sort by

313 publications mentioning hsa-mir-19a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-19a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 377
Other miRNAs from this paper: hsa-mir-155
However, these data do not preclude these four genes as miR-19a targets because significant differences were observed in target mRNA and protein analyses of A549 transfected with the miR-19a mimic (Fig 6C and 6D) and in cell viability of A549 transfected with the target cDNA expression vectors (Fig 7A, S4 Fig). [score:9]
Our results revealed that miR-19a downregulates the target genes FOXP1, TP53INP1, TNFAIP3, and TUSC2 and that these genes might play important roles in the tumorigenesis of lung cancer; however, the invasion inhibition potency was found to differ among the four genes. [score:8]
The miR-19a–binding sites identified using PicTar, TargetScan, or MiRanda software are shown in the 3ʹ-untranslated (UTR) region of miR-19a target candidate mRNAs. [score:7]
Although more than 10 genes remained as miR-19a target candidates, six genes (excluding the genes already reported as miR-19a targets), namely, forkhead box P1 (FOXP1), p53 -dependent damage-inducible nuclear protein 1 (TP53INP1), TNF-α -induced protein 3 (TNFAIP3), tumor suppressor candidate 2 (TUSC2), SIVA apoptosis-inducing factor 1 (SIVA1), and tumor necrosis factor receptor superfamily 12A (TNFRSF12A), were selected for this study. [score:7]
Expression plasmids for the miR-19a target proteins FOXP1, TP53INP1, TNFAIP3, and TUSC2 fused with the FLAG tag were constructed, and the protein expression derived from the plasmids was confirmed by western blotting using the anti-FLAG antibody (S3 Fig). [score:7]
Cells were counted using Hoechst 33342 staining at 24, 48, and 72 h. The number of each miR-19a target expression cell was significantly less than control cells at 24, 48, and 72 h. (B)s used A549 (upper) and LK79 (lower) stable cells with miR-19a target genes. [score:7]
Another reason might be that strong overexpression of miR-19a in LK79 caused decreased protein level of not the targets but also other unidentified targets of miR-19a. [score:7]
Protein expression of cDNA expression plasmids coding miR-19a target proteins fused with FLAG tag peptides. [score:7]
with antibodies for four miR-19a targets showed that the protein expression level of the four targets was higher in A549 than in LK79 cells (Fig 4B). [score:7]
In the present study, we identified novel target genes of miR-19a and showed the suppressive ability of the target genes on the growth, migration, and invasion of lung cancer cells. [score:7]
The expression of miR-19a was knocked down by transfection with anti-miR-19a locked nucleic acid (LNA) (30 nM; 5ʹ-TCA GTT TTG CAT AGA TTT GCA CA-3ʹ) or a control-LNA oligonucleotide targeting GFP (5ʹ-ATC ACT CTC GGC ATG GAC GAG C-3ʹ) (Gene Design Inc. [score:6]
Knockdown of miR-19a to 1/30 of the control level by LNA in LK79 cells (Fig 5A) may be expected to lead to increase in mRNA and protein expression of the target genes. [score:6]
The PTEN gene, reported to be an miR-19a target, was used as the positive control, and DAPK1, whose sequence did not match with miR-19a seed sequences at the 3ʹ untranslated region (UTR) of its mRNA, was used as the negative control. [score:5]
As TNF-α is a target of miR-19a [23], and our results suggest that TNFAIP3 is a target of miR-19a, miR-19a might affect TNF-α signaling. [score:5]
0137887.g007 Fig 7(A) Relative cell viability of A549 cells 24 h after transfection of expression plasmids with miR-19a target gene cDNAs. [score:5]
All four miR-19a target genes showed a suppression effect for colony formation, cell growth, and migration in both LK79 and A549 lines (Fig 7C and 7D; Fig 8A and 8B). [score:5]
Stable cell lines with miR-19a target genes exhibit suppression of cell growth, migration, and invasion. [score:5]
Recently, in addition to some reports that miR-19a represses the expression of cell signaling pathway genes such as PTEN or TNF-α [18, 19, 23], the overexpression of miR-19a in gastric cancer has been demonstrated to promote the epithelial–mesenchymal transition by activating the PI3K/AKT pathway [26]. [score:5]
In LK79 cells, miR-19a might be expressed at much more higher levels than the target mRNAs. [score:5]
To narrow the range of possible miR-19a targets, genes involved in cancer were extracted by search refinement by including more than two words related to cancer (tumor, suppressor, and apoptosis) in the preliminary literature search. [score:5]
Potential target genes of miR-19a were predicted by using the following miRNA target prediction software: PicTar (http://pictar. [score:5]
Therefore, further studies will be required for determining the association of the target genes with tumor malignancy and/or miR-19a expression in clinical studies using pathological specimens and tissues from patients with lung cancer. [score:5]
In particular, alterations in expression of more than two dozen miRNA has been reported in lung cancer patients [14], including recently reported overexpression of the miR-17-92 cluster (oncomiR-1) that encodes, among others, miR-19a and 19b [14]. [score:5]
We transfected Renilla luciferase reporter plasmids bearing possible miR-19a–binding sites of miR-19a target candidates and internal control firefly luciferase plasmids into HEK293 cells in which miR-19a expression was confirmed. [score:5]
We focused on six miR-19a target gene candidates, FOXP1, TP53INP1, TNFAIP3, TUSC2, SIVA1, and TNFRSF12A, which had been selected using miRNA target prediction software. [score:5]
To examine the function of the newly identified miR-19a target genes in lung cancer cells, we analyzed the expression level of miR-19a among 13 human lung cancer cell lines using TaqMan RT-PCR analysis. [score:5]
miR-19a target genes suppress cell viability, migration, and invasion of lung cancer cells. [score:5]
Expression of miR-19a and miR-19a target genes in human lung cancer cell lines. [score:5]
The miR-19a target cDNA expression plasmids were transfected into the cells using Lipofectamine 2000 (Life Technologies). [score:5]
However, the expression ratio of miR-19a and the target mRNAs might be extremely different in the two cell lines. [score:5]
At first, miR-19a mimic or control random miRNA was transfected into HEK293 cells to examine whether miR-19a reduced the expression of the four miR-19a target proteins. [score:5]
Secondly, anti-miR-19a LNA or control LNA was transfected into HEK293 cells to knock down endogenous miR-19a, and the expression of the four candidate proteins was analyzed by western blotting. [score:4]
Increased expression of the four target proteins was observed in anti-miR-19a LNA–treated cells as compared to that of control LNA–treated cells (Fig 3B). [score:4]
Our results suggest that miR-19a participates in the progression of lung cancer through TP53INP1 downregulation. [score:4]
The expression level, i. e., cycle threshold (CT) value, of each target mRNA in the pull-down sample with miR-19a–biotin was compared to the CT value of that in the pull-down sample with miR-random–biotin and shown as the relative ratio. [score:4]
Therefore, the knockdown of miR-19a to 1/30 of the control level might not have much effect on the increase in the target mRNAs in LK79 cells, as seen in most cases in Fig 5C. [score:4]
By western blotting at 72 h after transfection, decreased expression of the four target proteins was observed in miR-19a mimic–treated cells as compared to that of control miRNA–treated cells (Fig 3A). [score:4]
Primers to detect candidate miR-19a target cDNAs were designed flanking a possible miR-19a–binding region in the target mRNA (S1 Table). [score:4]
For miR-19a expression analysis, total cellular RNA was extracted using ISOGEN (Nippon Gene). [score:3]
For quantitative real-time PCR analysis of the miR-19a target genes, FOXP1, TP53INP1, TNFAIP3, and TUSC2 cellular mRNA was reverse transcribed with the ReverTra Ace First Strand cDNA Synthesis Kit (Toyobo), and the cDNA was amplified by PCR in a 20-μL total volume containing 0.2 μL of each reverse transcription reaction and 10 μL of the TaqMan 2× Universal PCR Master Mix (Life Technologies) in a 7300 Fast Real-Time PCR System with 40 cycles of 95°C for 15 s and 58°C for 5 min. [score:3]
Then, the mRNA levels of all four targets decreased in a dose -dependent manner in A549 cells treated with the miR-19a mimic. [score:3]
0137887.g005 Fig 5(A) Relative expression of miR-19a in LK79 cells 24 h after transfection of anti-miR-19a LNA or control LNA. [score:3]
S4 Fig of a single colony of G418-resistant A549 cells with each miR-19a target gene. [score:3]
0137887.g006 Fig 6(A) Relative expression of miR-19a in A549 cells 24 h after transfection of miR-19a mimic or control miRNA (10 nM). [score:3]
Taken together, FOXP1, TP53INP1, TNFAIP3, and TUSC2 were confirmed to be miR-19a target genes. [score:3]
For the effect of miR-19a on protein expression, at 72 h after transfection of HEK293 and A549 with the miR-19a mimic or anti-miR-19a-LNA, the protein samples (25 μg) were separated on 8% or 12% SDS-polyacrylamide gels, electrotransferred onto PVDF membranes, and incubated overnight at 4°C with the following antibodies: anti-TP53INP1 (T-17; Santa Cruz Biotechnology, Dallas, TX, USA), anti-FOXP1 (ab16645; Abcam, Cambridge, UK), anti-TNFAIP3 (ab74037; Abcam), anti-TUSC2 (ab70182; Abcam), anti-SIVA1 (ab67620; Abcam), and anti-TNFRSF12A (ITEM-4; Santa Cruz Biotechnology). [score:3]
These results suggest the possibility that these genes are miR-19a target genes. [score:3]
Cell growth of a single colony of G418-resistant A549 cells with each miR-19a target gene. [score:3]
The levels of four miR-19a target proteins in A549 cells treated with the miR-19a mimic tended to be lower than those in cells treated with control miRNA. [score:3]
Furthermore, SOCS-1 [20], THBS1 [21], IMPDH1, NPEPL1 [22], and TNF-α are also known as targets of miR-19a [23]. [score:3]
The biotinylated double-stranded miR-19a or control random RNA was incubated in cell extract (step 1) to yield a complex of the biotinylated miRNA single strand with target mRNA and RISC (step 2). [score:3]
For the confirmation of this pull-down system, we examined a positive control miR-19a target gene, PTEN, as well as a negative control gene, whose sequence did not match the miR-19a seed sequences. [score:3]
0137887.g003 Fig 3 (A) Expression analysis of candidate proteins by western blot analysis using proteins of HEK293 cells transfected with miR-19a mimic or control oligo RNA. [score:3]
However, as miRNA–mRNA binding depends on seed sequences and imperfect pairing of their strands, miR-19a must have yet-unidentified target genes that influence the onset and progression of lung cancer. [score:3]
S1 Fig Expression of SIVA1 and TNFRSF12A was analyzed by western blotting using proteins from HEK293 cells transfected with anti-miR-19a LNA or control LNA. [score:3]
Moreover, miR-19a activates the Akt-mTOR pathway by repressing the tumor suppressor PTEN [18, 19]. [score:3]
Expression of SIVA1 and TNFRSF12A was analyzed by western blotting using proteins from HEK293 cells transfected with anti-miR-19a LNA or control LNA. [score:3]
Fig 4 shows differences in the amounts of miR-19a and the four target proteins between LK79 and A549 cells. [score:3]
Sense (upper) and antisense (lower) strands of complementary sequences indicate the miRNA target site of the mRNA 3ʹ-UTR and miR-19a sequences, respectively. [score:3]
PTEN, known as one of miR-19a target genes, was used as a positive control. [score:3]
LK79 and A549 showed the highest and lowest level of miR-19a expression, respectively (Fig 4A). [score:3]
Before RT-PCR analysis of the target candidate genes, we confirmed whether the biotinylated miR-19a/mRNA complex contains the RISC component AGO2 by western blotting. [score:3]
0137887.g001 Fig 1(A) Overview of miR-19a target candidate mRNAs. [score:3]
Verification of miR-19a target candidate genes by western blot analysis. [score:3]
LK79 and A549 cells were then selected for the following analyses, to compare the function of these four genes between two lung cancer cell lines showing noticeably different expression levels of miR-19a. [score:3]
Effect of miR-19a target genes on lung cancer cells. [score:3]
Selection of miR-19a target candidate genes. [score:3]
We could not observe clear differences among the protein levels of the four miR-19a targets by western blotting between control and anti-miR-19a LNA–treated LK79 cells (data not shown). [score:3]
