sort by

463 publications mentioning hsa-mir-20a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-20a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 383
The EMAP-II -induced up-regulation of LC3-II/I, and down-regulation of P62/SQSTM1, was blocked by miR-20a overexpression; while miR-20a had a negative effect on ATG7 and ATG5 protein expression. [score:11]
The protein expression level of LC3-II/I significantly up-regulated and the protein expression level of P62/SQSTM1 significantly down-regulated in miR-20a (−) group when compared to control and miR-20a (−) NC groups. [score:10]
These results indicated that miR-20a overexpression reversed the effect of EMAP-II up -regulating the expression of LC3-II/I and down -regulating the expression of p62/SQSTM1, and miR-20a might be involved in the regulating of EMAP-II inducing autophagy. [score:10]
These findings suggest that low miR-20a expression contributes to up-regulation of autophagy-related protein expression, activates autophagy, and inhibits the proliferation of glioma cells. [score:10]
Compared with EMAP-II + miR-20a (+) NC group, EMAP-II + miR-20a (+) significantly down-regulated LC3-II/I protein expression and up-regulated P62/SQSTM1 protein expression (P < 0.05), whereas EMAP-II + miR-20a (−) group showed no significant differences. [score:10]
As shown in Figures 4A–H, the protein expression level of LC3-II/I significantly down-regulated and the protein expression level of P62/SQSTM1 significantly up-regulated in miR-20a (+) group compared with control and miR-20a (+) NC groups (P < 0.05). [score:10]
Therefore, EMAP-II may up-regulate expression of ATG5 and ATG7 via down-regulation of miR-20a, inducing autophagy in glioma cells. [score:9]
EMAP-II and miR-20a Inhibitor Inhibited Tumor Growth In VivoThe growth -inhibitory effect of EMAP-II and miR-20a inhibitor on U-87 and U-251 cells was further tested in xenografted mice. [score:9]
above demonstrated that EMAP-II up-regulates expression of ATG7 and ATG5 through miR-20a inhibition. [score:8]
This suggests that EMAP-II up-regulation of ATG7 and ATG5 by down-regulation of miR-20a leads to autophagy. [score:7]
MiR-20a and miR-106b negatively regulate autophagy induced by leucine deprivation via suppression of ULK1 expression in C2C12 myoblasts. [score:6]
MiR-20a targets the ATG ULK1 post-transcriptionally and regulates autophagy of C2C12 cells (Wu et al., 2012), suggesting control by regulating expression of the autophagy-related protein. [score:6]
In summary, this is the first study proposing that low-dose EMAP-II treatment induces autophagy of U-87 and U-251 glioma cells leading to inhibition of cell viability, migration and invasion via the down-regulation of miR-20a. [score:6]
In addition, miR-20a overexpression significantly down-regulated ATG7 and ATG5 protein levels. [score:6]
Whether EMAP-II induces autophagy through down-regulation of miR-20a expression, and thus affects the viability of glioma cells, is not known. [score:6]
MiR-20a expression significantly increased in glioma stem cells, which enhanced invasiveness (Wang et al., 2015); the degree of malignancy in brainstem gliomas was often higher in children than in adults, which correlated with up-regulation of miR-20a in pediatric brainstem gliomas (Wang et al., 2012). [score:6]
Research showed that miR-20a overexpression inhibits transformation from LC3-I to LC3-II, thereby negatively regulating autophagy in liver cancer cells (Chen et al., 2015). [score:6]
The results of this study showed that EMAP-II treatment of U-87 and U-251 cells led to a significant decrease in miR-20a expression and a significant increase in ATG7 and ATG5 expression. [score:5]
When the tumors grew to about 80 mm [3], the tumor-bearing mice were divided into four groups: (1) Control group, treated with 0.9% sodium chloride; (2) EMAP-II group, treated with 80 ng/kg EMAP-II; (3) miR-20a (−) group, treated with miR-20a (−) stable expressing cells; and (4) EMAP-II + miR-20a (−) group, treated with miR-20a (−) stable expressing cells and 80 ng/kg EMAP-II. [score:5]
Figure 8EMAP-II and miR-20a inhibitor inhibited tumor growth in vivo. [score:5]
Therefore, EMAP-II can inhibit miR-20a expression and induce autophagy of U-87 and U-251 glioma cells by an unknown mechanism. [score:5]
However, neither miR-20a overexpression nor silencing affected mRNA expression. [score:5]
In this study, miR-20a overexpression prevented the EMAP-II -induced increase of LC3-II/I and decreases of P62/SQSTM1 expression. [score:5]
Figure 7 EMAP-II alone and EMAP-II combined with miR-20a inhibitor inhibited the proliferation, migration and invasion of U-87 and U-251 Cells. [score:5]
Our study found that the expression level of miR-20a was significantly decreased in U-87 and U-251 glioma cells after EMAP-II treatment, suggesting EMAP-II inhibited the viability, migration, and invasion of glioma cells by decreasing miR-20a via an unknown mechanism. [score:5]
MicroRNA-20a (MiR-20a), a miR-17-92 family member located on chromosome 13, is highly expressed in glioma tissues; overexpression of miR-20a promotes proliferation of U-251 glioma cells, suggesting a tumor-promoting effect (Yao et al., 2012). [score:5]
In order to study the effect of miR-20a on EMAP-II inducing autophagy of U-87 and U-251 glioma cells, the experiments were divided into 10 groups (n = 8): (1) Control group; (2) EMAP–II group; (3) miR-20a (+) NC group, transfected with negative control of miR-20a overexpression; (4) miR-20a (+) group, transfected with miR-20a overexpression; (5) miR-20a (−) NC group, transfected with negative control of miR-20a silencing; (6) miR-20a (−) group, transfected with miR-20a silencing; (7) EMAP-II + miR-20a (+) NC group; (8) EMAP-II + miR-20a (+) group; (9) EMAP-II + miR-20a (−) NC group; and (10) EMAP-II + miR-20a (−) group. [score:5]
For example, miR-20a overexpression significantly inhibited the proliferation and invasive capacity of thyroid cancer cells (Xiong et al., 2014), while it is a cancer-promoter in cervical cells (Kang et al., 2012). [score:5]
EMAP-II and miR-20a Inhibitor Inhibited Tumor Growth In Vivo. [score:5]
MiR-20a is upregulated in anaplastic thyroid cancer and targets LIMK1. [score:5]
Similar to the above results, EMAP-II and miR-20a (−) groups inhibited the migration and invasion of cells, and the combination of EMAP-II and miR-20a (−) group displayed maximum inhibitory effect on the migration and invasion of cells (P < 0.05, Figures 7C–H). [score:5]
The growth -inhibitory effect of EMAP-II and miR-20a inhibitor on U-87 and U-251 cells was further tested in xenografted mice. [score:5]
Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2. Oncogene 34, 1407– 1419. [score:4]
Upregulation of miR-20a and miR-106b is involved in the acquisition of malignancy of pediatric brainstem gliomas. [score:4]
To verify that ATG7 or ATG5 3′-UTR is a direct target of miR-20a, we cloned the reporter plasmid containing the wild 3′-UTR of ATG7 and ATG5 (atg7/ATG5-3UTR-Wt) and mutant 3′-UTR of ATG7 and ATG5 (atg7/ATG5-3UTR-mut). [score:4]
To further verify the regulation effect of miR-20a on ATG7 and ATG5 expression, the experiments were divided into five groups: (1) Control group; (2) miR-20a (+) NC group; (3) miR-20a (+) group; (4) miR-20a (−) NC group; and (5) miR-20a (−) group. [score:4]
These results showed that miR-20a directly targeted the 3′-UTR of ATG7 and ATG5. [score:4]
Figure 6 ATG7 and ATG5 are the direct targets of miR-20a. [score:4]
This study aims to verify whether low-dose (0.05 nM) EMAP-II treatment induces autophagy in U-87 and U-251 glioma cells by regulation of the expression of miR-20a, and explores the molecular mechanisms associated with EMAP-II -induced glioma cell autophagy. [score:4]
To further confirm whether miR-20a is involved in EMAP-II -induced autophagy, western blot and immunofluorescence assays were used to test the protein expression of LC3 and P62/SQSTM1 in U-87 and U-251 cells, which were transfected with a mimic or inhibitor of miR-20a. [score:4]
Putative binding site between the 3′UTR of ATG7 (ATG5) mRNA and the seed region of miR-20a were predicted by TargetScan Human Release 6.2. [score:3]
showed that both EMAP-II and the miR-20a inhibitor effectively reduced cell viability, migration and invasion, and the combination brought synergistic or enhanced effects. [score:3]
Real-Time PCR analysis was performed to test the expression levels of miR-20a, ATG7 and ATG5 by means of a 7500 Fast Real-Time PCR System. [score:3]
Cells were seeded on six-well plates cultured overnight, then transfected with miR-20a mimic, miR-20a inhibitor, or their respective negative control (GenePharma, Shanghai, China) using lipofectamine 2000 reagent (Life Technologies Corporation) according to the manufacturer’s instructions. [score:3]
The expression levels of miR-20a decreased significantly after EMAP-II treatment. [score:3]
The expression levels of miR-20a in U-87 and U-251 cells after treating with EMAP-II were detected by quantitative real-time PCR. [score:3]
MiR-20a Directly Targeted the 3′-UTR of ATG7 and ATG5. [score:3]
MiR-20a Negatively Regulated ATG7 and ATG5 Protein Expression Levels in U-87 and U-251 Cells. [score:3]
Furthermore, combination of EMAP-II with a miR-20a inhibitor significantly reduces the proliferation, migration and invasion of glioma cells, prevents tumor growth in vivo, and exerts a synergistic effect against glioma. [score:3]
Using the bioinformatics Software TargetScan Human Release 6.2, putative binding sites for miR-20a were predicted on ATG7 and ATG5. [score:3]
After infection, the stable expressing cells of miR-20a-silencing [miR-20a (−)] were picked. [score:3]
EMAP-II and miR-20a inhibition significantly reduced the viability, migration and invasion of U-87 and U-251 cells in a synergistic manner. [score:3]
U-87 and U-251 cells were transfected with miR-20a mimics and its inhibitors, and then the mRNA and protein levels of ATG7 and ATG5 in U-87 and U-251 cells were detected by using western blot and quantitative real-time PCR, respectively. [score:3]
These data showed that nude mice were treated by EMAP-II combined with miR-20a inhibitor produced the smallest tumors and had the highest survival rate. [score:3]
Expression of hsa-miR-20a in human glioma tissues and its effect on the proliferation of human glioma cells in vitro. [score:3]
However, protein expression levels of ATG7 and ATG5 in miR-20a (−) group increased in comparison with those of control group and miR-20a (−) NC group (P < 0.05). [score:3]
The Effects of miR-20a on the Protein Expression of LC3 and P62/SQSTM1 in U-87 and U-251 Cells. [score:3]
The functional role of EMAP-II and miR-20a inhibitor alone or in combination on cell viability, migration and invasion of U-87 and U-251 cells was determined. [score:3]
EMAP-II and the miR-20a inhibitor contributed to reduced tumor size and prolonged survival of the mice, highlighting the synergistic effect against glioma. [score:3]
The expression change of P62/SQSTM1 was reversed to LC3, which was decreased in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups, while increased in miR-20a (+) group and there was no significant difference between EMAP-II + miR-20a (+) group and respective control groups. [score:3]
Figure 3 Effects of EMAP-II on the expression of microRNA-20a (miR-20a) in U-87 and U-251 glioma Cells. [score:3]
This study finds that EMAP-II and miR-20a inhibition have an antitumor effect toward glioma cells. [score:3]
As shown in Figures 6A,B, by using TargetScan Human Release 6.2 Software [1], 3′-UTR of ATG7 and ATG5 was predicted as a putative binding site matching with the seed region of miR-20a. [score:3]
Therefore, EMAP-II combined with a miR-20a inhibitor shows promise as a new treatment for glioma. [score:3]
The Single or Combined Application of EMAP-II and miR-20a Inhibitors on the Viability, Migration and Invasion of U-87 and U-251 Cells. [score:3]
To study the effect of EMAP-II and miR-20a inhibitor alone and in combination on cell proliferation, migration, and invasion, U-87 and U-251 cells were divided into six groups (n = 8): (1) Control group; (2) EMAP-II group; (3) miR-20a (−) NC group; (4) miR-20a (−) group; (5) NS + miR-20a (−) NC group, treatment with 0.9% sodium chloride after negative control of miR-20a silencing transfection; and (6) EMAP-II + miR-20a (−) group. [score:3]
Figure 4 The effects of miR-20a on protein expression levels of LC3 and P62/SQSTM1 in EMAP-II treated U-87 and U-251 glioma cells. [score:3]
A subsequent study analyzed the effect of EMAP-II and the miR-20a inhibitor on tumor size and survival time in a nude mouse mo del of subcutaneous xenograft. [score:3]
The combination of EMAP-II and miR-20a (−) displayed greater inhibitory effect than either EMAP-II or miR-20a (−) alone (P < 0.05). [score:3]
The Effects of Low-Dose EMAP-II on the miR-20a Expression Levels in U-87 and U-251 Cells. [score:3]
Furthermore, nude mice carrying silencing-expressed miR-20a combined with EMAP-II treatment had the smallest tumors and highest survival. [score:3]
The cells were harvested after 48 h. After the cell clones of miR-20a overexpression or silencing were established, EMAP-II was administrated for 0.5 h. Cell viability was analyzed by MTT (Solarbio Company, Beijing, China) assay. [score:2]
The protein expression levels of ATG7 and ATG5 in miR-20a (+) group were significantly decreased compared with those of control group and miR-20a (+) NC group (P < 0.05). [score:2]
miR-20a promotes migration and invasion by regulating TNKS2 in human cervical cancer cells. [score:2]
Compared with EMAP-II group, the expression of LC3 decreased in EMAP-II + miR-20a (+) group and there was no significant difference in EMAP-II + miR-20a (−) group. [score:2]
As shown in Figures 3A,B, compared with control group, EMAP-II significantly reduced the expression levels of miR-20a normalized to U6 at 0.5 h and 1 h and the decline was most obvious at 0.5 h (P < 0.05); meanwhile, there was no significant difference among EMAP-II 3 h, 6 h groups and control group (P > 0.05). [score:2]
However, whether EMAP-II induced autophagy of U-87 and U-251 cells via regulation of miR-20a is not clear. [score:2]
This suggests that miR-20a post-transcriptionally regulates ATG7 and ATG5. [score:2]
The mechanism of action is associated with negative regulation of the autophagy-related proteins ATG7 and ATG5 by miR-20a. [score:2]
For quantification of miR-20a expression, reverse transcription and real-time PCR amplification were carried out using Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix II with the TaqMan MicroRNA Assay of miR-20a and U6 (Applied Biosystems, Foster, CA, USA), respectively. [score:2]
As shown in Figures 8A–F, tumor volumes of xenografts were significantly suppressed in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups as compared to control group (P < 0.01), and the tumor volumes was most significantly decreased in EMAP-II + miR-20a (−) group (P < 0.01). [score:2]
Compared with EMAP-II group, the expression of P62/SQSTM1 increased in EMAP-II + miR-20a (+) group and there was no significant difference in EMAP-II + miR-20a (−) group. [score:2]
As shown in Figure 4I, the LC3 expression significantly increased in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups, while decreased in miR-20a (+) group and there was no significant change in EMAP-II + miR-20a (+) group when compared to respective control group. [score:2]
MiR-20a acts as a tumor promoter or suppressor, depending on the cell type. [score:2]
miR-20a (−) NC; [▴▴] P < 0.01 vs. [score:1]
miR-20a (−) NC group; [Δ] P < 0.05 vs. [score:1]
Survival curve analysis showed that, survival time of nude mice was longer in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups than that in control group, and was significantly longest in EMAP-II + miR-20a (−) group (Figures 8G,H). [score:1]
The miR-20a silencing was ligated into the pLenti6.3/V5eDEST vector (GenePharma, Shanghai, China) and then pLenti6.3/V5eDEST-miR-20a-scilecing vector was generated. [score:1]
ATG5wt + miR-20a (+) NC group, [##] P < 0.01 vs. [score:1]
miR-20a (−) NC group. [score:1]
Furthermore, miR-20a is also considered as an autophagy-related gene (ATG) and it may participate in regulating leucine deprivation -induced autophagy by changing intracellular levels of key autophagy-related proteins in C2C12 myoblasts (Wu et al., 2012). [score:1]
Whereas, miR-20a (−) group showed the opposite effect. [score:1]
This indicates that miR-20a may serve as a cancer-promoting gene and affect the biological activity of glioma cells. [score:1]
ATG7 wt + miR-20a (+) group. [score:1]
NS + miR-20a (−) NC group; [Δ] P < 0.05 vs. [score:1]
As shown in Figures 5A,B,G,H, there were no obvious differences of ATG7 mRNA and ATG5 mRNA levels between miR-20a (+) and miR-20a (+) NC groups, miR-20a (−) and miR-20a (−) NC groups (P > 0.05). [score:1]
miR-20a (+) NC group; [▴] P < 0.05 vs. [score:1]
It has been reported that miR-20a can affecte autophagy in C2C12 cells (Wu et al., 2012). [score:1]
EMAP-II + miR-20a (+) NC group. [score:1]
miR-20a (−) group. [score:1]
There was no significant difference among EMAP-II, EMAP-II + miR-20a (+) NC and EMAP-II + miR-20a (−) NC groups. [score:1]
The tumor-promoting effect of miR-20a has been reported in glioma cells and tissues (Yao et al., 2012). [score:1]
After that, cells were co -transfected with the wild-type or mutated ATG7 (ATG5)-3′UTR reporter plasmid (GenePharma, Shanghai, China), and transfected with miR-20a mimic or miR-20a mimic NC. [score:1]
Lentivirus encoding miR-20a silencing was generated using pLenti6.3/V5eDEST Gateway Vect—or Kit (Life Technologies Corporation, Carlsbad, CA, USA). [score:1]
As shown in Figures 5C–F, 5C–F,I–L, there were no obvious differences among control, miR-20a (+) NC and miR-20a (−) NC groups. [score:1]
[1 to 20 of 105 sentences]
2
[+] score: 355
Further, qRT-PCR assay showed the mesenchyme cell marker N-cadherin mRNA was significantly upregulated (P < 0.01) and the epithelial marker E-cadherin mRNA was significantly downregulated (P < 0.01) in HT29 cells upon miR-20a-5p overexpression (Figure 3B), whereas the mRNA of E-cadherin was upregulated (P < 0.01) and N-cadherin was downregulated (P < 0.05) in HCT116 cells upon miR-20a-5p knocking-down (Figure 3B). [score:15]
Overexpression or knockdown of Smad4 partially reversed the promoted or inhibited EMT due to miR-20a-5p upregulation or downregulation. [score:12]
Here, we identified a novel miRNA, miR-20a-5p, which targeted smad4 3′-UTR, and verified that 1) high miR-20a-5p expression promoted the invasion and metastasis of CRC cells and induced EMT of CRC cells by directly binding to the 3′-UTR of Smad4; 2) most importantly, we also revealed that miR-20a-5p was upregulated in CRC tissues and high miR-20a-5p expression predicted the poor prognosis. [score:11]
Overexpression or knockdown of Smad4 partially reversed the number of liver metastatic colonies resulting from miR-20a-5p upregulation or downregulation. [score:10]
Herein, upregulated miR-20a-5p was also found inducing the mesenchyme phenotype alteration and increased mesenchyme cell marker N-cadherin and decreased epithelial marker E-cadherin expression, while downregulated miR-20a-5p manifested reverse performances in CRC cells. [score:9]
The clinical characters of these patients and their correlated miR-20a-5p and Smad4 protein expression levels were shown in Table 1. Compared with adjacent normal tissues, miR-20a-5p was upregulated and Smad4 was downregulated obviously in colorectal cancer tissues (Figure 6A, 6C1–6C3, P < 0.001). [score:8]
Based on the miRNA target prediction programs analysis, we only selected miR-20a-5p and identified Smad4 was the functional downstream target of miR-20a-5p in CRC progression, however, whether there existed other promising targets of miR-20a-5p in colorectal cancer progression needs more intensive researches. [score:7]
Subsequently, Kaplan–Meier analysis with log-rank test showed high miR-20a-5p expression patients presented poorer disease free survival (DFS) and overall survival (OS) rates than those with low miR-20a-5p expression (Figure 6D, 6E, P < 0.001). [score:7]
In our study, we identified a novel miRNA, miR-20a-5p, which could directly target Smad4 3′UTR in CRC cells and cause its downregulation. [score:7]
We found that miR-20a-5p was significantly upregulated (Figure 1B, P = 0.002), while Smad4 was obviously downregulated (Figure 1C, P < 0.001) in tissues with metastasis than those without metastasis. [score:7]
miR-20a-5p, as an onco-miRNA, promoted the invasion and metastasis ability by suppressing Smad4 expression in CRC cells, and high miR-20a-5p predicted poor prognosis for CRC patients, providing a novel and promising therapeutic target in human colorectal cancer. [score:7]
miR-20a-5p not only promoted CRC cells aggression capacity in vitro and liver metastasis in vivo, but also promoted the epithelial-to-mesenchymal transition process by downregulating Smad4 expression. [score:6]
In HCT116 cells, the suppression effect of invasion and metastasis capacity in vitro and in vivo by knocking-down miR-20a-5p could be partially restored after silencing Smad4 expression (Figure 5B P < 0.05). [score:6]
Smad4 overexpression partially abrogated the increased wound healing, invasion and metastasis capacity induced by upregulation of miR-20a-5p. [score:6]
In nasopharyngeal carcinoma, overexpressed miR-20a-5p combined with miR-24–3p, miR-891a, miR-106a-5p and miR-1908 formed the exosomes to downregulated the MARK1 signaling pathway to alter cell proliferation and differentiation [23]. [score:6]
Taken together, miR-20a-5p mediated Smad4 expression by directly targeting its 3′-UTR, which may be involved in the promoting role in CRC progression. [score:6]
After transfecting miR-20a-5p mimics and anti-miR-20a-5p mimics into HT29 and HCT116 cell line respectively, we found miR-20a-5p mimics inhibited Smad4 3′-UTR luciferase activity in HT29 cells, conversely, anti-miR-20a-5p mimics promoted Smad4 3′-UTR luciferase activity in HCT116 cells (Figure 1F, P < 0.05), which demonstrated that miR-20a-5p might directly target the 3′-UTR of Smad4 in CRC cell lines. [score:6]
Overexpressing miR-20a-5p promoted the migration and invasion ability in HT29 cells (Figure 2A–2C, P < 0.01 for all), while knocking-down miR-20a-5p suppressed the migration and invasion ability in HCT116 cells (Figure 2A–2C, P < 0.01for all). [score:6]
HT29 and HCT-116 cells were transfected with constructed target gene (wt/mut-miR-20a-5p and wt/mut-Smad4) overexpression or knockdown plasmids using Lipofectamine 2000 (Invitrogen, Camarillo, CA, USA) according to the manufacturer's instructions, after cell transfection for 72 h, antibiotic selection (2 μg/ml puromycin) was selected for 5 days. [score:6]
miR-20a-5p negatively regulated Smad4 by directly targeting its 3′UTR in human colorectal cancer cells. [score:5]
HT29 cells with stable miR-20a-5p overexpression and HCT116 cells with stable miR-20a-5p silenced expression were injected into the nude mice from the tail's veins, and the control groups were injected with the same number and concentration of cells transfected with empty lentiviral vectors. [score:5]
Figure 4B showed miR-20a-5p overexpression remarkably suppressed the luciferase activity of the wild-type Smad4 3′-UTR luciferase construct (Figure 4B P < 0.05) but not the mutant Smad4 3′UTR. [score:5]
Further, functional studies demonstrated that overexpression of Smad4 partially abrogated the promoted invasion-migration-metastasis and EMT mediated by miR-20a-5p overexpression. [score:5]
Statistical analyses showed 74.8% (407/544) patients performed high expression of miR-20a-5p and 70.0% (381/544) patients showed low expression of Smad4 (Table 1A). [score:5]
Hence, we tried to explore the function of miR-20a-5p in colorectal cancer development and we confirmed that miR-20a-5p was upregulated in CRC tissues, especially metastatic tissues than non-metastatic tissues. [score:5]
In addition, patients with high miR-20a-5p expression usually showed a low Smad4 expression. [score:5]
Further, in HT29 cells, as shown, overexpressing miR-20a-5p promoted wound healing and migration-invasion capacity in vitro and more liver metastatic colonies in vivo, but the effect was partially weakened after increasing Smad4 expression (Figure 5A P < 0.05). [score:5]
Among these, miR-20a-5p whose robust downregulation effect drew our attention, indicating that miR-20a-5p may be the most powerful potential regulator of Smad4 in these 17 miRNAs. [score:5]
Smad4 knockdown partially restored the decreased wound healing, invasion and metastasis capacity induced by downregulation of miR-20a-5p. [score:5]
miR-20a-5p mediated Smad4 expression by directly binding to its 3′-UTR. [score:4]
Up-regulated miR-20a-5p promoted the invasion and metastasis of colorectal cancer in vitro and in vivo. [score:4]
miR-20a-5p mediated Smad4 expression by directly binding to its 3′-UTR in CRC cell lines. [score:4]
All these results indicated that Smad4 was a direct functional target of miR-20a-5p in aggression process in CRC cells. [score:4]
What's more, overexpression or knocking-down of Smad4 could also partially reverse the roles of miR-20a-5p in EMT process (Figure 5C P < 0.05, Figure 5D). [score:4]
On the contrary, both knockdown of miR-20a-5p and mutant-miR-20a-5p expression can promote luciferase activity of the wild-type Smad4 3′-UTR luciferase construct (P < 0.01) as well as mutant-type Smad4 (Figure 4C P < 0.001). [score:4]
Having shown the metastasis-promoting function of miR-20a-5p and its direct targeting role on Smad4, we further validated the biological function of Smad4 in the CRC aggression process mediated by miR-20a-5p. [score:4]
Overexpressing miR-20a-5p induced mesenchyme phenotype alteration in HT29 cells, while knocking-down miR-20a-5p tended to epithelial cell phenotype in HCT116 cells (Figure 3A). [score:4]
To generate the miR-20a-5p and Smad4 overexpression vector or knockdown vector and the corresponding negative controls, the open reading frame was amplified and cloned into the pcDNA3.0 vector. [score:4]
In addition, tissue microarray analysis obtained from 544 CRC patients’ clinical characters showed that miR-20a-5p was upregulated in human CRC tissues, especially in the tissues with metastasis. [score:4]
Compared with the normal colon epithelial cell line (FHC cell line), HCT116 cell line which owned high ability of migration and invasion as previously proved [13], showed high expression level of miR-20a-5p, while the low migration and invasion ability cell line HT29 performed low expression level of miR-20a-5p (Figure 1E). [score:4]
To determine whether miR-224 directly targets the 3′-UTRs of Smad4, the wild-type or mutant Smad4 gene contained 3′UTR sequence with relative miR-20a-5p binding specific sequence was amplified and transfected into Dual Luciferase Reporter vector, and miR-20a-5p mimics, anti-miR-20a-5p or mutant-anti-miR-20a-5p mimics were cotransfected into relative CRC cells by Lipo2000 following the introductions. [score:4]
Figure 3(A) The alteration of phenotypic observed under microscopy (magnification × 200) in miR-20a-5p overexpressing HT29 cells and miR-20a-5p knocking-down HCT116 cells. [score:4]
Taken together, miR-20a-5p/Smad4 signal pathway may be a promising therapeutic target for CRC patients. [score:3]
miR-20a-5p overexpressing and negative control HT29 cells were transfected with empty vectors or Lv-Smad4. [score:3]
For miR-20a-5p and Smad4 co-transfection, we constructed the plasmids with co-overexpression of miR-20a-5p and Smad4 or plasmids with co-silencing of miR-20a-5p and Smad4. [score:3]
Relationship between clinical features and miR-20a-5p or Smad4 protein expression in 544 colon cancer patients. [score:3]
What's more, the expression of miR-20a-5p was negatively correlated with that of Smad4 in these 10 patients (Figure 1D, R [2] = 0.234, P < 0.001). [score:3]
In the present, Smad4 was demonstrated to be a downstream target of miR-20a-5p in CRC progression. [score:3]
In summary, we identified a novel miRNA, miR-20a-5p, targeted Smad4 and promoted CRC invasion and metastasis. [score:3]
Our findings suggested that miR-20a-5p promoted the onco-process of CRC cells by repressing Smad4 expression. [score:3]
Figure 2Up-regulated miR-20a-5p promoted the invasion and metastasis of colorectal cancer in vitro and in vivo(A) (B) Migration and (C) invasion assays were performed both in empty vector-infected or miR-20a-5p vector infected HT29 cells and negative control or anti-miR-20a-5p vector infected HCT116 cells, respectively. [score:3]
Multivariate Cox proportional hazard analyses of miR-20a-5p expression and TNM in 544 CRC patients’ DFS and OS. [score:3]
For negative regulation on Smad4, we further investigated whether Smad4 was the direct target of miR-20a-5p. [score:3]
Figure 6(A) The expression of miR-20a-5p mRNA in 544 patients normal and paired tumor tissues through qRT-PCR (P < 0.001). [score:3]
Similarly, our studies also demonstrated overexpressing miR-20a-5p promoted CRC cells invasion and metastasis in vitro and more liver metastatic colonies in vivo. [score:3]
High miR-20a-5p expression was positively correlated with pT stage (P = 0.035), pN stage (P = 0.001), pM stage (P = 0.022), American Joint Committee on Cancer (AJCC) stage (P = 0.005), differentiation (P = 0.022), and Smad4 (P < 0.001). [score:3]
Interestingly, there were obvious phenotypic changes in miR-20a-5p overexpressing HT29 cells and miR-20a-5p knocking-down HCT116 cells, compared with the control groups. [score:3]
What's more, tumor metastasis patients showed a higher miR-20a-5p while lower Smad4 expression level than those without tumor metastasis (Figure 6B, 6C2–6C3, P < 0.001). [score:3]
Interrupt or inhibiting the miR-20a-5p/Smad4 pathway may provide a novel therapeutic method for CRC patients. [score:3]
To further validate the role of miR-20a-5p and Smad4 in CRC, eight colorectal cell lines and one normal colorectal epithelial cell line were used for testing the relative expression of miR-20a-5p. [score:3]
These data further demonstrated that miR-20a-5p overexpressing cells were more powerful of liver metastatic colonies. [score:3]
Meanwhile, mutant-miR-20a-5p expression had no influence on the luciferase activity of wild-type Smad4 3′-UTR but can alter the mutant Smad4 3′-UTR luciferase activity (Figure 4B P < 0.05) in HT29 cells. [score:3]
What's more, Multivariate cox proportional hazard analyses also revealed that advanced TNM stage and high miR-20a-5p expression contributed to poor DFS and OS (Table 2 P < 0.05 for all). [score:3]
Furthermore, we found miR-20a-5p repressed Smad4 expression at mRNA and protein level (Figure 1G, P < 0.05). [score:3]
miR-20a-5p negatively regulated Smad4 in human colorectal cancer. [score:2]
All the above results suggested that miR-20a-5p was a negative regulator of Smad4 in human colorectal cancer. [score:2]
miR-20a-5p knocking down and negative control HCT-116 cells were transfected with empty vectors or shSmad4. [score:2]
We compared the colonies formed in the livers of the mice and found that miR-20a-5p overexpression or knocking-down could significantly increase or decrease the liver metastatic colonies compared with the control (Figure 2D, P < 0.001). [score:2]
High level of miR-20a-5p generally indicates advanced stage, poor prognosis and chemo-therapy resistance in several cancer types. [score:1]
Taken together, miR-20a-5p could promote EMT process of CRC cells. [score:1]
As miR-20a-5p had the predicting role on the chemosensitivity of stage II colorectal cancer [25], whether miR-20A-5p also predicted the chemosensitivity of other stage CRC patients is unknown and the specific mechanisms also need to be further explored. [score:1]
Taken together, Smad4 played a significant role on the CRC progression mediated by miR-20a-5p. [score:1]
Subsequently, we evaluated miR-20a-5p and relative Smad4 expression level in 10 patients’ colorectal cancer tissues with and without metastasis. [score:1]
The correlation between miR-20a-5p and Smad4 expression levels was performed by calculating the Spearman correlation coefficient. [score:1]
