that miR-22 inhibited migration and invasion of GC cells via the miR-22/MMP14/Snail signaling axis. [score:3]
Apart from miR-22 functioned as a tumor suppressor, miR-22 acted as a potent proto-oncogenic miRNA precisely because of its ability to epigenetically derange the biology of the cell. [score:3]
Kaplan–Meier analysis on patients with survival data revealed that miR-22 low expression correlated with poor overall survival (P<0.05; Figure 1e). [score:3]
We also determined the expression of miR-22 in normal gastric mucous epithelium cell (GES-1) and four GC cells (AGS, BGC-823, HGC-27 and SGC-7901). [score:3]
The results showed that the suppression of miR-22 enhanced cell proliferation (Figure 3b), invasion and migration (Figures 3c–g). [score:3]
[17] MiR-22 was identified to be downregulated in diverse cancers, including colon cancer, [34] hepatocellular carcinoma, [34] ovarian cancer, [35] lung cancer, [36] prostate cancer and esophageal squamous cell carcinoma (ESCC). [score:3]
It was shown that miR-22 was downregulated in GC cells (AGS, BGC-823, HGC-27 and SGC-7901) compared with normal gastric mucous epithelium cell (GES-1) (Figure 1f). [score:3]
Together, the data suggest that miR-22 inhibit the growth of SGC-7901-engrafted tumors and repress the peritoneal dissemination and distal pulmonary metastases in vivo. [score:3]
Importantly, overexpressing miR-22 ameliorated progression of GC in an established experimental xenograft mo del and repressed the peritoneal dissemination and distal pulmonary metastases in vivo. [score:3]
Inhibition of miR-22 promotes cell proliferation, invasion and migration in GC cells in vitro. [score:3]
The qRT-PCR analyses showed that the expression of miR-22 was reduced in 44 of 61 (72%) tumor samples compared with their nonmalignant counterparts (Figure 1a). [score:2]
In summary, negative regulation of MMP14 and Snail by miR-22 is clinically relevant in the context of GC. [score:2]
MiR-22 directly regulates MMP14 and Snail in GC cells. [score:2]
The average expression level of miR-22 was significantly decreased in tumor tissues compared with paired NM tissues (P<0.001; Figure 1b). [score:2]
In this study, qRT-PCR validation results showed that miR-22 expression was significantly decreased in GC tissues compared with the paired adjacent normal tissues. [score:2]
To the best of our knowledge, this is the first study to demonstrate that the miR-22/MMP14/Snail axis regulates the proliferation, migration and invasion of GC cells. [score:2]
Most importantly, our results established MMP14 and Snail as direct functional effectors of miR-22 in GC. [score:2]
MiR-22 inhibited the growth of SGC-7901-engrafted tumors and repressed the peritoneal dissemination and distal pulmonary metastases in vivo. [score:2]
Consistent with above findings, our study provides a novel and comprehensive insight into the functional role of miR-22 as it relates to GC development and progression and metastatic processes. [score:2]
In a back to back study, Song et al. identified miR-22 as a key regulator of the self-renewal machinery of the hematopoietic system. [score:2]
Consistent with these evidences that MMP14 and Snail have been implicated in tumor development and progression, our study showed MMP14 and Snail were enriched in the primary GC tissues that inversely correlated to miR-22 levels. [score:2]
Previous studies have suggested that miR-22 functioned in multiple cellular processes, including proliferation, differentiation, senescence and apoptosis, and their deregulation is a hallmark of human cancer. [score:2]
Using a series of in vitro and in vivo assays, we uncovered that miR-22 act as an important tumor suppressor in the normal gastric mucosa. [score:2]
Cells were transfected with the firefly luciferase reporter plasmid including the wild-type or mutant 3′UTR of MMP14 or Snail (50 ng per well), and pRL-TK Renilla luciferase reports (10 ng per well), and then the cells were transfected miR-22 mimics or miR-NC (50 nM). [score:1]
In the transwell invasion and migration assay, cells transfected with miR-22 mimics displayed an inhibition in invasion and migration ability when compared with the control group in SGC-7901 cells (Figures 2e–g). [score:1]
The SGC-7901 cells were transfected with miR-NC, or miR-22 mimics, and AGS cells were transfected with miR-NC or anti-miR-22. [score:1]
MiR-NC, MiR-22 mimics and anti-miR-22 were obtained from RIBOBIO (Guangzhou, China) and transfected with Lipofectamine 2000 (Invitrogen) in AGS, SGC-7901 or HGC-27 cells at a final concentration of 50 nM. [score:1]
MMP14 and Snail regulation by miR-22 was also examined in GC cell lines by western blotting and the luciferase reporter assay. [score:1]
Moreover, our investigation for the expression of MMP14, Snail and miR-22 in 61 GC patients indicated that the mRNA levels of MMP14 or Snail were inversely correlated with miR-22 levels. [score:1]
To measure the effect of miR-22 mimics, anti-miR-22 inhibitor on cellular proliferation rates, SGC-7901, and AGS cells were seeded at a density of 10 [4] per well in 96-well plates, respectively. [score:1]
The results showed that the mRNA levels of MMP14 or Snail were inversely correlated with miR-22 levels in the 61 primary GC tissues (Figures 4h and i). [score:1]
The constructs were then co -transfected with pRL-TK and miR-22 mimics or miR-NC into HEK293T cells, respectively. [score:1]
SGC-7901 and HGC-27 cells were grown to 50–70% confluence and transfected with miR-NC, miR-22 mimics, si_con, si_MMP14#1, si_MMP14#2, si_Snail#1, si_Snail#2, pcDNA3.1 vector, pcDNA3.1-MMP14 vector or pcDNA3.1-Snail vector, co -transfected with miR-22 mimics and pcDNA3.1-MMP14, or co -transfected with miR-22 mimics and pcDNA3.1-Snail, respectively. [score:1]
Function investigation showed that the co-transfection of pcDNA3.1-MMP14 or pcDNA3.1-Snail and miR-22 mimics into SGC-7901 and HGC-27 cells significantly reversed miR-22 -suppressed migration and invasion (Figures 5m and n). [score:1]
To further investigate the contribution of miR-22 in vivo, we selected SGC-7901 cell, which possesses the lowest expression of miR-22 to perform the tumor xenograft studies, peritoneal dissemination and pulmonary metastasis via BALB/c nude mice mo dels. [score:1]
[1 to 20 of 86 sentences]
3
[+] score: 351
To further validate whether miR-22 can directly bind to the 3′UTR of parathymosin to suppress its expression, we generated compensatory mutations on the putative seed region of miR-22 that can restore the sequence complementarity to the mutated binding site 2 (Fig. 7A). [score:7]
The suppression effect of miR-22 on the expression of parathymosin depends on the predicted miR-22 target sites at the 3′UTR of parathymosin. [score:7]
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Total RNA extracted from Dex/OSM treated AR42J-B13 cells (7 Days) and mock controls were used for Northern blot analysis using antisense probes against down-regulated miRNAs (miR-93, miR-106b and miR-130b) and up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
Ectopic overexpression of miR-22 inhibits cell proliferation and induced G1 cell cycle arrest, while a lower expression level of miR-22 correlated with a higher degree of tumorigenicity in human hepatocellular carcinoma patients [15]– [17]. [score:7]
In the former case, miR-22 could directly bind to the 3′ UTR of parathymosin mRNA, and mediate its suppression of gene expression. [score:6]
Therefore, it is possible that miR-22 could affect both mRNA stability and protein translation of parathymosin through its direct targeting at the 3′UTR of parathymosin. [score:6]
Some target prediction algorithms, such as TargetScan 5.2 [21] and miRanda [22], predicted no miR-22 binding sites on the parathymosin 3′UTR with a free energy less than −20 kcal/mol (data not shown). [score:5]
2D-DIGE analysis identified differentially expressed proteins in miR-22 overexpressing AR42J-B13 cells. [score:5]
In this study, we took an approach of proteomic analysis to identify direct or indirect targets of miR-22 in transdifferentiated hepatocytes. [score:5]
Four proteins with altered expression in miR-22 stably overexpressing cells were identified (Fig. 4A). [score:5]
Comparing with the pIRES vector control, miR-22 inhibited the reporter expression by about 50%. [score:5]
As shown in Fig. 4A, the protein expression of vesicle -associated membrane -associated protein B (Vapb) and adenylate kinase isoenzyme 2 (AK2) were increased in cells overexpressing miR-22. [score:5]
For example, miR-22 could affect the expression of another gene(s) which in turn affects the expression of parathymosin. [score:5]
To identify the targets of miR-22, we first performed 2D-DIGE and using these pooled cells stably overexpressing miR-22. [score:5]
Among the 13 up-regulated miRNAs, miR-122a, miR-21, miR-22 were the most enriched in transdifferentiated hepatocytes with a fold change of ∼70, ∼20 and ∼10, respectively (Table 2). [score:4]
Alternatively, miR-22 could have a highly significant indirect effect on the protein expression of parathymosin. [score:4]
MiR-22 inhibited the expression of parathymosin through the 3′UTR binding sites. [score:4]
Compensatory mutations of miR-22 restored the repression effect of miR-22 on the 3′UTR of a parathymosin reporter containing a mu2 target site. [score:4]
Mutations at a single miR-22 binding site (DsRed-ParaT-mu1 or DsRed-ParaT-mu2) did not abolish the suppression effect from pIRES-miR-22 on the reporter activity. [score:4]
We next performed site-directed mutagenesis at each predicted miR-22 target sites at the 3′ UTR of parathymosin. [score:4]
As a preliminary attempt to address this issue, we asked whether transdifferentiation can be perturbed by knocking down the endogenous miR-22 (Fig. 10A–10D) or by overexpressing parathymosin (Fig. 10E–10H). [score:4]
To understand better the biology of miR-22, we identified parathymosin as a potential target of miR-22 (Fig. 4A). [score:3]
We also demonstrated here that miR-22 could reduce the expression of parathymosin by binding to two predicted sites at the 3′ UTR of parathymosin gene. [score:3]
As shown in Table 2, we found increased expression of liver specific miRNAs in transdifferentiated hepatocytes, including miR-122a, miR-21, miR-22, miR-182, miR-29 and miR-30. [score:3]
Mature miRNA of miR-93, miR-106b, miR-130b, miR-21, miR-22 and miR-182 were differentially expressed after transdifferentiation. [score:3]
As shown in Fig. 11, we examined by Western blot analysis the expression of parathymosin in HepG2 and Huh7 cells transfected with LNA-anti-miR-22 or LNA-scramble control, respectively. [score:3]
One of the potential targets of miR-22 that we identified here is parathymosin. [score:3]
In contrast to the clustering miRNA genes as mentioned above, some solo microRNAs, such as miR-22 on chromosome 10 [35] and miR-122a on chromosome 18, can be expressed independently from the other miRNAs. [score:3]
The detailed mechanism of the increased protein expression of Vapb and AK2 by miR-22, directly or indirectly, remains to be investigated in the future. [score:3]
To focus on the less well studied miR-22, we attempted to identify the potential targets of miR-22. [score:3]
We introduced LNA-anti-miR-22 into a B13-1 cell line and monitored the expression of transdifferentiation markers in the transfected culture of B13-1 cells. [score:3]
Parathymosin protein was down-regulated as assayed by 2D-DIGE (A) and Western blot analysis (C) in AR42J-B13 cells stably transfected with pIRES-miR-22. [score:3]
Parathymosin can be targeted by miR-22 in human hepatoma cell lines Huh7 and HepG2. [score:3]
However, the 5–10 fold effect of miR-22 on the protein expression of parathymosin (Fig. 4C) is much greater than its less than 2-fold effect on the mRNA level (Fig. 5C). [score:3]
As shown in Fig. 6A and 6B, there is no perfect match between the putative seed region of miR-22 and the two predicted target sites on parathymosin 3′UTR. [score:3]
As shown in Fig. 6C, the wild type reporter (DsRed-ParaT) activity was subjected to the suppression effect from pIRES-miR-22 (open bar). [score:3]
pIRES-miR-22 is the miR-22 expression vector. [score:3]
As shown in Fig. 10, we have demonstrated that reduction of miR-22 or expression of parathymosin has no major effect on Dex/OSM -induced transdifferentiation. [score:3]
Among a number of miRNAs with significantly altered expression levels, we focused on the less well studied miR-22 in hepatocytes. [score:3]
The DsRed-parathymosin 3′ UTR reporter plasmid (DsRed-ParaT) was cotransfected with the pIRES vector control plasmid or pIRES-miR-22 expression plasmid into AR42J-B13 cells. [score:3]
Indeed, the pIRES-miR-22 compensatory mutant 2 restored the suppression effect on the reporter activity of 3′UTR mutant 2 and mutant 1/2 (Fig. 7B). [score:3]
Reduction of parathymosin mRNA and protein by treatments of Dex/OSM induction or miR-22 overexpression. [score:3]
To distinguish between the potential direct and indirect effects from miR-22, we first conducted computer-aided analysis. [score:3]
While this result strongly suggests that miR-22 is not necessary for transdifferentiation, it remains unclear if miR-22 expression could be sufficient for transdifferentiation. [score:3]
In summary, we used miR-22 as a mo del system to examine the control of gene expression during hepatic transdifferentiation of AR42J-B13 cells. [score:3]
Elevation of gene expression by miR-22. [score:3]
In the latter case, miR-22 could mediate its effect by influencing other cellular genes which in turn reduced the expression of parathymosin. [score:3]
One of the potential targets of miR-22 is parathymosin. [score:3]
Increased expression of parathymosin protein can be detected by Western blot when Huh7 and HepG2 cells were treated with LNA anti-miR-22 (Experimental Procedures). [score:3]
The reduction of the DsRed reporter mRNA in the transient transfection system (Fig. 6D) is consistent with the reduction of parathymosin mRNA in miR-22 overexpressing cell lines by real-time PCR analysis (Fig. 5C). [score:3]
To validate a target of miR-22, we chose to focus on parathymosin. [score:3]
Nor is miR-22 sufficient for transdifferentiation in the absence of Dex/OSM, as we observed no detectable HBsAg when HBV was cotransfected with the miR-22 expresssion vector into AR42J-B13 cells (data not shown). [score:3]
The reduction of parathymosin could be caused by a direct or indirect effect from miR-22. [score:3]
These features suggest that the predicted target sites of miR-22 at the 3′UTR of parathymosin may not be convincing. [score:3]
As shown in Fig. 4C and Fig. 5A, stable transfection with pIRES-miR-22 can reduce the protein expression of parathymosin by 5–10 folds in Western blot analysis. [score:3]
Indeed, treatment with anti-miR-22 can result in elevated expression of parathymosin protein in both HepG2 and Huh7 cells. [score:3]
Reduction of gene expression by miR-22. [score:3]
Treatment of antagomiR-22 (anti-miR22) resulted in an increased expression of the reporter containing the 3′UTR of parathymosin. [score:3]
AR42J-B13 cells stably transfected with either a miR-22 expression vector or a vector only control were grown to 90% confluence in 10 cm dish. [score:3]
MiR-22 is not likely to be required for Dex/OSM induced transdifferentiation, since we observed no apparent effect on several transdifferentiation markers by transfecting LNA-anti-miR22 or by overexpressing parathymosin in B13-1 cells (Fig. 10). [score:3]
Presumably, the expression of miR-22 is driven by HNF-4a, which is highly abundant in transdifferentiated AR42J-B13 cells [3], [4]. [score:3]
To confirm the results from proteomic analysis in Fig. 4A, we performed Western blot analysis using anti-parathymosin antibody and whole cell lysates from AR42J-B13 cells, with or without Dex/OSM induction, as well as with or without stable transfection using a pIRES-miR-22 expression vector (Fig. 5A). [score:3]
It is worth mentioning here that the expression kinetics of primary miR-22 RNA precursor paralleled to that of mature miR-22, suggesting the lack of control at the level of posttranscriptional processing (Figure S4). [score:3]
Figure S4 The expression levels of mature and primary miR-22 RNAs were correlated with that of HNF4a during hepatic transdifferentiation. [score:3]
An inverse correlation between the expression levels of parathymosin mRNA and miR-22 was observed in most rat primary tissues. [score:3]
Reduction of parathymosin mRNA and protein levels were observed in AR42J-B13 cells treated with Dex/OSM or a miR-22 expression vector. [score:3]
The cloning and construction of this miR-22 expression vector is as described in the Experimental Procedures. [score:3]
0034116.g011 Figure 11 Increased expression of parathymosin protein can be detected by Western blot when Huh7 and HepG2 cells were treated with LNA anti-miR-22 (Experimental Procedures). [score:3]
An in vivo inverse correlation between miR-22 expression and the parathymosin mRNA level. [score:3]
Identification of miR-22 target by 2D-DIGE and LC/MS/MS. [score:3]
We observed here the reduction of parathymosin mRNA and protein levels in AR42J-B13 cells treated with Dex/OSM or with a miR-22 expression vector. [score:3]
We found that miR-22 could reduce the protein and mRNA expression of parathymosin (Fig. 4, 5, 6, 7, 8, 9, 10, 11). [score:3]
Pooled stable miR-22 overexpressing cell lines. [score:3]
Indeed, we found both pri-miR-22 and mature miR-22 were increased in expression, which correlated with HNF-4a mRNA level during AR42J-B13 transdifferentiation (Figure S4A). [score:3]
Ectopic overexpression of miR-22 in AR42J-B13 cells was analyzed by Northern blot (A) and stem-loop real-time PCR analysis (B). [score:3]
A similar degree of reduction of parathymosin protein in AR42J-B13 cells was detected by comparing Dex/OSM induction with miR-22 overexpression side-by-side. [score:3]
Knockdown the endogenous miR-22 by LNA -based antagomiR-22. [score:2]
MiR-22 can target parathymosin in human hepatocytes. [score:2]
LNA -based antagomiR-22 increased parathymosin 3′UTR reporter activity in a hepatoma cell line Q7 by knockdown endogenous miR-22. [score:2]
Next, we asked whether knockdown of miR-22 could increase the reporter activity. [score:2]
LNA anti-miR-22 knockdown of HepG2, Huh7 and B13-1 cell lines. [score:2]
Mutations at both predicted sites have an additive effect on miR-22 mediated silencing (***, p<0.001; **, p<0.005; ns, not significant). [score:2]
To experimentally test the possibility of any unconventional target sites of miR-22 on the 3′ UTR of parathymosin, we performed the reporter assay using a DsRed reporter containing the parathymosin 3′UTR. [score:2]
Similarly, LNA knockdown of miR-22 in transdifferentiated AR42J-B13 cells resulted in a significantly increased level of parathymosin mRNA (Fig. 8C). [score:2]
We applied the locked nucleic acid (LNA) technology to deliver anti-miR-22 into a rat hepatoma cell line Q7 [5] to knockdown the endogenous level of miR-22. [score:2]
It therefore appears that the effect of miR-22 on parathymosin could be mediated through an indirect mechanism. [score:2]
The results indicated that miR-22 could reduce DsRed mRNA levels through its binding site on the parathymosin 3′UTR (Fig. 6D). [score:1]
Taken together, we identified miR-22 as a microRNA species highly elevated in transdifferentiated hepatocytes. [score:1]
The biological significance of miR-22 and parathymosin is discussed below. [score:1]
The expression of miR-22 in these tissues and cells were measured by stem-loop real-time PCR (B). [score:1]
One single nucleotide polymorphism (SNP) with an A to G change is highlighted with an arrow, which is located outside the mature miR-22 sequences. [score:1]
Figure S2 Sequence alignment of cloned rat (rno) miR-22 of AR42J-B13 origin with the reference genome from Ensembl database (ENSRNOG00000035620). [score:1]
-3′ at the predicted seed sequences of miR-22. [score:1]
The miR-22 expression level in transiently transfected AR42J-B13 cells was measured by stem-loop real-time PCR (B). [score:1]
Further analysis by Southern blot revealed no apparent effect of miR-22 on HBV replication (data not shown). [score:1]
We pooled AR42J-B13 cells stably transfected with pIRES2-EGFP-miR-22. [score:1]
0034116.g010 Figure 10(A) Similar levels of HBV e antigen (HBeAg) were detected in the media of B13-1 cells transfected with LNA anti-miR22 vs. [score:1]
Protein lysates of pooled B13-pIRES or B13-pIRES-miR-22 cells were labeled with Cy3 and Cy5, respectively (Experimental Procedures). [score:1]
However, other software programs, such as RNA Hybrid [23], predicted two miR-22 binding sites at the 3′UTR of parathymosin (free energy less than −20 kcal/mol). [score:1]
The binding sites of transcription factors on the miR-22 promoter are predicted by the Transfac software (27) and presented in the schematic illustration (C). [score:1]
To address this issue, we cotransfected AR42J-B13 cells with a HBV replicon and pIRES-miR-22 without treatment of Dex/OSM, and detected no HBsAg in the medium by ELISA (data not shown). [score:1]
Recently, miR-22 was found to be involved in various signaling pathways, including estrogen, PTEN/AKT, and c-Myc [13]– [15]. [score:1]
Transcription factors and biogenesis of miR-22. [score:1]
Rno-miR-22 cloning. [score:1]
Using HBsAg and HBeAg as surrogate markers of transdifferentiation, we observed no difference in HBeAg secretion, when B13-1 cells were transfected with anti-miR-22 before Dex/OSM treatment (Fig. 10A; Experimental Procedures). [score:1]
Intriguingly, while we observed no significant effect on most transdifferentiation markers by reducing the endogenous miR-22 (Fig. 10B, 10C, and 10D), we detected small, yet reproducible, increase of HBsAg by ELISA after anti-miR22 treatment (Fig. 10A). [score:1]
For example, miR-22 is most abundant in muscle and heart, while parathymosin is the least abundant in muscle and heart. [score:1]
Mature miR-22 in these stably transfected cells were significantly higher than that of the vector control by Northern blot and real-time PCR (Fig. 3A and B). [score:1]
Approximately 1×10 [6] AR42J-B13 cells were transiently transfected by 3 µg plasmid DNA (pIRES2-EGFP-miR-22) with Genejuice (Novagen). [score:1]
To date, unlike miR-122a, miR-22 in hepatocytes has been less well studied [21], [29]. [score:1]
The expression of miR-22 was increased by more than 100-fold after hepatic transdifferentiation, as measured by real-time PCR analysis (Fig. 1B). [score:1]
0034116.g004 Figure 4 Protein lysates of pooled B13-pIRES or B13-pIRES-miR-22 cells were labeled with Cy3 and Cy5, respectively (Experimental Procedures). [score:1]
Our studies suggest that the reduction of endogenous miR-22 has no significant effect on transdifferentiation in general, albeit a minor effect on HBsAg was noted (Fig. 10A; see). [score:1]
The sequence of miR-22 was retrieved from Ensembl database and mirbase. [score:1]
Figure S3 Predicted binding sites of microRNA-22 are highly conserved at the 3′UTR of parathymosin from human, mouse and rat. [score:1]
Previous studies reported the potential roles of miR-22 in heart and muscle [14], [16]. [score:1]
As shown in Fig. 9C, the upstream sequences from the miR-22 gene contain two HNF-4a, one Pax-4, and one myogenin binding motifs. [score:1]
Our miR-22 sequences are identical to those available in the miR database (Figure S2). [score:1]
Reporter activity was significantly increased when 100 pmol of LNA-anti-miR-22 was used. [score:1]
Consistent with the results in Fig. 6, 7, 8, we found an inverse correlation between parathymosin mRNA and miR-22 levels across different primary tissues of a female rat by real-time RT-PCR and stem-loop PCR analyses (Fig. 9A and 9B). [score:1]
The potential effect of parathymosin or miR22 on the transdifferentiation of AR42J-B13 cells. [score:1]
As shown in Fig. 9C, computational analysis of the promoter region of miR-22 predicts several binding sites for transcription factors, including HNF-4a, myogenin, and pax-4. Therefore, the high abundance of miR-22 in liver, muscle, and heart is most likely driven by these tissue specific transcription factors [8], [27]. [score:1]
Transient transfection of miR-22 into AR42J-B13 cells resulted in a high level of miR-22 by stem-loop RT-PCR (Fig. 4B), and approximately 10-fold reduction of parathymosin protein by Western blot analysis (Fig. 4C). [score:1]
So far, our studies on miR-22 and parathymosin have been based on the rat cells, such as Q7, AR42J-B13 and its derived B13-1 cells. [score:1]
The sequences at the 3′ UTR of parathymosin were retrieved from Ensembl database and miR-22 binding site prediction was performed by RNA Hybrid software. [score:1]
In addition to the parathymosin protein level, we also measured the parathymosin mRNA levels of AR42J-B13 cells treated with Dex/OSM or with miR-22 overexpression, by real time PCR analysis (Fig. 5B and 5C). [score:1]
miR-22 is neither necessary nor sufficient for transdifferentiation. [score:1]
One day after seeding, cells were transfected with puromycin resistamt plasmid (pTRE2pur) and LNA-scramble control or LNA anti-miR-22 (Locked Nucleic Acid, Exiqon), using Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions. [score:1]
0034116.g006 Figure 6(A) RNA Hybrid software predicted two miR-22 binding sites, designated as “1” and “2” in the cartoon, at the 3′UTR of parathymosin with free energy less than −20 kcal/mol. [score:1]
Taken together, miR-22 does not appear to be either necessary or sufficient for transdifferentiation of AR42J-B13 cells. [score:1]
[1 to 20 of 132 sentences]
4
[+] score: 311
Other miRNAs from this paper: mmu-mir-22
Our results suggested that miR-22 was downexpressed in HCC and inhibited HCC cell proliferation, migration and invasion through downregulating cancer -associated gene CD147 which may provide a new bio-target for HCC therapy. [score:10]
Recently, several targets of miR-22 were reported to mediate its tumorsuppressive effect, such as tumor-suppressive PTEN, Max genes, p21, Sp1, CD147 and oncogene c-myc expression, etc. [score:9]
miR-22 plays a tumor-suppressive role by downregulating oncogenic target genes in many kinds of cancer [10, 24, 30, 31]. [score:8]
In conclusion, miR-22 down-expressed in HCC and the overexpression of miR-22 inhibited cell migration and invasion of HCC cells in vitro, and decrease HCC tumor growth in vivo. [score:7]
The expression of CD147 was significantly down-regulated after over expression of miR-22 at the mRNA level (Fig.   4a) and the protein level (Fig.   4b) compared with negative control, respectively. [score:7]
To confirm that CD147 is a target gene for miR-22, real time RT-PCR and western blot analysis were used to detect the expression of CD147 after transfected with miR-22 overexpression vector in MHCC-97H and SMMC-7721. [score:7]
miR-22, originally identified in HeLa cells, has been found to be overexpressed in prostate cancer, but down-regulated in breast cancer, cholangiocarcinoma, multiple myeloma, and hepatocellular carcinoma [27]. [score:6]
The reported paradoxical functions of miR-22 imply that miR-22 might act as a tissue/cell-specific or context -dependent tumor suppressor microRNA and the function diversely depending on its target genes and related regulatory networks. [score:6]