S2 Fig(A) Relative expression of miR-19a in A549 cells at 24 h after transfection of miR-19a mimic or control miRNA (1 and 5 nM). [score:3]
The PCR was performed on a 7300 Fast Real-time PCR System with 50 cycles of 95°C for 15 s and 60°C for 60 s. The expression level (CT value) of miR-19a was normalized to the CT value of a small nuclear RNA, U6B, which was co-amplified as an endogenous control. [score:3]
The luciferase activity of all plasmids with the miRNA -binding sites was significantly lower than that of the empty vector control (Fig 1C), suggesting that miR-19a–binding sequences in each miR-19a target candidate mRNA are recognized correctly by endogenous miR-19a in HEK293 cells. [score:3]
A549 showed a significantly decreased viability in all dishes with the miR-19a target cDNA plasmids compared to the control (Fig 7A), while there was no significant difference in the cell viability of LK79 (Fig 7B). [score:2]
Primers Used to Detect miR-19a Target cDNA. [score:2]
To verify whether the miRNA -binding sites are regulated by miR-19a in vivo, we constructed luciferase reporter plasmids with each miR-19a binding site in the 3ʹ-UTR of the Renilla luciferase gene (Fig 1B). [score:2]
The relative level of each target mRNA in the complex pulled down by using biotinylated miR-19a was compared to that of the complex pulled down by using the biotinylated control random RNA. [score:2]
MiR-19a, which is highly expressed in malignant lung cancer cells, is considered the key miRNA in tumorigenesis [18]. [score:2]
We used an in vitro pull-down assay for screening the target genes with biotinylated miR-19a and HEK293 cells. [score:2]
0137887.g004 Fig 4 (A) Relative expression of miR-19a in various lung cancer cell lines is shown as compared with that in human normal lung cell line WI-38. [score:2]
PCR primers for the candidate target genes were designed to amplify the region (100~300 bp) containing miR-19a–binding sites in their 3ʹ-UTRs (S1 Table). [score:2]
Genes FOXP1, TP53INP1, TNFAIP3, and TUSC2 were evaluated as miR-19a targets using another analysis for examining posttranscriptional regulation by miR-19a in the cells. [score:2]
Furthermore, we examined the luciferase activity of the plasmids bearing the miRNA -binding sites under miR-19a knockdown by co-transfection with anti-miR-19a LNA. [score:2]
The changes in the viability of the transfected cells demonstrated that miR-19a participates in the regulation of the cell cycle as dictated by miR-19a levels, and these cells are responsible for the difference in miR-19a quantities (Figs 5B and 6B). [score:2]
Verification of miR-19a candidate target genes by luciferase assays. [score:2]
Moreover, the mRNA levels of all four targets decreased significantly in A549 cells treated with the miR-19a mimic compared to control cells (Fig 6C). [score:2]
MiR-19a would be one of the multiple miRNAs regulating TUSC2 through the pseudogene, because we found possible miR-19a–binding sequences on the 3ʹ-UTR of pseudogene TUSC2P. [score:2]
Furthermore, patients with multiple myeloma and low miR-19a levels have been found to have an improved response to bortezomib compared to those with high miR-19a expression, and they experience a significantly extended survival upon bortezomib -based therapy [27]. [score:2]
Then, we compared the quantity of candidate target mRNAs in the complexes pulled down using biotinylated miR-19a and control random RNA by quantitative real-time PCR. [score:2]
showed a decrease in all four miR-19a target proteins in A549 cells treated with the miR-19a mimic compared to those of the cells treated with control miRNA (Fig 6D). [score:2]
Although there are many reports on the role of miR-19a and malignant tumors, miR-19a has been considered a clinical biochemical marker for acute myocardial infarction (AMI) diagnosis because circulating miR-19a expression is high in AMI patients [28]. [score:2]
Pull-down assay of target mRNAs of miR-19a. [score:2]
No change in SIVA1 or TNFRSF12A expression was observed in anti-miR-19a LNA–treated cells as compared to that in control LNA–treated cells (S1 Fig). [score:2]
The pull-down complex with biotinylated miR-19a exhibited the signal of the AGO2 protein (Fig 2C, lane 1), while no signal was noted for the pull-down complex with biotinylated random RNA (Fig 2C, lane 2), suggesting that biotinylated miR-19a, target mRNA, and AGO2 might form a complex in this pull-down assay. [score:2]
The pTK-hRG construct bearing a mismatch with the central region of miR-19a seed sequences was used as a negative control. [score:1]
rate and viability differ between lymphomas transfected with wild or mutated miR-19a; therefore, miR-19a might also be associated with cell growth [18]. [score:1]
The biotinylated double-stranded miR-19a or control random RNA was incubated in cell extract to produce a complex of the biotinylated miRNA single strand with RISC and mRNA. [score:1]
The mRNA level of TUSC2 increased significantly, while the mRNA level of FOXP1, TP53INP1, and TNFAIP3 showed no significant difference between control and anti-miR-19a LNA–treated LK79 cells (Fig 5C). [score:1]
Underlines indicate miR-19a seed sequences. [score:1]
–, control oligo RNA; +, miR-19a mimic. [score:1]
–, control LNA; +, anti-miR-19a LNA. [score:1]
The CT was calculated as the difference in the CT values between each miR-19a target gene and the β-actin gene in one sample. [score:1]
The miR-19a relative ratio showed a 1/30-fold decrease in LK79 transfected with anti-miR-19a LNA, while the miR-19a relative ratio showed a drastic 7,000-fold increase in A549 transfected with the miR-19a mimic. [score:1]
The 3ʹ-UTR fragments containing a possible miR-19a–binding region in the candidate genes were synthesized as oligonucleotides for both strands, which can produce XbaI cohesive ends after annealing. [score:1]
Effect of quantitative change of miR-19a on LK79 cells. [score:1]
The sequences were as follows: miR-19a mimic, sense 5ʹ-p-AUC CGC GCG AUA GUA CGU AUU-3ʹ and antisense 5ʹ-p-UAC GUA CUA UCG CGC GGA UUU-3ʹ; random miRNA (control miRNA), sense 5ʹ-p-UGU GCA AAU CUA UGC AAA ACU GA-3ʹ and antisense 5ʹ-p- UUA GUU UUG CAU AGU UGC AC-3ʹ. [score:1]
Among the six candidates, FOXP1, TP53INP1, TNFAIP3, and TUSC2 mRNA levels were significantly higher in the complex pulled down with biotinylated miR-19a than those of the control (Fig 2D). [score:1]
Effect of miR-19a in lung cancer cell lines. [score:1]
In the present study, we investigated the effect of miR-19a on lung cancer cells by transfecting an miR-19a mimic or anti-miR-19a LNA into cells with high (LK79 cells) or low (A549 cells) miR-19a expression. [score:1]
Biotinylated double-stranded RNA (8 nmoles) of miR-19a (sense 5ʹ-p-UGU GCA AAU CUA UGC AAA ACU GA-biotin-3ʹ and antisense 5ʹ-p-AGU UUU GCA UAG AUU UGC AUA AG-3ʹ) or control random RNA (sense 5ʹ-p-AUC CGC GCG AUA GUA CGU AUU-biotin-3ʹ and antisense 5ʹ-p-UAC GUA CUA UCG CGC GGA UUU-3ʹ) was added to the supernatant (500 μL) and incubated at 4°C for 30 min with 8-rpm shaking and then at 30°C for 1 h with 30-rpm shaking. [score:1]
Furthermore, the cells transfected with the miR-19a mimic (1 and 5 nM) showed an increase of about 300- and 1,700-fold, respectively, in miR-19a (S2 Fig). [score:1]
Thus, miR-19a also has potential applications in basic cancer studies, therapeutic strategies and decision-making, and as a biochemical marker for prognosis prediction of many kinds of malignant tumors. [score:1]
The miR-19a–binding sites of the candidate genes and negative control sequences (Negative Ctrl) were cloned downstream of the luciferase ORF at the XbaI restriction site of the pTK-hRG vector. [score:1]
Effect of quantitative change in miR-19a on A549 cells. [score:1]
Therefore, we focused on evaluating FOXP1, TP53INP1, TNFAIP3, and TUSC2 genes as miR-19a targets. [score:1]
Luciferase reporter plasmids with the sequences mismatched with the miR-19a seed region comprised the negative control. [score:1]
We detected an increased level of PTEN mRNA and decreased level of the negative control gene mRNA in the pull-down complex by using biotinylated miR-19a. [score:1]
We then performed other experiments to evaluate the possibility of these being miR-19a target genes. [score:1]
The negative control plasmid has mismatches in the center of miR-19a seed sequences. [score:1]
The gene, whose sequence did not match with miR-19a seed sequences, was used as the negative control. [score:1]
Exogenous miRNA transfection experiments were performed with miR-19a mimic (1, 5, and 10 nM) (CosmoBio, Tokyo, Japan) using HiPerFect Transfection Reagent (Qiagen, Venlo, Netherlands). [score:1]
At 24 h after transfection with anti-miR-19a LNA into LK79 cells, the cells treated with anti-miR-19a LNA showed a decrease in the level of miR-19a to one-thirtieth that in the cells treated with control LNA (Fig 5A) and exhibited decreased cell viability (Fig 5B), although the transfection efficiency of LK79 was very low. [score:1]
[1 to 20 of 120 sentences]
2
[+] score: 317
Other miRNAs from this paper: hsa-mir-17, hsa-mir-21
Increased miR-19a expressed in ASPC-1cells with miR-19a mimic down-regulated RHOB mRNA and protein expression levels while down-regulated miR-19a with miR-19a inhibitor up-regulated the RHOB mRNA and protein expression levels in ASPC-1 cells. [score:18]
Up-regulation of SP1 in ASPC-1 cells with SP1 vector plasmid significantly increased miR-19a expression levels and down-regulated SP1 with SP1 siRNA inhibited miR-19a expression (Figure 6A). [score:13]
A. Increased SP1 expression levels up-regulated miR-19a expression levels, while decreased SP1 inhibited miR-19a expression. [score:12]
Figure 6 A. Increased SP1 expression levels up-regulated miR-19a expression levels, while decreased SP1 inhibited miR-19a expression. [score:12]
Rh-endostatin inhibited miR-19a expression through down -regulating Sp1 and thus enhanced RHOB expression both in mRNA and protein levels to inhibit ASPC-1 cells proliferation, migration and invasion. [score:10]
D. it was also confirmed that rh-endostatin and gemcitabine inhibited proliferation and simultaneously down-regulated miR-19a expression levels in Panc-1 and Capan-2 cells. [score:8]
The expression levels of miR-19a (Supplementary Figure 4B) and RHOB (Supplementary Figure 4C, 4D) exhibited in planted tumors illustrated that tumor progression did caused by increased miR-19a and down-regulated RHOB expression levels. [score:8]
miR-19a mimic and inhibitor were transfected into ASPC-1 cells separately to increase or inhibit the expression levels of miR-19a (Supplementary Figure 4A). [score:7]
MiR-19a promoted progression of pancreatic cancer in vitro and in vivomiR-19a mimic and inhibitor were transfected into ASPC-1 cells separately to increase or inhibit the expression levels of miR-19a (Supplementary Figure 4A). [score:7]
Abraxane inhibited cell proliferation and suppressed miR-19a expression in pancreatic cancer cell lines (Supplementary Figure 2). [score:7]
These findings suggest that rh-endostatin suppressed miR-19a partly by inhibition of SP1 and thus increased RHOB expression levels in pancreatic cancer cells. [score:7]
Rh-endostatin inhibited miR-19a expression by suppression of SP1. [score:7]
Inhibition of cell proliferation and down-regulation of miR-19a by abraxane in different pancreatic cancer cell lines were confirmed, too. [score:6]
In conclusion, Sp1 driven up-regulation of miR-19a promotes cancer by targeting RHOB. [score:6]
Rh-endostatin suppressed miR-19a by inhibition of SP1. [score:5]
RHOB was among the predicted potential targets (Supplementary Figure 5A) and miR-19a was one of the miRNAs that may target RHOB (Supplementary Figure 5B). [score:5]
Our study added RHOB as one more target of miR-19a, which has been attested to target PTEN [13], SOCS1 [16], CUL5 [17], TNF-α [24] and TIMP-2 [25]. [score:5]
Here we addressed these questions and revealed miRNA-19a as a potential oncotarget (therapeutic target). [score:5]
We confirmed that miR-19a was over-expressed in pancreatic cancer tissues, and was correlated with poor differentiation and prognosis, promoted cancer cell proliferation, facilitated cells migration and invasion, as well as inhibited apoptosis. [score:5]
E. Hochst test and Flow Cytometer (FCM) test showed that decreased miR-19a with miR-19a inhibitor induced apoptosis while increased miR-19a with miR-19a mimic inhibited apoptosis in ASPC-1 cells. [score:5]
