sort by

302 publications mentioning hsa-mir-19b-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-19b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 328
As shown in Fig. 4D and E, the ectopic expression of miR-19b-3p significantly repressed RNF11 mRNA and protein levels, whereas miR-19b-3p inhibitors restored RNF11 expression, indicating that RNF11 expression could be squelched by miR-19b-3p via mRNA decay and translational suppression. [score:13]
However, knockdown of RNF11 rescued the inhibitory effects of miR-19b-3p inhibitors on NF-κB activity (Fig. 8), suggesting that miR-19b-3p activates NF-κB activity via targeting RNF11. [score:8]
Overexpression of miR-19b-3p markedly diminished RNF11 mRNA and protein levels, whereas treatment with miR-19b-3p inhibitors restored RNF11 expression. [score:7]
Similar to our in vitro findings, brain tissues from JEV-infected mice demonstrated an inverse relationship between the expression patterns of miR-19b-3p and its target, RNF11; i. e., higher miR-19b-3p expression was correlated with a reduced level of RNF11 (Fig. 9A to C). [score:7]
To further substantiate that RNF11 is indeed a target of miR-19b-3p, endogenous RNF11 expression was determined in U251 cells treated with miR-19b-3p mimics or inhibitors. [score:7]
Moreover, silencing of RNF11 rescued the inhibitory effect of miR-19b-3p inhibitors on JEV -induced expression of inflammatory cytokines. [score:7]
These results strongly demonstrate that miR-19b-3p expression is upregulated after JEV infection. [score:6]
miR-19b-3p regulates JEV -induced inflammatory cytokine expression by targeting RNF11. [score:6]
In addition to its oncogenic effects, the miR-19 regulon is reported to control NF-κB signaling by targeting members of the ubiquitin-editing protein complex in the cells stimulated with purified bacterial product (47), suggesting that targeting this miRNA regulon could regulate the activity of NF-κB signaling in inflammation. [score:6]
Of these miRNAs, miR-19b-3p was found to be statistically well upregulated upon viral infection, and it was expressed at high levels in the cells (unpublished data). [score:6]
This upsurge of inflammatory cytokines was achieved through suppression of RNF11, a direct target of miR-19b-3p. [score:6]
Thus, these data suggest that RNF11 is a direct target of miR-19b-3p and that its expression is modulated by miR-19b-3p. [score:6]
On the basis of the characterization of RNF11 in monocytic cell lines (69), its role in Parkinson's disease (65), its differential expression in neurons and glial cells (70), and our confirmed analysis of the upregulation of miR-19b-3p after JEV infection, we hypothesized that RNF11 may also have a role in inducing the JEV -mediated inflammatory response. [score:6]
In contrast, treatment of cells with miR-19b-3p inhibitors significantly inhibited the nuclear translocation of NF-κB in JEV-infected U251 cells (Fig. 7B). [score:5]
Importantly, silencing of RNF11 rescued the suppressive effect of miR-19b-3p inhibitors on these cytokines (Fig. 6C). [score:5]
Their sequences were as follows: miR-19b-3p mimics, 5′-UGUGCAAAUCCAUGCAAAACUGA-3′ (forward) and 5′-AGUUUUGCAUGGAUUUGCACAUU-3′ (reverse); mimic controls, 5′-UUCUCCGAACGUGUCACGUTT-3′ (forward) and 5′-ACGUGACACGUUCGGAGAATT-3′ (reverse); miR-19b-3p inhibitors, 5′-UCAGUUUUGCAUGGAUUUGCACA-3′; inhibitor controls, 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:5]
Since our deep-sequencing data revealed that miR-19b-3p is upregulated after JEV infection, we hypothesized that miR-19b-3p may have a crucial role in regulating the JEV -induced inflammatory response. [score:5]
We also demonstrated that miR-19b-3p positively regulates the JEV -induced inflammatory response in vitro and in vivo via targeting RNF11, a negative regulator of NF-κB signaling (60). [score:5]
In line with previous data, JEV -induced expression of TNF-α, IL-6, IL-1β, and CCL5 was decreased by miR-19b-3p inhibitors. [score:5]
FIG 3Inhibition of miR-19b-3p suppresses JEV -mediated production of inflammatory cytokines. [score:5]
miR-19b-3p belongs to the miR-17/92 cluster of miRNAs, and this miRNA cluster has been found to have divergent roles in the development of tumors and other diseases (61, 62). [score:4]
To substantiate that miR-19b-3p is indeed involved in the regulation of NF-κB signaling through RNF11, U251 cells were cotransfected with miR-19b-3p inhibitors or control oligonucleotides and siRNF11 or a nonspecific control siRNA and subsequently infected with JEV. [score:4]
Knockdown of RNF11 significantly increased the production of inflammatory cytokines, which means that RNF11 silencing produces effects similar to those of miR-19b-3p overexpression (Fig. 6C). [score:4]
Upregulation of miR-19b-3p upon JEV infection. [score:4]
The results revealed that miR-19b-3p was significantly upregulated in a time -dependent (Fig. 1A) and dose -dependent (Fig. 1B) manner. [score:4]
Mechanistically, miR-19b-3p modulated the JEV -induced inflammatory response via targeting ring finger protein 11, a negative regulator of nuclear factor kappa B signaling. [score:4]
In the present study, we found that miR-19b-3p is upregulated in JEV-infected U251 and BV2 cells and that it reinforces the production of inflammatory cytokines such as TNF-α, IL-6, IL-1β, and CCL5. [score:4]
Taken together, our findings demonstrate that miR-19b-3p positively regulates JEV -induced inflammatory cytokine production by targeting RNF11. [score:4]
The data demonstrated that miR-19b-3p is upregulated in cultured cells and mouse brain tissues during JEV infection. [score:4]
Moreover, the 4-bp mutation of in the miR-19b-3p seed region led to a complete abrogation of the negative effect of miR-19b-3p on expression of RNF11 3′ UTR reporter constructs (Fig. 4C). [score:4]
Interestingly, we also observed that overall expression levels of inflammatory cytokines in BV2 cells were lower than those in U251 cells, suggesting that astrocytes may react more effectively than microglia in regulating the miR-19b-3p -mediated inflammatory response upon JEV infection. [score:4]
In contrast to these findings, UV-irradiated inactivated JEV infection failed to induce miR-19b-3p upregulation in U251 cells (Fig. 1C), suggesting possible involvement of miR-19b-3p in a JEV -induced inflammatory response in brain astrocytes. [score:4]
Interestingly, certain cytokines of JEV -induced neuroinflammation, such as TNF-α, IL-6, IL-1β, and CCL5 (9, 36), were found to be significantly upregulated upon transfection of miR-19b-3p mimics in both infected and uninfected U251 cells (Fig. 2B). [score:4]
The antagomir-19b-3p, a chemically modified antisense oligonucleotide, was administered intravenously into mice at 24 and 36 h postinfection to knock down the expression of endogenous miR-19b-3p. [score:4]
Overexpression of miR-19b-3p led to increased production of inflammatory cytokines, including tumor necrosis factor alpha, interleukin-6, interleukin-1β, and chemokine (C-C motif) ligand 5, after JEV infection, whereas knockdown of miR-19b-3p had completely opposite effects. [score:4]
miR-19b-3p mimics (double-stranded RNA oligonucleotides), inhibitors (single-stranded chemically modified oligonucleotides), and control oligonucleotides were commercially purchased from GenePharma. [score:3]
The sequences of miR-19b-3p and its target site in the 3′ UTR of RNF11 were aligned with those from different species, and these sequences are shown to be highly conserved among species (Fig. 4A). [score:3]
We found that treatment of cells with miR-19b-3p mimics enhances the translocation of NF-κB from the cytoplasm to the nucleus, whereas miR-19b-3p inhibitors hinder the nuclear translocation of NF-κB. [score:3]
A marked reduction in luciferase activity was observed in U251 cells cotransfected with miR-19b-3p mimics and the RNF11 wild-type 3′ UTR carrying a binding site, whereas significantly increased luciferase activity was detected following application of miR-19b-3p inhibitors (Fig. 4C). [score:3]
U251 cells were transfected with miR-19b-3p mimics, inhibitors, or their controls (final concentration, 50 nM) for 24 h and subsequently infected with JEV at an MOI of 5. At 12, 24, and 36 h postinfection, cell supernatants were harvested, serially diluted, and then used to inoculate monolayers of U251 cells. [score:3]
In contrast, the inhibition of endogenous miR-19b-3p significantly repressed JEV-triggered cytokine production (Fig. 3B). [score:3]
Furthermore, we found that treatment of miR-19b-3p mimics or inhibitors did not produce any antiviral activity in JEV-infected U251 cells as viral titers were similar to those in control cells (Fig. 2C and 3C). [score:3]
In JEV-infected mice, treatment of antagomir-19b-3p caused a specific reduction in miR-19b-3p expression and rescued the alterations in RNF11 levels (Fig. 9A to C). [score:3]
First, we evaluated the consequences of synthetic miR-19b-3p mimics and inhibitors on the expression pattern of miR-19b-3p. [score:3]
Therefore, inhibition of miR-19b-3p may be an intriguing approach for the advancement of curative interventions. [score:3]
The psiCheck-2 dual-luciferase reporter vector (Promega) harboring the 3′ untranslated region (UTR) of RNF11 inserted into the XhoI and PmeI restriction sites at the 3′ end of Renilla luciferase was used to check the effect of miR-19b-3p on Renilla luciferase activity. [score:3]
In this study, we showed that astrocytes expressed high levels of miR-19b-3p upon JEV infection. [score:3]
The corroboration of miR-19b-3p expression patterns in JEV-infected U251 cells was scrutinized by quantitative real-time PCR. [score:3]
The lower panel shows the alignment of miR-19b-3p and its target site in the 3′ UTR of RNF11. [score:3]
As expected, transfection of miR-19b-3p mimics increased miR-19b-3p levels significantly in mock- or JEV-infected glial cells at 36 h postinfection (Fig. 2A and D), whereas miR-19b-3p inhibitors diminished its levels (Fig. 3A and D). [score:3]
RNF11 is a potential target of miR-19b-3p. [score:3]
These results demonstrate that the nucleotide sequence in the 3′ UTR of RNF11 is a potential miR-19b-3p targeting site. [score:3]
The effects of miR-19b-3p mimics and inhibitors on inflammatory cytokine production were also examined in BV2 cells, and the results were analogous to those observed in U251 cells (Fig. 2E and 3E). [score:3]
Similar to our previous data, JEV -induced nuclear translocation of NF-κB was decreased by miR-19b-3p inhibitors. [score:3]
Thus, miR-19b-3p targeting may constitute a thought-provoking approach to rein in JEV -induced inflammation. [score:3]
In JEV-infected mouse brain tissues, miR-19b-3p showed a reciprocal expression pattern with RNF11, which further supports a functional interplay between miRNA and mRNA in vivo. [score:3]
Lewis A, Mehta S, Hanna LN, Rogalski LA, Jeffery R, Nijhuis A, Kumagai T, Biancheri P, Bundy JG, Bishop CL, Feakins R, Di Sabatino A, Lee JC, Lindsay JO, Silver A 2015 Low serum levels of microRNA-19 are associated with a stricturing Crohn's disease phenotype. [score:3]
U251 cells were cotransfected with miR-19b-3p inhibitors or control oligonucleotides and siRNF11 or a nonspecific control siRNA (final concentration, 50 nM) for 24 h and then infected with JEV at an MOI of 5 for 36 h. The cytosolic extracts (upper panel) and nuclear extracts (lower panel) were isolated and subjected to immunoblotting with antibodies against RNF11, NF-κB p65, lamin A, and GAPDH. [score:3]
miR-19b-3p activates NF-κB signaling via targeting RNF11 in JEV-infected astrocytes. [score:3]
The cells were cotransfected with miR-19b-3p inhibitors or control oligonucleotides and siRNF11 or a nonspecific control siRNA and then infected with JEV. [score:3]
In vivo silencing of miR-19b-3p by a specific antagomir reinvigorates the expression level of RNF11, which in turn reduces the production of inflammatory cytokines, abrogates gliosis and neuronal cell death, and eventually improves the survival rate in the mouse mo del. [score:3]
As expected, silencing of RNF11 significantly enhanced the accumulation of NF-κB in the nucleus, and these effects were concordant with miR-19b-3p overexpression (Fig. 8). [score:3]
The present study reveals that miR-19b-3p targets ring finger protein 11 in glia and promotes inflammatory cytokine production by enhancing nuclear factor kappa B activity in these cells. [score:3]
First, we confirmed the expression of miR-19b-3p in the transfected cells (Fig. 6B). [score:3]
Cholesterol-conjugated and chemically modified miR-19b-3p inhibitors (antagomir-19b-3p) were synthesized by GenePharma. [score:3]
To determine whether the observed effects of miR-19b-3p on inflammatory cytokine production in response to JEV infection were, at least partially, mediated through RNF11, we analyzed the effects of silencing RNF11 expression by siRNA in U251 cells. [score:3]
miR-19b-3p expression activates the NF-κB pathway in JEV-infected astrocytes. [score:3]
A previous study has reported RNF11 as a potential target for miR-19b-3p (47). [score:3]
U251 cells were cotransfected with 100 ng of the constructed luciferase reporter plasmid along with miR-19b-3p mimics, inhibitors, or controls (final concentration, 50 nM). [score:3]
Huhn D, Kousholt AN, Sorensen CS, Sartori AA 2015 miR-19, a component of the oncogenic miR-17 approximately 92 cluster, targets the DNA-end resection factor CtIP. [score:3]
We also found that inhibition of ring finger protein 11 by miR-19b-3p resulted in accumulation of nuclear factor kappa B in the nucleus, which in turn led to higher production of inflammatory cytokines. [score:3]
Further investigations revealed that miR-19b-3p augments the inflammatory response via targeting ring finger protein 11 (RNF11), a negative regulator of nuclear factor kappa B (NF-κB) activity. [score:2]
To determine if RNF11 mRNA is indeed repressed by miR-19b-3p in the context of virus infection, a dual-luciferase reporter plasmid containing a putative binding site for miR-19b-3p and a mutant construct harboring the miR-19b-3p seed region with a 4-bp mutation were generated (Fig. 4B). [score:2]
In summary, this study provides evidence that miR-19b-3p acts as a positive regulator of JEV -induced neuroinflammation by enhancing NF-κB signaling, resulting in increased production of TNF-α, IL-6, IL-1β, and CCL5. [score:2]
Collectively, our results demonstrate that miR-19b-3p positively regulates the JEV -induced inflammatory response. [score:2]
To the best of our knowledge, our data suggest for the first time that miR-19b-3p -mediated regulation of RNF11 participates in the induction of an inflammatory response in the context of viral infections. [score:2]
In the present study, we found that miR-19b-3p is involved in regulating the JEV -induced inflammatory response in vitro and in vivo and that miR-19b-3p enhances the production of inflammatory cytokines in cultured cells and mouse brain tissues. [score:2]
To examine whether miR-19b-3p is involved in the JEV -mediated inflammatory process, the effect of miR-19b-3p on the regulation of inflammatory cytokine production after JEV infection was determined. [score:2]
Here, we found the involvement of miR-19b-3p in regulating the JEV -induced inflammatory response in vitro and in vivo. [score:2]
Thus, these findings demonstrated that miR-19b-3p appears to regulate inflammatory cytokine production by enhancing the activation of NF-κB signaling in JEV-infected astrocytes. [score:2]
Thus, these data indicate that miR-19b-3p participates in regulating JEV -mediated inflammation. [score:2]
FIG 6Regulation of JEV -induced production of inflammatory cytokines by miR-19b-3p is achieved through RNF11. [score:2]
Gantier MP, Stunden HJ, McCoy CE, Behlke MA, Wang D, Kaparakis-Liaskos M, Sarvestani ST, Yang YH, Xu D, Corr SC, Morand EF, Williams BR 2012 A miR-19 regulon that controls NF-kappaB signaling. [score:1]
Transfection of miR-19b-3p mimics increased the translocation of NF-κB from the cytoplasm to the nucleus (Fig. 7A). [score:1]
We also investigated the expression of miR-19b-3p in JEV-infected microglial BV2 cells (Fig. 1D and E). [score:1]
These results suggest that silencing of RNF11 phenocopied the proinflammatory effect of miR-19b-3p and counteracted the effect of anti-miR-19b-3p. [score:1]
Thus, these findings illustrate that JEV -induced miR-19b-3p potentiates NF-κB signaling through RNF11. [score:1]
In this regard, a JEV-infected mouse mo del was established to substantiate the effects of miR-19b-3p in vivo. [score:1]
Effects of miR-19b-3p on the JEV-triggered inflammatory cytokine production. [score:1]
The levels of miR-19b-3p were detected by quantitative real-time PCR (upper panels). [score:1]
To date, no study has reported the role of the miR-19 regulon in the context of any virus -mediated inflammatory response. [score:1]
To delineate the significance of miR-19b-3p in JEV-caused encephalitis in vivo, a mouse mo del for JEV infection was established. [score:1]
Moreover, administration of an miR-19b-3p-specific antagomir in JEV-infected mice reduces neuroinflammation and lethality. [score:1]
Genetic anatomization of the relative contribution of the individual miRNAs of this cluster has demonstrated that miR-19 recapitulated on its own the oncogenic effects of the full cluster (63). [score:1]
[1 to 20 of 94 sentences]
2
[+] score: 272
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-2, hsa-mir-21
Knockdown of miR-19b results in suppression of hTERT transcription and inhibition of cell growth through upregulation of PITX1 expression. [score:11]
When PITX1 expression status was plotted against miR-19b expression level, high miR-19b expression tended to be associated with decreased PITX1 expression (P<0.05) (Fig. 3D). [score:9]
Since we previously demonstrated that PITX1 can suppress hTERT expression in a transcription -dependent manner 4, we next determined whether miR-19b can lead to the regulation of hTERT transcription through an effect on the downregulation of PITX1. [score:9]
In addition, downregulation of hTERT expression in 293T overexpressing cells of miR-19b by introduction of FLAG-PITX1 decreased telomerase activity by 57–77% (see Supplementary Fig S3 online). [score:8]
Downregulation of PITX1 expression by miR-19b leads to activation of hTERT transcription in 293T cellsTo further explore the effects of miR-19b on PITX1 transcription, we generated two 293T cell lines that each stably overexpressed miR-19b (cl. [score:8]
To clarify whether miR-19b expression correlated with telomerase activity in mice tissues expressing mouse Tert (mTert), we performed expression analysis of mouse miR-19b (mmu-miR-19b) in mTert -positive (thymus and spleen) and –negative (brain and muscle) tissues 21. mmu-miR-19b was detected in thymus and spleen, but not in brain and muscle tissues (Fig 3I and J). [score:7]
High miR-19b expression is correlated with downregulation of PITX1 in melanoma cell lines and tissue samples. [score:6]
To further examine the suppressive effects of miR-19b on PITX1 under more physiological conditions, we knocked down endogenous miR-19b expression in human melanoma A2058 cells using anti-miR-19b oligonucleotides. [score:6]
In contrast, we demonstrated that PITX1 directly suppresses transcription of hTERT by binding to its promoter region 4. To our knowledge, the present study is the first report to provide evidence that hTERT transcription is modulated through interaction between a microRNA (miR-19b) and a suppressor gene (PITX1). [score:6]
These results suggested that the higher endogenous level of miR-19b in human melanoma cells may be responsible for the downregulation of PITX1 protein expression in these cells. [score:6]
Downregulation of PITX1 expression by miR-19b leads to activation of hTERT transcription in 293T cells. [score:6]
To further determine the relationship between the expression level of miR-19b and that of PITX1 in vivo, we immunohistochemically analyzed PITX1 protein expression status in each of the fourteen clinical melanoma tissue specimens in which miR-19b expression levels had been assayed (Fig. 3C). [score:6]
To confirm the above described effects of miR-19b, FLAG-tagged PITX1 expression plasmids that lack the PITX1 3′UTR region, or the control FLAG-vector, were transfected into miR-19b stably expressing clones (miR-19b FLAG-PITX1 and miR-19b FLAG-vector respectively). [score:5]
It was reported that miR-19b promotes PI3K pathway signaling through inhibition of PTEN expression 18 19. [score:5]
Our present data showed that the expression level of miR-19b was increased in the melanoma cell lines A2058, CRL1579, SK-MEL-28 and G361 (Fig 4A, B), which have been shown to express BRAF-mutants 32 40. [score:5]
RNA isolation and reverse transcriptase (RT)-PCR was performed as described previously 4. miR-19b and mmu-miR-19b expression, and PITX1, hTERT, mTert mRNA expression, were detected using. [score:5]
miR-19b regulates hTERT transcription activity through direct targeting of PITX1 mRNA. [score:5]
The bars correspond to means ± S. D. (D) Relationship between miR-19b expression and PITX1 positive or negative expression in melanoma clinical samples (*P<0.05). [score:5]
These findings suggest that the inhibition of cell growth resulting from knockdown of miR-19b in melanoma cells is independent of PI3K signaling pathway regulation by PTEN. [score:5]
are expressed relative to the value of NHEMs that were assigned a value of 1. The bars correspond to means ± S. D. (C) analysis of miR-19b expression levels in human melanoma clinical tissue samples relative to that in NHEMs (N), which was assigned a value of 1. Data were normalized to U6 control. [score:5]
Knockdown of miR-19b in A2058 cells reduced its expression to 44% of that of control cells (P<0.01, Fig 4A), and resulted in a 2.4 and 1.6-fold increase in PITX1 protein and mRNA expression, respectively, compared to that of control (Fig 4B, C). [score:5]
For overexpression of miR-19a/b, 5 × 10 [6] 293T cells were seeded in each well of 6-well plates and were transfected 24 h after seeding with 0.5 µg of pCMV-miR19a (cloning pre-miR19a sequence in to pCMV-miR plasmid; GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGU UGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC), pCMV-miR19b (cloning pre-miR19b sequence in to pCMV-miR plasmid; ACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUAUAUGUGGC UGUGCAAAUCCAUGCAAAACUGAUUGUGAUAAUGU) or pCMV-miR plasmid that also express the GFP gene that was used for fluorescence analysis of transfection efficiency (Origene, Rockville, MD, USA). [score:5]
We next performed analysis to determine the expression level of miR-19b in melanoma cell lines in which PITX1 protein expression is known to be lower than that of normal cells. [score:5]
Therefore, miR-19b mediated hTERT activation through the targeting of PITX1 may involve another oncogenesis pathway such as NF-κB or the Wnt signaling pathway, which can be activated by hTERT expression in melanoma cells. [score:5]
In contrast, knockdown of miR-19b resulted in significantly reduced hTERT mRNA expression (reduced to 67% of control) (P<0.01, Fig 4D). [score:4]
These results suggest that BRAF mutation may trigger an increase in the levels of miR-19b expression. [score:4]
Our results showed that knockdown of miR-19b leads to inhibition of proliferation of the melanoma cell line A2058 (Fig 4E). [score:4]
miR-19b expression was much higher in all melanoma cell lines compared to its expression level in NHEMs (Fig 3B). [score:4]
Knockdown of miR-19b leads to increased expression of PITX1. [score:4]
These results provide evidence that miR-19b directly repressed PITX1 translation through a specific 3′UTR mRNA binding sequence. [score:4]
In this study, we found that miR-19b directly targets PITX1 mRNA and leads to an increase in hTERT mRNA levels. [score:4]
In addition, miR-19b is also overexpressed in human lung cancer and promotes proliferation of lung epithelial progenitor cells, eventually induced abnormal lung phenotype in the transgenic mice 35 36. [score:3]
PITX1 mRNA is a target of miR-19b. [score:3]