d Analysis for correlation of miR-22 mRNA and CD147 protein expression in HCC tissues Furthermore, we also detected the CD147 expression in thirty-four pairs of HCC and normal tissues by immunohistochemistry. [score:5]
Our results indicate that miR-22 worked as a tumor suppressor microRNA and contributed to inhibit HCC cells migration and invasion in vitro. [score:5]
a Transfection of miR-22 overexpression vector to MHCC-97H and SMMC-7721 cells increases the expression of miR-22 detected by real-time quantitative RT-PCR. [score:5]
Overexpression of miR-22 in MHCC-97H and SMMC-7721 cells significantly inhibited cellular proliferation, migration and invasion capability in vitro. [score:5]
The expression of CD147 was inversely correlated with miR-22 expression in HCC tissues. [score:5]
Fig.  2Overexpression of miR-22 inhibited HCC cell proliferation and metastasis in vitro. [score:5]
miR-22 might act as a tumor suppressor and serve as a potential therapeutic target in HCC. [score:5]
Hence, our work indicates that miR-22 is an important suppressor in HCC invasion and metastasis, and CD147 seems to be a major downstream effector of miR-22 in its target network. [score:5]
Furthermore, the expression of miR-22 in metastatic HCC tissues was much lower than in no metastatic HCC tissues which indicated that the miR-22 expression was correlated with the HCC metastatic ability. [score:5]
Taken together, our results suggest that miR-22 worked as a tumor suppressor miRNA and contributed to inhibit HCC cells migration and invasion in vitro. [score:5]
Furthermore, the expression of miR-22 in metastatic HCC tissues was much lower than in no metastatic HCC tissues (Fig.   1a) which indicated that the miR-22 expression was negatively correlated with the HCC metastatic ability. [score:5]
miR-22 inhibited the expression of CD147 at the mRNA level a and the protein level b in MHCC-97H and SMMC-7721 cells. [score:5]
It has been reported that miR-22 inhibits cell migration and invasion through targeting CD147 in breast cancer [11]. [score:5]
d Analysis for correlation of miR-22 mRNA and CD147 protein expression in HCC tissues Furthermore, we also detected the CD147 expression in thirty-four pairs of HCC and normal tissues by immunohistochemistry. [score:5]
Our results showed that overexpression of miR-22 could significantly suppress HCC cell proliferation (P < 0.05, Fig.   2b). [score:5]
Moreover, overexpression of miR-22 could significantly inhibit the HCC cell proliferation, migration and invasion in vitro and decrease HCC tumor growth in vivo. [score:5]
First, we performed gain-of-function analysis and transfected miR-22 overexpression vector into MHCC-97H and SMMC-7721 cells to increase miR-22 expression. [score:5]
The expression of miR-22 is downexpressed in HCC tissues and cell lines. [score:5]
Furthermore, we identified CD147 as a target gene for miR-22 to regulate the invasion and metastasis of HCC cells in vitro. [score:4]
Down-regulation of CD147 mediated miR-22 function. [score:4]
Our results are also shown that CD147 is negatively regulated by miR-22 at the posttranscriptional level, via a specific target site within the 3′UTR. [score:4]
As expected, transfection of miR-22 overexpression vector resulted in substantial increase of miR-22 expression compared with pcDNA3.1 control transfected cells (Fig.   2a). [score:4]
As shown in Fig.   1a, miR-22 expression levels were downexpressed in HCC tissues compared with ANT tissues (P < 0.05). [score:4]
Finally, we found that miR-22 interacted with CD147 and decreased its expression, via a specific target site within the CD147 3′UTR by luciferase reporter assay. [score:4]
CD147 is a direct target of miR-22. [score:4]
This correlation indicates that miR-22 could negatively regulateCD147 expression in HCC tissues. [score:4]
miR-22 negatively regulates CD147 gene expression. [score:4]
We next asked whether miR-22 could inhibit HCC development in vivo. [score:4]
And miR-22 expression of each cell line was compared to the average expression level of miR-22 of three normal liver cell lines. [score:4]
Student’s t test was used to analyze the significant differences It has been reported that miR-22 could regulate CD147 expression in breast cancer [11]. [score:4]
b The relative luciferase activity in MHCC-97H and SMMC-7721 cells were determined after the CD147 3′UTR or mutant plasmids were co -transfected with miR-22 overexpression vector or negative control Hepatocellular carcinoma is one of the most frequently occurring cancers with poor prognosis. [score:3]
This newly identified miR-22/CD147 link provides a new, potential therapeutic target to treat HCC. [score:3]
The miR-22 overexpression vector was constructed according to previous [24] named as pcDNA3.1-miR-22. [score:3]
Fig.  5The CD147 3′UTR is a target of miR-22. [score:3]
miR-22 is a 22-nt non-coding RNA and originally identified in HeLa cells as a tumor-suppressing miRNA. [score:3]
We found that the expression of miR-22 in HCC tissues and cell lines were much lower than that in normal control, respectively. [score:3]
In the HCC tumor mo dels, miR-22 expression vector decreased the HCC tumors growth. [score:3]
miR-22 inhibits HCC cell proliferation, migration and invasion in vitro and decreases HCC tumor growth in vivo. [score:3]
a Analysis of the expression pattern of miR-22 in non-metastasis tumors and metastasis tumors of HCC correlated with adjacent non-tumor tissues using real-time RT-PCR. [score:3]
miR-22 expression in MHCC-97H, FHCC-98 and SMMC-7721 cells was relatively low. [score:3]
These results indicated that miR-22 served as a tumor metastasis suppressor in HCC cell through the CD147 pathway. [score:3]
Using HCC tumor mo dels, the control mice showed the apparent presence of primary tumor, whereas those injected with miR-22 expression vector decreased the volume and weight of tumors during the same observation period (Fig.   3). [score:3]
The lower expression of miR-22 in HCC cells with low metastatic potential suggested a causal role for miR-22 in the migration and invasion of HCC cell lines. [score:3]
miR-22 inhibits cell growth and induces cell-cycle arrest, apoptosis and senescence in breast cancer, colon cancer and lung cancer [29]. [score:3]
1 × 10 [6] cells were seeded in six-well plates, cultured overnight, and transfected with miR-22 overexpression vector or NC, respectively. [score:3]
In contrast, expression levels of miR-22 in HepG2 and MHCC-97L cells were relatively high. [score:3]
However, on the other side, miR-22 was recently suggested having an oncogenic role by targeting PTEN or TET family [8, 32]. [score:3]
a Representative figures of tumors in negative control and miR-22 overexpression groups. [score:3]
Taken together, our results suggest that and that CD147 is a potential target gene of miR-22. [score:3]
Correlation analysis indicated that there was a significant inverse correlation between the miR-22 mRNA and CD147 protein expression with a correlation coefficient (r) = −0.6684 and R [2] = 0.4467 (Fig.   4d). [score:3]
To verify whether miR-22 directly targeted CD147 in HCC cell lines, luciferase reporter assays were conducted. [score:3]
The expression of miR-22 was inversely correlated with HCC metastatic ability. [score:3]
A total of 1 × 10 [7] MHCC-97H cells stably expressing miR-22 were injected subcutaneously into nude mice. [score:3]
b The relative luciferase activity in MHCC-97H and SMMC-7721 cells were determined after the CD147 3′UTR or mutant plasmids were co -transfected with miR-22 overexpression vector or negative control To identify the expression of miR-22 in the HCC, thirty-four paired of HCC and normal tissues were measured by real time RT-PCR. [score:3]
Student’s t test was used to analyze the significant differences, * P < 0.05, ** P < 0.01 The miR-22 expression in HCC and normal liver cell lines were also detected. [score:3]
Subsequently, miR-22 was identified to be ubiquitously expressed in a variety of tissues [7]. [score:3]
Recently, miR-22 is identified as a tumor-suppressing microRNA in many human cancers. [score:3]
miR-22 inhibits HCC cell migration and invasion through the CD147 pathway. [score:3]
Student’s t test was used to analyze the significant differences, * P < 0.05, ** P < 0.01 The miR-22 expression in HCC and normal liver cell lines were also detected. [score:3]
In the present study, we found an inverse correlation between miR-22 and CD147 expression in the HCC tissues. [score:3]
c Overexpression of miR-22 presented a slower closing of scratch wound, compared with pcDNA3.1 control, at 48 h after transfection in MHCC-97H and SMMC-7721 cells. [score:2]
CD147 contains the binding site for miR-22 and is negatively regulated by miR-22. [score:2]
In this study, we demonstrated that miR-22 expression was decreased in HCC tissues and cell lines compared detected by real– time RT– PCR. [score:2]
To the best of our knowledge, this is the first study to examine the regulation mechanism of miR-22 and CD147 in HCC migration and invasion. [score:2]
The relationship of miR-22 and its target gene CD147 was also investigated. [score:1]
Judging from data between the controls and miR-22 -treated groups at the points of the experiment, miR-22 treatment resulted in a mean of decreasing in tumor growth. [score:1]
In the current study, we validate the differential expression of miR-22 in HCC and investigated the function of miR-22 in migration and invasion of HCC cells. [score:1]
As shown in Fig.   1b, miR-22 levels of all cell lines were lower than that of normal liver cell lines. [score:1]
So we want to explore whether there exists this relationship of miR-22 and CD147 in the HCC progression. [score:1]
The effect of miR-22 on HCC in vivo was validated by murine xenograft mo del. [score:1]
Perhaps, miR-22 may play more complex roles that exceed our perception in cancer, which needs us to explore it more deeply. [score:1]
We constructed pmirGLO-CD147-3′-UTR and pmirGLO-CD147-3′-UTR-mut with a substitution of four nucleotides within the miR-22 binding site (Fig.   5a). [score:1]
To identify the expression of miR-22 in the HCC, thirty-four paired of HCC and normal tissues were measured by real time RT-PCR. [score:1]
Synthetic miR-22 mimic treatments for cancer will become a significant scientific and therapeutic challenge. [score:1]
Moreover, the cell migration and invasion assay showed that overexpression of miR-22 resulted in reduced migration rate and invasion rate of MHCC-97H and SMMC-7721 cells compared with the control (Fig.   2d). [score:1]
We measured miR-22 expression level in 34 paired of HCC and matched normal tissues, HCC cell lines by real-time quantitative RT-PCR. [score:1]
b The relative levels of miR-22 in the seven HCC and three normal liver cell lines. [score:1]
Next, the wound-healing assay showed that HCC cells with miR-22 overexpression presented a slower closing of scratch wound, compared with the negative controls (P < 0.05, Fig.   2c). [score:1]
a Diagram of the luciferase reporter plasmids: plasmid with the full length CD147 3′UTR insert and plasmid with a mutant CD147 3′UTR which carried a substitution of four nucleotides within the miR-22 binding site. [score:1]
[1 to 20 of 87 sentences]
5
[+] score: 298
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-146a, hsa-mir-206
We identified miR-22 as a potentially neuroprotective miRNA based on its predicted regulation of several targets implicated in Huntington’s disease (histone deacetylase 4 (HDAC4), REST corepresor 1 (Rcor1) and regulator of G-protein signaling 2 (Rgs2)) and its diminished expression in Huntington’s and Alzheimer’s disease brains. [score:11]
A) Luciferase constructs expressing the Renilla luciferase gene under the control of the MAPK14/p38 or Tp53inp1 3′ UTRs were co -transfected in HEK293T cells with either an empty plasmid (pcDNA3.1), plasmid expressing a control miR-153 not predicted to target the 3′ UTR or a plasmid expressing miR-22. [score:9]
0054222.g006 Figure 6A) Luciferase constructs expressing the Renilla luciferase gene under the control of the MAPK14/p38 or Tp53inp1 3′ UTRs were co -transfected in HEK293T cells with either an empty plasmid (pcDNA3.1), plasmid expressing a control miR-153 not predicted to target the 3′ UTR or a plasmid expressing miR-22. [score:9]
miR-22 was also predicted to target HDAC4; reversal of acetylation defects have been shown to ameliorate neurodegeneration in cellular and animal mo dels of HD [13], and recent evidence has indicated that the administration of HDAC inhibitor suberoylanilide hydroxamic acid (SAHA) may work via diminishing HDAC4 expression post-transcriptionally [14]. [score:7]
We first assessed the effect of miR-22 overexpression in in vitro mo dels of HD comprising lentiviral -mediated expression of mutant Htt fragments (Htt171-82Q versus Htt171-18Q) in primary rat striatal or cortical neurons [15], [16]; these mo dels have previously been shown to exhibit HD-like neuropathologies and gene expression changes [17]. [score:7]
In these experiments we assessed miR-22 overexpression in the test case to no miRNA expression as a control; we reasoned that this condition provided a high-stringency comparator, since either miRNA overexpression or exposure to additional lentiviral vector exposure could itself potentially compromise neuronal survival and confound the interpretation of our results. [score:7]
Using the miRNA target algorithm TargetScan, we discovered that miR-22 is predicted to target multiple mRNAs that have been implicated in HD pathogenesis. [score:7]
Second, miR-22 is predicted to target Rgs2; we have recently shown that decreased Rgs2 expression in striatal neurons is protective in in vitro mo dels of HD by decreasing extracellular-signal-regulated kinase (ERK) activation [12]. [score:6]
The targeting of general anti-apoptotic and HD-specific pathways, together with evidence that it is downregulated in HD brain, make miR-22 a particularly interesting strategy for combating HD. [score:6]
First, miR-22 is predicted to target Rcor1, a crucial regulator of neuronal gene expression; the Restrictive Element 1 Silencing Transcription Factor pathway has been shown to be hyperactive in HD, leading to a large-scale repression of neuronal genes in affected neurons [11]. [score:6]
miR-22 is an miRNA that has previously been shown to be downregulated in both HD and Alzheimer’s disease brain [7], [10]. [score:6]
Luciferase constructs expressing the Renilla luciferase gene under the control of the corresponding 3′ UTRs were co -transfected in HEK293T cells with either a plasmid expressing miR-22 or an empty plasmid (pcDNA3.1). [score:5]
These data show that miR-22 has multipartite anti-neurodegenerative activities including the inhibition of apoptosis and the targeting of mRNAs implicated in the etiology of HD. [score:5]
We again chose to test the beneficial effects of miR-22 against the stringent control comprising neuronal cells without miRNA overexpression so to avoid confounding toxicities of the lentiviral vectors or control miRNA expression. [score:5]
As expected, we observed significant activation of effector caspases in all mo dels of neurodegeneration (Htt171-82Q, 3-NP, and aging), which in each case was inhibited overexpression of miR-22 (Figure 7A, B, C ). [score:5]
miR-22 is Protective in Multiple in vitro Mo dels of NeurodegenerationIn order to test whether non-Htt -targeting effects also contributed to the anti-neurodegenerative activity of miR-22, we employed a different HD mo del that would not involve Htt expression. [score:5]
As predicted, overexpression of miR-22 inhibited neurodegeneration in primary striatal and cortical cultures exposed to a mutated human huntingtin fragment (Htt171-82Q). [score:5]
miR-22 Targets Multiple Genes Involved in Huntington’s Disease. [score:5]
In so doing, we noted that miR-22 is also predicted by TargetScan to target the 3′ UTRs of the Tp53inp1 and MAPK14/p38 mRNAs, whose encoded proteins have known pro-apoptotic activities [23], [24]. [score:5]
Protein levels were normalized to β-3 tubulin, which is not a predicted target of miR-22 and whose expression did not change with miR-22 treatment. [score:5]
0054222.g001 Figure 1Luciferase constructs expressing the Renilla luciferase gene under the control of the corresponding 3′ UTRs were co -transfected in HEK293T cells with either a plasmid expressing miR-22 or an empty plasmid (pcDNA3.1). [score:5]
In order to test whether non-Htt -targeting effects also contributed to the anti-neurodegenerative activity of miR-22, we employed a different HD mo del that would not involve Htt expression. [score:5]
We demonstrated that overexpression of miR-22 is neuroprotective in in vitro mo dels of HD, which may be explained by miR-22′s targeting multiple genes previously implicated in HD pathogenesis. [score:5]
In order to first confirm the pertinent target predictions, we used 3′ untranslated region (UTR) luciferase assays to show that miR-22 specifically interacts with the 3′ UTRs of the Rcor1, Rgs2 and HDAC4 mRNAs (Figure 1 ), compared to control miRNAs that are not predicted to target these mRNAs (miR-146a served as the control for Rcor1 and HDAC4 whereas miR-153 served as a control for Rgs2 because Rgs2 contains a predicted miR-146a binding site). [score:5]
Having determined that miR-22 inhibits the expression of pro-apoptotic proteins, we next sought to evaluate whether miR-22 inhibited downstream manifestations of apoptosis. [score:5]
Overexpression of miR-22 also decreased neurodegeneration in primary neuronal cultures exposed to 3-nitropropionic acid (3-NP), a mitochondrial complex II/III inhibitor. [score:5]
The miR-22 -overexpressing condition is compared to the control with no miRNA overexpression (see text for rationale). [score:4]
0054222.g004 Figure 4Cultured primary striatal neurons (2.5 weeks in vitro) were treated with the indicated concentrations of 3-NP for 48 hours or left untreated (CTRL), and survival of neurons overexpressing miR-22 was compared to neurons not overexpressing miR-22 (uninfected). [score:4]
We subsequently confirmed the targeting of these mRNAs by miR-22 using 3′ UTR luciferase assays, and also showed by Western blot that miR-22 overexpression in primary neurons decreases the cellular accumulation of MAPK14/p38 protein (Figure 6A, B ). [score:4]
miR-22 also Targets Other Cell Death Regulators. [score:4]
Although miR-22 is not predicted to target Htt, we nonetheless considered whether our observed disease-modifying effects might involve changes in Htt accumulation. [score:4]
miR-22 downregulates protein levels of MAPK14/p38 and tp53inp1. [score:4]
Cultured primary striatal neurons (2.5 weeks in vitro) were treated with the indicated concentrations of 3-NP for 48 hours or left untreated (CTRL), and survival of neurons overexpressing miR-22 was compared to neurons not overexpressing miR-22 (uninfected). [score:4]
However, it is somewhat unclear whether direct manipulation of miR-22 overexpression would be the preferred strategy to achieve increased miR-22 levels. [score:4]
Given that none of the HD-related targets explored above have been implicated in neuronal aging, we considered what other targets of miR-22 might be relevant for its broader neuroprotective effects. [score:4]
Primary cortical neurons were infected with mir-22 -expressing lentivirus on DIV10 and neuronal survival was compared to cultures not overexpressing miR-22 (CTRL) after 5 weeks. [score:4]
Although the miR-22 -expressing vector modestly decreased neuronal viability (NeuN -positive cell count) compared to the non -treated control (Figure 4, left, reflecting toxicity of the lentiviral vector application), miR-22 overexpression increased the survival of neurons treated with 3-NP (Figure 4, middle and right). [score:4]
0054222.g005 Figure 5 Primary cortical neurons were infected with mir-22 -expressing lentivirus on DIV10 and neuronal survival was compared to cultures not overexpressing miR-22 (CTRL) after 5 weeks. [score:4]
Taken together, the above results show a therapeutic potential of miR-22 mediated by both general anti-apoptotic effects (via targeting MAPK14 and Trp53inp1), and specific HD-related effects (via Rcor1, HDAC4, Rgs2 and Htt). [score:3]
In addition to HD-specific pathways, miR-22 also demonstrated the ability of to inhibit apoptosis, as shown by its ability to decrease effector caspase activation. [score:3]
These results support the perspective that enhancing miR-22 expression might comprise a rational therapeutic strategy for the treatment of HD and other neurodegenerative conditions. [score:3]
As expected, Htt171-82Q decreased the viability of both striatal and cortical neurons; moreover, as predicted viability of the neuronal cells was restored by miR-22 overexpression (Figure 2 ). [score:3]
The mechanisms underlying the effects of miR-22 included a reduction in caspase activation, consistent with miR-22′s targeting the pro-apoptotic activities of mitogen-activated protein kinase 14/p38 (MAPK14/p38) and tumor protein p53-inducible nuclear protein 1 (Tp53inp1). [score:3]
As in the experiment shown in Figure 4, we observed that initially the exposure to miR-22 -expressing lentiviral vector decreased neuronal number (reflecting cell loss due to nonspecific toxicity of the lentiviral vector application). [score:3]
miR-22 Inhibits Neuronal Apoptosis. [score:3]
At DIV4 neurons were infected with lentiviral expression constructs for rno-miR-22 (at a p24 concentration of 25 ng/ml). [score:3]
Primary cultures of cortical neurons were prepared as in [16] and infected at DIV10 with a lentiviral vector expressing rno-miR-22 (at a p24 concentration of 25 ng/ml). [score:3]
Our study demonstrates that enhancing miR-22 expression in neurons has a pronounced neuroprotective against a variety of medically relevant neuronal insults. [score:3]
B) Fewer Htt -positive foci were detected in cells expressing miR-22+ Htt171-82Q. [score:3]
B) Primary cortical neurons were infected with lentivirus expressing miR-22 and proteins were harvested 3 weeks post-infection. [score:3]
miR-22 was assessed for its effects on caspase 3/7 activities in primary striatal neurons in the following neurodegenerative conditions: A) expressing a fragment of mutant Htt (Htt82Q), B) treated with 150 µM 3-NP or C) long-term culture (to mo del aging). [score:3]
Primary cultures of striatal neurons were prepared as in [29] and infected at DIV10 with lentiviral construct expressing rno-miR-22 (at a p24 concentration of 25 ng/ml). [score:3]
Nonetheless, the reduction of mutant Htt accumulation (or correction of abnormal Htt distribution) by miR-22 might contribute to its disease-mitigating activity in HD. [score:3]
0054222.g007 Figure 7 miR-22 was assessed for its effects on caspase 3/7 activities in primary striatal neurons in the following neurodegenerative conditions: A) expressing a fragment of mutant Htt (Htt82Q), B) treated with 150 µM 3-NP or C) long-term culture (to mo del aging). [score:3]
miR-22 targets Rcor1, Rgs2, and HDAC4 3′ UTRs. [score:3]
These analyses showed that both the increased cellular levels of total MAPK14/p38 (Figure 6C ) and activated phosphorylated MAPK14/p38 associated with neurotoxicity were abrogated by the overexpression of miR-22 (Figure 6D ). [score:3]
Protein levels were normalized to β-3 tubulin, which is not a predicted target of miR-22. [score:3]
These data support the conclusion that the inhibition of MAPK14/p38 activity comprises one of the neuroprotective capabilities of miR-22. [score:3]
We also took into account evidence for miRNA dysregulation in HD, and found one miRNA, miR-22, that fulfilled both criteria. [score:2]
The significant neuroprotection by miR-22, in this mo del indicated that the neuroprotective activities of miR-22 include mechanisms beyond regulating mutant Htt accumulation or distribution. [score:2]
SIN-PGK-miR-22-WPRE plasmid was also used to overexpress the miRNA by transfection in human embryonic kidney (HEK) T293 cells in 3′ UTR-luciferase assays. [score:2]
Alternatively, exploring other ways by which miR-22 levels could be regulated by small-molecule drugs might be another therapeutic option. [score:2]
MAPK14/p38 protein levels in miR-22 overexpressing cells were compared to MAPK14/p38 protein levels in the non-infected control cells (CTRL). [score:2]
Lentiviral vectors encoding the first 171 amino acids of human Huntingtin containing 18 or 82 polyglutamine repeats under control of a tetracycline response element (TRE) regulated promoter (SIN-TRE-htt117-18Q/82Q-WPRE), the tetracycline transactivator (tTA) under the control of a phosphoglycerate kinase (PGK) promoter (SIN-PGK-tTA-WPRE), and the rat miR-22 gene (rno-miR-22) under the control of PGK promoter (SIN-PGK-miR-22-WPRE) were produced in human embryonic kidney 293T (HEK293T) cells with a four-plasmid system as described previously [29]. [score:2]
We therefore hypothesized that miR-22 might be a potential therapeutic approach to treating HD via tandem regulation of the above pathways. [score:2]
miR-22 is protective against 3-NP toxicity. [score:1]
miR-22 is Protective in Multiple in vitro Mo dels of Neurodegeneration. [score:1]
We then tested the hypothesis that increasing cellular levels of miRNA-22 would achieve neuroprotection in in vitro mo dels of neurodegeneration. [score:1]
In other words, comparing the effect of miR-22 to the effect of another miRNA is problematic because it would be impossible to distinguish whether miR-22 were neuroprotective, or merely less toxic, than the other lentivirally- delivered miRNA. [score:1]
Where indicated cells were co-infected on DIV4 with vector encoding miR-22. [score:1]
We also assessed the effects of miR-22 on levels of MAPK14/p38 protein and its activation during neurodegeneration. [score:1]
miR-22 decreases caspase activation preceding neuronal cell death. [score:1]
However, as hypothesized, expression of miR-22 increased neuronal long-term neuronal survival, as measured by NeuN -positive cell counts at 5 weeks in vitro (Figure 5 ). [score:1]
To our surprise, the number of Htt-enriched foci was diminished by miR-22 (Figure 3 ). [score:1]
miR-22 is neuroprotective against long-term culture stress. [score:1]
We thus assessed the effects of miR-22 against neurodegeneration due to long-term culture stress. [score:1]
C) and D) Primary striatal neurons were infected on DIV1 with lentiviral vectors encoding WT (Htt18Q) or mutant (Htt82Q) Htt171 fragments under the control of the TRE promoter and co-infected on DIV4 with vector encoding miR-22 and 2.5 weeks post-infection proteins were harvested. [score:1]
We thus tested this hypothesis by measuring the effect of miR-22 overexpression on the activity of effector caspases (3 and 7). [score:1]
We next tested the potential for miR-22 to achieve neuroprotection. [score:1]
Here, we have shown that increasing cellular levels of miR-22 might be one such approach for combating neurodegeneration. [score:1]
We then asked whether miR-22 could prevent neurodegeneration in a non-HD-like condition. [score:1]
In addition, miR-22 improved neuronal viability in an in vitro mo del of brain aging. [score:1]
miR-22 decreases the focal accumulation of Htt protein. [score:1]
miR-22 is neuroprotective against mutant Htt. [score:1]