The miR-20a-5p was mutated by changing Smad4 3′UTR binding site AAA to GGG (mut-miR-20a-5p) and mutant Smad4 3′UTR was formed with the mutant miR-520g binding site UUU to CCC. [score:1]
These results indicated miRNA-20a-5p could promote CRC aggression in vitro. [score:1]
Further we demonstrated that miR-20a-5p promoted CRC cells invasion and metastasis by repressing Smad4 in vitro and vivo. [score:1]
miR-20a-5p has been reported to play a significant role in gastric cancer, non-small cell cancer, prostate cancer and other cancers. [score:1]
miR-20a-5p promoted the onco-process of CRC cells via Smad4 repression. [score:1]
Totally, high level of miR-20a-5p predicted poor prognosis of CRC patients, especially for patients with tumor recurrence. [score:1]
miR-20a-5p contained a length of specific converse binding sequence of Smad4. [score:1]
Further OS survival analysis showed that high level of miR-20a-5p in patients with tumor relapse also performed shorter survival time (Figure 6F, P = 0.003), while, there was no significant difference seen in the patients without tumor relapse (Figure 6G, P = 0.574). [score:1]
Figure 4 in CRC cell lines(A) The complementary sequences between the position 1357–1363 of wild-type or mutant human Smad4 3-UTRs mRNA and human miR-20a-5p. [score:1]
High level of miR-20a-5p was correlated with the metastasis and predicted poor prognosis in colorectal cancer patients. [score:1]
As for CRC, previous study revealed that combined the other five miRNAs (miR-21–5p, miR-103a-3p, miR-106b-5p, miR-143–5p, and miR-215), their prognostic and predictive role in predicting which patients benefit from adjuvant chemotherapy for stage II colon cancer [25], while the role of miR-20a-5p have not been explored in CRC yet. [score:1]
Thus miR-20a-5p may be an efficient marker for predicting the prognosis of the CRC patients and patients with high miR-20a-5p level might receive the stronger and individual treatment after surgery. [score:1]
In addition, high miR-20a-5p predicted poor prognosis for CRC patients. [score:1]
After total RNA were reverse transcripted into complementary DNA which acted as the template for the amplification of RNA, real-time PCR was used for miR-20a-5p amplification and TaqMan Human miRNAs qPCR Quantitation Kit (Applied Biosystems, Foster City, CA, USA) for quantification following amplification. [score:1]
These indicated that high miR-20a-5p and low Smad4 played significant roles in the patients’ tumor progress and may be valuable in prognostic prediction. [score:1]
and transfection technique were used to validate the correlation between miR-20a-5p and Smad4 in CRC. [score:1]
miR-20a-5p promoted epithelial-to-mesenchyme transition of colorectal cancer cells. [score:1]
miR-20a-5p promoted invasion and metastasis of colorectal cancer cells in vitro and in vivo. [score:1]
The transfected efficiency of miR-20a-5p and Smad4 is showed in Supplementary Figure 1A and 1B. [score:1]
We found wild type Smad4 3′-UTR mRNA contained a length of sequence conserved miR-20a-5p and conducted mutant miR-20a-5p and conserved mutant Smad4 3′-UTR, so miR-20a-5p with the complementary Smad4 3′UTR sites were mutated as reported previously [35, 36] (Figure 4A). [score:1]
High level of miR-20a-5p predicted poor prognosis in CRC patients. [score:1]
Overall, these findings suggested miR-20a-5p could increase the invasion and metastasis ability of colorectal cancer cells in vitro and vivo. [score:1]
miR-20a-5p promoted the epithelial-to-mesenchymal transition of colorectal cancer cells. [score:1]
The association between miR-20a-5p expression and the prognosis of CRC patients was evaluated by Kaplan–Meier analysis and multivariate cox proportional hazard analyses based on tissue microarray data. [score:1]
These discoveries further demonstrated the oncogenic role of miR-20a-5p in CRC. [score:1]
[1 to 20 of 99 sentences]
3
[+] score: 333
When overexpressed in human naïve CD4 [+] T-helper cells, miR-20a inhibits TCR -mediated signaling, CD69 expression, and decreases cytokine production. [score:7]
Thus, miR-20a represents a novel potential target for the modulation of inflammatory conditions, for the treatment of autoimmune diseases, and for the regulation of antibody responses. [score:6]
As shown in Fig 1A, the expression of miR-20a was rapidly (within 2 h) and significantly upregulated after T-cell stimulation. [score:6]
We have found that CD25 is upregulated to similar levels in both control and miR-20a overexpressing cells (data not shown). [score:6]
The latter observation is in line with normal upregulation of CD25 and the almost comparable levels of IL-2 production in miR-20a overexpressing vs. [score:6]
For miR-20a overexpression studies, a BLOCK-iT Pol II miR RNAi Expression Vector Kit (Invitrogen) was used to generate a vector coding for either miR-20a or a miR-control. [score:5]
We have found that overexpression of miR-20a does not affect the expression of Lck, Zap-70, LAT, PLC-γ, SLP-76, GADS, Sos1, Erk in resting (Fig 3A) as well as in activated CD4 [+] T cells (data not shown). [score:5]
Interestingly, inhibition of Ca [++] flux by EGTA completely abolished the expression of miR-20a precursors. [score:5]
As shown in Fig 2A and 2B, overexpression of miR-20a inhibits the TCR -mediated phosphorylation of Zap-70, LAT, PLC-γ, and Erk1/2. [score:5]
PTEN is a crucial regulator of proximal signaling also in T cells [54] and hence it could represent an ideal target candidate for the regulation of TCR signaling mediated by miR-20a. [score:5]
Also IL-6 production was suppressed upon miR-20a overexpression. [score:5]
However we did not observe any change in PTEN upon miR-20a overexpression in T cells, which appears rather to be a target of miR-17 and miR-19b, as suggested by recent data in mouse CD4 [+] T cells [19, 32]. [score:5]
Despite defective TCR -mediated signaling and CD69 expression, overexpression of miR-20a did not affect T-cell proliferation. [score:5]
To confirm the role of miR-20a in T cell activation, we suppressed its expression by DNA decoys. [score:5]
Nevertheless, we do not exclude the possibility that miR-20a may also regulate cytokine production via mechanisms which are independent on TCR signaling, for example by directly targeting cytokine transcripts. [score:5]
Second, whole blood cells from multiple sclerosis (MS) patients under-express miR-17 and miR-20a, whereas the expression of the other members of the cluster is not affected [20]. [score:5]
For overexpression, 1 x 10 [6] human naïve CD4 [+] T cells were transfected with 1 μg of either miR-control or miR-20a expressing plasmids using AMAXA nucleofection kit (Lonza) according to the manufacturer’s instructions. [score:5]
Similarly to PTEN, we also did not find alterations in STAT3 expression upon miR-20a overexpression. [score:5]
To exclude the possibility that the overexpression of miR-20a affects the expression of crucial signaling molecules, we performed additional experiments. [score:5]
In order to overexpress miR-20a, we cloned the human pre-miR-20a sequence into a pcDNA6.2-GW/EmGFP miR expression vector. [score:5]
Reduced CD69 expression but normal T-cell proliferation upon miR-20a overexpression. [score:5]
However, 45 minutes after TCR stimulation inhibition was less efficient, as decoy -treated CD4 [+] T cells displayed only 35% reduction of miR-20a expression compared to scrambled controls (Fig 4A). [score:4]
These results are in agreement with the overexpression data and support the hypothesis that miR-20a is a negative regulator of TCR -mediated signaling. [score:4]
These data are in agreement with the overexpression data and support the hypothesis that miR-20a is a negative regulator of TCR -mediated signaling. [score:4]
As shown in Fig 6A, overexpression of miR-20a moderately decreased the production of IL-2, IL-6, IL-8, but strongly inhibited IL-10 secretion compared to miR-control. [score:4]
Thus, we hypothesize that miR-20a may be a part of the cell machinery that translates quantitative differences in TCR signaling into qualitative regulation of CD4 [+] T-cell cytokine secretion. [score:4]
Based on the observation that Erk1/2, and Ca [++], and p38 signaling are all altered upon miR-20a overexpression, we hypothesize that miR-20a may regulate cytokine production at least in part via TCR -mediated signaling. [score:4]
Graph in (B) represents relative mean fluorescent intensity (MFI) of CD69 expression of miR-20a overexpressing cells compared to miR-control. [score:4]
As shown in Fig 5A and 5B, overexpression of miR-20a significantly decreased CD69 expression compared to cells transfected with miR-control. [score:4]
As expected, we have found that miR-20a overexpressing cells showed indeed a reduction in Ca [++] flux compared to cells expressing miR -negative control (Fig 2C and 2D). [score:4]
Having shown that miR-20a is rapidly induced upon TCR stimulation and that its expression depends on transcription factors which are crucial for T-cell functions, we next assessed whether miR-20a is involved in the regulation of T-cell activation. [score:4]
In fact, miR-19b and miR-17 regulate T-cell expansion, Th1 responses, and inhibit iTreg differentiation [19], whereas miR-17 and miR-20a appear to repress the transcription of genes involved in T-cell activation in the Jurkat T-cell line [20]. [score:4]
miR-20a is upregulated upon T-cell activation. [score:4]
0125311.g001 Fig 1Expression of miR-20a and miR-20a precursors in human naïve CD4 [+] T cells. [score:3]
In addition to a rapid induction, the expression of miR-20a was also sustained up to 48 h and decreased thereafter to the basal level (Fig 1A). [score:3]
Expression of miR-20a and miR-20a precursors in human naïve CD4 [+] T cells. [score:3]
Thus, IL-8, which has been shown to promote pro-inflammatory response, is a target of miR-20a not only in T cells. [score:3]
In addition, overexpression of miR-20a results in the constitutive activation of p38 mitogen- activated protein kinase (Fig 2A and 2B). [score:3]
In contrast to the mild effect on IL-2, IL-6, and IL-8 secretion, miR-20a appears to strongly suppress IL-10 production in human naïve CD4 [+] T cells. [score:3]
STAT3 has been shown to be a target of miR-20a in HEK 293 and RAW 264.7 cell lines [55]. [score:3]
We have found that miR-20a inhibits the secretion of cytokines such as IL-6, IL-8 and IL-10. [score:3]
Moreover, it appears that p38 phosphorylation cannot be further induced upon TCR stimulation in cells overexpressing miR-20a. [score:3]
Given that activated PLCγ-1 mediates Ca [++] signaling by generating IP [3], a decrease in the phosphorylation of PLCγ-1 upon miR-20a overexpression should also result in the reduction of the release of intracellular Ca [++] in response to TCR stimulation. [score:3]
Here, we have focused our attention on miR-20a, as its expression is rapidly induced (within minutes) upon T-cell activation. [score:3]
miR-20a inhibits early T-cell activation events. [score:3]
Expression of miR-20a precursors was quantified using RT qPCR. [score:3]
Further studies using in vivo mo dels and the identification of the molecular targets of miR-20a are required to shed more light onto the physiological function of miR-20a and onto the mechanism of its action. [score:3]
One of the important findings of our work is that miR-20a inhibits TCR signaling at a very proximal level. [score:3]
We have found that miR-20a is rapidly induced upon stimulation of the TCR and that its expression depends on the three key signaling pathways Ca [++], Erk, and NF-κB. [score:3]
We propose that this could either be due to the rapid re -expression of miR-20a upon TCR stimulation or to redundancy among members of the miR17-92 cluster and its paralogs (miR-106a-363 and miR-106b-25). [score:3]
As TCR -mediated signaling is defective upon overexpression of miR-20a, we next tested whether miR-20a also affects T-cell activation at a transcriptional level and we measured CD69 expression as a read-out system. [score:3]
Overexpression of miR-20a. [score:3]
To suppress miR-20a, DNA sequences complementary to the miR-20a (Decoy) were chemically synthesized from biomers. [score:3]
As shown in Fig 4A, we were able to achieve an efficient suppression (about 80%) of miR-20a in resting CD4 [+] naïve T cells. [score:3]
On the other hand, overexpression of miR-20a did not affect the release of other cytokines such as IL-4, IFN-γ, TGF-β and TNF-α. [score:3]
Histograms overlay show the expression of CD3 (left) and CD28 (right) in miR-20a versus miR-control transfected cells. [score:3]
In order to shed more light onto the function of miR-20a in TCR -mediated signaling, we performed inhibition experiments using a miR-20a decoy. [score:3]
Interestingly, a previous study showed that IL-8 is a target of miR-17 and miR-20a in breast cancer cell lines [43]. [score:3]
We next assessed whether these processes are affected upon overexpression of miR-20a. [score:3]
Inhibition of miR-20a slightly increases TCR -mediated signaling. [score:3]
Finally, also CD4 [+] T-cell proliferation was not affected upon miR-20a overexpression (Fig 5C). [score:3]
Efficient overexpression of miR-20a was also observed upon TCR stimulation of resting CD4 [+] T cells (Fig 1D). [score:3]
Using this system we were able to achieve a moderate overexpression (about 3 folds, Fig 1D) of miR-20a in resting CD4 [+] T cells with about 70% transfection efficiency (data not shown). [score:3]
0125311.g005 Fig 5Human naïve CD4 [+] T cells were transfected with either miR-20a or miR- control expression plasmids. [score:3]
It is important to mention that IL-10 concentration is also decreased upon ectopic expression of miR-17 and miR-20a in breast cancer cell lines [43]. [score:3]
Real-time quantitative PCR (RT qPCR) analysis showed that the expression of miR-20a precursors (both pri- and pre-miRNAs) was induced very rapidly (detectable already after 30 min) upon TCR triggering (Fig 1B). [score:3]
miR-20a inhibits cytokine production. [score:3]
Human naïve CD4 [+] T cells were transfected with either miR-20a or miR- control expression plasmids. [score:3]
miR-20a inhibits TCR -mediated signaling. [score:3]
Additionally, the seed region, which is crucial for the recognition of the mRNA target, is highly conserved among miR-17, miR-20a, miR-20b, miR-93, miR-106a, and miR-106b [13]. [score:3]
miR-20a does not affect the expression of signaling molecules and CD3 and CD28 receptors. [score:3]
Suppression of miR-20a. [score:3]
Therefore, we favor the hypothesis that miR-20a is not involved in the regulation of T-cell proliferation but rather in the cytokine production in CD4 [+] T cells. [score:2]
Collectively, these data indicate that miR-20a regulates TCR -mediated signaling at the level of Zap-70 activation. [score:2]
Collectively, we have demonstrated that miR-20a alone plays a role in the regulation of TCR signaling strength and in cytokine production of CD4 [+] T cells. [score:2]
miR-20a negatively regulates TCR -mediated signaling. [score:2]
Graphs in (A) show relative cytokine levels from miR-20a overexpressing cells compared to miR-control. [score:2]
FACS analyses revealed that miR-20a overexpression does not change the densities of CD3 and CD28 on the cell surface compared to control (Fig 3B). [score:2]
Thus, our data suggest that miR-20a alone is a regulator of cytokine production in naïve CD4 [+] human T cells and hence may play an important role in the homeostasis of the adaptive immune system. [score:2]
Moreover, these observations also corroborate previous data showing that miR-19b, but not miR-20a, regulates mouse CD4 [+] T-cell proliferation upon antigen stimulation [19]. [score:2]
As shown in Fig 1C, transcription of miR-20a was inhibited about 50% and 85% upon treatment with IKK VII and U0126, respectively, compared to control cells treated with DMSO alone. [score:2]
Thus, these data corroborate the idea that miR-20a is involved in the regulation of early transcriptional events during the activation of T cells [20], but it appears to be dispensable for T-cell proliferation. [score:2]
As shown in Fig 2E and 2F, we observed a slight dicrease in the recruitment of ZAP70 to CD3ζ upon miR-20a overexpression compared to miR-control. [score:2]
miR-20a regulates cytokine production. [score:2]
How miR-20a regulates interleukin production is not yet clear. [score:2]
TCR -mediated transactivation of miR-20a depends on Erk, Ca [++] and NF-κBSignals transduced via the TCR result in the activation of AP1, NF-κB and NFAT, three key transcription factors required for the induction of crucial genes (e. g. IL-2) and hence for T-cell proliferation. [score:1]
Therefore, we suspect that miR-20a may limit the recruitment of inflammatory cells at the site of inflammation. [score:1]
Collectively, our data indicate that miR-20a play an important role in cytokine production in CD4 [+] T cells. [score:1]
These data indicate that miR-20a is rapidly synthesized upon T-cell activation and suggest that it may play a role in early activation events. [score:1]
Collectively, these results suggest that miR-20a transcription strongly depends on Ca [++] flux, and Erk signaling and to a lesser extent on NF-κB activity. [score:1]
In fact, it has been shown that miR-20a represses transcriptional activation in the Jurkat T-cell line and was found to be decreased in multiple sclerosis patients’ whole blood samples [20]. [score:1]
These data corroborate previous observations suggesting that miR-17 and miR-20a repress transcriptional activation in the Jurkat T-cell line [20]. [score:1]
Quantification of miR-20a in both resting and activated cells was performed using real-time PCR. [score:1]
Human naïve CD4 [+] T cells were transfected with plasmids encoding either miR-20a or miR-control (miR-Ctrl) and cultered for 16 hours. [score:1]
The pre-miR-20a sequence was derived from the miRBase database (http://microrna. [score:1]
To investigate whether these signaling pathways are also involved in the transactivation of miR-20a in response to TCR stimulation, we measured the levels of miR-20a precursors in activated CD4 [+] T-cells in the presence or absence of U0126, IKK VII, and EGTA which selectively inhibit the activation of Erk, NF-κB, and inhibit Ca [++] flux, respectively. [score:1]
To investigate whether miRNA-20a is de novo transcribed upon TCR stimulation, we analyzed the expression of miRNA-20a precursors (both pri- and pre-miRNAs). [score:1]
When we assessed TCR -mediated signaling, we observed an increase in the phosphorylation of different signaling molecules upon treatment with miR-20a decoy (Fig 4B and 4C). [score:1]
The following decoys were used; miR-20a Decoy: 5’-CTAAACACTACCTGCACTATAAGCACTTTAGTGCTAC-3’; Scramble decoy: 5’-GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGAC-3’. [score:1]
Indeed, it has been shown that miR-20a functionally overlaps with miR-17, miR-106a, or miR-106b in macrophages, myeloid, and neuronal cells [33– 36]. [score:1]
0125311.g004 Fig 4Human naïve CD4 [+] T cells were transfected with miR-20a or scramble decoys. [score:1]
0125311.g003 Fig 3 (A) Lysates from T cells transfected with either miR-20a or miR-control were prepared and analyzed by immunoblotting using the indicated Abs. [score:1]
This cluster comprises six miRNAs: miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a [13]. [score:1]
To investigate whether miR-20a is involved in human naïve CD4 [+] T-cell activation, we first determined the expression pattern of miR-20a upon TCR triggering. [score:1]
The pre-miR-20a sequence additionally includes overhangs for cloning into the pcDNA 6.2-GW/EmGFP-miR vector (Invitrogen). [score:1]
0125311.g002 Fig 2Human naïve CD4 [+] T cells were transfected with plasmids encoding either miR-20a or miR-control (miR-Ctrl) and cultered for 16 hours. [score:1]
We next assessed whether, miR-20a affects the activation of signaling molecules upstream of Zap-70. [score:1]
Under non-polarizing conditions, we observed that miR-20a moderately decreased the production of IL-8, which is known as chemotactic factor [41, 42]. [score:1]
TCR -mediated transactivation of miR-20a depends on Erk, Ca [++] and NF-κB. [score:1]
Expression of miR-20a precursors was investigated as described above. [score:1]
0125311.g006 Fig 6Human naïve CD4 [+] T cells were transfected with plasmids encoding either miR-20a or miR-control (miR-Ctrl). [score:1]
Quantification of (A) miR-20a and (B) miR-20a precursors (both pri- and pre-miRNAs) was performed using RT qPCR. [score:1]
Freshly purified naïve CD4 [+] T cells were transfected with plasmid encoding either miR-20a or miR-control. [score:1]
Human naïve CD4 [+] T cells were transfected with miR-20a or scramble decoys. [score:1]
1 x 10 [6] human naïve CD4 [+] T cells were transfected with 1 μM of either miR-20a decoy or scramble control using Genepulser Xcell (BIO-RAD), rested for 16h in 6-well culture plates containing RPMI 1640 medium (Biochrome) supplemented with 10% FCS and 2 μg/mL Ciprobay before use. [score:1]
Human naïve CD4 [+] T cells were transfected with plasmids encoding either miR-20a or miR-control (miR-Ctrl). [score:1]
[1 to 20 of 116 sentences]
4
[+] score: 272
Other miRNAs from this paper: hsa-mir-17, hsa-mir-20b
miR-20a suppresses autophagy and lysosomal activity through downregulating the expression of ATG16L1, BECN1 and SQSTM1. [score:8]
Studies herein show that miR-20a inhibits basal and nutrient starvation -induced autophagic flux and lysosomal proteolytic activity, increases cellular reactive oxygen species (ROS) levels and DNA damage response by downregulating several key regulators of autophagy, including BECN1, ATG16L1 and SQSTM1. [score:7]
Upregulation of miR-20a strongly associates with downregulation of BECN1, SQSTM1 and ATG16L1 in human breast cancers, especially in triple -negative subtypes. [score:7]
Enrichment analysis of gene expression profiles revealed that expression of certain components of the autophagy/lysosome pathways correlate with lower expression of miR-20a (Figure 1c). [score:7]
We used TargetScan, an miRNA target prediction algorithm, to discover the downstream targets of miR-20a in the autophagy pathway. [score:7]
LNA -modified miR-20a inhibitor (LNA-20a) efficiently suppressed endogenous miR-20 expression (Supplementary Figure S3c). [score:7]
Upregulation of miR-20a associates with low expression of BECN1, ATG16L1 and SQSTM1 in breast cancer tissues. [score:6]
[40] A recent study report that both two members of the miR-17/92 cluster, miR-20a and miR-17, target the TP53-activating kinase DAPK3, which leads to inactivation of TP53 and upregulation of the miR-17/92 cluster. [score:6]
A significant upregulation of miR-20a expression was observed in ER -negative or PR -negative tumors (Supplementary Figure S1). [score:6]
We were also interested to know whether knockdown of endogenous miR-20a would affect target genes expression. [score:6]
Next, we employed luciferase assay to examine whether miR-20a directly regulates target genes expression. [score:6]
31, 32 Immunoblotting revealed that starvation -induced LC3-II turnover was inhibited by bafilomycin A1 (Baf A1) or hydroxychloroquine (HCQ), miR-20a inhibits basal level and starvation -induced LC3-II turnover (Figure 3a and Supplementary Figure S5). [score:5]
29, 30 Here, we analyzed miR-20a expression from TCGA miRNA-seq data set; miR-20a expression was markedly higher in breast cancer tissues (Figure 1a). [score:5]
Stable transfection of miR-20a markedly suppressed mRNA and protein expression of ATG16L1, SQSTM1 and BECN1 in MDA-MB-231 cells. [score:5]
The correlation of miR-20a and target gene expression was examined by Spearman correlation test. [score:5]
To explore the physiological relevance of the above findings, we inhibited endogenous miR-20a expression by LNA-20a. [score:5]
Immunoblotting revealed that miR-20a suppressed BECN1, ATG16L1 and SQSTM1 protein expression in both cells (Figures 2b and d and Supplementary Figure S4). [score:5]
miR-20a stable transfection also led to reduced LC3-II level and increased OPTN expression, indicating that miR-20a inhibits autophagic flux (Supplementary Figure S7). [score:5]
[49] In line with this report, we demonstrate that miR-20a directly targets BECN1, SQSTM1 and ATG16L1. [score:4]
Because we have shown that miR-20a directly targets SQSTM1, we used OPTN (Optic neuropathy-inducing protein, Optineurin), a most recently identified selective autophagy substrate, to determine autophagic flux. [score:4]
A significant upregulation of miR-20a is observed in breast cancer, especially in triple -negative breast cancer. [score:4]
We examined whether knockdown of miR-20a targets phenocopy the effect of miR-20a on DNA damage and ROS. [score:4]
We also disrupted the putative miR-20a paring sites in the 3′-UTRs by site-directed mutagenesis, the mutated reporters (Mut) restored miR-20a -induced inhibition of luciferase activity (Figure 2e). [score:4]
Therefore, in addition to the monoallelic loss of BECN1 in breast cancer, miR-20a -mediated downregulation of autophagy pathway might be another mechanism that promotes malignant transformation. [score:4]
Comparison of miR-20a levels between triple -negative breast cancers (n=82) and other subtypes (n=391) revealed that miR-20a is upregulated in triple -negative subtype (Figure 1b). [score:4]
In TCGA data set, breast cancer patients with higher levels of miR-20a show higher frequency of copy-number alterations and DNA mutations than cancer patients with lower miR-20a expression (Figure 8a), indicating that miR-20a promotes DNA damage response and increases genomic instability. [score:4]
Upregulation of miR-20a in human breast cancer. [score:4]
Both immunoblotting and DQ Red BSA fluorescence assay showed that overexpression of BECN1, SQSTM1 or ATG16L1 construct was sufficient to rescue miR-20a -induced inhibition of autophagy and lysosomal proteolytic pathway (Figures 5h and j). [score:4]
[30] Here, we analyzed TCGA miRNA-seq data set, upregulation of miR-20a was observed in breast cancer, especially in triple -negative subtype. [score:4]
We identified miR-20a expression signature predictive of estrogen receptor (ER), progesterone receptor (PR) or human epidermal growth factor receptor 2 (HER2). [score:3]
44, 45, 46 Our results show that miR-20a inhibits nutrient starvation -induced autophagic flux. [score:3]
[33] Nutrient starvation destabilized endogenous OPTN protein, overexpression of miR-20a caused OPTN accumulation, especially in nutrient-starved cells (Figure 3b). [score:3]
[41] Several studies demonstrate that miR-20a promotes proliferation, sustains cell survival and increases angiogenesis by targeting a number of genes, including the E2F family members. [score:3]
miR-20a inhibits autophagic flux and lysosomal proteolytic activity. [score:3]
28, 42, 43 However, in some circumstances, which depends on the physiological context and the cell type, miR-20a plays tumor suppressive function. [score:3]
Overexpression of miR-20a markedly reduced the transcript abundance of BECN1, ATG16L1 and SQSTM1 in both MDA-MB-231 and MCF7 cells (Figures 2a and c). [score:3]
miR-20a expression correlates negatively with that of BECN1, ATG16L1 or SQSTM1 in breast cancer (Figure 7a). [score:3]
The expression level of miR-20a was used as a phenotype label to identify biological processes and signaling pathways associate with it. [score:3]
To investigate the role of miR-20a in tumorigenesis, we generated MDA-MB-231 cell lines stably expressing NC or miR-20a through the lentivirus expression system. [score:3]
miR-20a attenuated LC3-II protein expression in both cells, especially in MCF7 cells presumably because MCF7 cells have higher levels of miR-20a after transfection (Figure 1e). [score:3]
Because BECN1, ATG16L1 and SQSTM1 are key autophagy regulators, we propose that miR-20a may negatively regulate the autophagy/lysosome pathway. [score:3]
[7]We also observed whether re-introduction of exogenous BECN1, SQSTM1 or ATG16L1 could provide resistance to miR-20a -mediated autophagy inhibition and prevents DNA damage. [score:3]
Tumor volume was also significantly larger in mice that were injected with miR-20a -expressing cells (Figure 8c). [score:3]
Overexpression of miR-20a caused distinct γH2AX foci formation in MCF7 cells (Figure 5a). [score:3]
Evidence from the above-mentioned in vitro experiments indicates that miR-20a suppresses autophagy pathway, induces ROS and DNA damage response. [score:3]
28, 29 We examined the expression patterns of miR-20a, a member of the miR-17/92 cluster, from TCGA breast cancer data set. [score:3]
showed MDA-MB-231 cells expressed much higher levels of endogenous miR-20a than MCF7 cells, but much lower amounts of miR-20a after transfection, indicating MCF7 cells have much better transfection efficiency than MDA-MB-231 cells (Supplementary Figures S3a and b). [score:3]
Consistent with the TCGA miRNA-seq data set analysis, miR-20a expression was markedly higher in tumor tissues (Figures 6a and b). [score:3]
miR-20a promotes tumorigenesis in vivoTo investigate the role of miR-20a in tumorigenesis, we generated MDA-MB-231 cell lines stably expressing NC or miR-20a through the lentivirus expression system. [score:3]
[34] Nutrient starvation increased red and yellow LC3 dots per cell; miR-20a -transfected cells showed decreased number of autophgosomes and autolysosomes in nutrient-starved cells, indicating that miR-20a inhibits starvation -induced autophagic flux (Figures 3c and d). [score:3]
[7] We also observed whether re-introduction of exogenous BECN1, SQSTM1 or ATG16L1 could provide resistance to miR-20a -mediated autophagy inhibition and prevents DNA damage. [score:3]
To further define the clinical relevance of our findings, we examined miR-20a expression in normal mammary tissues (n=30) and breast cancer tissues (n=30) by in situ hybridization. [score:3]
Nude mice injected with the miR-20a -expressing cells produced more tumors than the mice that were injected with the control cells (Figure 8b). [score:3]
51, 52 The expression levels of miR-20a were used as phenotype label, and ‘Metric for ranking genes’ was set to Pearson Correlation. [score:3]
[50] Interestingly, Gene Set Enrichment Analysis analysis indicate that high expression miR-20a is associated with reduction in the levels of proteins involved in DNA repair pathways (data not shown). [score:3]
Immunohistochemistry showed low levels of miR-20a targets (BECN1, ATG16L1 and SQSTM1) in tumor tissues. [score:3]
miR-20a targets several genes related to autophagy. [score:3]
These results demonstrate that endogenous miR-20a negatively regulates autophagic flux and lysosomal proteolytic activity. [score:2]
A large fraction of copy-number-altered genome and DNA mutations are also detected in breast cancer patients with elevated levels of miR-20a. [score:2]
To ablate the miR-20 bindings sites, we used site-directed mutagenesis kit (Takara, Kusatsu, Japan) to generate mutated vectors (Mut). [score:2]
Thus, we propose that in cancers with higher miR-20a, there is parallel inactivation of autophagy and impairment of DNA repair; this may impair the ability of the cells to adapt to environmental stress, which may subsequently enable gene amplification, mutation and accumulation of DNA damage, thereby promoting genomic instability and cancer progression. [score:2]
miR-20a increases genomic instability and DNA mutation frequency. [score:2]
Next, we determined whether knockdown of endogenous miR-20a would affect autophagic flux and lysosomal proteolytic activity. [score:2]
In line with this observation, immunoblotting revealed that miR-20a markedly increased the levels of γH2AX under normal and nutrient-starved conditions, whereas knocking down of endogenous miR-20a showed the opposite effect (Figure 5b). [score:2]
MCF cells were transfected with NC or miR-20a, cultured in normal medium or EBSS for 24 h. Cells suspension was mixed with low melting agarose (AB0015, Life Technologies, Carlsbad, CA, USA) and plated onto comet slide to perform single-cell gel electrophoresis. [score:1]