Overexpression of the miR-19b, but not of the control miR-vector, decreased the luciferase activity of the PITX1 wt 3′-UTR vector -transfected cells but not that of the PITX1 mut 3′-UTR vector- or of the control pGL4.75 vector -transfected cells (P<0.001, Fig 1F). [score:3]
As observed in Fig 2E and Supplementary Fig S2, overexpressing clones of miR-19b resulted in a 1.5- to 1.7-fold increase in telomerase activity. [score:3]
miR-19b expression level was detected by (Fig. 3C) and PITX1 protein status was determined by immunohistochemical staining (IHC). [score:3]
These data provide strong evidence of a functional link between miR-19b and PITX1 expression levels in melanoma tissues. [score:3]
The expression of miR-19b was shown to be increased by the introduction of mutated BRAF into normal thyroid cells 39. [score:3]
Further studies aimed at identification of the factors that control miR-19b, and analysis of the in vivo functions of miR-19b, will be required in order to clarify the significance of miR-19b regulation of oncogenic signaling pathways in cancer development. [score:3]
The bars correspond to means ± S. D. (A) analysis of relative miR-19b expression levels in anti-miR control or anti-miR-19b oligonucleotide transfected A2058 cells. [score:3]
To further explore the effects of miR-19b on PITX1 transcription, we generated two 293T cell lines that each stably overexpressed miR-19b (cl. [score:3]
A segment of the human PITX1 3′UTR region containing the predicted binding site for miR-19b based on the TargetScan database (http://www. [score:3]
Furthermore, analysis indicated higher expression of miR-19b in all fourteen human clinical melanoma specimens than that in NHEMs (Fig 3C). [score:3]
The bars correspond to means ± S. D. (C) of the PITX1 protein level in cloned cell lines stably expressing miR-19b or the miR-vector control. [score:3]
miR-19b and PITX1 expression in human melanoma cells and primary tissues. [score:3]
2) that stably express miR-19b or the control miR-vector were microscopically analyzed. [score:3]
Endogenous PITX1 in miR-19b FLAG-vector cells and endogenous PITX1 and exogenous FLAG-PITX1 expression levels in miR-19b FLAG-PITX1 cells were analyzed by (see Supplementary Fig S3A online). [score:3]
These data demonstrate that miR-19b decreases PITX1 expression, which modulates telomerase dependent pathways. [score:3]
PITX1 is a target of miR-19b. [score:3]
Furthermore, analysis of these cells at 48 h after transfection showed that the protein level of PITX1 was markedly reduced in miR-19b overexpressing cells compared with the cells transfected with miR-19a or control vector without miR-19b (Fig 1 D). [score:2]
Furthermore, an increase in the growth rate of the miR-19b overexpressing clones compared to the control clones was observed (P<0.05, Fig 2F). [score:2]
However, regulation of telomerase activity in normal cells may not be simply explained by the miR-19b-PITX1 pathway, and possibly involve in multiple factors. [score:2]
Transient overexpression of miR-19b induced a significant decrease in PITX1 mRNA levels compared to miR-19a- or miR-vector -transfected cells (Fig 1C, P < 0.01). [score:2]
Additionally, introduction of FLAG-PITX1 into miR-19b cells, in which endogenous PITX1 was decreased by miR-19b, inhibited cell growth compared with that in miR-19b FLAG -transfected cells (Fig 2G). [score:2]
The mRNA expression of mTert and mmu-miR-19b was analyzed using the specific primers: mmu-miR-19b : forward; 5′- TTGCAGATTTGCAGTTCAGCGT, reverse; 5′- TCCCACAATCAGTTTTGCATGG, mTert: forward; 5′- AGAGCTTTGGGCAGAAGGA, reverse; 5′- GAGCATGCTGAAGAGAGTCTTG). [score:2]
Western blot analysis indicated that the protein level of PITX1 was markedly reduced in the miR-19b overexpressing clones compared with that in the miR-vector control clones (Fig 2C). [score:2]
Further study involving a detailed analysis of the regulation of miR-19b transcription may contribute greatly to novel anti-cancer drug discovery and therapy. [score:2]
Furthermore, the knockdown of miR-19b transcription resulted in a reduction of telomerase activity by 51% (Fig 4E and Supplementary Fig S4 online), and miR-19b knockdown also led to a decrease in A2058 cell proliferation compared to control cells (P<0.05) (Fig 4F). [score:2]
Significantly increased expression of miR-19b in the miR-19b transfected cells compared to control transfected cells was confirmed using (Fig 2B). [score:2]
Our findings are consistent with these data as they provide evidence that miR-19b is crucial for the phenotypes of transformed cells and is a key oncogenic factor in the multistep processes of neoplastic development. [score:2]
Thus, our results suggest that oncogenic miR-19b functions may play an important role in one of the telomerase pathways that regulate cancer progression. [score:2]
These combined results suggest that the functional effects of miR-19b regulation of PITX1 levels are activation of hTERT transcription and enhancement of cell proliferation. [score:2]
Thus, this result provides evidence that miR-19b may play a significant role in the regulation of telomerase activity. [score:2]
We therefore investigated hTERT transcription in clones that overexpress miR-19b and found that hTERT transcription levels were significantly increased in clones that overexpressed miR-19b compared with their controls (p<0.05, Fig 2D). [score:2]
A2058 cells (1 × 10 [5] cells) were transfected with 90 pmol anti-miR-19b or negative control anti-miRNA oligonucleotides (Applied Biosystems, Tokyo, Japan, ID: MH10629) using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. [score:1]
Therefore, we focused here on miR-19b. [score:1]
To generate the PITX1 3′UTR mutated reporter (PITX1 3′UTR mut), a number of nucleotides in the PITX1 3′UTR that were complementary to the seed region nucleotides of miR-19b were mutated using PCR. [score:1]
In conclusion, our study combined with previous studies showed that miR-19b controls at least two distinct oncogenic signaling (PI3K and BRAF/MAPK) and telomerase dependent pathways that are involved in cancer progression. [score:1]
Thus, these results suggested that miR-19b could function similar between human and mouse. [score:1]
Human miR-19b is included in the miR-17-92 and the miR-106-363 clusters. [score:1]
miR-19a and miR-19b differ only a single nucleotide at position 11 from 5′ end (Fig 1A). [score:1]
We identified miR-19a and miR-19b as a miRNA that includes a seed sequence at the 5′ end that is complementary to a sequence within the 3′UTR region of PITX1 mRNA (nucleotides 912-919). [score:1]
Moreover, it has been reported that miR-19b potentiates NF-κB activity in human and mouse cells 37. [score:1]
To further validate the putative site of miR-19b initial binding within the 3′UTR of PITX1 mRNA, we generated full length of PITX1-3′UTR luciferase reporter vectors that contained the predicted, wild type (wt) miR-19b binding site (PITX1 wt 3′-UTR) or a mutated version (PITX1 mut 3′-UTR) (Fig 1E). [score:1]
Thus, the change of telomerase activity mediated by miR-19b may not always affect the telomere length. [score:1]
miR-19b and control stably transfected 293T cell clones (1 × 10 [4] cells/3ml/well), and anti-miR-19b and control oligonucleotide transfected A2058 cells (1 × 10 [5] cells/3ml/well), were seeded in 6-well culture plates. [score:1]
[1 to 20 of 76 sentences]
3
[+] score: 252
Provided that both, KCNE1 and KCNE4 up- or downregulation causes KCNQ1 inhibition and APD prolongation, KCNE1/4 downregulation by miR-19b overexpression could be causing the bradycardia observed in that study 13. [score:11]
We focused particularly on channels that were upregulated upon miR-19b loss, to identify putatively directly-regulated miR-19b target transcripts. [score:8]
Besides the described directly regulated ion channels in the heart, our qPCR data suggests additional indirectly regulated transcripts some of which are downregulated upon miR-19b reduction, including KCNA4, KCND3, SCN12B, and CACNA1C. [score:8]
Thus, miR-19b downregulation provokes a complex remo deling of units important for electrical activity through direct, indirect, and potentially maladaptive changes in gene expression, all contributing to the observed phenotype. [score:8]
In situ hybridization, to detect the likely mammalian homologous miR-19a and miR-19b transcripts, based on the complete sequence homology to the mammalian isoforms and their predominant expression levels, showed similar expression patterns for both isoforms at 48 and 72 hpf with robust expression in the skeletal muscle myosepta and in the heart (Fig. 2b). [score:7]
Importantly, we can show that reduction of KCNE4 can partially rescue miR-19b deficiency -induced bradycardia, underlining (I) the significant contribution of KCNE4 upregulation in the development of the phenotype but also (II) that additional miR-19b targets are involved. [score:7]
Interestingly, among the upregulated RNAs, transcripts harboring a predicted miR-19b binding site in their 3′-untranslated region (3′-UTR), as assessed through bioinformatics prediction, were remarkably overrepresented (Fig. 5a, marked in blue). [score:6]
In addition, KCNE1 was consistently and profoundly upregulated upon miR-19b reduction, potentially indicating indirect regulation through miR-19b. [score:6]
SCN1B, which we found directly regulated by miR-19b and upregulated upon its loss, functions as a beta subunit for Na [v]1.5 50. [score:6]
Importantly, kcnh2 expression is not affected by miR-19b downregulation. [score:6]
miR-19b directly and indirectly regulates cardiac ion channel expression. [score:6]
Upon miR-19b reduction we found a dramatic upregulation of both, KCNE4 and KCNE1, which might explain impaired cardiac repolarization through KCNQ1 inhibition resulting in reduced I [Ks] and consequently in the observed prolongation of the AP and the bradycardia. [score:6]
By directly and indirectly targeting several conserved cardiac ion channels and their modulatory subunits, miR-19b functions as a fine-tuner for APD and AP shape. [score:5]
Therefore, similar to MO19b, we decided to target a less conserved sequence within the miR-19b gene, again to not interfere with the expression of homologous miR-19-isoforms (suppl. [score:5]
To evaluate direct regulation, we cloned the native and full length 3′-UTRs of these putative targets into the 3′-UTR of a luciferase construct and analyzed the ability of miR-19b to repress luciferase expression in HEK293 cells. [score:5]
We designed a single guide RNA (sgRNA) to target the drosha-site to inhibit miR-19b procession. [score:5]
However, knockdown of miR-19b did not interfere with expression of neighboring miRNAs (±sd; n = 45 animals from 3 independent experiments; p < 0.05). [score:4]
To understand the molecular mechanism by which miR-19b modulates APD length, we analyzed the expression of cardiac ion channels known to cause APD prolongation when dysregulated or mutated in MO19b injected hearts by qPCR (Fig. 5a,b)  25. [score:4]
Importantly, targeting of these transcripts is conserved between zebrafish and human, suggesting also conserved functional consequences of miR-19b dysregulation. [score:4]
To assess whether loss of miR-19b affects angiogenesis in zebrafish during early development, we examined vessel formation in 48 and 72 hpf Tg(kdrl:EGFP) [s843] transgenic zebrafish expressing green fluorescent protein (GFP) under the control of an endothelial-specific promoter, labeling all vascular endothelial cells with GFP. [score:4]
Here, we provide evidence that miR-19b fine tunes the tightly balanced regulation of cardiac electrophysiology by modulating the expression of several ion-channels important for APD and AP shaping. [score:4]
Given that the here identified direct targets of miR-19b are conserved in humans, we hypothesize that miR-19b reduction might also cause APD prolongation in human ventricles. [score:4]
s, testing 3′-UTR responsiveness for miR-19b, confirmed SCN1B, SCN4B, KCNE4, and KCNJ2 as direct targets of miR-19b. [score:4]
Noticeably, many of the dysregulated genes were predicted targets of miR-19b. [score:4]
Furthermore, a previous study demonstrated that miR-19 directly targets Cx43 11. [score:4]
As control, target sites were mutated to reverse miR-19b -induced repression. [score:3]
Expression of miR-19 in the zebrafish. [score:3]
To elucidate the underlying mechanism of miR-19b-loss induced APD prolongation in an unbiased fashion, we used qPCR to assess changes in the expression of known APD prolongation -associated ion channels in hearts upon miR-19b reduction. [score:3]
While mammals express two isoforms, miR-19a and miR-19b, zebrafish exhibit four miR-19 isoforms encoded in four genomic loci (Fig. 1b,c). [score:3]
Interestingly, Li et al. showed that overexpression of miR-19b in zebrafish similarly results in bradycardia 13. [score:3]
Because all miR-19 isoforms are genomically closely located and polycystronically encoded on single pri-miRNA transcripts containing other miRNAs, we evaluated the impact of miR-19 knockdown on the expression of neighboring miRNAs to detect potential unintentional co-regulatory effects. [score:3]
miR-19b significantly repressed the expression of luciferase constructs containing the 3′-UTR of zebrafish and human SCN1B, KCNE4, and KCNJ2, and human SCN4B, but not of KCNE1 in either, human or zebrafish (Fig. 5c,d). [score:3]
MO19a-d were designed to target specifically one miR-19 isoform. [score:3]
miR-19 is expressed in the heart and is induced at stages of first heart activity. [score:3]
Our results indicate a direct regulation of KCNE4 by miR-19b. [score:3]
Noticeably, 19b-Crispants showed profoundly decreased miR-19b expression as assessed by qPCR (suppl. [score:3]
To exclude that loss of miR-363 is causing or contributing to the observed miR-19 deficiency phenotype, we used a morpholino targeting specifically miR-363 processing (suppl. [score:3]
While injection of MO19b could not rescue reg [−/−] zebrafish, miR-19b loss was able to significantly prevent the development of the reg phenotype in almost 40% of reg [+/−], often rendering mutation carriers even asymptomatic over a long period of time (Fig. 6c). [score:3]
Only injection of a MO against miR-19b specifically (MO19b) did not affect expression of any other neighboring miRNA (Fig. 3d). [score:3]
qRT-PCR analysis of single miR-19 isoforms showed detectable expression at the one-cell stage for miR-19a and miR-19b, with strong induction by 24 hpf, coinciding with the initiation of heart contractions in zebrafish (Fig. 2a). [score:3]
To further assess miR-19b causality in developing bradycardia, we deployed -mediated genome editing to specifically mutate miR-19b genomically and thereby impair miR-19b expression. [score:3]
Whether, and to which extend, miR-19b contributes to the pathophysiological electrical remo deling in the diseased myocardium should be a subject of future research. [score:3]
Further we show direct regulation of corresponding human genes by miR-19b and thereby establish miR-19b as a potential candidate gene causative for human LQTS. [score:3]
MO19 was designed to target all four miR-19 isoforms at the same time. [score:3]
HEK293 cells in 24-well-plates were co -transfected with 1 μg of a pGL3 plasmid, containing the 3′-UTR of the indicated genes downstream of the luciferase gene, a renilla expression-plasmid, and 40 pmol of miR-19b mimic or mimic control. [score:3]
To assess whether miR-19b knockdown hearts develop prolonged APs, we performed a sensitizing experiment using Terfenadine to pharmacologically block the I [Kr] current, thereby artificially prolonging the AP (Fig. 4a). [score:2]
For identification of the miR-19b binding site, potential binding sites were mutated, using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Cat No: 210518). [score:2]
Loss of miR-19b results in dysregulation of cardiac ion currents. [score:2]
How to cite this article: Benz, A. et al. miR-19b Regulates Ventricular Action Potential Duration in Zebrafish. [score:2]
miR-19b knockdown rescues short QT mutant. [score:2]
Consistent with previous reports, we found that overall morphology of miR-19b deficient hearts appeared to be normal, suggesting normal heart development (suppl. [score:2]
Morpholino -mediated knockdown of miR-19 in zebrafish leads to bradycardia and impaired ventricular contractility (±sd; n ≥ 14; p < 0.005). [score:2]
Here, we provide evidence that miR-19b regulates cardiac electrophysiology and we demonstrate that loss of miR-19b affects APD in vivo. [score:2]
However, APD50 and APD90 in miR-19b reduced hearts were significantly prolonged by 57.4% ± 3.8% and 38.6% ± 3.5%, respectively (Fig. 4). [score:1]
M-mode analysis revealed that at NOEL dosages of Terfenadine (30 μM), 25% ± 4.1% of miR-19b -deficient embryos developed an AV-block, while control larvae maintained their regular heartbeat without showing any sign of AV-conduction abnormalities (Fig. 5b,c, suppl. [score:1]
MO19 was designed to specifically block the processing of all miR-19 isoforms into their mature and active forms (suppl. [score:1]
Considering that miR-19b exerts a rather modulatory role in the electrical activity of the heart and loss of miR-19b results in a significant yet sub-phenotypic prolongation of the APD, the inability to rescue reg [−/−] that exhibits a profound shortening of the APD with severe manifestation of a resulting phenotype appears plausible. [score:1]
In situ hybridization of miRNAs For detection of microRNAs in zebrafishembryos at 48 and 72 hpf we used miR-19a- and miR-19b specific miRCURY LNA detection probes (35194, 35195, Exiqon) and followed the instruction manual of the manufacturer. [score:1]
Identification of miR-19b as causative isoform. [score:1]
To investigate the effects of loss of miR-19 on heart function, we initially injected a morpholino -modified oligonucleotide targeting all four isoforms of miR-19 (MO19) into zebrafish embryos at the single-cell stage. [score:1]
We next wanted to test whether miR-19b induced APD prolongation can be used to normalize a genetically caused pathological APD shortening. [score:1]
qRT-PCR analysis confirmed significant reduction of mature miR-19a, miR-19b, miR-19c, and miR-19d by at least 90% (Fig. 3c). [score:1]
miR-19b reduced hearts developed prolonged APDs. [score:1]
miR-19 deficient zebrafish displayed signs of cardiac dysfunction with cardiac edema and blood congestion at the inflow tract (Fig. 3a). [score:1]
These results lead us to conclude that miR-19b is involved in modulating cardiac conduction and electrical activity of the heart. [score:1]
Loss of miR-19 results in bradycardia and cardiomyopathy. [score:1]
To further illustrate the impact of miR-19b on the electrophysiology of the zebrafish heart, we performed an additional rescue experiment. [score:1]
Loss of miR-19b induces prolongation of the action potential. [score:1]
If increased KCNE4 levels contribute significantly to the observed APD prolongation and the bradycardia as a result of the miR-19b reduction, we hypothesized that reducing KCNE4 levels could partly rescue miR-19b-deficiency. [score:1]
In contrast, recordings taken from miR-19b reduced hearts by MO19b injection show a flattened, attenuated repolarization spike, potentially indicating increased I [Na] activity (Fig. 4d). [score:1]
We hypothesized that miR-19b loss mediated AP prolongation could be used to antagonize AP shortening in reg mutants and thereby to rescue the reg phenotype (Fig. 6b). [score:1]
For detection of microRNAs in zebrafishembryos at 48 and 72 hpf we used miR-19a- and miR-19b specific miRCURY LNA detection probes (35194, 35195, Exiqon) and followed the instruction manual of the manufacturer. [score:1]
To confirm the effect of miR-19b deficiency on ventricular APD, whole hearts from control and MO19b injected embryos at 48 hpf were dissected and ventricular compound APs from exogenously paced hearts were recorded (Fig. 4d). [score:1]
By impairment of the I [to]-current, the notch during early repolarization is decreased which might explain the elevated potential we observed during phase 1 in miR-19b deficient hearts. [score:1]
Supplementary MOvie 1. Supplementary MOvie 2. Supplementary MOvie 3. Supplementary MOvie 4. miR19 is conserved in sequence and syntheny. [score:1]
Phenotype of reggae mutants is partially rescued by loss of miR-19b. [score:1]
Importantly, these animals similarly developed bradycardia with an identical reduction in heart rate by 37.7% ± 9.5% that persisted, as a consequence of the genetic deletion, even beyond 5 dpf, confirming the effect of miR-19b on heart rhythm (Fig. 3h). [score:1]
We found that miR-19b reduction by MO19b injection did not alter overall angiogenesis (suppl. [score:1]
The sequence and the synteny of miR-19 is highly conserved among vertebrate species (Fig. 1a,b). [score:1]
Strikingly, miR-19b reduction significantly rescued reg [+/−] zebrafish, while reg [−/−] remained unaffected by this treatment. [score:1]
To ensure greater specificity in evaluating miR-19 function and to enable the identification of a single causal miR-19 isoform, we used four individual morpholinos to specifically target each miR-19 isoform exclusively (suppl. [score:1]
Importantly, MO19a or MO19b injection individually caused a reduction of mature miR-19a and miR-19b both by 50%. [score:1]
miR-19b deficient zebrafish display prolonged action potentials. [score:1]
Transcripts with a predicted miR-19b binding site in its 3′-UTR are indicated in blue (±sd; n = 3 from 15 pooled embryos per sample; p < 0,05). [score:1]
Additionally, the 3′UTR of human SCN4B showed responsiveness to miR-19b (±sd; n = 3; p < 0.05). [score:1]
Importantly, mutating the putative binding site in these 3′-UTRs, abolished miR-19-dependant repression of the luciferase protein. [score:1]
Taken together, our study establishes miR-19b as an important modulator of cardiac electrophysiology. [score:1]
Loss of miR-19 leads to bradycardia. [score:1]
[1 to 20 of 88 sentences]
4
[+] score: 214
Compared with the adjacent normal liver tissues, miR-19b expression was significantly downregulated in fibrotic liver samples and COL1A1 mRNA expression was significantly negatively correlated with the expression of miR-19b (r = −0.3990, P = 0.0159) (Fig.   1a- e). [score:9]
This is why, after we have shown that miR-19 expression was downregulated in the pericystic liver tissue of patients, we also used HCF and an in vitro mo del of HSC activation (LX-2 cells) as a first step to study the responsibility of metacestode components in the development and regulation of liver fibrogenesis around the cyst [32, 33]. [score:8]
TβRII mRNA was significantly up-regulated and its expression level was significantly inversely correlated with the expression of miR-19b (r = −0.4092, P = 0.0132) (Fig.   1f- i). [score:8]
In addition and conversely, we could show that overexpression of miR-19 inhibited the proliferation of HCF -induced HSC cells by directly targeting TβRII. [score:8]
Our study provides new evidence for the intervention of miRNAs in the regulation of fibrosis in infectious diseases; it suggests that E. granulosus can inhibit miR-19 liver expression and promote fibrosis through the increase in TβRII, the activation of hepatic stellate cells and extracellular matrix production. [score:8]
Conversely, overexpression of miR-19 by LX-2 cells inhibited the proliferation of these cells and led to decreased TβRII expression. [score:7]
Overexpression of miR-19b significantly inhibited α-SMA, COL1A1 and COL3A1 mRNA and protein expression levels in HCF -treated LX-2 cells. [score:7]
Based on our study, HCF simulation of LX-2 cells did promote their proliferation as well as the expression of α-SMA and synthesis of COL1A1 and COL3A1, while downregulating miR-19 levels. [score:6]
We have shown that, in the liver surrounding the parasitic cyst in CE patients, expression of miR-19 was downregulated and significantly negatively correlated with COL1A1 and TβRII mRNAs. [score:6]
It has been reported that miR-19b plays a role in various diseases, including infectious diseases, by regulating fibrogenesis. [score:6]