Bioinformatics search for potential target genes of miR-19a was performed by using 4 common databases, and RHOB was identified as a possible target. [score:5]
As a member of miR-17–92 cluster, miR-19a is expressed in many human cancers but shows contradictory properties: namely, it can promote [16, 17] or inhibit [18, 19] cancer progression in different type of neoplasms. [score:5]
We found that over-expressed miR-19a in ASPC-1 cells increased colony formation (Figure 3A) and proliferation (Figure 3B), increased S phase cell numbers in all cell cycles (Figure 3C), promoted cells migration and invasion (Figure 3D) and inhibited cell apoptosis (Figure 3E). [score:5]
The sequences of the corresponding small non-coding RNAs are as follows: miR-19a mimics: 5′-AGUUUUGCAUAGUUGCACUACA-3′; miR-19a inhibitor: 5′-UGUAGUGCAACUAUGCAAAACU-3′, mimics NC: 5′-UUCUCCGAACGUGUCACGUTT-3′, inhibitor NC: 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:5]
F. MiR-19a mimics promoted pancreatic cancer growing while its inhibitors suppressed cancer growing in Female Balb/c nude mice. [score:4]
F. High expression level of miR-19a (miR-19a levels in cancer/adjacent tissues > 1) was involved with a poor prognosis, compared to low expression level of miR-19a (miR-19a levels in cancer/adjacent tissues < 1). [score:4]
Figure 3 In vivo and in vitro tumor-promoting effect of miR-19a A. Colony formation assay indicated that miR-19a inhibitor suppressed while the miR-19a mimic promoted the colony formation of ASPC-1 cells. [score:4]
RHOB was a direct target of miR-19a. [score:4]
B. CCK8 assays showed that rh-endostatin inhibited ASPC-1 cells proliferation and acted synergistically with miR-19a inhibitor. [score:4]
RHOB is a direct target of miR-19a. [score:4]
MiR-19a was down-regulated most significantly among the altered miRNAs. [score:4]
A. Colony formation assay indicated that miR-19a inhibitor suppressed while the miR-19a mimic promoted the colony formation of ASPC-1 cells. [score:4]
Among them, miR-19a was down-regulated more significantly than the others, including miR-21, an onco-miRNA well-known in pancreatic cancer [10– 14]. [score:4]
Totally 28 miRNAs altered by rh-endostatin and 42 miRNAs altered by gemcitabine respectively were determined by high-throughput sequencing analysis and miR-19a was down-regulated significantly in both groups, confirmed also by fluorescence quantitative RT-PCR in ASPC-1 cells (Figure 1C) and the other two pancreatic cancer cell lines (Panc-1 and Capan-2 cells, Figure 1D). [score:4]
The down-regulation of miR-19a by rh-endostatin and gemcitabine was identified in different pancreatic cancer cell lines. [score:4]
High levels of miR-19a expression were correlated with tumor size (Figure 2B), node metastasis (Figure 2C), tumor infiltration (Figure 2D), differentiation (Figure 2E) and poor prognosis (Figure 2F). [score:3]
C. miR-19a was further identified as the same target of both gemcitabine and rh-endostatin by in ASPC-1 cells. [score:3]
B. CCK8 test showed that miR-19a mimic promoted ASPC-1 cell proliferation, which was curbed by miR-19a inhibitor. [score:3]
The assay of Dual Luciferase Reporter Gene activity confirmed that miR-19a could directly target the 3′UTR of RHOB. [score:3]
Over -expression of miR-19a in human pancreatic cancer tissues and its correlation with poor prognosis. [score:3]
Increased expression of miR-19a significantly affected luciferase activity when miR-19a was co -transfected with PGL3-RHOB-WT. [score:3]
These findings suggest the potential of miR-19a as a therapeutic target for pancreatic cancer. [score:3]
B. miR-19a was up-regulated in huge T phase (T > 5 cm) cases compared to that in cases with T < 5 cm. [score:3]
RHOB mRNA and protein expression levels were evaluated by RT-PCR (Supplementary Table 1) and western-blot separately after transfection with mimic and inhibitor of miR-19a in ASPC-1 cells. [score:3]
Rh-endostatin acted synergistically with inhibitor of miR-19a in cell cycle (Figure 7A), proliferation (Figure 7B), invasion (Figure 7C) and apoptosis (Figure 7D), which were abrogated by mimic of miR-19a. [score:3]
Importantly, the promoting effect of miR-19a on pancreatic cancer progression depends on inhibition of RHOB. [score:3]
To further understand the molecular mechanism for the regulation of miR-19a, the transcription factors of miR-19a were predicted using TRANSFAC [®] 7.0 in gene regulation (http://www. [score:3]
C. RHOB was determined a direct target of miR-19a by luciferase reporter assay. [score:3]
D. rh-endostatin induced ASPC-1 cells apoptosis and acted synergistically with miR-19a inhibitor and inversely with miR-19a mimic. [score:3]
Tumor mo del was established by implanting ASPC-1 cells with or without miRNA-19a mimics or inhibitors transfected (1 × 10 [7] cells) s. c. in the right axilla skin of mice. [score:3]
E. miR-19a was over-expressed in patients with lower differentiation compared to the patients with relatively higher differentiation. [score:2]
E. MiR-19a expression levels were positively correlated with SP1 at protein levels in human pancreatic cancer tissues (p < 0.05) and F. in adjacent tissues (p < 0.05). [score:2]
D. miR-19a was over-expressed in patients with local infiltration compared to the cases without local infiltration. [score:2]
C. Transwell migration assays showed that rh-endostatin reduced ASPC-1 cells migration and invasion and acted synergistically with miR-19a inhibitor, which could be completely offset by miR-19a mimic. [score:2]
MiR-19a was over-expressed in pancreatic cancer patients. [score:2]
miR-19a was over-expressed in cancer tissues compared with adjacent tissues (Figure 2A). [score:2]
MiR-19a expression was altered significantly by both rh-endostatin and Gemcitabine. [score:2]
A. miR-19a was over-expressed in human pancreatic cancer tissues compared to that in the adjacent tissues in 58 cases. [score:2]
MiR-19a expression was positively correlated with SP1 at protein levels in human pancreatic cancer (Figure 6E) and adjacent tissues (Figure 6F). [score:2]
C. miR-19a was over-expressed in patients with lymph node metastasis compared to that in cases without lymph node metastasis. [score:2]
Sp1 was identified as one of the upstream transcription factors that directly promote the transcription of miR-19a. [score:2]
Figure 2 A. miR-19a was over-expressed in human pancreatic cancer tissues compared to that in the adjacent tissues in 58 cases. [score:2]
MiR-19a was suppressed by rh-endostatin, gemcitabine and abraxane. [score:2]
A mutant construct in three miR-19a binding sites of RHOB 3′UTR region was also generated using quick change site-directed mutagenesis kit (Agilent, Roseville City, CA). [score:2]
SP1 directly promoted miR-19a transcription. [score:2]
These suggested that SP1 is one of the upstream transcription factors of miR-19a that directly promote miR-19a transcription. [score:2]
The binding set of RHOB by miR-19a was also predicted (Supplementary Figure 5C) and the mutant set of RHOB by miR-19a was thus designed (Supplementary Figure 5D). [score:1]
A. RHOB mRNA and B. protein levels were altered by miR-19a levels inversely. [score:1]
MiR-19a was among the 16 down-ragulated miRNAs. [score:1]
Furthermore, RHOB levels were inversely correlated with miR-19a levels both in pancreatic cancer tissues (Figure 4D) and in adjacent tissues (Figure 4E). [score:1]
The effect of abraxane on miR-19a was also explored since gemcitabine plus abraxane is a standard treatment option for pancreatic cancer patients. [score:1]
Levels of miR-19a were detected in formalin fixed paraffin-embedded pancreatic cancer tissues of 58 patients (Figure 2) and 12 fresh human pancreatic cancer samples (Supplementary Figure 3A). [score:1]
These data suggested that miR-19a was an onco-miRNA and promoted progression in pancreatic cancer. [score:1]
SP1 was one of the upstream transcription factors of miR-19a gene. [score:1]
B. ChIP and C. EMSA identified that promotor position of miR-19a gene had binding sites for SP1. [score:1]
The effect of abraxane, a standard pancreatic cancer treatment, on miR-19a was explored. [score:1]
The tumor-promoting effect of miR-19a in vivo was also confirmed (Figure 3F). [score:1]
This effect could be partly offset by miR-19a mimic. [score:1]
C. Enhanced miR-19a increased S phase cell numbers in all cell cycle. [score:1]
In vivo and in vitro tumor-promoting effect of miR-19a. [score:1]
Figure 4 A. RHOB mRNA and B. protein levels were altered by miR-19a levels inversely. [score:1]
Recent studies have suggested that high levels of miR-19a were associated with poor prognosis [20, 21] and multidrug resistance [22, 23]. [score:1]
D. RHOB levels were inversely related with miR-19a levels in pancreatic cancer tissues (p < 0.05) and E. in adjacent tissues (p < 0.05). [score:1]
The miR-19a expression was calculated relatively to U6 ribosomal RNA (RNU6) with U6 snRNA Real-time PCR normalization kit (GenePharma). [score:1]
[1 to 20 of 84 sentences]
3
[+] score: 282
Meanwhile, the TSC1 mRNA's 3′ untranslated regions (3′-UTR) luciferase activity was also inhibited after miR-19a expressing (Figure 1D), indicating that miR-19a directly targets TSC1 mRNA. [score:10]
To further confirm that TSC1 downregulation is the direct cause of mTORC1 activation in human osteoblasts, a TSC1 -expression construct (see Method) was introduced to miR-19a -expressing OB-6 cells. [score:9]
Figure 4OB-6 cells, expressing the lentiviral miR-19a expression vector (“LV-miR-19a”, Line1) or the non-sense scramble control microRNA (“miRC”), were further infected with lentiviral scramble control (“SCR-sh”) or Raptor (“Raptor-sh”) for 24 hours, cells were treated with/out Dex (1 μM), or plus RAD001 (200 nM); Expressions of listed proteins were shown (A, 1 hour after Dex treatment); Cell survival (B) and death (C) were tested 48 hours after Dex treatment. [score:7]
We show that microRNA-19a (“miR-19a”) directly targets and downregulates TSC1, causing mTORC1 activation in human osteoblasts. [score:7]
OB-6 cells, expressing the lentiviral miR-19a expression vector (“LV-miR-19a”, Line1) or the non-sense scramble control microRNA (“miRC”), were further infected with lentiviral scramble control (“SCR-sh”) or Raptor (“Raptor-sh”) for 24 hours, cells were treated with/out Dex (1 μM), or plus RAD001 (200 nM); Expressions of listed proteins were shown (A, 1 hour after Dex treatment); Cell survival (B) and death (C) were tested 48 hours after Dex treatment. [score:7]
Expression of miR-19a downregulated TSC1 and activated mTORC1 signaling in both OB-6 osteoblastic cells and primary human osteoblasts. [score:6]
Here, expression of miR-19a induced Nrf2 stabilization and expression of Nrf2-regulated genes (HO-1, NQO-1 and GCL-C). [score:6]
Collectively, these results indicate that forced -expression of miR-19a induces TSC1 downregulation in human osteoblasts. [score:6]
Inhibition of mTORC1, by RAD001 or Raptor, almost completely blocked miR-19a -induced mRNA expression of Nrf2-regulated genes. [score:6]
As demonstrated, forced -expression of miR-19a by LV-miR-19a (Figure 1G) led to significant TSC1 mRNA downregulation (Figure 1H). [score:6]
Notably, inhibition of mTORC1, by RAD001 or Raptor, almost completely blocked LV-miR-19a -induced mRNA expression of Nrf2-regulated genes, including HO-1 (Figure 6C) and NQO-1 (Figure 6D), indicating that mTORC1 activation is required for miR-19a -mediated Nrf2 activation in osteoblasts. [score:6]
HO-1, NQO-1 and GCL-C protein expressions were also upregulated in LV-miR-19a OB-6 cells (Figure 6B). [score:6]
Stable OB-6 cells, expressing the lentiviral miR-19a expression vector (“LV-miR-19a”, two lines, “Line1/2”), non-sense scramble control microRNA (“miRC”), or the parental control OB-6 cells (“Ctrl”), were subjected to of listed proteins (A and B). [score:5]
Figure 5The OB-6 osteoblastic cells were infected with lentiviral scramble control (“SCR-sh”), TSC1 (“TSC1-sh”) or plus lentiviral miR-19a expression vector (“+LV-miR-19a”), cells were further selected by puromycin, expressions of listed proteins were shown (A). [score:5]
In the TSC1-shRNA -expressing OB-6 cells, introduction of LV-miR-19a failed to further change TSC1 expression and mTOR activation (Figure 5A). [score:5]
results in Figure 2A showed that TSC1 protein expression was also decreased in two lines of LV-miR-19a -expressing OB-6 cells. [score:5]