and quantification of the tail moment (TM) confirmed that DNA damage was much more pronounced in miR-20a -transfected cells under nutrient starvation (Figure 5c). [score:1]
These results suggest that miR-20a promotes tumor initiation and progression in vivo. [score:1]
miR-20a induces DNA damage response and ROS under nutrient starvation. [score:1]
Reduction of lysosomal proteolytic activity was more pronounced in MCF7 cells because MCF7 cells had higher amounts of miR-20a after transfection (Figures 3e and f). [score:1]
miR-20a promotes tumorigenesis in vivo. [score:1]
These results demonstrate that miR-20a might be a potential diagnostic marker to distinguish triple -negative breast cancer from other subtypes. [score:1]
Gene Set Enrichment Analysis (GESA) suggests that miR-20a negatively correlates with the autophagy/lysosome pathway. [score:1]
miR-20a and LC3 plasmids (GFP-LC3 or mCherry-GFP-LC3) were co -transfected into MDA-MB-231 or MCF7 cells. [score:1]
MCF7 cells were transfected with luciferase vectors and miR-20a or NC using Lipofectamine 2000 (Invitrogen). [score:1]
miR-20a significantly reduced GFP-LC3 puncta formation in nutrient-starved cells. [score:1]
Additionally, miR-20a -induced γH2AX accumulation was markedly reduced by exogenous BECN1, SQSTM1 or ATG16L1 in nutrient-starved cells (Figures 5h and i). [score:1]
miR-20a also increased intracellular ROS levels in control and starved cells (Figure 5d). [score:1]
The staining intensity of miR-20a was determined using a visual grading system. [score:1]
[15] To make the connection between miR-20a and the autophagy/lysosome pathway at a molecular level, we performed Gene Set Enrichment Analysis. [score:1]
Integrative analysis reveals negative correlation between miR-20a and autophagy/lysosome pathway. [score:1]
Collectively, our results suggest that miR-20a -mediated dysfunction of autophagy contributes to mammary tumorigenesis by promoting genomic damage and instability. [score:1]
In the presence of miR-20a, the relative luciferase activities for BECN1, SQSTM1 or ATG16L1 wild-type constructs were reduced by 47%, 28% and 39%, respectively. [score:1]
miR-20a or NC was transfected into MDA-MB-231 cells by lentivirus infection. [score:1]
Blockage of endogenous miR-20a leads to increased autophagic flux. [score:1]
Gene Set Enrichment Analysis (version 2.0) was used to investigate the biological processes that correlate with miR-20a expression in breast cancer as described in the references. [score:1]
For in situ detection of miR-20a, the slides were hybridized with DIG-labeled oligonucleotide (Exiqon) complementary to miR-20a. [score:1]
[1 to 20 of 86 sentences]
5
[+] score: 230
The miR-20a-5p expression levels in SJSA-1 cells compared with G-292 cells (summarized in Table a) were analyzed by miR-seq and qRT-PCR analyses in plot b. The expression level of KIF26B is higher in SJSA-1 cells than in G-292 cells, as summarized in Table c. Western blot and qRT-PCR analyses are shown in plots d and e, respectively To examine the effects of miR-20a-5p on the expression of its targets in OS, we measured the RNA and protein levels of putative miR-20a-5p target genes, which were chosen by TargetScan (http://www. [score:10]
miR-20a-5p expression has been shown to correlate with the development and progression of diverse cancer types [26– 36]; for example, miR-20a-5p can be downregulated by glioblastoma hypoxia [31], which often promotes radioresistance and chemoresistance in cancer cells. [score:7]
In conclusion, this study is the first to illustrate that miR-20a-5p can regulate OS multi-drug resistance through its direct target gene KIF26B by targeting it in a classical 3′-UTR binding fashion. [score:7]
The current study is the first to demonstrate that KIF26B mRNA and protein expression is upregulated in OS cells because of hypermethylation of its upstream regulator miR-20a. [score:7]
Chemically modified mimic oligonucleotides (agomir) were synthesized to upregulate miR-20a-5p expression in vivo. [score:6]
To profile miRNA expression in the G-292 and SJSA-1 OS cell lines, we performed RNA-seq -based miR-omic analysis and referred to the relevant literature, and miR-20a-5p was selected as one of the studied target genes. [score:5]
The siRNA sequences used to produce KIF26B interference in this study were as follows: si-KIF26B: 5′-CGGACAGCCUCUCCUAUUAdTdT-3′ 3′-dTdTGCCUGUCGGAGAGGAUAAU-5′ hsa-miR-20a-5p antagomir: 5′-CUACCUGCACUAUAAGCACUUUA-3′ mimic: sense 5′-UAAAGUGCUUAUAGUGCAGGUAG-3′ antisense 5′-CUACCUGCACUAUAAGCACUUUA-3′ A full-length human KIF26B 3′-untranslated region (UTR, 520 bp) and wild-type (WT) and mutant (Mut) target sequences for miR-20a-5p were cloned on either side of the 3′-region of the luciferase coding sequence in the pmiR-RB-REPORT™ vector to construct the pmiR-RB-REPORT™-KIF26B vector. [score:5]
Western blot results showed that KIF26B expression was suppressed by transfection of the miR-20a-5p mimic in SJSA-1 cells (~28 %) and enhanced in antagomir -transfected G-292 cells (~3.15-fold) (Fig.   3a–e) relative to the negative control. [score:5]
The results showed that transfection with the miR-20a-5p mimic reduced the KIF26B level to 36 % of that found in the NC and that KIF26B siRNA inhibited KIF26B protein expression to approximately 40 % of the NC control (Fig.   4a). [score:5]
The siRNA sequences used to produce KIF26B interference in this study were as follows: si-KIF26B: 5′-CGGACAGCCUCUCCUAUUAdTdT-3′ 3′-dTdTGCCUGUCGGAGAGGAUAAU-5′ hsa-miR-20a-5p antagomir: 5′-CUACCUGCACUAUAAGCACUUUA-3′ mimic: sense 5′-UAAAGUGCUUAUAGUGCAGGUAG-3′ antisense 5′-CUACCUGCACUAUAAGCACUUUA-3′ A full-length human KIF26B 3′-untranslated region (UTR, 520 bp) and wild-type (WT) and mutant (Mut) target sequences for miR-20a-5p were cloned on either side of the 3′-region of the luciferase coding sequence in the pmiR-RB-REPORT™ vector to construct the pmiR-RB-REPORT™-KIF26B vector. [score:5]
We provide experimental evidence that miR-20a-5p repression of the direct target kinesin family member 26B (KIF26B), a member of the kinesin family that can attach to and move along microtubules to transport cellular cargoes, improved the chemosensitivity of OS cells to multiple drugs, including doxorubicin (Dox), etoposide (Etop), methotrexate (MTX), cisplatin (CDDP) and carboplatin (Carb). [score:4]
Expression of the DNA methylation-regulated miR-20a gene positively correlates with the multi-chemoresistance of OS cells. [score:4]
c, d The effects of the forced expression of miR-20a-5p or knockdown of KIF26B on the cell cycle distribution of SJSA-1 cells shown by FACS analysis in plot and in the original To further explore the mechanism underlying OS chemoresistance, we detected the activities of the following seventeen signaling pathways using Qiagen pathway reporter systems in both SJSA-1 and G-292 cells: oxidative stress, DNA damage, NF-κB, hypoxia, ER stress, heavy metal stress, heat shock, glucocorticoid, JNK, xenobiotic, Wnt, Notch, TGF-β, cell cycle/pRb-E2F, Myc/Max, and MAPK/ERK (Fig.   6a). [score:4]
The results showed that miR-20a-5p directly targeted kinesin family member 26B (KIF26B) in OS cells. [score:4]
a, b The effects of forced expression of miR-20a-5p and knockdown of KIF26B on the apoptosis of SJSA-1 cells shown by FACS analysis in table and in the original. [score:4]
MiR-20a-5p specifically suppresses KIF26B expression in OS cells. [score:4]
Overexpression of KIF26B modulates multi-drug resistance effects similar to miR-20a-5p knockdown in OS cells. [score:4]
Fig.  3KIF26B is a direct target of miR-20a-5p in OS cells. [score:4]
In this study, we demonstrated that the expression level of miR-20a-5p varies in OS cells with different levels of chemosensitivity, suggesting that miR-20a-5p might participate in the regulation of OS chemoresistance. [score:4]
e (*p < 0.05; **p < 0.01)Additionally, the miR-20a-5p mimic mediated KIF26B downregulation in SJSA-1 cells and increased the percentage of apoptotic cells from 1.29 to 5.01 %. [score:4]
The RT-PCR validation also confirmed that miR-20a-5p was significantly more highly expressed in the G-292 than the SJSA-1 cell line (by more than eightfold), suggesting that this miR might be involved in regulating the multi-drug resistance of OS cells. [score:4]
In conclusion, the KIF26B gene was shown to be a novel direct target of miR-20a-5p in OS cells and might contribute to miR-20a-5p -mediated multi-drug resistance in OS cells. [score:4]
e (*p < 0.05; **p < 0.01) Additionally, the miR-20a-5p mimic mediated KIF26B downregulation in SJSA-1 cells and increased the percentage of apoptotic cells from 1.29 to 5.01 %. [score:4]
In this study, we report that miR-20a-5p was downregulated in a multi-drug-resistant (MDR) human OS cell line (SJSA-1) and describe the mechanism of OS chemoresistance mediated by miR-20a-5p. [score:4]
The methylation ratio of the miR-20a gene in SJSA-1 cells in most CpG islands is much higher than the ratio in G-292 cells, as high as approximately 10-fold on average (51.53:5.67, Fig.   1c, d), indicating that miR-20a methylation is negatively correlated with miR-20a-5p expression (Fig.   2a, b). [score:3]
We found that miR-20a-5p was more highly expressed in G-292 cells than in SJSA-1 cells. [score:3]
The association data include protein, DNA and genetic interactions and pathways; gene and protein expression data; phenotypic screens and shared protein domains Further confirmation of the role of miR-20a-5p in OS cell resistance to Dox was obtained by immuno-histological analysis of KIF26B and Ki67 in tumor sections of Dox -treated versus PBS -treated mice. [score:3]
One of miR-20a-5p’s targets, kinesin family member 26B (KIF26B), was found to mediate the miR-20a-5p -induced reduction in OS chemoresistance by modulating the activities of the MAPK/ERK and cAMP/PKA signaling pathways. [score:3]
Because of its repressive effect on KIF26B and other downstream effects on two signaling pathways, decreasing miR-20a-5p expression promotes OS multi-drug resistance (at least for Dox, Etop and Carb, which were studied in this report) both in vitro and in vivo. [score:3]
To the best of our knowledge, this study provides the first evidence of the potential utility of miR-20a-5p as an important target for developing novel OS chemotherapeutics. [score:3]
d Methylation percentage at each CpG site in the SJSA-1 and G-292 cells Fig.  2Different expression patterns of miR-20a-5p/KIF26B in SJSA-1 and G-292 cells. [score:3]
Forced expression of miR-20a-5p counteracted OS cell chemoresistance in both cell culture and tumor xenografts in nude mice. [score:3]
Among these genes, the expression of kinesin family member 26B (KIF26B), which has a binding site for miR-20a-5p in the 3′-UTR of its mRNA, was opposite to that of miR-20a-5p at both the RNA (Fig.   2c, d) and protein levels (Fig.   2e) in G-292 and SJSA-1 cells. [score:3]
Moreover, we bioinformatically identified key links that connect miR-20a-5p to two signaling pathways via its target gene KIF26B, through which a chemoresistant phenotype is produced in OS cells. [score:3]
These results indicated that miR-20a-5p compromised the tumor -inhibition capability of Dox. [score:3]
Our data suggested that the miR-20a-5p level might serve as a potential biomarker of chemotherapy-resistant OS and that miR-20a-5p overexpression might aid in overcoming OS drug resistance. [score:3]
The levels of miR-20a-5p and KIF26B mRNA expression were determined by quantitative real-time PCR. [score:3]
f Layout of the luciferase reporter plasmid and the sequence of the WT and Mut UTR region of the KIF26B gene targeted by miR-20a-5p. [score:3]
The association data include protein, DNA and genetic interactions and pathways; gene and protein expression data; phenotypic screens and shared protein domainsFurther confirmation of the role of miR-20a-5p in OS cell resistance to Dox was obtained by immuno-histological analysis of KIF26B and Ki67 in tumor sections of Dox -treated versus PBS -treated mice. [score:3]
All of these observations suggest that KIF26B acts as a downstream target of miR-20a-5p and mediates chemoresistance against Dox, Etop, MTX, CDDP and Carb in OS cells. [score:3]
Fig.  4Effects of forced alteration of miR-20a-5p or KIF26B expression on chemoresistance in SJSA-1 and G-292 cells. [score:3]
Therefore, miR-20a-5p is capable of inhibiting in vivo tumor growth. [score:3]
This result indicated that low levels of miR-20a-5p promoted OS cell survival probably by increasing KIF26B expression. [score:3]
In conclusion, both the DNA methylation and gene expression levels of miR-20a-5p are tightly correlated with multi-drug resistance in OS cells. [score:3]
Expression of the miR-20a gene was negatively controlled by DNA methylation. [score:3]
To explore how miR-20a-5p affects chemoresistance regulation in OS, a luciferase reporter assay was performed to identify potential target genes of miR-20a-5p. [score:3]
KIF26B expression decreases in miR-20a-5p agomiR -injected SJSA-1 tumor xenografts and increases in antagomir -injected G-292 tumor xenografts in nude mice. [score:3]
Fig.  6Signaling pathways regulated by miR-20a-5p and KIF26B. [score:2]
Our findings suggest that miR-20a-5p may function as a potential biological molecule for preventing chemoresistance of OS, which may lead to additional new diagnostic and therapeutic approaches for OS and provide new insights into the posttranscriptional regulation of KIF26B. [score:2]
Furthermore, to assess whether miR-20a-5p directly alters the expression of KIF26B in the above OS cell lines, we measured KIF26B levels in OS cell lines that were transfected with either a miR-20a-5p mimic (SJSA-1) or an antagomir (G-292). [score:2]
Error bars represent the s. e. m. **p < 0.01 by Student’s t-testTo confirm KIF26B as a real miR-20a-5p target, the WT or Mut 3′-UTR region (520 bp) of KIF26B was inserted downstream of the luciferase gene in the pmiR-RB-REPORT™ vector (Guangzhou RiboBio, China) to create the pmiR-RB-REPORT™-UTR WT and Mut, respectively (Fig.   3f), and assayed in SJSA-1 and G-292 cell lines to determine the functional status of miR-20a-5p in OS cells. [score:2]
c Relative activities of the 6 pathways regulated by miR-20a-5p in OS cells. [score:2]
To further demonstrate that miR-20a-5p modulates multi-drug resistance by repressing KIF26B expression in OS cells, we compared drug-triggered cell death in SJSA-1 cells transfected with miR-20a-5p mimic or KIF26B siRNA. [score:2]
Furthermore, FACS analysis of the cell cycle in SJSA-1 cells showed that the percentage of S stage cells significantly decreased after miR-20a-5p mimic transfection or KIF26B knockdown (Fig. 5c, d). [score:2]
Error bars represent the s. e. m. **p < 0.01 by Student’s t-test To confirm KIF26B as a real miR-20a-5p target, the WT or Mut 3′-UTR region (520 bp) of KIF26B was inserted downstream of the luciferase gene in the pmiR-RB-REPORT™ vector (Guangzhou RiboBio, China) to create the pmiR-RB-REPORT™-UTR WT and Mut, respectively (Fig.   3f), and assayed in SJSA-1 and G-292 cell lines to determine the functional status of miR-20a-5p in OS cells. [score:2]
Expression levels of miR-20a-5p (a, b) and KIF26B mRNA (d, e) and protein (c) in miR-20a-5p mimic (5PM) -transfected SJSA-1 cells and miR-20a-5p antagomir (5PA) -transfected G-292 cells compared with the negative control (NC) as determined by qRT-PCR and Western blot analyses. [score:2]
More importantly, we found that miR-20a-5p/KIF26B promoted multi-drug resistance in OS cells by regulating MAPK/ERK and cAMP/PKA signaling pathway activities. [score:2]
In this investigation, we tested the impact of differential expression of miR-20a-5p on cell death in OS cells triggered by commonly used therapeutics. [score:1]
Furthermore, of these six pathways, MAPK/ERK, ATF2/ATF3/ATF4, and cAMP/PKA signaling pathway activity increased in miR-20a-5p mimic -transfected SJSA-1 cells and decreased in antagomir -transfected G-292 cells (Fig.   6b, c). [score:1]
g– i, The relative luciferase activity (fold change) of the reporter with WT or Mut KIF26B-UTR or with no UTR (Vec) was determined in the miR-20a-5p mimic (in SJSA-1)- or antagomir (in G292)- or Mock -transfected cells. [score:1]
MiR-20a-5p and KIF26B regulate the activities of chemoresistance -associated signaling pathways in multi-drug resistant OS cells. [score:1]
To investigate the epigenetic regulation of miR-20a-5p expression, the methylation status of the miR-20a promoter region was assessed in both the SJSA-1 and G-292 cell lines using the bisulfite sequencing PCR (BSP) assay. [score:1]
In the SJSA-1 tumor mice that received intratumoral injection of miR-20a-5p agomir, the mock tumor xenograft was lighter than the Ago-5P tumor xenograft. [score:1]
The sequences of primers and probes used for the qRT-PCR analysis were as follows: hKIF26B F: 5′-GCTGCGTGTTCTGTTTCGG-3′ hKIF26B R: 5′-TTCCTTGCGTTCGTTTATGAG-3′ hKIF26B probe: 5′-CY5-TCGGAAAGGATGATTCCATGCAGAAC-3′ hACTB F: 5′-GCCCATCTACGAGGGGTATG-3′ hACTB R: 5′-GAGGTAGTCAGTCAGGTCCCG-3′ hACTB probe: 5′-HEX-CCCCCATGCCATCCTGCGTC-3′ To detect and quantify the expression of miR-20-5p, RNA was reverse-transcribed using a Primer Set (RiboBio) and quantified using SYBR Green -based real-time PCR analysis in a FTC-3000P instrument (Funglyn Biotech Inc. [score:1]
Osteosarcoma miR-20a-5p KIF26B Multi-drug resistance Osteosarcoma (OS) is the most common primary bone malignancy in children and adolescents, up to 20–25 % of diagnosed patients present with metastasis, primarily to the lung [1]. [score:1]
Furthermore, the tumor weight of the miR-20a-5p agomir/Dox injected SJSA-1 mice was smaller than that in the miR-20aa-5p agomir/Mock counterparts, and the reverse observation was found in that of Dox -treated group of G-292 cells with and without miR-20a-5p agomir transfection (Fig.   7b–f). [score:1]
c Relative methylation levels (fold) of miR-20a in SJSA-1 and G-292 cells. [score:1]
Fig.  5Effects of forced alteration of miR-20a-5p or KIF26B levels on the cell survival of SJSA-1 cells. [score:1]
G-292-generated tumors on the left side of the backs of the nude mice were injected with 2 nM miR-20a-5p antagomir, while the right side of their backs was injected with 2 nM Mock. [score:1]
The Ct values of miR-20-5p were normalized to the Ct values of U6 RNA before quantification using the 2 [−ΔΔ]Ct method. [score:1]
The sequences of primers and probes used for the qRT-PCR analysis were as follows: hKIF26B F: 5′-GCTGCGTGTTCTGTTTCGG-3′ hKIF26B R: 5′-TTCCTTGCGTTCGTTTATGAG-3′ hKIF26B probe: 5′-CY5-TCGGAAAGGATGATTCCATGCAGAAC-3′ hACTB F: 5′-GCCCATCTACGAGGGGTATG-3′ hACTB R: 5′-GAGGTAGTCAGTCAGGTCCCG-3′ hACTB probe: 5′-HEX-CCCCCATGCCATCCTGCGTC-3′ To detect and quantify the expression of miR-20-5p, RNA was reverse-transcribed using a Primer Set (RiboBio) and quantified using SYBR Green -based real-time PCR analysis in a FTC-3000P instrument (Funglyn Biotech Inc. [score:1]
b Cell survival rate after administering IC [50] doses of drugs to SJSA-1 cells transfected with miR-20a-5p mimic (3PM) or KIF26B siRNA relative to the negative control (NC). [score:1]
Intratumoral injection of the miR-20a-5p agomir/antagomir indeed led to the expected changes in KIF26B levels in tumor sections (Fig.   7g), which confirmed that miR-20a-5p has a profound negative effect on both the growth and chemoresistance of the OS cell-derived tumor xenografts in nude mice. [score:1]
Ten days after cell injection, all of the SJSA-1-derived tumors were intratumorally injected with 2 nM miR-20a-5p agomir (Ago) every 2 days, whereas G-292-derived tumors were injected with 2 nM miR-20a-5p/Mock antagomir (Anta)/PBS. [score:1]
Fig.  7The effect of miR-20a-5p on both the in vivo growth and Dox chemoresistance of SJSA-1- and G-292-derived xenografts in nude mice. [score:1]
The boxes indicate the pathways that failed to respond in an expected manner Intratumoral injection of miR-20a-5p agomir/antagomir or the scramble sequence control (Mock) or PBS into SJSA-1/G-292-derived tumors was initiated on the tenth day and repeated four times once every 2 days. [score:1]
In summary, we demonstrated that a miR-20a-5p-centered axis dictates OS multi-chemoresistance. [score:1]
After transfection with either miR-20a-5p or miR-Ctrl for 48 h, the cells were collected and fixed in 70 % cold ethanol for 24 h at 4 °C. [score:1]
From the tenth day after cell injection, all six SJSA-1-generated tumors on the left side of the backs of the nude mice were intratumorally injected with 2 nM miR-20a-5p agomir, while the right side of their backs was injected with 2 nM Mock. [score:1]
However, knowledge of the contribution of miR-20a-5p to OS chemoresistance is still limited. [score:1]
[1 to 20 of 80 sentences]
6
[+] score: 220
These data, together with those outlined above, support a mo del that: through a p53-depedent mechanism, iASPP up-regulates miR-20a expression, leading to the repression of FBXL5 and BTG3 expression, which in turn promotes EMT, cell invasion and cisplatin resistance in CC (Fig.   5e). [score:8]
The miR-20a mimics (mimic-20a) or negative control mimic (mimic-NC), anti-miR-20a inhibitor (anti-20a), negative control inhibitor (anti-NC), siRNA targeting FBXL5 (AM16708) and BTG3 (AM16708) and respective negative controls (Thermo Fisher Scientific, Waltham, MA, USA) were transfected using Lipofectamine 2000 transfection reagent (Invitrogen, CA, USA). [score:7]
d Expression of FBXL5 or BTG3 protein in CC cells after the transient knockdown or overexpression of miR-20a. [score:6]
b qPCR analysis of FBXL5 and BTG3 expression in CC cells after knockdown or overexpression of miR-20a. [score:6]
Consistent with a role of iASPP in suppressing the transcriptional functions of p53 [15], knockdown of iASPP in HeLa cells significantly increased the p53 occupancy at the miR-20a promoter, while enforced expression of iASPP in SiHa cells triggered a release of p53 from the miR-20a promoter (Fig.   2e and f). [score:6]
a Venn diagram depicting 73 genes (including FBXL5 and BTG3) that were predicted potential targets of miR-20a, and were up-regulated by anti-20a in HeLa cells. [score:6]
In CC cells, FBXL5 and BTG3 function as tumor suppressors and direct downstream targets of miR-20a, and the repression of FBXL5 and BTG3 can restore the invasive and resistant characteristics of CC cells, which was suppressed by iASPP or miR-20a depletion. [score:6]
We examined if miR-20a, which was up-regulated following iASPP overexpression, would influence metastatic phenotypes and cisplatin resistance in CC cells, and explored the possible molecular mechanisms involved. [score:6]
Given that iASPP and miR-20a expression is elevated in CC tissues [15] (Fig.   2b), we assessed whether FBXL5 and BTG3 are differentially expressed in primary CC samples using qPCR analysis. [score:5]
Upregulation of miR-20a induced EMT and the recovery of CC cell invasion and cisplatin chemoresistance that was repressed by iASPP knockdown. [score:5]
This analysis revealed that more than 1000 genes were up-regulated by miR-20a knockdown. [score:5]
Using this list, we performed online miRDB target gene prediction analysis [23], and narrowed the predicted targets of miR-20a down to 73 common genes (Fig.   4a; 1: Table S2). [score:5]
b qPCR analysis of miR-20a in HeLa cells transfected with anti-miR-20a inhibitor (anti-20a) or negative control inhibitor (anti-NC), or in SiHa cells transfected with miR-20a mimic (mimic-20a) or negative control (mimic-NC). [score:5]
d Relative miR-20a expression in CC cells after transient overexpression of p53. [score:5]
We could detect a significant positive correlation between iASPP levels and the expression of miR-20a, and a significant negative association of miR-20a and FBXL5/BTG3 mRNA expression (Fig.   5c). [score:5]
Transient transfection of iASPP expression vector in SiHa cells significantly increased miR-20a expression (Fig.   2a). [score:5]
To find potential target genes affected by miR-20a, we performed a microarray gene expression analysis in HeLa cells transfected with anti-20a. [score:5]
Moreover, we observed the inhibitory effects of ectopic p53 expression on miR-20a level by qPCR in CC cells (Fig.   2c and d). [score:5]
CCK8 assay demonstrated that overexpression of miR-20a significantly decreased the activity of cisplatin by restoring cell survival, which was suppressed by iASPP depletion (Fig.   3g). [score:4]
Furthermore, the knockdown of FBXL5 or BTG3 resulted in E-cadherin inhibition and recovery of Vimentin in iASPP- or miR-20a-silenced cells (Additional file 1: Figure S1D and not shown). [score:4]
d Immunoblot of the indicated proteins in CC cells after knockdown or overexpression of miR-20a. [score:4]
In conclusion, our data suggest that iASPP promotes EMT and confers cisplatin resistance in CC via miR-20a-FBXL5/BTG3 signaling, and blocking iASPP activity or down -regulating its expression in CC may be a novel therapeutic strategy to improve the efficacy of cisplatin, one of the most wi dely used chemotherapy agents. [score:4]
Silencing of FBXL5 and BTG3 restored cell invasion and cisplatin chemoresistance, which was suppressed by iASPP or miR-20a knockdown. [score:4]
In line with this finding, we found that, though interfering with the activity of p53, iASPP up-regulates miR-20a level in CC cells, leading to EMT features, increased cell invasion and resistance to cisplatin treatment. [score:4]
qPCR analysis of CC cell lines and immortalized normal epithelial cell line EM demonstrated the up-regulation of miR-20a in CC cells (Fig.   3a). [score:4]
f Relative invasion of indicated CC cells after overexpression or knockdown of miR-20a. [score:4]
We identified FBXL5 and BTG3 as two direct miR-20a targets. [score:4]
1: Silencing of FBXL5 and BTG3 restored the effects that was suppressed by iASPP or miR-20a knockdown. [score:4]
iASPP promotes miR-20a expression in a p53 -dependent manner. [score:3]
However, the molecular mechanism of miR-20a overexpression in CC remains unclear. [score:3]
Importantly, miR-20a expression did not alter the activity of luciferase linked to FBXL5 or BTG3 3’-UTR where the putative miR-20a binding site was mutated (Fig.   4f and g). [score:3]
Thus, the FBXL5 and BTG3 mRNA are directly regulated by miR-20a in CC cells. [score:3]
In CC cells, overexpression of miR-20a facilitates the proliferation and metastasis of CC [39]. [score:3]
Fig. 2iASPP induces miR-20a expression in a p53 -dependent manner. [score:3]
Taken together, these data indicate that FBXL5 and BTG3 serve as tumor suppressors in CC cells, and miR-20a-FBXL5/BTG3 signaling is responsible for iASPP -induced EMT and cisplatin resistance. [score:3]
a qPCR analysis of miR-20a in control or iASPP-silenced HeLa cells and in SiHa cells after transient overexpression of iASPP. [score:3]
f, g HeLa and SiHa cells were co -transfected with reporter plasmids containing the wild-type FBXL5 (f)/BTG3 (g) or a mutant FBXL5/BTG3 3’-UTR, together with a miR-20a mimic, miR-20a inhibitor or respective negative controls. [score:3]
These data indicate that iASPP may induce the expression of miR-20a via modulating p53 activity in CC cells. [score:3]
As expected, transfection with anti-20a increased FBXL5 and BTG3 protein levels in HeLa cells, however miR-20a re -expression decreased FBXL5 and BTG3 protein levels in SiHa cells (Fig.   4d). [score:3]
c Schematic representation of the 3’-UTR of FBXL5 or BTG3 with the predicted target site for miR-20a. [score:3]
As shown in Fig.   2b, miR-20a was markedly upregulated in human CC samples compared with the paired normal cervical tissues, as determined by qPCR. [score:3]
Mutations in the miR-20a seed-matching sequences were created using a quick-change site-directed mutagenesis kit (Stratagene, CA, USA). [score:3]
In this study, we showed that stable silencing of iASPP expression enhances cisplatin chemosensitivity in vivo, and miR-20a-FBXL5/BTG3 signaling is responsible for iASPP -induced EMT and cisplatin resistance. [score:3]
The expression of mRNAs and miR-20a was determined using qPCR. [score:3]
iASPP induces miR-20a expression in a p53 -dependent manner. [score:3]
We next sought to determine the role of miR-20a in regulating iASPP -induced EMT and cisplatin resistance by modulating its levels in CC cells. [score:2]
e, f ChIP-qPCR assay of p53 occupancy at the human miR-20a and p21 (as a control) loci in control or iASPP-silenced HeLa cells (e), and in SiHa cells following transient overexpression of iASPP (f). [score:2]
We found that siRNA -mediated knockdown of FBXL5 or BTG3 significantly restored the invasive abilities and reduced the anti-tumor activity of cisplatin in iASPP- or miR-20a-silenced CC cells (Fig.   4i and j; 1: Figure S1C). [score:2]
Knockdown of miR-20a also resulted in decreased invasiveness of HeLa cells (Fig.   3e). [score:2]
Furthermore, we provided the first evidence that iASPP stimulates EMT and induces cisplatin resistance in both cervical adenocarcinoma cell line HeLa and cervical squamous cell carcinoma cell line SiHa, through regulating the downstream miR-20a-FBXL5/BTG3 signaling pathway. [score:2]
Since p53 has also been shown to directly repress the oncogenic miR-17-92a cluster (comprising miR-17, miR-18a, miR-20a, miR-19a, miR-19b and miR-92a) through binding the TATA box of the miR-17-92 promoters [19], we hypothesized that, via a p53-depedent mechanism, iASPP may promote cisplatin resistance by inducting this cluster, which was shown to enhance chemoresistance in mantle cell lymphoma [22]. [score:2]
Our results validated invasion-promoting role of miR-20a in CC cells, and further emphasized the requirement of miR-20a in iASPP -induced EMT and cisplatin resistance. [score:1]
c Correlative analysis of the indicated mRNAs and miR-20a in 40 paired tumor and non-tumor tissues of CC patients. [score:1]
Indeed, stable iASPP silencing in HeLa cells resulted in a pronounced repression of miR-20a (Fig.   2a) and a moderate repression of the remaining five miRNAs (data not shown). [score:1]
miR-20a mediates iASPP -induced EMT and cisplatin resistance. [score:1]
These results indicate that iASPP prevents p53 recruitment to the miR-20a promoter, leading to the induction of miR-20a in CC cells. [score:1]
Therefore, inactivation of miR-20a might be a novel strategy for the treatment of CC. [score:1]
a Relative miR-20a expression in CC cells and normal endometrial epithelial cell EM, as measured by qPCR analysis. [score:1]
These data suggest that miR-20a is required for iASPP -induced invasion and cisplatin resistance in CC cells. [score:1]
e Schematic representation of the proposed mechanism by which iASPP promotes EMT and cisplatin resistance in CC via miR-20a-FBXL5/BTG3 signaling. [score:1]
iASPP promotes EMT and confers cisplatin resistance in CC via miR-20a-FBXL5/BTG3 signaling. [score:1]
b Relative miR-20a expression in 40 paired cancerous and normal tissue samples from CC patients, measured by qPCR analysis. [score:1]
miR-20a-FBXL5/BTG3 signaling is responsible for iASPP -induced cell invasion and cisplatin resistance. [score:1]
Consistent with these data, a negative correlation between endogenous miR-20a levels and FBXL5 and BTG3 mRNA expression was found in CC cells, as measured by qPCR (Figs.   3a and 4e). [score:1]
These results show that the iASPP-miR-20a-FBXL5/BTG3 signaling is active in primary human CCs. [score:1]
Among this cluster, miR-20a is a known oncogenic miRNA, thought be critically associated with enhanced EMT properties in colon cancer [40] and cisplatin-resistant phenotype in gastric cancer [41]. [score:1]
We identified putative binding sites for miR-20a in the 3’-UTRs of FBXL5 and BTG3 (Fig.   4c). [score:1]
[1 to 20 of 67 sentences]
7
[+] score: 128
miR-20a has been found to induce epithelial-mesenchymal transition (EMT) – a key step in cell migration and tumour metastasis-via down-regulation of E-cadherin, and up-regulation of matrix metalloproteinases [22, 23]. [score:7]
Moreover, the levels of circulating miR-20a may be influenced by other factors, including chronic diseases such as HCV -mediated liver disease [36], systemic lupus erythematosus [37] and chronic obstructive pulmonary disease (COPD) [38], as well as other malignancies [39– 46]. [score:7]