Incubation of LX-2 cells (in vitro) with HCF induced a decreased proliferation of these cells and a reduced expression of miR-19, inversely correlated with the expression of collagen 1A1 and TGF-β receptor II (TβRII). [score:5]
g Correlation between miR-19b expression and COL1A1 mRNA expression. [score:5]
Taken together, these results suggest that components of parasitic origin present in the cyst fluid are involved in the development of fibrosis through the activation of HSC and that modulation of miR-19 expression is part of the regulatory mechanisms of pericystic fibrogenesis in CE. [score:5]
Fig. 1Levels of α-SMA, COL1A1, COL3A1, TβRII mRNA and miR-19b expression in patients with Cystic Echinococcosis (CE) and correlation between α-SMA, COL1A1, COL3A1 or TβRII mRNA expression and miR-19b. [score:5]
Intervention of TGF-β-like proteins of parasitic origin might act in the feedback loop of TGF-β/Smad system regulation, including downregulation of miR-19. [score:5]
These data, together with other published works, suggest miR-19 might suppress TβRII expression. [score:5]
Echinococcus granulosus Liver fibrosis HSC miR-19 TβRII Cystic echinococcosis (CE) is a chronic helminthic disease caused by infection with the metacestode (larval stage) of the tapeworm Echinococcus granulosus, one of the most widespread zoonotic diseases in humans in both developing and developed countries. [score:5]
f Correlation between miR-19b expression and α-SMA mRNA expression. [score:5]
i Correlation between miR-19b expression and TβRII mRNA expression. [score:5]
h Correlation between miR-19b expression and COL3A1 mRNA expression. [score:5]
Previous studies have shown that miR-19b, a member, with miR-19a, of the miR-17-92 cluster, can negatively regulate TGF-β signaling components by decreasing TβRII and Smad3 expression [25]. [score:4]
Lakner et al. found miR-19b levels are downregulated in patients with fibrosis -associated viral infections (HBV and HCV-related chronic hepatitis and hepatocellular carcinoma) and in experimental animal mo dels of hepatic fibrosis [25]. [score:4]
Furthermore, overexpression of miR-19b significantly decreased expression of TβRII when compared to cells transfected with NS-miRNA (Fig.   5). [score:4]
miR-19b negatively regulates the expression of ECM and TβRII in HCF -induced LX-2 cells. [score:4]
miR-19b is downregulated in HCF -treated LX-2 cells. [score:4]
Overexpression of miR-19b mimics in HCF -treated LX-2 resulted in a significant inhibition of cell proliferation at 72 h, when compared with HCF -treated LX-2 transfected with NS-miRNA. [score:4]
miR-19b inhibits HCF -induced LX-2 proliferation. [score:3]
The low expression of miR-19, however, might deserve several explanations and have consequences on a variety of cells. [score:3]
Furthermore, miR-19 was regulated in the process of hepatic fibrosis induced by E. granulosus infection and our complementary in vitro experiments suggest that components of E. granulosus cyst fluid could be involved in this regulation. [score:3]
Fig. 3Effect of HCF on the expression of miR-19b, α-SMA, COL1A1, COL3A1 and TβRII in LX-2 cells. [score:3]
The expression of miR-19b and genes that are involved in liver fibrosis were analysed in E. granulosus-infected human livers using qRT-PCR. [score:3]
Therefore, in the present study, our aim was to observe the expression of miR-19 in fibrosis liver of CE patients and in activated HSCs, and then to study the function of miR-19 on HSC activation in vitro. [score:3]
HCF also induced a decrease in the expression of miR-19b. [score:3]
a The effect of miR-19b overexpression on the proliferation of HCF -induced LX-2 cells by. [score:3]
Expression of miR-19b is decreased in patients with CE. [score:3]
In summary, our results reveal that miR-19 could inhibit the activation of HSCs. [score:3]
These findings strongly suggest that HCF play a TGF-β-like fibrosis promoting role in HSC activation and proliferation by influencing miR-19 expression. [score:3]
HCF was also able to decrease miR-19 expression in HSC and to increase key-markers of HSC activation, α-SMA, COL1A1 and COL3A1. [score:3]
Fig. 5Effect of miR-19b on the expression of α-SMA, COL1A1, COL3A1 and TβRII in LX-2 cells. [score:3]
LX-2 cells were transiently transfected with miR-19b mimics (50 nM) or miRNA negative control (miR-NC) and a, α-SMA; b, COL1A1; c, COL3A1; d, TβRII gene expression were assessed by QRT-PCR at 48 h. e, 48 h post-transfection cells were harvested and immunoblot performed on whole cell lysates for α-SMA, COL1A1, COL3A1 and TβRII. [score:3]
Fig. 4Effect of miR-19b overexpression on the proliferation and cell cycle distribution of HCF -induced LX-2 cells. [score:3]
Moreover, it was shown that delivery of miR-19b into human umbilical vein endothelial cells can block the transition from S phase to the G1/M phase by controlling cyclin D1 expression [30]. [score:3]
a Expression of miR-19b in HCF treated LX-2 cells. [score:3]
Recent studies have shown the negative regulation of TβRII signaling by members of the miR-17-92 cluster (19a, 19b, 92a), with miR-19b exhibiting the highest fold-change among the cluster members [25]. [score:2]
We now provide evidence that miR-19 could be a player in its regulation. [score:2]
The results showed that the expression of miR-19 was significantly reduced in the pericystic collagen-rich liver tissue of CE patients, compared to normal liver. [score:2]
The low expression of miR-19 we observed in the pericystic area compared to adjacent normal liver tissues, and its negative correlation with extracellular matrix proteins and TβRII, thus suggest that reduced levels of miR-19 play a role in the pathophysiology of CE. [score:2]
We subsequently analysed the effect of miR-19b mimics on LX-2 cell cycle by flow cytometry. [score:1]
Cell cycle distribution of HCF -treated LX-2 cells transfected with miR-19b mimics differed significantly from the HCF -treated control cells transfected with NS-miRNA, with a lower percentage of cells in the S phases but a higher percentage of cells in the G [2]/M phases. [score:1]
The cells were transfected with the miR-19b mimics or the nonspecific (NS)-miRNA (GenePharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions at a final concentration of 50 nM for 24 h. The culturing medium was changed 6 h after transfection and HCF was added at a concentration of 125 μg/ml. [score:1]
As the data obtained from human livers suggested that parasite components might contribute to the decrease of miR-19b in CE patients, we first performed the to assess HSC cell proliferation. [score:1]
Briefly, LX-2 cells were placed at a density of 3 × 10 [3] cells per well in 96-well culture plates for 24 h and were then transfected with the miR-19b mimics or negative control mimics using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:1]
e Levels of miR-19b in patients with CE. [score:1]
b The effect of miR-19b on cell cycle of HCF -induced LX-2 cells was analysed by flow cytometry. [score:1]
The role of miR-19 in liver fibrosis induced by E. granulosus has not been explored. [score:1]
[1 to 20 of 55 sentences]
5
[+] score: 210
In contrast to the upregulation of miR-19b in cardiac hypertrophy and cardiac development, miR-19b is downregulated in coronary artery disease, which is closely linked to the Apaf1/caspase -dependent pathway [31]. [score:10]
Our data identified miR-19b as a critical miRNA which was significantly upregulated and could synergize with miR-1 to control the expression of GJA1 protein in the development of VMC. [score:7]
In contrary, utilizing an established miR-19b inhibitor, we found that the inhibition of miR-19b significantly enhanced the expression of GJA1. [score:7]
More importantly, re -expression of GJA1 significantly blunted the miR-19b -mediated downregulation of GJA1 in hiPSCs-CMs (Figure 4D,E). [score:6]
In addition, overexpression of miR-19b impacts left-right symmetry by targeting ctnnb1 in the cardiac development of zebrafish embryos [30]. [score:6]
These consistent data obtained from HL-1 cells and hiPSCs-CMs strengthened the notion that miR-19b could cooperate with miR-1 to down-regulate the GJA1 expression. [score:6]
GJA1 Was Predicted to Be Targeted by miR-19b and Was Downregulated in VMC. [score:6]
In order to explore the underlying molecular mechanism of miR-19b in VMC, we searched for potential regulatory targets of miR-19b using several bioinformatics methods, including TargetScan, miRWalk and miRanda. [score:6]
Li M. Hu X. Zhu J. Zhu C. Zhu S. Liu X. Xu J. Han S. Yu Z. Overexpression of miR-19b impairs cardiac development in zebrafish by targeting CTNNB1 Cell. [score:6]
All three algorithms consistently predicted GJA1 as a target of miR-19b, whose putative target sequence is located in 1373–1386nt of the 3’-UTR of GJA1 mRNA (Figure 2C). [score:5]
Our previous study has found that miR-1 could suppress the GJA1 expression in VMC in the same way as miR-19b did [14]. [score:5]
Our findings were in consistent with a previous study which showed overexpression of miR-19b could induce arrhythmias by targeting the GJA1 in transgenic mice [32]. [score:5]
Tang Y. Zhang Y. C. Chen Y. Xiang Y. Shen C. X. Li Y. G. The role of miR-19b in the inhibition of endothelial cell apoptosis and its relationship with coronary artery disease Sci. [score:5]
To explore whether GJA1 could blunt the miR-19b -mediated irregular beating, we re-expressed the GJA1 in the hiPSCs-CMs using a specific overexpression plasmid. [score:5]
2.5. miR-19b Directly Regulated the Expression of GJA1 in Vitro. [score:5]
To verify the possible regulation of GJA1 by miRNA-19b, we detected the expression of GJA1 in the heart from VMC mo dels. [score:4]
It turned out that miR-19b was significantly upregulated in the VMC heart. [score:4]
Our current results found that with the development of VMC, the expression level of GJA1 was diminished by miR-19b gradually. [score:4]
2.2. miR-19b Was Upregulated in VMC Mo del in Vivo and in Vitro. [score:4]
To confirm miR-19b was upregulated in cardiomyocytes during VMC, we used CVB [3] to infect the HL-1 cells which are immortalized mouse cardiac cells. [score:4]
These results indicated that GJA1 was decreased along with VMC progression and might be a result of the upregulation of miR-19b. [score:4]
2.7. miR-19b Cooperated with miR-1 to Regulate the GJA1 Expression. [score:4]
These results verified that GJA1 was a direct target of miR-19b. [score:4]
To explore the effects of miR-19b upregulation on cardiac rhythm in VMC, we transfected miR-19b mimics into the hiPSCs-CMs. [score:4]
Furthermore, when GJA1 was downregulated by miR-19b mimics, hiPSCs-CMs beat irregularly which displayed an erratic rhythm and the beating rate was decreased. [score:4]
MiR-1 shared a similar expression tendency with miR-19b during the progression of VMC (Figure 5B). [score:3]
Our results showed that when miR-19b was upregulated, hiPSCs-CMs beat irregularly as manifested by an erratic rhythm (Figure 2A and Supplementary video 1, video 2), and the beating rate was significantly decreased as compared with control cells (Figure 2B). [score:3]
As compared with the sham group, miR-19b mimics remarkably decreased the expression of GJA1, confirming the negative regulation of GJA1 by miR-19b. [score:3]
In the present study, miR-19b was highly expressed throughout the progression of VMC. [score:3]
A wild type GJA1-3’-UTR gene containing miR-19b -binding site (GJA1-3’UTR-wt) and a mutated GJA1-3’-UTR gene with mutated miR-19b -binding site (GJA1-3’UTR-mut) were constructed and separately cloned into pMIR-REPORT miRNA expression reporter vector (Ambion, Inc. [score:3]
MiR-19b is a member of the miR-17-92 cluster, which has been reported to mediate a variety of diseases [15]. [score:3]
Then the expression plasmid of GJA1 was transfected into the hiPSCs-CMs which had already been transfected with miR-19b mimics. [score:3]
The present study found that miR-19b could cooperate with miR-1 to diminish the GJA1 expression in a dose -dependent manner. [score:3]
The present study revealed that overexpression of miR-19b could provoke irregular beating patterns in hiPSCs-CMs, indicating that miR-19b might be associated with arrhythmias. [score:3]
Overexpression of miR-19b Resulted in Irregular Beating Patterns in hiPSCs-CMs. [score:3]
And miR-19b could cooperate with miR-1 to diminish the GJA1 expression in a dose -dependent manner. [score:3]
Next, the expression of GJA1 was detected in response to miR-19b treatments in mouse cardiomyocytes HL-1 cells. [score:3]
Using the real-time PCR analysis, it was verified that miR-19b was increasingly upregulated in the heart throughout the progression of VMC, and peaked on day 7 compared with the control group (Figure 1D). [score:3]
Re-Expression of GJA1 Rescued the miR-19b-Mediated Irregular Beating in hiPSCs-CMs. [score:3]
This result suggested that the enhanced expression of miR-19b could cause irregular beating patterns in hiPSCs-CMs and might explain the arrhythmogenesis in VMC. [score:3]
As shown in Figure 3A,B, GJA1 was dramatically suppressed by miR-19b mimics. [score:3]
The GJA1 mRNA containing the putative binding site of miR-19b (WT) and the GJA1 mRNA with mutated binding site of miR-19b (mutant) were cloned into the luciferase expressing pMIR vector respectively (Figure 3C). [score:3]
These reports have collectively suggested the great involvement of miR-19b in heart diseases. [score:3]
These results demonstrated that as the target of miR-19b, GJA1 could functionally rescue the miR-19b -mediated irregular beating in the hiPSCs-CMs. [score:3]
More interestingly, re -expression of GJA1 functionally rescued the miR-19b -mediated irregular beating in hiPSCs-CMs. [score:3]
Based on our observation that there was significant fibrosis in late stage of VMC, we speculated that miR-19b might also regulate profibrotic genes other than the arrhythmogenic gene GJA1 in VMC. [score:2]
Moreover, the GJA1 which plays important roles in the maintenance of normal cardiac rhythm [7], was revealed to be negatively targeted by miR-19b using systemic in vitro assays. [score:2]
As we have shown above, GJA1 was inhibited by miR-19b presumably by binding to the 1373–1386 nt of the GJA1 3’-UTR, therefore, we further verified the observation using luciferase reporter assay. [score:2]
The results showed that miR-19b reduced the relative luciferase activity in cells transfected with GJA1-3’-UTR binding site, but not in cells transfected with mutated GJA1-3’-UTR (Figure 3D). [score:1]
The in vitro data also verified that miR-19b was increased in the cell mo del of VMC (Figure 1E). [score:1]
Each of the reconstructed reporter plasmids was transfected into HEK293T cells that were pretreated with miR-19b mimics or scrambled oligonucleotides controls (miR-NC). [score:1]
The HEK293T cells were plated into 24-well plates and transfected with empty vector, GJA1-3’-UTR-wt, GJA1-3’UTR-mut along with miR-19b mimic or scramble miR mimic. [score:1]
Video S2: The beating pattern of miR-19b mimics -treated hiPSCs-CMs. [score:1]
The results indicated miR-19b may play an important role in murine VMC mo del. [score:1]
Based on previous studies and the present observation, it is conclusive that miR-19b may contribute to cardiac arrhythmia by repression of GJA1 in VMC. [score:1]
Therefore, we assumed that miR-19b could interact with miR-1 in VMC. [score:1]
Analysis of the 3’-UTR of GJA1 mRNA revealed that the two binding sites of miR-1 were adjacent to that of miR-19b (Figure 5A). [score:1]
Since miR-19b played a crucial role in the development of heart and was involved in cardiac arrhythmias [15], we selected it for our subsequent confirmative assays. [score:1]
Figure S1: Transfection efficiency of miR-19b and miR-1 in iPSCs-CMs and HL-1 cells. [score:1]
The miR-19b mimics were chemically synthesized double-stranded RNAs. [score:1]
In all, our data suggest that miR-19b may contribute to cardiac arrhythmia through repression of GJA1 in VMC. [score:1]
Hence, hiPSCs-CMs were utilized to study the functional role of miR-19b in vitro. [score:1]
[1 to 20 of 62 sentences]
6
[+] score: 175
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-19b-2
Therefore, our results indicate that miR-19b directly inhibits PTPRG translation, resulting in the suppression of PTPRG expression. [score:10]
In agreement with this, miR-19b was found herein to directly suppress PTPRG expression and consequently promote cell proliferation and migration and inhibits the apoptosis of breast cancer cells. [score:8]
Considering that miR-19b is an upstream regulator of PTPRG, it is possible to downregulate miR-19b for restoration of PTPRG expression in vivo. [score:7]
In breast cancer, upregulation of miR-19 suppresses downstream proteins, including PTEN, p-AKT, p-MDM2 and p53, leading to breast cancer carcinogenesis. [score:6]
The correlation between miR-19b and PTRPG was further examined by assessing PTPRG expression in the human breast cancer cell line MCF-7 and MDA- 231 after overexpressing or knocking down miR-19b. [score:6]
In these experiments, miR-19b overexpression was achieved by transfecting MCF-7 and MDA-231 cells with pre-miR- 19b (a synthetic RNA oligonucleotide duplex mimicking the miR-19b precursor), whereas miR-19b knockdown was achieved by transfecting the cells with anti-miR- 19b (a chemically modified antisense oligonucleotide designed to specifically target mature miR-19b). [score:6]
Although decreased PTPRG expression and increased miR-19b expression play important regulatory roles in carcinogenesis, little is known about the correlation between miR-19b and PTPRG in breast cancer. [score:6]
Interestingly, co-treatment with pre-miR-19b suppressed the luciferase reporter activity to a greater extent than with pre-miR-19a (Figure 2B) again suggesting that PTPRG is more likely to be a bona fide target of the miR-19b rather than miR-19a. [score:5]
Because PTPRG reduction can mimic miR-19b induction in promoting breast cancer cell proliferation and migration and suppressing apoptosis, it is possible that targeting PTPRG is one mechanism by which miR-19b exerts its oncogenic function. [score:5]
The increased expression of miR-19b can promote tumorigenesis by repressing PTEN expression and activating the PI3K pathway [8, 9]. [score:5]
To determine the level at which miR-19b affected PTPRG expression, we repeated the above experiments and examined the expression levels of PTPRG mRNA. [score:5]
After removing the miRNAs previously reported to be tumor suppressor or increased in breast cancer, miR- 19a and miR-19b (miR-19a/b) were finally selected as candidate regulatory miRNAs of PTPRG. [score:4]
In this study, we found an alternative mechanism in which increased miR-19b negatively regulates PTPRG expression at the post-transcriptional level in human breast cancer. [score:4]
The efficient overexpression or knockdown of miR-19b is shown in Figure 3A. [score:4]
As anticipated, the PTPRG protein levels were significantly reduced by the overexpression of miR-19b and increased by the knockdown of miR- 19b (Figure 3B and 3C) in MCF- 7 and MDA-231 cells. [score:4]
For the luciferase reporter assay, the cells were seeded into 6-well plates and co -transfected with 2 μg of a firefly luciferase reporter plasmid, 2 μg of a β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (100 pmol) of miR-19b mimic, inhibitor, or a scrambled negative control RNA using Lipofectamine 2000 (Invitrogen). [score:4]
For the overexpression experiments of miRNA, 100 pmol of pre-miR-19b was used, and for the knockdown experiments of miRNA, 100 pmol of anti-miR-19b was used. [score:4]
Therefore, modulation of PTPRG by miR-19b may explain, at least in part, why the upregulation of miR-19b can promote tumor growth and breast cancer formation. [score:4]
MiR-19b directly regulates PTPRG expression at the post-transcriptional level. [score:4]
These results prove that miR-19b regulates PTPRG expression at the post-transcriptional level. [score:4]
MiR-19b promotes the proliferation and migration and inhibits the apoptosis of breast cancer cells by targeting PTPRG. [score:4]
Moreover, the cells transfected with pre-miR-19b showed stimulated cell migration, whereas the cells transfected with anti-miR-19b exhibited inhibited migration (Figure 4B and 4C). [score:3]
Taken together, this study provides the first evidence that miR-19b reduces PTPRG expression at the post-transcriptional level to promote tumorigenesis in human breast cancer. [score:3]
Furthermore, we detected an inverse correlation between miR-19b and PTPRG expression in breast cancer tissues. [score:3]
Identification of conserved miR-19b target sites within the 3′-UTR of PTPRG. [score:3]
This mutated luciferase reporter was unaffected by the overexpression of miR-19b (Figure 2B). [score:3]
As a key oncogenic component of the miR-17- 92 cluster, overexpression of miR-19 is implicated in carcinogenesis processes. [score:3]
The data indicated that miR-19b mediates the post-transcriptional repression of PTPRG gene expression in human breast cancer. [score:3]
These results suggested that miR-19b can promote proliferation and migration and inhibit the apoptosis of breast cancer cells. [score:3]
Finally, the biological roles of the miR-19b -mediated inhibition of PTPRG expression in human breast cancer were investigated. [score:3]
Moreover, the breast-cancer-promoting role of miR-19/PTEN/AKT/p53 axis can be reversed by curcumin, implying that miR-19 is a potential target for breast cancer intervention [15]. [score:3]
MCF-7 and MDA-231 cells were cultured in 12-well plates and transfected with pre-miR-19b, anti-miR-19b, PTPRG siRNA, or the PTPRG overexpression plasmid to induce apoptosis. [score:3]
Thus, PTPRG was deduced to be a miR-19b target based on both computational predictions and the inverse correlation between the levels of miR-19b and PTPRG protein, but not mRNA levels, in human breast cancer. [score:3]
For example, miR-19b promotes the tumorigenicity of Myc -driven B-cell lymphomas by targeting PTEN [13]. [score:3]
Next, we experimentally confirmed the negative regulation of PTPRG by miR-19b in breast cancer cells. [score:2]
We next focused on the biological functions of miR-19b in regulating PTPRG in MCF-7 and MDA- 231 cells. [score:2]
MiR-19b also contributes to human cervical carcinoma cellular proliferation and invasion through suppressing vasopressin-activated calcium-mobilizing receptor-1 (CUL5) [14]. [score:2]
Validation of miR-19b as a negative regulator of PTPRG. [score:2]
Next, we introduced point mutations into the corresponding complementary sites in the 3′-UTR of PTPRG to eliminate the predicted miR-19b binding sites. [score:2]
Figure 3(A) Quantitative RT-PCR analysis of miR-19b levels in MCF-7 and MDA-231 cells treated with pre-miR-control, pre-miR-19b, anti-miR-control or anti-miR-19b. [score:1]
The data showed that MCF-7 and MDA-231 cells transfected with pre-miR-19b exhibited increased proliferation, whereas transfecting with anti-miR-19b had the opposite effect on cell proliferation (Figure 4A). [score:1]
MiR-19b is an important component of the miR-17–92 cluster. [score:1]
Figure 4(A)s were performed 12, 24, 36 and 48 h after the transfection of MCF-7 and MDA-231 cells with pre-miR-control, pre- miR- 19b, anti-miR-control or anti-miR-19b. [score:1]
The inverse correlation between miR-19b and PTPRG protein levels (Figure 2D) and the disparity between the miR-19b and PTPRG mRNA levels (Figure 2E) were further illustrated using Pearson's correlation scatter plots. [score:1]
This finding suggests that the putative binding sites of PTPRG strongly contribute to the interaction between miR-19b and PTPRG mRNA. [score:1]
Further studies should be conducted to characterize the feasibility of targeting miR-19b in breast cancer therapy and develop simplified and cost-effective manipulation methods. [score:1]
After determining the levels of miR-19b in the same 14 pairs of breast cancer tissues and their corresponding noncancerous tissues, we showed that miR-19b levels were consistently increased in breast cancer tissues (Figure 2C). [score:1]
Thus, we focused on miR-19b in further studies. [score:1]
Detection of an inverse correlation between the miR-19b levels and the PTPRG protein levels in breast cancer tissues. [score:1]