On DIV4, where denoted, cultures were infected with vector encoding miR-22. [score:1]
[1 to 20 of 85 sentences]
6
[+] score: 276
Other miRNAs from this paper: hsa-mir-107, hsa-mir-34a, hsa-mir-20b
Finally, miR-22 inhibits VEGF expression by suppressing HIF-1α expression. [score:9]
Our biochemical data suggests that miR-22 directly regulates HIF-1α expression buy suppressing the translation of HIF-1α. [score:9]
Over -expression or knockdown of miR-22 did not alter the expression of HIF-1α mRNA, which suggests that miR-22 regulates HIF-1α translation but not transcription (Fig. 3A). [score:9]
However, miR-22 does not affect the expression of luciferase with a mutated miR-22 binding elements (Fig. 3C right), suggesting that miR-22 inhibits HIF-1α expression via interaction with the 3′ UTR of HIF-1α. [score:7]
Over -expression of miR-22 inhibits HIF-1a expression, but not HIF-1b. [score:7]
Hypoxia induced ANGPT2 and SCF, and over -expression of miR-22 inhibited hypoxia induced expression of ANGPT2 and SCF (Figure S2). [score:7]
To examine if miR-22 regulates HIF-1α protein expression, we transfected HCT116 cells with pre-miR-22 for over expression of miR-22 and with anti-sense-miR-22 for knockdown of miR-22. [score:7]
However, over -expression of miR-22 inhibited hypoxia -induced HIF-1α expression in HCT116 and HT29 (Fig. 2B–D). [score:7]
Several reports identify potential targets of miR-22 by using software algorithms, such as TargetScan, miRanda and PicTar, in combination with cellular studies. [score:5]
Our data reveal another mechanism through which miR-22 might act as a tumor suppressor: loss of miR-22 expression not only permits an increase in MYCBP but also an increase in HIF-1α. [score:5]
Oncogene 24 Ting Y Medina DJ Strair RK Schaar DG Differentiation -associated miR-22 represses Max expression and inhibits cell cycle progression. [score:5]
Since others have shown that c-myc limits miR-22 expression, tumors over -expressing c-myc might be expected to have lower levels of miR-22, higher levels of HIF-1α and VEGF. [score:5]
Over -expression of miR-22 suppressed the secretion of VEGF. [score:5]
Description: HCT116 cells were transfected with pre-miR-22 or control, and then exposed to normoxia or hypoxia for 8 h. RNAs from cell lysates were analyzed for angiopoietin 2 (ANGPT-2), stem cell factor (SCF), and COX-2 mRNAs by qPCR (n = 3± S. D. *P<0.05) Over -expression of miR-22 decreased the expressions of angiogenic factors. [score:5]
MiR-22 regulates HIF-1α by inhibiting its translation. [score:5]
Over -expression of miR-22 decreased hypoxia or DFX induced VEGF expression (Fig. 4A, black bars). [score:5]
Ectopic expression of miR-22 inhibited the proliferation and colony formation of MCF-7 cells [23]. [score:5]
Furthermore, miR-22 suppresses HIF-1α translation. [score:5]
In contrast, knockdown of miR-22 enhanced HIF-1α expression under hypoxia (Fig. 2C–D). [score:4]
Furthermore, we examined the effect of miR-22 upon expression of angiopoietin 2 (ANGPT2) and stem cell factor (SCF), because ANGPT2 and SCF are angiogenic growth factors that are regulated by HIF-1 [20]. [score:4]
Since colon cancer specimens with lower miR-22 show higher VEGF expression, we hypothesize that miR-22 regulates hypoxia signaling in colon cancer cell lines. [score:4]
Conversely, knockdown of miR-22 increased DFX induced VEGF expression (Fig. 4B). [score:4]
0020291.g002 Figure 2. (A) Alteration of miR-22 expression by transfection. [score:3]
Recent studies showed that miR-22 targets several proteins such as estrogen receptor a (ERa), c-Myc binding protein (MYCBP), Myc associated factor X (MAX), and PTEN, suggesting that miR-22 may be implicated in tumorigenesis. [score:3]
Expression of miR-22 in colon cancer. [score:3]
C-myc decreases the expression of several miRNAs including miR-22 in cancer cell lines [13]. [score:3]
We next examined the expression of miR-22 in several cancer cell lines. [score:3]
PPAR-alpha and BMP7 are also targets of miR-22 [28]. [score:3]
Figure S1 HIF-1β is not a target of miR-22. [score:3]
Mutation of the miR-22 response element (5′-GTTGACGG-3′ → 5′-G AT CA GGG -3′) was made by QuikChange Site-Directed Mutagenesis kit (Stratagene). [score:3]
RNA was extracted from 9 normal human colon specimens (white) and from 9 human colon cancer specimens (black), and analyzed by qPCR for miR-22 and VEGF expression (n = 9± S. D. ). [score:3]
Expression of miR-22 is lower in colon cancer specimens (P = 0.02) (Fig. 1C). [score:3]
We now identify HIF-1α as a target for miR-22 in a colon cancer cell line. [score:3]
We first used to measure miR-22 expression in human tissues, and found that miR-22 is expressed in most tissues, but relatively abundant in heart, smooth muscle, bladder, and adipose tissue (Fig. 1A). [score:3]
Over -expression of miR-22 did not alter the level of HIF-1β, the dimerization partner of HIF-1α (Figure S1). [score:3]
HIF-1α is a target of miR-22. [score:3]
Figure S2 MiR-22 regulates the expressions of angiogenic factors. [score:3]
The mouse miR-22 gene is mapped to a cancer -associated genomic region, and the human miR-22 gene lies within a loss of heterozygosity region (LOH) in several cancer cells [23], [29], suggesting that miR-22 is involved in suppressing tumor growth. [score:3]
Expression of miR-22 in human cells, normal human colon tissue and human colon cancer. [score:3]
These studies show that endogenous miR-22 inhibits HIF-1α. [score:3]
This tumor suppressor activity of miR-22 involves repression of MYCBP. [score:3]
Targets of miR-22. [score:3]
Over -expression of miR-22 in HCT116 slowed HUVEC migration (Fig. 5B–C). [score:3]
We found that HIF-1α is a new target of miR-22. [score:3]
Hypoxia induces HIF-1α, but miR-22 suppresses HIF-1α. [score:3]
We found that miR-22 inhibits VEGF secretion, suggesting miR-22 may act as an anti-angiogenesis factor in colon cancer cell lines. [score:3]
Over -expression of miR-22 decreased luciferase activity (Fig. 3C left). [score:3]
MiR-22 regulates VEGF expression and secretion. [score:3]
However others have shown that that knockdown of miR-22 increases apoptosis rate in 16HBE-T cells [26]. [score:2]
0020291.g001 Figure 1 (A) MiR-22 expression in normal human tissues. [score:2]
We explored how miR-22 regulates HIF-1 and hypoxia signaling using HCT116 colon cancer cells as an in vitro mo del of how tumor cells respond to hypoxia. [score:2]
Knockdown of miR-22 by transfecting with anti-sense-miR-22 decreased miR-22 levels down to 40% (Fig. 2A). [score:2]
MiR-22 controls VEGF expression in HCT116. [score:2]
MiR-22 inhibits HCT116 production of VEGF and stimulation of endothelial cells. [score:2]
MiR-22 also repressed c-Myc -binding protein MYCBP [23], c-Myc binding partner MAX [24] and tumor suppressor gene PTEN [25], [26], [27]. [score:2]
Our current study adds miR-22 to the list of miRNAs that regulate HIF-1 protein. [score:2]
MiR-22 is expressed in many cancer cells including the colon cancer cell line HCT116. [score:2]
In contrast, knockdown of miR-22 enhanced VEGF release (Fig. 4C–D). [score:2]
Therefore these data suggest that miR-22 may regulate tumor angiogenesis. [score:2]
To explore the mechanism by which miR-22 regulates HIF-1α, we made a luciferase reporter vector, which contains a fragment of the 3′ UTR of HIF-1α (extending after the stop codon from 0 to 401 bp) that includes a miR-22 binding site. [score:2]
MiR-22 targets estrogen receptor a (ERa) and represses estrogen signaling in several breast cancer cell lines [21], [22]. [score:2]
Description: HCT116 cells were transfected with pre-miR-22 or pre-miR-control, and exposed to normoxia or hypoxia for 16 h. Cell lysates were immunoblotted for HIF-1a and HIF-1b. [score:1]
0020291.g004 Figure 4 HCT116 were transfected with pre-miR-22 or anti-sense-miR-22 or control, and then exposed to normoxia or hypoxia for 16 h. The media was analyzed for VEGF by ELISA and RNA from cell lysates was analyzed for VEGF mRNA by qPCR (n = 3± S. D. *P<0.05) (A) Pre-miR-22 decreases VEGF mRNA. [score:1]
The 3′ UTR of HIF-1α includes a complementary sequence for miR-22 consisting of 7 nucleotides; this seed sequence contains one wobble binding nucleotide (G–A). [score:1]
A commercial membrane containing RNA from normal human tissues was probed for miR-22 using Northern analysis. [score:1]
HCT116 cells were transfected with Pre-miR-22 or anti-sense-miR-22 or control. [score:1]
MiR-22 in HCT116 regulates endothelial cell growth. [score:1]
These data suggested that miR-22 in HCT116 affects endothelial biology, increasing proliferation and migration. [score:1]
Next day, pMIR-REPORT Luciferase vectors including 3′ UTR of HIF-1α and precursor miR-22 or scrambled oligonucleotides were transfected into cells using Lipofectamine 2000 (Invitrogen). [score:1]
Cell lysates were probed for miR-22 by. [score:1]
MiR-22 regulates PPAR-alpha and BMP7 signaling pathways in human chondrocytes [28]. [score:1]
for miR-22 was performed as described previously. [score:1]
PLoS One 5 e10859 26 Liu L Jiang Y Zhang H Greenlee AR Yu R miR-22 functions as a micro-oncogene in transformed human bronchial epithelial cells induced by anti-benzo[a]pyrene-7,8-diol-9,10-epoxide. [score:1]
Since angiogenesis involves endothelial cell proliferation, we tested the effect of miR-22 upon HUVEC proliferation. [score:1]
The apparent contradiction between these two studies may be due to different cell lines or different methods for altering miR-22 levels. [score:1]
We also found that RNA levels of miR-22 and VEGF are negatively correlated (P<0.05) (Fig. 1D). [score:1]
A fragment of the 3′ UTR of HIF-1α (starting after the TGA stop codon and extending for 401 bp) containing the miR-22 response element was cloned into pMIR-REPORT luciferase vector (Applied Biosystems). [score:1]
Natural log transformation of relative ratio of RNA for miR-22 and VEGF was used for statistical analysis (n = 30). [score:1]
0020291.g005 Figure 5 HCT116 cells were transfected with pre-miR-22 or control, and the media were collected. [score:1]
MiR-22 regulates the differentiation of a monocyte cell line [24]. [score:1]
HCT116 or HeLa cells were transfected with Pre-miR-22 or Pre-miR-control and cultured for 72 hours. [score:1]
pl), and found that the miR-22 seed sequence matches the 3′ UTR of HIF-1α (7 nucleotides matches including one wobble match). [score:1]
HCT116 cells were transfected with control oligonucleotides or pre-miR-22, and then exposed to normoxia or hypoxia for 16 h. Cell lysates were immunoblotted for HIF-1α. [score:1]
Colon cancer specimens contain less miR-22 and more VEGF than normal colon specimens. [score:1]
We co -transfected HCT116 cells with this reporter vector and with pre-miR-22 or control. [score:1]
Human HIF-1α 3′ UTR has a potential binding site for miR-22 (Fig. 3B). [score:1]
HCT116 cells were transfected with pre-miR-22 or control, and the media were collected. [score:1]
In cancer, the function of miR-22 is controversial. [score:1]
Role of miR-22 in tumor angiogenesis. [score:1]
Pre-miR-22 decreases the ability of hypoxic treated cells to produce factors that stimulate endothelial proliferation. [score:1]
Briefly, 10 µg of each RNA were loaded onto 15% TBU-gel (Invitrogen), transferred to nitrocellulose membrane, and hybridized with [32]P-end-labeled probes specific for miR-22 at 42°C for 16 hours. [score:1]
We find that miR-22 levels in human colon cancer are lower than in normal colon tissue. [score:1]
A scratch was performed using a 1000 µl pipette tip and media change to condition media from HCT116 transfected with Pre-miR-control or Pre-miR-22. [score:1]
of pre-miR-22 into HCT116 increased miR-22 levels more than 10 fold (Fig. 2A). [score:1]
To examine the level of miR-22 in colon cancer, we measured miR-22 expression by qPCR in 9 human colon cancer specimens and 9 normal colon tissues from patients at The Johns Hopkins Hospital. [score:1]
To investigate the role of miR-22 in VEGF expression, we transfected HCT116 with pre-miR-22 or anti-sense-miR-22 or control, and then measured VEGF mRNA expression by qPCR. [score:1]
The miR-22 probe, 5′-TAAAGCTTGCCACTGAAGAACT-3′ was synthesized by Integrated DNA Technologies; all other reagents were purchased from Applied Biosystems. [score:1]
However, media from hypoxic cells transfected pre-miR-22 blocked this increase in proliferation (Fig. 5A). [score:1]
HCT116 were transfected with pre-miR-22 or anti-sense-miR-22 or control, and then exposed to normoxia or hypoxia for 16 h. The media was analyzed for VEGF by ELISA and RNA from cell lysates was analyzed for VEGF mRNA by qPCR (n = 3± S. D. *P<0.05) (A) Pre-miR-22 decreases VEGF mRNA. [score:1]
We added to HUVEC cells the conditioned media from HCT116 cells which had been transfected with pre-miR-22 or control and had then been exposed to normoxia or hypoxia. [score:1]
However the function of miR-22 in cancer cells remains unknown. [score:1]
We could detect miR-22 in three colon cancer cell lines, HCT116, HCT116 p53 KO and HT29, and also in an epithelial cancer cell line, HeLa (Fig. 1B). [score:1]
We transfected HCT116 cells with pre-miR-22 or control, exposed the cells to normoxia or hypoxia, and harvested the media. [score:1]
There was no significant difference between media from normoxia cells transfected pre-miR-22 and media from normoxia cells transfected control (Fig. 5A). [score:1]
HCT116 cells were transfected with a luciferase reporter vector (MiRreport) containing the 3′ UTR of HIF-1α (left panel) or a mutated 3′UTR of HIF-1α (right panel) and with pre-miR-22 or pre-miR-control. [score:1]
[1 to 20 of 105 sentences]
7
[+] score: 269
To further decipher why FA deficiency induced the upregulation of miR-149 and miR-22 expression and inhibited the expression of MTHFR in HCC but maintained its expression in normal hepatocytes. [score:12]
Our study also indicated that the elevated expression of miR-22-3p (69%) and miR-149-5p (37–48%) might maintain the translational level of MTHFR in normal hepatocytes by directly targeting and inhibiting the overexpression of MTHFR mRNA in conditions of FA deficiency. [score:12]
0168049.g007 Fig 7A schematic mo del illustrates how the upregulation of miR-22 and miR-149 might promote apoptosis (or not) in HCC cells (or normal hepatocytes) via the downregulation (or maintenance) of MTHFR, which causes MAT1A (or MAT2A/B) inhibition and the induction of genome hypomethylation. [score:9]
A schematic mo del illustrates how the upregulation of miR-22 and miR-149 might promote apoptosis (or not) in HCC cells (or normal hepatocytes) via the downregulation (or maintenance) of MTHFR, which causes MAT1A (or MAT2A/B) inhibition and the induction of genome hypomethylation. [score:9]
Notably, the function of miR-22-3p in HL-7702 cells might be replaced by the increase in miR-149-5p on the 21 [st] day, and we also found a potential substitution effect between miR-22-3p and miR-149-3p (Fig 1) Our results indicated that FA deficiency induces miR-22-3p and miR-149-5p upregulation and suggested the inhibition of MTHFR expression by miR-22-3p and miR-149-5p in QGY-7703 and HL-7703 cells. [score:8]
The upregulation of miR-22-3p and miR-149-5p promotes the dysregulation of DNA methylation and DNA synthesis/mismatch repair in HCC via the downregulation of MTHFR in conditions of FA deficiency. [score:8]
Histone deacetylase 4 (HDAC4) [56] and Cyclin -dependent kinase inhibitor 1A (CDKN1A) [57] are two critical proteins in cancer, and both are directly targeted and regulated by miR-22. [score:7]
The changes in the expression of miR-22-3p/miR-149-5p in response to FA deficiency were detected by Poly (A) Tailing RT-qPCR, and the expression of MTHFR at both the transcriptional and translational levels was determined by RT-qPCR and Western blotting, respectively. [score:7]
The 3’UTR of MTHFR is directly targeted by miR-22-3p and miR-149-5pTo determine whether MTHFR is a direct target of miR-22-3p and miR-149-5p, wild-type and mutant sequences of the 3’UTR of MTHFR were cloned downstream of the Renilla luciferase coding region in a psiCHECK-2 vector. [score:7]
To further research the miR-22-3p and miR-149-5p induced biological meaning of the change in MTHFR expression in HCC cells, we added the expression of TP53INP1 and PDCD4 in HCC as two parameters under conditions of long term FA deficiency, and the results indicated that FA deficiency induced the expression of TP53INP1 (34%) and PDCD4 (49%) in elevated. [score:7]
These included a predicted target site (miR-22-3p) within the MTHFR 3’UTR that is ranked in the 99th percentile according to the TargetScan scoring criteria; however, this seed region was subsequently shown to be a pseudo target site, and thus those results are not shown here. [score:7]
When compared with the targets predicted by TargetScan, miR-22-3p and miR-149-5p target sites were found to be conserved in mammals. [score:6]
This study aimed to reveal the relationship between FA deficiency and the expression of miR-22-p/miR-149-5p and the targeted regulation of miR-22-3p/miR-149-5p on the key folate metabolic gene Methylenetetrahydrofolate reductase (MTHFR). [score:6]
The survival time is shorter in patients with low miR-22 expression compared with those with high expression, and the overexpression of miR-22 exerts an anti-proliferative effect on HCC cells both in vitro and in vivo. [score:6]
When compared with targets predicted by miRDB, the MTHFR 3’UTR also harbored the same five additional poorly conserved miR-22-3p target sites and the same three additional poorly conserved miR-149-5p target sites. [score:6]
FA deficiency led to an upregulation of miR-22-3p/miR-149-5p expression in QGY-7703/HL-7702 cells, while the transcription of MTHFR was decreased in QGY-7703 cells but elevated in HL-7702 cells. [score:6]
The level of miR-22, which is downregulated in HCC, is correlated with a decrease in the disease-free survival of HCC patients. [score:6]
Expression of miR-22-3p and miR-149-5p is upregulated under conditions of FA deficiency. [score:6]
The results of this study suggested that miR-22-3p directly targeted MTHFR, which led to the repression of MTHFR expression. [score:6]
The study by Zhou et al. [55] found that miR-22 is downregulated in HCC and that its expression is associated with the differentiation, metastasis and prognosis of carcinomas. [score:6]
Furthermore, a high-level expression of miR-22-3p and miR-149-5p in HCC and human hepatocytes was strongly associated with the downregulation of MTHFR mRNA levels under conditions of FA deficiency. [score:6]
Expression of MTHFR is affected under conditions of FA deficiencyTo explore the miR-22-3p and miR-149-5p induced difference in expression of MTHFR between HCC cells and normal hepatocytes, the relative expression of MTHFR in hepatocellular carcinoma cells under conditions of FA deficiency was markedly lower in 12% (P<0.05, 7 [th] day), 17% (P<0.01, 14 [th] day) 20% (P<0.01, 21 [st] day) of cells compared with the control. [score:6]
It was shown that miR-22-3p and miR-149-5p were also upregulated 69% (P<0.05, 14 [th] day) and 48% (P<0.05, 14 [th] day), respectively, miR-149-5p were upregulated 37% (P<0.01, 21 [st] day) when HL-7702 cells were grown in the FA-free medium compared with the control. [score:6]
They also found that the expression of miR-22 in hepatocellular carcinoma is significantly associated with histological differentiation and is negatively correlated with the expression of ezrin protein. [score:5]
In addition, the overexpression of miR-22-3p and miR-149-5p was associated with the inhibition of MTHFR protein levels in HCC under conditions of FA deficiency/FA-free medium. [score:5]
In normal hepatocytes, miR-22 and the inhibition of MAT1A expression [41] lead to an overall decrease in methylation. [score:5]
Moreover, the slightly high expression of miR-22-3p and miR-149-5p was correlated with the maintenance of the translational levels of MTHFR in normal hepatocytes. [score:5]
2014; 13(1): 11– 2. 44 Xin M, Qiao Z, Li J, Liu J, Song S, Zhao X, et al miR-22 inhibits tumor growth and metastasis by targeting ATP citrate lyase: evidence in osteosarcoma, prostate cancer, cervical cancer and lung cancer. [score:5]
To explore the miR-22-3p and miR-149-5p induced difference in expression of MTHFR between HCC cells and normal hepatocytes, the relative expression of MTHFR in hepatocellular carcinoma cells under conditions of FA deficiency was markedly lower in 12% (P<0.05, 7 [th] day), 17% (P<0.01, 14 [th] day) 20% (P<0.01, 21 [st] day) of cells compared with the control. [score:4]
Role of epigenetic and miR-22 and miR-29b alterations in the downregulation of Mat1a and Mthfr genes in early preneoplastic livers in rats induced by 2-acetylaminofluorene. [score:4]
MiR-22-3p/miR-149-5p directly targeted the 3’UTR sequence of the MTHFR gene. [score:4]
To identify the roles of miR-22-3p and miR-149-5p in the development of HCC under conditions of FA deficiency, we analyzed the expression level of miR-22-3p by Poly(A) Tailing quantitative real-time PCR (RT-qPCR) in the HCC cell line QGY-7703 on the 14 [th] and 21 [st] day after the start of FA deficiency (the cells could not survive in the FA-free RPMI 1640 medium); a matched normal hepatocyte cell line (HL-7702) was also examined. [score:4]
The 3’UTR of MTHFR is directly targeted by miR-22-3p and miR-149-5p. [score:4]
To determine whether MTHFR is a direct target of miR-22-3p and miR-149-5p, wild-type and mutant sequences of the 3’UTR of MTHFR were cloned downstream of the Renilla luciferase coding region in a psiCHECK-2 vector. [score:4]
MiR-22-silenced cyclin A expression in colon and liver cancer cells is regulated by bile acid receptor. [score:3]
MiR-22 has been determined to be a regulator or an inhibitor in diverse cancers, including osteosarcoma, prostate cancer, cervical cancer, lung cancer, [44]breast cancer[45], colorectal cancer[46], gastric cancer [47, 48], ovarian cancer[49], acute myeloid leukemia[50], medulloblastomas[51], endometrial endometrioid carcinomas[52], esophageal squamous cell carcinoma[53] and hepatocellular carcinoma[54]. [score:3]
With the above findings, our study provides a novel and comprehensive insight into the functional roles of miR-22-3p and miR-149-5p as they relate to the regulation of MTHFR in the development of HCC by DNA methylation and DNA synthesis/mismatch repair. [score:3]
0168049.g001 Fig 1The expression of miR-22-3p and miR-149-5p in QGY-7703 and HL7702 cells on the 14 [th] day and the 21 [st] day under conditions of FA deficiency/culture in the FA-free medium; U6 served as an internal reference. [score:3]
We found that miR-22-3p and miR-149-5p are potent tumor suppressors in HCC. [score:3]
The expression of miR-22-3p and miR-149-5p in QGY-7703 and HL7702 cells on the 14 [th] day and the 21 [st] day under conditions of FA deficiency/culture in the FA-free medium; U6 served as an internal reference. [score:3]
This indicates a higher likelihood of miR-22-3p and miR-149-5p targeting functionality. [score:3]
Poly (A) tailing RT-qPCR miR-22-3p and miR-149-5p expression analyses. [score:3]
0168049.g002 Fig 2Prediction and validation of the 3’UTR of the MTHFR gene as a target of miR-22-3p. [score:3]
Prediction and validation of the 3’UTR of the MTHFR gene as a target of miR-22-3p. [score:3]
We also determined the expression of miR-22-3p in the normal hepatocyte cell line HL-7702. [score:3]
To the best of our knowledge, this is the first study to demonstrate that the miR-22-3p/miR-149-5p/ MTHFR axis potentially regulates the DNA methylation/synthesis/mismatch repair system of HCC cells and normal hepatocytes (HL-7702 cells). [score:2]
The Poly (A) Tailing RT-qPCR analyses showed that the expression of miR-22-3p under conditions of FA deficiency was increased 4.19-fold (P<0.01, 14 [th] day) and 3.86-fold (P<0.001, 21 [st] day) compared with the control. [score:2]
In addition, the Poly (A) Tailing RT-qPCR validation results showed that the expression of miR-22-3p and miR-149-5p was significantly increased in the normal human hepatocyte cell line HL-7702 and the hepatocellular carcinoma cell line QGY-7703 under conditions of FA deficiency compared with the control. [score:2]
In summary, the negative regulation of MTHFR by miR-22-3p and miR-149-5p is relevant in this context. [score:2]
Previous studies have suggested that miR-22 functions in multiple cellular processes, including proliferation, differentiation, senescence and apoptosis and that their dysregulation is a hallmark of human cancer [43]. [score:2]
Here, the direct binding of miR-22-3p to the 3’UTR of MTHFR has been demonstrated for the first time. [score:2]
In summary, our results first established MTHFR as a direct functional effector of miR-22-3p and miR-149-5p in HCC. [score:2]
The results suggested that miR-22-3p/miR-149-5p exert different post-transcriptional effects on MTHFR under conditions of FA deficiency in normal and cancerous human hepatocytes. [score:1]
miR-22 in tumorigenesis. [score:1]
The results also implied that miR-22-3p/miR-149-5p might exert anticancer effects in cases of long-term FA deficiency. [score:1]
Lipofectamine 2000 (Invitrogen, USA) was used to transfect the cells with 0.8 μg per well of psiCHECK- MTHFR 3’UTR or psiCHECK-MUT reporter construct, hsa-miR-22-3p/has-miR-149-5p mimic or controls (all at 100 nM, RIBOBIO, Guangzhou, China). [score:1]
HEK293 cells were then co -transfected with these constructs along with psiCHECK- MTHFR 3’UTR (miR-22-3p/miR-149-5p), psiCHECK-MUT (miR-22-3p/miR-149-5p), miR-22-3p mimic, miR-214-3p mimic (same 3’UTR as miR-22-3p, as a positive control[35]), miR-149-5p mimic or miR-NC. [score:1]
Moreover, it has been suggested that folate may play critical roles in the prevention of tumorigenesis in different cancer types [27– 29], and preliminary studies have indicated a correlation between miR-22/miR-149 and MTHFR [30, 31]. [score:1]
Zekri AN et al. [58]identified serum miR-22 and other miRNAs with alpha fetoprotein (AFP) that might be of considerable clinical use in the early detection of HCC in both normal populations and high-risk patients. [score:1]
HEK293 cells were co -transfected with a dual-luciferase reporter vector (pisCHECK-2) wild-type or mutant MTHFR 3’UTR and with an miR-22-3p mimic, an miR-214-3p mimic, an miR-149-5p mimic or miR-NC, as indicated. [score:1]
[1 to 20 of 60 sentences]
8
[+] score: 232
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-221, hsa-mir-222
We demonstrated that c-Fos upregulates miR-22 expression in differentiated cells via direct binding to the miR-22 promoter, leading to downregulation of MDC1 and reduction in DSB repair, suggesting that c-Fos induces accumulated DSBs and prevents their repair, at least to some extent, through downregulation of MDC1 (Figure 6D). [score:13]
Collectively, these results strongly suggest that the expression of miR-22 is inversely correlated with the expression of MDC1 during cell differentiation and that miR-22 downregulates MDC1 expression at the post-transcriptional level. [score:10]
We have recently discovered that upregulation of miR-22 leads to a downregulation of MDC1, consequently suppressing efficient DSB repair [17]. [score:9]
These results suggest that that c-Fos stimulates miR-22 expression, which in turn downregulates MDC1 expression during terminal differentiation. [score:8]