One study reported tissue miR-20a expression in colorectal adenomas, and found that expression was higher in paraffin-embedded colorectal adenoma samples (n = 7) than healthy controls (n = 9). [score:5]
We found that miR-20a expression was significantly up-regulated (fold change: 2.063 (0.910–5.418), P = 0.0065) in tumours compared to adjacent normal tissues (Table 1). [score:5]
miR-20a belongs to the miR-17/92 cluster located in the 13q31.1 region, and is up-regulated in numerous cancers, including anaplastic thyroid [5], ovarian [6], and prostate cancer [7, 8]. [score:4]
miR-20a is significantly up-regulated in primary CRC compared to their adjacent normal tissues. [score:3]
The dominant strains of bacteria in colorectal adenomas may degrade miR-20a in the bowel lumen, thus reducing miRNA expression in faecal samples. [score:3]
Amongst the 667 miRNAs we screened using a microarray reported previously [14], miR-20a was the most up-regulated miRNA in tumour specimens compared to its adjacent normal. [score:3]
Next, miR-20a expression was validated in faecal samples from a large cohort of 595 patients, including 198 with CRC, 199 with adenomas, and 198 healthy controls. [score:3]
There were no significant differences in faecal -based miR-20a expression between the groups with or without antibiotic intake (Figure 3). [score:3]
We began by using 40 paired clinical CRC tissues to validate miR-20a expression. [score:3]
Studies by other groups have also demonstrated that faecal miR-20a expression was significantly lower after curative CRC surgery, highlighting a potential role for miR-20a in surveillance of CRC recurrence [25]. [score:3]
miR-20a was selected from an expression microarray containing 667 miRNAs. [score:3]
There were no significant differences in faecal -based miR-20a expressions between the groups (Figure 3). [score:3]
miR-20a was confirmed to be more highly expressed in tumours than in their adjacent normal tissues (Table 2). [score:3]
miR-20a levels were expressed in number of copies per nanogram of extracted total RNA. [score:3]
Data from our miRNA microarray, which was previously reported [14], demonstrated that miR-20a was the one of most up-regulated miRNA in tumours compared to adjacent normal tissues. [score:3]
A review of the literature revealed no published studies on faecal miR-20a expression in patients with colorectal adenomas. [score:3]
In this study, we began by verifying miR-20a expression levels in 40 paired tissues from CRC patients. [score:3]
Using multiplex PCR techniques, which facilitates detection of multiple targets in a single PCR reaction, our previously reported faecal miRNA biomarkers [14, 15, 21] can be combined with miR-20a in a panel to increase its overall sensitivity and specificity. [score:3]
Faecal -based miR-20a expression is not associated with antibiotic intake. [score:3]
Rather unexpectedly, miR-20a expression levels were lower in adenoma than in healthy controls (p = 0.0201, AUROC = 0.41) (Figure 1). [score:3]
This may also result in lower expression levels of faecal miR-20a in colorectal adenoma patients. [score:3]
The miR-20a level was expressed as the number of copies per nanogram of extracted total RNA. [score:3]
miR-20a expression was significantly higher in the 40 CRC tumours compared to their respective adjacent normal tissues (P = 0.0065). [score:2]
miR-20a expression is elevated in colorectal carcinoma tissues compared with adjacent normal tissues. [score:2]
Each open circle represents a sample with an undetectable miR-20a level. [score:1]
We evaluated the expression levels of faecal -based miR-20a in the context of tumour location in CRC patients. [score:1]
The AUROC values of faecal -based miR-20a were 0.73 (95% CI: 0.68–0.78) in CRC, and 0.41 (95% CI: 0.35–0.47) in adenoma (Figure 1B). [score:1]
Therefore, we also looked into the effects of antibiotics on faecal -based miR-20a levels by comparing patients who took antibiotics within 30 days of the faecal sample collection and those who had not. [score:1]
Thus, miR-20a was selected for further validation in 40 paired tumour and corresponding adjacent normal tissues from CRC patients. [score:1]
Faecal -based miR-20a is not associated with the location of CRC. [score:1]
Whilst levels of faecal -based miR-20a were slightly lower in proximal CRC than distal and rectal CRC, this result was not statistically significant (Figure 2). [score:1]
The sensitivity and specificity of faecal -based miR-20a for colorectal cancer detection. [score:1]
Thus restrictions to antibiotic use prior to testing for miR-20a are not required to optimise test performance. [score:1]
Samples with no amplification of miR-20a were also included and assigned a value of “0” in the analysis, provided the sample could be amplified by another miRNA such as miR-135b [14], miR-221, or miR-18a [21]. [score:1]
miR-20a had a sensitivity of 55% and specificity of 82% for CRC detection. [score:1]
As shown in Figure 1A, miR-20a was able to discriminate between patients with CRC and healthy individuals. [score:1]
The quantitation of miR-20a was based on a standard curve plotted by known input amongst all of the miRNAs, and normalised to per nanogram of the total input RNA. [score:1]
Consequently, we assigned “0” to all Ct values larger than 48 for miR-20a. [score:1]
The use of antibiotics did not influence faecal miR-20a levels. [score:1]
No significant difference in the level of miR-20a was found between patients with proximal, distal, and rectal cancer. [score:1]
We found that miR-20a levels have comparable efficacy for the detection of proximal colon, distal colon and rectal CRC. [score:1]
Faecal -based miR-20a is a potential non-invasive marker for colorectal cancer. [score:1]
Next, we quantitated miR-20a in human faecal samples from 595 subjects, including 198 patients with CRC, 199 patients with adenoma, and 198 individuals with a normal colonoscopy (Table 1). [score:1]
Further verification of miR-20a was performed in 40 pairs of primary CRC tissues, as well as 595 faecal samples (198 CRCs, 199 adenomas, and 198 healthy controls) using TaqMan probe based quantitative Real-Time PCR (qRT-PCR). [score:1]
Thus, the purpose of this study was to evaluate the expression of miR-20a in faeces as a non-invasive CRC diagnostic biomarker. [score:1]
Tumour location does not significantly alter faecal miR-20a levels. [score:1]
Faecal -based miR-20a in combination with our previously reported faecal miRNA biomarkers miR-92a [15] or miR-135b [14] did not show a big improvement in sensitivity. [score:1]
miR-20a has also been shown to diminish cellular response to the TGF-β signalling pathway by preventing its delay of G1/S transition and promoting progression into the cell cycle [10, 22]. [score:1]
Collectively, these functional studies suggested a role for miR-20a in the pathogenesis of CRC, and supported the use of miR-20a as a non-invasive biomarker. [score:1]
We have previously investigated the expression profile of 667 mRNAs in a microarray, and reported miR-20a as a potential biomarker [14, 21]. [score:1]
The second cut-off value of 43,312 copies/ng for miR-20a (Table 3) was chosen for its high specificity of 90% enabling assessment of its performance for reference. [score:1]
Collectively, this data demonstrates the ability of miR-20a to differentiate patients with CRC from those without, supporting its use in CRC diagnostics. [score:1]
Based on standard curves plotted from known amounts of synthetic miR-20a, a technical detection limit of 6 copies for miR-20a would give an approximate Ct value of 48. [score:1]
Thus far, our results suggest that faecal -based miR-20a is a potential non-invasive biomarker for CRC detection. [score:1]
Levels of miR-20a were also significantly higher in faecal samples from CRC patients (P < 0.0001). [score:1]
Further research is needed to evaluate the relationship between the gut flora and expression of miR-20a in patients with colorectal adenomas. [score:1]
We believe that the higher specificity of faecal miR-20a makes it a better choice for CRC diagnosis than circulating miRNAs. [score:1]
Faecal -based miR-20a can be utilised as a potential non-invasive biomarker for CRC screening. [score:1]
In summary, our study demonstrated that faecal -based miR-20a can be utilised as a potential non-invasive biological marker. [score:1]
Its potential as a biomarker is supported by various functional studies implicating miR-20a in tumourigenesis. [score:1]
The majority of studies found that circulating miR-20a was unable to differentiate CRC patients from healthy controls in a statistically significant manner [33, 34]. [score:1]
The cut-off value of 27,493 copies/ng of extracted total faecal RNA for miR-20a was selected to maximise the sum of the sensitivity and specificity for CRC diagnosis (Table 3). [score:1]
When miR-20a is combined with miR-92a, the AUROC is 0.77 (95% CI: 0.72–0.82), with a sensitivity and specificity of 57% and 84% for CRC, respectively. [score:1]
[1 to 20 of 65 sentences]
8
[+] score: 116
Interestingly, when testing each 3 pmol of the individual inhibitors alone, only the miR-106b -inhibitor was able to strongly downregulate E2F-activity, whereas the miR-20a -inhibitor showed only moderate effects and the miR-17 -inhibitor did not affect E2F activity. [score:12]
These microRNAs are also found downregulated in XXL-USSC, as well as miR-137 and miR-214 (Fig. S2), which both target CDK6 [61], [62] In addition to miR-17 [37], miR-20a, and miR-106b (this study), miR-214 also downregulates PTEN [63]. [score:9]
In contrast to the neuronal lineage differentiations, expression of miR-17, miR-20a, and miR-106b remained unchanged or was slightly upregulated after 7 days of osteogenic differentiation. [score:6]
The inhibitor batch strongly reduced E2F-activity, whereas only miR-20a-, and miR-106b -inhibitor alone gave significant effects on E2F-activity. [score:5]
Cell-cycle related proteins predicted as targets for miR-17, miR-20a, and miR-106b and chosen for experimental target gene validation. [score:5]
Proliferation-inhibiting effects of microRNA inhibitors to miR-17, miR-20a, and miR-106b in USSC. [score:5]
Stains from time points 24 h and 48 h after transfection are shown from untransfected SA5/03, and from SA5/03 transfected with negative control mimic and the inhibitor batch, as well as with the miR-17, miR-20a, and miR-106b inhibitors alone (48 h only). [score:5]
Pickering and coworkers [31] demonstrated an appoximately 2-fold increase of E2F1 levels upon inhibition of miR-17 and miR-20a in human fibroblasts and a decrease of BrdU–positive cells upon inhibition of miR-17 and miR-20a in serum starved fibroblasts. [score:5]
MiR-17 and miR-20a belong to the medium abundant microRNAs in native USSC and they are found among the most strongly downregulated microRNAs in XXL-USSC, together with miR-106b. [score:4]
MicroRNAs miR-17, miR-20a, and miR-106b were found consistently downregulated in all USSC lines differentiated into cells of neuronal lineage. [score:4]
Despite their cell cycle relevant target proteins, miR-17, miR-20a, and miR-106b also impact neuronal lineage differentiation of USSC, since certain genes relevant for neuronal differentiation and function like NBEA, EPHA4, NTN4 and NEUROG1 are also affected by these microRNAs [55]. [score:3]
Fold expression changes (2 [−ddCt]-values) are given for microRNAs miR-17, miR-20a, and miR-106b. [score:3]
Differential expression of miR-17, miR-20a, and miR-106b in USSC differentiating in neuronal and osteogenic lineages. [score:3]
Validation of putative cell cycle relevant target genes for microRNAs miR-17 (A), miR-20a (B), and miR-106b (C) in HEK293T-cells. [score:3]
Expression data of microRNAs miR-17, miR-20a, and miR-106b and additional cell-cycle-related microRNAs are shown from native USSC as well as from days 14 and 28 (SA8/25) of differentiations. [score:3]
Figure S3 List of cell-cycle related genes predicted as targets for miR-17, miR-20a, and miR-106b. [score:3]
On the other hand, miR-106b, which shares high sequence homology with miR-17 and miR-20a, was shown to promote cell cycle progression by targeting CDKN1A (also termed p21, [39]). [score:3]
Using a retroviral overexpression approach of the miR-17-92 cluster, Yu and coworkers [38] described an anti-proliferative effect of miR-17 and miR-20a based on their interaction with CCND1-3′-UTR, whereas functional data provided in our study are in line with the earlier report of pro-proliferative effects of miR-17 [36]. [score:3]
0016138.g002 Figure 2Validation of putative cell cycle relevant target genes for microRNAs miR-17 (A), miR-20a (B), and miR-106b (C) in HEK293T-cells. [score:3]
MiR-17, miR-20a, and miR-106b have common target proteins. [score:3]
For the first time we identified CCND2, RB1, RBL1, and WEE1 as targets common to all three microRNAs and in addition found new interactions between miR-20a and -106b and CCND1, PTEN, and RBL2. [score:3]
Firefly activities were normalized to effects caused by (i) endogenous HEK293T microRNAs on the 3′UTRs cloned (miR-17, miR-20a, and miR-106b and homologs are highly expressed in HEK293T cells [52]), (ii) unspecific effects of certain microRNA -mimics on Firefly and Renilla activity per se, and (iii) transfection efficiency variations. [score:3]
Mir-17, miR-20a, and miR-106b inhibit E2F transcription factor activity. [score:3]
As seen in Figs. 2B and 2C, miR-20a and miR-106b showed highly similar behavior compared to miR-17 regarding significant Firefly activity reductions and relative influences between the analyzed target genes. [score:2]
” gives the TaqMan qPCR-assay data from osteogenic differentiations of USSC SA5/73 and SA8/25 at days 0 (native) and 7. “Deep sequencing” gives deep sequencing expression data of microRNAs miR-17, miR-20a, and miR-106b aquired from native USSC lines SA5/73, SA8/25, SA8/77, and SA4/101. [score:2]
MiR-20a also affects translation of E2F2 and E2F3 [30]. [score:2]
Normalized Firefly-activities were compared to those of pairwise co-transfections of these vectors with the microRNA mimic of interest (miR-17, miR-20a, miR-106b, also including an unspecific mimic negative control) to test for (i) unspecific effects of the given microRNA -mimic on Firefly/Renilla per se, (ii) effects of endogenous HEK293T microRNAs (iii) for validation of the particular target prediction. [score:2]
Different regulation patterns of microRNAs miR-17, miR-20a, and miR-106b during neuronal lineage and osteogenic differentiation of USSC. [score:2]
0016138.g006 Figure 6Relationships between pro-proliferative and anti-proliferative proteins involved in G [1]/S transition and miR-17, miR-20a, and miR-106b. [score:1]
Figure S1 Sequence Aligning between miR-17, miR-20a, and miR-106b. [score:1]
A batch of miR-17, miR-20a, and miR-106b increases E2F transcription factor activity in HEK293T cells. [score:1]
Proliferation-activating effect of microRNA mimics to miR-17, miR-20a, and miR-106b in USSC. [score:1]
This mo del can now be extended to miR-20a and miR-106b. [score:1]
Functional effect of miR-17, miR-20a, and miR-106b on cell cycle arrest in XXL-differentiating USSC. [score:1]
Relationships between pro-proliferative and anti-proliferative proteins involved in G [1]/S transition and miR-17, miR-20a, and miR-106b. [score:1]
[1 to 20 of 35 sentences]
9
[+] score: 113
Among these 5 miRNAs, miR-20a and miR-20b were validated as regulatory miRNAs in hypoxia -induced VEGF expression, whereas the other three could be expressed for the regulation of other genes without over-repressing VEGF expression due to competitive action. [score:9]
The expression of COX2 was down-regulated by miR-15b, miR-16, and miR-20b, and c-MET was down-regulated by all three of these miRNAs plus miR-20a. [score:9]
Co-regulatory effect of miR-15b, miR-16, miR-20a, and miR-20b on angiogenic factors in CNE cellsWhen under hypoxia stimulation, VEGF is not the only angiogenic gene up-regulated, as other angiogenic factors have been reported to be up-regulated as well [22], [23]. [score:8]
In keeping with its antagonism of Myc, HIF-1α down-regulates c-Myc-activated genes such as hTERT, BRCA1 [31], [32], and might also down-regulate miR-20a and miR-20b, since both miR-20a and miR-20b may be c-Myc-activated genes. [score:7]
MiR-20a and miR-20b may target c-MET, whereas miR-20b also targets COX2. [score:5]
Using the same transfection method, we introduced inhibitors of these miRNAs into normoxic CNE cells, which express low levels of VEGF and high levels of endogenous miR-15b, miR-16, miR-20a, and miR-20b. [score:5]
ELISA was used to detect the change in VEGF expression levels after endogenous miR-15b, miR-16, miR-20a, and miR-20b were inhibited. [score:5]
We also analyzed the effect of inhibiting endogenous miR-15b, miR-16, miR-20a, and miR-20b on VEGF expression. [score:5]
As a member of the miR-17 cluster located on chromosome 13, the expression of miR-20a is regulated by c-Myc through direct binding to the miR-17 cluster locus. [score:5]
miR-15b, miR-16, miR-20a, and miR-20b were down-regulated in hypoxia induced CNE cells (C). [score:4]
These data indicate that some of angiogenic factors expressed in CNE cells were specifically co-regulated by miR-15b, miR-16, miR-20a, and miR-20b. [score:4]
In contrast to miR-15b and miR-16, the down-regulation of miR-20a and miR-20b may be related to hypoxia inducible factor-1α (HIF-1α). [score:4]
Taken together, the down-regulation of miR-15b, miR-16, miR-20a, and miR-20b in CNE cells might be mediated by the accumulation of p53 or the stabilization of HIF-1α during hypoxia. [score:4]
Transfection with miR-15b, miR-16, miR-20a, and miR-20b, but not the negative controls, resulted in a 26–51% decrease in VEGF expression at the protein level 30h after transfection (Fig. 3A). [score:3]
CNE cells were transfected with inhibitors of miR-15b, miR-16, miR-20a, and miR-20b. [score:3]
The effect of miR-15b, miR-16, miR-20a, and miR-20b on VEGF expression was tested in CNE cells by transfection of the cells with siRNA duplexes homologous in sequence to the miRNAs. [score:3]
To investigate the putative effects of miR-15b, miR-16, miR-20a, and miR-20b, we determined the consequence of over -expressing these miRNAs on VEGF expression. [score:3]
Computational predictions indicated that miR-20a, miR-20b, miR-17-5p, miR-106a, and miR-106b had binding sites in Construct I. With slightly relaxed criteria about free energy and conservation, miR-15b, miR-16, miR-17-5p, miR-20b, and miR-107 have computationally predicted target sites in Construct II reporters (Table 4). [score:3]
Among these 54 miRNAs, miR-16, miR-20a, miR-20b, let-7b, miR-17-5p, miR-27a, miR-106a, miR-106b, miR-107, miR-193a, miR-210, miR-320, and miR-361 were predicted to target VEGF. [score:3]
Hypoxia -induced CNE cells, which expressed high levels of VEGF but lacked miR-15b, miR-16, miR-20a, and miR-20b, were transfected with synthetic miRNA duplexes of these miRNAs and a set of controls. [score:3]
0000116.g005 Figure 5(A) CNE cells were transfected or co -transfected with miR-20a and miR-106b, which share the same binding site, or with miR-20a and miR-361, which target different binding sites. [score:3]
To investigate whether different combinations of miRNAs have different contributions towards VEGF regulation, we performed co-transfection experiments using miR-20a with miR-106b, which share the same binding site, and miR-20a with miR-361, which target their own binding sites. [score:2]
Compared to single transfection with miR-20a, miR-106b, or miR-361, co-transfection of miR-20a with miR-361 exhibited additive repression on VEGF expression, suggesting a coordinate action of these miRNAs (Fig. 5A). [score:2]
In this investigation, we found that miR-15b, miR-16, miR-20a, and miR-20b are sharply down-regulated in CNE cells after hypoxia treatment. [score:2]
Co-regulatory effect of miR-15b, miR-16, miR-20a, and miR-20b on angiogenic factors in CNE cells. [score:2]
The controls consist of one positive control: VEGF-siRNA (PC), and four negative controls: miR-224, mutated miR-16, and miR-20a (miR-16M, miR-20aM), and a random sequence (NC). [score:1]
These are miR-15b, miR-16, miR-20a, and miR-20b. [score:1]
On the other hand, little difference was observed between co-transfection of cells with miR-20a and miR-106b. [score:1]
0000116.g006 Figure 6CNE cells were induced with or without DFOM (6–1), transfected with miR-15b, miR-16, miR-20a, or miR-20b (6–2) and transfected with Construct I or Construct II (6–3). [score:1]
These include one positive control, VEGF-siRNA, and four negative controls, miR-224, mutated miR-16 (miR-16M 5′-UAGCCUAACGUAAAUAUUGGCG- 3′) and miR-20a, miR-20aM 5′ -UACGUUGCUUAUAGUGCAGGUAG- 3′), and a random sequence. [score:1]
This binding site is shared by 12 different miRNAs, according to the bioinformatics prediction, but only miR-17-5p, miR-20a, miR-20b, miR-106a, and miR-106b were detected in DFOM-untreated CNE cells. [score:1]
CNE cells were induced with or without DFOM (6–1), transfected with miR-15b, miR-16, miR-20a, or miR-20b (6–2) and transfected with Construct I or Construct II (6–3). [score:1]
[1 to 20 of 32 sentences]
10
[+] score: 103
Let-7c, miR-17, miR20a, and miR-30d were the four miRNAs out of the 275 analyzed by both RT-qPCR and RNAseq that showed differential expression (p<0.05) between normal and diseased cells with the same direction in change (up- or down-regulated) by both methods. [score:9]
When comparing VICs from severely diseased valves with those from normal and mildly diseased valves, decreases in let-7c (p = 0.011 PCR, p = 0.019 RNAseq, PCR fold change (FC) = -15.7) (Fig 7a) and miR-20a (p = 0.041 PCR, p = 0.040 RNAseq, FC = -4.0) (Fig 7b) expression levels were noted. [score:7]
Both let-7c (a) and miR-20a (b) expressions were lower in VICs from severely diseased valves compared with the cells from normal or mildly diseased valves. [score:6]
Similarly, miR-20a expression was found to be downregulated in senescing human diploid fibroblasts, and it may exert its anti-senescence effects through the p21 and p16 pathways [28]. [score:6]
TGF-βR1/2 are direct targets of miR-20a and miR-17 [24, 35], and for the canine species, TGF-βR is also a predicted target for these two miRNA [20, 21]. [score:6]
PCA and HCL analyses of the four miRNAs of interest (let-7c, miR-17, miR-20a, and miR-30d) using both RT-qPCR and RNAseq data also supported the observed miRNA differences between VICs from severely diseased valves and those from normal and mildly diseased valves. [score:5]
Similar to miR-20a and miR-17, let-7c has also been found to target TGF-βR1 [23], and it was reported to be a key inhibitor for fibroblast proliferation and migration during wound healing [36]. [score:5]
Given the increase in median age for the dogs in the mildly and severely diseased group, we have also analyzed the effect of age on miRNA expression levels and did not find any age -associated change in let-7c, miR-17, miR-20a, and miR-30d. [score:5]
We have demonstrated that miRNA dysregulation (let-7c, miR-17, miR-20a, and miR-30d) may participate in canine MMVD development, and these miRNA should be explored further as potential therapeutic targets. [score:5]
In fact, the entire miR-17-92 cluster is commonly found to be downregulated in senescent cells, and decreases in both miR-20a and miR-17 have been correlated with the increase in transcription of p21 [26]. [score:4]
Downregulation of miR-20a, miR-17, and let-7c is associated with TGF-β signaling. [score:4]
In addition, miRNA profiling of VICs using both RT-qPCR and RNAseq showed decreases in expressions of let-7c, miR-17, miR-20a, and miR-30d. [score:3]
Because our candidate miRNA (let-7c, miR-17, miR-20a, and miR-30d) were deemed differentially expressed by both techniques, we believe that the probability for false positive or spurious changes is decreased, thus strengthening our findings. [score:3]
Let-7c, miR-17, miR-20a, and miR-30d were decreased in VICs of diseased valves. [score:3]
In the canine species, EGLN3 and E2F1 are predicted targets of miR-20a [20, 21]. [score:3]
The ability of miR-20a, miR-17, and let-7c to control the phenotypic transformation of VICs into myofibroblasts will need to be tested with overexpression of these three miRNAs in VICs. [score:3]
Based on the RT-qPCR and RNAseq analyses, decreases in miR-20a and miR-17 expressions were noted in VICs harvested from severely affected valves. [score:3]
Frank et al. showed that miR-20a can control apoptosis of cardiomyocytes through the inhibition of EGLN3 and E2F1 [34]. [score:3]
miR-17 and miR-20a temper an E2F1 -induced G1 checkpoint to regulate cell cycle progression. [score:2]
In this study of canine MMVD, we observed dysregulated miRNAs associated with the control of myofibroblastic differentiation, extracellular matrix (let-7c, miR-17, miR-20a), and senescence and apoptosis (miR-17, miR-20a, miR-30d) [23– 31]. [score:2]
Given that TGF-β had been implicated in MMVD in people [9], the interaction of miR-20a, miR-17, and let-7c with TGF-βR is of particular interest to myxomatous mitral valve development. [score:2]
To directly link miR-20a and miR-17 to these observations, a gain and loss of function test will need to be performed. [score:2]
The decrease in miR-20a was noted consistently in both the RT-qPCR and RNAseq analyses. [score:1]
Both miR-20a and miR-17 belong to the miR-17-92 cluster, where miR-20a and miR-17 can be grouped together as one functional unit [34]. [score:1]
Normalized RT-qPCR C [q] number and RNAseq count number for let-7c, miR-17, miR-20a, and miR-30d. [score:1]
Principal component analysis of let-7c, miR-17, miR-20a, and miR-30d using both RT-qPCR and RNAseq data. [score:1]
severe (p<0.05) cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7f, cfa-miR-127, cfa-miR-1271, cfa-miR-130a, cfa-miR-139, cfa-miR-17, cfa-miR-1836, cfa-miR-1837, cfa-miR-20a, cfa-miR-23a, cfa-miR-25, cfa-miR-26a, cfa-miR-29b, cfa-miR-378, cfa-miR-421, cfa-miR-502, cfa-miR-503, cfa-miR-542, cfa- miR-652, cfa-miR-653, cfa-miR-872 Normal and mild vs. [score:1]
0188617.g007 Fig 7Normalized RT-qPCR C [q] number and RNAseq count number for let-7c, miR-17, miR-20a, and miR-30d. [score:1]
The critical role that miR-20a and miR-17 play in controlling cell senescence is of interest in the canine MMVD mo del. [score:1]
Decreases in miR-20a and miR-17 are associated with cell senescence. [score:1]
Hierarchical clustering of let-7c, miR-17, miR-20a, and miR-30d using both RT-qPCR and RNAseq data. [score:1]
In addition, it is unclear if let-7a, miR-17, miR-20a, and miR-30d are differentially sorted into exosomes by VICs. [score:1]
severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1]
Previous studies have also showed a decrease in miR-20a during EndMT [35]. [score:1]
[1 to 20 of 34 sentences]
11
[+] score: 100
To further confirm whether impaired c-Myc expression was responsible for the decreased expression of miR-17 and miR-20 upon NC treatment, we detected the expression of miR-17 and miR-20a in K562 stably overexpressing c-Myc. [score:9]
We found NC could markedly upregulate p21 (Fig. 5F), whereas overexpression of miR-17 and miR-20a antognized the protein level increment of p21 in K562 cells after treatment with NC (Fig. 5G). [score:6]
We found that c-Myc downregulation led to decreased expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 (Fig. 5B), which were consistent with the effects of NC shown in Fig. 5A. [score:6]
Our results showed that continuous overexpression of c-Myc significantly reversed miR-17 and miR-20a expression in K562 cells exposed to NC (Fig. 5C and D). [score:5]
Expression profiling had shown that miR-17 and miR-20a were overexpressed in varieties of solid tumors and hematopoietic malignancies, including MLL-rearranged leukemia [52], T-cell acute lymphoblastic leukemia [28, 53] and B-cell lymphoma [54, 55]. [score:5]
We also observed that a specific group of miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were activated by c-Myc and executed part of c-Myc functions in leukemia development [11, 20, 21, 22], was markedly downregulated. [score:5]
Infection of K562 cells with LV-miR-17 or LV-miR-20a lentiviral particles caused a significant upregulation of mature miR-17 or miR-20a level (Fig. 5E). [score:4]
We found that most of them, especially miR-17 and miR-20a showed significant downregulation after NC treatment. [score:4]
In our study, we found miR-17 and miR-20a were downregulated in the process of erythroid differentiation and apoptosis induced by NC in K562 cells. [score:4]
We next examined the effects of NC on the expression of c-Myc activated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were typically increased in leukemia and triggered to the development of leukemia [11, 20, 21, 22]. [score:4]
miR-17 and miR-20a are two representative members of a highly conserved gene cluster miR-17–92, a miRNA polycistron also known as oncomir, and might have parallel roles through regulating the same target genes as they contain the same seed sequence [51]. [score:4]
These results suggested downregulation of c-Myc was responsible for NC induced decrease of miR-17 and miR-20a. [score:4]
The expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, which were reported to be dependent on c-Myc transcriptional activity [27, 48, 49, 50] and contribute the development of leukemia [11, 20, 21, 22], was examined in K562 cells treated with NC. [score:4]
The relative expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 was detected by real-time qRT-PCR. [score:3]
Furthermore, we detected the effect of miR-17 or miR-20a on the expression of globin γ with or without NC treatment in K562 cells. [score:3]
We next explored the effects of c-Myc inactivation on the expression of the tumor associated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells. [score:3]
p21 was reported to be one of the target genes of miR-17 and miR-20a [28]. [score:3]
By flow cytometry, we found overexpression of miR-17 or miR-20a reversed apoptosis induced by NC (Fig. 5I). [score:3]
The relative expression of mature miR-17 (C), miR-20a (D) was detected by real-time qRT-PCR. [score:3]
To determine the expression level of mature miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells, All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used following manufacturer’s protocol. [score:3]
We found that NC treatment could markedly improve globin γ expression, which was accordant with our previous studies (Fig. 1D), while miR-17 or miR-20a could remarkably weaken the incremental effects of NC on globin γ (Fig. 5H, right 3 lanes). [score:3]
miR-17 and miR-20a overexpression partly attenuated NC -induced differentiation and apoptosis, suggesting that miR-17 and miR-20a might take part in tumorigenesis of CML. [score:3]
These evidences supported that NC elicited erythroid differentiation and apoptosis were regulated by the biological effects of c-Myc-activated miRNAs, particularly miR-17 and miR-20a. [score:2]
To package LV-miR-17, LV-miR-20a or control lentiviral particles, Hek293T cells were co -transfected with a mixture of 10μg pLV-miR-17, pLV-miR-20a or pLVTHM, and 6.67μg psPAX2, 3.3μg pMD2. [score:1]
MiR-17 and miR-20a antagonized NC -induced differentiation and apoptosis of K562 cells. [score:1]
The relative level of mature miR-17 and miR-20a were detected by real-time qRT-PCR. [score:1]
0116880.g005 Fig 5(A) K562 cells were treated with 0, 4 or 8 μM NC for 2 days, the relative levels of mature miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 were detected by real-time qRT-PCR. [score:1]
Our results revealed that NC treatment decreased the relative levels of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, among which miR-17 and miR-20a showed the sharpest decrement by 65.0 ± 0.6% and 62.6 ± 2.6%, respectively (Fig. 5A). [score:1]
To investigate whether overexpression of miR-17 or miR-20a would influence the ability of NC to induce erythroid differentiation, we constructed lentiviral vectors harboring pri-miR-17 or pri-miR-20a sequence. [score:1]
The pri-miR-17 or pri-miR-20a PCR products were inserted into pLVTHM plasmid to generate pLV-miR-17 and pLV-miR-20a plasmid, which were used to produce lentiviral particles. [score:1]