Stable OB-6 osteoblastic cells, expressing the lentiviral miR-19a expression vector (“LV-miR-19a”, two lines, “Line1/2”), non-sense scramble control microRNA (“miRC”), or the parental control OB-6 cells (“Ctrl”), were subjected to quantitative real-time PCR (“qRT-PCR”) assay of miR-19a (“-3p”) and TSC1/2 mRNA expressions (B, C and E); TSC1/2 mRNA 3′-UTR luciferase activity assay was also tested (D and F). [score:5]
Thus, miR-19a expression apparently activated mTORC1 -dependent Nrf2 signaling and inhibited Dex -induced oxidative stresses in OB-6 cells. [score:5]
Figure 2Stable OB-6 cells, expressing the lentiviral miR-19a expression vector (“LV-miR-19a”, two lines, “Line1/2”), non-sense scramble control microRNA (“miRC”), or the parental control OB-6 cells (“Ctrl”), were subjected to of listed proteins (A and B). [score:5]
The qRT-PCR assay results in Figure 6A confirmed that expression of miR-19a by LV-miR-19a significantly increased mRNA expressions of Nrf2-regulated genes, including heme oxygenase 1 (HO-1), NAD(P)H quinone oxidoreductase 1 (NQO-1) and γ- glutamylcysteine synthetase catalytic subunit (GCL-C). [score:5]
In the current study, miR-19a expression inhibited Dex -induced ROS production in osteoblasts. [score:5]
In miR-19a -expressing primary human osteoblasts, the TSC1 construct similarly restored TSC1 expression and abolished mTORC1 activation (Figure 2F). [score:5]
Intriguingly, expression of miR-19a (by LV-miR-19a) in the TSC1 -expressing OB-6 cells was unable to further protect cells from Dex (Figure 5B and 5C). [score:5]
Results in Figure 1A showed that miR-19a (“-3p”) targets the 3′-untranslated region (UTR) of human TSC1 (at position 4878–4884). [score:5]
The OB-6 osteoblastic cells were infected with lentiviral scramble control (“SCR-sh”), TSC1 (“TSC1-sh”) or plus lentiviral miR-19a expression vector (“+LV-miR-19a”), cells were further selected by puromycin, expressions of listed proteins were shown (A). [score:5]
These results imply that TSC1 should be the primary and direct target protein of miR-19a in mediating its cytoprotective activity in osteoblasts. [score:4]
Considering that TSC2 mRNA was unchanged in LV-miR-19a OB-6 cells (Figure 1E), TSC2 downregulation by miR-19a should be due to the disruption of the TSC1-TSC2 complex. [score:4]
As demonstrated, introduction of LV-miR-19a also induced protein downregulation of TSC1 and TSC2 in the primary osteoblasts (Figure 2C). [score:4]
If TSC1 is the primary target protein of miR-19a, TSC1 knockdown shall also protect osteoblasts from Dex. [score:4]
miR-19a downregulates TSC1/2 and activates mTORC1 in human osteoblasts. [score:4]
Remarkably, as shown in Figure 2B, phosphorylations of two key mTORC1 substrates, including 4EBP1 and p70S6K1 [19, 20, 29, 30], were significantly increased in miR-19a -expressing OB-6 cells, suggesting mTORC1 activation. [score:3]
The non-sense scramble control microRNA (“miRC”) didn't change miR-19a nor TSC1/2 expressions in the osteoblasts (Figure 1B–1I). [score:3]
Primary human osteoblasts were infected with the LV-miR-19a or miRC for 48 hours, cells were treated with/out Dex (1 μM), or plus RAD001 (200 nM); Expressions of listed proteins were shown (D, 1 hour after Dex treatment); Cell survival (E) and death (F) were tested 48 hours after Dex treatment. [score:3]
TSC1 is the primary target of miR-19a in mediating its cytoprotective activity in osteoblasts. [score:3]
Primary human osteoblasts were infected with the LV-miR-19a or miRC for 48 hours, miR-19a (“-3p”) expression (G), TSC1 mRNA level (H) and TSC1 mRNA 3′-UTR luciferase activity (I) were tested similarly. [score:3]
mRNA expression (Figure 1E) and 3′-UTR luciferase activity (Figure 1F) of TSC2, a protein that forms complex with TSC1, were unchanged by LV-miR-19a. [score:3]
In the current study, we propose that miR-19a is a TSC1 -targeting miRNA in human osteoblasts. [score:3]
Studies [6, 21] have shown that activation of mTORC1 could protect human osteoblasts from Dex, we therefore tested whether miR-19a expression could also exert similar functions. [score:3]
Thus, miR-19a expression indeed protected OB-6 cells from Dex. [score:3]
Primary human osteoblasts were infected with LV-miR-19a or miRC for 48 hours, expressions of listed proteins were shown (C and D). [score:3]
Importantly, exogenous TSC1 expression in OB-6 cells almost completely blocked miR-19a -induced mTORC1 activation (tested by p-S6K1, Figure 2E). [score:3]
microRNA-19a-3p (“miR-19a”) putatively targets the 3′-UTR of human TSC1 mRNA (A). [score:3]
Importantly, miR-19a expression protects human osteoblasts from Dex. [score:3]
As expected, the TSC1 construct didn't affect miR-19a expression by LV-miR-19a in the osteoblasts (Data not shown). [score:3]
The lentiviral pSuper-GFP-puro-miR-19a expression vector (“LV-miR-19a”) was designed (based on the descried sequence [49]) and synthesized by Genepharm (Shanghai, China). [score:3]
The results in Figure 1 demonstrated that expression of miR-19a by LV-miR-19a caused TSC1 mRNA depletion. [score:3]
The construct was transfected to miR-19a -expressing osteoblasts via Lipofectamine 2000 transfection. [score:3]
Importantly, results showed that Dex -induced ROS production was largely attenuated following miR-19a expression in OB-6 cells (Figure 6E). [score:3]
These results indicate that miR-19a -induced mTORC1 activation could possibly activate Nrf2 signaling, which likely inhibits Dex -induced oxidative stress. [score:3]
Forced -expression of miR-19a. [score:3]
These results together indicate that TSC1 is the primary target of miR-19a in mediating its osteoblast cytoprotection. [score:3]
In the primary human osteoblasts, introduction of LV-miR-19a also induced mRNA expressions of HO-1, NQO-1 and GCL-C (Figure 6F). [score:3]
A lentiviral miR-19a expression vector (“LV-miR-19a”) was established, which was introduced to OB-6 human osteoblastic cells. [score:3]
mTORC1 inhibition, by RAD001 or Raptor, almost completely abolished miR-19a -induced osteoblast cytoprotection. [score:3]
Remarkably, TSC1 mRNA expression was decreased in the two lines of LV-miR-19a OB-6 cells (Figure 1C). [score:3]
These results suggest that miR-19a expression induced Nrf2 protein stabilization, which is necessary for its activation [40, 41]. [score:3]
Figure 1microRNA-19a-3p (“miR-19a”) putatively targets the 3′-UTR of human TSC1 mRNA (A). [score:3]
The quantitative real-time PCR (“qRT-PCR”) assay results in Figure 1B demonstrated that miR-19a (“-3p”) expression level was dramatically increased in the two lines of OB-6 cells. [score:2]
Indeed, we show that TSC1 mRNA's 3′-UTR luciferase assay was also largely attenuated after miR-19a expression. [score:2]
These results imply that TSC1 silence should be the direct and primary cause of mTORC1 activation by miR-19a in human osteoblasts. [score:2]
Expression of miR-19a (“-3p”) in the resulting cells was tested by qRT-PCR assay. [score:2]
OB-6 cells, with “LV-miR-19a” or “miRC”, were further infected with lentiviral scramble control (“SCR-sh”) or Raptor (“Raptor-sh”) for 24 hours, or plus RAD001 (200 nM) co-treatment, qRT-PCR assay was applied to test HO-1 mRNA (C) and NQO-1 mRNA (D); Data were expressed as mean ± SD (n = 5). [score:2]
Notably, miR-19a was in valid in TSC1-silenced OB-6 cells. [score:1]
Stable OB-6 cells with LV-miR-19a (“Line1”) (E), as well as the primary human osteoblasts with LV-miR-19a (F), were further transfected with TSC1 cDNA construct (“wt-TSC1”, 0.20 μg/mL, for 48 hours) or the empty vector (pSuper-puro-EGFP, “Vec”), total cell lysates were subjected to of listed proteins. [score:1]
We thus tested the potential effect of miR-19a on Nrf2 signaling activation. [score:1]
The plasmid with the perfect match contain the complementary sequences of the mature miR-19a-3p behind the firefly luciferase gene [49]. [score:1]
Remarkably, Dex -induced cytotoxicity was dramatically attenuated in the two lines of OB-6 cells with LV-miR-19a (Figure 3A–3C). [score:1]
miR-19a protects human osteoblasts from Dex. [score:1]
Two lines of stable OB-6 cells with LV-miR-19a were established, which were named as “LV-miR-19a (Line-1)” and “LV-miR-19a (Line-2)”. [score:1]
Remarkably, miR-19a -induced osteoblast cytoprotection against Dex was almost completely nullified by RAD001 or Raptor (Figure 4B and 4C). [score:1]
miR-19a activates Nrf2 signaling in human osteoblasts. [score:1]
Significantly, miR-19a protected human osteoblasts from Dex, and activation of mTORC1 is required for the process. [score:1]
This could explain the superior cytoprotective activity of miR-19a against Dex in human osteoblasts. [score:1]
The human osteoblasts were infected with LV-miR-19a lentivirus or the scramble non-sense control miRNA (“miRC”). [score:1]
The similar results were also observed in the primary human osteoblasts, where LV-miR-19a attenuated Dex -induced cell viability reduction (Figure 3D) and cell death (Figure 3E). [score:1]
Similarly in the primary human osteoblasts, mTORC1 blockage by RAD001 (Figure 4D) intensified Dex -induced injuries and almost reversed miR-19a -induced anti-Dex actions (Figure 4E and 4F). [score:1]
The reporter plasmid was then utilized as template to generate a miR-19a response element. [score:1]
These results suggest that mTORC1 activation is required for miR-19a -induced osteoblast cytoprotection against Dex. [score:1]
Notably, RAD001 or Raptor almost completely blocked mTORC1 activation (p-S6K1/p-4EBP1) in OB-6 cells with LV-miR-19a (“Line1”, Figure 4A). [score:1]
mTORC1 activation is required for miR-19a -mediated osteoblast cytoprotection against Dex. [score:1]
OB-6 osteoblastic cells (A and B) or primary human osteoblasts (F), with the lentiviral miR-19a expression vector (“LV-miR-19a”) or non-sense scramble control microRNA (“miRC”), were subjected to qRT-PCR assay (A and F) and (B) of listed Nrf2 pathway genes; The OB-6 cells were also treated with/out Dex (1 μM) for 12 hours, relative ROS intensity was analyzed by the DCFH-DA fluorescent dye assay (E). [score:1]
In order to prove that mTORC1 activation is required for miR-19a -mediated osteoblast cytoprotection, pharmacological and genetic methods were employed to block mTORC1 activation. [score:1]
Nrf2 mRNA level was unchanged by LV-miR-19a (Figure 6A), yet its protein level was significantly increased (Figure 6B). [score:1]
Importantly, TSC2 protein level was also reduced by LV-miR-19a (Figure 2B). [score:1]
Figure 6OB-6 osteoblastic cells (A and B) or primary human osteoblasts (F), with the lentiviral miR-19a expression vector (“LV-miR-19a”) or non-sense scramble control microRNA (“miRC”), were subjected to qRT-PCR assay (A and F) and (B) of listed Nrf2 pathway genes; The OB-6 cells were also treated with/out Dex (1 μM) for 12 hours, relative ROS intensity was analyzed by the DCFH-DA fluorescent dye assay (E). [score:1]
Meanwhile, TSC1 mRNA's 3′-UTR luciferase activity was also decreased by LV-miR-19a (Figure 1I). [score:1]
[1 to 20 of 86 sentences]
4
[+] score: 231
miR-19a suppresses HBP1 expression and up-regulates MIF to promote the release of inflammatory factors TNF-α and IL-6. In addition, miR-19a was up-regulated by the TNF-α in both THP-1 and RAW264.7 cells. [score:11]
We show that the miR-19a down-regulates HBP1, resulting in MIF up-regulation and increased secretion of inflammatory cytokines TNF-α and IL-6, while miR-19a inhibition has the opposite effects. [score:9]
To search potential targets of miR-19a, we performed several miRNA target prediction algorithms available online, including TargetMiner, MirDB, PicTar, Targetscan. [score:9]
Taken together, these data indicate that HBP1 is a functional target of miR-19a, which directly targets its 3′UTR, and that HBP1 serves as an effector of miR-19a by regulating MIF expression and IL-6 and TNF-α secretion and thereby affecting foam cell formation. [score:9]
Other reports suggest that miR-19a is up-regulated in endothelial blood vessel cells under hypoxia-inducible factor and shear stress 25– 27, and miR-19a suppresses IL-10 expression in peripheral B cells from patients with atherosclerosis [28] suggesting that miR-19a may participate in atherosclerosis. [score:8]
TNF-α -mediated expression of miR-19a upregulates MIF by targeting HBP1 and promotes the release of inflammatory cytokines TNF-α and IL-6. This TNF-α-miR-19a-HBP1-MIF forward feedback loop results in foam cell formation and promotes AS progression. [score:8]