Effects of miR-19b on the proliferation, migration and apoptosis of MCF-7 and MDA-231 cells. [score:1]
Because PTPRG is involved in reversible tyrosine phosphorylation, the influence of miR-19b on tumorigenesis and other biological processes may be momentous. [score:1]
The alteration of miR-19b levels did not influence the mRNA levels of PTPRG (Figure 3D). [score:1]
Similarly, the cells transfected with pre-miR-19b showed reduced apoptosis, whereas the cells transfected with anti-miR-19b exhibited increased apoptosis (Figure 4D and 4E). [score:1]
In this study, we identified a novel relationship between miR-19b and PTPRG in human breast cancer. [score:1]
Inverse correlation between miR-19b and PTPRG protein levels in human breast cancer tissues. [score:1]
Clearly, the miR-19b levels were significantly increased in the MCF-7 and MDA-231 cells when these cells were transfected with pre-miR-19b, whereas the miR-19b levels were decreased when the cells were transfected with anti-miR-19b. [score:1]
[1 to 20 of 56 sentences]
7
[+] score: 119
In line with reduced expression levels in failing hearts of old mice, decreased miR-18a, miR-19a, and miR-19b expression was associated with severe heart failure at old age (Fig. 3A), while miRNA expression in old patients with a preserved function was not different from young ICM patients (Fig. 3A). [score:7]
In contrast, collagen 1A1 and 3A1 transcription was not affected by either miR-18a and miR-19b overexpression or inhibition in neonatal rat cardiomyocytes and cardiac fibroblasts (NRCFs), indicating that collagen expression in cardiac fibroblasts is unrelated to these miRNAs (Fig. 6B). [score:7]
For the overexpression or inhibition of miR-18a and miR-19b, NRCMs and NRCFs were transfected with 80 nm miRIDIAN hairpin inhibitor (antagomiR) miR-18a (#IH-300487-06) or miR-19b (#IH-300489-05), or with miRIDIAN mimic miR-18a (#C-300487-05), or miR-19b (#C-300489-03) (Dharmacon, Colorado, CO, USA). [score:7]
Together, these data suggest that regulation of CTGF and TSP-1 is the result of the shared expression of miR-18a, miR-19a, and miR19b, enabling modest changes in miRNA expression to control transcriptional repression. [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
In cardiac fibroblasts, overexpression of miR-18a and miR-19b also decreased CTGF and TSP-1 transcription; however, inhibition of these miRNAs was not sufficient to increase CTGF and TSP-1. This may be attributed to the fact that a fibroblast produces large amounts of CTGF and TSP-1 while it contains relatively low amounts of miR-18a and miR-19b. [score:5]
Overexpression of miR-18a and miR-19b, using miRNA mimics, resulted in significant repression of CTGF and TSP-1 mRNA and protein expression in cardiomyocytes (Fig. 5F and G; Supporting information Fig. S3A). [score:5]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
Here, miRNA mimics of miR-18a and miR-19b blunted the expression of CTGF and TSP-1, and vice versa, inhibition of these miRNAs enhanced CTGF and TSP-1 levels. [score:5]
Indeed, overexpression of miR18a and miR-19b in cardiomyocytes repressed collagen 1A1 and 3A1 mRNA levels, while inhibition of these miRNAs using antagomirs significantly enhanced collagen transcription (Fig. 6A). [score:5]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
These results imply that the age-related regulation of CTGF and TSP-1 expression by miR-18a and miR-19b in the heart is uniquely restricted to the cardiomyocyte to control its surrounding ECM. [score:4]
Fig. 5MiR-18a and miR-19b regulate CTGF and TSP-1 expression in cardiomyocytes. [score:4]
Our in vitro results support a role for miR-18a, miR-19a, and miR-19b in regulating CTGF and TSP-1 expression in the aged cardiomyocyte. [score:4]
MiR-18a and miR-19b are abundantly expressed in the adult mouse heart and are predominantly localized in the perinuclear area of cardiomyocytes (Fig. 5A–C). [score:3]
Importantly, the abundant expression of miR-18a and miR-19b in cardiomyocytes coincides with low levels of CTGF and TSP-1, whereas in cardiac fibroblasts, relatively low levels of miR-18a and miR-19b were associated with high CTGF and TSP-1 transcription (Fig. 5E). [score:3]
These findings confirm the expression profiles in aged HF-prone mice and again suggest that miR-18a, miR-19a, and miR-19b could transcriptionally repress CTGF and TSP-1 levels in cardiomyocyte aging and HF at old age. [score:3]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
Therefore, we investigated whether age-related changes in miR-18a, miR-19a, and miR-19b expression regulate CTGF, TSP-1, and collagen levels in rodent mo dels of aging -associated heart failure and in the human failing heart. [score:2]
Fig. S3 CTGF and TSP-1 transcripts are regulated by miR-18a and miR-19b in cardiomyocytes. [score:2]
Next, we performed a series of functional studies to determine the role of miR-18a and miR-19b in the regulation of CTGF and TSP-1 and collagen production in cardiomyocytes and cardiac fibroblasts. [score:2]
These results show that regulation of CTGF and TSP-1 by miR-18a and miR-19b is uniquely restricted to the cardiomyocyte. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
This was corroborated by the finding that miR-18a and miR-19b expression was higher in cardiomyocytes compared to cardiac fibroblasts (Fig. 5D). [score:2]
RT-PCR analysis of miR-18a, miR-19a, miR-19b, CTGF, and TSP-1 transcript levels in myocardial biopsies from idiopathic cardiomyopathy (ICM) patients at older age with normal (n = 5) and severely impaired (n = 9) cardiac function. [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
CTGF, TSP-1, miR-18a, miR-19a, and miR-19b levels in aged HF-resistant (12 weeks, n = 8; 52 weeks, n = 8; and 104 weeks, n = 9) and HF-prone mice (12 weeks, n = 6; 52 weeks, n = 11; and 104 weeks, n = 9). [score:1]
Importantly, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs. [score:1]
RT-PCR analysis for the induction collagen 1A1 (COL1A1) and collagen 3A1 (COL3A1) in cultured neonatal rat cardiomyocytes and cardiac fibroblasts after manipulation with miR-18a and miR-19b mimics and antagomirs. [score:1]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
Vice versa, blunting of miR-18a and miR-19b using antagomirs was sufficient to increase CTGF and TSP-1 transcript and protein levels in cardiomyocytes (Fig. 5F, G; Supporting information Fig. S3A). [score:1]
Cardiac fibroblasts demonstrated decreased CTGF and TSP-1 transcript levels upon introduction of miR-18a and miR-19b; however, this did not result in reduced protein levels (Fig. 5H, I). [score:1]
Double DIG-labeled locked nucleic acid (LNA) hybridization probes complementary to mouse mature miR-18a (5DIGN/CTATCTGCACTAGATGCACCTTA/3DIG_N) (#38462-15), miR-19b (5DIGN/TCAGTTTTGCATGGATTTGCACA/3DIG_N) (#38092-15), and a scrambled probe (5DIGN/GTGTAACACGTCTATACGCCCA/3DIG_N) (#99004-15) were purchased from Exiqon (Vedbaek, Denmark). [score:1]
[1 to 20 of 35 sentences]
8
[+] score: 103
The main findings of the present study are the following: (1) Decreased myocardial and serum miR-19b expression is present in AS patients, namely in those with HF; (2) Both myocardial and serum miR-19b are inversely associated with myocardial LOX protein and CCL, as well as with LV stiffness in AS patients; (3) miR-19b inhibition increased the expression of CTGF and LOX protein in human adult fibroblasts. [score:7]
Although down-regulation of myocardial miR-19b expression has been reported previously in AS patients 23, findings here reported expand this information on this microRNA showing that miR-19b was abnormally decreased not only in the myocardium but also in the blood of these patients, and namely in those with HF. [score:6]
Although the underlying mechanisms need to be fully elucidated, we report that miR-19b inhibition also increases CTGF expression in fibroblasts. [score:5]
according to the databases mentioned in the section indicated that CTGF is a potential target for miR-19b, therefore, we analyzed its protein expression in HDF transfected cells. [score:5]
In silico analysis according to the databases mentioned in the section indicated that CTGF is a potential target for miR-19b, therefore, we analyzed its protein expression in HDF transfected cells. [score:5]
Inhibition of miR-19b significantly increased (p < 0.05) the expression of LOX protein in HDF cells (Fig. 4). [score:5]
Therefore, it may be speculated that miR-19b might control LOX expression in human fibroblasts via CTGF regulation. [score:4]
In fact, our in vitro data suggest a role of miR-19b in the regulation of LOX expression in human fibroblasts. [score:4]
In contrast, a direct correlation was observed for miR-19b between its expression in myocardial tissue and in peripheral blood in all AS patients (r = 0.375, p < 0.05). [score:4]
On the other hand serum miR-19b was also decreased in AS patients and was associated with its myocardial expression. [score:3]
Inverse correlations between myocardial miR-19b expression and myocardial LOX protein [linear fit: −1.823x + 6.761; panel (a)], collagen cross-linking [linear fit: −2.224x + 5.626; panel (b)] and left ventricular chamber stiffness constant (K [LV]) [linear fit: −0.042x + 0.113; panel (c)] in patients with aortic stenosis. [score:3]
Expression of LOX mRNA and protein [panels (a) and (c)] and CTGF mRNA and protein [panels (c) and (d)] in adult human dermal fibroblasts transfected with control oligonucleotides or with anti-miR-19b. [score:3]
Although some members of the cluster are located in chromosome X (e. g. miR-19b-2) no differences were observed between males and females in miR-19b expression neither in myocardium nor in serum (Supplementary results). [score:3]
Relative expression of miR-133a and miR-19b in myocardium [Panel (a)] and serum [Panel (b)] from patients with aortic stenosis (AS) and control subjects. [score:3]
The inhibition of miR-19b induces an increase in CTGF and LOX protein in human dermal fibroblasts. [score:3]
The expression of miR-133a and miR-19b is decreased in myocardium and serum from aortic stenosis patients. [score:3]
From the 7 microRNAs assessed, miR-133a, miR-21 and miR-19b were detected both in myocardial and serum samples from AS patients and control subjects, whereas the expression of miR-29b, miR-1, miR-208a and miR-499-5p was under the limit of detection in serum samples from AS patients and control subjects. [score:3]
Inverse correlations between serum miR-19b expression and myocardial LOX protein [linear fit: −0.037x + 5.587; panel (a)], collagen cross-linking [linear fit: −0.059x + 4.505; panel (b)] and left ventricular chamber stiffness constant (K [LV]) [linear fit: −0.002x + 0.100; panel (c)] in patients with aortic stenosis. [score:3]
In vitro studies As expected, miR-19b expression was decreased (p < 0.01) in HDF cells transfected with antimiR-19b (0.01 ± 0.01 A. U. ) compared to those transfected with control oligonucleotides (1.06 ± 0.18 A. U. ). [score:2]
Coherently, miR-19b has been shown to regulate CTGF in ageing -associated HF both in a rodent mo del and in patients 20. [score:2]
In this regard, it must be noted that a direct correlation was found between myocardial and serum miR-19b suggesting the partial cardiac origin of serum miR-19b in AS patients. [score:2]
As expected, miR-19b expression was decreased (p < 0.01) in HDF cells transfected with antimiR-19b (0.01 ± 0.01 A. U. ) compared to those transfected with control oligonucleotides (1.06 ± 0.18 A. U. ). [score:2]
MicroRNA-19b expression and parameters related to myocardial fibrosis in aortic stenosis patients classified according to the presence or absence of heart failure. [score:2]
The expression of miR-133a and miR-19b was reduced in the myocardial and serum samples from AS patients compared to control subjects (Fig. 1). [score:2]
Thus, circulating miR-19b emerges as a potential biomarker of the alterations of myocardial collagen present in AS patients with HF. [score:1]
Associations of miR-19b with cardiac parameters. [score:1]
Myocardial miR-19b is inversely correlated with LOX, collagen cross-linking and left ventricular stiffness in aortic stenosis patients. [score:1]
Serum levels of miR-19b were also inversely correlated with LOX, CCL and K [LV] in AS patients (Fig. 3). [score:1]
Although descriptive in nature these findings raise the possibility that miR-19b participates in the alterations of the myocardial collagen that impair LV mechanics and contribute to HF in AS. [score:1]
In addition, we report for the first time that decreased miR-19b was associated with increased myocardial LOX and CCL in AS patients. [score:1]
This is further supported by the association between myocardial miR-19b and the presence of HF observed in AS patients, independently of possible confounding factors like age, sex and ejection fraction. [score:1]
We report that myocardial levels of miR-19b were abnormally decreased in AS patients and were associated with an excess of LOX and CCL, as well as increased LV stiffness, namely in those patients with HF. [score:1]
These associations suggest that miR-19b may modulate the enzyme LOX which determines CCL 14. [score:1]
Myocardial miR-19b was inversely correlated with CVF (r = −0.409, p < 0.05), as well as with LOX, and CCL in AS patients (Fig. 2). [score:1]
The potential pathophysiological impact of the association between miR-19b, LOX and CCL is given by our observation that these parameters were associated with LV chamber stiffness and that all of them were associated with the presence of HF in AS patients. [score:1]
Moreover, myocardial miR-19b was inversely correlated with K [LV] in AS patients (Fig. 2). [score:1]
Taken together, all these data support the hypothesis that myocardial miR-19b could be involved in LV dysfunction by facilitating LOX -mediated CCL that results in the formation of stiff collagen fibers in the myocardium of patients with AS and HF. [score:1]
Serum miR-19b is inversely correlated with LOX, collagen cross-linking and left ventricular stiffness in aortic stenosis patients. [score:1]
Therefore, although validation studies in larger independent cohorts are necessary, circulating miR-19b could be another biomarker of the quality of myocardial fibrosis (i. e. CCL), at least in AS patients. [score:1]
On the other hand, the associations here reported between circulating miR-19b and myocardial parameters, namely CCL, may be of potential clinical interest. [score:1]
MiR-19b belongs to the miR-17-92 cluster which includes miR-17, miR-18, miR-19a, miR-19b, miR-20 and miR-92 30. [score:1]
Moreover, logistic regression analysis showed that decreased myocardial miR-19b was associated with the presence of HF (OR 0.949, 95% CI 0.91–0.99; p < 0.05), independently of age, gender and ejection fraction. [score:1]
Moreover, decreased serum miR-19b was also associated with excessive myocardial LOX and CCL, and increased LV stiffness, especially in patients with HF. [score:1]
[1 to 20 of 43 sentences]
9
[+] score: 81
Other miRNAs from this paper: hsa-mir-19b-2
Genes from direct target NRM mo dels (miR-19b-1 is predicted to target the gene by at least two miRNA target prediction algorithms) are represented by rectangular nodes. [score:8]
This also becomes apparent in Figure 3 that compares the observed expression of functional miR-19b-1 targets (left) to their predicted expression using only miR-19b-1 as predictor (middle) and predictions using miR-19b-1 together with the identified complementary miRNA predictors (right). [score:7]
In Figure 3 (A), the expression values of all genes for which miR-19b-1 served as a predictor in either the direct target or the residual mo dels were centered and scaled and then clustered with Euclidean distance and Ward linkage. [score:6]
The gene expression values of these genes were then predicted with either miR-19b-1 alone (Figure 3 (B)) or with all predictors included in the direct target and residual mo dels (Figure 3 (C)). [score:6]
In mo dels that were learned on the residuals of the direct target mo dels, we found 14 genes with miR-19b-1 in their list of predictors, suggesting that the prominent role of miR-19b-1 in oncogenesis might not be restricted to its direct action as a silencing miRNA. [score:5]
They found miR-19b tissue-specific for leukemias and colon and these two tissues of origin also show highest and second highest expression in the miRNA expression data of Blower [38], which we use. [score:5]
This confirms the known role of miR-19b-1 in apoptosis and points to further functions of miR-19b-1 targets in DNA recombination and repair which are also often dysregulated in cancer. [score:4]
We identified 9 genes where miR-19b-1 is one of possibly many predictors in mo dels that have either positive or negative coefficients and predictors with complementary seed sequences (direct target mo dels). [score:4]
The three most significant GO terms from the target gene over-representation analysis of miR-19b-1 are ‘DNA recombination’, ‘DNA repair’ and ‘programmed cell death’ (Table 3). [score:3]
The Onco-miRNA miR-19b-1. Gene expression of genes for which miR-19b-1 serves as one of the predictors. [score:3]
Interestingly, only three of the genes are predicted to be targets of miR-19b-1 based on sequence information (rectangular nodes), the others are not in the databases (ellipsoid gene nodes) and stem from the residual mo dels. [score:3]
B) Gene expression predicted from miR-19b-1 only. [score:3]
Most frequent GO terms over-represented in targets of miR-19b-1.. [score:3]
The target gene sets of miR-19b-1 are enriched for four of these terms. [score:3]
miR-19b-1 belongs to the mir-17-92 cluster which is frequently amplified and over-expressed in lymphomas [33]. [score:3]
Interestingly, in most cases, miR-19b-1 was not chosen as a single predictor but as a co-predictor that needs to be complemented with further miRNAs in order to predict gene expression. [score:3]
Whereas the prediction of gene expression values with miR-19b-1 alone is very poor, the prediction using all predictors from the regression mo dels is good. [score:3]
The most frequently occurring GO terms over all mo dels are summarized in Table 2. GO term enrichment analysis for the genes from negative regulation and residual mo dels where miR-19b-1 served as a predictor was done analogously. [score:2]
miR-19b-1 is located in the center of the network, around it are genes for which miR-19b-1 is one of the predictors from the negative restricted mo dels (NRM) and the third layer consists of miRNAs for which the genes from the second layer are predictors (unconstrained mo dels). [score:1]
0040634.g004 Figure 4 Interactions of miR-19b-1 with genes with functions in ‘DNA recombination’ (orange), ‘DNA repair’ (pink), ‘programmed cell death’ (green), all three categories (yellow), in ‘DNA recombination’ and ‘DNA repair’ (purple) and in ‘DNA recombination’ and ‘programmed cell death’ (red). [score:1]
Interaction network of miR-19b-1.. [score:1]
Focusing on the subnetwork around miR-19b-1, some of the genes for which miR-19b-1 serves as a predictor are known to have binding sites (11 genes), but the majority of the genes were de novo identified (50 genes). [score:1]
If only miR-19b-1 is allowed as a predictor in the LARS mo del, the prediction is poor. [score:1]
Interactions of miR-19b-1 with genes with functions in ‘DNA recombination’ (orange), ‘DNA repair’ (pink), ‘programmed cell death’ (green), all three categories (yellow), in ‘DNA recombination’ and ‘DNA repair’ (purple) and in ‘DNA recombination’ and ‘programmed cell death’ (red). [score:1]
miR-19b has been shown to be the key oncogenic miRNA within the mir-17-92 cluster. [score:1]
[1 to 20 of 25 sentences]
10
[+] score: 78
Bta-mir-19b and bta-mir-19b-2 share the same targets and therefore overall 12 genes were identified which showed expression consistent with being targets of miRNAs with differential level of expression, 10 of which were in the PP group and 2 in NP group compared with the NN group. [score:8]
miRNAs belonging to the human miR-17-92 cluster, including mir-19b, which had lower expression in NP vs NN, have been described as targeting ZBTB4 [73] which indeed had higher expression levels in the NP group. [score:7]
Bta-mir-19b and bta-mir-19b2 were differentially expressed in both positive and exposed groups, although apparently affecting the expression of different target genes in the two groups. [score:7]
Four miRNAs, bta-mir-19b, bta-mir-19b2, bta-mir-1271 and novel miRNA 14_7917, which showed a differential expression between PP and NN groups were also differentially expressed between NP vs NN groups with the same trend of expression. [score:7]
HIC1, TBC1D8 and IMPDH1 were over expressed in the PP group in comparison with the NN control groups and had the same target sequence motif for both bta-mir-19b and bta-mir-19b-2, which had lower expression in the PP group. [score:7]
One of the genes targeted by both bta-mir-19b and bta-mir-19b2 is HIC1 (Hypermethylated In Cancer 1), which showed an increased expression only in the PP group which is consistent with the decrease in the miRNAs levels. [score:5]
The target prediction analysis carried out here also suggests that bta-mir-19b and bta-mir-19b-2, which had lower levels in PP vs NN animals, target IMPDH1, which is consistent with the increased IMPDH1 level in PP vs NN groups. [score:5]
In particular, the NP group showed reduced levels of bta-mir-19b, bta-mir-19b-2 and bta-mir-1271 and an increased expression of target genes which was observed in the PP vs NN groups. [score:5]
Among differentially expressed miRNAs between the PP and NN groups bta-mir-19b, bta-mir-19b-2, bta-mir-1271 and Novel:14_7917 have previously been found to be involved in human tuberculosis and in inflammatory bowel disease. [score:5]
Patterns of miRNA and mRNA expression observed between the two groups suggests that the status was different, although expression of bta-mir-19b and bta-mir-19b2 differed in both NP and PP groups in comparison with the NN control group (Table 3), suggesting that the exposed group was responding, possibly to latent MAP infection. [score:5]
HIC1, TBC1D8 and IMPDH1 had the same sequence motif and were targeted by both bta-mir-19b and bta-mir-19b-2 in the PP group, while ZBTB4 was targeted by bta-mir-19b and bta-mir-19b-2 in the NP group. [score:5]
This would explain the high variability of the expression levels observed in the exposed group compared with the other two groups for bta-mir-19b, bta-mir-19b2, bta-mir-301a and bta-mir-32 that were all differentially expressed between the PP vs NN groups. [score:4]
Interestingly, although the level of mir-19 was also lower in the NP vs NN animals, the expression of IMPDH1 was not appreciably higher in NP vs NN groups. [score:3]
Interestingly, reduced expression of mir-19b and mir-19b-2 has been observed respectively in serum [66] and sputum [63] of tuberculosis affected human vs healthy patients. [score:3]
Furthermore, mir-19b was reported to have low levels of expression in mucosal tissue of Crohn’s affected patients when compared to healthy controls [67]. [score:2]
[1 to 20 of 15 sentences]
11
[+] score: 64
The top ranked miRNAs (NPES > 2.8, p = 0.001 and FDR < 0.02) included, miR-19b-3p (miR-19ab family) and miR-92a/b-3p (miR-25/32/92abc/363/363-3p/367 family), were significantly upregulated in eBL tumor cells, and targets tumor suppressor genes such as ATM and NLK, which are observed to be downregulated in eBL. [score:11]
These tumor suppressors were targeted by multiple upregulated miRNAs (miR-19b-3p, miR-26a-5p, miR-30b-5p, miR-92a-5p and miR-27b-3p) which could account for their aberrant expression in eBL. [score:10]
Among the upregulated miRNAs in eBL were members of the miR-17~92 cluster (miR-19b-3p, and miR-92a-3p) (logFC > 3), which target tumor suppressor genes such as TP53 [63] and ATM (ataxia telangiectasia mutated) kinase [59, 64], respectively. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Genomic aberrations such as abnormal upregulation of host miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) targeting ATM would favor proliferation, tumor cell survival and occurrences of mutations that would favor oncogenesis. [score:7]