[1 to 20 of 30 sentences]
12
[+] score: 89
The miR-17-5p/miR-20a downstream target genes (P21 and Bim-S) are upregulated by si FLI1 knockdown, but are downregulated by ad FLI1 expression. [score:12]
In the 17-92 miRNA family, miR-17-5p and miR-20a were closely associated with the expression of FLI1, being downregulated in the si FLI1 -treated cells (p < 0.05, Figure 5B) and upregulated in the FLI1 -expressing cells (p < 0.05, Figure 5C). [score:11]
After knocking down FLI1, both miR-17-5p and miR-20a are significantly downregulated, releasing their downstream suppression targets P21 and Bim-S, leading to reduced cell proliferation, enhanced apoptosis, and finally the suppression of tumors (Supplementary Figure 6). [score:11]
To confirm the regulation of FLI1 on miR-17-5p and miR-20a, we used the re -expression of Flag- FLI1, Flag- FLI1∆ETSor Flag-vector to rescue the down-regulation of miR-17-5p and miR-20a expression induced by FLI1 knockdown. [score:10]
For example, miR-17-5p and miR-20a mainly inhibit the expression of target genes Bim-S and P21 [35, 36]. [score:7]
Using a rescue experiment, we demonstrate that knockdown of FLI1, particularly its ETS binding domain, alters the expression of miR-17-5p and miR-20a. [score:4]
We showed that Flag- FLI1, rather than the Flag- FLI1∆ETS mutant or the Flag-vector control, was able to rescue the downregulated miR-17-5p and miR-20a (p < 0.05, Figure 5D). [score:4]
Among the 17-92 miRNA family, miR-17-5p and miR-20a were significantly downregulated by si FLI1. [score:4]
Similarly, miR-17-5p and miR-20a mimics could rescue the inhibition of cell proliferation induced by FLI1 knock-down in SCLC cells. [score:4]
Finally, we examined whether the downstream target genes of miR-17-5p and miR-20a were also affected by FLI1. [score:3]
To further delineate the underlying mechanism of FLI1, we examined the expression of mature 17-92 miRNAs in treated SCLC cells, including miR-17-5p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a. [score:3]
Two major components of the microRNA cluster, miR-17–5p and miR-20a [34], have been reported to target a noticeable large subset of key genes that promote proliferation and cell cycle progression in SCLC [22]. [score:3]
The miR-17-92 cluster (miR17-5p, miR-18, miR-19a, miR-19b, miR-20a and miR-92a), located in an intron of MIR17HG [miR-17-92 cluster host gene (non-protein coding)] on chromosome 13 (13q31.3), is overexpressed in lung cancers, especially with the most aggressive SCLC [31]. [score:3]
Importantly, we found that the inhibition of cell proliferation was rescued efficiently by both miRNA mimics (Figure 5E, miR-17-5p; Figure 5F, miR20-a). [score:3]
In conclusion, this study for the first time to uncover that FLI1 influences tumorigenesis and cellular proliferation of SCLC cells by regulating the miR-17-92 cluster transcription, especially miR-17-5p and miR-20a. [score:2]
We investigated whether miR-17-5p and miR-20a mimics could rescue the inhibition of cell proliferation induced by FLI1 knockdown. [score:2]
In this pathway, the oncogenic FLI1 regulates miR-17-5p and miR-20a through its binding to a conserved ETS binding site in the gene promoter. [score:2]
Both of miR-17-5p and miR-20a had been found to serve as growth-promoting miRNAs in SCLC [22]. [score:1]
[1 to 20 of 18 sentences]
13
[+] score: 86
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograft To validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograftTo validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
In order to validate the miRNA expression obtained from whole genome profiling, expression of selected metastamiRs, including hsa-miR-1224-3p, hsa-miR-1260 (both significantly upregulated), hsa-miR-125b, hsa-miR-27b, hsa-miR-93,and hsa-miR-20a (all significantly downregulated) were confirmed using QPCR. [score:11]
To define the effect of characterized metastamiRs on the putative target proteins, we adopted two approaches: (i) inhibited hsa-miR-1224-3p or hsa-miR-1260 (both significantly upregulated) and (ii) functionally mimicked hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (all significantly downregulated) and examined for the miRNA -dependent modulations in protein targets. [score:11]
First, MSDACs transiently transfected with mimics for hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (those exhibited complete suppression in aggressive disease) and examined for the regulation of their corresponding target proteins (Fig.   6a). [score:8]
Thus, we validated our microarray results with RT-qPCR for upregulation (Hsa-miR-1260; Hsa-miR-1224-3p) and downregulation (Hsa-miR-20a, Hsa-miR-27b, Hsa-miR-125b, Hsa-miR-93) profiles (see Fig.   3b). [score:7]
miRNA mimic (hsa-miR-125b, hsa-miR-27b, hsa-miR-93, hsa-miR-20a) and inhibitor (hsa-miR-1224-3p, hsa-miR-1260) approach for select miRNAs revealed the direct influence of the altered metastamiRs in the regulation of identified protein targets. [score:7]
Transient transfection of MSDACs with hsa-miR-125b-, hsa-miR-27b-, hsa-miR-93- or hsa-miR-20a- mimics (MISSION® microRNA Mimics, Sigma-Aldrich) as well as hsa-miR-1224-3p- and hsa-miR-1260 -inhibitors (MISSION® Synthetic miRNA Inhibitors, Sigma-Aldrich) were carried out by using either TurboFectin 8.0 reagent (Origene) or Neon electroporation transfection system (Life Technologies). [score:5]
On the other hand, MSDACs transfected with hsa-miR-20a exhibited significant (P < 0.001) inhibition of ASK1, MMP2, MMP3/10, PTPN3 and VEGF (Fig.  6b iii). [score:3]
We did not see any consistent inhibition of CREB and STAT3 at least with the mimic for hsa-miR-20a. [score:3]
b Histograms of mean cell–Alexa Fluor intensity obtained from Columbus automated batch analysis showing alterations in the expression (i) GRB10, MMP2, p38, STAT3, TNFα and VEGF in cells with hsa-miR-125b mimic, (ii) EGFR FOSB, kRAS, p38, PTPN3 and VEGF in hsa-miR-27b mimic transfected cells, (iii) ASK1, CREB, MMP2, MMP3/10, PTPN3, STAT3and VEGF in MSDACs with hsa-miR-20a mimic and, (iv) MMP2, MMP3/10, PTPN3 and STAT3 with hsa-miR-93 mimic in MSDACs. [score:3]
Compared to the non-metastatic xenograft, we observed a complete (P < 0.001) decrease in the expression of hsa-miR-93, hsa-miR-20a, hsa-miR-125b, and hsa-miR-27b (Fig.   3b). [score:2]
[1 to 20 of 12 sentences]
14
[+] score: 84
miR-20a and miR-17 directly bind to the 3′ untranslated region (UTR) of FBXO31 and inhibit FBXO31 mRNA and protein expression in human GC cells. [score:8]
Human miR-20a mimics, miR-17 mimics, control mimics, miR-20a inhibitors, miR-17 inhibitors and control inhibitors were synthesized from RiBoBio (Guangzhou, China). [score:7]
Our results indicated that miR-17 and miR-20a mimics inhibited, whereas miR-17 and miR-20a inhibitor increased, the expression of FBXO31. [score:7]
The overexpression of miR-17 and miR-20a contributed to the down-regulation of FBXO31 in GC tissues partly. [score:6]
miR-20a and 17 were up-regulated in GC samples and FBXO31 expression was negatively associated with miR-20a and 17 in primary GC tissues. [score:6]
We used different databases, such as TargetScan, pictar and miRanda to predict the miRNA targeting FBXO31 and found that miR-20a and 17 were partly complementary to two conserved site within the 3' UTR of FBXO31. [score:5]
Therefore,we transfected the mimics or inhibitor of miR-20a or miR-17 into GC cells BGC-823 and HGC-27 and used qRT-PCR and western blot to detect the expression of FBXO31. [score:5]
However, miR-20a and 17 mimics or inhibitor have no effect on the protein expression level of another F-box protein FBXL11 (Fig. S2). [score:5]
We used qRT-PCR to determine miR-20a and 17 expression in 56 paired GC and the corresponding non-cancerous normal mucosa tissues. [score:3]
Correlation analyses between FBXO31 and miR-20a (17) expression in GC samples were made using linear regression. [score:3]
FBXO31 expression is negatively associated with miR-20a and miR-17 in primary GC tissues. [score:3]
Clinically,we found that the expression of miR-17 and miR-20a in tumor tissue was significantly higher than that in surrounding normal mucosa. [score:3]
We found that miR-20a or miR-17 mimics decreased, whereas miR-20a or miR-17 inhibitor increased, the mRNA and protein level of FBXO31, respectively (Fig. 3 A-F). [score:3]
showed that the expression of miR-20a and 17 in tumor tissue was significantly higher than that in surrounding normal mucosa. [score:3]
Two miR-20a and miR-17 complementary sequences GCACTTT in the 3' UTR were mutated singly or together to remove complementarity by use of a QuikChange site-directed mutagenesis kit with pMIR-FBXO31/wt as the template. [score:2]
To further determine whether FBXO31 was a direct target of miR-20a and miR-17,we constructed a vector containing the 3'UTR of FBXO31 and luciferase reporter vector pMIR-REPORT (pMIR-FBX) and investigated the effect of miR-20a and miR-17 on the luciferase activity of pMIR-FBX. [score:2]
26/52 samples showed the inverse trend of decreased FBXO31 and increased miR-20a expression in tumor tissues compared with non-cancerous tissue. [score:2]
In all, 37/56 (66.1%) and 38/56 (67.9%)of the clinical GC specimens showed increased expression of miR-20a and miR-17,respectively, as compared with surrounding normal mucosa (Fig. 4A and 4B). [score:2]
Therefore, we detected whether FBXO31 were regulated by miR-17 and miR-20a. [score:2]
We found miR-20a and 17 significantly reduced the luciferase activity of pMIR-FBX (Fig. 3G). [score:1]
Therefore, the second region of the 3' UTR of FBXO31 is important in binding with the miR-20a and miR-17. [score:1]
Figure 3 (A) miR-20a and miR-17 were analyzed with qRT-PCR in BGC-823 and HGC-27 cells transfected with miR-20a, miR-17 mimics or control mimics. [score:1]
Statisticalanalysis showed that FBXO31 were highly correlated with miR-20a and miR-17 levels in GC samples (P<0.0001) (Fig. 4E and 4F). [score:1]
Because two sites within the 3'UTR of FBXO31 was found to be complementary to miR-20a and 17, we constructed three mutant, pMIR-FBX/mut1 (Site1 was mutated), pMIR-FBX/mut2 (Site2 was mutated) and pMIR-FBX/mut1,2 (Both site1 and 2 were mutated). [score:1]
Figure 4 (A and B) qRT-PCR analysis of miR-20a (A) and miR-17 (B) level in 56 paired human GC and adjacent normal gastric mucosa tissues. [score:1]
The 217bp 3' -UTR sequence of human FBXO31 gene containing miR-20a and miR-17 binding sites was amplified and inserted into the SpeI/HindIII sites of the pMIR-REPORT luciferase vector (named as pMIR-FBXO31/wt). [score:1]
[1 to 20 of 26 sentences]
15
[+] score: 82
Whereas decreased expression of miR-20a/b was not correlated with altered mRNA levels of E2F1 and Cyclin D1 (Figure  4A,B), upregulation of Cyclin D1 gene expression during UVB -induced senescence was observed at the protein level (Figure  4C). [score:8]
Similarly, downregulation of miR-20a and miR-20b is consistent with previous observations suggesting that members of the miR-17-92 cluster are commonly downregulated in various senescence mo dels as well as in organismal aging [16]. [score:7]
To further validate the bioinformatics -based target selection, regulation of several newly identified candidate genes by specific microRNAs was addressed in HDF overexpressing miR-15a, miR-20a, and miR-93, respectively. [score:6]
High confidence targets were identified for miR-20a and miR-20b encoded by the miR-17-92 cluster which is known to synergize with Myc in cancer development [26], probably through repression of p21 [WAF1] expression at the post-transcriptional level [27]. [score:6]
Whereas these findings establish CDKN2B, RUNX1 and RARB as functional target genes for miR-15a and miR-20A, respectively, the binding of these microRNAs to the 3'-UTR of the target genes remains to be confirmed by additional experiments. [score:5]
In addition, the data suggest TIMP3, ETV1, B2M, IGFBP-3, and RRAS2 as potential targets for miR-20a (Figure  4A), and TGM2, CPE, RHOJ, and SERPING1 as potential targets for miR-20b (Figure  4B). [score:5]
Expression levels for miR-15a, miR-20a, miR-20b, miR-93, and miR-101 are shown in Figure  3, along with their established target mRNAs. [score:5]
Thereby, eight miRNAs (miR-15a, miR-17, miR-20a, miR-20b, miR-34, miR-93, miR-101, miR-155) were identified for which regulated mRNA targets were found with high confidence. [score:4]
Figure 4 Correlation network of miR-20a/b and their high confidence target genes. [score:3]
Our finding that E2F1 and VEGFA are relevant targets for miR-20a/b in the context of UVB -induced senescence is consistent with these data. [score:3]
Together the results obtained in this study suggest important roles for microRNAs miR-15, miR-20a/b, miR-93 and miR-101, and their mRNA targets, during UVB -induced senescence of human diploid fibroblasts. [score:3]
To achieve the overexpression of microRNA in HDFs, cells were reverse transfected with Pre-miR™ miRNA Precursor for miR-15a, miR-20a, miR-93, miR-101, and Pre-miR™ miRNA Precursor Molecules-Negative Control #2 for negative control (Applied Biosystems, Austria) using siPORT™ NeoFX™ Transfection Agent (Ambion, Austria) according the manufacturer’s protocol. [score:3]
of the bioinformatic analysis suggested several so far unreported potential targets for miR-20a and miR-20b in the context of UVB -induced senescence. [score:3]
miRNA expression levels for miR-20a, miR-20b, miR-15a, and miR-93 were determined by. [score:3]
miR-15a and miR-20a were overexpressed in HDF as indicated. [score:3]
E2F1 and Cyclin D1 are predicted targets for both miR-20a and miR-20b. [score:3]
For the genes RARB, RUNX1 and CDKN2B, we found that overexpression of the appropriate microRNA species (miR-15a and miR-20a, respectively) reduced protein levels of the respective gene products (Additional file 6: Figure S4). [score:3]
Bioinformatic analysis of miRNA-mRNA networks was performed to identify new functional mRNA targets with high confidence for miR-15a, miR-20a, miR-20b, miR-93, and miR-101. [score:3]
In these experiments, data obtained by the miRNA array for miR-15a, miR-20a, miR-20b, miR-93, and miR-101 were confirmed (Figure  2); whereas miR-17, miR-34 and miR-155 were also regulated in UVB -treated cells in accordance with the miRNA array results, the observed differences did not reach statistical significance (data not shown). [score:2]
Thus, DRAM, IDS, NFAT5, EGR2, CCND2, and RARB were identified as potential high confidence interactions for both miR-20a and miR-20b (Figure  4A,B). [score:1]
of the analysis are presented here for miR-20a (A), and miR-20b (B). [score:1]
In addition, 7 other microRNAs (hsa-miR-155, hsa-miR-15a, hsa-miR-17, hsa-miR-20a, hsa-miR-20b, hsa-miR-34a, hsa-miR-93) were chosen for qPCR confirmation of array data using the Taqman qPCR platform (Life Technologies). [score:1]
Our analysis confirmed a high confidence interaction between both miR-20a and miR-20b with p21 [WAF1] (CDKN1A), p15 [INK4B] (CDKN2B), RUNX1, and vEGF-A (Figure  4A,B), thereby validating the analytical procedure. [score:1]
[1 to 20 of 23 sentences]
16
[+] score: 78
qRT-PCR results showed that AF113014 overexpression could result in a significant down-regulation of miRNA-20a while knockdown of AF113014 increased miRNA-20a expression (Fig 6B). [score:9]
Although, the expressions of Egr2 could be downregualted by miR-20a, AF113014 could recover the inhibition of miR-20a, and increased the expressions of Egr2 in presence of miR-20a (Fig 6D and 6E). [score:7]
Our study further found that AF113014 can up-regulate anti-oncogene Egr2 expression by interaction with miR-20a. [score:6]
AF113014 up-regulated Egr2 expression by interacting with miR-20a. [score:6]
These results suggested that AF113014 up-regulated Egr2 expression through interacting with miR-20a. [score:6]
Cells were co -transfected with Ad-AF113014 or Ad-GFP, 300ng pTARGET-miR-20a or pTARGET vector (both preserved in our lab), 200ng pGL3-control-Egr2-3’UTR or pGL3-control and 25ng of the control Renilla plasmid pRL-TK (Promega, USA) using Lipofectamine2000. [score:5]
The 3'-UTR of human EGR2 containing miR-20a binding site was PCR-amplified and cloned into the Xba I site of pGL3-control dual-luciferase miRNA target expression vector (Promega, USA). [score:5]
Furthermore, to explore the roles of Egr2 and miRNA-20a in the effect of AF113014 upon the cell growth, RNAi suppression of Egr2 and overexpression of miR-20a in cells transduced with AF113014 werevcarried out. [score:5]
These results suggested that AF113014 could regulate the expression of Egr2 by interaction with miR-20a. [score:4]
Dual-luciferase reporter assay showed that Egr2 was a target gene of miR-20a and AF113014 could weaken the inhibition of miR-20a to Egr2. [score:4]
The expression of miR-20a/LncRNA-AF113014/Egr2 in HCC. [score:3]
0177843.g008 Fig 8 The expressions of Egr2, LncRNA-AF113014 and miR-20a in HCC tissues were analyzed with qPCR. [score:3]
The expressions of Egr2, LncRNA-AF113014 and miR-20a in HCC tissues were analyzed with qPCR. [score:3]
showed that the luciferase activity of Egr2-3 'UTR was lower in cells expressing miR-20a comparison with its control. [score:3]
The expression linking of miR-20a/LncRNA-AF113014/Egr2 was checked in six human HCC tissue samples compared with adjacent non-cancerous tissues (Fig 8). [score:2]
0177843.g007 Fig 7 (A) Proliferations of SMMC7721 cells were examined by MTS after co -transfected with Ad-AF113014, miR-20a, miR-20a-in, Ad-Egr2, si-Egr2 in groups. [score:1]
0177843.g006 Fig 6. (A) Software predicted the binding sites between AF113014, miRNA-20a and Egr2-3'UTR. [score:1]
Proliferation founctions of AF113014 effected on miR-20a and Egr2 in HCC cells. [score:1]
In summary, our study revealed the functions and mechanism of AF113014, miR-20a and Egr2 in HCC. [score:1]
In this study, we found miR-20a could combine with Egr2-3 'UTR region and there was also a complementary base pairing relationship between AF113014 and miR20a. [score:1]
Interestingly, we found that there was base complementary relationship between AF113014, miRNA-20a and Egr2-3 'UTR (Fig 6A). [score:1]
miR-20a [42, 43], miR-150, miR-137, miR-224, miR-337 were identified (S3 Fig). [score:1]
[1 to 20 of 22 sentences]
17
[+] score: 72
Radiation up-regulated miRNA expression levels included let-7g, miR-16, miR-20a, miR-21 and miR-29c, while miR-18a, miR-125a, miR-127, miR-148b, miR-189 and miR-503 were down-regulated. [score:9]
Our own cell -based assays clearly show that miR-20a overexpression dramatically inhibits clonogenic survival, while the inhibition of the miRNA increased survival rates. [score:6]
We found that overexpression or inhibition of let-7g, miR-189, and miR-20a markedly influenced clonogenic survival and cell proliferation per se. [score:5]
Matsubara et al. could show that the inhibition of miR-20a can induce apoptosis in lung cancer cells over -expressing the miR-17-92 cluster [19]. [score:5]
We found that the overexpression or inhibition, respectively, of miR-189, let-7g and miR-20a showed the strongest effects on functional cell behavior. [score:5]
miR-20a was also found to be up-regulated after radiation treatment. [score:4]
Furthermore, we measured in non-irradiated EC a strong inhibition of clonogenic survival by pre-miR-20a, while the downregulation of the miR-20a level increased the number of clones (P < 0.05) (Fig. 4). [score:4]
Again, since radiation was clearly found to up-regulate miR-20a, this microRNA is another potential candidate in our system linking functional cell death with effects of radiation. [score:4]
Although the direct functional effects of miR-20a over- or underexpression were strong, the clonogenicity upon irradiation was not markedly affected. [score:4]
In the case of miR-20a the effects on clonogenicity and proliferation were remarkably different: Compared to the strong inhibitory effect of miR-20a precursor on clonogenic survival the proliferation inhibition of irradiated cells was much more moderate, but significant (Fig. 8C). [score:4]
In Fig. 8 the effects of ionizing radiation after transfection with precursors or inhibitors of miR-189, let-7g and miR-20a are shown. [score:3]
Figure 4 Clonogenic survival of HDMEC after transfection with miR-20a precursor or inhibitor. [score:3]
miR-20a inhibition showed the opposite effect in cells with 2 Gy RT. [score:3]
Panels A-C show the proliferation data of cells pre -treated with precursor or inhibitor molecules of miR-189, let-7g and miR-20a. [score:3]
Interestingly, our data showed that the radiation sensitivity itself in endothelial cells does not appear to be markedly dependent on the expression level of miR-20a. [score:3]
Out of the microRNA list from the microarrays we selected six miRNAs (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a) for further functional analysis. [score:1]
s Out of the microRNA list from the microarrays we selected six miRNAs (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a) for further functional analysis. [score:1]
Furthermore, miR-20a is involved in cell cycle progression [20]. [score:1]
We found that especially miR-189, let-7g, and miR-20a seem to play a role in endothelial cell clonogenic survival and/or proliferation, and to a weaker extend also miR-125a, -127, and -148b. [score:1]
Only miR transfected samples without irradiation were set 100%, except for pre-miR-20a. [score:1]
The following pre- and anti-miRs were used: hsa-let-7g, hsa-miR-125a, hsa-miR-127, hsa-miR-148b, hsa-miR-189, hsa-miR-20a, pre-miR negative control #1, and anti-miR negative control #1 (all purchased from Ambion). [score:1]
Six microRNAs (miRs) were chosen for subsequent functional analyses (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a). [score:1]
[1 to 20 of 22 sentences]
18
[+] score: 67
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-16-2, hsa-mir-15b
The expression of CDKN1A mRNA was seen to be regulated by miR-17-5p and miR-20a-5p, and this relationship was observed in HepG2 cells; CDKN1A mRNA transcription did not change in HepaRG® cells miR-17-5p and miR-20a-5p decrease the expression of cyclin -dependent kinase inhibitor 1A (CDKN1A) [16], whose expression was increased about 2.45-fold in the hypoglycemic condition in HepG2 cells, although its expression was not changed in normal hepatocytes HepaRG® cells (Table  2) [16]. [score:12]
The expression of CDKN1A mRNA was seen to be regulated by miR-17-5p and miR-20a-5p, and this relationship was observed in HepG2 cells; CDKN1A mRNA transcription did not change in HepaRG® cells miR-17-5p and miR-20a-5p decrease the expression of cyclin -dependent kinase inhibitor 1A (CDKN1A) [16], whose expression was increased about 2.45-fold in the hypoglycemic condition in HepG2 cells, although its expression was not changed in normal hepatocytes HepaRG® cells (Table  2) [16]. [score:12]
HSPA8 also belongs to the HSP70 family and inhibits apoptosis [12, 13], and this gene is targeted by miR-17-5p and miR-20a-5p, among the miRNAs shown in Table  1. Although expression of these two miRNAs greatly decreased (by about half), the expression of HSPA8 was increased only about 1.17-fold in the hypoglycemic condition in HepG2 cells, and its expression was not changed in normal hepatocytes (Table  2). [score:11]
The hsa-miR-17-5p mirVana® miRNA inhibitor (Ambion®, ThermoFisher Scientific K. K. ) and hsa-miR-20a-5p mirVana® miRNA inhibitor (Ambion®) were used to inhibit the expression of miRNAs. [score:9]
On the other hand, the miR-17-5p inhibitor significantly increased the transcription of p21 (Fig.   4b) and protein expression was significantly inhibited when both miR-17-5 and miR-20a-5p were inhibited with the antisense RNA (Fig.   4b). [score:9]
The expression levels of miR-17-5 and miR-20a-5p were significantly suppressed by transfection of the antisense inhibitors (Fig.   4a). [score:7]
Fig. 4Effects of the hsa-miR-17-5p and hsa-miR-20a-5p mirVana® miRNA inhibitors. [score:3]
The inhibition of both miR-17-5 and miR-20a-5p increased the proportion of G1 phase cells and decreased the proportion of S phase cells (Fig.   4c). [score:3]
We next transfected the antisense RNA for miR-17-5 and miR-20a-5p into HepG2 cells cultured under the normoglycemic condition. [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 61
The inhibitors of miR-17–5p and miR-20a-5p but neither the inhibitor control nor the miR-19b-3p inhibitor led to a significant upregulation of p21 protein levels (Fig. 6D). [score:10]
Our results show that continuous E6/E7 expression is linked to an upregulation of let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and a downregulation of miR-21–5p, in exosomes secreted from HeLa cells. [score:9]
Here, we took a closer look at members of the tumorigenic miR-17~92 cluster, since (i) miR-17–5p was among the top ten hits of abundant miRNAs of which the expression was maintained by the E6/E7 oncogenes, (ii) all other members of this cluster, as well as of the paralog cluster miR-106b~25, were also downregulated by E6/E7 silencing when applying less stringent selection criteria (S3 Table), (iii) several members of the miR-17~92 cluster are well-decumented to be overexpressed in cervical cancer tissues, including the tested miR-17–5p [27– 30, 34, 37] and miR-20a-5p [23, 30, 31, 34, 35] (also see S2 Dataset), and (iv) four of these miRNAs (miR-17–5p, miR-20a-5p, miR-93–5p, and miR-106b-5p) possess the same seed sequence and can bind to the 3’ UTR of the p21 mRNA [18]. [score:8]
Next, it was studied whether an experimental increase of mir-17~92 expression, encoding two p21 -targeting miRNAs, miR-17–5p and miR-20a-5p [18], can contribute to keep basal levels of p21 expression low in HeLa cells. [score:7]
Our findings that miR-17–5p and miR-20a-5p inhibitors significantly induced endogenous p21 protein levels, indicates that oncogenic HPVs reduce p21 expression in cervical cancer cells by increasing the intracellular concentrations of members of this miRNA seed family. [score:5]
control”) that carries no homology to any known mammalian gene or with specific miRNA inhibitors of miR-17–5p, miR-20a-5p, and miR-19b-3p. [score:3]
Transfection of a mir-17~92 expression vector led to an increase of miR-17–5p, miR-20a-5p, miR-19b-3p and miR-92a-3p levels, as expected, but not of miR-34a-5p, which served as a negative control (Fig. 6A). [score:3]
Four miRNAs encoded by the miR-17~92 and miR-106b~25 clusters (miR-17–5p, miR-20a-5p, miR-106b-5p, miR-93–5p) are grouped into the miR-17 family, according to their identical seed sequence, and target two binding sites in the 3’ UTR of p21 [66, 67]. [score:3]
These findings indicate that continuous HPV E6/E7 oncogene expression determines a signature of seven miRNAs in exosomes secreted from HeLa cells in that it leads to significantly increased let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p and decreased miR-21–5p levels. [score:3]
miR-17–5p, miR-20a-5p, miR-19b-3p, miR-92a-3p: encoded by the mir-17~92 expression vector; miR-34a-5p: negative control (not encoded by the vector). [score:3]
In reciprocal experiments, we investigated whether the downmodulation of miR-17–5p and miR-20a-5p in HeLa cells might result in an upregulation of p21 levels. [score:2]
They encompass several family members with identical seed regions, including the let-7 family (let-7a-5p, let-7d-5p, let-7f-5p, let-7g-5p), miR-378 family (miR-378a-3p, miR-378c), miR-99 family (miR-99a-5p, miR-100–5p), as well as members of the miR-17~92 cluster (miR-20a-5p, miR-92a-3p). [score:1]
miR-20a-5p and miR-92a-3p are both members of the miR-17~92 cluster. [score:1]
A statistically significant and > 1.5-fold decrease upon E6/E7 silencing was detected for exosomal let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423–3p, miR-7–5p, miR-92a-3p, whereas miR-21–5p exhibited a statistically significant and > 1.5-fold increase upon E6/E7 silencing (illustrated in bold in S4 Table). [score:1]
The oncogenicity of miRNAs has been particularly well demonstrated for members of the miR-17~92 cluster (also called “oncomir-1”; coding for miR-17, miR-20a, miR-18a, miR-19a, miR-19b and miR-92a) and of its paralog cluster miR-106b~25 (coding for miR-106b, miR-93 and miR-25) [18]. [score:1]
miR-20a-5p can block oncogene -induced senescence via p21 repression [109], whereas miR-92a-3p possesses anti-apoptotic potential [110]. [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 56
Furthermore, we tested two more inhibitors of miRNAs expressed in HaCaT cells that are predicted to target TGFBR2: miR-93 and miR-423 (miR-20a and miR-93 have the same seed sequence). [score:7]
Inhibition, using an anti-sense inhibitor, of miR-20a or miR-34a, which are both expressed in HaCaT cells, caused an increase in TGFBR2 mRNA level, whereas transfection of miRNA mimics of these siRNAs caused a reduction. [score:7]
Based on these results, we identified miR-20a, miR-34a and miR-373 as miRNAs that inhibit TGFBR2 expression. [score:5]
Two of the miRNAs predicted to have target sites in these regions are miR-20a (which has been shown to target TGFBR2 in megakaryocytes [49]) and miR-34a. [score:5]
miR-20a and miR-34a were expressed in HaCaT cells, whereas miR-373 was not, but all had predicted target sites on the TGFBR2 UTR and could cause repression. [score:5]
For example, TGFBR2 is potentially suppressed by aberrant expression of miR-20a in cancer [49] and by induction of miR-21 during adipogenic differentiation [61]. [score:5]
We therefore went beyond the siRNA screen and looked for evidence for repression of TGFBR2 by expressed miRNAs (in HaCaT cells), such as miR-20a, miR-93, miR-34a and miR-423, and non-expressed miRNAs, such as miR-373. [score:5]
In transfection experiments using miRNA mimics and inhibitors, we found that TGFBR2 is indeed regulated by miR-20a and miR-34a in HaCaT cells. [score:4]
Luciferase activity of a construct containing the TGFBR2 3' UTR luciferase transcript and TGFBR2 mRNA levels were significantly reduced by transfected miR-20a or miR-34a (Figure 10A), and transfection of miR-20a or miR-34a inhibitors caused an increase in the TGFBR2 mRNA level (Figure 10B). [score:3]
Two independent siRNAs were used as non -targeting controls (controls 1 and 2), and a microRNA miR-20a mimic and an siRNA with perfect complementarity to the TGFBR2 ORF were used as positive controls for the 3' UTR and the ORF constructs, respectively. [score:3]
Inhibition of miR-20a or miR-34a leads to increased levels of TGFBR2 mRNA, whereas addition of exogenous miR-20a or miR34a leads to drastically reduced levels of TGFBR2 mRNA. [score:3]
miRNA inhibitors (such as miR-20ai against miR-20a) were co -transfected with lacZ siRNA. [score:3]
miR-20a UAAAGUGCUUAUAGUGCAGGUAG miR-20a* ACUGCAUUAUGAGCACUUAAAGU miR-34b UAGGCAGUGUCAUUAGCUGAUUG miR-34b* AUCACUAACUCCACUGCCAUCA miR-373 GAAGUGCUUCGAUUUUGGGGUGU miR-373* ACUCAAAAUGGGGGCGCUUUCC We used antibodies recognizing phospho-tail SMAD2 Ser-465/467 (Cell Signaling, Danvers, MA, USA) and murine antibodies against α-tubulin (Sigma-Aldrich, St. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 55
As miRNAs play their roles by regulating target genes, we identified target genes of miR-20a both in human and mice by bioinformatic methods. [score:6]
Furthermore, in cutaneous squamous cell carcinoma, researchers also found that miR-20a could inhibit A431 and SCL-1 proliferation and metastasis, and LIMK1 was a direct target gene of miR-20a [33]. [score:6]
In anaplastic thyroid cancer, miR-20a could inhibit cellular proliferation and cell invasion via decreasing LIMK1 protein expression [32]. [score:5]
Relative expression levels of target genes of miR-20a. [score:5]
miR-20a might be a key inhibitor in this process via targeting Limk1 to lower cell motility. [score:5]
This result suggested that miR-20a could directly target Limk1. [score:4]
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
In this study, we found that in infertile male subjects, sperm motility was lower in relative higher GEN dose group (Group3) while the relative expression levels of seminal plasma miR-19b-1, miR-20a and miR-92a-1 were higher in corresponding groups. [score:3]