The expression levels of miR-19a in the blood and arteries of the antagomiR-19a group are significantly lower than that in the control group, Additionally, the expression of HBP1 in the arterial wall of ApoE -null mice is upregulated with antagonistic miR-19a treatment. [score:8]
We found that overexpression of HBP1 rescued HBP1 downregulation that was mediated by miR-19a (Fig.   4G) and weaken the pro-inflammatory effects (increased IL-6 and TNF-α secretion) caused by miR-19a (Fig.   4I,K). [score:6]
These results support differential roles of miR-19a and miR-19b in regulating circulating lipids, as miR-19b targets ABCA1 and miR-19a targets HBP1. [score:6]
Through TNF-α-miR-19a-HBP1-MIF pathway, miR-19a up-regulates MIF and promotes the release of inflammatory cytokines TNF-α and IL-6. TNF-α promotes the expression of miR-19a, resulting in a forward feedback formed (Fig.   6). [score:6]
HBP1 as a functional target of miR-19a regulates the expression of MIF in foam cell formation. [score:6]
We found that the expression of miR-19a is upregulated by oxLDL stimulation in a dose- and time -dependent manner (Fig.   1D,E). [score:6]
We found that the expression of miR-19a was upregulated by oxLDL stimulation in a dose- and time -dependent manner (Fig.   1F,G). [score:6]
With the miR-19a mimic, we found that miR-19a suppressed reporter activity and that the site 2 mutant rescued such suppression, whereas the site 1 mutant had no effect (Fig.   3B). [score:5]
In contrast, inhibition of HBP1 by the siRNA restrained the protein level of HBP1 that was induced by knockdown of miR-19a (Fig.   4H) and reversed the phenotype (reduced IL-6 and TNF-α secretion) caused by miR-19a knockdown (Fig.   4J–L). [score:5]
In this study, we demonstrated that miR-19a is highly abundant in the blood and tissue of patients with atherosclerotic coronary artery disease and identified HMG box-transcription protein1 (HBP1) as a new target for miR-19a. [score:5]
All the results suggest that miR-19a regulate HBP1 by directly target the site 2 on the 3′UTR of HBP1. [score:5]
To further examine whether HBP1 is a functional target of miR-19a during foam cell formation, THP-1 cells were transfected with the miR-19a mimic, siHBP1–1, or the HBP1 overexpression vector. [score:5]
In addition, introduction of the miR-19a inhibitor caused an evidently increase in luciferase activity (Fig.   3C), which was abolished by the mutation at site 2 but not at site 1. Double mutations had similar impact as the site 2 mutant. [score:5]
Thus there is a forward feedback loop during atherosclerosis (Fig.   6): TNF-α stimulates the expression of miR-19a to suppress HBP1 and subsequently elevate MIF production, which in turn increases TNF-α secretion. [score:5]
Additionally, we also detected significantly higher expression of HBP1 in the arterial wall of antagonistic miR-19a -treated ApoE null mice immunohistochemistry than the control, implying that miR-19a represses HBP1 expression in mice (Fig.   5I,J). [score:5]
Overexpression of miR-19a decreased the level of HBP1 and increased the level of MIF; miR-19a inhibition had the opposite effects (Fig.   3D,E). [score:5]
Next, to investigate whether miR-19a regulates lipid uptake of macrophages, we transfected THP-1-derived macrophages with a miR-19a inhibitor, then incubated cells with Dil-oxLDL for 6 h. Both fluorescent imaging and fluorescence activated cell sorting (FACS) results showed that inhibition of miR-19a repressed the lipid uptake of macrophages and reduced foam cell formation (Fig.   2G,H and I). [score:4]
miR-19a directly targets the 3′UTR of HBP1. [score:4]
In addition, miR-19a is upregulated by TNF-α. [score:4]
These results indicate that miR-19a inhibition alleviates the inflammatory response and slows the development of AS. [score:4]
Interesting, miR-19a was also upregulated by the TNF-α in both THP-1 and RAW264.7 cells (Fig.   1H,I). [score:4]
In the present work, we ascertain HBP1 as a novel target gene of miR-19a in atherosclerosis. [score:3]
It has been reported that HBP1 could be a target gene of miR-19a and miR-17–5p in tumor cells 29, 30. [score:3]
Conversely, inhibition of miR-19a had the opposite effects (Fig.   2E,F). [score:3]
We also demonstrate that overexpression of miR-19a promotes foam cell formation. [score:3]
1×10 [4] HEK-293T cells were seeded into 96-well plates for 24 hours, and the cells were transfected with pRL-TK-HBP1–3′UTR or pRL-TK-HBP1–3′UTR mutant (mut1 or mut2) vectors (100 ng), 10 ng of pGL3 control (Promega, Madison, USA), and 10 pmol miR-19a mimic or miR-19a inhibitor using Lipofectamine LTX and Plus reagent (Invitrogen, Carlsbad, CA, USA). [score:3]
Next, we determined the relative expression level of miR-19a in 38 pairs of atherosclerotic lesion and normal LIMA from the same patients using qRT-PCR and found that the miR-19a level was remarkably higher in the atherosclerotic lesion than in the normal LIMA (Fig.   1C). [score:3]
Inhibition of miR-19a, therefore, may be a novel strategy to combat atherosclerosis. [score:3]
To validate that the expression of miR-19a was increased in patients with AS, we also measured the miR-19a expression level using qRT-PCR and found that miR-19a level was indeed higher in the plasma from patients with CAD (Fig.   1B). [score:3]
miR-19a is overexpressed in the plasma and atherosclerotic plaques of CAD patients and is induced by oxLDL in human macrophages. [score:3]
HBP1 (HMG box-transcription protein1), which acts as a transcriptional repressor, is identified as a potential target of miR-19a. [score:3]
THP-1-derived macrophages were transfected with miR-19a mimic or miR-19a inhibitor at the indicated dose (Fig.   2A,D). [score:3]
In summary, our present work demonstrates that miR-19a is elevated in the circulation and atherosclerotic lesions of patients with coronary artery disease. [score:3]
Overall, these results suggest that miR-19a inhibition attenuates atherosclerosis in mice. [score:3]
We found that overexpression of miR-19a in macrophages enhanced IL-6 and TNF-α production (Fig.   2B,C). [score:3]
Furthermore, mouse RAW 264.7 cells was used to test whether miR-19a is regulated by oxLDL stimulation mice. [score:2]
Two HBP1 3′-UTR mutants with mutation in the miR-19a binding site are also shown. [score:2]
Inflammatory cytokine production and lipid uptake is regulated by miR-19a. [score:2]
THP-1-derived macrophages were transfected with miR-19a inhibitor for 48 hours, and then incubated with 20 μg/ml Dil-oxLDL (Yiyuan biotechnology Guangzhou, China) for 6 hours at 37 °C For FACS assay, cells were washed three times with PBS before subjected to FACS (fluorescence activated cell sorting). [score:2]
Figure 2Inflammatory factor production and lipid uptake is regulated by miR-19a. [score:2]
The expression level of miR-19a in plasma and aortic tissue from antagomiR-19a -injected ApoE [−/−]mice was decreased notably compared with the control group (Fig.   5A, B). [score:2]
We reveal enrichment of serum miR-19a in coronary patients in comparison with healthy individuals, and miR-19a overexpression in atherosclerotic tissues of arterial walls compared to LIMA tissues. [score:2]
We made mutants for both sites and performed a luciferase reporter assay in HEK-293T cells by transfecting a miR-19a mimic (or a miR-19a inhibitor) and a luciferase reporter downstream with either the wild type HBP1 3′UTR or its mutants (Fig.   3A). [score:2]
High-fat fed ApoE [−/−] mice are treated with a miR-19a antagonist, antagomiR-19a. [score:1]
Finally, we used an animal mo del to determine the role of miR-19a in atherosclerosis. [score:1]
Atherosclerosis continues to be one of the biggest threat to human health and its initiation, prevention, and treatment invite extensive biological and medical research 22, 23. miR-19a is an important member of the miR-17–92 polycistronic gene cluster, which include seven microRNAs (miR−17–5p and −3p, miR-18a, miR19a and b, miR-20a and miR-92a) [24]. [score:1]
Figure 6 Schematic presentation of miR-19a in atherosclerosis. [score:1]
This study implies miR-19a as a promoter to inflammation and atherosclerosis. [score:1]
The results showed that miR-19a levels were significantly higher in CAD patients (Fig.   1A). [score:1]
We also demonstrate the role of miR-19a in vivo using an animal mo del of atherosclerosis. [score:1]
There are two putative binding sites in the HBP1 3′UTR to the seed sequence of miR-19a and both are highly conserved in human, chimp, mouse, rat, and dog. [score:1]
These results imply that miR-19a is a pro-inflammatory miRNA during atherosclerosis. [score:1]
To investigate the expression of miR-19a in an in vitro mo del, THP-1 cells were treated with 100 nM PMA and subsequently stimulated with oxLDL at different concentrations (0, 10, 50 μg/ml) for 24 h or with 50 μg/ml oxLDL for different durations (0, 12, and 24 h) 18, 19. [score:1]
[1 to 20 of 59 sentences]
5
[+] score: 224
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2
In summary, this study not only elucidated the critical role of MTUS1 as a tumor suppressor in lung cancer but also explored the molecular mechanisms underlying MTUS1 regulation and identified miR-19a/b as direct upstream regulators of MTSU1 expression. [score:8]
Interestingly, MTUS1 was identified as a co-target of miR-19a/b by bioinformatics analysis, and an inverse correlation between miR-19a/b levels and MTUS1 levels was detected in lung cancer tissues, indicating that miR-19a/b overexpression may play a role in lung cancer progression by co -targeting MTUS1. [score:7]
MTUS1 modulation by miR-19a/b may explain why miR-19a/b upregulation and MTUS1 downregulation during lung carcinogenesis promote cancer progression. [score:7]
*, P < 0.05; **, P < 0.01; ***, P < 0.001 To determine whether the inhibitory effects exerted by miR-19a/b on MTUS1 expression are mediated via binding of miR-19a/b to their presumed target sites in the MTSU1 mRNA 3′-UTR, the entire MTSU1 3′-UTR containing the presumed miR-19a/b binding sites was fused to a reporter plasmid downstream of the firefly luciferase gene. [score:7]
*, P < 0.05; **, P < 0.01; ***, P < 0.001 Because miRNAs generally exhibit expression patterns that contrast with those of their targets (Ambros, 2004; Bartel, 2004; He and Hannon, 2004), we investigated whether miR-19a/b expression levels were inversely correlated with MTUS1 expression levels in lung cancer. [score:7]
Consequently, MTUS1 protein expression was significantly inhibited by the introduction of miR-19a/b in A549, H1975 and HCC827 cells, while MTUS1 protein expression was significantly increased by the introduction of anti-miR-19a/b in these cells (Fig.   3A and 3B). [score:7]
*, P < 0.05; **, P < 0.01; ***, P < 0.001 To determine whether the inhibitory effects exerted by miR-19a/b on MTUS1 expression are mediated via binding of miR-19a/b to their presumed target sites in the MTSU1 mRNA 3′-UTR, the entire MTSU1 3′-UTR containing the presumed miR-19a/b binding sites was fused to a reporter plasmid downstream of the firefly luciferase gene. [score:7]
Based on the results of the computational prediction and the detection of an inverse correlation between miR-19a/b expression and MTUS1 expression in vivo, it is very likely that miR-19a/b are involved in MTUS1 post-transcriptional regulation. [score:6]
In these experiments, miR-19a/b overexpression was achieved by transfecting cells with pre-miR-19a/b (synthetic RNA oligonucleotides mimicking miR-19a/b precursors), whereas miR-19a/b knockdown was achieved by transfecting cells with anti-miR-19a/b (chemically modified antisense oligonucleotides designed to specifically target mature miR-19a/b). [score:6]
MTUS1 mRNA expression was decreased by miR-19a/b overexpression and increased by miR-19a/b knockdown in A549, H1975, and HCC827 cells (Fig.   3C and 3D). [score:6]
After determining the levels of miR-19a/b in 9 pairs of lung cancer tissues and corresponding normal adjacent tissues, we showed that miR-19a/b expression levels were consistently upregulated in lung cancer tissues (Fig.   2B). [score:6]
Interestingly, although individual miR-19a or miR-19b overexpression/knockdown increases/decreases cell proliferation, simultaneous introduction/reduction of miR-19a and miR-19b exerted synergistic effects with respect to cell proliferation promotion/suppression compared to the effects exerted by miR-19a or miR-19b alone (Fig.   4D and 4E). [score:5]
In conclusion, these results suggest that miR-19a/b recognize and bind to the 3′-UTR of the MTUS1 mRNA transcript and inhibit MTUS1 translation. [score:5]