To demonstrate that miR-22 effectively targets and downregulates MDC1 in terminally differentiated cells, we inhibited miR-22 during terminal differentiation and monitored MDC1 localization and the DDR function of MDC1. [score:8]
We examined miRNA expression and found that expression of miR-22 is upregulated in three terminally differentiated cell lines: MCF-7, HL60 and K562 cells. [score:8]
Consistent with these results, transfection of the anti-miR-22 (Figure 3C) or miR-22-insensitive MDC1 cDNA (Figure 3D) rescued the inhibitory effect of TPA -induced differentiation on MDC1 foci formation as shown by immunofluorescence, suggesting that inhibition of MDC1 foci in TPA-differentiated MCF-7 cells is due to expression of miR-22. [score:7]
Moreover, knockdown of both c-Fos and c-Jun did not further suppress miR-22 expression relative to c-Fos knockdown alone. [score:7]
In previous work, we demonstrated that miR-22 regulates DSB repair through downregulaton of MDC1 expression [17]. [score:7]
Here, we have uncovered a new MDC1 regulatory pathway triggered by the c-Fos -dependent upregulation of miR-22 expression during terminal differentiation. [score:7]
miR-22 downregulates MDC1 expression during terminal differentiation. [score:6]
To test whether MDC1 is directly targeted by miR-22 during terminal differentiation, we tested the effect of miR-22 on luciferase expression from control or full-length MDC1 3′-UTR-containing reporter genes in MCF-7 cells during terminal differentiation. [score:6]
Thus, we suggest that the c-Fos/miR-22/MDC1 axis -mediated downregulation of DSB repair induces chromosome instability during terminal differentiation and may represent a therapeutic target for cancer. [score:6]
miR-22 -mediated downregulation of MDC1 suppresses DSB repair in differentiated MCF-7 cells. [score:6]
Terminally differentiated MCF-7 cells expressing high levels of miR-22 exhibited a DSB repair defect, whereas knockdown of miR-22 completely rescued DSB repair in these cells, further indicating that miR-22 regulates DNA repair through MDC1 during terminal differentiation. [score:5]
Of note, the inhibition of miR-22 in TPA-differentiated MCF-7 cells significantly decreased levels of DNA damage, which indicated an inverse correlation between the level of miR-22 expression and cellular DNA repair capacity in terminally differentiated cells. [score:5]
The effect of TPA -induced differentiation on MDC1 protein expression was effectively reversed by transfecting cells with anti-miR-22 (Figure 3A and Supplementary Figure 4A) and by expressing exogenous MDC1 cDNA that does not harbor the miR-22 -binding 3′-UTR (Figure 3B and Supplementary Figure 4B). [score:5]
Similar to TPA -treated cells, RA -treated cells also showed increased miR-22 expression and decreased MDC1 expression (Supplementary Figure 2A and 2B). [score:5]
Taken together, our results provide strong evidence that c-Fos dependent upregulation of miR-22 has an important role in regulating DNA repair in differentiated cells by repressing the DDR function of MDC1, promoting accumulation of DNA damage and an environment for genomic rearrangement. [score:5]
In the present study, we have established that miR-22 is upregulated by the transcription factor c-Fos during terminal differentiation, establishing a linear signaling pathway: differentiation → c-Fos → miR-22 → MDC1. [score:4]
We then asked how miR-22 expression is regulated during cell differentiation. [score:4]
Together, these results provide evidence that endogenous miR-22 induced in response to cellular differentiation affects DSB repair, and suggests that miR-22 -mediated down-regulation of MDC1 plays a role in the genomic instability of terminally differentiated cells. [score:4]
We next showed that TPA -induced differentiation negatively regulates MDC1 expression via miR-22. [score:4]
In view of these data, we hypothesized that the down-regulation of MDC1 by miR-22 could be a key factor impairing DSB repair in differentiated cells. [score:4]
c-Fos upregulates miR-22 in differentiated cells. [score:4]
Indeed, miR-22 knockdown completely restored the level of MDC1 expression as well as the recruitment of MDC1 to the DBS sites in terminally differentiated MCF-7 cells. [score:4]
To provide further evidence of a connection between downregulation of MDC1 and the reduction of DNA repair during terminal differentiation, we overexpressed miR-22-insensitive MDC1 in TPA-differentiated MCF-7 cells and measured DSB repair. [score:4]
We now demonstrate that miR-22 is upregulated in differentiated breast cancer MCF-7 cells as well as in the human leukemic cell lines HL60 differentiated into macrophages and K562 cells differentiated into megakaryocytes. [score:4]
Indeed, miR-22 was consistently upregulated during terminal differentiation of MCF-7, HL60 and K562 cells (Figure 1C). [score:4]
Recent miRNA studies have also provided compelling evidence for an upregulation of miR-22 in various postmitotic cells [5, 23, 24]. [score:4]
Thus, we hypothesized that c-Fos and/or c-Jun might bind to the core elements of the miR-22 promoter and contribute to upregulation of miR-22 transcription in differentiated cells. [score:4]
These results suggest that miR-22 plays an important role in the DDR via regulation of MDC1 expression in differentiated cells. [score:4]
miR-22 is upregulated in post-mitotic differentiated cells. [score:4]
Elucidation of this mechanism offers opportunities for applications targeting miR-22 in therapeutic interventions. [score:3]
Taken together, these results suggest that induction of c-Fos and the subsequent ability to induce miR-22 expression is responsible for the impaired DDR function of MDC1 in differentiated cells. [score:3]
On the other hand, because miR-22 has been described as a differentiation-responsive miRNA [5, 23, 24] and because we have previously reported that it targets MDC1 [17], an important mediator of the DDR [25– 27], we were particularly interested in the miR-22. [score:3]
These data support an operational mo del in which c-Fos mediates an increase in miR-22 expression that impacts MDC1 function in differentiated cells. [score:3]
To determine which transcription factor(s) might influence miR-22 expression in differentiated cells, we performed an in silico analysis of the miR-22 promoter region (1.3 kb upstream of the miR-22 stem loop) using the transcription factor binding site program PROMO [30]. [score:3]
miR-22 affects DSB repair by modulating MDC1 expression in terminally differentiated MCF-7 cells. [score:3]
These data suggest that c-Fos is a key transcriptional regulator of miR-22 in differentiated MCF-7 cells. [score:2]
The expression of anti-miR-22 and miR-22-insensitive MDC1 showed no significant increase in γ-H2AX staining or comet moments after IR exposure compared to undifferentiated cells. [score:2]
We observed that knockdown of c-Fos reduced miR-22 levels in TPA-differentiated MCF-7 cells, whereas c-Jun siRNA did not affect miR-22 level in these cells (Figure 5B). [score:2]
c-Fos negatively regulates MDC1 via miR-22 in differentiated MCF-7 cells. [score:2]
Induction of miR-22 impairs formation of MDC1 foci in differentiated MCF-7 cells. [score:1]
Wild type segments of the 3′UTR of MDC1 containing putative miR-22 binding sites and deletion mutants of predicted miR-22 binding sites were cloned into pMIR-REPORT firefly luciferase vector (Applied Biosystems) as described previously [17]. [score:1]
Cells were transfected with 50 nM anti-miR-22 or 1 μg of pcDNA-HA MDC1 using lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions, and then same cells were treated with 100 nM TPA for 3 days. [score:1]
To quantify miR-22, cDNA was synthesized using Mir-X™ miRNA first-strand synthesis and SYBR qRT-PCR kit (Clontech) according to the manufacturer's instructions. [score:1]
To determine whether the effect of TPA -induced differentiation on DSB repair was mediated by MDC1 and miR-22, we transfected MCF-7 cells with either anti-miR-22 or the miR-22-insensitive MDC1 expression plasmid, and then measured comet tail moments and the levels of γ-H2AX foci, which act as useful surrogate marker of DNA damage. [score:1]
Effect of miR-22 on IR -induced MDC1 foci in differentiated MCF-7 cells. [score:1]
Thus, there is a possibility that attenuated DNA repair in differentiated cells may be dependent on miR-22. [score:1]
We observed that the impaired DSB repair capacity in differentiated MCF-7 cells was fully rescued by anti-miR-22 (Figure 4B and 4C) or miR-22-insensitive MDC1 (Figure 4D and 4E). [score:1]
Figure 3(A and B) Untreated and TPA -treated MCF-7 cells were transfected with anti-miR-22 (A) or miR-22-insensitive MDC1 cDNA (B). [score:1]
PROMO identified six c-Jun -binding sites at -1053 and -1047, -765 and -759, -547 and -540, -433 and -427, -207 and -200, and -43 and -36 nucleotides, and five c-Fos -binding sites at -1108 and -1099, -690 and -683, -578 and -571, -547 and -540, -532 and -525 nucleotides relative to the miR-22 stem loop (Figure 5A). [score:1]
Thus, our findings suggest that c-Fos/miR-22/MDC1 might act as a sensitizer in cancer therapy and accompany anticancer drug or radiation therapy to enhance therapeutic efficacy and to improve the chance recovery from cancer. [score:1]
For rescue experiments of differentiation, anti-miR-22 (miR-22 antisense-oligonucleotide (ASO), Panagene) and the pcRNA-HA-MDC1 construct were used. [score:1]
Figure 5 (A) Representation of the human -1.3 kb miR-22 promoter fragment. [score:1]
To test this, TPA-differentiated MCF-7 cells were transiently transfected with either c-Jun siRNA, c-Fos siRNA, or siRNAs for both c-Jun and c-Fos, and then miR-22 expression levels were measured using quantitative RT-PCR. [score:1]
We also treated another differentiation-inducing agent, retinoic acid (RA), with MCF-7, HL60 and K562 cells and measured miR-22 and MDC1 expression. [score:1]
To analyze miR-22 promoter, MCF-7 cells were transiently transfected with c-jun siRNA, c-fos siRNA or both c-jun and c-fos siRNA using lipofectamine RNAiMax (Invitrogen), and subsequently, cells were induced differentiation by treatment of TPA. [score:1]
We therefore validated our array data on miR-22 by quantitative RT-PCR. [score:1]
[1 to 20 of 60 sentences]
9
[+] score: 193
MiR-22 up-regulation led to a decrease in MMP2 protein expression and an increase in E-cadherin protein expression, and the change in these protein levels was reversed by MMP14 and Snail (Figure 4E). [score:7]
Over -expression of miR-22 suppressed the proliferation of A375 melanoma cells, the opposite result was obtained after transfection with miR-22 inhibitor (Figure 3D). [score:7]
MALAT1 can promote the growth and metastasis of melanoma cells though sponging miR-22, functionally releasing MMP14 and Snail mRNA transcripts targeted by miR-22, causing MMP2 activation and E-cadherin down-regulation, and inducing ECM remo delling and EMT. [score:6]
D. Western blots identified MMP14 and Snail protein expression changes following transfection with miR-22 inhibitor or NC. [score:5]
Real-time PCR and western blotting showed that the expression of endogenous MMP14 and Snail was lower in miR-22 mimic transfected cells, and was increased in the miR-22 inhibitor group (Figure 4C–4E). [score:5]
Furthermore, the invasive and migratory abilities of A375 melanoma cells were inhibited by the miR-22 mimic, the effect of miR-22 inhibitor is opposite (Figure 3E–3H). [score:5]
Meanwhile, Real-time PCR and western blotting showed that the inhibitory effect of miR22 on the MMP14 or Snail expression were more significantly in the absence of MALAT1 (Figure 5B and 5D). [score:5]
C. The expression levels of MALAT1 in A375 cells transfected with the miR-22 mimic or inhibitor. [score:5]
Using bioinformatic analysis, we determined that MALAT1, a ceRNA, shares regulatory miR-22 with its target MMP14 and Snail (Figure 2A and Figure 4A). [score:4]
MiR-22 suppressed tumor invasion and metastasis by targeting member matrix metalloproteinase 14 (MMP14) and Snail [17]. [score:4]
Subsequently, we demonstrated that MMP14 and Snail were the downstream target of MALAT1 ceRNA function and were important for MALAT1 to regulate melanoma cell phenotypes, suggesting that MALAT1 affected melanoma progression in a miR-22 site -dependent manner. [score:4]
MMP14 and Snail are the direct functional targets of miR-22 in melanoma cells. [score:4]
Figure 4 A. The putative binding sites of miR-22 within the 3′-UTR of MMP14 and Snail, as predicted by TargetScan. [score:3]
A. The expression of MMP14 and Snail mRNA in A375 cells transfected with MALAT1 or MALAT1 combination with the miR-22 mimic. [score:3]
Figure 2 A. The putative binding sites of miR-22 on the MALAT1 transcript, as predicted by LncBase Predicted v. 2. B. Over -expression of miR-22 led to a marked decrease in luciferase activity of pMIR-MALAT1-WT, without any change in luciferase activity of pMIR-MALAT1-MUT in A375 cells. [score:3]
Figure 5 A. The expression of MMP14 and Snail mRNA in A375 cells transfected with MALAT1 or MALAT1 combination with the miR-22 mimic. [score:3]
Here, we found that miR-22 was largely reduced in melanoma tissues and acts as a tumor suppressor in melanoma cells. [score:3]
These results indicate that MMP14 and Snail are the functional targets of miR-22 in melanoma cells. [score:3]
B. The expression of MMP14 and Snail mRNA transfected with miR-22 or miR-22 combination with si-MALAT1. [score:3]
The influence of MALAT1 on MMP14, Snail, MMP2 and E-cadherin expression was reversed by the miR-22 mimic (Figure 5A and 5C). [score:3]
A. The putative binding sites of miR-22 on the MALAT1 transcript, as predicted by LncBase Predicted v. 2. B. Over -expression of miR-22 led to a marked decrease in luciferase activity of pMIR-MALAT1-WT, without any change in luciferase activity of pMIR-MALAT1-MUT in A375 cells. [score:3]
C. PCR to assess the mRNA level of MMP14 and Snail in A375 cells following transfection with miR-22 mimic or inhibitor. [score:3]
Meanwhile, real-time PCR showed that endogenous MALAT1 was reduced in miR-22 mimic -transfected cells, but miR-22 inhibitor increased MALAT1 levels (Figure 2C). [score:3]
This suggesed that MMP14 and Snail are the potential targets of miR-22. [score:3]
The hsa-miR-22 mimic and hsa-miR-22 inhibitor were also purchased from GenePharma. [score:3]
C. Transfection efficiency of the miR-22 mimic or inhibitor were determined by PCR. [score:3]
D. Western blots identified MMP14 and Snail protein expression changes following transfection with miR-22 or miR-22 in combination with si-MALAT1. [score:3]
We first detected miR-22 expression in 20 pairs of malignant melanoma tissues and adjacent normal tissues by real-time PCR. [score:3]
E. Western blots identified MMP14, Snail, E-cadherin and MMP2 protein expression changes following transfection with miR-22 alone or in combination with MMP14 and Snail. [score:3]
Taken together, these results suggest that miR-22 acts as a tumor suppressor in melanoma. [score:3]
B. Over -expression of miR-22 led to a marked decrease in luciferase activity of the WT plasmid, without significant change in the MUT plasmid in A375 cells. [score:3]
The expression and the biological functions of miR-22 in melanoma. [score:3]
C. Western blots identified MMP14, Snail, E-cadherin and MMP2 protein expression changes following transfection with MALAT1 or MALAT1 in combination with the miR-22 mimic. [score:3]
MMP14 and Snail are the functional targets of miR-22 that affect invasive and migratory abilities of melanoma cells. [score:3]
To study the mechanism of action of miR-22 in melanoma cells, we found that the binding sites of miR-22 matched the 3′-UTR of MMP14 and Snail by using bioinformatic analysis (TargetScan, http://www. [score:3]
Then we detected the expression of miR-22 in human epidermal melanocytes and human melanoma cell lines, and found that miR-22 was significantly lower in melanoma cells than in human epidermal melanocytes (Figure 3B). [score:3]
The miR-22 mimic or inhibitor was transfected into A375 cells to further study the function of miR-22 in melanoma cells (Figure 3C). [score:3]
These findings suggested that miR-22 was MALAT1 primary targeting endogenous miRNAs in melanoma cells. [score:3]
A. The putative binding sites of miR-22 within the 3′-UTR of MMP14 and Snail, as predicted by TargetScan. [score:3]
MiR-22 is down-regulated in melanoma tissues and represses melanoma cells proliferation, invasion and migration. [score:3]
Dual luciferase reporter assays showed that over -expression of miR-22 led to a marked decrease in luciferase activity of the WT plasmid, without significant change in the MUT plasmid in A375 cells (Figure 4B). [score:2]
MMP14 and Snail are the direct functional effectors of miR-22. [score:2]
We subsequently constructed luciferase reporter plasmids containing the wild-type MALAT1 (pMIR-MALAT1-WT) and mutant MALAT1 with mutations of predicted miR-22 binding sites (pMIR-MALAT1-MUT). [score:2]
Dual luciferase reporter assays showed that miR-22 over -expression led to a marked decrease in luciferase activity in pMIR-MALAT1-WT, without changing the luciferase activity of pMIR-MALAT1-MUT in A375 cells (Figure 2B). [score:2]
G. and H. The effect of miR-22 mimic or inhibitor on the migratory ability of melanoma cells was assessed by the scratch wound assay. [score:2]
And lastly, we found that MALAT1 promoted melanoma cell growth and metastasis by competitively binding the miR-22, up -regulating MMP14 and Snail, and having downstream effects on MMP2 and E-cadherin protein. [score:2]
B. MiR-22 expression profile in human epidermal melanocytes (HEMa-LP) and three human melanoma cell lines (A375, SK-MEL-5 and SK-MEL-2). [score:2]
We subsequently demonstrated that MALAT1 is negatively regulated by miR-22 and that MALAT1 could act as a ceRNA by sponging miR-22 in melanoma cells. [score:2]
E. and F. The effect of miR-22 mimic or inhibitor on the invasive capacity of melanoma cells was assessed by the transwell assay. [score:2]
These data indicate that MALAT1 is negatively regulated by miR-22 in melanoma cells. [score:2]
Subsequently, we performed an RNA pull-down analysis to detect endogenous miRNAs associated with the MALAT1 to further validate the direct interaction between miR-22 and MALAT1. [score:2]
MiR-22 is a tumour suppressor in many human tumors, such an renal cell carcinoma, glioblastoma, and gastric cancer [17, 33, 34]. [score:2]
A. The level of miR-22 was analysed in primary malignant melanoma tissues and adjacent normal tissues. [score:1]
The cells were co -transfected with the luciferase reporter construct and hsa-miR-22 mimic or mimic control. [score:1]
F. and G. MMP14 and Snail plasmids reversed the effect of miR-22 on the invasive ability of melanoma cells. [score:1]
However, the biding between MALAT1 and miR-1 or miR-145 (positive control) were significantly less than miR-22 (Figure 2E). [score:1]
G. and H. The miR-22 mimic reversed the effect of MALAT1 on the migratory capacity of melanoma cells. [score:1]
The interaction of MALAT1 with miR-22. [score:1]
Future studies to assess the role of the MALAT1/ miR-22/ MMP14/ Snail axis in a clinical context are warranted. [score:1]
Quantitative RT-PCR was used to detect the levels of MALAT1, MMP14, Snail, miR-18b, miR-1, miR-145 and miR-22. [score:1]
MALAT1 promoted melanoma cell growth and metastasis by operating as a ceRNA for the miR-22. [score:1]
E. and F. The effect of MALAT1 on the invasion of melanoma cells was largely abrogated by the miR-22 mimic. [score:1]
We found that the MS2-tagged wild-type MALAT1 (MALAT1-WT-MS2) was significantly enriched for miR-22 compared to the empty vector and MALAT1 with a mutation in the miR-22 binding site (MALAT1-MUT-MS2) in A375 cells (Figure 2D). [score:1]
We also demonstrated that MALAT1 promoted the proliferation, invasion and migration of melanoma cells by acting as a competing endogenous RNA (ceRNA) for miR-22. [score:1]
The effect of miR-22 on the invasive and migratory abilities of A375 melanoma cells was also largely abrogated by the MMP14 and Snail plasmids (Figure 4F–4I). [score:1]
D. and E. MS2-RIP followed by miRNA RT-PCR to detect endogenous miR-22, miR-1, miR-18b or miR-145 associated with the MS2-tagged MALAT1 transcript. [score:1]
We predicted the binding sites of miR-22 on MALAT1, MMP14 and Snail by using bioinformatics websites. [score:1]
Moreover, the effect of MALAT1 on the migration and invasion of melanoma cells was also largely abrogated by an miR-22 mimic (Figure 5E–5H). [score:1]
The potential miR-22 binding sites in MALAT1 transcripts were predicted using LncBase Predicted v. 2 (http://carolina. [score:1]
The potential miR-22 binding sites in MALAT1 transcripts were predicted. [score:1]
Figure 3 A. The level of miR-22 was analysed in primary malignant melanoma tissues and adjacent normal tissues. [score:1]
MALAT1 is physically associated with miR-22 in melanoma cells. [score:1]
H. and I. MMP14 and Snail plasmids reversed the effect of miR-22 on the migratory capacity of melanoma cells. [score:1]
In summary, the results indicated an important role for MALAT1 in modulating MMP14 and Snail by competitively binding miR-22. [score:1]
The 3′-UTR fragment of MMP14 and Snail containing the putative miR-22 binding sequences was inserted into pMIR-REPORT vectors. [score:1]
However, little is known about the role of miR-22 in melanoma. [score:1]
[1 to 20 of 76 sentences]
10
[+] score: 161
Recently, several targets of miR-22 were reported to mediate its tumorsuppressive effect, such as tumor-suppressive PTEN, Max genes, p21, Sp1, CD147 and oncogene c-Myc expression, etc. [score:9]
The expression of miR-22 is down-regulated in ESCC tissues and cell lines. [score:6]
miR-22, originally identified in HeLa cells, has been found to be overexpressed in prostate cancer, but down-regulated in breast cancer, cholangiocarcinoma, multiple myeloma, and hepatocellular carcinoma [14]. [score:6]
Therefore, we conclude that miR-22 expression is significantly down-regulated in ESCC at mRNA levels in a manner negatively associated with aggressive tumor behaviors. [score:6]
Our results showed that restoration of miR-22 expression suppressed cell proliferation in both of the ESCC cell lines (Figure  3B and C). [score:5]
miR-22 might act as a tumor suppressor and serve as a potential therapeutic target in ESCC. [score:5]
These results have increased our knowledge of the expression profile of miR-22 in tumor types and this specific expression mode indicates that miR-22 might play an important role in ESCC cancer progression. [score:5]
Our findings suggest that miR-22 act as tumor suppressor and inhibiting ESCC cell migration and invasion. [score:5]
Figure 3 Overexpression of miR-22 inhibits proliferation of ESCC cell lines. [score:5]
Over -expression of miR-22 inhibits ESCC cell proliferation. [score:5]
In summary, the present study provides evidence to support that miR-22, a microRNA downexpressed in ESCC, inhibits cell migration and invasion of ESCC cells in vitro. [score:5]
Furthermore, transfection of miR-22 expression plasmid could significantly inhibit the cell proliferation, migration and invasion in Eca109 and Kyse410 ESCC cell lines. [score:5]
Our results indicate that miR-22 served as a tumor suppressor miRNA and contributed to inhibition of migration and invasion of ESCC cells. [score:5]
Figure 4 Overexpression of miR-22 inhibits migration and invasion of ESCC cell lines. [score:5]
As expected, transfection of miR-22 expression plasmid into Eca109 and Kyse410 cells resulted in substantial increase of miR-22 expression compared with negative control (NC) transfected cells (Figure  3A, P = 0.023). [score:4]
We found that the expression of miR-22 in ESCC tissues and cell lines were much lower than that in normal control, respectively. [score:3]
To the best of our knowledge, this is the first study to examine the expression and mechanism of miR-22 in ESCC migration and invasion. [score:3]
Restoration of miR-22 in Eca109 and Kyse410 cells significantly inhibited cellular migration and invasion capability. [score:3]
We also confirmed that miR-22 expression was significantly reduced in metastasis tumors (P = 0.0034) and advanced histologic grades (P = 0.0315, Figure  1B,C). [score:3]
Taken together, our results suggest that miR-22 as a tumor suppressor plays a role in the metastasis and progression of ESCC. [score:3]
However, the expression and role of miR-22 in ESCC have not yet been clarified. [score:3]
Subsequently, miR-22 was identified to be ubiquitously expressed in a variety of tissues [7]. [score:3]
Figure 2 The relative expression levels of miR-22 in the eight ESCC cell lines and one normal esophageal epithelial cell lines. [score:3]
miR-22 expression in Eca109 and Kyse410 cells was relatively low. [score:3]
In addition to cell growth inhibition, the effect of miR-22 on tumor migration and invasion was also addressed in this study. [score:3]
We also discovered that miR-22 suppress ESCC cell migration and invasion. [score:3]
Lately, miR-22 is identified as a tumor-suppressing microRNA in many human cancers. [score:3]
Figure 1 miR-22 is down-expressed in ESCC tissues. [score:3]
The down -expression of miR-22 correlates with ESCC metastatic ability. [score:3]
miR-22 is a 22-nt non-coding RNA and was originally identified in HeLa cells as a tumor-suppressing miRNA. [score:3]
As showed in Figure  1A, we found that tumor tissues showed aberrant downregulation of miR-22 compared with adjacent non-tumor tissues (P = 0.0015). [score:3]
We also detected the miR-22 expression in ESCC and normal esophageal epithelial cell lines. [score:3]
miR-22 inhibits ESCC cell migration and invasion. [score:3]
The expression of miR-22 was inversely correlated with ESCC metastatic ability. [score:3]
For the expression of miR-22, genomic fragment of Homo sapiens miR-22 precursor was amplified by PCR using the primer pairs: 5’- GGG GGA TCC CTG GGG CAG GAC CCT -3’ and 5’- GGG GAA TTC AAC GTA TCA TCC ACC C -3’ [23]. [score:2]
In this study, we demonstrated that miR-22 expression is decreased in human ESCC tissues and cell lines compared with matching adjacent normal tissues and cell lines. [score:2]
The identification of miR-22 as an essential regulator of tumor cell migration and invasion in vitro emphasizes an essential role of this miR-22 in mediating ESCC oncogenesis and tumor behavior. [score:2]
In our study, we demonstrated that miR-22 expression is decreased in human ESCC tissues and cell lines compared with matching adjacent non-tumoral tissue and normal cell lines. [score:2]
The identification of miR-22 as an important regulator of tumor cell migration and invasion in vitro emphasizes an essential role of this miRNA in mediating ESCC oncogenesis and tumor behavior. [score:2]
As showed in Figure  2, miR-22 levels of all cancer cell lines were lower than that of normal esophageal epithelial cells (NEEC) (P = 0.003). [score:1]
The expression levels of miR-22 were first evaluated in thirty paired of ESCC and normal tissues by real time RT-PCR. [score:1]
Briefly, 1 × 10 [6] cells were seeded in six-well plates, cultured overnight, and transfected with miR-22 and control, respectively. [score:1]
These findings imply that miR-22 might be a suitable candidate for anticancer therapy. [score:1]