After treatment with GEN, we found that the relative expression levels of miR-17 and miR-20a were significantly increased at the dose of 5 mg/kg/day (Figure 4, P < 0.05, P < 0.01, respectively). [score:3]
We found that miR-20a was the only miRNA of miR-17-92 cluster differentially expressed both in human and mice samples. [score:3]
miR-20a was the only miRNA that differentially expressed in human and mice samples. [score:3]
It is interesting that the relative expression levels of miR-19b-1, miR-20a and miR-92a-1 were higher in Group 3 compared to Group 1 (Figure 2, P < 0.05). [score:2]
The result of 3’ UTR luciferase assay showed that Limk1 was targeted by miR-20a. [score:2]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Cells were transfected with 50 nM miR-20a mimics, negative control (NC), 500 ng pGL3-Limk1-miR-20a-WT and pGL3-Limk1-miR-20a-Mut on 24-well plates respectively. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
of miR-20a. [score:1]
These findings suggested that miR-20a might be one of the key miRNAs that is involved in abnormal spermatogenesis induced by GEN. [score:1]
[1 to 20 of 18 sentences]
22
[+] score: 51
Fluorescence in situ hybridization (FISH) was conducted in an area containing at least 85% tumor in order to appropriately visualize the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b in FFPE tissues of GC patients (Fig. 4b), and these experiments provided consistent results concerning the miRNA levels that the five miRNAs were up-regulated in GC patients. [score:6]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b The putative target genes of the miRNAs were identified by miRanda, miRDB, miRWalk, RNA22, and Targetscan. [score:5]
MiR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in GC tissues by qRT-PCR (a: 30 pairs of tumor and matched normal tissues) and FISH (b: pictures were selected from 10 pairs of GC tissues and matched normal tissues). [score:4]
Interestingly, miR-20a, miR-210, and miR-92b were significantly up-regulated in the arterial circulation which might suggest that circulating miR-20a, miR-210, and miR-92b could be absorbed and transmitted to distant body sites and participate in biological processes (including tumorigenesis, metastasis and other pathways). [score:4]
Interestingly, in arterial plasma, miR-20a, miR-210 and miR-92b were significantly up-regulated while miR-185 was significantly decreased with a fold-change of 1.37, 2.35, 3.34 and 0.44, respectively (Supplementary Table S5 online). [score:4]
In the training and testing phases of our experiment, miR-185, miR-20a, miR-210, miR-25 and miR-92b were found to be significantly up-regulated in GC. [score:4]
Up-regulation of circulating miR-20a could be used to facilitate the diagnosis of nasopharyngeal carcinoma 37 as well as astrocytoma 38. [score:4]
When the results of two stages were combined, miR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in peripheral plasma of GC patients compared with NCs (Fig. 2). [score:3]
As shown in Fig. 4a, the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b was significantly higher in tumor than in normal tissues, and this correlation was consistent with results obtained from peripheral plasma. [score:3]
As a member of the miR-17-92 cluster, miR-20a could also sustain the self-renewal function of GC stem cells and promote the proliferation of GC cells by targeting E2F transcription factor 1 (E2F1) 30. [score:3]
None of the five miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) from GC patients demonstrated a significantly different expression level in peripheral plasma exosomes as compared to controls (Supplementary Table S6 online). [score:2]
In the larger cohort, 5 of 11 miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) were consistent with those in the training stage (Table 2; the other miRNAs were shown in the Supplementary Table S2 and Table S3 online). [score:1]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b. [score:1]
The areas under the curve (AUC) were 0.65 (95% confidence interval (CI): 0.57–0.72), 0.67 (95% CI: 0.61–0.74), 0.75 (95% CI: 0.68–0.82), 0.65 (95% CI: 0.58–0.73) and 0.69 (95% CI: 0.62–0.76) for miR-185, miR-20a, miR-210, miR-25 and miR-92b, respectively (Supplementary Figure S1 online). [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b. [score:1]
It was suggested that elevated level of circulating miR-20a could promote growth, migration and invasion of GC cells and enhance the chemoresistance of GC cells to cisplatin and docetaxel 28 29. [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b; N: normal controls; T: tumor. [score:1]
Among the five miRNAs, miR-20a seemed to be much more related to pathological mechanisms of cancer such as by interacting with MAPK and mTOR signaling. [score:1]
Thus, miR-20a might serve as an oncogene in GC. [score:1]
Their results showed that the four miRNAs in our study (miR-25, miR-20a, miR-185 and miR-210) were co-purified with the Ago2 ribonucleoprotein complex other than exosomes in plasma while the form of miR-92b was undefined in the circulation. [score:1]
[1 to 20 of 20 sentences]
23
[+] score: 49
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-106a, hsa-mir-34a, hsa-mir-449a
Increased miR-24 expression in senescent HDFs may inhibit cell proliferation by suppressing cell cycle regulatory genes including E2F2 [32], which then prevent miR-20a promoter activation resulting in decreased miR-20a expression [35]. [score:10]
Our data on SA-miRNAs expression showed upregulation of miR-24 and miR-34a and downregulation of miR-20a and miR-449a in senescent cells. [score:9]
TRF treatment increased miR-20a expression in young HDFs, reduced miR-34a expression in senescent HDFs, and increased miR-449a expression in both young and senescent HDFs (P < 0.05). [score:7]
Upregulation of miR-20a in young HDFs after TRF treatment may increase the inhibition effect on p21 [Cip1] [30] and hence increase CDK2 level to form active CDK complexes with cyclin E and cyclin A to promote higher cell proliferation rate in young HDFs [31]. [score:6]
Decrease in miR-20a expression in senescent cells observed in this study, which was also reported in previous studies [27, 28], may be attributed to the increase in CCND1 gene expression [29] which was also observed in senescent HDFs. [score:5]
The expression of miR-20a and miR-449a was decreased while the expression of miR-24 and miR-34a was increased significantly in senescent HDFs as compared to young HDFs (P < 0.05) (Figure 2). [score:4]
Young HDFs rather than senescent HDFs responded towards TRF treatment, by showing an increase in miR-20a expression. [score:3]
Several miRNAs (including miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) that funnel proliferating cells to senescence regulate cellular senescence via either or both p53/p21 and p16/pRb pathways [14]. [score:2]
PCR reactions were then performed according to manufacturer's instructions to quantitate the expression levels of miRNAs (miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) using Taqman Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, USA), and Taqman microRNA assay (Applied Biosystems, USA) for the miRNAs of interest. [score:2]
The PCR amplification was performed in iQ5 Multicolor Real Time PCR (Bio Rad, USA) at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. The PCR incubation profile was extended to 45 cycles for miR-20a and miR-449a. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 48
According to Matsubara et al. [80], inhibition of miR-17-5p and miR-20a with antisense oligonucleotides (ONs) can induce apoptosis selectively in lung cancer cells overexpressing miR-17-92, suggesting the possibility of targeting an ‘oncomiR addiction’ to expression of these miRNAs in a subset of lung cancers. [score:9]
Resveratrol and Pterostilbene decrease the levels of endogenous as well as exogenously expressed miR-17, miR-20a and miR-106b thereby upregulating their target PTEN [122] and eventually leading to reduced tumor growth in vivo. [score:8]
As p21 and STAT 3 are direct targets of miR-17-5p and miR-20a, downregulation of miR-17-5p and miR-20a induces myeloid differentiation and growth arrest in AML cells in vitro and in vivo [112]. [score:7]
HIF-1α (Hypoxia Inducible Factor 1 Alpha Subunit) downregulates the expressions of miR-17-5p and miR-20a through a mechanism that is dependent of c-Myc but independent of its transcription partner HIF-1ß. [score:6]
Supporting in vitro and tissue level high expression of miR-17-5p, a clinical study proves serum levels of miR-17 along with miR-19a, miR-20a and miR-223 were significantly upregulated in CRC patients compared to controls [104]. [score:5]
qPCR -based miRNA expression profiling revealed that miR-17-5p, miR-18a-5p and miR-20a-5p exhibit enhanced expression in tissue samples derived from triple -negative as compared to luminal A breast tumors, which are less aggressive and have much better prognosis as well as lower recurrence rate [64]. [score:4]
miR-17-5p and miR-20a in turn negatively regulate E2F1 expression [28]. [score:4]
MiR-17 along with miR-106a/b and miR-20a/b targets GABBR1(gamma-amino-butyric acid type B receptor 1) thus promoting colorectal cancer cell proliferation and invasion [99]. [score:3]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
A study in multiple myeloma (MM) patients showed that high levels of miR-17-5p, miR-20a and miR-92-1 of miR-17-92 cluster are associated with shorter progression-free survival, suggesting poor prognosis [109]. [score:1]
[1 to 20 of 10 sentences]
25
[+] score: 46
The results showed that miR-378 was downregulated in GC tissues, whereas the other five miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) were upregulated in GC (Figure 2). [score:7]
In conclusion, our systemic review identified five upregulated miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) and one downregulated miRNA (miR-378) that are potential novel biomarkers for GC. [score:7]
We identified the five miRNAs that were most consistently upregulated (miR-21, miR-106a, miR-17, miR-18a and miR-20a) and two most consistently downregulated (miR-378 and miR-638) in at least four profiling studies. [score:7]
0073683.g002 Figure 2 Using U6 as a normalization control, the expression of miR-21, miR-106b, miR-17, miR-18a and miR-20a was significantly higher in GC tissues, while the expression of miR-378 was significantly lower. [score:5]
Mir-20a is another miRNA with oncogenic activity, and was found to be upregulated in four studies in this literature. [score:4]
Moreover, the upregulation of miR-20a has previously been found in cervical cancer, prostate cancer and ovarian cancer, and this miRNA could promote the cell proliferation or invasion of these cancers [41]– [43]. [score:4]
MiR-106b, miR-17 and miR-18a levels were significantly higher in poorly differentiated GC, cases with lymph node involvement, or late stage disease, while miR-20a levels were significantly higher in cases of GC with lymph node involvement. [score:3]
Expression levels of miR-21, miR-106b, miR-17, miR-18a, miR-20a and miR-378 in GC and adjacent noncancerous tissue samples. [score:3]
13 (10): 890– 8. 43 Fan X, Liu Y, Jiang J, Ma Z, Wu H, et al (2010) miR-20a promotes proliferation and invasion by targeting APP in human ovarian cancer cells. [score:3]
Our study also found that miR-20a was significantly elevated in GC tissues and was significantly associated with lymph node metastasis. [score:1]
For example, serum miR-21 was significantly elevated in perioperative serum from adenomas and colorectal cancer (CRC), and was an independent prognostic marker for CRC [50], [51]; Plasma miR-106b, together with miR-20a and miR-221 have the potential as novel biomarkers for early detection of gastric cancer [40]; Circulating miR-17 may used as a novel noninvasive biomarker for nasopharyngeal carcinoma [52], gastric cancer [53] and CRC [54]; Serum miR-18a may be used as a novel biomarker in breast cancer [55], colorectal cancer [56], hepatocellular carcinoma [57], and pancreatic cancer [58]; Circulating miR-378 may be used as a biomarker in renal cell carcinoma [59] and gastric cancer [60]. [score:1]
Three of these miRNAs were reported in five microarray studies (miR-21, miR-106b and miR-378), four were reported in four studies (miR-17, miR-18a, miR-20a and miR-638), and seven were reported in three studies (miR-19a, miR-20b, miR-25, miR-30d, miR-923, miR-375, and miR-148a). [score:1]
[1 to 20 of 12 sentences]
26
[+] score: 46
Other miRNAs from this paper: hsa-mir-19a
In HG-activated PBMCs, LPS stimulated TF expression and downregulated miR-20a, an effect reverted by OLM (10 [−6] M); miR-19a expression was unchanged by LPS in both CG and HG conditions. [score:8]
A third and intriguing point emerging from these results was the reversal of LPS -induced miR-20a downregulation by OLM, an AT1R blocker that, as expected [4, 5], inhibited both TF PCA and TF Ag. [score:6]
Among other potentially significant miRs interacting with TF gene [2], miR-19a and miR-20a have recently been shown to modulate TF expression in monocytes of patients with immune -mediated diseases [6]. [score:5]
This study shows inhibition of both miR-19a and miR-20a in response to HG [4], a procoagulant [4, present results] and proinflammatory stimulus [8– 10] that activates NF- κB [10, 11], a redox-sensitive transcription factor [12] critical for TF gene expression [3]. [score:5]
A second result of this study worth of comment relates to the inhibition by LPS of miR-20a in HG-activated PBMCs, an effect compatible with attenuation of a negative posttranscriptional feedback loop on TF expression in interaction with HG -induced excess ROS production and NFkB overactivation [8– 11]. [score:5]
As compared with CG, HG inhibited miR-19a and miR-20a expression and induced a highly significant stimulation of both TF PCA and TF Ag (Figures 1(a) and 1(b)). [score:4]
The results of this study disclose behaviours of miR-19a and miR-20a potentially involved in the posttranscriptional regulation of TF expression in the context of the complex interplay among inflammation, coagulation, and ATII, in which TF plays a pivotal role. [score:4]
Notably, cytoplasmic miR -induced silencing complexes restrain TF protein translation and destabilize TF mRNA by binding to the 3′-UTR of TF transcripts [1] and binding sites for both miR-19a and miR-20a have been recognized in the 3′-UTR of the TF mRNA transcript in human monocytes [6] and other cell types as well [13, 14]. [score:3]
miR-19a and miR-20a are inhibited by inflammatory stimuli active on TF expression and their response differs by the stimulus under investigation; angiotensin II may participate in that mechanism. [score:3]
Quantification of miR-19a, miR-20a, and RNU6B (as housekeeping gene) expression was carried out in triplicate using specific TaqMan MicroRNA Assays (Applied Biosystems), according to the manufacturer's instructions. [score:2]
In CG conditions, miR-20a levels in response to LPS showed inconsistent changes but decreased in presence of HG, a trend reverted by AT1R blockade through OLM (Figures 2(b) and 3(b)). [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 44
Inversely, the neuro-inflammatory regulator hsa-miR-20a that is down-regulated in human aging (Hackl et al., 2010) and is affected in Alzheimer's disease (Delay et al., 2011) was up regulated in patients (log fold change: 1.5, p-value: 0.002). [score:8]
Statistical significance enrichment analysis identified nine miRNAs as frequently targeted at detected spliced transcripts: hsa-miR-769-3p (predicted to target four transcripts), hsa-miR-378 (with six targets) as well as hsa-mir-320, hsa-miR-92b-5p, hsa-miR-16, hsa-miR-150, hsa-miR-671, hsa-miR-20a, and hsa-miR-18b (The full list and adjusted p-values are given under Table S10). [score:7]
Elevated hsa-miR-20a -mediated suppression of the transcription factor E2F1 can also impair transcription (Brock et al., 2009), whereas potentiated targeting by mir-20a of the BMPR2 protein, a pathogenic hallmark of pulmonary hypertension may compete with BMPR2 regulation by the miR-17/92 cluster (Huang et al., 2012) which was also identified as changed in our PD patients data (log fold change: −1.16, p-value: 13.28). [score:6]
For example, hsa-mir-20a and hsa-miR-378 increased in PD patients and decreased post-DBS, whereas the inflammatory -regulating hsa-miR-424 (Spinelli et al., 2013) showed no change in PD but it's passenger 3′ form (hsa-miR-18b-3p, previously called star form) exhibited down-regulation following DBS. [score:5]
Of these, hsa-miR-378, and hsa-miR-20a were predicted to bind the same seven AS target genes, affecting the actin -associated protein VASP involved in axon guidance (Mohamed et al., 2012), the hemoglobin subunit gamma-2 HBG2 gene, the retinoic acid receptor responder RARRES3, the androgen-regulated solute carrier SLC14A1 (Vaarala et al., 2012), TMEM69, a dividing leukocytes biomarker (Solmi et al., 2006), the mitochondrial tRNA dimethyl-allyltransferase trit1 and the bZIP nuclear transcription factor. [score:4]
miR-20a encoded by the miR-17-92 cluster increases the metastatic potential of osteosarcoma cells by regulating Fas expression. [score:4]
miR-17, miR-19b, miR-20a, and miR-106a are down-regulated in human aging. [score:4]
Enrichment analysis for miRNA binding sited in the detected genes detected 3 of the DBS -modified miRNAs: hsa-miR-20, hsa-mir-18, and hsa-miR-143 as highly predicted to bind AS targets detected by the exon level analysis (Table S19). [score:3]
The modified leukocyte miRNAs also differed in their copy numbers (for example, hsa-miR-20a expressed higher as compared with hsa-miR-320, Figure 2G). [score:2]
Enrichment analysis detected 6 of the DBS -modified miRNAs as modified (having adjusted p-value < 0.05): hsa-miR-320 (a, b, and c) as predicted to bind 4 spliced transcripts including hnRNPA2B1, hsa-miR-378 (predicted to bind 6 spliced transcripts), hsa-miR-92b (predicted to bind 4 spliced transcripts), hsa-mir-150, hsa-miR-20a, and hsa-miR-18b (where hsa-miR-18b-3′ changed). [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 38
For example, hsa-miR-29c is regulated by YY1 and NFKB1; hsa-miR-17, hsa-miR-21, hsa-miR-20a and hsa-miR-34a target MYC: YY1 regulates hsa-miR-29c, which targets BCL2; and hsa-miR-21 targets NFKB1, which regulates hsa-miR-155. [score:10]
The analysis only focused on hsa-miR-20a to illustrate the regulatory associations regarding differentially expressed miRNAs in three networks (differentially expressed, related and experimentally validated networks). [score:6]
CCND1 and MYC regulate hsa-miR-20a, which targets four genes in the differential expression network. [score:6]
In the experimentally validated network, 10 genes regulate hsa-miR-20a, which targets 26 genes. [score:4]
In the, four genes regulate hsa-miR-20a, which targets 14 genes. [score:4]
For example, MIR17HG encodes six miRNAs, and four of these miRNAs (hsa-miR-17, hsa-miR-20a, hsa-miR-19a and hsa-miR-19b-1) target CCND1. [score:3]
As with PTEN, regulatory associations between hsa-miR-20a and DLBCL -associated genes influence multiple DLBCL processes; however, other regulatory associations between hsa-miR-20a and non -associated genes may not influence DLBCL. [score:3]
MYC, CCND1 and hsa-miR-20a were found to form two self-adaptation associations (Table II). [score:1]
Table II shows hsa-miR-20a, and its predecessors and successors in the three networks. [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 35
However, the presence of miR-20a, −25 and -30b, all predicted to inhibit expression of genes involved in brown fat development, may prevent the development of a “classical” brown fat phenotype in human BAT. [score:7]
In this present study, miR-20a was the only miRNA predicted to target MYF5 and PPARγ (a previously experimentally observed target [38]), two important factors directing cell fate towards a brown fat phenotype [11]. [score:6]
Finally, PPARγ is known to be targeted by miR-20a [29] and myogenic factor 5 (MYF5) is predicted to be targeted by miR-20a. [score:5]
Furthermore, miR-20a was the miRNA targeting the second most numbers of genes (n = 149) involved in growth and development, highlighting its potential importance in these pathways. [score:4]
These 10 miRNAs and their predicted regulatory network are presented in Fig.   5. Bone morphogenetic protein 2 (BMP2) and BMP7 are predicted to be targeted by miR-20a,-140 and miR-25, −30b, respectively. [score:4]
In contrast, miR-20a is also predicted to target BMP2 and BMPR2, a growth factor and receptor increased in white fat differentiation [39]. [score:3]
Of these 25 miRNAs, miR-20a was predicted to target MYF5 and PPARγ, two important genes involved in brown adipogenesis, as well as BMP2 and BMPR2, genes involved in white adipogenesis. [score:3]
The identification of BAT-enriched miRNAs, conserved in both mouse and human BAT, such as miR-20a, may be a common factor controlling BAT development. [score:2]
These findings suggest that miR-20a may have the capacity to control cell fate toward a brown or white fat phenotype. [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 33
Inhibition of HIV Expression by the Silencing Exerted by miR-17-5p and miR-20 on PCAF (A), and Downregulation of This Inhibition by HIV (B). [score:10]
Triboulet et al. have reported that the infection of a lymphoid cell line by HIV-1 downregulates six miRNAs, including miR-17-5p and miR-20, and upregulates eleven others, including miR-122, -297, -370, and -373 [32]. [score:7]
Of note, two of the miRNAs downregulated during HIV infection are precisely miR-17-5p and miR-20, which target the Tat cofactor PCAF. [score:6]
For instance, the neutralization of miR-17 and miR-20 by specific inhibitors should release the inhibition exerted by these miRNAs on PCAF and hopefully trigger HIV replication in reservoir cells, resulting in the eradication of this population. [score:5]
Moreover, the cellular miR-17-5p and miR-20, through their repression of PCAF expression (Figure 3B), seem to exert the same effect [32]. [score:3]
Thus, by reducing the amount of miR-17-5p and miR-20 available, the virus alleviates the negative control exerted by the cell on PCAF, thereby facilitating its own transcription (Figure 3B). [score:1]
Triboulet et al. have shown that the cellular miRNAs miR-17-5p and miR-20 silence the mRNA encoding the histone acetylase PCAF. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 31
The high endogenous expression level represents an attractive, therapeutic vulnerability and makes miR-20a a target for miRNA inhibitors in patients with CRC [34]. [score:7]
Zhou J. Liu R. Luo C. Zhou X. Xia K. Chen X. Zhou M. Zou Q. Cao P. Cao K. miR-20a inhibits cutaneous squamous cell carcinoma metastasis and proliferation by directly targeting LIMK1 Cancer Biol. [score:6]
In our study, using microarray analyses in two different cell lines, we identified and confirmed two differentially expressed human miRNAs (hsa-miR-597 and hsa-miR-720) in HRT-18 and identified nine differentially expressed human miRNAs (hsa-miR-3142, hsa-miR-20a, hsa-miR-4301, hsa-miR-1290, hsa-miR-4286, hsa-miR-3182, hsa-miR-3142, hsa-miR-1246 and hsa-miR-720) in Caco-2 cells. [score:5]
Furthermore, miR-20a expression has been related to the malignant process of cervical cancer, especially invasion and metastasis by targeting ATG7 and TIMP2 [37]. [score:5]
Li X. Zhang Z. Yu M. Li L. Du G. Xiao W. Yang H. Involvement of miR-20a in promoting gastric cancer progression by targeting early growth response 2 (EGR2) Int. [score:3]
With the exception of miR-767-3p, which was not detectable by RT-qPCR, we could confirm the regulation of all the other miRNAs detected by the microarray (miR-597, miR-720, miR-3182, miR-20a, miR-4301, miR-3142, miR-4286 and miR-1290). [score:2]
Another example is miR-20a, which plays a key role in tumorigenesis and progression and is involved in the carcinogenesis of gastric cancer through modulation of the EGFR2 signaling pathway [33]. [score:1]
In the Caco-2 cell line, we identified two human miRNAs (hsa-miR-3142 and hsa-miR-20a) and eight human miRNAs (hsa-miR-4301, hsa-miR-1290, hsa-miR-4286, hsa-miR-3182, hsa-miR-3142, hsa-miR-1246 and hsa-miR-720) after 12 and 24 h, respectively (p < 0.05, Figure 4C,D). [score:1]
The nine miRNAs were miR-767-3p, miR-597, miR-720, miR-3182, miR-20a, miR-4301, miR-3142, miR-4286 and miR-1290. [score:1]
[1 to 20 of 9 sentences]
32
[+] score: 30
Another explanation is that the expression of miRNA-20a may be down-regulated in the necrotic hepatocytes. [score:6]
Temporal abundance analysis of host serum miRNAs in two murine mo dels during S. japonicum infectionTwo mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
Two mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
There was a tendency, albeit not statistically significantly, for relatively high expression of miRNA-20a in the serum of infected BALB/c mice at 7 weeks p. i. and thereafter. [score:3]
These data indicate that other tissues, such as the spleen and/or intestine, which also retain schistosome eggs, may contribute to the serum levels of miR-20a and miR-34a, both are multi-tissue expressed miRNAs [45, 46]. [score:3]
Thus, the low efficiency of reverse transcription of other miRNA-20a isomiRs might have impaired the sensitivity of detecting this miRNA to some degree. [score:1]
In C57BL/6 mice, the serum concentrations of miR-122, miR-20a and miR-34a did not change at any time point post infection, but the level of serum miR-21 was increased at 6 (1-Way ANOVA, P<0.01) (Fig 1A). [score:1]
In contrast, apart from miR-20a, the serum levels of the three other host miRNAs were significantly elevated in BALB/c mice by 6 (miR-122) or 7 (miR-21 and miR-34a) weeks p. i. and thereafter (Fig 1B and S3 Fig). [score:1]
The serum miR-20a and miR-34a levels showed a significant but weaker correlation with the serum AST and ALT levels than those of miR-122 and miR-21 in BALB/c mice. [score:1]
M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
S1 Fig M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
With miR-122 and miR-34a, there was a significant difference between the two mouse strains at 4–11 weeks p. i., while for miR-21 and miR-20a, significant difference was only observed at 7 weeks p. i. (Fig 1C). [score:1]
This may have been due to the existence of multiple relatively high expressed miRNA-20a isomiRs and the design of the RT-primer against this miRNA, since we only designed one RT-primer against one form of miRNA-20a isomiRs. [score:1]
[1 to 20 of 13 sentences]
33
[+] score: 30
hy926 cells Not shown HIF1A Angiogenesis[123] miR-200b HMVECs Downregulated upregulated ETS1 Angiogenesis hypoxia[135, 136] HUVECs KLF2 miR-210 HUVECs Upregulated EFNA3 Angiogenesis hypoxia[131, 132, 150] HIF3A miR-424 HUVECs, hMVECs, hBOECs and hMBECs Upregulated CUL2 Angiogenesis[137] HIF1A* miR-429 HUVECs Upregulated HIF1A Hypoxia[12, 109] HIF3A miR-433 HUVECs Downregulated HIF1A Proliferation and migration[138] miRNAs proven to directly bind HIF mRNAs are in bold, and indirect effects are marked with “*” ARNT aryl hydrocarbon receptor nuclear translocator, CUL2 cullin-2, EFNA3 ephrin A3, EGLN1 prolyl hydroxylase domain-containing protein 2 (PHD2), ETS1 ETS Proto-Oncogene 1, Transcription Factor, HIF1A hypoxia-inducible factor 1-alpha, HIF1AN hypoxia-inducible factor 1-alpha inhibitor, HIF3A hypoxia-inducible factor 3 alpha, KLF2 Kruppel-like factor 2 The miR-17 family includes miR-17, miR-18a/b miR-20a/b, miR-93 and miR-106a/b. [score:23]
Lin SC Wang CC Wu MH Yang SH Li YH Tsai SJ Hypoxia-Induced MicroRNA-20a Expression Increases ERK Phosphorylation and Angiogenic Gene Expression in Endometriotic Stromal CellsJ Clin Endocrinol Metab 2012 115. [score:4]
Although the expression changes of other miR-17 family members (miR-17, miR-20a and miR-20b) were reported to be involved in the HIF-related response during hypoxia in cancer cells [114, 117] and in mouse pulmonary artery smooth muscle cells (PASMC) [118], the exact role of these miRNAs needs to be confirmed during hypoxia in human endothelia. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 29
Target onco/tumor suppressor genes Type of cancer Colon lung pancreas prostate APC 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a EP300 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a DNMT1 17-5p, 32, 106a MSH3 17-5p, 20a, 106a RB1 17-5p, 20a, 106a HOXB4 17-5p, 20a, 106a RECK 21, 106a, 155 ETV1 17-5p, 20a,106a SYT7 17-5p, 20a,106a EGR1 191, 32, 106a PTEN 17-5p, 21, 20a,106a MCL1 17-5p, 32, 20a,106a STAT3 17-5p, 21, 20a,106a Table should be read in this way: APC is a target gene of miR-17-5p, miR-32, miR-20a and miR-106a and this gene is involved in colon and pancreatic cancer Another important observation from Figure 2 is that all the miRNAs except miR-155 and miR-24-2 are overexpressed in colon, pancreatic and prostate cancer. [score:9]
Target onco/tumor suppressor genes Type of cancer Colon lung pancreas prostate APC 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a EP300 17-5p, 32, 20a, 106a 17-5p, 32, 20a, 106a DNMT1 17-5p, 32, 106a MSH3 17-5p, 20a, 106a RB1 17-5p, 20a, 106a HOXB4 17-5p, 20a, 106a RECK 21, 106a, 155 ETV1 17-5p, 20a,106a SYT7 17-5p, 20a,106a EGR1 191, 32, 106a PTEN 17-5p, 21, 20a,106a MCL1 17-5p, 32, 20a,106a STAT3 17-5p, 21, 20a,106a Table should be read in this way: APC is a target gene of miR-17-5p, miR-32, miR-20a and miR-106a and this gene is involved in colon and pancreatic cancerAnother important observation from Figure 2 is that all the miRNAs except miR-155 and miR-24-2 are overexpressed in colon, pancreatic and prostate cancer. [score:9]
EP300 is involved in colon and pancreatic cancer (predicted target of miR-17-5p, miR-32, miR-20a and miR-106a), and so on. [score:3]
For example, APC is involved in colon and pancreatic cancer and it is a predicted target of miR-17-5p, miR-32, miR-20a and miR-106a. [score:3]
In module six, two miRNA clusters (miR-17-5p and miR-20a) and (miR-143 and miR-145) are dysregulated in colon, lung and prostate cancer tissues. [score:2]
It has been observed that miR-32, miR-29b-2, miR-21, miR-20a, miR-191, miR-17-5p, miR-106a, miR-155 and miR-24-2 all have significant dysregulation in lung, colon and pancreatic cancer cell line. [score:2]
In [30], the survival analysis among the 41 stage I adenocarcinoma patients revealed that three miRNAs (miR-155, miR-17-3p, and miR-20) were associated with patients survival. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 27
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Heart-specific miRNAs or miRNAs abundantly expressed in the heart, B) Liver-specific miRNAs or miRNAs abundantly expressed in the liver, C) miRNAs showing strong expression in the thymus, D) Expression analysis of miR-18a and miR-20a, the miRNAs located in the miR-17-92 cluster, and E). [score:9]
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Although miR-18a and miR-20a are likely derived from the same primary-transcript, the expression levels of these mature miRNAs are not similar (Figure 2D). [score:3]
Surprisingly, the expression pattern of miR-20a's differed from that of miR18a in different tissues. [score:3]
miR-18a and miR-20a are located within the miR-17-92 cluster, which contains miRNAs known as "oncomiRs" because of their overexpression in many types of cancer cells [58, 59]. [score:3]
The miR-17-92 cluster (polycistronic miRNA gene) encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) located in the third intron of a ~7-kb primary transcript known as C13orf25 [61]. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 26
The expression of both CCND1 and E2F2 was in fact found to be significantly down-regulated upon exposure to MWCNTs in this study (Fig 5A), further validating the increased levels of miR-20a-5p in our study and its regulatory role in targeting these genes (Fig 5A). [score:9]
In fact, some of the miRNAs (e. g., ↑hsa-miR-20a-5p, ↑hsa-miR-21-5p, ↑hsa-miR-23a-5p, ↓hsa-miR-16-5p) and their mRNA targets aberrantly expressed in exposed workers are known to play critical roles in cell proliferation, apoptosis, tumor invasiveness and tumorigenesis as well as the pathogenesis of cancer including and NSCLC [103, 112– 120]. [score:5]