Figure 3 Direct regulation of MTUS1 expression by miR-19a/b. [score:5]
While MTUS1 protein and mRNA expression was significantly increased in A549 cells transfected with anti-miR-19a (100 pmol) or anti-miR-19b (100 pmol), the greatest increase in expression occurred when anti-miR-19a and anti-miR-19b (50 pmol each) were transfected into A549 cells simultaneously (Fig.   4A–C). [score:5]
To determine the level at which miR-19a/b influenced MTUS1 expression, we repeated the above experiments and examined MTUS1 mRNA expression after transfection. [score:5]
These results indicated that the suppressive effects of miR-19a/b on MTUS1 protein and mRNA expression were not an individual effects but synergistic effects. [score:5]
As a single miRNA can target hundreds of genes, it is necessary to determine whether the effects of miR-19a/b on lung cancer cells are derived from miR-19a/b -mediated MTUS1 suppression. [score:5]
Co-treatment with miR-19a/b synergistically suppresses MTUS1 expression in lung cancer cells. [score:5]
The correlation between miR-19a/b and MTUS1 was examined further by evaluating MTUS1 expression in three lung cancer cell lines (A549, H1975, and HCC827) in the setting of miR-19a/b overexpression or knockdown. [score:4]
This mutated luciferase reporter was unaffected by miR-19a/b overexpression or knockdown (Fig.   3E). [score:4]
Next, we identified miR-19a/b as a potential regulator of MTUS1 using bioinformatics analysis and experimentally confirmed that MTUS1 is directly regulated by miR-19a/b in lung cancer cells. [score:4]
Validation of MTUS1 as a direct target of miR-19a/b. [score:4]
We found that miR-19a/b are co -upregulated in lung cancer and have concordant cellular functions, which allowed us to hypothesize that miR-19a/b may play important roles in lung carcinogenesis. [score:4]
Thus, the cell proliferation promoted by MTUS1 knockdown was similar to that elicited by miR-19a/b overexpression, indicating that miR-19a/b and MTUS1 exert contrasting effects on cell proliferation. [score:4]
For the luciferase reporter assays, 293T cells were seeded in 24-well plates and co -transfected with 0.5 μg of firefly luciferase reporter plasmid, 0.5 μg of β-galactosidase (β-gal) expression plasmid (Ambion,Austin, Tex), and equal amounts (25 pmol) of miR-19a/b mimics, inhibitors, or scrambled negative control RNAs using Lipofectamine 2000 (Invitrogen). [score:4]
Because miR-19a/b display extensive sequence homology, they are thought to possess overlapping targets and have redundant functions. [score:3]
More importantly, both the wound healing and the Transwell assays indicated that simultaneous introduction of miR-19a and miR-19b exerted synergistic effects with respect to the promotion of cell migration compared to the effects exerted by miR-19a or miR-19b alone and that simultaneous inhibition of miR-19a and miR-19b decelerated cell migration more than inhibition of either miRNA alone (Fig.   4F– I). [score:3]
Moreover, there was perfect base-pairing between the seed regions (The core sequences that encompass the first 2–8 bases of the mature miRNA) and cognate targets, and the miR-19a/b binding sequences in the MTUS1 3′-UTR were highly conserved across species. [score:3]
For miRNA overexpression, equal amounts of pre-miR-19a (100 pmol), pre-miR-19b (100 pmol) or pre-miR-19a/b (50 pmol each) were used. [score:3]
These results confirmed the synergistic effects of miR-19a/b on MTUS1 expression in lung cancer cells. [score:3]
Taken together, our findings indicate that because miR-19a/b and MTUS1 exhibit contrasting expression patterns and exert contrasting biological effects in lung cancer cells, it is very possible that miR-19a/b synergistically modulate cell proliferation and migration in lung cancer cells by silencing MTUS1. [score:3]
The predicted interactions between miR-19a/b and their target sites in the MTUS1 3′-UTR are illustrated in Fig.   2A. [score:3]
Thus, this study delineated a novel regulatory network employing miR-19a/b and MTUS1 to regulate lung cancer cell fates. [score:3]
Finally, we showed that MTUS1 is synergistically suppressed by miR19a/b, resulting in lung cancer cell proliferation and migration. [score:3]
Synthetic RNA molecules, including pre-miR-19a and pre-miR-19b (miRNA mimics), anti-miR-19a and anti-miR-19b (miRNA inhibitors), and scrambled negative control RNAs (pre-miR-control and anti-miR-control), were purchased from GenePharma (Shanghai, China). [score:3]
Identification of conserved miR-19a/b target sites within the 3′-UTR of MTUS1. [score:3]
As expected, miR-19a/b overexpression resulted in a ~40% reduction in luciferase reporter activity compared to cells treated with the pre-miR control, whereas miR-19a/b inhibition resulted in a 1.5-fold increase in reporter activity compared to cells transfected with the anti-miR control (Fig.   3E). [score:3]
Co-treatment with pre-miR-19a and pre-miR-19b successfully increased miR-19a/b levels (Fig. S2C and S2D) and enhanced MTUS1 protein and mRNA suppression compared to treatment with either pre-miR-19a or pre-miR-19b alone (Fig.   4A–C). [score:2]
Two of the most famous oncomirs, miR-19a/b in the miR-17-92 miRNA cluster are involved in regulating of a wide variety of human cancers. [score:2]
For miRNA knockdown, equal amounts of anti-miR-19a (100 pmol), anti-miR-19b (100 pmol) or anti-miR-19a/b (50 pmol each) were used. [score:2]
The roles of miR-19a/b in regulating MTUS1 in lung cancer cells. [score:2]
showed that cell proliferation was significantly increased in A549 cells transfected with pre-miR-19a/b, which confirmed the hypothesis that miR-19a/b function as oncogenic miRNAs; in contrast, miR-19a/b knockdown had the opposite effect on A549 cell proliferation (Fig.   4D and 4E). [score:2]
However, the molecular basis underlying the contributions of miR-19a/b to the development of lung cancer remains to be elucidated. [score:2]
During wound healing assay, more A549 cells migrated to the scratch in the cell monolayer when these cells were transfected with pre-miR-19a/b, while A549 cell mobility was significantly inhibited by anti-miR-19a/b transfection (Fig.   4F and 4G). [score:2]
In this study, we evaluated the expression patterns of miR-19a/b in lung cancer tissues and observed that the expression levels of both miR-19a and miR-19b were elevated in lung cancer tissues compared with those in paired normal adjacent tissues. [score:2]
Taken together, these results indicate that miR-19a/b may regulate the proliferation, migration, and invasion of lung cancer cells through a MTUS1 -dependent manner. [score:2]
To investigate whether the regulation of cell proliferation, migration, and invasion by miR-19a/b is executed through a MTUS1 -dependent manner, we co -transfected A549 cells with miR-19a/b mimic and the MTUS1-overexpression vector. [score:2]
MiR-19a/b were identified as candidate regulatory miRNAs of MTUS1 and were selected for further experimental verification. [score:2]
*, P < 0.05; **, P < 0.01; ***, P < 0.001 To investigate the cellular phenotypes triggered by miR-19a/b -mediated MTUS1 downregulation, A549 cells were transfected with either pre-miR-19a/b or anti-miR-19a/b and then analyzed regarding changes in cell proliferation and migration. [score:2]
Furthermore, we induced point mutations into the corresponding complementary sites in the MTUS1 3′-UTR to eliminate the predicted miR-19a/b binding sites. [score:2]
293T cells were co -transfected with firefly luciferase reporters containing either wild-type (WT) or mutant (Mut) miR-19a/b binding sites in the MTUS1 3′-UTR and pre-miR-control, pre-miR-19a/b, anti-miR-control, or anti-miR-19a/b. [score:1]
Figure 4 Effects of miR-19a/b on lung cancer cell proliferation and migration. [score:1]
We also showed that both miR-19a and miR-19b can function as promoters of lung cancer cell proliferation and migration. [score:1]
microRNA MTUS1 miR-19a/b lung cancer proliferation migration All over the world, lung cancer has been the leading cause of cancer-related death (Ramalingam et al., 1998). [score:1]
The inverse correlation between miR-19a/b levels and MTUS1 protein/mRNA levels was illustrated further using Pearson’s correlation scatter plots (Fig.   2C). [score:1]
To test binding specificity, the sequences that interact with the seed sequence of miR-19a/b were mutated (from TTGCAC to AACGTG), and the mutant MTUS1 3′-UTR was inserted into an equivalent luciferase reporter plasmid. [score:1]
MiR-19a/b belong to the same miRNA family and differ by only a single nucleotide at position 11. [score:1]
Equal amounts of pre-miR-19a (100 pmol), pre-miR-19b (100 pmol) or pre-miR-19a/b (50 pmol each) were transfected into A549 cells to overexpress miR-19a and/or miR-19b, respectively, and the reductions in MTUS1 levels were measured. [score:1]
As members of the miR-17-92 cluster, miR-19a and miR-19b (miR-19a/b) usually function as oncogenes in many types of cancer, including gastric cancer (Lu et al., 2015), pancreatic cancer (Wang et al., 2016), and breast cancer (Li et al., 2014b). [score:1]
The resulting plasmid was transfected into A549 cells along with a transfection control plasmid (β-gal) and pre-miR-19a/b, anti-miR-19a/b or scrambled negative control RNAs. [score:1]
Therefore, miR-19a/b and MTUS1 exerted opposing effects on cell migration. [score:1]
Detection of an inverse correlation between miR-19a/b and MTUS1 levels in lung cancer tissues. [score:1]
Figure 2 Inverse correlation between miR-19a/b and MTUS1 levels in lung cancer tissue samples. [score:1]
As anticipated, cellular miR-19a/b levels were significantly increased in A549, H1975, and HCC827 cells when these cells were transfected with pre-miR-19a/b, whereas miR-19a/b levels were significantly decreased when these cells were transfected with anti-miR-19a/b (Fig. S2A and S2B). [score:1]
These results suggest that miR-19a/b synergistically accelerate lung cancer cell proliferation. [score:1]
One overlapping hybrid between the MTUS1 3′-UTR and miR-19a or miR-19b was identified. [score:1]
The results are displayed as the ratio of firefly luciferase activity in miR-19a/b -transfected cells to that in control cells. [score:1]
One goal of this study was to determine whether miR-19a/b function individually or synergistically. [score:1]
In this study, miR-19a/b were shown to participate in cooperative MTUS1 repression. [score:1]
Likewise, co-treatment with anti-miR-19a and anti-miR-19b successfully decreased miR-19a/b levels (Fig. S2C and S2D). [score:1]
[1 to 20 of 71 sentences]
6
[+] score: 224
MiR-19a-3p/19b-3p directly targeted TGF-β Receptor IIIt is generally considered that miRNAs exert their function through regulating the expression of their downstream target genes. [score:8]
The protein of MMP-2 and MMP-9 in were decreased by miR-19a-3p/19b-3p, suggesting that miR-19a-3p/19b-3p suppresses the invasion ability of human cardiac fibroblasts through down-regulation of the expression of MMP-2/9 (Fig. 5e,f). [score:8]
To elucidate that miR-19a-3p/19b-3p is the important regulator of cardiac homeostasis and remo deling for potential therapeutic strategy for heart failure, we therefore demonstrated the miR-19a-3p/19b-3p inhibited the fibrosis through autophagy inhibition by targeting TGF-β R II in human cardiac fibroblasts (Figs 7 and 8). [score:8]
These results suggested that miR-19a-3p/19b-3p can directly and negatively regulate TGF-β R II gene expression and inhibit the TGF-β/Smad2 signaling transduction activated by TGF-β1. [score:7]
Herein we demonstrated that the cardiac-specific over -expression of miR-19a-3p/19b-3p resulted in inhibition of interstitial fibrosis, invasion potential, and epithelial mesenchymal transition (EMT) (Fig. 5). [score:5]
The sequence of 3′UTR of human TGFBR2 cDNA containing the putative target site for the miR-19a-3p/19b-3p; stark black body stands for the putative target site for miR-19a-3p/19b-3p: CTCTTCTGGGGCAGGCTGGGCCATGTCCAAAGAGGCTGCCCCTCTCACCAAAGAACAGAGGCAGCAGGAAGCTGCCCCTGAACTGATGCTTCCTGGAAAACCAAGGGGGTCACTCCCCTCCCTGTAAGCTGTGGGGATAAGCAGAAACAACAGCAGCAGGGAGTGGGTGACATAGAGCATTCTATGCCTTTGACATTGTCATAGGATAAGCTGTGTTAGCACTTCCTCAGGAAATGAGATTGATTTTTACAATAGCCAATAACA TTTGCACTTTATTAATGCCTGTATATAAATATGAATAGCTATGTTTTATATATATATATATATATCTATATATGTCTATAGCTCTATATATATAGCCATACCTTGAAAAGAGACAAGGAAAAACATCAAATATTCC The use of miR19a/19b mimicsThe miR-Ribo [TM] miR19a/19b mimics were chemically synthesized mature double stranded miRNA that could be ready to use (Guangzhou RiboBio Co. [score:5]