Upregulation of miRNAs (miR-27b-3p, miR-26a-5p, miR-30b-5p, miR-19b-3p, and miR-92b-3p) in eBL targeting ATM suggests abnormal miRNA mediate regulation of this gene which would lead to ATM loss. [score:7]
By observing elevated expression of MYC, miR-19b-3p, miR-92a-3p and miR-92b-3p in eBL tumor cells compared to GC B-cells, we confirm that elevated expression of the miR-17~92 cluster miRNAs is a critical feature facilitating eBL lymphomagenesis. [score:4]
This miRNA gene cluster encodes for six distinct miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92) that share the same seed sequence [68]. [score:1]
[1 to 20 of 9 sentences]
12
[+] score: 60
However, above reports did not show the reduced plasma expression of miR-17, miR-451, miR-106a, and miR-19b in disease groups, suggesting the downregulation of four-miRNA panel is specific for FSGS and may be involved in the pathogenesis of FSGS. [score:8]
a-d The expression of miR-17, miR-451, miR-106a, and miR-19b between in FSGS patients (n = 74) and in other chronic kidney diseases including 69 IgAN patients, 24 MSPGN patients, and 26 MN patients. [score:5]
Tang Y The role of miR-19b in the inhibition of endothelial cell apoptosis and its relationship with coronary artery diseaseSci. [score:5]
Figure  5c showed miR-17, miR-451, and miR-106a were significantly downregulated in FSGS with proteinuria (n = 56) when compared with FSGS patients who were in remission (urinary protein <400 mg/24 h after treatment) (n = 18), whereas the expression of miR-19b did not differ in above two groups. [score:5]
Fig. 3 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
A schematic of the study outlining the independent patients and samples used in discovery, training, validation, and blinded-test phases of the identification of plasma-miRNA panel for FSGS miRNA profiling in plasma from five FSGS patients and five healthy controls was performed by using a real-time PCR -based high-throughput miRNA array a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
Fig. 4 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
Here, we found four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were significantly downregulated in FSGS compared with healthy controls. [score:3]
Above data suggest that there was a correlation between miRNAs expression (especially for miR-17 and miR-19b) and histologic classification of FSGS. [score:3]
In addition, there was a correlation between miRNAs expression (especially for miR-17 and miR-19b) and histologic classification of FSGS. [score:3]
a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
We found that the expression of miR-17, miR-451, and miR-19b was significantly lower in medium-severe FSGS compared with mild FSGS (Fig.   5a). [score:2]
In current study, we found that the expression of plasma miR-17, miR-451, and miR-19b was significantly lower in medium-severe FSGS compared with mild FSGS. [score:2]
MiR-17 and miR-19b, as members of miR-17 ~ 92 cluster, play key roles in kidney development and homeostasis. [score:2]
results showed that the levels of miR-17, miR-451, miR-106a, and miR-19b were the lowest in FSGS patients compared with healthy controls and disease controls. [score:2]
ROC curve analysis showed that miR-17 had AUC of 0.61 (95% CI, 0.51–0.72), miR-451 had AUC of 0.76 (95% CI, 0.67–0.85), miR-106a had AUC of 0.64 (95% CI, 0.54–0.74), and miR-19b had AUC of 0.72 (95% CI, 0.62–0.82) (Fig.   4b). [score:1]
As shown in Fig.   5b, the plasma levels of miR-17, miR-19b, and miR-106a were significantly lower in combined variants group than in NOS, tip lesion, or perihilar groups. [score:1]
We performed Kruskal–Wallis test, then found there was significant difference on the level of miR-17 (P = 0.04) and miR-19b (P = 0.01) between different subtypes of FSGS (Table  S2). [score:1]
As a result, four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were the ones which fulfilled above criteria and then selected for further validation. [score:1]
As shown in Fig.   3b, the areas under ROC curves (AUCs) of miR-17, miR-451, miR-106a, and miR-19b were 0.66 (95% confidence interval (CI), 0.52–0.80), 0.66 (95% CI, 0.51–0.80), 0.70 (95% CI, 0.56–0.84), and 0.72 (95% CI, 0.59–0.86), respectively. [score:1]
For example, significant positive correlations were found between miR-17 and miR-451, and between miR-106a and miR-19b plasma levels, with correlation coefficient values of 0.773 and 0.843, respectively (P  < 0.001) (Figure  S3). [score:1]
The fold changes in miR-17, miR-451, miR-106a, and miR-19b were 0.55, 0.56, 0.59, and 0.55, respectively (Fig.   3a). [score:1]
Logistic regression demonstrated that a linear combination of values for miR-17, miR-451, miR-106a, and miR-19b produced the best mo del for FSGS diagnosis. [score:1]
[1 to 20 of 23 sentences]
13
[+] score: 55
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-2
miR-19a and miR-19b directly bind BARD1 3’UTR reducing its expression levels. [score:4]
org website, we focused on two miRNAs that may potentially regulate BARD1 expression by the binding to its 3’UTR: miR-19a and miR-19b (Figure 3C ). [score:4]
Corroborating our hypothesis of regulation of BARD1 mRNAs by miRs, miR-19a and miR-19b overexpression led to BARD1 reduction (Figure 4B ). [score:4]
Moreover, considering that one of the reported miR-19b targets is Bim, a protein of the mitochondrial apoptosis pathway [42], a reorganisation in the events leading to caspase-9 activation might be postulated. [score:3]
The overexpression of miR-19a and miR-19b in NB4 cells was confirmed by qPCR in NB4, K562, U937 and HL60 cells (Figure 3D ). [score:3]
We found that Vorinostat reduces BARD1 mRNA levels by increasing miR-19a and miR-19b expression. [score:3]
BARD1 is a target of miR-19a and miR-19b. [score:3]
miR-19a and miR-19b overexpression leads to increased sensitivity to Vorinostat treatment. [score:3]
In other words, it is tempting to speculate on a possible patient stratification on the basis of expression levels of miR-19 and BARD1 isoforms to better define patients that might actually benefit from epi -based treatment. [score:3]
BARD1 is the target of miR-19a and miR-19b. [score:3]
As expected, Real-Time PCR analysis showed an increment of hsa-miR-19a and hsa-miR-19b expression 48 hours after transfection (Figure 4A ) compared to the untreated control and the mimic-miR-scramble control. [score:2]
To further demonstrate the direct binding of miR-19a and miR-19b to the 3’UTR of BARD1, we cloned the BARD1 3’UTR region into the pGL3 vector, downstream of the luciferase reporter gene. [score:2]
Upon treatment with Vorinostat, U937-miR-19a and U937-miR-19b cells showed a higher percentage of cell death in comparison with the negative control (Figure 5A ). [score:1]
Figure S4 Validation of stable transfected clones for miR-19a and miR-19b. [score:1]
We concluded that the decrease of BARD1 mRNA observed by Vorinostat treatment could involve miR-19a and miR-19b. [score:1]
s in U937-MIR cells further suggested that in U937-miR-19a and U937-miR-19b cells Vorinostat treatment induced stronger caspase-8 and, in particular, caspase-9 activation (Figure 5B ). [score:1]
0083018.g004 Figure 4(A) Real-Time PCR for mir-19a and miR-19b in NB4 cells transfected with mimic-miR-19a, mimic-miR-19b or mimic-miR-scramble (miR-s). [score:1]
Clones were screened for overexpression of the two miRNAs and clones U937-miR-19a D and G and U937-miR-19b D and E were selected for further investigation (Figure S4 ). [score:1]
The reaction mixture was then combined with specific mimic-miRNAs (1:1) at the desired concentration and incubated for 10 minutes at RT; in this case 50 nM mimic-miR-19a and 50 nM mimic-miR-19b were used, or 50 nM mimic-miR-scramble as negative control. [score:1]
The luciferase assay clearly showed that miR-19a and miR-19b can directly bind to the 3’UTR of BARD1, decreasing luciferin oxidation and light development (Figure 4C, left), compared to the HeLa control cells transfected only with pGL3-3’UTR-BARD1 vector and the mimic-miR-scramble control. [score:1]
pCMV-MIR vectors (OriGene) encoding for miR-19a or miR-19b and the empty vector were first amplified in E. coli DH5α and plasmids were extracted with PureLinkHipure Plasmid Filter Maxiprep Kit (Invitrogen). [score:1]
These findings strengthen our conclusions regarding the prognostic role of miR-19a and miR-19b, and give new connotations to the isoforms of BARD1, which may prove useful both as diagnostic and predictive markers. [score:1]
Real-Time PCR for miR-19a and miR-19b in pCMV-MIR stable transfected U937 cells. [score:1]
To clarify the biological functions of miR-19a and miR-19b, stable transfection of pCMV-MIR-19a, pCMV-MIR-19b into U937 cells was performed. [score:1]
miR-19b, especially, seems to play a crucial role in inducing carcinogenesis. [score:1]
To confirm that, we transfected NB4 cells with mimic-miR-19a and mimic-miR-19b. [score:1]
1 µg of pGL3-3’UTR-BARD1 plasmid plus 200 nM mimic-miR-19a, mimic-miR-19b or mimic-miR-scramble were used. [score:1]
Modulation of miR-19a, miR-19b and BARD1increases mortality of U937 cells after Vorinostat treatment. [score:1]
Annealing of miR-19a and miR-19b to BARD1 3’UTR: wild type and mutated BARD1 3’UTR are schematized. [score:1]
In particular, relative fold change for miRNA19a and miRNA19b were 0.32 and 0.36, respectively. [score:1]
[1 to 20 of 30 sentences]
14
[+] score: 50
Data leading to this concludion include the following: Firstly, we provided new evidence to show that cMyc could stimulate expression of miR-17∼92 cluster miRNAs, among others, during early stage of human fibroblastic cell reprogramming; Secondly, forced expression of miR-17∼92 cluster with 4F or 3F enhanced human iPSC induction; Thirdly, miR-19a and miR-19b of the miR-17∼92 cluster were key members that play critical roles in this process; Lastly, PTEN was a target of miR-19a/b that mediated the effect of miR-17∼92 cluster on human fibroblast reprogramming. [score:7]
Error bars, s. d. ; n = 3. C. Mature miRNA expressions of miR-17-92 cluster were analyzed by qRT-PCR in 293T cells transfected with miR-19a or miR-19b truncated vector or vector expressing the complete miR-17∼92 cluster. [score:5]
Our studies demonstrate for the first time that miR-17∼92 cluster stimulates human fibroblast reprogramming by targeting PTEN, with miR-19a and miR-19b playing a predominant role. [score:3]
Western blot analysis showed that PTEN protein expression decreased in IMR90 cells transfected with miR-19a or miR-19b mimics. [score:3]
To further validate the results of the antagomir experiment, we used miR-19a- or miR-19b- truncated miR-17∼92 cluster expressing vector for iPSC induction [33]. [score:3]
Moreover, iPSC induction efficiency by 4F decreased significantly after inhibition of miR-19a or/and miR-19b by antagomirs (Figure 3C). [score:3]
B. Mature miR-19a and miR-19b expressions were analyzed by qRT-PCR in 293T cells transfected with miRNA antagomirs for miR-19a and miR-19b, respectively. [score:3]
A. Western blot analysis showed that PTEN protein expression decreased in IMR90 cells transfected with miR-19a or miR-19b mimics. [score:3]
C. Inhibition of miR-19a and/or miR-19b decreased the reprogramming in IMR90 cells induced by 4F. [score:3]
Real-time PCR analysis showed that truncation of miR-19a and miR-19b specifically reduced mature miRNA expression of miR-19a and miR-19b, respectively, without affecting the maturation of other miRNAs in this cluster (Figure S3C). [score:3]
The miR-17∼92 cluster is a primary transcript that processes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a. [score:1]
Hence, while our current results clearly establish cMyc/miR19/PTEN axis as key players in this process, further deciphering these roles and underlying mechanisms will no doubt further our understanding of the fate decision and safety controls during reprogramming. [score:1]
F. Deletion of miR-19a or miR-19b in miR-17∼92 cluster decreased the efficiency of reprogramming in IMR90 cells induced by 3F. [score:1]
Taken together, the data indicate that miR-19a and miR-19b are the key components of miR-17∼92 cluster in human fibroblastic cell reprogramming. [score:1]
miR-19a and miR-19b are the key components of miR-17∼92 cluster in reprogramming. [score:1]
We found that, among those miRNA mimics, only miRNA mimics for miR-19a and miR-19b significantly enhanced iPSC induction efficiency by 4F (Figure 3A). [score:1]
Further, we induced iPSCs with miR-19a and/or miR-19b mimics combined with 3F, or miR-19a and/or miR-19b antagomirs combined with 4F. [score:1]
In case of iPSC induction by 3F, deletion of miR-19a or miR-19b not only resulted in decreased iPSC clone numbers but also delayed the appearance of iPSC clones (Figure 3F). [score:1]
miR-19a and miR-19b are the key components of miR-17∼92 cluster in human fibroblast reprogramming. [score:1]
B. miR-19a and/or miR-19b stimulated the reprogramming in IMR90 cells induced by 3F. [score:1]
We found that miR-17∼92 cluster, miR19a and miR19b in particular, enhanced human fibroblast reprogramming, in the presence or absence of cMyc. [score:1]
We found that iPSC induction efficiency by 3F was also greatly enhanced in the presence of miR-19a and/or miR-19b mimics (Figure 3B). [score:1]
Moreover, our data demonstrate that miR-19a and miR-19b, which are oncogenic in human malignancies [27], are the most potent to stimulate induction of iPSCs. [score:1]
D. Deletion of miR-19a or miR-19b in miR-17∼92 cluster decreased the efficiency of reprogramming in IMR90 cells induced by 4F. [score:1]
[1 to 20 of 24 sentences]
15
[+] score: 47
Based on the experiments using specific miR inhibitors, the mechanisms of the effects of miR-18a-5p, miR-19a-3p, and miR-19b-3p on the up-regulation of activated STAT3 might be the suppression of genes for regulatory proteins of STAT3 such as protein inhibitor of activated STAT3 (PIAS3) and suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) [29– 32]. [score:13]
Interestingly, miRNA inhibitors targeted to miR-18a-5p, miR-19a-3p, and miR-19b-3p down-regulated the expression of BCL2, BCL2L1, BIRC5, and MMP9, target genes of STAT3, which implied the positive feedback loop of STAT3/miR-17-92 clusters (Fig. 7B-E). [score:12]
In particular, inhibition of miR-18a-5p, miR-19a-3p, and miR-19b-3p resulted in differential up-regulation of mRNA expressioin of PIAS3, SOCS1, and SOCS3, coding genes for regulatory proteins of STAT3 such as (Supplemental Fig. 6–8). [score:9]
In order to figure out feedback effects of miR-17-92 clusters on STAT3 activation, we evaluated the expression of target genes of STAT3 which demonstrated higher expression in Y79 cells than other retinal constituent cells: BCL2, BCL2L1, BIRC5, and MMP9 according to the treatment with specific miRNA inhibitors to components of miR-17-92 clusters: miR-18a-5p, miR-19a-3p, and miR-19b-3p. [score:7]
Interestingly, the inhibition of miR-18a-5p, miR-19-3p, and miR-19b-3p induced the decrease in the proportion of pSTAT3 -positive retinoblastoma cells. [score:3]
org demonstrated that sequences from 998 through 1020 in the 3′ UTR region of CCND1 are targets for miR-17 and miR-20a, those from 1770 through 1784 are those for miR-19a, and those from 1777 through 1782 are those for miR-19b. [score:3]
[1 to 20 of 6 sentences]
16
[+] score: 45
We demonstrate that, when expressed at the high levels found in G4 MBs, linc-NeD125 functions as a competing endogenous RNA (ceRNA) that, sequestering miR-19a-3p, miR-19b-3p, and mir-106a-5p, de-represses the expression of their targets CDK6, MYCN, SNCAIP and KDM6A, major driver genes of G4 MB. [score:7]
Left panel: linc-NeD125 expression in D283 Med cells transfected with LNA inhibitors targeting miR-19a, miR-19b and miR-106a (LNA miRs, gray bar) or with scrambled LNA (LNA CTRL, white bar). [score:7]
Their ectopic expression had no effect on the levels of miR-19a-3p, miR-19b-3p, or miR-106a-5p (Supplementary Figure 2), indicating that linc-NeD125 does not regulate their abundance [15]. [score:4]
miR-19a-3p, miR-19b-3p and miR-106a-5p repress G4 MB driver gene expression. [score:3]
As shown in Figure 2B, only miR-19a-3p, miR-19b-3p, and miR-106a-5p were significantly overexpressed in tumour specimens, with 2- to 4-fold increases over control levels. [score:3]
Given the high expression levels of miR-19a-3p, miR-19b-3p and miR-106a-5p in D283 Med cells (Figure 2E), miRNA loss-of-function experiments were performed. [score:3]
Collectively, these results demonstrate that linc-NeD125 controls the in vitro expression of four genes known to drive G4 MB, i. e. CDK6, MYCN, SNCAIP, and KDM6A, by competing with their transcripts for binding to miR-19a-3p, miR-19b-3p and miR-106a-5p. [score:3]
Linc-Ned125 de-represses G4 MB driver gene expression by sequestering miR-19a-3p, miR-19b-3p, and miR-106a-5p. [score:3]
Linc-NeD125 functions as a natural miRNA sponge, competitively binding and sequestering three endogenous miRNAs—miR-19a-3p, miR-19b-3p and miR-106a-5p—whose targets include CDK6, MYCN, SNCAIP, and KDM6A transcripts (Figure 8). [score:3]
Effects of miR-19a-3p, miR-19b-3p, miR-106a-5p inhibition on D283 Med cell properties. [score:3]
The same tool was used to eliminate 2 of the 6 miRNAs that could bind the pull-down bait, leaving a short list of 4 miRNAs—namely miR-19a-3p, miR-19b-3p, miR-106a-5p and miR-191-5p—which are specifically bound by linc-NeD125 (Figure 1D, right panel). [score:1]
Among those, we found that the microRNAs bound by linc-NeD125, miR-19a-3p, miR-19b-3p and miR-106a-5p, were predicted to pleiotropically repress five G4 driver genes (Figure 2C). [score:1]
Interaction of miR-19a-3p, miR-19b-3p and miR-106a-5p with G4 driver genes. [score:1]
To verify the specificity of miRNA-linc-NeD125 interaction, we cloned the wild type and mutant linc-NeD125 into luciferase reporter vectors (Figure 4A, left panel) and transfected them into D283 Med cells, along with the LNAs complementary to miR-19a-3p, miR-19b-3p, and miR-106a-5p. [score:1]
Right panel: number and positions of miR-19a-3p, miR-19b-3p, miR-106a-5p, miR-191a-5p MREs on linc-NeD125 sequence. [score:1]
Middle panel: Western blot analysis of five G4 MB driver gene protein products in D283 Med cells transfected with LNAs against miR-19a, miR-19b, miR-106a (LNA miRs) or with scrambled LNA (LNA CTRL). [score:1]
[1 to 20 of 16 sentences]
17
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
18
[+] score: 42
These miRNAs had overlapping and cooperative effects on tumor suppressor genes with miR-19b directly targeting PTEN and BIM; miR-20a directly targeting PTEN, BIM and PHF6; miR-92 directly targeting IKAROS/ IKZF1, PTEN, BIM, NF1 and FBXW7, and miR-223 directly targeting FBXW7, respectively. [score:15]
Mavrakis et al. [46] further identified five miRNAs (miR-19b, miR-20a, miR-26a, miR-92 and miR-223) that contributed to leukemogenesis and acted as multi -targeted regulators of several tumor suppressor genes (IKAROS/ IKZF1, PTEN, BIM, PHF6, NF1 and FBXW7). [score:6]
MiR-19 activated the PI3K/AKT pro-survival pathway via downregulation of several negative regulators [44]. [score:4]
MiR-19 was confirmed to regulate NF-κB signaling through direct targeting of CYLD with further in vitro experiments [45]. [score:4]
Moreover, luciferase assay experiments showed that miR-19 directly repressed the expression of CYLD, which plays a predominant role in the negative regulation of NF-κB, inducing activation of the NF-κB downstream program [45]. [score:4]
Among these are miR-19, which showed the highest expression of all members of the miR-17-92 cluster in human T-ALL. [score:3]
This expression of miR-19 is sufficient enough to promote leukemogenesis in NOTCH1 -induced T-ALL in vivo through coordination a phosphatidylinositol-3-OH kinase (PI3K) pathway related program of cell survival. [score:3]
As mentioned above, miR-19, which belongs to the miR-17-92 cluster, controlled multiple regulators (PP2A, PRKAA1, BIM, and PTEN) of PI3K signaling which resulted in increased phosphorylation of AKT and the ribosomal S6 protein, which subsequently promoted survival of T-ALL cells [44]. [score:2]
Three of these miRNAs (miR-19b, miR-20a, and miR-92) belong to the oncogenic miR-17-92 cluster. [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 36
The ANOVA test showed significant differences between control, MGUS, diagnostic and CR samples in the expression levels of miR-16 (P < 0.001), miR-17 (P < 0.001), miR-19b (P < 0.001), miR-20a (P = 0.002), miR-660 (P < 0.001) and miR-25 (P < 0.001), with the highest levels of expression observed in samples from healthy controls. [score:5]
Progression-free survival after autologous stem-cell transplantation according to the expression levels of miR-19b and miR-331, comparing patients with low levels of both miRNAs and those with high expression of either miRNA. [score:5]
In our patients with MM, several miRNAs were underexpressed in serum at diagnosis but increased at CR; moreover, miR-19b and miR-331 were associated with shorter PFS. [score:3]
Figure 3 Figure 4In the univariate analysis, only older age (>55 years), high creatinine levels (>2 mg/dL), and low miR-19b/miR-331 expression were associated with shorter PFS. [score:3]
Moreover, the expression of five of these miRNAs miR-16, miR-17, miR-19b, miR-20a and miR-660 – increased at the time of CR, and two of the 14 miRNAsmiR-19b and miR-331 – were linked to PFS after ASCT. [score:3]
Figure 3 Figure 4 In the univariate analysis, only older age (>55 years), high creatinine levels (>2 mg/dL), and low miR-19b/miR-331 expression were associated with shorter PFS. [score:3]
The analysis of the 14 miRNAs identified in the screening phase confirmed the differential expression of five miRNAs between the diagnostic and CR samples of the patients with MM: miR-16 (P = 0.028), miR-17 (P = 0.016), miR-19b (P = 0.009), miR-20a (P = 0.017) and miR-660 (P = 0.048) (Figure 2). [score:3]
Progression-free survival after autologous stem-cell transplantation according to (A) miR-19b and (B) miR-331 expression levels in serum. [score:3]
Importantly, the miR-19b/miR-331 combination retained its prognostic value in the multivariate analysis (HR, 5.3; P = 0.033). [score:1]
Significantly lower levels of miR-19b were observed in samples obtained at relapse than in those obtained at CR (P = 0.04). [score:1]
Shorter PFS was associated with low miR-19b levels (median 1.8 vs. [score:1]
Patients with lower levels of miR-19b or miR-331 had shorter PFS than those with higher levels, and moreover, those with low levels of both miRNAs had shorter PFS than those with high levels of either miRNA. [score:1]
miR-19b and miR-133 as markers of PFS after CR. [score:1]
Differential serum levels of miR-16, miR-17, miR19b, miR-20a, miR-25 and miR-660 in patients with multiple myeloma (MM) at diagnosis (Dx) and at complete remission (CR), in patients with monoclonal gammopathy of undetermined significance (MGUS), and in healthy controls (HC). [score:1]
The multivariate analysis identified the miR-19b/miR-331 combination (HR, 5.3; 95% CI, 1.1–24.7; P = 0.033) and creatinine levels (HR, 7.5; 95% CI, 1.9–29.7; P = 0.004) as prognostic markers of PFS. [score:1]
miR-16, miR-17, miR-19b, miR-20a and miR-660 as markers of CR. [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 35
miRNA Protein target(s) Regulatory Action Clinical Implications miR-1 LXRα*Directly suppresses LXR in vitro May promote an increase in cellular cholesterol[38] miR-9 ACAT1* Directly suppresses ACAT1 and esterification of cholesterol in macrophages Overexpression may promote macrophage cholesterol efflux and reduce foam cell formation[47] miR-10b ABCA1* ABCG1* Directly represses ABCA1 and ABCG1 expression and decreases macrophage cholesterol efflux Can be suppressed by dietary anthocyanins, leading to increased macrophage cholesterol efflux and lesion regression[63] miR-19b ABCA1* Directly suppresses ABCA1 and decreases cholesterol efflux to ApoA1; increases atherosclerotic lesion area and severity Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[53] miR-26 ABCA1* ARL7 Activated by LXR to suppress both proteins, decreasing macrophage cholesterol efflux Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[58] miR-27a/b ABCA1* ABCG1 ACAT1* CD36 LPL* Directly suppresses ABCA1, indirectly suppresses ABCG1, and reduces cholesterol efflux. [score:32]