Importantly, the different members of miR-17-92 cluster including miR-20a-5p –located on Chr13q31 –and mostly target genes involved in regulation and execution of G1/S transition, such as CCND1, E2Fs. [score:4]
A significant up-regulation of oncomiR mir-21-5p and miR-20a-5p (belonging to oncogenic miR-17-92 family or cluster) was found in the blood samples of MWCNT exposed workers (S1 File). [score:4]
Some miRNAs, such as miR-20a-5p, a member of miR-17-92 cluster, and miR-146a-5p, were located in the central positions with multiple target mRNAs. [score:3]
2014; 2014: 8 doi: 10.1155/2014/756975 117 Wang M, Gu H, Wang S, Qian H, Zhu W, Zhang L, et al Circulating miR-17-5p and miR-20a: molecular markers for gastric cancer. [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 26
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, hsa-mir-331, hsa-mir-422a
Since miR-20a targets TGFβ1 signaling pathways and regulates activation of SMAD2/3, it may activate epithelial-to-mesenchymal transition (EMT) and facilitate the migration. [score:4]
As can be seen, the NRP1 -positive cells had a moderately higher basal rate of proliferation and these cells responded to miR-20a by increased proliferation, whereas those with NRP1 knockdown did not. [score:2]
miR-20a, a member of the miR-17-92 cluster, activates proliferation of renal clear cells carcinomas [18] and our observations are consistent with the previous report. [score:1]
F. 1 nM miR-20a does not modulate the binding of VEGF to sNRP1. [score:1]
This selective activation by miR-20a was completely canceled by the NRP1 antibody (Figure 6B). [score:1]
In addition, the effect miR-20a on migration was antagonized by a competitor miRNA, which binds to NRP1 but does not participate in miRNA-specific signaling and does not affect migration (see Methods) (Figure 5D). [score:1]
C. Prior knockdown of NRP1 with siRNA abrogated the response of 786-O cells to miR-20a in the proliferation assay. [score:1]
B. Division of 768-O cells is activated by miR-20a, miR-331, and miR-422. [score:1]
We found that full-length AGO2 binds miR-20a with an affinity that is lower than that of NRP1: Kd =7.272±4.692 nM and 0.3864±0.02742 nM, respectively. [score:1]
Figure 5 A. 768-O cells pre -loaded with CFSE and treated with miR-20a or miR-422. [score:1]
Figure 4 A. miR-20a, pre-complexed or not with 1 nM sNRP1, binds to the plate coated with the Piwi domain of AGO2. [score:1]
A. miR-20a, pre-complexed or not with 1 nM sNRP1, binds to the plate coated with the Piwi domain of AGO2. [score:1]
A. 768-O cells pre -loaded with CFSE and treated with miR-20a or miR-422. [score:1]
The panel of miRNAs included miR-20a, miR-138, miR-331, miR-422, and control RNA, which were biotinylated using the Pierce biotinylation kit. [score:1]
G. 1 nM VEGF insignificantly affects the affinity of miR-20a to sNRP1. [score:1]
C. Pre-treatment of the sNRP1-coated plate with anti-NRP1 antibody (ab) prevents binding of miR-20a to the plate. [score:1]
This suggests that unassisted neuropilin -mediated uptake of miR-20a was able to induce specific response in vascular endothelial cells. [score:1]
AGO2 is pre-mixed or not with the equimolar amount of miR-20a and serially diluted after 1 h incubation. [score:1]
For example, treatment with miR-20a increased migration, and this effect was neutralized by a competing miRNA that does not affect migration by itself. [score:1]
Of the miRNAs tested miR-20a, but not miR-331 and miR-422 mimics activated tube formation (Figure 6A). [score:1]
Migration of ACHN cells was notably activated by miR-331, but miR-20a and miR-422 were much less effective (Figure 5E). [score:1]
In case of the miRNA competition the cells were pre -treated with the competitor 30 min before adding the equal amount of miR-20a. [score:1]
[1 to 20 of 22 sentences]
38
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
In analysis of the expression of the meningioma 1 (MN1) gene and MN1 -associated microRNA in Chinese adult de novo acute myeloid leukemia (AML) patients, Xiang found that increased expression of MN1 was associated with reduced miR-20a expression and increased miR-181b expression. [score:9]
While up-regulation of miR-20 was associated with higher complete remission rates and overall survival [105], miR-204 expression was reduced in AML patients and low miR-204 expression was correlated with short patient survival [114]. [score:8]
In addition, miR-20a up-regulation was also associated with a higher complete remission rate and longer overall survival [105]. [score:4]
Expression signatures of a minimum of two (miR-126/126*), three (miR-224, miR-368, and miR-382), and seven (miR-17-5p and miR-20a, along with the aforementioned five) miRNAs could correctly distinguish CBF, t (15;17), and MLL-rearrangement AMLs, suggesting that these microRNAs may cooperate with specific translocation in leukemogenesis [107]. [score:3]
Analyses of over 430 miRNAs in 50 clinical T-ALL samples revealed a common signature: miR-223, miR-19b, miR-20a, miR-92, miR-142-3p, miR-150, miR-93, miR-26a, miR-16 and miR-342 [59]. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 24
Figure 3miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation Both gain- and loss-of-function in vivo studies of miR-126 in mouse mo dels demonstrated that either enforced expression or knockout of miR-126 substantially promoted development of t(8;21) AML in mice [75]. [score:10]
miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation. [score:6]
Fischer et al identified that miR-17, miR-18a, miR-20a and miR-93 all function as the CBF-AML fusion proteins in negative regulating their target RUNX1 and the RUNX1-miR-221-KIT axis [74]. [score:4]
miR-18a, miR-20a and miR-93 are frequently upregulated in distinct subtypes of non-CBF-AML [74]. [score:4]
[1 to 20 of 4 sentences]
40
[+] score: 24
During MC3T3 osteogenic differentiation, miR-29b-3p, miR-29c-3p and miR-204 expression was upregulated, both at day 3 and at day 7 of differentiation, while miR-146b-5p and miR-20a-5p were upregulated only at day 7 of differentiation, which is in agreement with microarray results (Figure 2A; Supplementary Figure 1). [score:9]
Results obtained show that miR-29b-3p, miR-29c-3p and miR-20a-5p were upregulated upon osteogenic differentiation, while miR-143-3p, miR-195-5p and miR-497-5p were downregulated (Figure 2B). [score:7]
Upregulation of miR-20a during human osteogenic differentiation was previously described by Zhang et al. [23]. [score:4]
Therefore, we analyzed miR-20a expression in our MSC samples as a positive control. [score:3]
miR-146b-5p, miR-29b-3p, miR-29c-3p, miR-20a-5p, miR-143-3p, miR-195-5p and miR-497-5p expression levels were measured by quantitative real-time PCR. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 23
Other miRNAs from this paper: hsa-mir-17
e Immunoblotting analysis by using indicated antibodies on whole protein lysate from U87MG transfected with a construct carrying the ORF and 3′UTR of TRIM8 or the ORF and 3′ UTR of TRIM8 containing a deletion of miR-17 complementary site and a miR-17 mimic, miR-17 inhibitor, or miR-control Next, to test whether miR-17 or miR-20a directly target the 3′UTR of TRIM8, HEK293 cells were co -transfected with 3′UTR TRIM8 reporter construct along with a synthetic mimic of miR-17 or of miR-20a. [score:6]
e Immunoblotting analysis by using indicated antibodies on whole protein lysate from U87MG transfected with a construct carrying the ORF and 3′UTR of TRIM8 or the ORF and 3′ UTR of TRIM8 containing a deletion of miR-17 complementary site and a miR-17 mimic, miR-17 inhibitor, or miR-controlNext, to test whether miR-17 or miR-20a directly target the 3′UTR of TRIM8, HEK293 cells were co -transfected with 3′UTR TRIM8 reporter construct along with a synthetic mimic of miR-17 or of miR-20a. [score:6]
To experimentally in vitro test whether TRIM8 is directly targeted by miR-17 and miR-20a, the 3′UTR of TRIM8 gene carrying wild type and mutated miRNA seed was inserted into a luciferase reporter vector and the entire genomic coding region of the miR-17-92 cluster was cloned into pcDNA3 expression plasmid. [score:6]
The reporter construct, pSV-Renilla (pRL-SV40, Promega) and miR-17 mimic (or miR-17-5p hairpin inhibitor or miR-20a mimic, Dharmacon) or pcDNA3- miR-17-92 were transfected into H1299, HEK293 or MCF-7 cells using Hyperfect Transfection Reagent (Qiagen) or Lipofectamine 2000 (Life Technologies). [score:3]
As a result, we found that the 3′UTR of TRIM8 contains two putative conserved miR-17 and miR-20a binding sites. [score:1]
b HEK293 cells were co -transfected with reporter constructs carrying the 3′UTR of TRIM8 or 3′ UTR of TRIM8 containing mutated miR-17 complementary site and a synthetic mimic of miR-17, mimic of miR-20a, or miR-control (miR-CNT). [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 23
The ANOVA test showed significant differences between control, MGUS, diagnostic and CR samples in the expression levels of miR-16 (P < 0.001), miR-17 (P < 0.001), miR-19b (P < 0.001), miR-20a (P = 0.002), miR-660 (P < 0.001) and miR-25 (P < 0.001), with the highest levels of expression observed in samples from healthy controls. [score:5]
A microarray analysis found six miRNAs (miR-148a, miR-181a, miR-20a, miR-221, miR-625 and miR-99b) that were upregulated in patients with MM compared to healthy controls [20]; miR-221 and miR-99b were related to the karyotype of the disease, whereas miR-148a and miR20a were related to relapse-free survival [20]. [score:5]
A non-significant trend towards a difference in miR-331 expression was observed, and there were no significant differences between expression levels of miR-16, miR-17, miR-20a, miR-25 or miR-660. [score:5]
The analysis of the 14 miRNAs identified in the screening phase confirmed the differential expression of five miRNAs between the diagnostic and CR samples of the patients with MM: miR-16 (P = 0.028), miR-17 (P = 0.016), miR-19b (P = 0.009), miR-20a (P = 0.017) and miR-660 (P = 0.048) (Figure 2). [score:3]
Moreover, the expression of five of these miRNAs miR-16, miR-17, miR-19b, miR-20a and miR-660 – increased at the time of CR, and two of the 14 miRNAs miR-19b and miR-331 – were linked to PFS after ASCT. [score:3]
miR-16, miR-17, miR-19b, miR-20a and miR-660 as markers of CR. [score:1]
Differential serum levels of miR-16, miR-17, miR19b, miR-20a, miR-25 and miR-660 in patients with multiple myeloma (MM) at diagnosis (Dx) and at complete remission (CR), in patients with monoclonal gammopathy of undetermined significance (MGUS), and in healthy controls (HC). [score:1]
[1 to 20 of 7 sentences]
43
[+] score: 23
However, compared to controls, curcumin pretreatment upregulated 14 H [2]O [2]-modulated miRNAs of which seven miRNAs (miR-20a: p=0.001, FC=2.89; miR-126: p=0.006, FC=4.35; miR-146a: p=0.037, FC=2.89; miR-150: p=0.005, FC=4.59; miR-155: p=0.049, FC=2.40; miR-29b: p=0.016, FC=4.02; and miR-142–3p: p=0.036, FC=20.57) were also significantly upregulated by curcumin treatment alone. [score:6]
In our investigation, curcumin significantly induced the expression of five miRNAs (miR-146a, miR-150, miR-155, miR-20a, miR-22, and miR-126) that target downstream molecules such as VEGF, NF-κB, PDGFβ, and endothelin 1. The mechanism of action of curcumin on the modulation of miRNA expression is not well understood. [score:5]
However, miR-20a was also reported to target VEGF, indicating negative feedback regulation of miR-20a on VEGF [41]. [score:4]
Five miRNAs (miR-20a, miR-126, miR-146, miR-150, and miR-155) that target VEGF-A, platelet-derived growth factor β (PDGFβ), NF-κB, endothelin 1, p53, and AT [1]R were tightly clustered together in curcumin -treated samples, and their expression was significantly (p<0.05) different compared to the controls. [score:4]
Based on statistical significance (p<0.05) and 2 -FC, curcumin alone significantly increased the expression of nine miRNAs (miR-18a, miR-22, miR-20a, miR-29b, miR-126, miR-142–3p, miR-146a, miR-150, and miR-155). [score:3]
VEGF was reported to induce miR-20a and miR-155 in human umbilical vein endothelial cells [40]. [score:1]
[1 to 20 of 6 sentences]
44
[+] score: 23
This downregulation of Pur-α in monocytes was attributed to the robust expression of a group of miRNAs that included miR-15a, miR-15b, miR-16, miR-20a, miR-106b, and miR-93, which all directly targeted the 3′UTR of Pur-α [229]. [score:9]
Employing a similar microarray -based approach, Triboulet et al. [181] showed that, while 11 cellular miRNAs (including miR-122, miR-297, miR-370, and miR-373) were upregulated, just two cellular miRNAs, miR-17-5p and miR-20a were downregulated upon HIV-1 infection in the Jurkat cells. [score:7]
Though, neither miR-17-5p nor miR-20a could directly target the viral RNA, both miRNAs had four binding sites located on the 3′-UTR of histone acetyltransferase P300/CBP -associated factor (PCAF), an important cellular cofactor for the viral Tat function. [score:4]
Intriguingly, Whisnant et al. [222] failed to detect any significant alteration in the expression levels of miR-17-5p and miR-20a in HIV-1-infected primary CD4 [+] PBMCs. [score:3]
[1 to 20 of 4 sentences]
45
[+] score: 23
miRNAs predominantly affect protein expression, so we initially used a stable isotope labelling in cell culture (SILAC) -based approach to identify miR-17∼19b- and miR-20a-regulated proteins. [score:4]
We further confirmed this by a complementary approach using lentiviral overexpression of antagomirs against miR-17, miR-18 and miR-20a in the human BCR-ABL -positive BV173 cell line. [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
miR-20a overexpression showed similar, but weaker, effects to miR-17∼19b in preliminary experiments (data not shown). [score:3]
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
Together, these data demonstrate direct and functional miRNA binding of miR-17∼19b members namely miR-17/miR-20a and miR-18a to human BCL2 mRNA. [score:2]
In human BCL2, we identified 13 binding sites for miR-17∼19b miRNAs (five sites for miR-17, six sites for miR-18a and two sites for miR-20a) located within the CDS and 3′UTR (Supplementary Figure 3B). [score:1]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
Notably, six binding sites for miR-17∼19b miRNAs (three sites for miR-18a, two sites for miR-17 and one site for miR-20a) are located within the 5′UTR and CDS of murine Bcl2 (Supplementary Figure 3A). [score:1]
TonB cells metabolically labelled with heavy, medium, or light isotope lysine and arginine versions were lentivirally transduced with miR-17∼19b, miR-20a, or a control vector (SIEW). [score:1]
Protein abundance was only slightly affected in miR-20a cells and thus, respective proteins were not further analysed. [score:1]
[1 to 20 of 11 sentences]
46
[+] score: 23
Down-regulation of miR-20a-5p triggers cell apoptosis to facilitate mycobacterial clearance through targeting JNK2 in human macrophages. [score:6]
Similarly, miRNA-20a targets ATG7 and ATG16L1 and is able to inhibit autophagy (Guo et al., 2016). [score:5]
MicroRNA-20a inhibits autophagic process by targeting ATG7 and ATG16L1 and favors mycobacterial survival in macrophage cells. [score:4]
According to recent findings, miR-20a-5p functions as a negative regulator of mycobacterial-triggered apoptosis and inhibition of miR-20a-5p results in more efficient Mtb clearance (Zhang et al., 2016). [score:4]
miR-20a-5p, miR-21, miR-209-5p, and miR-145 also regulate apoptosis. [score:2]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016 With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
[1 to 20 of 7 sentences]
47
[+] score: 23
A comparison was performed between the miRNAs upregulated in both MMTBI and STBI group which identified a signature of 10 miRNAs viz miR-151-5p, miR-195, miR-20a, miR-328, miR-362-3p, miR-30d, miR-451, miR-486, miR-505* and miR-92a, with increased expression in both MMTBI and STBI groups (Fig. 2, Common miRNAs in MMTBI and STBI are highlighted in bold in Tables 1 and 2). [score:6]
Validation in CSF samples showed that expression of miR-328, miR-362-3p miR-486 and miR-451 was significantly upregulated, however; no significant elevation in levels of miR-151-5p, miR-30d and miR-20a was detected. [score:6]
This analysis identified 30 genes as direct targets for the 8 miRNA candidate miR-151-5p, miR-195, miR-328-3p, miR-362-3p, miR-30d, miR-20a, miR-486 and miR-92a. [score:4]
Similar observation was also found for miR-20a. [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
The analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75, p value < 0.016), miR-451 (0.82, p value < 0.002), miR-328 (0.73, p value < 0.030), miR-92a (0.86, p value < 0.001), miR-486 (0.81, p value < 0.003), miR-505 (0.82, p value < 0.002), miR-362 (0.79, p value < 0.006), miR-151 (0.66, p value < 0.123), miR-20a (0.78, 0.007). [score:1]
The AUC’s were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86), miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78). [score:1]
Comparison of miRNAs modulated in this study with that of serum miRNA from blast induced MMTBI in rats show common miRNAs such as miR-20a, miR-362-3p, miR-195, miR-451 and miR-92a. [score:1]
There were significant differences between the two groups for all but two of the selected miRNA: miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p < 0.101); miR-92a (p < 0.001); miR-486 (p < 0.006); miR-505 (p < 0.008); and miR-362 (p < 0.035); miR-151 (p < 0.065); and miR-20a (p < 0.012) (Fig. 5). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA (see asterisks): miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101); miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035); miR-151 (p = 0.065); and miR-20a (p = 0.012). [score:1]
[1 to 20 of 10 sentences]
48
[+] score: 22
The mitogen-activated protein kinase (MAPK) signaling pathway was associated with the smallest P-value (1.8×10 [−11]) among the pathways targeted by the five miRNAs over-expressed in NPC exosomes, which included hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:5]
Another study noted that hsa-miR-20a-5p targets the JAK1 gene to regulate the JAK/STAT signaling pathway [57]. [score:4]
E. The identification of five over-expressed miRNAs in P-serum-EXOs/N-serum-EXOs, TW03 (EBV [+])-EXOs/NP69-EXOs, and TW03 (EBV [−])-EXOs/NP69-EXOs: hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908. [score:3]
Five miRNAs, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were commonly over-expressed in the exosomes from P-serum and TW03 (EBV [+]) or TW03 (EBV [−]) cells (Fig. 5E). [score:3]
For example, miR-20a-5p, miR-24-3p, and miR-106a-5p converge on MAPK1 and miR-20-5p and miR-106a-50 converge on TAOK3, demonstrating a combinatorial effect of miRNAs on the same target. [score:3]
This is consistent with our findings indicating that exosomes alter the phosphorylation of STAT proteins in tumor -induced CD4 [+] T cells to affect T-cell differentiation and that hsa-miR-20a-5p was over-expressed in NPC exosomes. [score:3]
Our results showed that five exosomal miRNA clusters, including hsa-miR-24-3p, hsa-miR-891a, hsa-miR-106a-5p, hsa-miR-20a-5p, and hsa-miR-1908, were abundant in NPC tumor-derived exosomes from patient sera or TW03 cell lines versus the exosomes from healthy donor sera or NP69 cells. [score:1]
[1 to 20 of 7 sentences]
49
[+] score: 22
More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55]. [score:16]
Moreover, c-MYC regulates the transcription of miRNAs from miR-17 cluster and two of them (miR-17-5p and miR-20) regulate transcription factor E2F1 at the translational level [52], which is also transcriptionally activated by c-MYC [89]. [score:5]
-26.80 ERB B3 648 hsa-miR-20a. [score:1]
[1 to 20 of 3 sentences]
50
[+] score: 22
These miRNAs had overlapping and cooperative effects on tumor suppressor genes with miR-19b directly targeting PTEN and BIM; miR-20a directly targeting PTEN, BIM and PHF6; miR-92 directly targeting IKAROS/ IKZF1, PTEN, BIM, NF1 and FBXW7, and miR-223 directly targeting FBXW7, respectively. [score:15]
Mavrakis et al. [46] further identified five miRNAs (miR-19b, miR-20a, miR-26a, miR-92 and miR-223) that contributed to leukemogenesis and acted as multi -targeted regulators of several tumor suppressor genes (IKAROS/ IKZF1, PTEN, BIM, PHF6, NF1 and FBXW7). [score:6]
Three of these miRNAs (miR-19b, miR-20a, and miR-92) belong to the oncogenic miR-17-92 cluster. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 22
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In contrast to the clear upregulation observed for miR-155, the expression of the miR-17~92 cluster (especially miR-17-3p and miR-20a) tended to decrease along differentiation. [score:6]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
Interestingly, the expression level of miR-20a was significantly increased in the central memory subset, in contrast to more differentiated subsets. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
[1 to 20 of 5 sentences]
52
[+] score: 21
Treatment of Panc-1 with G2535 elicited decreased expression of the oncogenic miRNAs miR-17, miR-20a, miR-106a, miR-222 and increased expression of the tumor suppressor miRNAs let-7a, let-7d, let-7e and let-7f. [score:7]
Upon treatment of Colo-357 with G2535, the oncogenic miRNAs miR-17, miR-19b-1, miR-20a, miR-106a, miR-200b and miR-221 showed decreased expression and the tumor suppressor miRNAs let-7a, let-7b, let-7c, let-7d, let-7f, let-7i and miR-16-1 showed increased expression. [score:7]
In regards to Colo-357, treatment with B-DIM showed decreased expression of the oncogenic miRNAs miR-17, miR-19b-1, miR-20a and miR-106a. [score:3]
Upon treatment of Panc-1 with B-DIM, the oncogenic miRNAs miR-17, miR-20a, miR-106a, miR-221, and miR-222 all showed decreased expression. [score:3]
Falling into this category is the group of six miRNAs termed the miR-17-92 cluster which is made up of miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1 [49]. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
In contrast, ICI 182,780 increased the expression of miR-20a and miR-21 in MSMC and LSMC, and miR-26a in MSMC, while inhibiting the expression of miR-26a in LSMC [210]. [score:7]
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
Genes targeted by three of the altered miRNAs were examined: miR-20a regulates E2F1, miR-106a regulates RBI, and miR-127 regulates BCL6. [score:6]
Western blot of mammary gland lysates after 12 wks of E [2] showed that levels of RBI and E2F1 were decreased and BCL6 protein was increased, data that are in agreement with the increase miR-20a and miR-106a and the decrease in miR-127 detected [198]. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 20
Our results revealed up-regulation of miR-20a-5p and miR-451a, and down-regulation of miR-204-5p, miR-424-5p, miR-126-3p, miR-26a-5p and miR-9-5p in the sera of CHD-PAH patients. [score:7]
We have previously reported that miR-20a-5p directly targets the PRKG1 gene, thereby promoting the proliferation and migration of PASMCs but inhibiting cell differentiation 30. [score:6]
We found that two miRNAs (miR-20a-5p and miR-451a) were significantly up-regulated and five miRNAs (miR-204-5p, miR-424-5p, miR-126-3p, miR-26a-5p and miR-9-5p) were significantly down-regulated in CHD-PAH sera compared to the healthy controls (Fig. 7). [score:6]
We first performed first screen by pooling serum samples of 24 healthy subjects and 24 patients with CHD-PAH and fourteen miRNAs (miR-451a, miR-9, miR-424, miR-223, miR-204, miR-150, miR-328, miR-21, miR-34a, miR-34b, miR-26a, miR-27b, miR-126 and miR-20a) changed more than 1.5-fold. [score:1]
[1 to 20 of 4 sentences]
55
[+] score: 20
In contrast, expression of miR-19a and miR-20a was downregulated in mouse NS cell differentiation. [score:6]
In contrast, antiapoptotic miR-20a was mainly downregulated throughout neural differentiation. [score:4]
In fact, transfection of hematopoietic progenitors with miR-20a increased the proliferation of monocytes and blocked differentiation, whereas inhibition of miR-20a caused a decrease in proliferation and more rapid differentiation and maturation. [score:3]
Expression of specific proapoptotic (miR-16, let-7a and miR-34a) and antiapoptotic miRNAs (miR-20a and miR-19a) were analyzed by quantitative Real Time-PCR from 10 ng of total RNA using specific Taqman primers and GAPDH for normalization. [score:2]
However, additional studies are required to determine the specific role of both miR-20a and miR-19a during cell differentiation, and also evaluate if their expression is restricted to a specific cell type. [score:1]
Recently, additional functions have been assigned to this cluster, particularly to miR-20a and miR-19a. [score:1]
miR-19a and miR-20a are members of the miR-17-92 cluster [61], which consists of seven mature miRNAs, previously linked to tumorigenesis. [score:1]
Specifically, miR-20a was shown to control monocyte differentiation [62]. [score:1]
Our results, showing that miR-20a decreases during mouse NS cell differentiation, are in agreement with this previous report. [score:1]
[1 to 20 of 9 sentences]
56
[+] score: 20
Here, we selected four highly expressed miRNAs in 293A cells (miR-20a, -92a, -195 and -497) (S1 Fig) and determined the miRNA inhibition efficiency by transfecting various amount of each corresponding dTuD vector. [score:5]
The initial expression levels of miR-20a, -92a, -195 and -497 in 293A cells. [score:3]
293A cells were transfected with dTuD targeting miR-20a, -92a, -195 or -497 at the concentration of 0, 100, 200, 400 and 800 ng/mL. [score:3]
The expression of miR-20a, 92a and 195 were at nearly the same level in 293A cells (S1 Fig). [score:3]
35%, 73%, 53% and 35% of miR-20a, -92a, -195 and -497 were efficiently inhibited by each corresponding dTuD at the concentration of 800 ng/mL. [score:3]
0143864.g002 Fig 2 293A cells were transfected with dTuD targeting miR-20a, -92a, -195 or -497 at the concentration of 0, 100, 200, 400 and 800 ng/mL. [score:3]
[1 to 20 of 6 sentences]
57
[+] score: 20
Moreover, E6 can degrade p53 [27, 28], thus upregulating the expression of miR-17-5p, miR-20a-5p, and miR-106b-5p [29]. [score:6]
Here, we identified eight types of miRNAs, namely, the highly expressed miR-15a-5p, miR-17-5p, miR-20a-5p, miR-21-5p, miR-96, miR-106b-5p, and miR-3653 as well as the poorly expressed miR-497-5p. [score:5]
The qRT-PCR results demonstrated that miR-106b-5p (p = 0.000), miR-3653 (p = 0.000), miR-17-5p (p = 0.000), miR-96 (p = 0.000), miR-15a-5p (p = 0.000), miR-20a-5p (p = 0.000), and miR-21-5p (p = 0.000) were highly expressed in cancer tissues, while miR-497-5p (p = 0.016) was expressed at very low levels. [score:5]
These findings imply that miR-15a-5p, miR-17-5p, miR-20a-5p, miR-21-5p, and miR-106b-5p are molecular targets of HPV in vivo. [score:3]
These miRNAs included miR-106b-5p, miR3653, miR-3188, miR-497-5p, miR-218-5p, miR-17-5p, miR-96, miR-15a-5p, miR-20a-5p, miR-21-5p, and miR-590-5p (Table 3). [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 19
It has been found that, in chronic gastritis, the expression of miR-1 and miR-155 is upregulated, whereas the expression of miR-20, miR-26b, miR-202, miR-203, and miR-205 is downregulated. [score:11]
MiR-20a is capable of suppressing p21 expression. [score:4]
CagA activates c-Myc through the activation of the Erk pathway, which further stimulates the expression of miR-17 and miR-20a. [score:3]
Studies conducted by Saito et al. showed that miR-17 and miR-20a are also involved in the gastric cancer-promoting signaling pathways mediated by CagA [89, 90]. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 19
MicroRNA-20a-5p promotes colorectal cancer invasion and metastasis by downregulating Smad4. [score:3]
miR-20a targets BNIP2 and contributes chemotherapeutic resistance in colorectal adenocarcinoma SW480 and SW620 cell lines. [score:3]
There is evidence that miR-20a promotes cell cycle progression in response to the multifunctional cytokine, transforming growth factor beta (TGF-β), a pro-metastasis but growth-repressive cytokine that represses MYC expression, induces p21 (CDKN1A), and delays entry into G1/S phase. [score:3]
MiR-20a promotes CRC cell line migration, invasion and the expression of EMT markers (Sokolova et al., 2015; Xu et al., 2015; Cheng et al., 2016). [score:2]
The direct repression of CDKN1A and constituents of a MYC-repressing complex (consisting of E2F5 and KLF11) by miR-20a were identified as key interactions contributing to the ability of miR-20a to neutralize the growth-repressive properties of TGF-β (Sokolova et al., 2015). [score:2]
The effects of miR-20a on p21: two mechanisms blocking growth arrest in TGF-beta-responsive colon carcinoma. [score:1]
The human miR-17 family consists of eight miRNAs (miR-17, miR-18a/b, miR-20a/b, miR-93, and miR-106a/b), with three of these (miR-17, miR-18a, and miR-20a) transcribed from the miR-17-92 miRNA locus. [score:1]
Like miR-20a, miR-106a/b also appear to enhance metastasis or an EMT phenotype. [score:1]
The TGF-β pathway, which is important for repressing cellular proliferation and cell cycle progression is also antagonized by several miRNAs, including miR-17/106, miR-135b, and miR-20a through effects on TGFBR2 and SMAD4. [score:1]
microRNA-20a enhances the epithelial-to-mesenchymal transition of colorectal cancer cells by modulating matrix metalloproteinases. [score:1]
Several members of this cluster, such as miR-17 (Ng et al., 2009; Yu et al., 2012), miR-20a (Schetter et al., 2008; Motoyama et al., 2009; Earle et al., 2010; Yu et al., 2012), miR-92a (Motoyama et al., 2009; Ng et al., 2009; Earle et al., 2010; Tsuchida et al., 2011; Schee et al., 2012; Wu et al., 2012; Yu et al., 2012) and miR-18a (Motoyama et al., 2009; Brunet Vega et al., 2013; Zhang et al., 2013b), are all reportedly increased in CRC tumors and in serum/plasma, with their elevated levels correlating with recurrence and poor prognosis. [score:1]
[1 to 20 of 11 sentences]
60
[+] score: 19
In contrast to no effect of p100 on expression of miR-17/miR-20, the results from using p100 knockdown and constitutive expression revealed that p100 was crucial for miR-302d expression. [score:8]
However, our results indicated that p100 deletion failed to affect expression of miR-17/miR-20 although p100 exhibited an inhibitory effect on cyclin d1 mRNA 3′-UTR activity. [score:5]
The expression of these miRNAs were therefore determined in both p100+/+ and p100−/− cells, and the expression of miR-302a, miR-302b and miR-302d was found to be significantly decreased in p100−/− cells, whereas there was no observable difference on miR-17, miR-19a, miR-20a and miR-106b between p100+/+ and p100−/− cells (Figure 4E). [score:5]
The potential miRNA of miR-17/miR-20a cluster has been reported to inversely correlate to Cyclin D1 abundance in human breast cell lines [41]. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 19
All six miRNAs were overexpressed in HCC when compared to the adjacent normal liver, with miR-17 and miR-106b (p value<0.001) being the most overexpressed and miR20-b being minimally overexpressed (p value=0.03) (Figure 1A). [score:6]
Notably, we confirmed that MYC regulates miR-17, but not miR-19 or miR-20 expression (Supplementary Figure 5), as has also been described by us previously [9]. [score:4]
Figure 1 A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
The miR-17 family (miR-17, miR-20a, miR 20-b, miR 106-a, miR 106-b, miR-93) and MYC expression was examined in human HCC from the cancer genome atlas (TCGA) [16]. [score:3]
[1 to 20 of 5 sentences]
62
[+] score: 19
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. [score:5]
[1 to 20 of 3 sentences]
63
[+] score: 19
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
Two members of the polycistron, miR-17-5p and miR-20a, downregulate E2F1, which is a direct target of MYC that promotes cell cycle progression. [score:7]
Further dissection of the genetic complexity of the cluster was demonstrated by generating conditional knockout alleles of the four seed regions represented in the cluster: miR-17, miR-20a; miR-18a; miR-19a, miR-19b-1; miR-92-1 [32]. [score:2]