Here, we focused on the regulation of miR-19a-3p/19b-3p on the autophagy-related fibrosis in human cardiac fibroblasts and the mechanisms of regulation of its target genes. [score:5]
We found that over -expression of miR-19a-3p/19b-3p could significantly reduce TGF-β R II gene expression. [score:5]
As shown from the images in Fig. 5a,b, when the expression of miR-19a-3p/19b-3p was up-regulated by mimics in human cardiac fibroblasts, the cells demonstrated much low-migration potentiality compared to cells treated with miRNA Control. [score:5]
How to cite this article: Zou, M. et al. Autophagy inhibition of hsa-miR-19a-3p/19b-3p by targeting TGF-β R II during TGF-β1 -induced fibrogenesis in human cardiac fibroblasts. [score:5]
MiR-19a-3p/19b-3p prediction targetsTargetScan 7.0 human, miRDB, miRanda, Ingenuity Pathway Analysis were used to identify predicted miR-19a-3p/19b-3p targets. [score:5]
Furthermore, we confirmed and extended our previous discoveries, revealing that miR-19a-3p/19b-3p is a negative regulator of TGF-β1/Smad2 signaling via directly targeting TGF-β Receptor II (Fig. 6). [score:5]
The sequence of 3′UTR of human TGFBR2 cDNA containing the putative target site for the miR-19a-3p/19b-3p; stark black body stands for the putative target site for miR-19a-3p/19b-3p: CTCTTCTGGGGCAGGCTGGGCCATGTCCAAAGAGGCTGCCCCTCTCACCAAAGAACAGAGGCAGCAGGAAGCTGCCCCTGAACTGATGCTTCCTGGAAAACCAAGGGGGTCACTCCCCTCCCTGTAAGCTGTGGGGATAAGCAGAAACAACAGCAGCAGGGAGTGGGTGACATAGAGCATTCTATGCCTTTGACATTGTCATAGGATAAGCTGTGTTAGCACTTCCTCAGGAAATGAGATTGATTTTTACAATAGCCAATAACA TTTGCACTTTATTAATGCCTGTATATAAATATGAATAGCTATGTTTTATATATATATATATATATCTATATATGTCTATAGCTCTATATATATAGCCATACCTTGAAAAGAGACAAGGAAAAACATCAAATATTCC The miR-Ribo [TM] miR19a/19b mimics were chemically synthesized mature double stranded miRNA that could be ready to use (Guangzhou RiboBio Co. [score:5]
To further explore whether miR-19a-3p/19b-3p inhibited autophagy -mediated fibrosis induced by targeting TGF-β1, pharmacological induction of autophagy was applied. [score:5]
To further identify the miR-19a-3p/19b-3p putative target gene TGF-β R II that might be involved in autophagy-related fibrosis, transfection and Q-PCR analysis was conducted to determine the mechanism by which miR-19a-3p/19b-3p inhibited TGF-β Receptor II mRNA. [score:5]
As shown in Fig. 4a,b, the expression of miR-19a-3p/19b-3p was significantly down-regulated in HF plasma samples, P < 0.001 compared to Control group. [score:5]
We integrated Targetscan 7.0 predictions and the resulting candidate functions and found that the TGF-β R II gene had the highest recurrence rate as a potential target gene of miR-19a-3p/19b-3p. [score:5]
TargetScan 7.0 human, miRDB, miRanda, Ingenuity Pathway Analysis were used to identify predicted miR-19a-3p/19b-3p targets. [score:5]
To explore whether the TGF-β Receptor II was the target gene of the miR-19a-3p/19b-3p, we constructed the luciferase reporter vector with the putative TGF-β Receptor II 3′ UTR target site for the miR-19a-3p/19b-3p downstream of the luciferase gene (pGL3- TGF-β R II -3′-UTR). [score:5]
Therefore the down-regulation of TGF-β R II and phosphorylated form of Smad 2 and Smad 3 are modulated by miR-19a-3p/19b-3p. [score:4]
We validated that miR-19a-3p/19b-3p negatively regulates multiple players in autophagy and fibrosis and that TGF-β R II was one of miR-19a-3p/19b-3p targets was also validated in previous results. [score:4]
MiR-19a-3p/19b-3p decreases TGF-β1 induced autophagy-related fibrosisWe validated that miR-19a-3p/19b-3p negatively regulates multiple players in autophagy and fibrosis and that TGF-β R II was one of miR-19a-3p/19b-3p targets was also validated in previous results. [score:4]
We found that human TGFBR2 (TGF-β Receptor II) 3′-UTR contained putative miR-19a-3p/19b-3p complementary sites predicted using TargetScan 7.0 (http://www. [score:3]
The result showed that the expression of miR-19a-3p/19b-3p was negative correlation with the migration ability of human cardiac fibroblasts (Fig. 5c,d). [score:3]
MiR-19a-3p/19b-3p expresses with low levels in the plasma of HF patientsStudies of the last two years have shown that miRNA can be free outside the cells and stable in plasma or serum. [score:3]
show that expression of miRNA19a-3p/19b-3p is much low in HF patients (Fig. S1a,b). [score:3]
To determine whether autophagy activation rescued the inhibition effect of miR-19a-3p/19b-3p on autophagy-related fibrosis, rapamycin was applied for autophagy inducer. [score:3]
However, the over -expression of miR-19a-3p/19b-3p significantly reduced the level of the phosphorylated forms of Smad 2 and Akt (Fig. 6f,g). [score:3]
Furthermore, we detected the TGF-β/Smad2 signaling transduction undergoing the over -expression of miR-19a-3p/19b-3p. [score:3]
As is shown in Fig. 8d–f, rapamycin could further increase LC3-II level, synthesis of collagen type I α2 and fibronectin and expression of MMP-2 and MMP-9 in human cardiac fibroblasts with miR-19a-3p/19b-3p and TGF-β1. [score:3]
We next determined whether the expression of autophagy and fibrosis related proteins would be modulated by miR-19a-3p/19b-3p. [score:3]
Our data show that the phosphorylated activated form of Smad 2 and Smad 3 after miR-19a-3p/19b-3p over -expression. [score:3]
Consistently, the increased synthesis of collagen type Iα2 and fibronectin and expression of MMP-2 and MMP-9 induced by TGF-β1 were also significantly restored by miR-19a-3p/19b-3p (Fig. 8a,c). [score:3]
To investigate the target of miR-19a-3p/19b-3p in human cardiac fibroblasts, systemic bioinformatic publicly available algorithms were used to analyze and identify potential targets. [score:3]
Q-PCR was used to analyze the expression of miR-19a-3p/19b-3p when treated with mimics and nonspecific miRNA Control. [score:3]
MiR-19a-3p/19b-3p directly targets TGF-β Receptor II. [score:3]
These results showed that TGF-β R II was the target gene of the miR-19a-3p/19b-3p (Fig. 6b). [score:3]
MiR-19a-3p/19b-3p directly targeted TGF-β Receptor II. [score:3]
The miR-19a-3p/19b-3p expression is specifically decreased in patients with DCM, especially in the end stage of DCM (Fig. 4). [score:3]
The 3′UTR of human TGF-β R II cDNA containing the putative target site for the miR-19a-3p/19b-3p (sequence shown in Supplementary data) was chemically synthesized and inserted at the XbaI site, immediately downstream of the luciferase gene in the pGL3-control vector (Promega, Madison, WI) by Integrated Biotech Solutions Co. [score:3]
MiR-19a-3p/19b-3p negatively regulates multiple players in fibrosisTo investigate whether the differential expression of miR-19a-3p/19b-3p was correlated with cell invasion, human cardiac fibroblasts were transfected with miR-19a-3p/19b-3p mimics and nonspecific miRNA Control. [score:2]
MiR-19a-3p/19b-3p expresses with low levels in the plasma of HF patients. [score:2]
We examined miR-19a-3p/19b-3p expression in human cardiac tissues and human cardiac fibroblasts by Q-PCR assay, as previously described. [score:2]
MiR-19a-3p/19b-3p prediction targets. [score:2]
To further examine whether miR-19a-3p/19b-3p would inhibit EMT, consistent with metastasis ability, after transient transfection with miR-19a-3p/19b-3p mimics in human cardiac fibroblasts, both vimentin and α-SMA mRNA levels were decreased compared to miRNA Control group (Fig. 5e,f). [score:2]
In summary, miR-19a-3p/19b-3p was important in regulating reorganization of actin cytoskeleton and the maintenance of cell morphology. [score:2]
MiR-19a-3p/19b-3p mimic treatment was not associated with any significant changes in TGF-β Receptor I expression. [score:2]
revealed that the protein level of TGF-β Receptor II but not TGF-β Receptor I was markedly reduced in the cells over -expressing miR-19a-3p/19b-3p compared to the non transfected cells (Fig. 6d,e). [score:2]
MiR-19a-3p/19b-3p expresses with low levels in heart failure patients. [score:2]
MiR-19a-3p/19b-3p decreases expression of autophagy-related fibrosis members induced by TGF-β1. [score:2]
Taken together, these results demonstrated that autophagy mediated the regulation of miR-19a-3p/19b-3p on fibrosis in human cardiac fibroblasts. [score:2]
Figure 6c indicates that transfection of human cardiac fibroblasts from controls with miR-19a-3p/19b-3p mimics induced significant decrease in TGF-β Receptor II mRNA expression levels compared to miRNA Control transfection. [score:2]
It was shown in Fig. 7 that we got an expected inhibition effect after transfected with miR-19a-3p/19b-3p for 72 h. The invasion potential of human cardiac fibroblasts was examined by transwell invasion assay with co-treatment of miR-19a-3p/19b-3p mimics and TGF-β1 (10 ng/ml). [score:2]
MiR-19a-3p/19b-3p modulation did not affect the expression of total Smad 2/3 and Akt. [score:2]
200 ng of pGL3- TGF-β R II-3′-UTR plus 80 ng pRL-TK (Promega) were transfected in combination with 50 nM of the miR-19a-3p/19b-3p mimics or miRNA mimic control using Lipofectamine [TM] 2000 reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol, respectively. [score:1]
For quantification of TGF-β R II transcripts, Q-PCR was carried out with total RNA samples extracted from human cardiac fibroblasts after miR-19a-3p/19b-3p mimics transfection. [score:1]
Variations in expression of miR-19a-3p/19b-3p between different RNA samples from cells or plasma were calculated after normalization to U6 or ath-miR-156a, respectively 50. [score:1]
Cells were transiently transfected with miR-19a-3p/19b-3p mimics, BECN1 siRNA, pCMV-myc-Atg5 plasmid using Lipofectamine [TM] 2000 reagent (Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions 49. [score:1]
In HCF, significant decrease in relative luciferase activity was noted when pGL3- TGF-β R II -3′-UTR was cotransfected with the miR-19a-3p/19b-3p mimics but not with the miRNA mimic control, respectively. [score:1]
The results showed that miR-19a-3p/19b-3p reduced the accumulation of both the yellow and red puncta induced by TGF-β1 (Fig. 7e). [score:1]
The migratory cell numbers of human cardiac fibroblasts transfected with miR-19a-3p/19b-3p mimics were significantly more than that of cells transfected with miR Control respectively. [score:1]
Luciferase reporter vector together with the miR-19a-3p/19b-3p mimics or the miRNA mimic control were transfected into HCF, respectively. [score:1]
MiR-19a-3p/19b-3p regulates human cardiac fibroblasts autophagy -mediated fibrosis induced by TGF-β1. [score:1]
To probe the possible anti-invasion mechanism of miR-19a-3p/19b-3p, we tested the activity protein of MMP-2/9 in miR-19a-3p/19b-3p -transfected human cardiac fibroblasts. [score:1]
Human cardiac fibroblasts were transfected with miR-19a-3p/19b-3p mimics, miR Control. [score:1]
Human cardiac fibroblasts were transfected with miR-19a-3p/19b-3p and miR Control. [score:1]
The nucleotide sequences of miR-19a-3p/19b-3p are available in the GenBank database with the accession numbers of LM378760.1, LM378761.1. [score:1]
Among them, the decreasing ratio of miRNA-19a/b is the most distinct 48. [score:1]
In HCF cells, significant decrease in relative luciferase activity was noted when pGL3- TGF-β R II -3′-UTR was cotransfected with the miR-19a-3p/19b-3p mimics but not with the miRNA mimic control, respectively. [score:1]
The conversion from LC3-Ito LC3-II and degradation of p62/SQSTM1 induced by TGF-β1 were significantly restored by miR-19a-3p/19b-3p (Fig. 8a,b). [score:1]
It was shown in Fig. 7c,d, the autophagy induction of TGF-β1 was significantly reduced by miR-19a-3p/19b-3p mimics (16.8% to 2.37% and 2.99%). [score:1]
Human cardiac fibroblasts were pre -transfected with miR-19a-3p/19b-3p and miR Control. [score:1]
Human cardiac fibroblasts were pro -transfected with miR-19a-3p/19b-3p and then treated with 10 ng/ml TGF-β1. [score:1]
MiR-19a-3p/19b-3p negatively regulates multiple players in fibrosis. [score:1]
The use of miR19a/19b mimics. [score:1]
The experiments were normalized with GAPDH at baseline level and after pro-transfection with miR-19a-3p/19b-3p mimics, miR Control and stimulation with TGF-β1 (10 ng/ml) for 72 hours. [score:1]
To investigate whether the differential expression of miR-19a-3p/19b-3p was correlated with cell invasion, human cardiac fibroblasts were transfected with miR-19a-3p/19b-3p mimics and nonspecific miRNA Control. [score:1]
For miRNA miR19a/19b mimics transfection, the optimal concentration for human cardiac fibroblasts was 50 nM. [score:1]
[1 to 20 of 78 sentences]