In vivo, ABCA1 suppression in macrophages by miR-19b [53] and miR-144-3p [5], and in liver by miR-144-5p [54], reduced HDL cholesterol and RCT. [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 35
miR-19b-3p targets TIMELESS and NR1D2 and many of its correlated neighbours, let-7e-5p, miR-99b-5p and, indirectly, miR-140-3p (separated by 1 degree and connected via miR-214-3p and miR-212-3p) are instead down-regulated, suggesting a potential regulation of miR-19b-3p on these miRNAs. [score:8]
miR-19b-3p is correlated with miR-99b-5p, targeting PER1, RORA and TIMELESS mRNAs and, indirectly, with miR-140-3p, targeting NPAS2 and TIMELESS mRNAs. [score:6]
Besides, these miRNAs are involved in the pathways controlling cancer cell proliferation and invasiveness (Supplementary Table S6) Table 2 Fold Change (Tumor versus Control) Targets let-7e-5p Down PER1, CLOCK miR-125b-5p Down PER1, RORA, TIPIN miR-140-3p Down NPAS2, TIMELESS miR-99b-5p Down PER1, RORA, TIMELESS miR-19b-3p Up TIMELESS, NR1D2 miR-139-5p Down TIMELESS Figure 3 Multi-layer network of clock genes and targeting miRNAs in which nodes represent clock genes or miRNAs, while edges represent correlation or interaction among miRNAs or genes. [score:5]
This latter miRNA is implicated in colorectal carcinogenesis [36] and targets PER1 and CLOCK mRNAs and in our analysis it gains a link to miR-19b-3p, which targets TIMELESS and NR1D2 mRNAs. [score:5]
Additionally, the fold-change and the correlation values indicated miR-19-3b as a possible negative regulator of the let-7-e-5p gene, as it was negatively correlated and up-regulated in tumor. [score:5]
Besides, these miRNAs are involved in the pathways controlling cancer cell proliferation and invasiveness (Supplementary Table S6) Table 2 Fold Change (Tumor versus Control) Targets let-7e-5p Down PER1, CLOCK miR-125b-5p Down PER1, RORA, TIPIN miR-140-3p Down NPAS2, TIMELESS miR-99b-5p Down PER1, RORA, TIMELESS miR-19b-3p Up TIMELESS, NR1D2 miR-139-5p Down TIMELESS Figure 3 Multi-layer network of clock genes and targeting miRNAs in which nodes represent clock genes or miRNAs, while edges represent correlation or interaction among miRNAs or genes. [score:5]
Noteworthy, miR-19b-3p is weakly (−0.47) anti-correlated with miR-99b-5p in the control subset, but the anti-correlation strength becomes stronger in the tumor subset. [score:1]
[1 to 20 of 7 sentences]
22
[+] score: 34
miR-151a-3p (ΔΔCt = -2.01, P = 8.29E-06), MiR-181b-5p (ΔΔCt = -3.39, P = 1.04E-10), miR-320a (ΔΔCt = -2.47, P = 5.02E-12), miR-328 (ΔΔCt = -2.28, P = 4.33E-06), miR-433 (ΔΔCt = -2.33, P = 0.0001), miR-489 (ΔΔCt = -2.10, P = 1.25E-06), miR-572 (ΔΔCt = -2.47, P = 2.66E-08) and miR-663a (ΔΔCt = -2.06, P = 0.00002) were downregulated, while miR-101-3p (ΔΔCt = 1.43, P = 0.003), miR-106b-5p (ΔΔCt = 1.30, P = 0.008), miR-130a-3p (ΔΔCt = 2.35, P = 1.89E-09), miR-195-5p (ΔΔCt = 1.43, P = 0.0016) and miR-19b-3p (ΔΔCt = 1.87, P = 6.88E-09) were upregulated in the ASD individuals. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572, and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-130a-3p, miR-195-5p, and miR-19b-3p were upregulated. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
Collectively, these results predicted several neurologically relevant canonical pathways for the target genes of the five miRNAs (miR-130a-3p, miR-19b-3p, miR-320a, miR181b-5p, and miR-572) that showed a good discriminative power in ROC analysis. [score:3]
High values for sensitivity, specificity and area under the curve (AUC) were observed for five miRNAs: miR-181b-5p, miR-320a, miR-572, miR-130a-3p and miR-19b-3p (see Additional file 6). [score:1]
High values for sensitivity, specificity and the area under the curve (AUC) were observed for five miRNAs: miR-181b-5p, miR-320a, miR-572, miR-130a-3p and miR-19b-3p (see Additional file 6). [score:1]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 33
The relative expression of miRNAs in DCM samples and healthy control samples is shown in Figure 9. We found a 2.6-fold increase in hsa-miR-340 expression (P < 0.001), a 2.4-fold increase in hsa-mir-19b expression (P < 0.01) and a twofold increase in hsa-miR-302 expression (P < 0.05) in DCM samples. [score:9]
The hsa-miR-19b and hsa-miR-302 were down-regulated in the profile analysis, but up-regulated in the quantitative RT-PCR assay. [score:6]
Van Almen et al. [29] reported that decreased hsa-miR-19 expression leads to increased expression of CTGF and TSP-1 in aged failure-prone hearts. [score:5]
The miRNAs hsa-miR-19a (12 degrees) and hsa-miR-19b (12 degrees) were significantly down-regulated in the DCM samples. [score:4]
Importantly, our study identified miRNAs, hsa-miR-19b, hsa-miR-302d and hsa-miR-340 (Fig. 9) which were significantly up-regulated in human DCM and may play a critical role in the pathophysiology of heart failure. [score:4]
Real-time PCR demonstrated that hsa-miR-19b, hsa-miR-302d and hsa-miR-340 were significantly increased (P < 0.05), which validate the results from the and implied an important role of miR-340. [score:1]
In the network, the performance differences in the most critical miRNAs (hsa-miR-340, hsa-miR-19a, hsa-miR-19b, etc. ) [score:1]
The miRNAs hsa-miR-200b (16 degrees), hsa-miR-181c (14 degrees), hsa-miR-340 (13 degrees), hsa-miR-557 (13 degrees), hsa-miR-19a (12 degrees), hsa-miR-19b (12 degrees) and hsa-miR-548f (12 degrees) were significantly differentially regulated in DCM samples compared with non-failing control samples. [score:1]
Selected miRNAs (hsa-miR-10a, miR-19b, miR-181c, miR-302d and miR-340) were further quantified with TaqMan qRT-PCR. [score:1]
The key miRNAs identified included hsa-miR-181c, hsa-miR-19a and hsa-miR-19b, which all have higher degrees in the network diagram. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 32
Our analysis illustrated some potential targets that are consistent with the known targets as presented in Table 1. For example, our analysis showed that miR-19b-1 may regulate the experimentally validated target Tsp1. [score:8]
Upon treatment of Colo-357 with G2535, the oncogenic miRNAs miR-17, miR-19b-1, miR-20a, miR-106a, miR-200b and miR-221 showed decreased expression and the tumor suppressor miRNAs let-7a, let-7b, let-7c, let-7d, let-7f, let-7i and miR-16-1 showed increased expression. [score:7]
We also found that miR-19b-1 may target E2F8, another related member of this transcription factor family which plays a role in inhibiting cellular proliferation. [score:5]
In regards to Colo-357, treatment with B-DIM showed decreased expression of the oncogenic miRNAs miR-17, miR-19b-1, miR-20a and miR-106a. [score:3]
Additionally, it was reported that miR-19b-1 may also target caspase 8 (CASP8), death -associated protein kinase 3 (DAPK3), and programmed cell death 1 ligand 2 (PDCD1LG2), all genes known to be involved in apoptosis, further suggesting the anti-apoptotic function of the miR-17-92 cluster in cancer. [score:3]
Due to the considerable number of potential targets for the miRNAs, we will limit our discussion by only focusing on miR-19b-1 of the miR-17-92 cluster as well as miR-221. [score:3]
Thus miR-19b-1 may negatively regulate this transcription factor and allow proliferation to occur, contributing to the oncogenic role of the miR-17-92 cluster in cancer. [score:2]
Falling into this category is the group of six miRNAs termed the miR-17-92 cluster which is made up of miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1 [49]. [score:1]
[1 to 20 of 8 sentences]
25
[+] score: 32
The only exceptions were miR-19b and miR-29b, upregulated in cell lines while a not significant downregulation was observed in clinical samples. [score:7]
Strong inverse correlation was observed between the tumor suppressor PTEN and several members of the miR-17, miR-19, miR-130/301 and miR-26 families, which were upregulated in the osteosarcoma cell lines. [score:6]
In addition, the expression of the tumor suppressor gene phosphatase and tensin homolog (PTEN) inversely correlated with miR-17, miR-20b, miR-9* and miR-92a (Table 2), but also showed a modest inverse correlation (r = −0.4 to −0.5) with other miRNAs of the miR-17, miR-19, miR-130/301 and miR-26 families (Table S6). [score:5]
miR-451 and miR-497 showed a trend towards being significantly decreased, miR-31 showed a heterogenous expression pattern, and miR-19b, miR-29b and miR-142-3p were expressed at comparable level in clinical samples and bone. [score:5]
miR-18a of the miR-17-92 cluster and miR-18b of the miR-106a-92 cluster showed almost identical expression patterns in clinical samples, while some divergence was observed for miR-19b being encoded by both clusters (Figure 3). [score:3]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
Of the 15 miRNAs, all but miR-19b showed significant changes in gene expression level for clinical samples compared to either bone and/or osteoblasts. [score:2]
These 13 miRNAs include all the above seven miRNAs (omitting miR-31*) previously described in osteoblasts [8] as well as miR-1, miR-18a, miR-18b, miR-19b, miR-133b and miR-144. [score:1]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 31
The inhibitors of miR-17–5p and miR-20a-5p but neither the inhibitor control nor the miR-19b-3p inhibitor led to a significant upregulation of p21 protein levels (Fig. 6D). [score:10]
HPV E6/E7 increase intracellular levels of members of the oncogenic miR-17~92 cluster that reduce p21 expression in HPV -positive cancer cellsThe 52 most abundant cellular miRNAs that were downregulated > 1.5-fold upon E6/E7 silencing in both deep sequencing and qRT-PCR analyses encompassed miR-17–5p and miR-19b-3p, two members of the miR-17~92 cluster, and miR-93–5p, a member of the paralog miR-106b~25 cluster (Fig. 2D/E). [score:6]
The 52 most abundant cellular miRNAs that were downregulated > 1.5-fold upon E6/E7 silencing in both deep sequencing and qRT-PCR analyses encompassed miR-17–5p and miR-19b-3p, two members of the miR-17~92 cluster, and miR-93–5p, a member of the paralog miR-106b~25 cluster (Fig. 2D/E). [score:4]
control”) that carries no homology to any known mammalian gene or with specific miRNA inhibitors of miR-17–5p, miR-20a-5p, and miR-19b-3p. [score:3]
Transfection of a mir-17~92 expression vector led to an increase of miR-17–5p, miR-20a-5p, miR-19b-3p and miR-92a-3p levels, as expected, but not of miR-34a-5p, which served as a negative control (Fig. 6A). [score:3]
miR-17–5p, miR-20a-5p, miR-19b-3p, miR-92a-3p: encoded by the mir-17~92 expression vector; miR-34a-5p: negative control (not encoded by the vector). [score:3]
The oncogenicity of miRNAs has been particularly well demonstrated for members of the miR-17~92 cluster (also called “oncomir-1”; coding for miR-17, miR-20a, miR-18a, miR-19a, miR-19b and miR-92a) and of its paralog cluster miR-106b~25 (coding for miR-106b, miR-93 and miR-25) [18]. [score:1]
The 23 miRNAs comprise several family members of the miR-378 family (miR-378a-3p, miR-378c, miR-378d, miR-378f), as well as members of the miR-17~92 and miR-106b~25 clusters (miR-17–5p, miR-19b-3p, miR-93–5p). [score:1]
[1 to 20 of 8 sentences]
27
[+] score: 30
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-2
Interestingly, although individual miR-19a or miR-19b overexpression/knockdown increases/decreases cell proliferation, simultaneous introduction/reduction of miR-19a and miR-19b exerted synergistic effects with respect to cell proliferation promotion/suppression compared to the effects exerted by miR-19a or miR-19b alone (Fig.   4D and 4E). [score:5]
While MTUS1 protein and mRNA expression was significantly increased in A549 cells transfected with anti-miR-19a (100 pmol) or anti-miR-19b (100 pmol), the greatest increase in expression occurred when anti-miR-19a and anti-miR-19b (50 pmol each) were transfected into A549 cells simultaneously (Fig.   4A–C). [score:5]
More importantly, both the wound healing and the Transwell assays indicated that simultaneous introduction of miR-19a and miR-19b exerted synergistic effects with respect to the promotion of cell migration compared to the effects exerted by miR-19a or miR-19b alone and that simultaneous inhibition of miR-19a and miR-19b decelerated cell migration more than inhibition of either miRNA alone (Fig.   4F– I). [score:3]
For miRNA overexpression, equal amounts of pre-miR-19a (100 pmol), pre-miR-19b (100 pmol) or pre-miR-19a/b (50 pmol each) were used. [score:3]
Synthetic RNA molecules, including pre-miR-19a and pre-miR-19b (miRNA mimics), anti-miR-19a and anti-miR-19b (miRNA inhibitors), and scrambled negative control RNAs (pre-miR-control and anti-miR-control), were purchased from GenePharma (Shanghai, China). [score:3]
Co-treatment with pre-miR-19a and pre-miR-19b successfully increased miR-19a/b levels (Fig. S2C and S2D) and enhanced MTUS1 protein and mRNA suppression compared to treatment with either pre-miR-19a or pre-miR-19b alone (Fig.   4A–C). [score:2]
For miRNA knockdown, equal amounts of anti-miR-19a (100 pmol), anti-miR-19b (100 pmol) or anti-miR-19a/b (50 pmol each) were used. [score:2]
In this study, we evaluated the expression patterns of miR-19a/b in lung cancer tissues and observed that the expression levels of both miR-19a and miR-19b were elevated in lung cancer tissues compared with those in paired normal adjacent tissues. [score:2]
Likewise, co-treatment with anti-miR-19a and anti-miR-19b successfully decreased miR-19a/b levels (Fig. S2C and S2D). [score:1]
One overlapping hybrid between the MTUS1 3′-UTR and miR-19a or miR-19b was identified. [score:1]
Equal amounts of pre-miR-19a (100 pmol), pre-miR-19b (100 pmol) or pre-miR-19a/b (50 pmol each) were transfected into A549 cells to overexpress miR-19a and/or miR-19b, respectively, and the reductions in MTUS1 levels were measured. [score:1]
As members of the miR-17-92 cluster, miR-19a and miR-19b (miR-19a/b) usually function as oncogenes in many types of cancer, including gastric cancer (Lu et al., 2015), pancreatic cancer (Wang et al., 2016), and breast cancer (Li et al., 2014b). [score:1]
We also showed that both miR-19a and miR-19b can function as promoters of lung cancer cell proliferation and migration. [score:1]
[1 to 20 of 13 sentences]
28
[+] score: 30
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
Taken together, circulating miR-19b might suppress genes associated with intake of microvesicles, cell adhesion and structural changes, neural network formation, and intracellular signaling at the cells miR-19b reached, more effectively in the housed cattle than in grazing cattle. [score:3]
In addition, potential target genes of miR-19b were significantly annotated to molecular biological pathways of endocytosis, focal adhesion, axon guidance, and Wnt signaling. [score:3]
MiR-19b and miR-361 are expressed in bovine adipose tissue. [score:3]
The miR-19b expression showed temporary elevation in the housed cattle at 1 and 2 mo. [score:3]
The results of qRT-PCR normalized with the let-7g level showed that the levels of miR-19b, miR-148a, miR-150, miR-221, and miR-361, and miR-486 in the grazing cattle were lower than those in the housed cattle at 1 mo of grazing (P = 0.013, 0.014, 0.093, 0.011, 0.041, and 0.023, respectively) (Fig 6A). [score:1]
At 2 mo, the levels of miR-19b, miR-150, miR-223, miR-320a, and miR-361 in the grazing cattle were lower than in the housed cattle (P = 0.015, 0.020, 0.026, 0.023, and 0.089, respectively). [score:1]
Meanwhile, in the present study, circulating levels of miR-19b, miR-150, miR-223, and miR-320a were temporarily lower in the grazing cattle than in the housed, suggesting that there might be some stress on the grazing cattle. [score:1]
Grazing -induced miRNAs: miR-19b, miR-150, miR-223, miR-320a, miR-361. [score:1]
In contrast, the miR-19b level in the housed but not in the grazing cattle increased from time 0 to 2 mo (P = 0.006). [score:1]
Notably, the present study showed that effect of grazing on c-miRNAs, such as miR-19b and miR-150, was maintained for a month or more. [score:1]
No exercise -induced changes in circulating miR-19b, miR-150, miR-320a, or miR-361 have ever been reported, which may indicate the specificity of changes in those miRNAs to the grazing movements of cattle. [score:1]
[1 to 20 of 13 sentences]
29
[+] score: 29
Expression of the miRNAs miR-19a and miR-19b is also found up-regulated in gastric cancer tissue where they contribute to multi drug resistance in the host cell by targeting the important tumor suppressor protein PTEN [42]. [score:10]
A similar pattern was observed for the paralogous miR-106-363 cluster showing a non-significant down-regulation in expression of miR-106a, miR-18a, and miR-20b after 24 h and a highly significant down-regulation of miR-106a, miR-18a, miR-20b, and miR-19b after 5 days of E. faecalis infection (Figure 1B). [score:9]
In contrast, ROS stimulation of 1, 3, and 5 h did not significantly alter expression of the miR-17-92 cluster, with the exception of miR-19b, which was up-regulated after 5 h (Figure 2C–E). [score:6]
After 20 min miR-18a, miR-19a, miR-19b, and miR-20a were significantly down-regulated (Figure 2A). [score:4]
[1 to 20 of 4 sentences]
30
[+] score: 25
Of the two miRNAs predicted to target EGR2, miR-19b was downregulated, which in accordance with the increased expression of EGR2, while miR-137 was downregulated only at T1 followed by upregulation from T2 to T4. [score:14]
MiR-19 of the miR-17–92 cluster promotes NSC proliferation [15] and targets FoxO1 to regulate NSC differentiation through cooperation with the Notch signaling pathway [16]. [score:4]
The expression patterns obtained in the present study combined with the results of these previous reports indicate that miR-19b and miR-137 interact with EGR2 to promote proliferation and repress the differentiation of NSCs. [score:3]
However, the potential relationship between EGR2 and miR-19b/miR-137 on the development of NSCs remains to be fully elucidated. [score:2]
MiR-19b is a member of miR-19 family located in the miR-106–25 cluster, which has been reported to be involved in regulating NSC proliferation and differentiation through a network related to the insulin/IGF-FoxO pathway [37]. [score:2]
[1 to 20 of 5 sentences]
31
[+] score: 23
Furthermore, we found a significant upregulation of miR-19, miR-192, miR-194, and miR-215 in the tumor compartment of the lung metastases and a significant downregulation of the same miRNAs in the liver metastases. [score:7]
In the tumor stroma only miR-19, miR-215, and miR-21 showed a significant downregulation in the liver metastases compared to the lung metastases, but none of the miRNAs was downregulated more than by 2-fold. [score:6]
miR-125 and miR-199-5 showed a 2-fold; miR-19 and miR-127 showed a 4-fold; miR-215 showed a 100-fold; miR-194 showed a 150-fold; and miR-192 showed a 300-fold upregulation in the normal liver tissue compared to the normal lung tissue. [score:3]
miR-194 showed a 1.5-fold; miR-125, miR-127, and miR-192 showed a 2.5-fold; miR-19 and miR-215 a 3-fold; miR-145, miR-199-3, and miR-429 a 5-fold; miR-21 a 7-fold; and miR-199-5 a 12.5-fold downregulation in the liver metastases compared to the lung metastases. [score:3]
Additionally, several well-known oncogenic/tumor suppressive miRNAs such as miR-19b, miR-21, miR-125b, and miR-429 were included in this study. [score:3]
The final selection of miRNAs for further analysis consisted of 11 miRNAs: miR-19b, miR-21, miR-125b, miR-127-3p, miR-145, miR-192, miR-194, miR-199a-3p, miR-199a-5p, miR-215, and miR-429. [score:1]
[1 to 20 of 6 sentences]
32
[+] score: 23
a T cells were transfected with let-7i, miR-19b, miR-25 or miR-92a and then cultured under stimulation with anti-CD3 and anti-CD28 mAbs for 72 h. The phenotype was determined by flow cytometry based on cytokine expression (IFN-γ, IL-17A) and transcription factor expression (Foxp3). [score:5]
In contrast, upregulation of let-7i and miR-19b in the circulation have not been previously described regarding MS pathogenesis, indicating the need for analysing exosomal miRNAs. [score:4]
Subsequently, we selected four miRNAs, let-7i, miR-19b, miR-25 and miR-92a for further analysis, the expression of which showed most significant differences between MS-exosome and HC-exosome (Fig.   2b). [score:3]
Subsequent analysis of the expression of exosomal miRNAs has demonstrated that the miRNA expression profiles in MS-derived exosomes are characterised by overabundance of four miRNAs: let-7i, miR-19b, miR-25 and miR-92a (Fig.   2). [score:3]
Materials used for transfection in this study were as follows: MISSION Human miRNA Mimics of hsa-let-7i-5p, hsa-miR-19b-3p, hsa-miR-25-3p and hsa-miR-92a-3p, and MISSION miRNA Negative Control 2 (all from Sigma-Aldrich, MO, USA); mirVana microRNA inhibitor of hsa-let-7i-5p and a negative control (Thermo Fisher Scientific, MA, USA); Silencer Select validated siRNAs of TGFBR1 and IGF1R, and Silencer Select Negative Control No. [score:3]
Error bars represent the mean ± s. d. s. d. standard deviation, n. s. not significant, A. U. arbitrary unit, RT-qPCR reverse transcription quantitative polymerase chain reaction, PBS phosphate-buffered saline To evaluate the functionality of the miRNAs upregulated in MS-exosome, CD3 [+] T cells from healthy donors were transfected with let-7i, miR-19b, miR-25 or miR-92a, and cultured with anti-CD3 and anti-CD28 mAbs for 72 h. Subsequently, the frequencies of inflammatory and regulatory T cell populations were evaluated by flow cytometer. [score:1]
MiR-19b and miR-92a belong to both the miR-17-92 and miR-106a-363 clusters [42]. [score:1]
Error bars represent the mean ± s. d. s. d. standard deviation, n. s. not significant, A. U. arbitrary unit, RT-qPCR reverse transcription quantitative polymerase chain reaction, PBS phosphate-buffered saline Treg cells but not Th1 or Th17 cells are affected by let-7iTo evaluate the functionality of the miRNAs upregulated in MS-exosome, CD3 [+] T cells from healthy donors were transfected with let-7i, miR-19b, miR-25 or miR-92a, and cultured with anti-CD3 and anti-CD28 mAbs for 72 h. Subsequently, the frequencies of inflammatory and regulatory T cell populations were evaluated by flow cytometer. [score:1]
A trend for negative correlation between miR-19b and Treg cells was also observed, but it was not statistically significant (p = 0.075, Pearson’s correlation analysis). [score:1]
Since miR-25 and miR-92a belong to the same family of miRNAs [42], we speculated that miR-19b, miR-25 and miR-92a in exosomes may have some function distinct from that of let-7i in MS pathogenesis, although we have not experimentally addressed this possibility yet. [score:1]
[1 to 20 of 10 sentences]
33
[+] score: 22
For example, we recently identified a network of miR-19 targets converging on the control of inflammation by virtue of regulating the expression of components of the NF-κB signalling pathway (27). [score:6]
Indeed, while miR-19a-3p did not have the predicted highly inhibitory motif, it was able to repress TLR7 sensing independently of miR-19 targeting in miR-19 -deficient cells (Figure 1). [score:5]
To distinguish the direct contribution of miR-19 and -92 in TLR7 sensing from a potential off-target effect of the 2′OMe AMOs used, experiments were replicated in BMMs from miR-17∼92 [flox/ flox] × LysMCre mice—where levels of mature miR-17-5p, miR-19a-3p and miR-92a-3p were decreased by ∼70% (Figure 1B). [score:4]
We have recently reported a positive regulatory role for miR-19 miRNAs (including both miR-19a-3p and miR-19b-3p) in the control of nuclear factor kappa B (NF-κB) signalling in several cell lines (27). [score:2]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
Gantier M. P. Stunden H. J. McCoy C. E. Behlke M. A. Wang D. Kaparakis-Liaskos M. Sarvestani S. T. Yang Y. H. Xu D. Corr S. C. A miR-19 regulon that controls NF-kappaB signalingNucleic Acids Res. [score:1]