In the current study, we validated the differential expression of miR-22 in ESCC and investigated the function of miR-22 in migration and invasion of ESCC cancer cells. [score:1]
We first measured miR-22 expression level in 30 paired of ESCC and matched normal tissues, ESCC cell lines by real-time quantitative RT-PCR. [score:1]
The PCR product was cloned into pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) named as pcDNA3.1-miR-22. [score:1]
The wound-healing assay showed that Eca109 and Kyse410 cells with miR-22 overexpression presented a slower closing of scratch wound, compared with the negative controls (Figure  4A, P = 0.019 and P = 0.021). [score:1]
miR-22 Esophageal squamous cell carcinoma Invasion Migration Esophageal cancer, one of the most common malignant tumors, is the eighth most common cancer and the sixth most common causes of cancer mortality in the world [1, 2]. [score:1]
The findings of this study contribute to the current understanding of the functions of miR-22 in ESCC. [score:1]
However, the specific function of miR-22 in ESCC is unclear at this point. [score:1]
Based on the above results, we detected whether miR-22 can change the capacity of ESCC cells for proliferation. [score:1]
We transfected Eca109 and Kyse410 cells with miR-22 expression vector or pcDNA3.1 control, and then evaluated the cell growth rate. [score:1]
[1 to 20 of 52 sentences]
11
[+] score: 154
To support functional targeting of P2rx7 mRNA by miR-22, we transfected neuronal cells (N2a) with either LNA -modified antagomirs to inhibit miR-22 (Ant22) or a mimic sequence (Mi22) to upregulate miR-22, and then recorded P2X7R agonist-evoked currents (Fig. 2K). [score:8]
Inhibition of miR-22 increases P2X7R protein and function in vivoTo obtain in vivo evidence that P2X7R is a target of miR-22 we tested the effects of inhibiting miR-22 in mice using antagomirs. [score:7]
Mimics targeting miR-34a have recently entered clinical trials for the treatment of cancer 44 and we therefore attempted to directly upregulate miR-22 in the hippocampus by intracerebroventricular microinjection of Mi22. [score:7]
To obtain in vivo evidence that P2X7R is a target of miR-22 we tested the effects of inhibiting miR-22 in mice using antagomirs. [score:5]
miR-22 mimic treatment reduces P2X7R expression and seizures in vivoLast, we sought to complement the antagomir findings and explore therapeutic potential by investigating whether over -expression of miR-22 would suppress P2X7R protein levels in the contralateral hippocampus and reduce spontaneous seizures. [score:5]
De-repression of the miRNA target by antagomirs triggered inflammatory responses that were not ordinarily seen in this brain region, and increased spontaneous seizures in mice, whereas delivery of miR-22 suppressed seizures. [score:5]
RNA therapeutics including miRNA mimics have recently entered clinical testing in humans 44 and we found that delivery of a sub-picomolar central injection of Mi22 was sufficient to upregulate miR-22 to a level comparable to that in the contralateral hippocampus and this had an anti-seizure effect. [score:4]
The major finding in the present study was that expression of the P2X7R is regulated post-transcriptionally by miR-22 within the contralateral hippocampus after status epilepticus and this restrains the emergent epilepsy phenotype. [score:4]
In animal studies where altered miR-22 expression was reported, the direction of change after status epilepticus was inconsistent 52 53. [score:4]
This pattern of cellular expression was confirmed in purified cultures of mouse hippocampal neurons, microglia and astrocytes, with highest basal levels of miR-22 found in cultured astrocytes (Fig. 2M). [score:3]
Last, we sought to complement the antagomir findings and explore therapeutic potential by investigating whether over -expression of miR-22 would suppress P2X7R protein levels in the contralateral hippocampus and reduce spontaneous seizures. [score:3]
Predicted targets of mmu-miR-22 were identified using miRanda and microRNA. [score:3]
Inhibition of miR-22 increases P2X7R protein and function in vivo. [score:3]
The most highly expressed miRNA unique to the contralateral hippocampus was miR-22-3p (hereafter miR-22) (Fig. 2G). [score:3]
However, data here show that blocking P2X7R using genetic or pharmacologic approaches was sufficient to obviate the main pro-inflammatory and pro-excitatory phenotype in miR-22 -inhibited mice. [score:3]
We next explored which cells expressed miR-22 in mouse brain tissue sections. [score:3]
Early work reported tumor-suppressor effects of miR-22 54 but anti-inflammatory and neuroprotective functions recently emerged for miR-22 in CNS mo dels 55 56. [score:3]
We then searched the 2902 predicted targets of mmu-miR-22 against the 468 mouse proteins with the term “ion channel” and found 15 proteins, which were Ank3, Arrb1, Clcc1, Cav3, Cnga2, Itpr1, Mylk, P2rx7, Ryr3, Tmc3, Trpc5, Trpm5, Trpm6, Trpm7 and Unc80. [score:3]
We did not observe a reduction in P2rx7 transcript levels due to miR-22 targeting. [score:3]
This suggests that, despite multi -targeting potential of miRNAs, the main effects of miR-22 in the contralateral hippocampus are via P2X7R. [score:3]
Thus, while our data point to miR-22 protecting via suppression of P2X7R and thus an anti-inflammatory mechanism, inflammatory signaling is not invariably pro-epileptogenic. [score:3]
To overexpress miR-22 we used chemically -modified double-stranded RNAs (mirVana™ mimics; Life technologies). [score:3]
Consistent with a role in suppressing neuroinflammation, we found that blocking miR-22 resulted in an early and sustained elevation in proinflammatory signaling and molecular markers of excitability in the contralateral hippocampus. [score:3]
Taken together, these findings are consistent with miR-22 targeting of P2X7R after status epilepticus in the contralateral hippocampus. [score:3]
miR-22 inhibition increases astrogliosis and impairs cognitive performance in epileptic mice. [score:3]
Based on these neuroinflammatory responses, we hypothesized that miR-22 inhibited mice would develop exacerbated epilepsy. [score:3]
miR-22 mimic treatment reduces P2X7R expression and seizures in vivo. [score:3]
Notably, specificity protein 1 (Sp1) was recently identified to control expression of P2X7R in neurons 73 and the miR-22 promoter contains putative Sp1 binding sites (C. C. personal communication). [score:3]
Among several miRNAs that could potentially target P2X7R, only miR-22 was up -loaded into the RISC. [score:3]
In vivo silencing of miR-22 exacerbates epilepsyBased on these neuroinflammatory responses, we hypothesized that miR-22 inhibited mice would develop exacerbated epilepsy. [score:3]
miR-22 inhibition exacerbates epilepsy in mice. [score:3]
These findings suggest miR-22 normally restrains development of a contralateral epileptogenic focus in this mo del and loss of miR-22, as with loss of miR-128 28, is pro-epileptic. [score:2]
MicroRNA-22 targets the P2X7R in the contralateral hippocampus. [score:2]
Thus, silencing miR-22 exacerbates epilepsy and leads to contralateral hippocampal involvement in spontaneous seizures. [score:1]
We found that miR-22 and the P2rx7 transcript were selectively uploaded to the RISC in the normally spared contralateral hippocampus of mice after status epilepticus triggered by intra-amygdala kainic acid. [score:1]
Further studies will be required to determine which cellular effect of miR-22 silencing is the most important contributor to the epilepsy phenotype. [score:1]
To investigate whether miR-22 inhibition also affected function of the P2X7R, we performed patch-clamp recordings from EGFP -positive dentate granule cells in ex vivo slices obtained from Scr- and Ant22 -treated P2rx7 reporter mice 12 h after status epilepticus (Fig. 3H). [score:1]
Combining both approaches identified miR-22 as the most abundant RISC -loaded miRNA unique to the contralateral hippocampus after status epilepticus. [score:1]
Sequence for the probes: anti-miR-22: CTTCAACTGGCAGCTT/3Dig_N and anti-antagomir; 5DigN/AGCTGCCAGTTGAAG/3Dig_N. [score:1]
Silencing miR-22 also caused a rapid escalation of epileptic seizure rates in mice. [score:1]
Mimic effects on miR-22 and seizures were short-lived, however, contrasting the prolonged effects of antagomirs in this study and reported previously 27. [score:1]
The miR-22 antagomir sequence was CTTCAACTGGCAGCT and scrambled was ACGTCTATACGCCCA. [score:1]
We proceeded next to study the effect of silencing miR-22 on seizures. [score:1]
The mature sequence of miR-22 is fully conserved between mouse and human (Fig. 2H). [score:1]
In silico analysis identified a putative miR-22 seed binding site in the 3′UTR of the P2rx7 transcript, comprising an 8 nt match, starting at the second nt (adenosine) from the 5′ end of the miRNA (Supplementary Fig. 2A). [score:1]
In situ hybridization detected a strong miR-22 signal in granule layer cells as well as hilar and pyramidal neurons and smaller cells, likely glia, as well as in the neocortex and other brain regions (Fig. 2L and Supplementary Fig. S2B). [score:1]
High P2X7R levels, however, render microglia susceptible to ATP -induced apoptosis 70 so it is possible silencing miR-22 promoted microglial cell death. [score:1]
The probes to detect miR-22 or the antagomir were 2′-O,4′-C methylene bicyclonucleoside monomer-containing oligonucleotides (LNA -modified. [score:1]
miR-22 is uploaded to the RISC in the contralateral hippocampus. [score:1]
Understanding what controls miR-22 activation may help explain why secondary epileptic foci form in some cases. [score:1]
It will require additional studies to determine why the seizure “dose” that reaches the contralateral hippocampus induces the pathway and why induction of miR-22 is not effective in the ipsilateral hippocampus. [score:1]
The distribution of miR-22 was similar in tissue sections from mice after status epilepticus (Fig. 2L). [score:1]
In vivo silencing of miR-22 exacerbates epilepsy. [score:1]
Notably, the miR-22 in situ signal was readily observed in ipsilateral neurons including dentate granule cells, where there was no RISC loading of the P2rx7 transcript. [score:1]
In vivo silencing of miR-22 exacerbates astrogliosisWe next examined pathological changes in the hippocampus after epilepsy monitoring in Ant22 and Scr mice. [score:1]
This may be due to the Ago2 search and selection process 72 or the transcriptional control of miR-22, the mechanisms of which are unknown in the brain. [score:1]
An interesting observation in the present study was the dramatic astrogliosis found in the contralateral hippocampus of miR-22 silenced epileptic mice. [score:1]
miR-22 manipulation alters P2X7R function in vitro and in vivo. [score:1]
This suggests de-repression of P2X7R by silencing miR-22 generates an early pro-inflammatory environment in the post-status contralateral hippocampus. [score:1]
Black arrows, granule neurons; miR-22 was also present in glia-like cells (white arrows). [score:1]
Determining which of the multiple potentially pro-epileptogenic effects of silencing miR-22 is most critical for the epilepsy phenotype will require further studies. [score:1]
Panels on right shows a staining control and higher-power images of miR-22 staining after SE. [score:1]
We also found that miR-22 modulation affected Tnfα levels. [score:1]
However, seizure rates during later monitoring (days 5–9) were similar to Scr levels (data not shown), perhaps as a result of the transient ability of Mi22 to enhance hippocampal miR-22 levels (see Fig. 6F). [score:1]
Pro-inflammatory phenotype in miR-22-silenced mice is P2X7R -dependent. [score:1]
In vivo silencing of miR-22 exacerbates astrogliosis. [score:1]
Silencing miR-22 increases markers of inflammation in the contralateral hippocampus. [score:1]
Injection of picomolar amounts of Mi22 produced dose -dependent, short-lasting increases in hippocampal miR-22 levels (Fig. 6E,F). [score:1]
[1 to 20 of 68 sentences]
12
[+] score: 109
Other miRNAs from this paper: hsa-mir-17, hsa-mir-125b-1, hsa-mir-125a, hsa-mir-125b-2
To further explore the role of miR-125b and miR-22 in prostate tumorigenesis, M12 stable cell lines were constructed that either increased expression of miR-125b (M12+miR125b), or expressed a proven miR-22 inhibitor, (M12+miR-22i). [score:7]
miR-125b directly targets ErbB2, ErbB3 and MET and miR-22 targets PTEN [30, 31]. [score:6]
In HEK293T cells, miR-22 gene expression has been shown to be transcriptionally upregulated by the AKT pathway in a feed forward loop, which would further decrease PTEN levels [31]. [score:6]
Restoration of miR-125b or inhibition of miR-22 expression resulted in a substantial decrease in the migratory and invasive abilities of the M12 cell line (Fig 5), which could not be accounted for by strictly modifying growth rate. [score:5]
are shown for parental M12 cells or M12 cells stably transformed with a scrambled RNA sequence as a negative control (M12+scrambled RNA), a miR-22 inhibitor (M12+miR-22 inhibitor) or restored miR-125b (M12+miR-125b). [score:5]
Conversely, miR-22 targets PTEN, the loss of which by increased expression of miR-22 further exacerbates PI3K signaling. [score:5]
In conclusion, our approach has uncovered the loss of miR-125b acting as a tumor suppressor and the overexpression of the oncomiR miR-22 in promoting prostate tumor progression. [score:5]
M12 cells stably transformed with a miARREST [™] miR22-3p inhibitor (M12+miR-22i) expression plasmid (pEZX-AM03) from GeneCopoeia (HmiR-AN0332-AM03) were maintained with hygromycin (200 μg/ml). [score:5]
Although several miRs were found to be dysregulated, most notable was the differential expression of miR-125b and miR-22 [18, 21]. [score:4]
A top strand (56 bases of sequence 5’-CATATTGG TGCTAGAAAAGGCAGCTAAAG GAAGTGAATCTGTATTGGGGTACAGGT) and bottom strand (62 bases of sequence 5’- (TCGAGTATAACCACGATCTTTTCCGTCGATTTCCTTCACTTAGACATAACCCCATGTCCAGC 62 bases) with the centrally located miR-22 target region (in italics) was synthesized and directionally cloned into the Sac/AccI site of pmirGLO (Promega). [score:4]
Dysregulation of miR-125b and miR-22 expression in RNA extracted from prostate tissue samples by LCM. [score:4]
Mutation of a single base (C to A) within the target to miR-22’s seed region [31] resulted in increased firefly luciferase activity. [score:4]
Western blots confirmed that upon inhibition of miR-22, PTEN activity was increased 7-fold (Fig 4D and 4E). [score:3]
Our studies suggest a mechanism by which these signal transduction pathways are enhanced in prostate tumorigenesis due to the loss of miR-125b and overexpression of miR-22. [score:3]
Conversely, the overexpression of miR-22 would lower PTEN levels, the cellular brake known to fine tune the PI3K/AKT pathway [40]. [score:3]
Since no significant proliferative differences were noted for altering miR-125b or miR-22 expression at 20 hours, the effect of these modifications on cell migration and invasion was determined. [score:3]
0142373.g005 Fig 5Restoration of miR-125b or inhibition of miR-22 impairs in vitro migratory and invasive potential of M12 cells but initially has little effect on cell proliferation. [score:3]
A mutant PTEN 3’-UTR sequence containing a C (red) to A mutation which has been shown to abolish regulation by miR-22 binding was similarly synthesized and cloned [31]. [score:3]
Restoration of miR-125b or inhibition of miR-22 impairs in vitro migratory and invasive potential of M12 cells but initially has little effect on cell proliferation. [score:3]
The importance of miR-125b as a tumor suppressor and miR-22 as an oncomiR was initially suggested by qRT-PCR analysis of the p69, M2182 and M12 cell lines [18]. [score:3]
These proteins figure prominently in signal transduction pathways that are targeted by miR-125b and miR-22. [score:3]
Altogether these results suggest an interesting cooperation between miR-125b and miR-22 in regulating key signal transduction pathways known to be dysregulated in prostate cancer progression (Fig 6). [score:3]
Mo del for dual regulation by miR-125b and miR-22. [score:2]
Restoration of miR-125b resulted in a substantial decrease in migratory ability (3.7-fold) for M12+miR125b in Transwell chamber assays versus a similar decrease when the action of miR-22 is inhibited (Fig 5). [score:2]
miR-22 is known to regulate PTEN activity by binding to its 3’-UTR [31]. [score:2]
Dysregulation of miR-125b and miR-22 in the p69/M12 human prostate cancer cell line progression mo del. [score:2]
Similarly, miR-22 was shown to directly bind to PTEN (Fig 4C). [score:2]
Validation of miR-125b and miR-22 binding to the 3'-UTR of ErbB2 and PTEN respectively. [score:1]
In contrast, miR-22 likely functioned as an oncomiR with the level of miR-22 increasing 3.5-fold as the cells became more tumorigenic and ultimately metastatic. [score:1]
Comparison of miR-125b (grey) and miR-22 (black) levels in RNA extracted from p69, M2182 and M12 cell lines by SYBR based qRT-PCR as described in. [score:1]
miR-125b and miR-22 may be useful as relevant biomarkers to identify and stage prostate cancer. [score:1]
Restoration of miR-125b or Decrease of miR-22 Affected the Migratory and Invasive Behavior of the M12 Cancer Cell Line. [score:1]
009) probably due to the decrease in functional miR-22 contributing to an increased level of the cellular brake PTEN (see Fig 4D and 4E). [score:1]
A miR-22 binding site within PTEN was identified by Bar et al. [31]. [score:1]
0142373.g001 Fig 1Comparison of miR-125b (grey) and miR-22 (black) levels in RNA extracted from p69, M2182 and M12 cell lines by SYBR based qRT-PCR as described in. [score:1]
Of these miRs, the importance of hsa-miR-125b (miR-125b) and hsa-miR-22 (miR-22) to tumorigenesis was further confirmed by in vitro experiments. [score:1]
[1 to 20 of 36 sentences]
13
[+] score: 73
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-21
B MIR22HG expression under microgravity; Overexpressed MIR22HG, host gene of miR-22 microRNA in DLD-1 cells under microgravity, MOLT-4 cells show no differential expression; Levels of dysregulation of direct targets of miR-22 microRNA CDK6, CCNA2, SP1 and CDKN1A in microarray data; RT-PCR validation of microRNA miR-22 levels and target genes in DLD-1 shows over expressed microRNA miR-22 in DLD-1 cells under microgravity confirming upregulation in microarray data. [score:18]
This study also demonstrated for the first time, the dysregulation of the microRNA host genome, miR-22 in a colorectal cancer cell line, DLD-1. Due to the significant tumor suppressive role of microRNA-22, its upregulation under microgravity may contribute to the anti-proliferative effect of microgravity. [score:7]
Some targets of miR-22 such as SP1, CDK6 and CCNA2 were also significantly downregulated (Fig 5B) while others such as p21 (CDKN1A) were not significantly dysregulated. [score:7]
The gene expression profile also revealed dysregulation of microRNA host genes in microgravity including the significant tumor suppressor, miR-22 in DLD-1. DLD-1 is an epithelial, adherent cell line derived from a colorectal adenocarcinoma (Dukes type C). [score:6]
The miR-22 host gene, MIR22HG was highly upregulated in DLD-1 (Log fold 4.4) but not differentially expressed in MOLT-4 (Fig 5B). [score:6]
Real Time PCR for miR-22 targets— CCND1 and CDKN1A however, did not show significant dysregulation with -0.09 log fold (down regulation) and 0.11 log fold (up regulation) change, respectively (Fig 5B). [score:6]
Identifying mechanisms by which microgravity influences miR-22 expression and the other dysregulated microRNA host genes identified in this study, may provide potential candidates for cancer therapy. [score:4]
miR-22 functions as a tumor suppressor through post-transcriptional regulation of p21 to determine cell fate [31]. [score:4]
Significantly, the deregulation of the microRNA-22 host gene and its targets was also under microgravity (Fig 5B). [score:4]
Real time PCR for miR-22 microRNA also showed a 4.18 log fold upregulation in DLD-1 cells under microgravity (Fig 5B) confirming the fold change observed in microarray analysis. [score:4]
The farnesoid X receptor regulates miR-22 which targets CCNA2 in colon and liver cancer cells [34]. [score:4]
MiR-22-silenced cyclin A expression in colon and liver cancer cells is regulated by bile acid receptor. [score:3]
[1 to 20 of 12 sentences]
14
[+] score: 63
Other miRNAs from this paper: hsa-mir-101-1, hsa-mir-130a, hsa-mir-101-2, oar-mir-22
Similarly, miR-22 expression is down-regulated possibly explaining increased ESR1 expression level during fetal ovarian development. [score:9]
MiR-22 is down-regulated during fetal ovarian development (GPR score 0.953, ~1900 fold; Table 3) and up-regulated during testicular development (GPR score 0.500, 2.6 fold; Table 3), according to real time PCR. [score:8]
Based on our results, we further suggest that Let7 and miR-22 regulate estrogen signalling during fetal sheep gonadal development, and miR-22 may be necessary for suppressing the estrogen-signalling pathway during fetal testicular development. [score:6]
MiRNA expression analysis revealed that Let7 and miR-22 are preferentially expressed in GD75 ovaries and testes, respectively. [score:5]
Based on these results, we postulate that Sertoli cell development requires suppression of estrogen signalling during sheep testicular development involving miR-22. [score:5]
Contrary, in testes CYP19A1 and ESR1 expression levels are significantly lower compared to ovaries at GD42 and GD75, whereas Let7e, Let7g, and miR-22 expression are significantly increased in GD75 compared to GD42 testes. [score:3]
Although real time PCR indicated increased miR-22 expression in GD75 testes, we were unable to detect miR-22 using in situ hybridization at this stage. [score:3]
was conducted to examine the localization of miR-22, predicted to target ESR1 in fetal sheep gonads. [score:3]
Importantly, Pandey and Picard [44] recently demonstrated that miR-22 targets and reduces ESR1 mRNA in breast cancer cells in vitro. [score:3]
Potential targets of Let7 and miR-22 are CYP19A1 and ESR1 (ERα), respectively [34]. [score:3]
Because GD90 tissue sections were available, we explored the possibility that miR-22 can be detected by in situ hybridization at later stages of fetal gonadal development. [score:2]
Color development was monitored and stopped by washing the slides in PBST (5 hours for U6, 48 hours for miR-22 and scramble). [score:2]
As estrogen signaling is important in human and sheep ovarian development, these data indicate that miR-22 is involved in repressing estrogen signaling within fetal testes. [score:2]
Cellular localization of miR-22 was examined in GD75 and GD90 ovaries and testes using non-radioactive in situ hybridization. [score:1]
D) GD90 testis section incubated with miR-22 DIG labeled probe. [score:1]
C) GD75 testis section incubated with miR-22 DIG labeled probe indicating no positive staining. [score:1]
To examine the cellular localization of miR-22, LNA -modified probes and in situ hybridization was performed on GD75 testicular tissue sections. [score:1]
Using a LNA -modified probe specific to miR-22, in situ hybridization analysis revealed specific localization of miR-22 in Sertoli cells within testicular cords of GD90 testis sections, but not GD75 testis sections (Figure 4). [score:1]
One possibility is that in situ hybridization was not sensitive enough to detect miR-22 at this stage. [score:1]
Non-radioactive in situ hybridization was performed using DIG labeled LNA miRNA probes for U6 (positive control), miR-22, and a scramble (negative control) (Cat # 99002-15, 300500-15, and 99004-01 respectively; Exiqon, Vedbaek, Denmark) according to the manufacturer's instruction and included a Tyramide Signal Amplification (TSA) step (Perkin-Elmer, Waltham, MA). [score:1]
revealed miR-22 localization within fetal testicular cords. [score:1]
Cellular localization of miR-22 in fetal sheep gonads. [score:1]
[1 to 20 of 22 sentences]
15
[+] score: 61
miR-22 expression inhibits cell migration and invasion via targeting transcription factor Sp1 [35], while it suppresses colon cancer cell migration and invasion by inhibiting the expression of T-cell lymphoma invasion and metastasis 1 (TIAM1) [36]. [score:13]
While expression of some of these miRNAs seemed to be specifically dysregulated in certain tumor stages, 12 miRNAs, including 4 up-regulated (miR-200c, miR-487a, miR-491-3p and miR-452) and 8 down-regulated miRNAs (miR-125b, miR-142-3p, miR-199a-5p, miR-22, miR-299-3p, miR-29a, miR-429, and miR-532-5p), were identified to be commonly dysregulated in all ccRCC tumors at different stages (Table 1). [score:11]
Eleven commonly dysregulated miRNAs, including 3 up-regulated (miR-487a, miR-491-3p and miR-452) and 8 down-regulated (miR-125b, miR-142-3p, miR-199a-5p, miR-22, miR-299-3p, miR-29a, miR-429, and miR-532-5p), were identified in ccRCC tumor samples as compared with adjacent nontumorous samples. [score:7]
Eleven miRNAs were identified to be commonly dysregulated, including three up-regulated (miR-487a, miR-491-3p and miR-452) and eight down-regulated (miR-125b, miR-142-3p, miR-199a-5p, miR-22, miR-299-3p, miR-29a, miR-429, and miR-532-5p) in tumor tissues as compared with adjacent normal tissues. [score:7]
Three key miRNAs (miR-199a-5p, miR-22 and miR-429), which regulate 53, 53, and 51 predicted target genes, respectively, were identified based on the miRNA-gene networks (Table 2). [score:4]
The 11 miRNAs and their predicted target genes were analyzed by Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and three key miRNAs (miR-199a-5p, miR-22 and miR-429) were identified by microRNA-gene network analysis. [score:3]
Down-regulation of miR-199a-5p, miR-22 and miR-429 in ccRCC of all three stages and in 786-O cells as compared with normal kidney samples. [score:3]
Three key miRNAs were refined according to miRNA-gene network analysis and the enrichment of predicted target genes in the “Pathway in cancers” (pathway Id, hsa05200), including miR-199a-5p, miR-22 and miR-429. [score:3]
0125672.g003 Fig 3Down-regulation of miR-199a-5p, miR-22 and miR-429 in ccRCC of all three stages and in 786-O cells as compared with normal kidney samples. [score:3]
Tumor suppressive function of miR-22 has been reported in gastric cancer and colon cancer. [score:3]
This study identified 11 commonly dysregulated miRNAs in ccRCC, three of which (miR-199a-5p, miR-22 and miR-429) may represent key miRNAs involved in the pathogenesis of ccRCC. [score:2]
As miR-199a-5p and miR-22 were more greatly down-regulated in 786-O cells compared to miR-429, and the function of miR-22 has been wi dely studied in other cancers, we selected the less characterized miR-199a-5p for functional validation. [score:1]
Three miRNAs (miR-199a-5p, miR-22 and miR-429) were further refined and may represent key miRNAs in the pathogenesis of ccRCC. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 56
To clarify the biological links between miRNAs and TNRC6B, we examined the expression pattern of TNRC6B in Huh7 cells by real-time qPCR when expression levels of miR-18a, miR-18b miR-122, miR-221, miR-423-5p, and miR-22 were either over-expressed or suppressed. [score:9]
The expression pattern of TNRC6B when miR-22 was over-expressed or suppressed was similar to the expression pattern using miR-18b (Figure  1B). [score:9]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