Distinctive miRNA signatures obtained using unsupervised hierarchical clustering could distinguish these three groups based on just 16 miRNAs with miR-17~92 cluster members (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-20b, and miR-92) and its paralog miR-106a, being the predominant one in addition to miR-29a/c,miR-100, miR-199a*, miR-140, miR-630, and miR-16 [49]. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 19
Because of the previous study of Stern-Ginossaret al. reported that miRNAs (miR-20a, miR-93 and miR-106b) could downregulate MICA and MICB expression [16], two types of reporter mutants were generated. [score:6]
Xie J. Liu M. Li Y. Nie Y. Mi Q. Zhao S. Ovarian tumor -associated microRNA-20a decreases natural killer cell cytotoxicity by downregulating MICA/B expressionCell Mol. [score:6]
The studies of Stern-Ginossa et al. reported that miR-20a, miR-93 and miR-106b could control MICA and MICB expressions [16] and recent study of Tsukerman et al. also showed that MICB expressions were regulated by miR-10b [31]. [score:6]
One type of constructs contained the mutated binding sites of both known miRNAs (miR-20a, miR-93 and miR-106b) and nine novel miRNAs (our candidate miRNAs, miR-320c, miR-320a, miR-320b, miR-320c, miR-320d, miR-542-3p, miR-641, miR-661 and miR-940) and another type contained only the mutated binding sites of known miRNAs as a positive control (Figure 3A). [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 18
The cooperative regulation of human and viral miRNAs of the apoptotic pathway is demonstrated in Figure 8. The dashed arrows indicate validated targets of miR-17, mir-20a, and miR-BART5, and the solid arrows indicate the new regulation pattern discovered in our module. [score:5]
In their research, host miR-17 and miR-20a were found to be downregulated following human immunodeficiency virus (HIV-1) infection. [score:4]
A number of recent works ([62- 64]) have also identified BIM as a direct target of multiple members of the miR-17-92 cluster (including mir-17 and miR-20a). [score:4]
Furthermore, O'Donnell et al. [51] validated that E2F1 is a target of miR-17 and miR-20a. [score:3]
miR-17 and miR-20a belong to the genomic cluster miR-17-92. [score:1]
The module consists of three human miRNAs, miR-17, miR-20a, and miR-15b, one viral miRNA, miR-BART5, and three human genes. [score:1]
[1 to 20 of 6 sentences]
66
[+] score: 18
Of the miRNAs expressed, miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c expression were significantly increased (p< = 0.05) in human macropahge after exposure to Toxoplasma infection for 24 h (Figure  1A). [score:5]
Together, these data demonstrate that STAT3 binding to the promoter element of the miR-17 ~ 92 gene mediates miRNAs (miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a) upregulation in human macrophage in response to Toxoplasma infection. [score:4]
Several miRNAs upregulated in human macropahge following Toxoplasma infection are cluster miRNAs; e. g., miR-19a, miR-19b and miR-20a are from the miR-17 ~ 92 gene cluster. [score:4]
Increased expression of miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c were noted in human macrophage at 6 h and 12 h postinfection, the abundance of these miRNAs significantly increased by ~23.5-fold at 24 h postinfection. [score:3]
Cells were transfected with specific anti-miRs (30 nM, Ambion) or a mixture of anti-miRs to miR-17-5b and miR-20a (a total of 30 nM with 15 nM for each), and then exposed to Toxoplasma for 24 h. The percentages of parasite -positive macrophage following exposure to Toxoplasma for 24 h was similar in all cultures, to those transfected with the specific anti-miRs (p > 0.05, Figure  4A), suggesting that those transfected with anti-miRs did not affect the number of parasite-infected macrophage. [score:1]
Of note, miR-19b, miR-19a and miR-20a are cluster gene miRNAs and co-transcribed with a host gene, C13orf25 [26]. [score:1]
[1 to 20 of 6 sentences]
67
[+] score: 18
Other miRNAs from this paper: hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221
In this mo del, downregulation of miR-20a caused a 4-fold increase in Cx43 expression and reduced the cell proliferation. [score:6]
Suppression of CX43 expression by miR-20a in the progression of human prostate cancer. [score:5]
The latter demonstrates that Cx43 is a direct target of miR-20a. [score:4]
Li et al. (2012a, b) found an inverse relationship between miR-20a and Cx43 protein and mRNA expression in human prostate tumors and cell lines. [score:3]
[1 to 20 of 4 sentences]
68
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
The selectivity of HDI -mediated silencing of AICDA/Aicda and PRDM1/Prdm1 was emphasized by unchanged expression of HoxC4 and Irf4 (important inducers/modulators of AICDA/Aicda), Rev1 and Ung (central elements for CSR/SHM), and Bcl6, Bach2, or Pax5 (repressors of PRDM1/Prdm1 expression), as well as unchanged expression of miR-19a/b, miR-20a, and miR-25, which are not known to regulate AICDA/Aicda or PRDM1/Prdm1. [score:8]
[1 to 20 of 2 sentences]
69
[+] score: 17
Among the miRNAs whose expression was suppressed by butyrate, members of the miR-106b family, including miR-17, miR-20a/b, miR-93 and miR-106a/b, regulate p21 translation and cancer cell proliferation [15, 16]. [score:8]
Previously, we reported that butyrate decreased miR-17 and miR20a levels in HCT116 cells, thereby allowing p21 expression to down-regulate cell proliferation [15]. [score:6]
As shown in Fig.   1e, consistent with previous reports [15, 26], miR-17, miR-18a, miR-19a/b and miR-20a, were decreased by 40 to 70 % after butyrate treatment. [score:1]
In addition to the aforementioned miR-17 and miR-20a, the miR-17-92a cluster encodes miR-18a, miR-19a/b and miR-92a. [score:1]
Butyrate treatment also decreased the levels of other miR-17-92a cluster members, including miR-17, miR-18a, miR-19a/b and miR-20a. [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 17
miR-92a is among the most consistently up-regulated miRNAs in gastric cancer [31], and miR-20a is involved in the carcinogenesis of gastric cancer through modulation of the EGR2 signaling pathway [43]. [score:4]
After 20 min miR-18a, miR-19a, miR-19b, and miR-20a were significantly down-regulated (Figure 2A). [score:4]
After 24 h of infection miR-17, miR-18a, and miR-20a were down-regulated; however, this trend was not significant. [score:4]
Li X. Zhang Z. Yu M. Li L. Du G. Xiao W. Yang H. Involvement of miR-20a in promoting gastric cancer progression by targeting early growth response 2 (EGR2) Int. [score:3]
Furthermore, miR-17 and miR-20a have been reported to have anti-carcinogenic effects by negatively regulating oncogenic cyclin D1 [44]. [score:2]
[1 to 20 of 5 sentences]
71
[+] score: 16
Similarly, miR-20a over -expression caused 50% suppression (p<0.0001) while miR-20a inhibition produced a 22% increase (p=0.0009). [score:7]
The sensitivity of the E2F1 3 [′]-UTR to intracellular 181b, miR-107, and miR-20a levels was determined by luciferase reporter gene expression in the presence of either synthetic miRNA or corresponding anti-miR inhibitor. [score:5]
To confirm that this response was not a reporter gene artefact, other E2F1 targeting miRNA miR-107 and miR-20a were also transfected and analysed. [score:3]
Panel B illustrates predicted binding sites for schizophrenia -associated miR-181b, miR-107, and miR-20a in the 3′-UTR of E2F1, as well as the AU-rich element in this 3′-UTR. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 16
[179] In addition, some non-BMP-regulated miRNAs also have regulatory roles in BMP signaling: miR-141 and -200a remarkably modulate the BMP-2 -induced pre-osteoblast differentiation through the translational repression of Dlx5; [180] miR-542-3p targets BMP7 and represses BMP7 -induced osteoblast differentiation and survival; [181] miR-20a promotes osteogenic differentiation through upregulation of BMP/Runx2 signaling by targeting PPARγ, Bambi, and Crim1; [182] miR-140 targets a mild inhibitor of BMP Dnpep, and loss of miR-140 in mice causes growth defects of endochondral bones and craniofacial deformities. [score:16]
[1 to 20 of 1 sentences]
73
[+] score: 16
However, only miR-17 and miR-20a were shown to directly target TGF-β receptor II and miR-18a was reported to target the TGF-β down-stream signaling proteins Smad2 and Smad4 (for review see [4]). [score:6]
Moreover, the expression of the closely related family members miR-17 (which only differs from miR-20a by 2 nucleotides) and miR-19a (which only differs from miR-19b by one nucleotide) was not significantly changed, and might compensate for the reduction in miR-20a and miR-19b expression, respectively. [score:5]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
However, the reduction of miR-19b and miR-20a in muscle tissue of miR-92a [−/−] mice was less than 50%. [score:1]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
[1 to 20 of 5 sentences]
74
[+] score: 16
The expression of cyclin -dependent kinase inhibitor CDKN1A (p21) is inhibited by miR-17-5p, miR-18a, and miR-20a. [score:7]
Five miRNAs of the cluster (miR-92-1, miR-19a, miR-20a, miR-19b, miR-17-5p) were upregulated in these cancer cell lines. [score:4]
Recently, Yu et al. reported that Cyclin D1, which has been demonstrated as an oncogenic protein in breast cancer cell, is negatively regulated by miR-17-5p and miR-20a [58]. [score:2]
The research group reported that E2F1 is negatively regulated by miR-17-5p and miR-20a. [score:2]
A polycistronic microRNA cluster termed miR-17-92, located in chromosome 13 open reading frame 25 (C13orf25) in the human genome, encodes seven miRNAs: miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92-1. Fig. (2) shows the genomic organization of this cluster. [score:1]
[1 to 20 of 5 sentences]
75
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-184, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
An overall down-regulation of the Rb pathway was apparent, with mutations in RB1 in three samples and global up-regulation of MDM2 (RB1 repressor) and of RB1 -targeting miRNAs (miR-215, miR-106a, miR-17, miR-20a, miR-93, miR-215, miR-21). [score:10]
The top five up-regulated oncogenic miRNAs were miR-93, miR-20a, miR-214, miR-146b and miR-92a (percentile rank of overexpressed miRNAs 92.9, 91.4, 84.3, 75.8 and 68, respectively). [score:6]
[1 to 20 of 2 sentences]
76
[+] score: 15
Other miRNAs from this paper: hsa-mir-23b, hsa-mir-142, hsa-mir-106b, hsa-mir-34b
The miRNA inhibitors (anti-miR-23b-5p, anti-miR-34b-3p, anti-miR-106b-5p, anti-miR-142–5p, anti-miR-20a-5p), miRNA inhibitor negative control, miR-106b-5p mimic and negative control mimic were designed and synthesized by RiboBio. [score:5]
In contrast, among the predicted miRNAs that might target SETD2, the expression of miR-23b-5p, miR-34b-3p, miR-106b-5p and miR-142–5p were significantly higher in ccRCC cell lines and tissues, while miR-20a-5p showed no significant difference (Figure 1G). [score:5]
To investigate whether the predicted microRNAs could regulate the expression of SETD2, we respectively transfected 100 nM synthesized antagomirs against miR-23b-5p, miR-34b-3p, miR-106b-5p, miR-142–5p and miR-20a-5p into 786-O as well as SN12-PM6 cells. [score:2]
786-O and SN12-PM6 cells were transfected for 72 h with 100 nM anti-miR negative control, anti-miR-23b-5p, anti-miR-34b-3p, anti-miR-106b-5p, anti-miR-142–5p or anti-miR-20a-5p. [score:1]
The microRNAs including miR-23b-5p, miR-34b-3p, miR-106b-5p, miR-142–5p and miR-20a-5p were tested among HK-2,786-O and SN12-PM6 cell lines (F) as well as ccRCC tissues (G) by real-time RT-PCR, using U6 as an internal control. [score:1]
Figure 2786-O and SN12-PM6 cells were transfected for 72 h with 100 nM anti-miR negative control, anti-miR-23b-5p, anti-miR-34b-3p, anti-miR-106b-5p, anti-miR-142–5p or anti-miR-20a-5p. [score:1]
[1 to 20 of 6 sentences]
77
[+] score: 15
Among the previously identified putative targets of synergistic miRNA regulation, we found two mRNAs, namely, NEURL1B and ZBTB24, with two miR-20a binding sites that reside in close proximity. [score:4]
For the detailed 3D mo del of two miRNA-Argonaute hybrids (miR-20a/hAgo2) attached to one stretch of target 3′ UTR (NEURL1B mRNA) we retrieved the crystal structure of miR-20a/hAgo2 determined by Elkayam et al. (24) through X-ray crystallography from the Protein Data Bank (PDB id: 4F3T). [score:3]
The 3D mo del of the RNA triplex in association with two AGO proteins suggests that it is the interaction between the two AGO proteins that provides additional stability for the RNA triplex (NEURL1B-miR-20a-miR-20a). [score:1]
All three 3D mo dels are depicted in Figure 4. Figure 4. NEURL1B mRNA and miR-20a/hAgo2 interaction. [score:1]
We selected the NEURL1B-miR-20a-miR-20a triplex to observe if AGO proteins have any impact on the stability of miRNA-mRNA hybridization in neighboring binding sites. [score:1]
For the analysis we built three mo dels: (i) miR-20a/hAgo2 attached to the first binding site in NEURL1B mRNA; (ii) miR-20a/hAgo2 attached to the second binding site and (iii) one miR-20a/hAgo2 complex attached to each of the two neighboring binding sites in the NEURL1B mRNA. [score:1]
All three 3D mo dels are depicted in Figure 4. Figure 4. NEURL1B mRNA and miR-20a/hAgo2 interaction. [score:1]
miR-20a as stick mo del is colored in green at the first binding site and colored in red at second binding site. [score:1]
Interestingly, we observed that the complex with two sets of miR-20a/hAgo2 bound to NEURL1B was more stable (potential energy: −61,822.58 kcal/mol) than both complexes with a single unit of miR-20a/hAgo2 (potential energy: −34,129.67 and −23,869.30 kcal/mol). [score:1]
Therefore, we utilized the structure of human argonaute-2 (hAgo2) in complex with miR-20a previously generated by Elkayam et al. (24) at 2.2 Å resolution (PDB ID: 4F3T) as basis for 3D mo deling. [score:1]
[1 to 20 of 10 sentences]
78
[+] score: 15
Indeed, overexpression of miR-17 and miR-20a inhibited senescence in primary human fibroblasts by blunting the activation of p21 [WAF1], while inhibition of miR-17 caused senescence in anaplastic thyroid cancer cells (Takakura et al., 2008; Hong et al., 2010). [score:7]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
Aging of HF-resistant mice, on the other hand, was accompanied by significantly enhanced expression of these miRNAs, except for miR-17 and miR-20a (Supporting information Table S1). [score:3]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
[1 to 20 of 4 sentences]
79
[+] score: 15
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
[1 to 20 of 2 sentences]
80
[+] score: 15
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Furthermore, we and Gorter et al. 24 observed the up-regulation of miR-17-5p, miR-20a-5p, miR-23a-3p and the down-regulation of miR-139-5p, whereas we and Bot et al. 23 observed the down-regulation of miR-551b-3p. [score:10]
First, a subgroup of miRNAs (miR-15b-5p, miR-17-5p, miR-18a-5p, miR-19a-3p, miR19b-3p, miR-20a-5p, miR-20b-5p, miR-21-5p, miR-23b-5p, miR-24-3p, miR-27a-3p, miR-92a-3p, miR-93-5p, miR-142-3p, miR-344b-2-3p, miR-431, miR-466b-5p and miR-674-3p) displayed increased expression levels during latency (4 and 8 days after SE), decreased their expression levels at the time of the first spontaneous seizure and returned to control levels in the chronic phase (Fig. 2, Supplementary Fig. S1). [score:5]
[1 to 20 of 2 sentences]
81
[+] score: 14
c-Myc binding upregulates the transcription factor E2F1 and two miRNAs in the miR-17-92 cluster, miR-17-5p and miR-20a, target E2F1 (O’Donnell et al., 2005). [score:6]
Volinia et al. (2006) showed that miR-20a also targets the tumor suppressor transforming growth factor beta receptor 2 (TGFBR2). [score:5]
This suggests that there is a negative feedback loop involving c-Myc, E2F1, miR-17-5p, and miR-20a whereby c-Myc induces expression of E2F1 and the post-transcriptional repressors of E2F1, miR-17-5p, and miR-20a. [score:3]
[1 to 20 of 3 sentences]
82
[+] score: 14
The modulation of miRNA expression following E6/E7 siRNA treatment was further confirmed by real-time quantitative PCR (RT-qPCR) for approximately three-quarters of the targets and among them, let-7d-5p, miR-20a-5p, miR-378a-3p, miR-423-3p, miR-7-5p, miR-92a-3p were downregulated and miR-21-5p was upregulated. [score:11]
Moreover, the miR-7-5p favors cell proliferation [96], the miR-20a-5p blocks oncogene -induced senescence by targeting p21 [97], and miR-92a-3p possesses anti-apoptotic properties [98]. [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 14
MiR-20a, miR-155, and miR-18a were found up-regulated in Kidney Neoplasms while miR-145 was found down-regulated. [score:7]
For example, miR-20a and miR-155 were confirmed to be up-regulated in Colon Neoplasms [69]. [score:4]
MiR-20a and miR-19b shown differential expression between neoplastic conditions and non-tumoral colon tissues [70]. [score:3]
[1 to 20 of 3 sentences]
84
[+] score: 13
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
At the latent stage, up-regulated miRNAs miR-20a, miR-17, miR-23a, miR-27a and miR-146a have been previously shown to be enriched in mouse microglia [58]. [score:4]
[1 to 20 of 2 sentences]
85
[+] score: 13
Mature miR-20a was used as the cytoplasmic control which showed no expression in the nucleolus, and its sequence is 5′DigN-cta cct gca cta taa gca ctt ta-3′. [score:3]
When these data were translated into fold-enrichment of the respective miRNAs in the isolated RISC (Figure 4B), we observed that miR-20a was about 6 times more likely than miR-484 to be co-purified with RISC. [score:3]
Cytoplasmic microRNA control miR-20a and a scrambled negative (f) control are also included. [score:1]
The miRNA identified in the qPCR screen to be nucleolus-excluded, miR-20a, was indeed found by ISH to be mostly cytoplasmic. [score:1]
However, significantly more miR-20a was detected in RISC isolated by AGO2 immunoprecipitation than miR-484. [score:1]
0070869.g004 Figure 4 (A) Relative abundance of miR-484 and miR-20a determined by in unfractionated HeLa cells and in AGO2 immunoprecipitates. [score:1]
As shown in Figure 4A, the total cellular content of miR-484 and miR-20a, miRNAs that are shown to be clearly nucleolar and cytoplasmic respectively (Figure 2A), are comparable. [score:1]
miR-484 and miR-20a bind to RISC with different efficiency. [score:1]
Two-step RT-PCR of miR-484 and miR-20a was performed by using Taqman MicroRNA Assays (life technologies) with special designed primers for both target miRNAs for reverse transcription and RT-PCR respectively. [score:1]
[1 to 20 of 9 sentences]
86
[+] score: 13
Downregulation or accumulation of subsets of miRNAs implies a tumor suppressor or oncogenic function, respectively, is often seen in tumor development, as in the examples of downregulated let-7 in lung cancer [5], deleted or downregulated miR-15 and miR-16 in chronic lymphocytic leukemia [6], and miR-17-5p and miR-20a control the balance of cell death and proliferation [7]. [score:13]
[1 to 20 of 1 sentences]
87
[+] score: 13
Because the expression of the miR-17 family is directly controlled by the proto-oncogene MYC [32]– [34] and because we have recently demonstrated (7) that in human keratinocytes lacking p63, MYC expression is down regulated, the down-regulation of miR-17, miR-20, miR-106a, miR-143 and miR-455-3p genes we observed in keratinocytes lacking p63 could be due to MYC down-regulation. [score:13]
[1 to 20 of 1 sentences]
88
[+] score: 13
As shown in Figure 2, the serum levels of miR-17, miR-20a and miR-106a were significantly elevated in response to virus infection (p < 0.01), consistent with the results from the TaqMan Arrays, while the expression of miR-376c in serum samples of H7N9 patients was slightly higher than that in healthy controls (p < 0.05). [score:3]
The ROC curves of miR-17, miR-20a and miR-106a showed a moderate distinguishing ability with a corresponding area under the curve (AUC) value of 0.897 (95% CI: 0.818–0.976), 0.825 (95% CI: 0.718–0.933) and 0.898 (95% CI: 0.798–0.998), respectively (Figure 3A–C). [score:1]
Furthermore, miR-17, miR-20a, miR-106a and miR-376c used in this study for the diagnosis of H7N9 virus infection did not overlap with those for enterovirus and H1N1 virus infections, thus indicating high diagnostic specificity of these four miRNAs. [score:1]
In summary, we, for the first time, provided an overview of host serum miRNA alterations in response to H7N9 virus infection, as well as identified the diagnostic ability of combined miR-17, miR-20a, miR-106a and miR-376c serum levels, thus promoting our understanding of this emerging virus pathogenesis. [score:1]
MiR-17 (A), miR-20a (B) and miR-106a (C) showed a moderate discriminating efficiency with an AUC value more than 0.8, while miR-376c (D) exhibited a poor diagnostic ability with an AUC value of 0.622. [score:1]
Circulating miR-20a could also serve as a potential predictive biomarker for HCV -mediated fibrosis [23]. [score:1]
Finally, an important question remains to be answered: whether the serum levels of four miRNAs (miR-17, miR-20a, miR-106a and miR-376c) could be used for discriminating H7N9 virus from other types of viral infections with the same good performance. [score:1]
Figure 4 ROC curve for a combination of miR-17, miR-20a, miR-106a and miR-376c was constructed. [score:1]
When the serum levels of these four miRNAs were subjected to combined analysis by multiple logistic regression, the generated ROC curve reflected a higher ability to differentiate patients with H7N9 virus infection from healthy controls (AUC value: 0.96; 95% CI: 0.917–1.000), demonstrating the diagnostic accuracy of miR-17, miR-20a, miR-106a and miR-376c as effective biomarkers in combination (Figure 4). [score:1]
Figure 2The serum levels of miR-17, miR-20a, miR-106a and miR-376c were determined by quantitative RT-PCR in individual healthy controls (n = 36) and patients (n = 21). [score:1]
Four miRNA molecules (miR-17, miR-20a, miR-106a and miR-376c) were selected for validation of the TaqMan Array data in a larger scale population by quantitative RT-PCR. [score:1]
[1 to 20 of 11 sentences]
89
[+] score: 13
Again, it is not clear why the Diana-microT-CDS and TargetScan algorithms did not identify the miR-20a-3p, miR-23b-5p, miR-29a-5p, miR-103-3p, miR-107 and miR-532-5p MREs in human S-endoglin mRNA that were detected manually. [score:3]
Further, let-7b-5p, miR-20a, and miR-29a-5p (experimentally cataloged miRNAs which target human endoglin mRNAs, Table 7 (Tab. [score:3]
7) (References in Table 7: let-7b-5p: Selbach et al., 2008[145]; miR-16-5p: Balakrishnan et al., 2014[14]; miR-20a-3p: Balakrishnan et al., 2014[14]; miR-23b-5p: Balakrishnan et al., 2014[14]; miR-29a-5p: Balakrishnan et al., 2014[14]; miR-103a-3p: Balakrishnan et al., 2014[14]; miR-107: Balakrishnan et al., 2014[14]; miR-532-5p: Haecker et al., 2012[63]; miR-628-5p: Balakrishnan et al., 2014[14]; miR-522-3p: Tan et al., 2014[153]) documents ten human experimentally supported miRNA/endoglin mRNA interactions, and the methodology utilized to substantiate the interaction, the tissue and/or cell line used for experimentation, the location of the MRE if known, the type of interaction (direct or indirect), and the literature reference. [score:3]
Although neither algorithm identified human endoglin mRNA MRE target sites for HITS-CLIP validated miRNAs (miR-20a-3p, miR-23b-5p, miR-29a-5p, miR-103-3p, miR-107, and miR-532-5p) (Table 7 (Tab. [score:3]
When the human S-endoglin mRNA isoform was subjected to manual sequence analysis two putative miR-20a-3p CDS MREs (5′ AUGCAG 3′, 6mer “seed” region) were located (804 and 1239 nts downstream from the start codon) and two potential miR-23b-5p MREs (5′ AACCCA 3′, 6mer “seed” region) were identified in the 3′-UTR (448 and 509 nts downstream from the stop codon) of this mRNA isoform. [score:1]
[1 to 20 of 5 sentences]
90
[+] score: 13
Figure 4 A. Histograms of individual miRNA QPCR analysis showing circulating levels of randomly selected miRNAs (miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93) in the serum of animals with non-metastatic primary disease or with high-risk metastatic disease. [score:5]
Compared with the non-metastatic favorable disease animals, we observed marginal variations in the expression of miR-20a, miR-27b, miR-93, miR-1260, and miR-1224 (Figure 4A). [score:4]
For the present study, we used QPCR to confirm expression of selected miRNAs, including hsa-miR-1224-3p, hsa-miR-1260, hsa-miR-27b, hsa-miR-93, and hsa-miR-20a. [score:3]
B. Correlation analysis of the serum-circulating profiles of miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93 observed using the miRnome approach. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 13
Transcripts for all three microRNAs were significantly elevated in neonatal CPCs and mir-17 and mir-20a are directly regulated by Myc expression [17], [42]. [score:5]
Functional differences in proliferation would be anticipated based on the expression of microRNAs 17, miR-20a, and miR-106b which were expressed at significantly higher levels in neonatal cardiovascular progenitors (Figure 3b) [14]– [17]. [score:5]
Pro-proliferative microRNAs such as miR-106b, mir-20a, and mir-17 also play a role; these microRNAs help reduce G1 arrest through regulation of E2F1 transcription factors [14], [17]. [score:2]
MicroRNA 17, miR-20a, and miR-106 b levels, positively correlated with proliferation, were significantly higher in neonatal CPCs (p = 0.0094, p = 0.0030, p = 0.0085, respectively). [score:1]
[1 to 20 of 4 sentences]
92
[+] score: 13
Namely, it includes six (i. e., E2F3, RB1, RBL2, CCND2, WEE1, CCND1) out of 13 genes in the mitotic G1-G1/S phases as specific targets of miR-17, miR-20a and miR-106b. [score:3]
Bicluster 379 groups together TGFBR2, BMPR2, SMAD and PTEN as targets of miR-17, miR-19 and miR-20a, which are members of the miR-17-92 gene cluster. [score:3]
According to [54], this gene is a validated target of miR-17, miR-20a, miR-20b. [score:3]
This bicluster (i. e., 511-512) groups six different members of the miR-17-92 gene cluster family (i. e., miR-17, miR-93, miR-20a and b, and miR-106a and b) that potentially co-target 116 different genes. [score:3]
Moreover, at level 2 of the hierarchy, bicluster 379 is merged with bicluster 405, which groups together miR-17 and miR-20a (belonging to the miR-17-92 gene cluster), with miR-20b (belonging to the miR-160a-363 gene cluster). [score:1]
[1 to 20 of 5 sentences]
93
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In mature MII-stage oocytes, four miRNAs were upregulated and eleven were downregulated in comparison to immature GV-stage oocytes, as can be seen in Figure 2. The RT-PCR analysis of miR-15a and miR-20a expression revealed the concordant dynamic changes of these two miRNAs during meiosis. [score:9]
Moreover, the high concentration of FSH in the in vitro maturation medium led to reverse effect on the expression of miR-15a and miR-20a, which confirmed the involvement of these two miRNAs in the oocyte maturation process influenced by FSH [28]. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 12
Patients with LNM tended to have overexpression of miR-20a, but down-regulation of miR-203. [score:6]
And in another research, Zhao et al. [34] found that the expression levels of miR-20a and miR-203 were both significantly higher in cervical cancer patients compared with healthy controls. [score:2]
The authors took further study to analyze the efficiency of using miR-20a to differentiate LNM (+) patients from LNM (−) patients. [score:1]
They identified 6 serum miRNAs that can predict LNM in cervical SCC patients: miR-1246, miR-20a, miR-2392, miR-3147, miR-3162-5p and miR-4484. [score:1]
These results suggested that the circulating miR-20a may be a potential biomarker for detecting the lymph node status of cervical cancer patients. [score:1]
The value of the area under the receiver-operating curve (AUC) was 0.734 ± 0.058, the sensitivity and specificity of serum miR-20a were 75% and 72.5%, respectively, and the cut-off point was 3.0. [score:1]
[1 to 20 of 6 sentences]
95
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Up-regulation of circulating miR-20a is correlated with hepatitis C virus -mediated liver disease progression. [score:6]
Considering other miRNA species, miR-571 has been associated with HCV-related cirrhosis progression (201); miR-20a and miR-92a serum levels were elevated in HCV-infected fibrosis patients, and miR–92a expression was significantly reduced after infection resolution (202); circulating serum miR-320c, miR-134, and miR-483-5p were shown to be significantly increased in expression for HCV-infected patients when compared to HC (203). [score:4]
Circulating serum miR-17, miR-20a, miR-106a, and miR-376c were significantly increased in expression for patients compared to healthy individuals (220). [score:2]
[1 to 20 of 3 sentences]
96
[+] score: 12
Previous studies have shown that higher TRBP expression increased expression of miR-17 and miR-20a, both which were upregulated in our data [4]; TRBP is regulated by the MAPK/ERK pathway [4] suggesting another indirect effect between genes in this signaling pathway and miRNAs. [score:10]
Thirteen of the miRNAs:mRNA seed region matches (MEF2C with miR-203a; TGFBR1 with miR-2117 and miR-6071; DUSP4 with miR-193b-3p; PDGFRA with miR-17-5p, miR-19b-3p, miR-203a, miR-20a-5p, miR-20b-5p, miR-29b-3p, miR-501-3p; RASGRP3 with miR-429; and PRKCB and miR-203a) were inversely associated suggesting a greater likelihood of a direct effect between the miRNA and mRNA. [score:2]
[1 to 20 of 2 sentences]
97
[+] score: 12
miR-17 and miR-20a are two of six miRNAs expressed from the miR-17/92 cluster, while miR-106b and miR-93 are expressed from the miR-106b/25 cluster [65], [66]. [score:5]
miRNA-sponged LCLs were generated by transducing LCL35 with pLCE-sCXCR4 (control sponge, described in [81]) or pLCE-s17/20/106, containing nine imperfect target sites for miR-17, miR-20a, or miR-106a in the 3′UTR of GFP [81], and FAC-sorting for high GFP -expressing cells 48-hrs post-infection. [score:5]
The miR-17/20/106 sponge contains nine imperfect binding sites within the 3′UTR of GFP for miR-17, miR-20a, or miR-106a (Table S15); miR-106b and miR-93 differ from these three miRNAs in their 3′ non-seed sequences (Figure 6C, Table S1- S4). [score:1]
Shown are the mature miRNA sequences for miR-106a, miR-17, and miR-20a as identified by deep sequencing and the sequence of the LMP1 3′UTR cluster containing the seed match site. [score:1]
[1 to 20 of 4 sentences]
98
[+] score: 12
Other over-expressed members of the cluster, such as miR-17-5p/miR-20, have been linked to the regulation of cell proliferation through a Cyclin D1 regulatory feedback loop [32] and through the inhibition of AIB1 translation [33] in breast cancer. [score:9]
The top miRNAs with elevated expression levels in basal-like samples were miR-18a/b (TNoM p<2E-10) and other members of the miR-17-92 cluster (miR-17/17*, miR-18a/b, miR-19a, miR-20a and miR-106a). [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 12
Second, TAL1 is a putative target of several miRNAs that are up-regulated in hematopoietic stem cells, such as hsa-miR-17-5p, hsa-miR-197, hsa-miR-106 and hsa-miR-20 [39], and of some that are down-regulated in differentiated megakaryocytes, such as hsa-miR-106 and hsa-miR-20 [40], suggesting that miRNAs might regulate TAL1 at different stages of hematopoietic development. [score:11]
We excluded from further analysis the miR-Vec-20a, miR-Vec-17 and miR-Vec-93, since the miRNAs encoded belong to the oncogenic cluster miR-17-92 (miR-17-5p and miR-20a-5p) or to the same family (miR-93-5p). [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 11
In differentiated hNSCs, downregulated hsa-miR-96 correlated with SOX5 upregulation of gene and protein expression; similar results were obtained for hsa-miR-302a, hsa-miR-182, hsa-miR-7, hsa-miR-20a/b, and hsa-miR-17 and their target NR4A3. [score:11]
[1 to 20 of 1 sentences]