In accord with our previous findings (27), we demonstrated that 2′OMe AMO -mediated blocking of miR-19 significantly reduced the production of TNF-α induced by immunostimulatory ssRNA in WT BMMs. [score:1]
However, this effect of the miR-19a-3p 2′OMe was mostly retained in BMMs depleted of miR-19a-3p and miR-19b-3p, indicative of a miRNA-independent effect (Figure 1). [score:1]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
[1 to 20 of 9 sentences]
34
[+] score: 20
It has been reported that miR-19 antagonists lead to higher SOCS1 levels and miR-19 mimics can repress SOCS1 reporter constructs, thus obviously supporting the bioinformatic predictions that SOCS1 is a direct target of miR-19 [6]. [score:4]
miR-10b for instance is induced early in ME-15 and remains upregulated, while miR-19 abundance ceases after 24 h. In general, the majority of IRmiR genes were reset to basal levels after 24 h and further studies are needed for kinetic classification. [score:4]
Significance codes are defined by the intervals: '***' < 0.001 ≤ '**' < 0.01 ≤ '*' < 0.05 Table 2 Modulation of microRNA expression by IFNα—4 and 24 h after stimulation Control Interferon-alpha treated 4 h 24 h 4 h 24 h a ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF Validated microRNAs hsa-miR-19a 13,617 6,726 -1.02 18,318 17,178 -0.07 19,226 17,409 -0.10 14,425 14,079 -0.02 hsa-miR-19b 13,365 9,406 -0.42 25,463 22,438 -0.13 21,532 20,625 -0.04 18,039 17,440 -0.03 hsa-miR-30e-5p 9,497 6,838 -0.39 13,045 11,321 -0.15 12,643 10,887 -0.16 13,230 11,809 -0.12 hsa-let-7a 15,244 4,335 -2.52. [score:3]
This and the finding that miR-19 regulates SOCS1 [4] may be relevant for the regulation of cytokine signaling. [score:3]
Significance codes are defined by the intervals: '***' < 0.001 ≤ '**' < 0.01 ≤ '*' < 0.05 Table 2 Modulation of microRNA expression by IFNα—4 and 24 h after stimulation Control Interferon-alpha treated 4 h 24 h 4 h 24 h a ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF Validated microRNAs hsa-miR-19a 13,617 6,726 -1.02 18,318 17,178 -0.07 19,226 17,409 -0.10 14,425 14,079 -0.02 hsa-miR-19b 13,365 9,406 -0.42 25,463 22,438 -0.13 21,532 20,625 -0.04 18,039 17,440 -0.03 hsa-miR-30e-5p 9,497 6,838 -0.39 13,045 11,321 -0.15 12,643 10,887 -0.16 13,230 11,809 -0.12 hsa-let-7a 15,244 4,335 -2.52. [score:3]
For the microRNAs let-7 a/b, miR-19 a/b, and miR-203, the PCR -based quantification method (Figure 2b) confirmed the direction of change found with microarray technology (Table 2a). [score:2]
17,178 14,079 -0.22 hsa-miR-19b 13,365 21,532 0.61** 25,463 18,039 -0.41 9,406 20,625 1.19* 22,438 17,440 -0.29. hsa-miR-30e-5p 9,497 12,643 0.33 13,045 13,230 0.01 6,838 10,887 0.59* 11,321 11,809 0.04 hsa-let-7a 15,244 22,226 0.46 28,304 30,449 0.08 4,335 6,386 0.47. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 20
miR-19a and miR-19b could downregulate the expression of SOCS1 and SOCS3 in various tumors. [score:6]
The downregulation of SOCS3 by miR-19b causes the phosphorylation of STAT3 and induces the expression of cyclinD1, which could promote cell proliferation by the transition from G1 phase to S and G2 phases (93). [score:6]
The overexpression of miR-19b in human colon cancer cell line HT-29 cells downregulates the protein level of SOCS3, but not that of the SOCS3 mRNA. [score:6]
Therefore, although few references have reported that miRNA -induced dysregulation of SOCS expression and function exerts significant influence on the clinical outcome of cancer patients, some miRNAs, such as miR-155, miR-19a, miR-19b, and miR-221, might be promising biomarker candidates in predicting and evaluating the clinical prognosis of certain tumor types. [score:2]
[1 to 20 of 4 sentences]
36
[+] score: 19
Our differential RNA-Seq analysis identified miR-19b and miR-29a as the two most abundant deregulated microRNAs in WD mice (Table 1). [score:2]
Indeed, some R1-miR19 displayed a relatively low body weight and a normal glucose regulation, whereas their respective R2-miR19 progeny displayed the full disorder (increased body weight, altered blood glucose levels and insulin tolerance). [score:2]
This phenomenon was made apparent by analysis of the progenies of individual R1-miR19 males crossed with control females, namely the R2-miR19 progenies (Fig. 4e). [score:1]
Induction of obesity by microinjection of the microRNA miR-19b into one-cell embryos. [score:1]
Synthetic microRNA, miR-19b (CUGUGCAAAUCCAUGCAAAACUGAC) and mir-29a (GACUGAUUUCUUUUGGUGUUCAGA)(purchased from Sigma, Saint-Louis, MO, USA) was prepared in filtered microinjection buffer (10 mM Tris, pH 7.4; 0.1 mM EDTA) at a concentration of 4,000,000 molecules/pl. [score:1]
The R1-miR19 fathers and their respective R2-miR19 progenies are indicated by grey-filled or red-filled circles. [score:1]
At 16 weeks of age, two R1-miR19 male were crossed with females to obtain the R2-miR19 progeny. [score:1]
The degree of glucose intolerance and insulin resistance was more variable, as only half of the obese R1-miR19b animals showed impaired glucose tolerance and insulin sensitivity (Fig. 4d,e). [score:1]
Further investigation on the miR-19 mice through the transcriptomic analysis of either early embryo and/or adipose-derived stem cells will provide additional insight into the mechanisms of miR-19 action and will help to identify genes involved in the development of obesity and/or metabolic disorders at the very early stages of development. [score:1]
Indeed, it is interesting to note that some R2-miR19 mice developed the full miR19 phenotypes despite the normal metabolic features of their R1-miR19 progenitors. [score:1]
We have identified miR-19b as one of these molecules, but further assessment of its specific role is complicated by the pleiotropic nature of its activity, spanning from lymphomagenesis 29 to the inflammatory response 30. [score:1]
Injections of miR-19b into one-cell embryos induced obesity and aspects of the diabetic phenotype. [score:1]
Strikingly, males and females born from miR19b-microinjected one-cell embryos (designated R1-miR19) had, in average, body weights greater than the controls (34.17g ± 6.5 vs. [score:1]
This individual variation was also evident in R1-miR19 mice. [score:1]
By quantitative RT-PCR analysis, we confirmed the deregulation of miR-182, miR-19a, miR-19b, miR-29a and miR-340 in testis and sperm RNA of the WD males compared to SD males (Table 1). [score:1]
None of the R1-miR19 mice, however, showed increased values of fasting glucose levels (Fig. 4c), which is at odds with the more complete pathology observed for the WD series, but is similar to the R1-sperm injected progenies and to the previously published reports of metabolic alterations without overt diabetes 10. [score:1]
Theses results suggest that upon RNA injection, epigenetic changes take place which can remain phenotypically silent but are later transmitted to the progeny (R2-miR19 obese males were born from R1-miR19 normal males) (Fig. 4). [score:1]
[1 to 20 of 17 sentences]
37
[+] score: 19
Our results have shown that miR-17 and miR-19 directly inhibit Pparα expression in cystic kidneys, but whether reducing Pparα gene dosage is sufficient to promote cyst growth is not known. [score:6]
miR-17 and miR-19 binding to Pparα 3′-UTR lead to reduced Pparα expression, which in turn affects mitochondrial metabolism in kidney epithelial cells. [score:3]
Similarly, deleting the miR-19 binding site abolished miR-19 -mediated, but not miR-17 -mediated, repression. [score:1]
Luciferase reporter assays revealed that compared with scramble, both miR-17 and miR-19 mimics suppressed wild-type Pparα 3′-UTR. [score:1]
Both miR-17 and miR-19 repressed Pparα 3′-UTR. [score:1]
The seed sequences for the miR-17 and the miR-19 binding sites were mutated in the WT-Pparα 3′-UTR construct to produce the Pparα 3′-UTR (Δ17) and Pparα 3′-UTR (Δ19) constructs. [score:1]
To test whether the binding sites are functional, we co -transfected mIMCD3 cells with a luciferase reporter plasmid containing Pparα 3′-UTR and miR-17, miR-19, or scramble mimics (Fig. 8b). [score:1]
Deleting the miR-17 binding site prevented miR-17 -mediated, but not miR-19 -mediated, repression. [score:1]
mIMCD3 cells were co -transfected with this plasmid and scramble (scr, black), miR-17 mimic (red) or miR-19 mimic (blue) (n=3). [score:1]
Watson-Crick base-pairing between miR-17/ PPARΑ 3′-UTR and miR-19/ PPARΑ 3′-UTR is shown. [score:1]
In the cytoplasm, the mature miRNAs (miR-17 and miR-19) bind to Pparα 3′-UTR. [score:1]
Pparα 3′-UTR harbours an evolutionarily conserved binding site for miR-17 and miR-19 families (Fig. 8a). [score:1]
[1 to 20 of 12 sentences]
38
[+] score: 18
Mature miRNA expression could be classified into two groups: i) cardia-tissues: miRNAs rarely expressed in other tissues but expressed in gastric cardia, including miR-148a, miR-192, miR-200a and miR-200b; ii) quasi-ubiquitous: miRNAs expressed in many tissues and conditions, including miR-29c, miR-21, miR-24, miR-29b, miR-29a, miR-451, miR-31, miR-145, miR-26a, miR-19b and let-7b. [score:9]
Six miRNAs showed a low variable pattern of expression (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451) and could be considered part of the expression pattern of the healthy gastric tissue. [score:4]
Could observe miRNAs with high interindividual variation, for exempla miR-21, and another with low interindividual variation, e. g. expression pattern slightly variable (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451). [score:3]
The high expression levels of miRNAs identified by ultra-deep sequencing (in descending order: miR-29c, miR-21, miR-148a, miR-29a, miR-24, miR-29b, miR-192, miR-451, miR-145, miR-31, miR-200a, miR-19b, miR-200b, let-7b and miR-26a) were validated with the TaqMan miRNA assays (Life Technologies). [score:2]
[1 to 20 of 4 sentences]
39
[+] score: 18
Other miRNAs from this paper: hsa-mir-19b-2, hsa-mir-30a, hsa-mir-204, hsa-mir-132, hsa-mir-155
In the present study, we identified 4 significantly downregulated miRs, hsa-miR-204-5p, hsa-miR-155-5p, hsa-miR-132-3p, and hsa-miR-19b-3p, in human GC tissues by a combination of the high-throughput miR sequencing approach as well as subsequent qRT-PCR validation. [score:4]
A further study needs to be taken to revalidate the miR-19b expression pattern in GC. [score:3]
This approach allowed us to identify 5 differentially expressed miRs, hsa-miR-132-3p (A, p = 0.013), hsa-miR-155-5p (B, p = 0.031), hsa-miR-19b-3p (C, p = 0.002), hsa-miR-204-5p (D, p = 0.016), and hsa-miR-30a-3p (E, p = 0.019), that were significantly modulated between tumoral and peritumoral tissues (Figure 1). [score:3]
Interestingly, the altered miR expression pattern was consistent with the previous studies for hsa-miR-155-5p [21, 22], hsa-miR-19b-3p [23], and hsa-miR-204-5p [15, 24] in human GC. [score:3]
Instead, our data showed a downmodulated alteration in vivo, which indicates that miR-19b might act as a tumor suppressor towards GC. [score:3]
Similar results were also observed for hsa-miR-155-5p (MGC-803: t = 20.281, p = 0.000; BGC-823: t = 5.286, p = 0.006; and GTL-16: t = 3.196, p = 0.033) as well as for has-miR-132-3p (MGC-803: t = 7.755, p = 0.001; BGC-823: t = 4.707, p = 0.009; and GTL-16: t = 3.314, p = 0.032), as shown in Figure 3. However, we failed to replicate the in vivo findings of hsa-miR-19b-3p or has-miR-30a-3p in the present three GC cell lines (data not shown). [score:1]
As shown above, the miR sequencing and qRT-PCR results agreed with each other for the modulation pattern of hsa-miR-132-3p, hsa-miR-155-5p, hsa-miR-19b-3p, and hsa-miR-204-5p in human GC. [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 18
In [71], hsa-miR-19b-3p is associated with Alzheimer’s Disease (hsa-miR-19b-3p is reducing number during Alzheimer’s Disease), but miR-19b is still unknown in rhesus. [score:5]
Turquoise contains highest number of genes (i. e., forty five genes) which are targeted by miR-19b. [score:3]
Next, yellow module has twenty one genes targeted by miR-19b. [score:3]
Here, two miRNAs are associated with Alzheimer’s Disease i. e., hsa-miR-19b and hsa-miR-520d-5p. [score:3]
Following that, miR-19b, miR-19a, miR-520d-5p, miR-524-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-495, miR-944 and miR-664 regulate 121, 119, 130, 130, 109, 109, 109, 102, 138, 123 genes, respectively. [score:2]
, miR-19b, miR-19a, miR-520d-5p, miR-519b-5p, miR-519a, miR-519c-3p, miR-944 and miR-664) are partially known (i. e., known to only human, but still unknown to rhesus). [score:1]
Notably, hsa-miR-19b-3p is connected with fourteen different gene-modules (viz. [score:1]
[1 to 20 of 7 sentences]
41
[+] score: 18
It has been shown that miR-17 and miR-19b regulate Th1 and prevents inducible Treg differentiation by targeting PTEN, TGFβRII, and CREB1 [19], and also promote Th17 -mediated inflammation by targeting PTEN and IKZF4 [32] in mouse CD4 [+] T cells. [score:6]
However we did not observe any change in PTEN upon miR-20a overexpression in T cells, which appears rather to be a target of miR-17 and miR-19b, as suggested by recent data in mouse CD4 [+] T cells [19, 32]. [score:5]
In fact, miR-19b and miR-17 regulate T-cell expansion, Th1 responses, and inhibit iTreg differentiation [19], whereas miR-17 and miR-20a appear to repress the transcription of genes involved in T-cell activation in the Jurkat T-cell line [20]. [score:4]
Moreover, these observations also corroborate previous data showing that miR-19b, but not miR-20a, regulates mouse CD4 [+] T-cell proliferation upon antigen stimulation [19]. [score:2]
This cluster comprises six miRNAs: miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a [13]. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 17
As with many targets of miRNA, four confirmed targets of miR-19 (Bim, PTEN, PRKAA1, and PP2A) act to negatively regulate the phosphatidylinositol-3-kinase (PI3K) pathway [31], suggesting that the oncogenic effect of overexpressed miR-17-92 in acute leukaemias may be related to the silencing of these genes. [score:8]
High expression of both miR-19a and miR-19b, members of the miR-17-92 cluster, also targets SOCS1 in myeloma cells [76]. [score:5]
In T-ALL without MLL-rearrangements, miR-17-92 has also shown oncogenic potential as induced expression of miR-19 accelerated the development of ALL in mice [63]. [score:4]
[1 to 20 of 3 sentences]
43
[+] score: 17
Of the miRNAs expressed, miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c expression were significantly increased (p< = 0.05) in human macropahge after exposure to Toxoplasma infection for 24 h (Figure  1A). [score:5]
Together, these data demonstrate that STAT3 binding to the promoter element of the miR-17 ~ 92 gene mediates miRNAs (miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a) upregulation in human macrophage in response to Toxoplasma infection. [score:4]
Several miRNAs upregulated in human macropahge following Toxoplasma infection are cluster miRNAs; e. g., miR-19a, miR-19b and miR-20a are from the miR-17 ~ 92 gene cluster. [score:4]
Increased expression of miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c were noted in human macrophage at 6 h and 12 h postinfection, the abundance of these miRNAs significantly increased by ~23.5-fold at 24 h postinfection. [score:3]
Of note, miR-19b, miR-19a and miR-20a are cluster gene miRNAs and co-transcribed with a host gene, C13orf25 [26]. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 17
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
There were also non significant trends towards preferential expression of miR-19b and miR-92 in the central memory cells. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
Considering the role of the miR-19~92 cluster in lymphocyte development and proliferation, it is tempting to speculate that its expression may be related to the greater proliferative potential and memory precursor-like capacity, characteristic of central memory cells compared to more differentiated subsets (in particular late effector memory cells). [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 16
The increased expression of miR-19b, -26b, -27b, -200c, -203 and the concomitant decrease of their targets expression mediate the tumor suppression mechanisms [171]. [score:9]
In mice, Davidson and colleagues studied the effect of a diet based on corn oil-cellulose compared with a diet based on fish oil (EPA and DHA) and pectin in the presence of carcinogens: their results demonstrated an increased expression of miR-16, miR-19b, miR-21, miR-26b, miR-27b, miR -93, 200c, and miR-203 and the decreased expression of some of their direct targets, such as, PTK2B, TCF4, PDE4B, HDAC4, and IGF1 [158], thus suggesting some different molecular mechanisms involving the fish oil diet. [score:7]
[1 to 20 of 2 sentences]
46
[+] score: 15
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-2, hsa-mir-106a, hsa-mir-20b
In human breast cancer cells, TF expression can be downregulated by miR-19 [21], suggesting that TF expression can be regulated by miRNA. [score:9]
Several studies have shown that many types of cancer cells express aberrantly high levels of TF [22] and miR-19 regulates TF expression in breast cancer cells [30]. [score:6]
[1 to 20 of 2 sentences]
47
[+] score: 14
The expression profiles of 171 miRNAs changed significantly: 69 upregulated miRNAs (miR-17, miR-19b, miR-92-1) and 102 downregulated miRNAs (miR-134, miR-34, miR-196b) in S KOV3-TR30 cells as compared with S KOV3 cells (Figure 1). [score:8]
A miR-17~92 cluster comprising miR-17, miR-18a, miR-20a, miR-19a, miR-19b, and miR-92-1 is overexpressed in a large fraction of lymphomas [11]. [score:3]
B2 containing binding sites for miR-17-5p/-20a and miR-92, and B3 contains binding sites for miR-19 and miR-92 while there is not binding site of B1 with miR-17~92. [score:1]
B2 fragment contains miR-17-5p/-20a and miR-92 binding site and B3 fragment contains miR-19 and miR-92 binding site. [score:1]
PTEN 3′-UTR contains putative binding sites for both miR20a/17-5p and miR-19. [score:1]
[1 to 20 of 5 sentences]
48
[+] score: 14
Furthermore, miR-19 targeting downregulates the expression of BIM, a proapoptotic gene, that has been described to be expressed under the control of 17~92 cluster in other malignancies [33]. [score:10]
SOCS-1 downregulation induces constitutive STAT3 phosphorylation, which is reversed when MM cell lines are transfected with anti miR-19. [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 13
As other targets, mRNA from TLR is regulated by miRNAs, and miR-19a and miR-19b were demonstrated to upregulate TLR-2 expression in RASF; even more, downregulation of miR-19b in activated RASF was associated with an increased production in IL-6 and MMP3 release, so they seem to work as negative regulators of inflammatory responses [62]. [score:13]
[1 to 20 of 1 sentences]
50
[+] score: 13
Moreover, inhibition of miR-19b and miR-221/222 expression with miRNA inhibitors can ameliorate the inflammation -induced cellular ROS production by regulating peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), thereby suggesting that these three miRNAs may be the potential therapeutic targets for atherosclerosis and coronary restenosis (61). [score:10]
Xue et al. have found that overexpression of miR-19b and miR-221/222 in human aortic endothelial cells can induce reactive oxygen species (ROS) overproduction, which eventually leads to cell apoptosis and contributes to the pathogenesis of atherosclerosis (61). [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 13
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
In this study, we found that in infertile male subjects, sperm motility was lower in relative higher GEN dose group (Group3) while the relative expression levels of seminal plasma miR-19b-1, miR-20a and miR-92a-1 were higher in corresponding groups. [score:3]
It is interesting that the relative expression levels of miR-19b-1, miR-20a and miR-92a-1 were higher in Group 3 compared to Group 1 (Figure 2, P < 0.05). [score:2]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 13
With miR-19a mimic transfectants (A) 46 of the 53 miRNAs exhibited significantly decreased expression, miR-19a, miR-19b, and miR-20b being among the seven mirNA with significantly increased expression. [score:5]
Microarray results suggested that levels of expression of five members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-19b, and miR-92a) were significantly decreased only in cells transfected with miR-363-5p mimic (Figure 3). [score:3]
As expected, high levels of expression of miR-19a/miR-19b, or miR-20b, or miR-363-5p were found in cells transfected with mimic for miR-19a, or miR-20b - or miR-363-5p, respectively. [score:3]
Only miR-19b, miR-20b, miR-92a, and miR-106a were detectable in these cells. [score:1]
The miR-17-92 cluster, located on human chromosome 13, encodes six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. The miR-106a-363 cluster, located on human chromosome X, encodes six miRNAs: miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 13
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19b-2, hsa-mir-122, hsa-mir-146a, hsa-mir-146b
Overexpression of miR-19b inhibits HSC proliferation and suppresses COL1A1 protein levels by targeting growth factor receptor-bound 2 [25]. [score:9]
Ge S. Xie J. Liu F. He J. MicroRNA-19b reduces hepatic stellate cell proliferation by targeting GRB2 in hepatic fibrosis mo dels in vivo and in vitro as part of the inhibitory effect of estradiol J. Cell. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 13
Moreover, circulating miR-19b levels have been associated with a worse disease progression in patients affected by NSCLC (30). [score:3]
In particular, PDTXs with a Ki67 immunoreactivity >50% showed significantly higher expression of circulating miR-19b and miR-21 levels (p = 0.04 and p = 0.03 by Mann–Whitney U test, respectively; Figure 6C). [score:3]
In particular, circulating miR-19b, -21, and miR-210 levels were directly correlated with PDTXs proliferation. [score:2]
As a member of the miR-17-92 cluster, miR-19b is an oncogenic key factor present in different types of cancer (27, 28). [score:1]
Lastly, to investigate whether our mo del supported the discovery of new biomarkers, we analyzed in SCC tissues or serum the expression of seven miRNAs (miR-19a, miR-19b, miR-20a, miR-21, miR-31, miR-150, and miR-210) known to be involved in lung cancer (13, 14). [score:1]
Recently, miR-19b has been shown to induce tumor growth and metastasis in vivo (29). [score:1]
Conversely, serological levels of miR-19b, miR-20a, and miR-31 significantly decreased at the latter PDTX harvesting point compared to the 1.5 and 3 months schedule (p = 0.02, p = 0.007, and p = 0.003 by ANOVA, respectively; Figure 6B), mimicking what observed for these small regulatory RNAs in PDTXs tissues (Figure 6A). [score:1]
miR-19b, miR-20a, and miR-31 were significantly higher in 1.5 months old PDTXs (respectively * p = 0.02, ** p = 0.007, and ** p = 0.003, by ANOVA), and miR-21 and -210 levels were correlated with PDTXs proliferative activity (respectively * p = 0.03, * p = 0.02 by ANOVA). [score:1]
[1 to 20 of 8 sentences]
55
[+] score: 13
However, from the up-regulated miRNAs, miR-19b-1* and miR-29c, and from down-regulated miRNAs, miR-381 and miR-30e*, had the highest fold change in the non-exosomal fraction of follicular fluid. [score:7]
MicroRNAs like miR-640, miR-526b* and miR-381 were abundant at higher level in theca cells, while miR-373, miR-30e* and miR-19b-1* expressed more in COCs. [score:3]
Similar analysis for non-exosomal miRNAs shows that miR-19b-1* and miR-30e* were highly abundant in cumulus oocyte complex (COCs) whereas miR-381 was highly abundant in theca cells. [score:1]
The PCR array results revealed that, in follicular fluid from follicles containing growing oocytes (BCB-), miR-654-5p and miR-640 (in exosomal) and miR-19b-1* and miR-29c (in non exosomal) were highly abundant (Table 2 ). [score:1]