TNRC6B on the other hand, was a common target gene in miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 using Targetscan. [score:5]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
Down-regulation of miR-22 has proliferative effect on HCC [23]. [score:4]
Then, we speculated that miR-18b and miR-22 could regulate the expression level of TNRC6B, and to clarify this physiological association, we performed an Ago2-coimmunoprecipitation (Ago2-IP) analysis. [score:4]
Homo sapiens trinucleotide repeat containing 6B (TNRC6B) was a common hypothetical target gene in miR-221, miR-18a, miR-18b, miR-423-5p, miR-455-3p, miR-1914*, miR-215, miR-122*, let-7b, and miR-22 using miRanda algorithm. [score:3]
The concentration of TNRC6B IP -RNA treated with miR-18b was higher than those treated with the control RNA or double strand of miR-22, miR-455-3p, and let-7b (Figure  1D). [score:1]
Ago2-IP fractionated cell lysates were prepared by transfecting 293FT cells with mature double strand of miR-18b, miR-22, miR-455-3p, let-7b, or a non-specific siRNA which was used as a control RNA. [score:1]
[1 to 20 of 12 sentences]
17
[+] score: 55
More importantly, histone deacetylase 4 (HDAC4), known to have critical roles in cancer development, was shown to be directly targeted and regulated by miR-22 [26]. [score:6]
In concordance, ectopic miR-22 expression in both Sk-Hep1 and Mahlavu cells under FD conditions showed a significantly decreased self-renewal ability (less tumor spheres generated) while the reverse was observed with the addition of miR-22 inhibitor. [score:5]
A recent study indicated that ectopic expression of miR-22 significantly inhibits HCC cell proliferation and tumourigenicity. [score:5]
When miR-22 expression was increased by exogenous mimic molecules, a significantly lower number of spheres generated from both Sk-Hep1 and Mahlavu cell lines while the reverse was observed when miR-22 inhibitor was added (Figure 4B). [score:5]
Down-regulation of miR-22 signaling axis in FD-conditioned HCC cells. [score:4]
FD -induced stemness was associated with down-regulation of miR-22. [score:4]
Subsequently, our Western blot analysis showed that miR-22 mimic treatment led to a decreased HDAC4, ZEB2 and Oct4 while an increased in PRRX1 and the reverse was observed when inhibitor was added (Figure 4C). [score:3]
A. FD-conditioned Sk-Hep1 and Mahlavu cells appeared to express a significantly lower level of miR-22. [score:3]
Figure 4 A. FD-conditioned Sk-Hep1 and Mahlavu cells appeared to express a significantly lower level of miR-22. [score:3]
However, it appears that in HCC, miR-22 acts as a tumor suppressor. [score:3]
B. The addition of miR-22 mimic significantly reduced the number of HCC spheres generated in both cell lines while the introduction of miR-22 inhibitor increased the number of spheres. [score:3]
C. Western blot analysis demonstrated that the expression of HDAC4, ZEB2, Oct4 was negatively correlated to the level of miR-22 while the reverse was true for PRRX1, in both cell lines. [score:3]
FD-conditioned HCC cells contained a lower level of miR-22 leading to the elevated level of HDAC4, an established oncogenic epigenetic modifier [40, 41], may provide a partial and mechanistic explanation for the association between cancer development and folate deficiency. [score:2]
The functional and oncogenic role of miR-22 has been implicated as an epigenetic modifier and promoter of EMT and breast cancer stemness toward metastasis [25]. [score:1]
We observed a significantly lower level of miR-22 in both FD-conditioned SK-Hep1 and Mahlavu cells (Figure 4A). [score:1]
However, in hepatocellular carcinoma, a decreased level of miR-22 has recently been associated with poor prognosis in hepatoma patients [26]. [score:1]
Mechanistically, we have identified a negative association between miR-22 level and FD -induced EMT and stem cell properties. [score:1]
MicroRNA-22 (miR-22) has been linked to c-Myc oncogenic pathway and shown to contribute to metastasis in breast cancer [25]. [score:1]
Thus, we intended to examine the role of miR-22 in FD-conditioned HCC cell lines. [score:1]
[1 to 20 of 19 sentences]
18
[+] score: 48
miR-101, miR-22, and circR-0015774 were the top upregulated sncRNAs, whereas miR-122, piR-952, and circR-0035409 were the most frequently downregulated. [score:7]
The top five differentially upregulated miRNAs in HCC (Table  5) were: miR-142 (1 million-fold), miR-7704 (257-fold), miR-101 (147-fold), miR-23a (124-fold), and miR-22 (85-fold); whereas, the top five downregulated were: miR-122 (513-fold), Let-7g (358-fold), miR-378c (187-fold), miR-185 (68-fold), and miR-451a (58-fold). [score:7]
The top five differentially upregulated miRNAs in LGDN (Table  2) were: miR-141 (625-fold), miR-101 (208-fold), miR-22 (111-fold), miR-16 (61-fold), and miR-486 (35-fold); whereas, the top five downregulated were: miR-451a (513-fold), miR-378c (104-fold), miR-361 (95-fold), miR-122 (81-fold), and miR-30c (78-fold). [score:7]
miR-22 is considered to have tumor suppressor activity; however, in our study, it showed remarkable overexpression in HCC [33]. [score:4]
The top five differentially upregulated miRNAs in eHCC (Table  4) were: miR-101 (215-fold), miR-22 (94-fold), miR-10b (34-fold), miR-19b (34-fold), and miR-192 (29-fold). [score:4]
The top five differentially upregulated miRNAs in HGDN (Table  3) were: miR-101 (266-fold), miR-22 (170-fold), miR-16 (54-fold), miR-192 (45-fold), and miR-19b (34-fold). [score:4]
The top five downregulated were: miR-26b (1 million-fold), miR-20a (1 million-fold), Let-7f (1 million-fold), miR-22–3p (1 million-fold), and Let-7c (364-fold). [score:4]
The top five downregulated were: miR-20a (1 million-fold), miR-22–3p (1 million-fold), miR-26b (1 million-fold), Let-7f (1 million-fold), and miR-30c (3545-fold). [score:4]
The top five differentially upregulated miRNAs in cirrhosis (Table  1) were: miR-7704 (403-fold), miR-22 (143-fold), miR-101 (113-fold), miR-486 (75-fold), and miR-192 (32-fold). [score:4]
In summary, miR-101, miR-22, miR-122, circR-0015774, circR-0035409, MT-TS1, MT-TP, sno115-31, and snoRD37 may serve as biomarkers for liver pathogenesis, since they were differentially expressed. [score:3]
[1 to 20 of 10 sentences]
19
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
20
[+] score: 43
Taken together, these results do not argue that EMT itself suppresses cancer, but instead demonstrate that EMT is not always associated with increased tumorigenesis, migration and invasion, and that all EMT inducers are not equal: while some of them (such as miR-22) can promote tumorigenicity, motility and invasiveness, others (such as miR-100) inhibit these properties owing to their ability to target both EMT-repressing genes and oncogenic/pro-invasive genes (Figure 7H ). [score:7]
While miR-125b and miR-720 did not cause any changes in cell morphology or EMT markers (Figure 1C and data not shown), expression of either miR-100 or miR-22 (Figure S2B) was sufficient to induce EMT: upon expression of either miRNA, epithelial cells became scattered and assumed fibroblastic morphology (Figure 1C ); E-cadherin expression was undetectable and the mesenchymal marker vimentin was dramatically induced (Figure 1D ). [score:7]
Using TaqMan qPCR assays, we confirmed that four miRNAs, miR-100, miR-125b, miR-22 and miR-720, were commonly upregulated miRNAs in EMT; five miRNAs, miR-200c, miR-141, miR-205, miR-663 and miR-638, were commonly downregulated miRNAs in EMT (Figure 1B and Table S2). [score:6]
However, in stark contrast to miR-100, miR-22 functions to promote tumorigenesis, invasion and metastasis, ostensibly through direct targeting of the TET family of methylcytosine dioxygenases [41]. [score:4]
We performed to determine the expression levels of miR-100 and miR-22 in human breast cancer. [score:3]
miR-22 expression levels in four subtypes of human breast tumors and paired normal breast tissues. [score:3]
Although miR-22 expression showed no significant difference between breast tumors and paired normal mammary tissues based on (Figure S3), patients with high levels of miR-22 had worse survival rates than patients with low levels of miR-22 [41]. [score:3]
In contrast, miR-22 expression showed no significant difference between cancer and paired normal tissues (Figure S3). [score:3]
Figure S2 Expression levels of miR-100 and miR-22. [score:3]
Consistent with our results, a recent report also demonstrated that miR-22 is an EMT inducer [41]. [score:1]
Figure S3TCGA data analysis of miR-22. [score:1]
Another EMT-inducing miRNA identified in our study is miR-22. [score:1]
The human mir-100, mir-22, mir-125b and mir-720 genomic sequences were PCR amplified from normal genomic DNA and cloned into the MSCV-PIG or pBabe-puro retroviral vector. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 40
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2
We examined the relative expression levels of miR-16 and miR-22 in SH-SY5Y cells after a 48-hour PFOS treatment as previous studies demonstrated that miR-16 [29] and miR-22 [28] regulated BDNF mRNA translation at the posttranscriptional level. [score:6]
Our results revealed that PFOS significantly increased the relative expression of miR-22, which may repress the translation of BDNF mRNA. [score:5]
Our results indicate that PFOS most likely acts through miRNA-22 rather than miRNA-16 to suppress BDNF gene expression. [score:5]
miRNA-16 and miRNA-22 are two such mediators that are known to inhibit BDNF expression [28, 29]. [score:5]
Effect of PFOS on the Relative Expression of miR-16 and miR-22. [score:3]
In addition, our results showed that the increase in miR-22 levels may contribute to the PFOS -induced decrease in BDNF expression. [score:3]
BDNF mRNA has been previously reported to the target molecule of miR-16 [29, 30] and miR-22 [28]. [score:3]
These results indicate that PFOS influenced the relative expression of miR-16 and miR-22. [score:3]
To determine the relative mechanism through which PFOS alters BDNF expression, the relative expression of BDNF related miRNAs miR-16 and miR-22-3p was measured by RT-PCR. [score:3]
The expression levels of specific miRNAs (has-miR-16 and has-miR-22-3p) were analysed using the miScript SYBR Green PCR Kit and miScript Primer Assays (Qiagen, USA) according to the manufacturer's instructions and normalized to U6 expression; the corresponding primer sequences used for miRNA reverse transcription and QPCR were not listed in the instructions. [score:2]
However, compared with the control, the relative expression of miR-22 increased 234%, 228%, and 156% in the 10, 50, and 100  μM dose groups, respectively, after a 48-hour treatment. [score:2]
[1 to 20 of 11 sentences]
22
[+] score: 40
Of note, down-regulated miR-22 and up-regulated miR-138 were found to have significant association of simultaneous inverse expression in their target genes, DDIT4 (DNA-damage-inducible transcript 4) and ROCK2 (Rho -associated, coiled-coil containing protein kinase 2), respectively (p-value < 0.05). [score:11]
Although further studies for functional validation of target genes of DEMs are necessary, the present study indicates that altered expression of miR-138 and miR-22 may be associated with the maintenance of tumor heterogeneity HMM by regulating their target gene expression. [score:10]
[a, b] Fold change and p-value were determined by RNA-seq analysis Abbreviation: FC, fold change Table 3 miRNAs Targets GO and KEGG terms EASE score hsa-mir-138-1 ROCK2 GO:0006793~phosphorus metabolic process 0.000743227 GO:0006468~protein amino acid phosphorylation 0.001408809 GO:0016310~phosphorylation 0.003583528 GO:0051130~positive regulation of cellular component organization 0.002402911 GO:0033043~regulation of organelle organization 0.039881837 GO:0007010~cytoskeleton organization 0.013056657 GO:0030036~actin cytoskeleton organization 0.013837722 GO:0030029~actin filament -based process 0.016937947 GO:0007242~intracellular signaling cascade 0.004744225 KEGG:has04810~Regulation of actin cytoskeleton 0.000105943 KEGG:has04310~Wnt signaling pathway 0.000224177 hsa-mir-22 DDIT4 GO:0012501~programmed cell death 0.009907439 GO:0008219~cell death 0.003096555 GO:0006915~apoptosis 0.007165309 GO:0009968~negative regulation of signal transduction 2.94131E-05 GO:0010648~negative regulation of cell communication 7.08217E-05 KEGG:hsa04150~mTOR signaling pathway 0.017825651Potential functions of miR-122 and miR-138-1 defining SP cells were presented. [score:8]
[a, b] Fold change and p-value were determined by RNA-seq analysis Abbreviation: FC, fold change Table 3 miRNAs Targets GO and KEGG terms EASE score hsa-mir-138-1 ROCK2 GO:0006793~phosphorus metabolic process 0.000743227 GO:0006468~protein amino acid phosphorylation 0.001408809 GO:0016310~phosphorylation 0.003583528 GO:0051130~positive regulation of cellular component organization 0.002402911 GO:0033043~regulation of organelle organization 0.039881837 GO:0007010~cytoskeleton organization 0.013056657 GO:0030036~actin cytoskeleton organization 0.013837722 GO:0030029~actin filament -based process 0.016937947 GO:0007242~intracellular signaling cascade 0.004744225 KEGG:has04810~Regulation of actin cytoskeleton 0.000105943 KEGG:has04310~Wnt signaling pathway 0.000224177 hsa-mir-22 DDIT4 GO:0012501~programmed cell death 0.009907439 GO:0008219~cell death 0.003096555 GO:0006915~apoptosis 0.007165309 GO:0009968~negative regulation of signal transduction 2.94131E-05 GO:0010648~negative regulation of cell communication 7.08217E-05 KEGG:hsa04150~mTOR signaling pathway 0.017825651Potential functions of miR-122 and miR-138-1 defining SP cells were presented. [score:8]
Among them, ROCK2 and DDIT4 were found to be statistically significant targets of miR-138 and miR-22, respectively. [score:3]
[1 to 20 of 5 sentences]
23
[+] score: 39
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
Overexpression of miR-22 during DC development enhanced CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs, while miR-22 knockdown demonstrated an opposite effect (Li et al., 2012). [score:5]
Overexpression and knockdown of miR-22 showed significant effects on the mRNA abundance of IRF8, a transcription factor essential for pDC and CD8α [+] cDC development. [score:5]
It has been found that miR-22 is highly expressed in mouse CD11c [+]CD11b [+]B220 [−] cDCs compared to pDCs, and is induced in DC progenitor cell cultures with GM-CSF, which stimulates CD11c [+]CD11b [+]B220 [−] cDCs differentiation. [score:2]
These studies demonstrated that miR-22 was important in regulating the differentiation of DC subsets (Li et al., 2012). [score:2]
[1 to 20 of 5 sentences]
24
[+] score: 39
Total and RISC -associated miRNA levels were analysed by at 72 h post-transfection and are plotted as indicated in A. To extend these data further, we also analysed similar sensor constructs containing a fully complementary miR-22-3p target or targets containing mismatches at 5′ positions 1 and 2, or 1, 2, 3 and 4, or mismatches at 3′ positions 19, 20, 21 and 22, or at only position 21 and 22. [score:5]
Total and RISC -associated miRNA levels were analysed by at 72 h post-transfection and are plotted as indicated in A. To extend these data further, we also analysed similar sensor constructs containing a fully complementary miR-22-3p target or targets containing mismatches at 5′ positions 1 and 2, or 1, 2, 3 and 4, or mismatches at 3′ positions 19, 20, 21 and 22, or at only position 21 and 22. [score:5]
As shown in Figure 5C, we in fact did not see any effect on RISC association mediated by either the mRNA targets lacking full seed homology or, perhaps surprisingly, the fully complementary miR-22-3p target. [score:5]
To test this hypothesis, we used some of the same sensor constructs analysed in Figure 3 and overexpressed the encoded sensor mRNAs specific for miR-22-3p, miR-101-3p and miR-197-3p in 293 cells. [score:3]
The indicated analysis of miR-22-3p and miR-101-3p expression levels was normalized to miR-138, which does not show differential RISC association. [score:3]
In contrast, the two constructs bearing mismatches at positions 19–22, or only at 21 and 22, as well as the target that was only complementary to the miR-22-3p seed, all enhanced the RISC association of miR-22-3p by ∼2-fold. [score:3]
We also tested an indicator construct containing three tandem miR-22-3p targets that had full complementarity to the miR-22-3p seed (nucleotides 1–8), but no other sequence homology. [score:3]
Note that the constructs with mismatches at position 1 and 2, or 1, 2, 3 and 4, lack full seed homology to miR-22 and therefore are predicted to be poor targets for miR-22 binding in vivo. [score:3]
As shown in Figure 1A, and detailed in Supplementary Table S1, we observed that several of these highly expressed miRNAs were either more highly RISC associated (e. g., miR-197-3p, miR-191-5p, miR-92a-3p and miR-92b-3p) or significantly less RISC associated (e. g., miR-22-3p, miR-27b-3p and miR-101-3p) than the average miRNA. [score:3]
Similarly, miR-22-3p is ∼5-fold less RISC associated than the average miRNA in 293 cells but is RISC associated at the average level (0.94-fold) in A549 cells. [score:1]
Specifically, miR-22-3p and miR-101-3p, both of which are normally weakly RISC associated in 293 cells (Figure 1), increased their RISC association by ∼2-fold and by ∼6-fold, respectively (Figure 5A). [score:1]
However, the level of 3′ tailing varied wi dely, with >20% of all reads specific for miR-101-3p bearing 3′ tails while <0.3% of the reads specific for miR-22-3p were tailed. [score:1]
Finally, miR-27-3p and miR-22-3p, which were underrepresented in RISC in 293 cells (Figure 1) were not found to be underrepresented in these other cell types (Figure 2). [score:1]
However, this was not observed at 3 days after transfection (miR-22-3p levels were 1.03 ± 0.56 relative to control cells; miR-101-3p levels were at 0.98 ± 0.19; and miR-197-3p levels were 1.16 ± 0.47. [score:1]
As shown in Figure 1C, we were able to fully confirm the preferential RISC association of miR-92a-3p/miR-92b-3p and miR-197-3p, and the weak RISC association of miR-101-3p and miR-22-3p, by analysis. [score:1]
[1 to 20 of 15 sentences]
25
[+] score: 39
Detailed data for all experimental validation studies are presented in Additional file 2. In summary, we identified osteo -inhibitory targets for miR-10a, miR-22, miR-26a, miR-26b, and miR-29b with the highest targeting impact resulting from miR-26a, miR-26b, and miR-29b expression. [score:9]
Figure  3 summarizes the results of experimental validations from all 22 predicted miRNA-target interactions: CDK6 was targeted by miR-22, miR-26a, miR-26b, and miR-29b; CTNNBIP1 was regulated by miR-10a and miR-29b; SMAD1 and TOB1 were both recognized by miR-26a and miR-26b; and HDAC4 was targeted by miR-29b. [score:8]
CTNNBIP1 was also regulated by miR-10a and CDK6 [45] was targeted by miR-22, miR-26a, miR-26b and miR-29b. [score:4]
Experimental validation of putative target sites on 4128bp (A) and 4169bp (B) fragments of the 10235nt 3 [′]-UTR of CDK6 (CDK6-1 and CDK6-2, shown as blue bars with indicated putative miRNA binding sites) for miRNAs miR-22, -26a, -26b, -29b, and -137 in HEK293T-Cells. [score:3]
The most redundant miRNA-target network involved miR-26a/b and miR-29b and, to a lesser extent, miR-22, miR-10a, and miR-137 (Table  1); subsequent analyses focused on these six miRNAs. [score:3]
Among the most prominently expressed miRNAs were miR-10a, miR-152, miR-22, miR-26a/b, miR-29b, miR-30b/c, miR-345, and miR-532-5p. [score:3]
miR-22 and miR-29b interacted with fragment CDK6-1. Figure 2 Experimental validation of target gene predictions. [score:3]
miR-22 and miR-29b interacted with fragment CDK6-1. Figure 2 Experimental validation of target gene predictions. [score:3]
Summarizing results from both CDK6-3 [′]-UTR fragments, significant regulatory miRNA effects were seen for miR-22, miR-26a, miR-26b, and miR-29b, whereas miR-137 had no significant effect. [score:2]
It should be noted that attempts to functionally analyze miR-10a and miR-22 failed due to a nearly complete loss of transfected USSC from the culture plates (data not shown). [score:1]
[1 to 20 of 10 sentences]
26
[+] score: 35
In our analysis, miR-22 showed significant target bias, meaning that a disproportionate number of its targets were dysregulated, including sTNFR-1A. [score:6]
We also sought to verify whether overexpression of miR-22 would affect protein levels of the predicted target sTNFR1A (soluble tumor necrosis factor receptor 1A). [score:5]
0010337.g006 Figure 6 (A) Decreased protein production of IFITM3 in miR-125a overexpressing neuronal cells and (B) decreased secretion of sTNFR-1A in miR-22 overexpressing neuronal cultures. [score:5]
Both miR-125a and miR-22 were found to be upregulated in our analysis of HIV-infected individuals. [score:4]
Second, those miRNAs which had fewer gene-targets correlating to dysregulated mRNAs, but of higher significance, for example miR-518b (Accession Number 574474), miR-424 (Accession Number 494336), miR-629 (Accession Number 693214), miR-22 (Accession Number 407004), and miR-200b (Accession Number 406984) are indicated by the dark blue in the p<0.001 column. [score:4]
Our in vitro study demonstrated that overexpressing miR-22 caused reduction in sTNFR-1A protein levels in the supernatant of primary human neurons. [score:3]
We used a lentiviral vector system to overexpress either a CDH-GFP control vector, miR-125a, or miR-22 under control of the CMV promoter. [score:3]
Lentiviral overexpression of (A) miR-22 and (B) miR-125a in primary neuronal cultures. [score:3]
Lentiviral vectors were obtained from Origene (Rockville, MD) which contained human miR-125a (#SC400749) and human miR-22 (#SC400286) mature sequences on a pCMV-MIR backbone. [score:1]
Two-hundred μL supernatant was removed at 1, 3, 5 days, and immediately following exposure to 10 MOI of miR-22 lentiviral vector. [score:1]
[1 to 20 of 10 sentences]
27
[+] score: 35
A) K562 miRNA Host Transcript miRNA:Host transcript Status miR-342 EVL Downregulated miR-548e SHOC2 Downregulated miR-486 ANK1 Upregulated B) HL60 miRNA Host Transcript miRNA:Host transcript Status miR-22 C17orf91 Downregulated miR-151 PTK2 Downregulated miR-199b DNM1 Upregulated miR-25 MCM7 Upregulated miR-618 LIN7A Upregulated The analysis of microarray data revealed induction in the expression of some of the miRNA biogenesis genes (RNASEN, DGCR8, XPO5, RAN) in K562 cell line (Table 3). [score:27]
Fold differences in the expression of some of the differentially expressed genes in normal and K562 cells (miR-22 and miR-27a) using all three methods were found to be comparable indicating quantitative nature of these approaches (Additional file 3). [score:5]
Many of the differentially regulated miRNAs, identified in this study have been reported to be involved in various cellular processes like cell cycle (miR-192) [78], apoptosis (miR-16, -126, -98) [21, 79, 80] differentiation (miR-27a, -181, -342, -223) [28, 81- 83] DNA repair (miR-24, -210) [84, 85] metastasis [86], erythroid maturation (miR-22) [87], erythropoiesis (miR-24) [88] and hematopoiesis (miR-142, -181) [89, 90]; highlighting their putative role in leukemogenesis or progression. [score:2]
Fold change differences in normal PBMC versus K562 is presented for miR-27a and miR-22 using the three transcript detection methods. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 35
Out of 11 miRs, 3 miRs were reliably detected and significantly up-regulated: miR-21, miR-92a, and miR-99a while the expression of miR-1, miR-22, and let-7f was down-regulated (Fig.   1). [score:9]
Huang WQ Wei P Lin RQ Huang F Protective Effects of Microrna-22 Against Endothelial Cell Injury by Targeting NLRP3 Through Suppression of the Inflammasome Signaling Pathway in a Rat Mo del of Coronary Heart DiseaseCell Physiol Biochem. [score:6]
Huang SC Mir-22-3p Inhibits Arterial Smooth Muscle Cell Proliferation and Migration and Neointimal Hyperplasia by Targeting HMGB1 in Arteriosclerosis ObliteransCell Physiol Biochem. [score:4]
Whether expression of miR-22 in our study is down regulated in ECs or SMCs cannot be decided, as in the plaque material, both cell types can be found. [score:4]
And in coronary ECs antagomirs of miR-22 reduce cell survival and increase expression of pro-inflammatory cytokines. [score:3]
Down regulation of miR-22 in VSMCs enhances proliferation and neointima formation via the cytokine HMGB1. [score:2]
In our study we identified three miRs that were down regulated in CAP, namely let-7f, miR-1 and miR-22. [score:2]
In rats under high fat diet miR-22 is down regulated in the heart which goes along with inflammasome activation. [score:2]
miR-22 is found in vascular SMCs and ECs. [score:1]
In both cell types, miR-22 is reduced under atherosclerosis: either in human arteries from arteriosclerosis obliterans or in coronary ECs from rats under high fat diet 35, 44. [score:1]
But surely, this decrease in miR-22 levels will create an unfavourable pro-inflammatory situation that promotes plaque formation. [score:1]
[1 to 20 of 11 sentences]
29
[+] score: 34
Expression profiling of the 6 shortlisted miRNAs revealed that most of the miRNAs were downregulated in oral tumors and miR-22-3p and miR-30b-5p were significantly downregulated in undifferentiated tumors. [score:9]
We further analyzed the expression of miRNAs with reference to cellular differentiation status and observed low-level expression of miRNAs in undifferentiated tumors, and only miR-22-5p and miR-30b-5p expression were statistically significant (P = 0.0485 and 0.0440, respectively). [score:7]
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
Except for miR-22-3p and miR-30b-5p, other miRNAs are significantly downregulated in oral tumors. [score:4]
Six miRNAs miR-137, miR-148a-3p, miR-338-3p, miR-30a/b-5p and miR-22-3p known to be associated with several cancers were chosen to study the expression levels in oral tumors 20, 25, 26. [score:3]
miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p shared maximum common downstream targets. [score:3]
Further, in undifferentiated tumors, OIP5-AS1 alone or together with other lncRNAs might sponge miR-22-3p and miR-30b-5p to a greater extent resulting in the derepression of the downstream target genes. [score:3]
[1 to 20 of 7 sentences]
30
[+] score: 32
b Relationships among target genes predicted by miR-199a-5p and miR-22 Fig. 3GO and pathway analysis results of the target genes predicted by differentially expressed miRNAs in HBV infection. [score:7]
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
In the same way, the processes targeted by miR-199a-5p and miR-22 were cellular response to starvation, fructose 2, 6-bisphosphate metabolism, central nervous system projection neuron axon genesis, neuron migration, and dendrite morphogenesis (Fig.   3b). [score:3]
b Main biological processes influenced by genes targeted by miR-199a-5p, and miR-22. [score:3]
b The expression of miR-22. [score:3]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
Five miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) matched the criterion. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 31