Four miRNAs namely: miR-19b-1*& miR-29c (enriched in non exosomal fraction of follicular fluid from BCB-) and miR-381 & miR-30e* (enriched in non exosomal fraction of follicular fluid from BCB+ group) were also investigated for their expression in surrounding follicular cells. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 13
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
Overexpression of the mir-17–mir-18a–mir-19b-1 cluster was shown to accelerate Myc -induced tumor development in a mouse B-cell lymphoma mo del [61]. [score:4]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
MiR-92a belongs to the miR-17 ~92 cluster with seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a) and was first described as an oncogenic miRNA cluster involved in B-cell lymphoma [61]. [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 12
Thus, we note that the predicted targeting and down-regulation of SPHK2 by miR-19a and miR-19b in the first 20 hours post-PMA stimulation could prevent the metabolism of two anti-proliferative metabolites simultaneously, thereby inhibiting proliferation. [score:8]
Interestingly, miR-19a and miR-19b (part of the cluster), are predicted to target sphingosine kinase 2 (SPHK2) mRNA in four independent databases (see). [score:3]
The miRNA cluster on chromosome 13 contains several miRNAs (hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-19b-1, and hsa-mir-92-1 (hsa-mir-92-1 excluded from analysis, due to ambiguous nomenclature)) that are transcribed as a single transcript. [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 12
Huang et al. [17] found that the over -expression of miR-19b was significantly correlated with longer disease-free survival (DFS) and overall survival (OS) in patients with hepatocellular carcinoma (HCC). [score:5]
MiR-17, miR-19, and miR-92 played a role in resistance to apoptosis, since thet could directly inhibit the produced pro-apoptotic proteins through the MAPK/ERK and PI3 K/AKT signaling pathways, which were important in cell survival regulation [52]. [score:5]
The miR-17-92 family maps to human chromosome 13 (13q31.3) and encodes for the miR-17–92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, miR-92a) and two paralogs (miR-106a, miR-106b) [12]. [score:1]
The following search terms and combinations were used in keyword and subject heading searches: (“miR-17-92 cluster” OR “miR-17” OR “miR-18a” OR “miR-19a” OR “miR-19b” OR “miR-20a” OR “miR-92a” OR “miR-106a” OR “miR-106b”) and (“neoplasm” OR “neoplasia” OR “cancer” OR “tumor” OR “carcinoma” OR “adenoma”) and (“prognosis” OR “survival” OR “mortality” OR “outcome”). [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 12
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 12
A reproducible repression of endogenous BTG1 protein was also observed for vectors expressing miR-19b and miR-130, suggesting the possibility that multiple miRNAs target BTG1. [score:5]
In addition to miR-454-3p, miR-19b was predicted to have two binding sites on the 3′-UTR of the BTG1 mRNA, one of which occupies the same site as the putative miR-454-3p target. [score:3]
A significant repression of endogenous BTG1 protein by miR-19b expression vector was also observed in 786-O cells (Additional file 2F). [score:3]
These miRNAs included hsa-mir-130, hsa-mir-301a, hsa-mir-302, hsa-mir-454-3p, and hsa-mir-19b. [score:1]
[1 to 20 of 4 sentences]
62
[+] score: 12
According to TargetScan7.0, CCND1 could be targeted by miR-15, miR-16, and miR-19 at different binding sites. [score:5]
We detected expression of miR-15a, miR-15b, miR-19a, and, miR-19b-2 but not miR-19b-1 in the cell lines examined. [score:3]
The expression and function of miR-15 and miR-19 have not been reported before. [score:3]
miR-15 has two transcripts (miR-15a and miR-15b), and miR-19 has three transcripts (miR-19a, miR-19b-1, and miR-19b-2). [score:1]
[1 to 20 of 4 sentences]
63
[+] score: 12
Specifically, miR-375 is predicted to be involved in a KEGG pathway associated with diabetes (Figure 2) and the cluster miR-19 a/b is associated with numerous pathways with a significant role in the biology of NAFLD, including apoptosis, mTOR, MAPK, adipocytokine and hedgehog signaling [2]; a full list of predicted pathways is shown in Figure 2. Figure 2The graph represents a heat-map of predicted targets aggregated in co -expression clusters and ranked according to their biological function based on KEGG (Kyoto Encyclopaedia of Genes and Genomes) pathways or Gene Ontology (GO) analysis. [score:5]
Specifically, miR-375 is predicted to be involved in a KEGG pathway associated with diabetes (Figure 2) and the cluster miR-19 a/b is associated with numerous pathways with a significant role in the biology of NAFLD, including apoptosis, mTOR, MAPK, adipocytokine and hedgehog signaling [2]; a full list of predicted pathways is shown in Figure 2. Figure 2The graph represents a heat-map of predicted targets aggregated in co -expression clusters and ranked according to their biological function based on KEGG (Kyoto Encyclopaedia of Genes and Genomes) pathways or Gene Ontology (GO) analysis. [score:5]
Specifically, we tested the hypothesis of an association between rs2829145 genotypes and circulating levels of mir-122, miR-192, miR-375 and the complex miR-19 a/b; these miRNAs were selected because we already found a significant association with NAFLD [24]. [score:1]
In the A-allele carriers, we observed increased circulating levels of the complex miR-19a (p =0.008) and miR-19b (p =0.0009), as well as circulating levels of miR-375 (p =0.029) (Figure 1). [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 11
The expression of hsa-miR-138, hsa-miR-409 and hsa-miR-19 showed significant difference between two groups. [score:3]
The expression of hsa-miR-138 (a), hsa-miR-409 (b), hsa-miR-19 (c) and hsa-miR-204 (d) were tested in fetal hippocampus tissues of DS and control group. [score:3]
Of all miRNA-mRNA pairs, we also selected hsa-miR-409-5p, which played roles in cell proliferation and apoptosis [16], along with its predicted target genes, SMARCC1 and EFNB1, and another two miRNAs, hsa-miR-19-3p and hsa-miR-204-5p to validate the microarray results. [score:3]
The expression of hsa-miR-19 and hsa-miR-204 were reduced in DS group compared to control group. [score:2]
[1 to 20 of 4 sentences]
65
[+] score: 11
For instance, downregulation of miR-141 increases CUL3 expression in Hirschsprung's disease [49], and miR-19 targets CUL5 to regulate proliferation and invasion of cervical cancer cells [50]. [score:11]
[1 to 20 of 1 sentences]
66
[+] score: 11
To support this finding, miR-19b-1 upregulation has been observed in HeLa human cancer cells and in mice lung tumors [76], but no similar study to ours is currently available which detects deregulation in this miRNA. [score:5]
Other miRNAs such as miR-29a, miR-199-5p, miR-339-5p, miR-590-5p and miR-19b-1 are overexpressed in both the training and validation set, but have barely been described in cancer in general and in NSCLC in particular. [score:3]
Although miR-19b-1 is not wi dely described in the literature, miR-19b overexpression was validated in our validation cohort. [score:3]
[1 to 20 of 3 sentences]
67
[+] score: 11
ceRNAs are important regulators in cell cycle control and tumor suppression (e. g. PTEN-P1 blocking miR-19b and miR-20a from binding to PTEN tumor suppressor [17]– [19]), modulating self-regulation in hepatocellular carcinoma (HCC) (HULC lncRNA acts as ceRNA of the protein coding gene PRKACB that induces activation of CREB which in turn is involved in upregulation of HULC [20]) as well as in developmental stages (e. g. linc-MD1 blocking miR-133 from binding to transcription factors involved in myogenic differentiation [21] and H19 blocking the miRNA let-7 to affect muscle differentiation in vitro [22]). [score:11]
[1 to 20 of 1 sentences]
68
[+] score: 11
5) 7 hsa-mir-19a dbDEMC 32 hsa-mir-30d dbDEMC 8 hsa-mir-92a HMDD, miR2Disease 33 hsa-mir-451 literature 9 hsa-mir-210 miR2Disease 34 hsa-mir-152 dbDEMC 10 hsa-mir-19b dbDEMC, miR2Disease 35 hsa-mir-215 dbDEMC 11 hsa-mir-224 dbDEMC, miR2Disease 36 hsa-mir-130a dbDEMC, HMDD 12 hsa-let-7f dbDEMC, miR2Disease 37 hsa-mir-499 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
69
[+] score: 11
For miR-19b a recent study showed that overexpression of miR-19a/b was sufficient to induce hypertrophy in neonatal rat cardiomyocytes and revealed that miR-19a/b directly targets the anti-hypertrophic genes atrogin-1 and MuRF-1 (muscle RING-finger protein-1) [38]. [score:6]
miR-106a, miR-17, miR-19b and miR-224, were highly expressed during secondary muscle fiber formation (Stg2) and then decreased significantly during the subsequent phases of development (Fig. 3A), suggesting that they may be functionally related to the phase of secondary muscle fiber formation. [score:4]
These two FSHD1 fetal muscle biopsies share 11 miRNAs with similar modulations (Fig. 4), miR-1225–3p, miR-19b-1*, miR-208b, miR-22, miR-372, miR-383, miR-767–3p, miR-802, miR-872, miR-875–5p, and miR-892b. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 10
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 7 sentences]
71
[+] score: 10
Studies have reported that resveratrol suppresses glioma cell growth by down -regulating oncogenic microRNAs (miR-21, miR-30a-5p, miR-19) and up -regulating their targets’ expression, which are closely relevant to glioma formation and development [7]. [score:10]
[1 to 20 of 1 sentences]
72
[+] score: 10
In the colon, up-regulated miR-17-92a promotes neoplasia through various pathways, e. g. miR-18a and miR-19 directly repress TSP-1 and CTGF, respectively, to promote angiogenesis [24] and miR-92a down-regulates BCL2L11 expression thereby reducing apoptosis [44]. [score:10]
[1 to 20 of 1 sentences]
73
[+] score: 10
The relationship between spontaneous apoptosis and baseline miRNA expression was examined by Pearson correlation analysis, resulting in significant negative correlations for 29 miRNAs, most of them expressed at high levels, including miR-29a-3p, let-7g-5p, miR-29b-3p, let-7f-5p, let-7a-5p, miR-26b-5p, miR-19b-3p, or miR-155-5p, and positive correlations for 9 miRNAs, all of them expressed at low levels, including miR-1246, or miR-638 (S4 Table). [score:7]
From the miR-17~92 cluster, miR-17-5p, miR-19a-3p, miR-19b-3p, miR-20a-5p, and miR-92a-3p were expressed at high levels, and miR-17-3p, and miR-20a-3p, at low levels. [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 10
Moreover, the expression of the closely related family members miR-17 (which only differs from miR-20a by 2 nucleotides) and miR-19a (which only differs from miR-19b by one nucleotide) was not significantly changed, and might compensate for the reduction in miR-20a and miR-19b expression, respectively. [score:5]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
However, the reduction of miR-19b and miR-20a in muscle tissue of miR-92a [−/−] mice was less than 50%. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 10
The importance of these functions have been demonstrated by showing that retroviral overexpression of a cassette containing miR-17, miR-18 and miR-19 in mice results in c-Myc -induced lymphoma [29]. [score:3]
MiRNA microarray profiling reveals that Toxoplasma infection increases the levels of miR-17-, miR-18- and miR-19 -family members. [score:1]
As miR-17 family members are co-transcribed with members of the miR-18 (Figure S1, blue box), miR-19 and miR-25 families, and are encoded in three separate paralogous loci (miR-17∼92, miR-106a∼363 and miR-106b∼25; Figure 1B), we assembled a heat-map from our microarray data that contains the averaged fold-change values for all probes that hybridized to members of the miR-17, miR-18, miR-19 or miR-25 families (18, 4, 4, and 4 probes, respectively; Figure 1C). [score:1]
Examples relevant to the present work are four families of miRNAs (miR-17, miR-18, miR-19 and miR-25) that are encoded by three paralogous loci; these related loci, which are miR-17∼92, miR-106b∼25 and miR-106a∼363 (see Figure 1B), produce primary transcripts that are post-transcriptionally processed to yield mature miR-17, miR-18, miR-19 and miR-25 family members. [score:1]
Upon Toxoplasma infection, miR-17 family members collectively increased ∼3-fold, and miR-19 and miR-25 family members increased ∼1.5-fold. [score:1]
These results suggest that the mature miR-18 and miR-19 family members that increase upon infection with Toxoplasma are derived from miR-17∼92; although pri-miR-106b∼25 is also increased in Toxoplasma-infected cells, miR-106b∼25 does not encode miR-18 and miR-19 family members and, consistent with previous reports [32], [37], no pri-miR-106a∼363 was detectable. [score:1]
Colors of each miRNA indicate the miRNA family to which each belongs; miR-17 = yellow; miR-18 = green; miR-19 = blue; miR-25 = red. [score:1]
MiR-18, miR-19 and miR-25 family members also showed an increase in abundance in RNA samples derived form Toxoplasma-infected HFFs (Figures 2C). [score:1]
[1 to 20 of 8 sentences]
76
[+] score: 10
From the top downregulated miRNAs, miR205 has been reported as a negative regulator of E-cadherin levels, promoting, through Snail upregulation, a more proliferative and invasive phenotype [32] and silencing of miR-19 has been described to reverse EMT in lung cancer by suppressing E-cadherin [33]. [score:10]
[1 to 20 of 1 sentences]
77
[+] score: 10
It is seen that the expression of miR-17, miR-18a, miR-19, miR-20a, miR-21, miR-31, miR-92a, and miR-224 is upregulated in lung cancer cells and inhibition of their expression can reduce cell growth and invasion capacities [7, 39– 41]. [score:10]
[1 to 20 of 1 sentences]
78
[+] score: 10
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Finally, hsa-miR-19b [47, 54] and hsa-miR-483-5p [47, 53], which are upregulated, and hsa-miR-28-5p [47, 53], hsa-miR-19a [48, 53] and hsa-miR-1973 [48, 51], which are downregulated, are expressed in spermatozoa, but they have not been associated with spermatogenesis or related processes. [score:9]
The others are linked to cancer and aging (hsa-miR-30b-5p, hsa-miR-30c-5p, hsa-miR-375, hsa-miR-19b-3p, hsa-miR-200c-3p), or to unknown biological functions (hsa-miR-891a, hsa-miR-1233-3p) (see Table  1) [46]. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 9
T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematological malignancy that is classified into different genetic subtypes based upon the aberrant expression of specific transcription factor oncogenes (TAL, TLX1, TLX3 or HOXA) or the arrest at a specific stage of T-cell differentiation (immature T-ALL) 1– 4. Notably, these molecular subgroups are characterized by unique mRNA and long non-coding RNA expression signatures, which partially reflect their putative cell of origin 1, 2, 5. MicroRNAs (miRNAs) are short non-coding RNAs that function as post-transcriptional repressors of specific target genes 6, 7. Several studies have previously described a role for miRNAs in malignant T-cell transformation, including the identification of both an oncogenic (miR-19b, mir-20a, miR-26a, miR-92 and miR-223) [8] as well as a tumor suppressor (miR-150, miR-155, miR-200 and miR-193b-3p) 9, 10 miRNA network involved in T-ALL disease biology. [score:9]
[1 to 20 of 1 sentences]
80
[+] score: 9
As illustrated in Fig 3, 7 miRNAs including miR-29c, miR-217, miR-375, miR-215, miR-19b, miR-133a and let-7a had relatively low and stable expression levels (P < 0.05) in early period, and increased significantly (P < 0.01) from 12 to 13 weeks when the gonads entered into rapid development. [score:4]
Furthermore, miRNA-217, miRNA-155, miR-19b and miR-9 have target genes that are associated with puberty onset, such as FSHR, LEPR and circadian clock genes. [score:3]
According to previous reports and our sequencing results, 9 miRNAs, including miR-29c-3p, miR-375, miR-215-5p, miR-9-5p, miR-19b-3p, miR-133a-3p, let-7a, miR-217-5p and miR-155 were determined as candidates. [score:1]
Circulating miR-19b is a marker of fatty liver [47]. [score:1]
[1 to 20 of 4 sentences]
81
[+] score: 9
The binding sites of the MicroRNAs, including miR-20a, miR-19b, miR-21, miR-26a and miR-214, are highly homologous in the 3’UTR of PTEN and PTENp1, and those MicroRNAs are able to regulate the translation of PTEN in humans[5]. [score:4]
It was evidenced that 5 MicroRNAs (mir-19b, mir-20a, mir-21, mir-26a, mir-214) could bind to the 3'UTR of PTEN and PTENp1, and thus act as MicroRNA sponges to protect their parent gene from MicroRNA disturbancein the human[5]. [score:1]
The green triangle represents the mir-19b binding site, the yellow diamond represents the mir-26a binding site, and the blue rectangle represents the mir-20a binding site. [score:1]
Most importantly, mir-19b existed in all of 3’UTR of PTENps and PTEN of NMR (Table 2). [score:1]
Five MicroRNAs (mir-19b, mir-20a, mir-21, mir-26a, mir-214),which can competitively bind with PTEN and PTENp1 in human[5], were downloaded from miRBase database[16]. [score:1]
And most excitingly, we found conserved binding sites for the mir-19b, mir-20a and mir-26a in the 3’UTR of most of the NMR PTENps and the PTEN. [score:1]
[1 to 20 of 6 sentences]
82
[+] score: 9
Of the large number of targets whose expression levels correlated negatively with miR-19a and/or miR-19b in TCC (Table S6), many genes were well known to be associated with cancer based on previous functional studies. [score:5]
Thus, we believed that down-regulation of miR-19a and miR-19b may also promote the tumorigenic process of TCC. [score:4]
[1 to 20 of 2 sentences]
83
[+] score: 9
These results support differential roles of miR-19a and miR-19b in regulating circulating lipids, as miR-19b targets ABCA1 and miR-19a targets HBP1. [score:6]
MicroRNAs are involved in the regulation of blood lipids [36]; among them, miR-19b is reported to regulate HDL-C and LDL-C in the plasma of ApoE -null mice [37]. [score:3]
[1 to 20 of 2 sentences]
84
[+] score: 8
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
[1 to 20 of 4 sentences]
85
[+] score: 8
Specifically, members of the miR-17-92 cluster were deregulated in our dataset: miR-19a and miR-19b were strongly up-regulated, in addition to moderate up-regulation of miR-17-3p/miR-17-5p and miR-92b. [score:8]
[1 to 20 of 1 sentences]
86
[+] score: 8
These studies showed that while multiple miRNAs were differentially regulated by ischemia in each mo del, miR-19b,-2*, and miR-339-5p were all significantly upregulated in common to both mo dels (71). [score:5]
Brain miRNAs analyzed at 5 days post-stroke revealed a small cohort of miRNAs (miR-15a, miR-19b, miR-32, miR-136, and miR-199a-3p) highly expressed exclusively in adult females. [score:3]
[1 to 20 of 2 sentences]
87
[+] score: 8
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[1 to 20 of 2 sentences]
88
[+] score: 8
miR-17-92 cluster (miR-17, miR-18a, miR-19a, and miR-19b), also target CTGF as well as thrombospondin-1 in the context of myocardial fibrosis [31]. [score:3]
The remaining 14 (miR-18a-5p, miR-146a-5p, miR-30d-5p, miR-17-5p, miR-200a-3p, miR-19b-3p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-192-5p, miR-296-5p, miR-29a-3p, and miR-133a-3p) were upregulated in HCM patients with T [1] < 470 ms compared with those with T [1] ≥ 470 ms, and 11 (except miR-192-5p, miR-296-5p and miR-133a-3p) were significantly inversely correlated with postcontrast T [1] values. [score:3]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs We validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs Validation of by real-time PCRWe validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 8
Up-regulation of miR-34a [16], miR-19b [17], miR-503 [18] or miR-125b [19] can induce cardiac fibrosis, whereas overexpression of miR-101a [20], miR-17-3p or miR-29a [21] inhibits the fibrosis of CFs. [score:8]
[1 to 20 of 1 sentences]
90
[+] score: 8
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-19b-2, hsa-mir-21
These miRNAs typically downregulate PTEN mRNA levels by targeting it for degradation and include miR-17, miR-19, and miR-21 [83– 85]. [score:6]
While several examples of miR-17 and miR-19 -mediated PTEN RNA levels have been reported in the cancer literature, miR-21 has been described to play a critical role in repair and recovery, a developmental signaling-related process. [score:2]
[1 to 20 of 2 sentences]
91
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
The effect of masculinization treatment with either a synthetic androgen (17-α-methyl testosterone) or an inhibitor of cytochrome P450 aromatase (Fadrozole) on miRNA expression has been studied in Atlantic halibut; masculinization treatment resulted in differential expression of let-7a, miR-19b, miR-24, and miR-202-3p in gonads (Bizuayehu et al. 2012b). [score:7]
In zebrafish, myotube production ceases at 40% of the total body length and the transition from hyperplasia to hypotrophy is facilitated by miRNAs, including let-7, miR-19, and miR-130 families (Johnston et al. 2009). [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 8
The top five differentially upregulated miRNAs in eHCC (Table  4) were: miR-101 (215-fold), miR-22 (94-fold), miR-10b (34-fold), miR-19b (34-fold), and miR-192 (29-fold). [score:4]
The top five differentially upregulated miRNAs in HGDN (Table  3) were: miR-101 (266-fold), miR-22 (170-fold), miR-16 (54-fold), miR-192 (45-fold), and miR-19b (34-fold). [score:4]
[1 to 20 of 2 sentences]
93
[+] score: 8
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
[1 to 20 of 1 sentences]
94
[+] score: 8
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
[19] Dissection of the miR-17∼92 cluster has demonstrated that miR-19 is both necessary and sufficient to abrogate apoptosis, at least in Myc -mediated lymphomagenesis most likely by repression of PTEN and BIM. [score:1]
[1 to 20 of 4 sentences]
95
[+] score: 8
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-2, hsa-mir-126
Zhang X Yu H Lou JR Zheng J Zhu H Popescu NI Lupu F Lind SE Ding WQ MicroRNA-19 (miR-19) regulates tissue factor expression in breast cancer cells. [score:4]
Li S Ren J Xu N Zhang J Geng Q Cao C Lee C Song J Li J Chen H MicroRNA-19b functions as potential anti-thrombotic protector in patients with unstable angina by targeting tissue factor. [score:2]
The decrease in luciferase activity tended to be more pronounced than that exhibited by miR-19b. [score:1]
A, Human embryonic kidney 293 (HEK) cells were cultured for 24 h and then cotransfected with a mock plasmid and 200 μmol/L control mimic or 200 μmol/L miR-126 mimic as well as with a tissue factor (TF)-3′-UTR harboring plasmid and 200 μmol/L control mimic, 200 μmol/L miR-126 mimic or 200 μmol/L miR-19b mimic. [score:1]
[1 to 20 of 4 sentences]
96
[+] score: 7
Additionally, miR-20b* was higher expressed in pediatric PreBII large cells (up 14.1 fold, p = 0.0106), and miR-18b*/miR-19a*/miR-19b-1*/miR-20b*/miR-25* were higher expressed in adult Immature B cells (up 4.6–17.3 fold, p = 0.0465–0.0093). [score:5]
Interestingly, five star-form partners were similarly significantly higher expressed in pediatric PreBII small cells as compared to adults (miR-17a*/miR-18a*/miR-19b*/miR-20b*/miR-93*) (up 3–29 fold, p = 0.0018–0.042). [score:2]
[1 to 20 of 2 sentences]
97
[+] score: 7
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
[1 to 20 of 2 sentences]
98
[+] score: 7
miR-19b was found to inhibit TGF-β signaling, and its expression decreased in patients with advanced fibrosis, suggesting the potential of miR-19b as a therapeutic target for hepatic fibrosis [17]. [score:7]
[1 to 20 of 1 sentences]
99
[+] score: 7
We selected 12 miRNAs: miR-9, miR-19b, miR-27b, miR-92a, miR-140-5p, miR-190, miR-200a, let-7a, miR-129-5p, miR-582-5p, miR-892a, and miR-1237 (Figure  1) and tested whether they downregulate FOXP2 expression in cell culture systems. [score:6]
We found that miR-9, miR-19b, miR-140-5p, miR-200a, let-7a, miR-129-5p, miR-582-5p, and miR-892a reduced FOXP2 protein levels significantly (Figure  2A). [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 7
Two created sites, ssc-miR-19a and ssc-miR-19b targeting HSPA1A (encoding the heat shock 70 kDa protein 1A), found by TargetScan and PACMIT overlapped with TargetSpy predictions. [score:7]
[1 to 20 of 1 sentences]