miRNAs Expression Mo del Target Effect on cardiac fibrosis Reference miR-21 ↑ MI Cardiac fibroblasts PTEN MAPK ↑ MMP2 expression, matrix remo deling, fibroblast survival, interstitial fibrosis Roy et al., 2009; Thum et al., 2008 miR-29 ↓ I/R, MI TGF-β ↑ MMP2 expression, excessive reparative fibrosis van Rooij et al., 2008; Kriegel et al., 2012; Nicolini et al., 2015; Yang et al., 2015 miR-30-133 ↓ I/R CTGF ↑ Collagen production Duisters et al., 2009; Nicolini et al., 2015 miR-22 ↓ MI TGF-βRI ↑ Collagen deposition Hong et al., 2016 miR-101 ↓ MI c-Fos TGF-β ↑ Collagens, fibronectin, MMP-2, MMP-9 Pan et al., 2012 MI, myocardial infarction; PTEN, phosphatase and tensin homolog; MAPK, mitogen-activated protein kinase; I/R, ischemia/reperfusion; TGF-β, transforming growth factor beta; CTGF, connective tissue growth factor; TGF-βRI, transforming growth factor beta receptor type I. In addition to cardiac disease, the potential of targeting miRNAs in other fibrotic diseases is also of current clinical importance. [score:15]
In other works, the downregulation of miRNAs was also observed in cardiac disease mo dels including reductions in miR-133, miR-590, miR-30, miR155, miR-22, miR-29, and miR101 (van Rooij et al., 2008; Duisters et al., 2009; Shan et al., 2009; Pan et al., 2012; Kishore et al., 2013; Hong et al., 2016). [score:6]
For example, the targeting of miR-22 shows clinical potential as this miRNA was found to be a negative regulator of cardiac fibrosis through the suppression of TGF-βR1 (Hong et al., 2016). [score:6]
MiR-22 may suppress fibrogenesis by targeting TGFbetaR I in cardiac fibroblasts. [score:4]
[1 to 20 of 4 sentences]
32
[+] score: 26
Histone deacetylase inhibitors (HDACi) also stimulate miR-22 expression. [score:5]
CUR inhibited Jak-3 activity and stimulated miR-22 expression. [score:5]
Suppression of the Jak3/STAT3/STAT5 resulted in an increase in pri-miR-22 and subsequently miR-22. [score:3]
In these studies, miR-22 was determined to have many effects such as inhibition of: cyclin dependent kinase 2 (CDK2), histone deacetylase 6 (HDAC6), MYC associated factor X (MAX), MYC binding protein (MYCBP), nuclear receptor coactivator 1 (NCOA1), and PTEN. [score:3]
Malignant T cells display decreased expression of miR-22 in comparison to normal T cells. [score:3]
BBR induced miR-22-3p which bound SP1 and suppressed cyclinD1 and BCL2 [265]. [score:3]
miRs such as: miR-21, miR-22, miR-34, miR-101, miR-146a miR-200 and let-7 have been associated with the CSC phenotype. [score:1]
miR-22-3p has been determined to be detected at decreased levels in HCC. [score:1]
STAT5 has been shown to bind to the promoter region of miR-22. [score:1]
BBR will increase miR-22-3p in HCC. [score:1]
[1 to 20 of 10 sentences]
33
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
miR-22 regulates ERα protein expression in a pancreatic cancer cell line [213]. [score:4]
Conversely, knockdown of miR-221 and miR-22 in ERα -negative MDA-MB-468 partially restored ERα protein expression and increased tamoxifen -induced apoptosis [212]. [score:4]
One of the predicted 3’UTR gene targets of miR-22 was ESR1 (ERα) [213]. [score:3]
In a study to identify curcumin gene targets, curcumin increased miR-22 by 65% in BxPC-3 human pancreatic carcinoma cells [213]. [score:3]
Follow-up studies showed that curcumin reduced ERα protein expression in BxPC-3 cells and that transfection of an antisense RNA oligonucleotide of miRNA-22 into BxPC-3 cells increased ERα protein by ~ 1.9-fold. [score:3]
Thus, miR-22 regulates ERα protein levels and the authors suggest a role for ERα as anti-tumorigenic in pancreatic cancer. [score:2]
[1 to 20 of 7 sentences]
34
[+] score: 25
Other miRNAs from this paper: hsa-mir-212, hsa-mir-132
To further understand SIRT1 regulation we tested (in the same LCL RNA preparations) the expression levels of miR-212 [36], miR-132 [35] and miR-22 [37] reported to regulate SIRT1, and observed opposite expression patterns compared with SIRT1 (Fig.   1, Supplementary Fig.   1). [score:6]
As shown in Supplementary Fig.   1a, miR-22 expression was down-regulated (FD = −2.5; P = 0.001) in the centenarian LCLs compared with controls aged 56–82 years. [score:5]
Negative Pearson correlation was observed between miR-22 and SIRT1 expression levels (R = −0.629 P = 1.17E-09; Supplementary Fig.   1b). [score:3]
miR-132, miR-212 and miR-22 were shown to target SIRT1 35– 37. [score:3]
In the current study, we therefore studied SIRT1, RGS2, miR-132, miR-212 and miR-22 expression levels in LCLs from healthy donors of various age groups, including centenarians, and in LCLs from AD patients. [score:3]
TaqMan® MicroRNA Assay IDs are listed below: MicroRNA Symbol TaqMan™ MicroRNA Assay ID U6 snRNA (Control miRNA Assay) 001973 hsa-miR-22-3p 000398 hsa-miR-132-3p 000457 hsa-miR-212-3p 000515 Comparative critical threshold (Ct) values were determined in duplicates for analyzing relative gene and miRNA expression in selected sample groups according to 2 [−ΔCт] (ΔCт = Ct target Gene − Ct reference gene). [score:2]
TaqMan® MicroRNA Assay IDs are listed below: MicroRNA Symbol TaqMan™ MicroRNA Assay ID U6 snRNA (Control miRNA Assay) 001973 hsa-miR-22-3p 000398 hsa-miR-132-3p 000457 hsa-miR-212-3p 000515Comparative critical threshold (Ct) values were determined in duplicates for analyzing relative gene and miRNA expression in selected sample groups according to 2 [−ΔCт] (ΔCт = Ct target Gene − Ct reference gene). [score:2]
We applied real-time PCR reactions for measuring the expression levels of SIRT1, RGS2, miR-22, miR-132 and miR-212 in postmortem olfactory bulb and hippocampus tissues from AD patients and non-demented age-matched controls. [score:1]
[1 to 20 of 8 sentences]
35
[+] score: 25
Of these differentially expressed miRNAs, miR-27b (downregulated in OA) directly targets MMP-13 expression (Stone et al., 2011); miR-22 (upregulated in OA) directly regulates PPARA and BMP-7 expression in cartilage; miR-9 inhibits MMP13 secretion in isolated human chondrocytes; and miR-146a is highly expressed in early OA cartilage and has been shown to control knee joint homeostasis and OA -associated algesia by balancing inflammatory responses in the cartilage and synovium. [score:22]
They suggested miR-22 and miR-125 as possible master regulators, and miR-344-5p/484 and miR-488 as possible master coregulators that may influence the genes involved in one-carbon metabolism. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 24
Average expression values at baseline, after 12 months and average expression change from baseline (delta values) in the vitamin D and placebo groups  Vitamin D group*___________________________________________ Placebo group___________________________________________   Baseline average expression (dCp) 12 months average expression (dCp) [a] Average difference in expression (ddCp) Baseline average expression (dCp) 12 months average expression (dCp) [a] Average difference in expression (ddCp)let-7f0.14(−0.06, 0.39)0.29(−0.10, 0.45)0.11(−0.38, 0.37)0.10(−0.05, 0.30)0.11(−0.12, 0.29)−0.12(−0.34, 0.22)let-7a1.09(0.86, 1.18)1.06(0.88, 1.27)0.07(−0.15, 0.26)0.94(0.82, 1.17)1.02(0. 81, 1.19)0.06(−0.23, 0.23)miR-151-5p−0.88(−1.12, -0.68)−0.90(−1.08, -0.66)0.04(−0.26, 0.24)−0.92(−1.24, -0.76)−1.14(−1.35, -0.78)−0.12(−0.47, 0.17)miR-22−0.81(−1.13, -0.57)−0.91(−1.17, -0.56)−0.09(−0.38, 0.29)−0. [score:17]
Among these 15 miRNAs, only miR-22, which was up-regulated, was included in our analysis. [score:4]
In the main study plasma from the 77 subjects were analysed for expression of 12 miRNAs (let-7a, let-7f, miR-19a, miR-22, miR26a, miR28-5p, miR-99b, miR151-5p, miR-221, miR-532-3p, miR-548-3p, miR-766). [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 23
miR-22 -induced inhibition of the ten-eleven-translocation gene 2 (TET2) tumor suppressor increased the methylation of TET2 target genes, such as Aim2, Hal, Igbt2, and Sp140, and resulted in positive effects on hematopoietic stem cell self-renewal and transformation. [score:7]
The oncogenic microRNA miR-22 targets the TET2 tumor suppressor to promote hematopoietic stem cell self-renewal and transformation. [score:5]
MiR-22 was recently shown to be an epigenetic modifier that promotes stemness and metastasis in breast cancer by directly targeting enzymes in the TET family, which regulate DNA demethylation (Song et al., 2013b). [score:4]
The TET family is involved in the demethylation of the miR-200 promoter, and miR-22 promotes CSC properties such as EMT and a metastatic phenotype through the suppression of the miR-200 family. [score:3]
Using ALDH activity, Ibara et al. determined that miR-205 and miR-22 were highly expressed in mouse mammary progenitor cells (Ibarra et al., 2007). [score:3]
This has led to the suggestion that mir-22 is associated with myelodysplastic syndrome and hematological malignancies (Song et al., 2013a). [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 22
Forced expression of miR-22 by either treatment with curcumin or miR-22 mimetics transfection inhibited the expression of SP1 and ESR1 target genes, whereas miR-22 anti-sense enhanced SP1 and ESR1 expressions [58]. [score:11]
They found that miR-22 was the most up-regulated and miR-199a* the most suppressed. [score:6]
The expression of two computationally predicted targets for miR-22, SP1 transcription factor (SP1) and estrogen receptor 1 (ESR1), were examined. [score:5]
[1 to 20 of 3 sentences]
39
[+] score: 22
With respect to SIRT1, we observed that its lower expression in adipose tissues of obese individuals correlated negatively with levels of miR-34a (which is physiologically up-regulated in mature adipocytes), and with two miRNA that have opposite effect on adipocyte differentiation: miR-22 (inhibiting adipogenic differentiation by targeting histone deacetylase 6) and miR-181a (promoting adipocyte differentiation by inhibition of the tumor necrosis factor α pathway) [85, 86, 87]. [score:12]
As mentioned above, SIRT -targeting miRNAs were found to be crucial for the regulation of adipogenesis and determination of MSCs differentiation towards preadipocytes (e. g., miR-34a, miR-22, miR-93, miR-146b, miR-181a) as well as lipid metabolism (miR-33, miR-34a), insulin secretion (miR-15b) and sensitivity (miR-125a), and their expression profile differs between tissues obtained from obese and normal-weight individuals [26, 41, 44, 53, 85, 86, 87, 88]. [score:6]
Zhang S. Zhang D. Yi C. Wang Y. Wang H. Wang J. MicroRNA-22 functions as a tumor suppressor by targeting SIRT1 in renal cell carcinoma Oncol. [score:4]
[1 to 20 of 3 sentences]
40
[+] score: 22
Downregulation of mir-22 expression with simultaneous overexpression of miR-886.3p suggests the effectiveness of the treatment, while a reverse profile of these two miRNAs may be a negative prognostic marker in a pharmacotherapy [63]. [score:8]
The incubation of NHDF cell cultures for 2 hours with a biological drug leads to changes in the expression of 12 miRNAs (hsa-miR-1231, hsa-miR-1275, hsa-miR-143, hsa-miR-16, hsa-miR-1909, hsa-miR-196a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-3162, hsa-miR-34a, hsa-miR-382, and hsa-miR-939), regulating the expression of the analysed transcripts. [score:6]
In our studies, we have observed that after 2-hour incubation of the cells with adalimumab, hsa-miR-22 is involved in the regulation of EDNRA expression. [score:4]
The data from the experiment show the overexpression of both hsa-miR-22 and EDNRA mRNA. [score:3]
Krintel et al. have demonstrated that miR-22 may be a useful diagnostic marker used to monitor the results of adalimumab therapy. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 21
Comparison of the expression of regulated miRNAs and their cognate-predicted targets in our arrays revealed significant anti-correlation only for specific regulated miRNAs, which we grouped into two: miRNAs that are enriched in the embryonic liver, including miR-106a, miR-18a and miR-574-3p, and miRNAs that are enriched in the adult liver, including let-7a and c, miR-23b and miR-22. [score:7]
Among adult liver-enriched miRNAs, we confirmed a statistically-significant downregulation of transcripts that have predicted binding sites for the let-7/98, miR-22 and miR-23 seeds, which correspond to the miRNAs identified previously as expressed higher in the adult liver than in the embryo: let-7a, let-7b, let-7c, miR-22, and miR-23b. [score:6]
We observe that this score increases when targets of let-7/98 and miR-23 and miR-22 are considered together, suggesting that many genes are downregulated in the adult by the combined repression of several miRNA species. [score:5]
In summary, the miRNA seeds that achieved the best scores in terms of anti-correlation with their predicted target genes are presented, and correspond to miRNAs let-7a, let-7b, let-7c, miR-22, and miR-23b, for adult liver-enriched miRNAs (Table 2), and miR-106a, miR-18a and miR-574-3p, for embryonic liver-enriched miRNAs (Table 3). [score:3]
[1 to 20 of 4 sentences]
42
[+] score: 21
Thermo-sensitive miRNAs Fold change in miRNA Fold change in target mRNA Predicted gene targets Cell Type rno-miR-22-3P + 3.4 −13.5 Acly Spermatid rno-miR-22-5P + 1.8 −13.5 Acly Spermatid rno-miR-129-5P −1.9 + 8.5 selV Spermatocyte rno-miR-3560 + 2.1 −1.6 MCT2 Spermatocyte rno-miR-3560 + 2.1 −12.3 Txnrd1 Spermatocyte rno-miR-466c-5P + 1.5 −1.8 Prkar2B Spermatid The H & E stained testes sections of control and cryptorchid rat suggest that at 24 h there was negligible visible change in any stage of spermatogenesis and most of the stages were present (Fig.   1b), as in control (Fig. 1a). [score:5]
Thermo-sensitive miRNAs Fold change in miRNA Fold change in target mRNA Predicted gene targets Cell Type rno-miR-22-3P + 3.4 −13.5 Acly Spermatid rno-miR-22-5P + 1.8 −13.5 Acly Spermatid rno-miR-129-5P −1.9 + 8.5 selV Spermatocyte rno-miR-3560 + 2.1 −1.6 MCT2 Spermatocyte rno-miR-3560 + 2.1 −12.3 Txnrd1 Spermatocyte rno-miR-466c-5P + 1.5 −1.8 Prkar2B Spermatid Crytorchidism is a state wherein the loss of germ cells takes place by apoptosis leading to infertility, and transient testicular heating has been shown to provide reversible contraception in men [25] and temporary sterility in rats [26]. [score:5]
The study has identified Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as potential heat sensitive targets in germ cells, which may be tightly regulated by heat sensitive miRNAs rno-miR-22-3P, rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno-miR-3560 and rno-miR-466c-5P. [score:4]
Among various pathways affected significantly by heat stress, the study has identified Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as potential heat sensitive targets in germ cells, which may be under tight regulation of heat sensitive miRNAs, rno-miR-22-3P, rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno-miR-3560 and rno-miR-466c-5P, as predicted by miRDB tool. [score:4]
Acly is target of the miRNAs rno-miR-22-3p and rno-miR-22-5p. [score:3]
[1 to 20 of 5 sentences]
43
[+] score: 21
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
Of the seven tumor-tissue miRNAs downregulated, four (hsa-miR-370; hsa-miR-139-5p; hsa-miR-let-7e; hsa-miR30c) were expressed in both tumor and plasma (both free and within exosomes); hsa-miR-516-3p was present in tumor only, and hsa-miR-22 and hsa-miR-145-3p were present in tumor and exosome only. [score:6]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
[1 to 20 of 3 sentences]
44
[+] score: 21
Suppressor of cytokine signaling (SOCS) protein family is also responsible for termination of GH-activated STAT signaling [68], where the expression of SOCS1-7 proteins is regulated by HM cell miR-182-5p, let-7f-5p, miR-148a-3p, miR-22-3p, miR-16-5p, miR-181a-5p, miR-141-3p (Figure S6). [score:6]
Specifically, AGPAT6 (1-acylglycerol-3-phosphate O-acyltransferase 6) is known to be regulated by the some of the top most highly expressed HM cell miRNAs (let-7f-5p, miR-182-5p, miR-148a-3p, and miR-22-3p), and has a direct effect on the synthesis of triacylglycerol and long chain acyl-CoA (fatty acids) [61]. [score:5]
The top 10 most highly expressed miRNAs were clustered together, with a strong correlation in expression in pre- and post-feed milk seen between hsa-miR-30d-5p and hsa-miR-22-3p, and between hsa-let-7f-5p and hsa-let-7a-5p (Figure 4C). [score:5]
Further, the abundant in HM cells miR-181A-5P, miR-22-3p and miR-21-5p repress ERα (ESR1), whilst the milk most highly expressed miRNA, let-7f-5p, negatively regulates ERβ (ESR2) (Figure S8). [score:4]
The known miRNAs examined were: hsa-let-7f-5p, hsa-miR-181a-5p, hsa-miR-148a-3p, hsa-miR-22-3p, and hsa-miR-182-5p. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 20
Irrespective of wild type or mutated or null p53, after radiation treatment, miR-302a and miR-302c up-regulated, and miR-518f down-regulated in colon cancer cells, whereas after SN38 treatment up-regulated miRNAs were miR-133a, miR-155, miR-204, miR-22, miR-512-3p, miR-517a, miR-517c and miR-708 in the all colon cancer cell lines. [score:10]
Irrespective of p53 status, after radiation miR-302a and miR-302c up-regulated, and miR-518f down-regulated in the all cell lines, whereas after SN38 treatment up-regulated miRNAs were miR-133a, miR-155-3p, miR-204, miR-22, miR-512-3p, miR-517a, miR-517c and miR-708 in the all cell lines (Figure 3, Table 1a). [score:10]
[1 to 20 of 2 sentences]
46
[+] score: 20
Another study also showed that SIRT1 expression levels were significantly upregulated in breast cancer tissues, and SIRT1 overexpression eliminated the suppressive effects of the miR-22 overexpression on the malignant phenotype of MCF7 cells [50]. [score:12]
Zhou X lncRNA MIAT functions as a competing endogenous RNA to upregulate DAPK2 by sponging miR-22-3p in diabetic cardiomyopathyCell Death Dis. [score:4]
Zou Q MicroRNA-22 inhibits cell growth and metastasis in breast cancer via targeting of SIRT1Exp. [score:4]
[1 to 20 of 3 sentences]
47
[+] score: 19
Among the 87 most-variable expressed miRNAs across the entire panel, a group of 15 miRNAs (hsa-miR-130a, hsa-miR-886-5p, hsa-miR-886-3p, hsa-miR-222, hsa-miR-21*, hsa-miR-29a, hsa-miR-23a, hsa-miR-24, hsa-miR-30a, hsa-miR-27a, hsa-miR-22, hsa-miR-532-3p, hsa-miR-100, hsa-miR-125b, hsa-miR-221) was significantly higher expressed in the minor cluster as opposed to other miRNAs (Figure 2, top red box). [score:5]
Similarly, the most highly expressed miRNAs in normal-like/claudin-low cell lines were hsa-miR-22, hsa-miR-532-3p, hsa-miR-125b, hsa-miR-501-5p, and hsa-miR-155*, whereas in basal-like cell lines miRNAs of the miR-200 family (hsa-miR-492, hsa-miR-26b, hsa-miR-617, hsa-miR-155) were highly expressed (fold change ≥ 2) (see Table S9 in Additional file 1). [score:5]
The top four most significantly associated miRNAs - hsa-miR-130a (11q12.1), hsa-miR-22 (17p13.1), hsa-miR-93 (7q22.1) and hsa-miR-383 (8p22) - with DNA CNVs in breast cancer cell lines are shown in Figure 6. Figure 6 Association of miRNA expression with genomic copy number variation in breast cancer cell lines. [score:3]
Importantly, this repertoire of miRNAs includes hsa-miR-22 previously shown to be regulated by ER [66] and we provide evidence that it can also be regulated by the loss of the locus containing this miRNA. [score:3]
The top four most significantly associated miRNAs - hsa-miR-130a (11q12.1), hsa-miR-22 (17p13.1), hsa-miR-93 (7q22.1) and hsa-miR-383 (8p22) - with DNA CNVs in breast cancer cell lines are shown in Figure 6. Figure 6 Association of miRNA expression with genomic copy number variation in breast cancer cell lines. [score:3]
[1 to 20 of 5 sentences]
48
[+] score: 18
The target genes are labeled in red Click here for file The enriched pathway of the target gene union of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a (normal-preferring). [score:5]
The target genes are labeled in red The enriched pathway of the target gene union of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a (normal-preferring). [score:5]
So, we selected the union of the target genes of hsa-miR-141 and hsa-miR-200b for tumor-preferring miRNAs, and the union of the target genes of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a for normal-preferring miRNAs. [score:5]
The target genes of hsa-miR-22, hsa-miR-125b, and hsa-miR-99a were significantly enriched in the MAPK pathway (p = 2.4E-6). [score:3]
[1 to 20 of 4 sentences]
49
[+] score: 18
Of the miRNAs that were significantly up- or down-regulated, five were shared between acutely and persistently infected cattle (bta-miR-17-5p, bta-miR-144, bta-miR-497, bta-miR-22-5p, and bta-miR-1281). [score:4]
The up-regulated miRNA species included bta-miR-17-5p, bta-miR-146a, bta-miR-144, bta-miR-34a, bta-miR-369-3p, bta-miR-497, and bta-miR-22-5p (Table  2 and Fig.   2a). [score:4]
Despite that, the miRNA profiles generated from human serum collected from individuals infected with related + ssRNA viruses (Dengue virus and HCV) showed some dysregulated miRNAs shared with the ones reported for FMDV here, which included: let-7 g, miR-22-5p, miR-23b-5p, miR-146a, and miR-497 [51, 52]. [score:2]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
The remaining 8 miRNAs are encoded within intronic regions: bta-miR-26b, bta-miR-455-3p, bta-miR-23b-5p, bta-let-7 g, bta-miR-22-5p, bta-miR-147, bta-miR-369-3p, and bta-miR-1224. [score:1]
The remaining 8 miRNAs (bta-miR-497, bta-miR-144, bta-miR-181b, bta-miR-22-5p, bta-miR-23b-5p, bta-miR-17-5p, bta-miR-154a, and bta-miR-369-3p) detected in this study were found to be clustered. [score:1]
Four of the miRNAs detected were shared between the two profiling studies: miR-22-5p, miR-146b, miR-23b-5p, and miR-369-3p. [score:1]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
The only chromosomes in the Bos taurus genome that were associated with more than one of the identified miRNAs were: chromosome #8 with bta-miR-23b-5p, bta-miR-31, and bta-miR-455-3p; chromosome #16 with bta-miR-34a, bta-miR-181b, and bta-miR-205; chromosome #19 with bta-miR-22-5p, bta-miR-144, and bta-miR-497; and finally chromosome #21 with bta-miR-154a and bta-miR-369-3p. [score:1]
It is interesting to note that six of the 19 miRNAs described in this study are considerably abundant in cattle liver: bta-miR-22-5p, bta-miR-150, bta-miR-17-5p, bta-miR-455-3p, bta-miR-146, and let 7-g [64]; an organ in which FMDV does not establish infection. [score:1]
[1 to 20 of 10 sentences]
50
[+] score: 17
Recently, miR-22 was reported to regulate the PTEN/AKT/FOXO1 pathway and together generate a feed-forward regulatory loop: miR-22 suppresses PTEN expression, leading to the activation of AKT activity, which in turn upregulates miR-22 transcription [103]. [score:10]
Moreover, many conserved miRNA target sites are found within the PTEN 3’-UTR, such as miR-21, miR-22, miR-214 and miR-126 [99– 102]. [score:3]
Yuan et al demonstrated that ectopic activation of miR-22 results in hair loss due to the repression of the hair keratinocyte differentiation program and pointed out that miR-22 directly represses myriad transcription factors upstream of phenotypic keratin genes, including FOXN1 [165]. [score:2]
Figure 2 A. TXNIP/miR-124a/FoxA2/IAPP; B. miR-204/MEIS2-FOXC1/PAX6/ITGβ1; C. resveratrol/miRNA-520h/PP2A/C/Akt/NF-κB/FOXC2; D. Gα12/AP-1/miR-135b/FOXO1-Gα12/miR-194/MDM2/FOXO1; E. miR-22-miR-486/PTEN/PI3K/AKT/FOXO1; F. TGF-β/FOXO1/miR-21/AKT/NF-KB/Snail; G. AR/PI3K/AKT/FOXO3/AP-1/miR-21/PTEN; H. miR-34a-146b-132-21-217/Sirt/FOXO1. [score:1]
A. TXNIP/miR-124a/FoxA2/IAPP; B. miR-204/MEIS2-FOXC1/PAX6/ITGβ1; C. resveratrol/miRNA-520h/PP2A/C/Akt/NF-κB/FOXC2; D. Gα12/AP-1/miR-135b/FOXO1-Gα12/miR-194/MDM2/FOXO1; E. miR-22-miR-486/PTEN/PI3K/AKT/FOXO1; F. TGF-β/FOXO1/miR-21/AKT/NF-KB/Snail; G. AR/PI3K/AKT/FOXO3/AP-1/miR-21/PTEN; H. miR-34a-146b-132-21-217/Sirt/FOXO1. [score:1]
[1 to 20 of 5 sentences]
51
[+] score: 15
miR-22 is a tumor suppressor that induces cellular senescence (by targeting CDK6, SIRT1 and Sp1) [42] and is frequently downregulated in ER [+] breast cancer [43]. [score:8]
Several microRNAs were strongly down- (miR-22-3p, miR-29c-3p) or upregulated (miR-328, miR-98-5p) by progesterone and might contribute to the observed hormonal effects. [score:4]
Compared to control cells, both miR-22 and miR-29c were downregulated not only after progesterone treatment, but also after irradiation in ADLH [−] and ALDH [+] cells. [score:3]
[1 to 20 of 3 sentences]
52
[+] score: 15
miR-22 inhibits estrogen signaling by directly targeting the ERα mRNA (12). [score:6]
Furthermore, other studies demonstrated that miR-22 (12, 13) and miR-221/222 (14, 15) also directly interacted with the 3’UTR region of ERα and regulated ERα expression. [score:5]
It has been reported that miR-22 is downregulated in ERα -positive human breast cancer cell lines and clinical samples (13). [score:4]
[1 to 20 of 3 sentences]
53
[+] score: 15
In their study, miR-22 overexpression can also increase the expression of the anti-apoptosis gene Bcl-2 and decrease the pro-apoptosis gene Bax, which attributed to a reduction in apoptosis. [score:5]
In addition, they also found that miR-22 overexpression resulted in a reduction in inflammatory cytokines, such as TNF-α, IL-6, COX-2, and iNOS [22]. [score:3]
Yu H. Wu M. Zhao P. Huang Y. Wang W. Yin W. Neuroprotective effects of viral overexpression of microRNA-22 in rat and cell mo dels of cerebral ischemia-reperfusion injury J. Cell. [score:3]
Researchers also found that caspase-3 activity was inhibited by miR-22 in cerebral ischemic/reperfusion injury [22]. [score:3]
As the inflammatory cascade reaction is the main cause of aggravation of cerebral injury, the anti-inflammatory effect might also be one of the mechanisms underlying miR-22 mediated neuroprotection. [score:1]
[1 to 20 of 5 sentences]
54
[+] score: 15
Consistent with those data, in our study, curcumin upregulated miR-103, miR-22, and miR-23b and downregulated miR-195, miR-15b, miR-196, and miR-92. [score:7]
In our investigation, curcumin significantly induced the expression of five miRNAs (miR-146a, miR-150, miR-155, miR-20a, miR-22, and miR-126) that target downstream molecules such as VEGF, NF-κB, PDGFβ, and endothelin 1. The mechanism of action of curcumin on the modulation of miRNA expression is not well understood. [score:5]
Based on statistical significance (p<0.05) and 2 -FC, curcumin alone significantly increased the expression of nine miRNAs (miR-18a, miR-22, miR-20a, miR-29b, miR-126, miR-142–3p, miR-146a, miR-150, and miR-155). [score:3]
[1 to 20 of 3 sentences]
55
[+] score: 15
On one hand, when the original miRNA expression dataset was combined with other mRNA expression datasets miR-22 was radically repositioned relative to its targets and their expression profiles. [score:9]
Moving forward, miR-22 was shown to be involved in age-related cardiac fibrosis, whose overexpression contributed to cellular senescence and migration of cardiac fibroblasts [26]. [score:3]
On the contrary, we suggest that miR-22 has not substantial impact on heart longevity as proposed recently. [score:1]
Huang ZP Chen J Seok HY Zhang Z Kataoka M Hu X MicroRNA-22 regulates cardiac hypertrophy and remo deling in response to stressCirc Res. [score:1]
Further, miR-22 was suggested as cardiac aging biomarker by the work of Jazbutyte et al. [26]. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 15
Additional studies showed that miR-22 represses a broad spectrum of target genes, including Sirt1, HDAC4, PPARα, and Purb, a negative regulator of Serum Response Factor (SRF) during the regulation of cardiac hypertrophy [28, 29]. [score:5]
Recently, we and others demonstrated that miR-22, a miRNA enriched in cardiomyocytes but only mildly up-regulated during cardiac hypertrophy, significantly promotes cardiac hypertrophy in vitro and in vivo [28, 29]. [score:4]
Conversely, cardiac-specific overexpression of miR-22 induced spontaneous hypertrophic growth in the heart. [score:3]
Cardiac-specific knockout of miR-22 in mice repressed stress -induced cardiac hypertrophy, accompanied by accelerated dilation. [score:2]
Huang Z. P. Chen J. Seok H. Y. Zhang Z. Kataoka M. Hu X. Wang D. Z. MicroRNA-22 regulates cardiac hypertrophy and remo deling in response to stress Circ. [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 15
miR-22 targets the methylcytosine dioxygenase TET (ten-eleven translocation) family members, inhibits the demethylation of the miR-200 promoter, and suppresses the expression of miR-200 [65]. [score:9]
miR-22 targets the ten-eleven-translocation (TET) family of methylcytosine dioxygenases and demethylates the promoter region of the miR-200 precursor [161]. [score:3]
Therefore, the interplay between the miR-200 family, miR-22, and ZEB1/ZEB2 plays an important role in the stemness regulation and EMT. [score:2]
Interestingly, the cooperation between miR-22 and the miR-200 family results in EMT, an elevated pool of stem cells and increased tumorigenesis. [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 14
Other predictions, based on our dataset are: hsa-mir-488 – very probably involved in apoptosis (2 of 3 occurrences, 1 of them in Alu insertion) hsa-mir-526b* - very probably involved in cell adhesion (2 of 3 occurrences) hsa-mir-453 and hsa-mir-17-3p (Alu-related) and hsa-mir-22 and -302b (not related to Alus) – are probably involved in transport hsa-mir-17-3p, -412 and -453 – very probably targeting receptors (additional support: MiRanda-predicted target for hsa-mir-453 – neuron derived orphan receptor 1) hsa-mir-422a – probably targeting structural proteins. [score:7]
Other predictions, based on our dataset are: hsa-mir-488 – very probably involved in apoptosis (2 of 3 occurrences, 1 of them in Alu insertion) hsa-mir-526b* - very probably involved in cell adhesion (2 of 3 occurrences) hsa-mir-453 and hsa-mir-17-3p (Alu-related) and hsa-mir-22 and -302b (not related to Alus) – are probably involved in transport hsa-mir-17-3p, -412 and -453 – very probably targeting receptors (additional support: MiRanda-predicted target for hsa-mir-453 – neuron derived orphan receptor 1) hsa-mir-422a – probably targeting structural proteins. [score:7]
[1 to 20 of 2 sentences]
59
[+] score: 14
Hence, miR-210 when inhibited increases the level of apoptosis in HeLa cells [46]; miR-22 promotes cell survival in UV irradiated cells through a tumor suppressor gene down-regulation [74]; down-regulation of miR-25 in ovarian cancer cells induces apoptosis [75]; miR-155 was described as having anti-apoptotic effects in murine macrophages during Helicobacter pylori infection [76]; and miR-133b is known to inhibit pro-survival molecules MCL-1 and Bcl-w proteins, two members of the BCL-2 family [47]. [score:13]
Among the miRNAs for which levels were modulated during L. major infection, several were described as playing a possible role in apoptosis e. g., miR-210, [46] miR-22, miR-155 and miR-133b [47]. [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 14
On the other hand, a number of breast milk miRNAs found to be associated with the development of atopic dermatitis were the relatively highly expressed miRNAs: miR-22-3p, miR-146b-5p, miR-21-5p, miR-375 and let-7f-5p. [score:4]
However, a number of them are relatively highly expressed including miR-146b-5p, miR-21-5p, miR-22-3p, miR-375 and let-7f-5p. [score:3]
Human breast milk samples contain a relatively stable core group of highly expressed miRNAs, including miR-148a-3p, miR-22-3p, miR-30d-5p, let-7b-5p and miR-200a-3p. [score:3]
The top 5 miRNAs were consistently highly expressed and included miR-148a-3p, miR-22-3p, miR-30d-5p, let-7b-5p and miR-200a-3p. [score:3]
The five most abundant miRNAs identified in the breast milk samples were miR-148a-3p, miR-22-3p, miR-30d-5p, let-7b-5p and miR-200a-3p. [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 13
Another study found that miR-22 correlated with inhibition of cancer cell migration and invasion [43], so the down-regulated expression reflects the consistency with our observations that the addition of LH to LHR+ S KOV3 cells inhibited cell proliferation, migration, and invasion [14]. [score:10]
Among the 65 differentially expressed microRNAs, 13 intronic ones were observed that are highly or moderately correlated with their host genes, such as mir-555/ASH1L, mir-22/C17orf93, mir-198/FSTL1, mir-561/GULP1 and mir-564/KIF15, 18 poorly correlated and four negatively correlated with their host genes (Table S3). [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 13
Experimental title/design GEO series accession number Publication PROTEIN CODING MRNA Vitamin D effect on bronchial smooth muscle cells GSE5145Bosse et al., 2007 Genome-wide analysis of vitamin D receptor (VDR) target genes in THP-1 monocytic leucemia cells GSE27270Heikkinen et al., 2011 Transcriptional effects of 1,25 dihydroxi-vitamin D3 physiological and supra-physiological concentrations in breast cancer organotypic culture GSE27220 Analysis of vitamin D response element binding protein target genes reveals a role for vitamin D in osteoblast mTOR signaling GSE22523Lisse et al., 2011 Expression profiling of androgen receptor and vitamin D receptor mediated signaling in prostate cancer cells GSE17461Wang et al., 2011b Understanding vitamin D resistance using expression microarrays GSE9867Costa et al., 2009 Effects of TX527, a hypocalcemic vitamin D analog on human activated T lymphocytes GSE23984Baeke et al., 2011 Transcriptome profiling of genes regulated by RXR and its partners in monocyte-derived dendritic cells GSE23073Szeles et al., 2010 NON-PROTEIN CODING RNA MicroRNA-22 upregulation by vitamin D mediates its protective action against colon cancer. [score:12]
MicroRNA-22 is induced by vitamin D and contributes to its antiproliferative, antimigratory and gene regulatory effects in colon cancer cells. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 13
Studies have shown that miR-22 over -expression down-regulates CDK6 in human fibroblasts [37] and miR-26a/b over -expression down-regulates CDK6 in human liver and lung cells [38], which in both cases causes cell cycle arrest in the G1 phase. [score:11]
miR-26a and miR-22 have a cluster 5 profile and miR-26b has a cluster 6 profile and thus could be implicated in miRNA mediated cell cycle regulation in human granulopoiesis. [score:2]
[1 to 20 of 2 sentences]
64
[+] score: 13
Their finding suggests that MIAT functions as a competing endogenous RNA to upregulate DAPK2 expression by sponging miR-22-3p in DbCM (60). [score:6]
Overexpression of MIAT antagonized the inhibitory effect of miR-22-3p on DAPK2. [score:5]
Furthermore, MIAT and DAPK2 were shown to be a target of miR-22-3p by luciferase assay. [score:2]
[1 to 20 of 3 sentences]
65
[+] score: 12
0 hsa-mir-98 dbDEMC;miR2Disease hsa-mir-411 dbDEMC;HMDD v2.0 hsa-mir-28 dbDEMC hsa-mir-22 dbDEMC;miR2Disease;HMDD v2.0 In this study, we implemented both global and local LOOCV validation methods based on 5430 known miRNA-disease associations between 383 diseases and 495 miRNAs from HMDD v2.0 to evaluate the prediction accuracy of. [score:7]
0 hsa-mir-98 dbDEMC;miR2Disease hsa-mir-411 dbDEMC;HMDD v2.0 hsa-mir-28 dbDEMC hsa-mir-22 dbDEMC;miR2Disease;HMDD v2.0 The first column records top 1–25 related miRNAs. [score:5]
[1 to 20 of 2 sentences]
66
[+] score: 12
Huang S Wang S Bian C Yang Z Zhou H Zeng Y Upregulation of miR-22 promotes osteogenic differentiation and inhibits adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells by repressing HDAC6 protein expressionStem Cells Dev. [score:8]
miR-486 is involved in ASC replicative senescence [67], miR-143 has been related to the immune modulatory function of MSCs [68], miR-10a and miR-22 are important regulators of MSC differentiation [69, 70], and miR-10b promotes the migration of mouse BMSCs [71]. [score:2]
miR-21-5p, miR-22-3p, miR-10b-5p, and miR-222-3p were among the most represented in both cells and exosomes; however, various miRNAs (shown in bold in Table  1) were only present either in the list of cellular or in the list of exosomal highly represented miRNAs. [score:1]
Surprisingly, the five most abundant miRNAs (miR-486-5p, miR-10a-5p, miR-10b-5p, miR-191-5p, and miR-222-3p in ASC exosomes; and miR-143-3p, miR-10b-5p, miR-486-5p, miR-22-3p, and miR-21-5p in BMSC exosomes) accounted for 43–59 % of the total miRNA reads. [score:1]
[1 to 20 of 4 sentences]
67
[+] score: 12
Other miRNAs from this paper: hsa-mir-21
ERα also inhibits miR-22 which may also inhibit ERα, providing a secondary pathway for reducing CSE expression [35]. [score:7]
miR-21 and miR-22 are reported to suppress but PI3K and TNF-α stimulate CSE transcription by targeting Sp1 gene [35– 37]. [score:5]
[1 to 20 of 2 sentences]
68
[+] score: 12
Among these, 10 pairwise miRNAs (mfi-miR-142, mfi-miR-17, mfi-miR-18a, mfi-miR-20a, mfi-miR-181a, mfi-miR-182, mfi-miR-199a, mfi-miR-30a, mfi-miR-9a, and mfi-miR-9b) were found to have relatively lower expression levels of miR-#-3p than their miR-#-5p counterparts, while the other 5 pairwise miRNAs (miR-29c, miR-22, miR-363, miR-24a, and miR-126) showed relatively higher expression levels of miR-#-3p. [score:5]
Among the miRNAs with high abundance (more than 100,000 counts), 12 miRNAs (mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f) were most highly expressed in M. fissipes metamorphosis. [score:3]
The expression levels of mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f were highest in this study, implying their potential significant functions in M. fissipes metamorphosis. [score:3]
MiR-143, miR-181a-5p and miR-22-3p were highly enriched in skeletal muscle tissue [40, 41], which was the major tissue of M. fissipes tadpoles for small RNA-seq. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-22, miR-26b, miR-29c, miR-30c and miR-126 exhibited almost similar expression patterns in all tissues examined (Figure 3B). [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
miR-22, miR-26b, miR-29c and miR-30c showed ubiquitous expression in diverse tissues. [score:3]
The observation that miR-22, miR-26b, miR-126, miR-29c and miR-30c are ubiquitously expressed in 14 different tissues of pig is interesting. [score:3]
[1 to 20 of 4 sentences]
70
[+] score: 12
With the exception of miR-22 and miR-181a in NTera-2 cells, the differential expression of all miRNAs listed in Table  3 correspond with their reported expression during EMT or MET. [score:5]
In NTera-2 cells, miR-124-3p, miR-7, miR-22 and miR-181a are downregulated. [score:4]
However, only miR-124-3p and miR-7 are inhibitors of EMT, while miR-22 and miR-181a are activators. [score:3]
[1 to 20 of 3 sentences]
71
[+] score: 12
In our mo del, we observed in preliminary experiments that exposure to CSE inhibits the expression of miR22, a miRNA involved in the development of COPD through its effect on DC and the synthesis of IL-17 [30]. [score:6]
However, in our hands, the inhibition of miR22 as well as its upregulation with a mimicker did not allow to reproduce the phenotype of CSE-exposed MDDC. [score:6]
[1 to 20 of 2 sentences]
72
[+] score: 12
PARP activity increases TET1 expression levels through maintaining a permissive chromatin state 34. miR-22 suppresses TET expression levels in breast cancer cells through directly targeting the 3′-untranslated regions (UTRs) of TET mRNAs 27. [score:12]
[1 to 20 of 1 sentences]
73
[+] score: 12
According to Polioudakis et al. (34), overexpression of miR-22 helps to terminate hematopoietic differentiation through targeting the Max protein to inhibit the Myc-Max transcriptional complex. [score:7]
Consistently, miR-22 showed increase in expression during Mk differentiation. [score:3]
Among these, ten were significantly up- regulated in megakaryocytes with the top four being miR1246, miR-148a, miR-22 and miR-188 from 18 to 5 fold increase. [score:2]
[1 to 20 of 3 sentences]
74
[+] score: 11
Following the identification of the M-CSF receptor as a direct target of miR-22, miR-34a, and miR-155, Riepsaame et al. further demonstrated that miRNA upregulation viz. [score:7]
miR-22, miR-34a, and miR-155 have recently been reported to directly target the M-CSF receptor in mice (16). [score:4]
[1 to 20 of 2 sentences]
75
[+] score: 11
This same study also described a reciprocal feedback loop between ERα and miR-22, suggesting that estrogen action is closely regulated via post-transcriptional control of ERα expression. [score:4]
Other miRNAs, including miR-18a, miR-22, miR-206, and miR-221/222 have also been implicated in ERα targeting [84]. [score:3]
Similarly, the sex-specific regulation of miR-22 processing in muscle lipid metabolism has also recently been described and may contribute to understanding the well-described differences in muscle metabolism and body weight between males and females [103]. [score:2]
Important roles for miR-23a and miR-22 have also been described in cardiac function involving the action of estrogen. [score:1]
Moreover, miR-22 provides estrogenic cardioprotection in female rats by controlling myocardial oxidative stress [102]. [score:1]
[1 to 20 of 5 sentences]
76
[+] score: 11
Interestingly, miR-22 was significantly upregulated when comparing APAP-overdosed patients with HC. [score:4]
The presence of these miRNAs in the peripheral circulation has not yet been reported, however, miR-22-3p is also abundantly expressed in the liver [25]. [score:3]
By contrast, miR-22-3p, miR-423-5p and miR-10b-5p have not been found in red blood cells. [score:1]
In all five groups, we observed miR-486-5p to be the most abundant miRNA, followed by miR-92a-3p in HBV, LC and HC, and miR-22-3p in T2DM and upon APAP-overdosing. [score:1]
Apart from miR-22-3p which increased from 7% in the HC to 21% in the APAP samples, the composition of the most abundant miRNAs in APAP, HBV, LC and T2DM was comparable to HC (S3 Table). [score:1]
Based on the total number of sequencing reads the miRNAs miR-486-5p, miR-92a-3p, miR-22-3p, miR-451a, miR-423-5p, miR-16-5p, miR-142-5p, miR-191-5p, miR-10b-5p and miR-25-3p were the most abundant miRNAs in the serum of HC subjects. [score:1]
[1 to 20 of 6 sentences]
77
[+] score: 11
Further support for TET proteins as regulators of oncogenic behavior was provided by engineered expression of microRNA (miR-22) which down-regulated expression of TET1,2,3, triggered epithelial-mesenchymal transition in the human MCF10 breast epithelial cell line and caused non-metastatic human MCF-7 breast cancer cell line to express metastatic properties: cell proliferation, invasion, and angiogenesis [158]. [score:11]
[1 to 20 of 1 sentences]
78
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
MicroRNA-22 and microRNA-140 suppress NF-κB activity by regulating the expression of NF-κB coactivators. [score:6]
In HCC has been reported up -expression of miR-21, miR-221, miR-22, miR-15, miR-517a, and down -expression of miR-122, miR-29 family, miR-26a, miR-124, let-7 family members, and miR-199a/b-3p (Szabo et al., 2012). [score:5]
[1 to 20 of 2 sentences]
79
[+] score: 11
Namely, hsa-miR-22, a cell growth inhibitor, hsa-miR-181b, hsa-miR-320 and hsa-let-7e, all tumor suppressor miRNAs, were all upregulated in the first 6 h post-infection as part of the host-cell immune response to the virus. [score:8]
Among them are hsa-miR-22, hsa-miR-181b and hsa-miR-320 that were overexpressed at 6 and 12 h post-infection as part of the host immune response to the virus. [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 11
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
[1 to 20 of 1 sentences]
81
[+] score: 10
MiRNA prediction tools included: miRanda [34], RNA22 [35], TargetScan [36], and MiRWalk [37] Combined with CD133 molecular regulation and human umbilical cord blood mononuclear cell s expressed miRNA two aspects of information, the final confirmation of the following 12 miRNA [19]: hsa-miR-29a-3p, hsa-miR-29b-3p, hsa-miR-200c-3p, hsa-miR-4423-5p, hsa-miR-335-3p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-22-3p, hsa-miR-30a-5p, hsa-miR-30e-5p, hsa-miR-377-3p and hsa-miR-4739 (Supplementary Table  2). [score:6]
Combined with CD133 molecular regulation and human umbilical cord blood mononuclear cells expressed miRNA two aspects of information, the final confirmation of the following 12 miRNA [19]: hsa-miR-29a-3p (Fig.   4A), hsa-miR-29b-3p (Fig.   4B), hsa-miR-200c-3p (Fig.   4C), hsa-miR-4423-5p (Fig.   4D), hsa-miR-335-3p (Fig.   4E), hsa-miR-142-5p (Fig.   4G), hsa-miR-22-3p (Fig.   4H), hsa-miR-30a-5p (Fig.   4I), hsa-miR-30e-5p (Fig.   4J), hsa-miR-377-3p (Fig.   4K) and hsa-miR-4739 (Fig.   4L) showed no difference between CD133+HUCB-MNC cells and CD133−HUCB-MNC cells. [score:4]
[1 to 20 of 2 sentences]
82
[+] score: 10
Third, proteomic profiling, conducted by Iliopoulos and colleagues [70], identified peroxisome proliferator-activated receptor alpha (PPAR-alpha), a miRNA-22 target, as a protein that is negatively regulated in OA. [score:4]
High throughput analysis of OA cartilage samples, employing miRNA array analysis, revealed that the expression of distinct miRNAs, exemplified by miRNA-22 and miRNA-103, is deregulated in OA. [score:4]
Specifically, a positive correlation among the body mass index (BMI, a measure of obesity) and the up-regulated miRNAs, miRNA-22 and miRNA-103, was reported. [score:2]
[1 to 20 of 3 sentences]
83
[+] score: 10
In contrast, miR-22, a miRNA upregulated in human senescent fibroblasts targeting SIRT1 expression [54], was not identified as differentially expressed upon TACC3 depletion (suppl. [score:10]
[1 to 20 of 1 sentences]
84
[+] score: 10
Hepatic expression of tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22 and miR-125b, and tumor promoting miRNAs, miR-10b and miR-99b in NASH-HCC mo del male and female mice. [score:5]
As shown in Fig. 4, the tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were lower, whereas the tumor-promoting miRNAs, miR-10b and miR-99b were higher in males than in females in both the STZ-HFD group and the control group. [score:3]
We also observed that tumor-suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were significantly decreased in STZ-HFD mice compared to controls with significantly lower levels in males than in females. [score:2]
[1 to 20 of 3 sentences]
85
[+] score: 10
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
[1 to 20 of 2 sentences]
86
[+] score: 10
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-29c
Soluble ST2 is a direct target of miR-29aComputational analysis revealed that miR-22, 183, 25 and 29a were predicted to regulate sST2. [score:5]
However, miR-22, 183 and 25 showed much less favourable probability in targeting sST2 (total context score value 27) than miR-29 family. [score:3]
Computational analysis revealed that miR-22, 183, 25 and 29a were predicted to regulate sST2. [score:2]
[1 to 20 of 3 sentences]
87
[+] score: 10
Interestingly, a group of miRNAs, including miR-221/222, miR-206, miR-18a, and miR-22, have been reported to be involved in the regulation of ERα at either the transcriptional or post-transcriptional level [10, 11], thereby presenting attractive targets for therapeutic intervention in ERα -negative breast cancer. [score:4]
miR-22 has previously been shown to be over-expressed in progenitor cells [45]. [score:3]
miR-22 was found to be primarily expressed in MMTV- Wnt1 tumors. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Guo M. M. Hu L. H. Wang Y. Q. Chen P. Huang J. G. Lu N. He J. H. Liao C. G. miR-22 is down-regulated in gastric cancer, and its overexpression inhibits cell migration and invasion via targeting transcription factor Sp1 Med. [score:10]
[1 to 20 of 1 sentences]
89
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Also androgens regulate the expression of some miRNAs, such as miR-22, miR-122, and mir-125b (Cochrane et al. 2011); however, direct posttranscriptional regulation of androgens by miRNAs is not elucidated yet. [score:6]
Estrogens regulate transcription of some miRNAs, such as miR-21 and miR-221; in contrast, other miRNAs such as let-7, miR-22, miR-196b, or miR-206 target estrogen receptor alpha transcript (Cochrane et al. 2011). [score:4]
[1 to 20 of 2 sentences]
90
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-25, hsa-mir-33a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-141, mmu-mir-155, mmu-mir-10b, mmu-mir-129-1, mmu-mir-181a-2, mmu-mir-183, mmu-mir-184, hsa-mir-192, mmu-mir-200b, hsa-mir-129-1, mmu-mir-122, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-129-2, hsa-mir-184, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-96, mmu-mir-34a, mmu-mir-129-2, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-25, mmu-mir-210, mmu-mir-181a-1, mmu-mir-216a, mmu-mir-223, mmu-mir-33, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-217, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-375, mmu-mir-375, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-33b, mmu-mir-216b, hsa-mir-216b, mmu-mir-1b, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-129b, mmu-mir-216c, bbe-let-7a-1, bbe-let-7a-2, bbe-mir-10a, bbe-mir-10b, bbe-mir-10c, bbe-mir-125a, bbe-mir-125b, bbe-mir-129a, bbe-mir-129b, bbe-mir-133, bbe-mir-1, bbe-mir-183, bbe-mir-184, bbe-mir-200a, bbe-mir-200b, bbe-mir-210, bbe-mir-216, bbe-mir-217, bbe-mir-22, bbe-mir-252a, bbe-mir-252b, bbe-mir-278, bbe-mir-281, bbe-mir-33-1, bbe-mir-33-2, bbe-mir-34a, bbe-mir-34b, bbe-mir-34c, bbe-mir-34d, bbe-mir-34f, bbe-mir-375, bbe-mir-7, bbe-mir-71, bbe-mir-9, bbe-mir-96, bbe-mir-34g, bbe-mir-34h, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The sequencing frequency of the four most abundantly expressed miRNAs (miR-22, miR-1, let-7a and miR-25) constituted 78.82% of the total miRNA sequencing reads, suggesting that they might be ubiquitously expressed in amphioxus. [score:5]
As shown in the figure, bbe-miR-1, bbe-let-7, bbe-miR-25, bbe-miR-22, and so on were clearly expressed in amphioxus. [score:3]
Based on the available nematode, fruitfly, zebrafish, frog, chicken, mouse, rat and human miRNA information [18], 45 conserved amphioxus miRNAs could be classified into three distinct groups: 23 miRNAs (let-7a, miR-1, miR-7, miR-9, and so on) were conserved throughout the Bilateria; 5 miRNAs (miR-252a, miR-252b, miR-278, miR-281 and miR-71) were homologous to invertebrate miRNAs; and 17 miRNAs (miR-141, miR-200a, miR-200b, miR-183, miR-216, miR-217, miR-25, miR-22, miR-96, and so on) were present both in chordates and vertebrates (Table S9 in). [score:1]
In contrast, many phylogenetically conserved miRNAs, as well as miRNAs present in both chordates and vertebrates (for example, miR-216, miR-217, miR-22, miR-25, and miR-96), could be reliably traced back to B. belcheri (Gray). [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 10
Other miRNAs from this paper: hsa-mir-18a
Overexpression of miR-22 in male tumor adjacent tissue was associated with downregulated ERα expression, potentially by attenuating the protective effect of estrogen and causing increased IL-1α expression [32] and STAT3 and IL-1α involved in inflammation and stemness inducible of HCC progression. [score:10]
[1 to 20 of 1 sentences]
92
[+] score: 9
Notably the RT-PCR results indicate that expression levels of miR-146a were 4x and 50 x higher overall than the expression levels of miR-24 and miR-22 respectively (data not shown). [score:5]
Up-regulation was confirmed by RT-PCR in four new donors for each of the miRNAs that we validated in this way (namely miR-22, −24 and -146a) (see Figure  4A - TemRA cells were also included in this analysis). [score:4]
[1 to 20 of 2 sentences]
93
[+] score: 9
Other miRNAs from this paper: hsa-mir-29c
In breast cancer, miR-22 could indirectly inhibit CD147 -associated tumor invasion and metastasis by repressing Sp1 expression, and form an auto-regulatory loop with Sp1 by binding to the miR-22 promoter to inhibit miR-22 transcription [19]. [score:9]
[1 to 20 of 1 sentences]
94
[+] score: 9
Tang Y. Jin X. Xiang Y. Chen Y. Shen C. X. Zhang Y. C. Li Y. G. The lncRNA MALAT1 protects the endothelium against ox-LDL -induced dysfunction via upregulating the expression of the miR-22-3p target genes CXCR2 and AKT FEBS Lett. [score:8]
It was also shown in a study by Tang et al. that the lncRNA MALAT1 can have a protective effect against endothelial dysfunction induced by ox-LDL in part by competing with miR-22-3p as an endogenous RNA [64]. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The target functions of miR-22-3p were apoptosis, endocytosis, and tumorigenesis. [score:3]
The authors suggested that decreased expression of miR-22-3p in plasma of POF patients reflects the diminished ovarian reserve as a consequence of the pathologic process of POF. [score:3]
Further, miR-22-3p has been found to show a lower expression level in the plasma of women with POF and distinguish them from control subjects. [score:3]
[1 to 20 of 3 sentences]
96
[+] score: 9
miR-22 [28], miR-101 [29], and miR-7 [30] have all been shown to be downregulated in tumor specimens and function as tumor suppressors; miR-17 [31] and miR-21 [32] have been shown to be upregulated in tumor specimens and function as oncogenes. [score:9]
[1 to 20 of 1 sentences]
97
[+] score: 9
Other miRNAs from this paper: hsa-mir-217, hsa-mir-125b-1, hsa-mir-125b-2
Additionally, lncRNA MIAT was demonstrated to function as a ceRNA to upregulate DAPK2 by regulating miR-22-3p in diabetic cardiomyopathy [25]. [score:5]
Zhou X lncRNA MIAT functions as a competing endogenous RNA to upregulate DAPK2 by sponging miR-22-3p in diabetic cardiomyopathyCell Death Dis. [score:4]
[1 to 20 of 2 sentences]
98
[+] score: 9
The column TBX20 target indicates whether the gene has a TBX20 binding site [31] transferred from mouse to human with coordinate liftover within 10 kb around the gene and miR-22 target indicates whether a gene is a predicted conserved target of miR-22 according to targetscan. [score:9]
[1 to 20 of 1 sentences]
99
[+] score: 9
Among all, miR-22 was the most significantly up-regulated and was associated with the suppression of Sp1 and estrogen receptor 1, while miR-199a* was the most significantly down-regulated miR. [score:9]
[1 to 20 of 1 sentences]
100
[+] score: 9
MicroRNAs also play a role in the maintenance of stem cells, and some are expressed during self-renewal (miR-269, miR-290-295 cluster, miR-371, miR-200c) while others are up-regulated during differentiation (miR-21, miR-22, miR-29, miR-134, miR-296, miR-470) (see text for details). [score:6]
In contrast, the expression of other miRs (miR-21, miR-22 and miR-29) increases during the differentiation of indicating a possible role for them in stem cell differentiation [57, 58]. [score:3]
[1 to 20 of 2 sentences]