7
[+] score: 222
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-200c
Together, miR-19a was up-regulated in CRC tissues compared with adjacent normal tissues and its overexpression was associated with lymph node metastasis, suggesting that its up-regulation was acquired in the course of tumor progression and in particular, during the acquisition of metastatic potential. [score:8]
We found that miR-19a was frequently up-regulated in CRC tissues, high expression of miR-19a was associated with lymph node metastasis, and miR-19a overexpression promoted invasion of human CRC cell lines. [score:8]
We found that miR-19a was frequently up-regulated in CRC tissues and a high expression of miR-19a was associated with lymph node metastasis. [score:6]
Although E-cadherin levels did not change, miR-19a inhibition dramatically attenuated TNF-α -induced up-regulation of N-cadherin, Fibronectin and Vimentin (Fig. 5A). [score:6]
Current evidences suggest several roles of miRNA, including enhancement of colony formation, influence of therapeutic induced cell apoptosis, alternation of drug resistance-related proteins, and promotion of angiogenesis and tumor stem-like cells, however, the mechanisms of miRNA-regulated tumor progression are still largely unknown Here, we showed that overexpression of miR-19a promoted invasion of colon cancer cells, consistent with the findings of Zhang et al. 16, which revealed that overexpressing miR-19a exhibited significantly enhanced invasive ability. [score:6]
Further results showed that miR-19a inhibition attenuated TNF-α -induced up-regulation of mesenchymal protein and invasion. [score:6]
Analysis using the X-tile software revealed that 0.22 was the optimal cut-point that separated patients into a group with miR-19a lower expression and group with miR-19a higher expression. [score:5]
Overexpression of miR-19a promoted CRC cells progression in vitroHigher miR-19a expression was associated with lymph node metastasis, suggested that miR-19a may affect invasion of human CRC. [score:5]
We demonstrated that miR-19a expression correlated with reduced E-cadherin and increased N-cadherin, Vimentin and Fibronectin expression in CRC cells. [score:5]
In our study, miR-19a was consistently up-regulated after TNF-α treatment, whereas TNF-α is negatively regulated by miR-19a. [score:5]
Ectopic miR-19a expression decreased the expression of TNF-α in both HCT 116 and Caco-2 cells (Supplementary Fig. S4). [score:5]
In addition, we also found that miR-19a was up-regulated by TNF-α and miR-19a was required for TNF-α -induced EMT in CRC cells. [score:4]
Interestingly, our results showed that miR-19a was up-regulated in CRC patients presenting lymph node metastasis. [score:4]
In this patient subpopulation, miR-19a was consistently up-regulated in rectal cancer patients presenting lymph node metastasis, supporting the results obtained in our study. [score:4]
Subsequent analysis indicated that miR-19a was consistently up-regulated after TNF-α treatment. [score:4]
Considering, TNF-α has been reported previously to be a miR-19a gene target in ESCC 34 and ulcerative colitis 35, we had conducted the western blot assay to determine whether TNF-α would be a target in CRC cells. [score:4]
Furthermore, we demonstrated that over -expression of miR-19a significant promoted tumorsphere growth, colony formation and drug resistance. [score:3]
Overexpression of miR-19a promoted invasion (P < 0.05). [score:3]
Increased expression of miR-19a in cells following infection was confirmed by Real-Time PCR (Fig. 2A). [score:3]
TNF-α treatment resulted in a significant increase in miR-19a expression (Fig. 5C). [score:3]
Overexpression of miR-19a enhanced invasion in CRC cells. [score:3]
As shown in Fig. 2B, ectopic miR-19a expression significantly enhanced the invasive ability of HCT 116 and Caco-2 cells (P < 0.05). [score:3]
In each experiment, the extent of miR-19a expression was assessed by Real-Time PCR. [score:3]
Caco-2 cells expressing miR-19a formed significantly more colonies than scramble control (P = 0.0166, Fig. 3B). [score:3]
Higher miR-19a expression was associated with lymph node metastasis, suggested that miR-19a may affect invasion of human CRC. [score:3]
As shown in Table 1, the expression of miR-19a was correlated with lymph node metastasis (P = 0.018) and TNM stage (P = 0.008). [score:3]
Taqman RT-PCR was used to assess the expression of miR-19a in 11 pairs of CRC and adjacent non-tumorous tissues. [score:3]
This finding is consistent with clinical observations, which revealed that miR-19a was higher expression in cancer with lymph node metastasis than those without lymph node metastasis. [score:3]
High levels of miR-19a expression were associated with regional lymph node metastasis in CRC. [score:3]
The HCT 116 cells transfected with miR-19a inhibitor reversed TNF-α effect on cell invasion. [score:3]
Correlation between miR-19a expression and clinical parameters in 275 CRC patients. [score:3]
In our study, miR-19a was consistently up-regulated in CRC tissues compared with adjacent normal tissues. [score:3]
The HCT 116 and Caco-2 cells transfected with miR-19a inhibitor reversed TNF-α effect on EMT transition (The full-length blots were presented in the supplementary Figure S5). [score:3]
The result showed that miR-19a was significantly up-regulated in tumor tissue compared with the corresponding normal tissues (P = 0.008, Fig. 1A). [score:3]
However, miR-19a expression was correlated with lymph node metastasis in rectal cancer (P = 0.004, Table S6). [score:3]
Overexpression of miR-19a promoted CRC cells progression in vitro. [score:3]
In colon cancer, miR-19a expression was not significantly associated with lymph node metastasis (P = 0.302, Table S5). [score:3]
HCT 116 cells were treated with TNF-α for 72 hours, miR-19a expression was examined by Real-Time PCR. [score:3]
Consistent with these results, invasion analysis showed that miR-19a inhibition attenuated TNF-α -induced invasion (Fig. 5B). [score:3]
On the other hand, Zhang et al. reported that the expression level of miR-19a had no difference in 13 cases of CRC with distant metastasis 16. [score:3]
In our study, we discovered that the levels of the epithelial markers, E-cadherin, decreased and 3 mesenchymal markers (N-cadherin, Vimentin, and Fibronectin) increased in CRC cells after over -expression of miR-19a. [score:3]
Overexpression of miR-19a facilitated cell survival after treating with 5-Fluorouracil (5-Fu) as expected (Fig. 3C). [score:3]
The CRC tissues expressed significantly higher levels of miR-19a than the adjacent normal tissues (P = 0.008), the median (lower quartile, upper quartile) of tumor and adjacent normal tissues group were 0.91 (0.33, 1.27) and 0.38 (0.34, 0.46) respectively. [score:3]
Overexpression of miR-19a induced EMT in CRC cell lines. [score:3]
Transfection with anti-miR-19a inhibited CRC cells invasion (P = 0.0001). [score:3]
Kaplan-Meier curve and log-rank test showed that miR-19a expression wasn’t associated with survival (P = 0.171, Table 2, Supplementary Fig. S2). [score:3]
Overexpression miR-19a in both HCT 116 and Caco-2 cells decreased the levels of the epithelial markers, E-cadherin, whereas increased the mesenchymal markers, vimentin, N-cadherin or Fibronectin. [score:3]
The expression of epithelial and mesenchymal markers were detected by western blot analysis and N-cadherin, Vimentin or Fibronectin, was found to decrease in the presence of anti-miR-19a compared to controls in CRC cell lines (Fig. 5A). [score:2]
MiR-19a expression levels in CRC with lymph node metastases (n = 112) were significantly higher than in CRC without lymph node metastasis (n = 156, P = 0.034), the mean ± standard deviation of N0 and N1 + N2 group were 0.13 ± 0.12 and 0.16 ± 0.14 respectively. [score:2]
MiR-19a was up-regulated in rectal cancer patients with lymph node metastasis compared to those without metastasis (Fig. 1C). [score:2]
MiR-19a expression index was equaled the quotient between the IOD and the total area of AOI. [score:2]
MiR-19a mimics, inhibitor or negative control were transfected in the different CRC cell lines using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s recommendations. [score:2]
MiR-19a expression levels in CRC specimens. [score:2]
Expression of mature miR-19a was analyzed using the TaqMan miRNA Assay (Applied Biosystems Inc. [score:2]
MiR-19a was up-regulated in rectal cancer patients with lymph node metastasis (n = 50) compared to those without metastasis (n = 40, P = 0.004), the median (lower quartile, upper quartile) of N0 and N1 + N2 group were 27.40 (19.61, 42.09) and 39.16 (25.01, 51.57) respectively. [score:2]
Compared with negative control, miR-19a inhibition abrogated the abilities of TNF-α to induce spindle-like morphological features (Supplementary Fig. S3). [score:2]
To better understand the relationship between miR-19a and TNF-α -mediated EMT, HCT 116 cells were transfected with anti-miR-19a oligo or negative control for 24 hours, and then treated with 10 ng/ml TNF-α for 48 hours. [score:1]
We also showed that miR-19a was essential for TNF-α -mediated EMT in CRC cells. [score:1]
Cells transfected with miR-19a displayed resistance to 5-FU. [score:1]
s were performed to determine the effects of miR-19a on invasive capacity of CRC cells. [score:1]
How to cite this article: Huang, L. et al. Hsa-miR-19a is associated with lymph metastasis and mediates the TNF-a induced epithelial-to-mesenchymal transition in colorectal cancer. [score:1]
In situ hybridization (ISH) was performed using a miRNA-19a probe from Exiqon (miRCURY LNA™ Detection probe, 250 pmol, 5′-DIG labeled). [score:1]
We then analyzed miR-19a lymph node metastasis signature in an external validation set. [score:1]
To further investigate the clinical pathology and prognostic significance of miR-19a expression in CRC patients, levels of miR-19a were quantified in a cohort of 275 formalin-fixed, paraffin-embedded CRC samples using in situ hybridization. [score:1]
The correlations between miR-19a expression levels and the potential factors in CRC patients were evaluated by performing Chi-square Test. [score:1]
HCT 116 and Caco-2 cells were infected with either pGV-miR-19a or pGV-miR-NC in the presence of 5 μg/ml polybrene for 12 hours, and the medium was refreshed. [score:1]
To better understand whether miR-19a is involved in this progression, epithelial and mesenchymal markers were assessed by western blot analysis of miR-19a mimics and control transfected CRC cells. [score:1]
Our present study next focused on the potential relationship between the expression of miR-19a and various clinicopathological characteristics, particularly lymph node metastasis. [score:1]
This suggested that miR-19a was essential for TNF-α -mediated EMT and provided mechanistic insight into the role of miR-19a in mediating some of the TNF-α mediated EMT activity. [score:1]
Taken together, these results indicate that miR-19a could serve as a potential biomarker of lymph node metastasis in CRC. [score:1]
The results suggested that miR-19a induced EMT in colon cancer cells. [score:1]
In situ hybridization In situ hybridization (ISH) was performed using a miRNA-19a probe from Exiqon (miRCURY LNA™ Detection probe, 250 pmol, 5′-DIG labeled). [score:1]
To determine the role of miR-19a in CRC cells, HCT 116 and Caco-2 cells were stably infected with the miR-19a lentiviral vector or scramble control lentiviral vector. [score:1]
pGV254-miR-19a, pHelper 1.0 and pHelper 2.0 cotransfections were using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction. [score:1]
The results suggested that miR-19a can induce EMT in CRC cell lines. [score:1]
EMT has also been shown to promote stem-like cancer cells that may endow tumor initiating cells with traits necessary for metastasis formation 30 31, which provides a possible explanation for miR-19a function of tumorsphere growth, colony formation and drug resistance. [score:1]
We also performed the association study to evaluate the correlation of miR-19a expression with the metastatic potential using the TCGA data portal. [score:1]
In conclusion, our findings demonstrated a potential role of miR-19a in CRC lymph node metastasis. [score:1]
The results showed that high levels of miR-19a were significantly correlated with TNM stage, which is similar to the findings in bladder cancer and gastric cancer 26 27. [score:1]
MiR-19a precursor sequences was amplified from human genomic DNA and cloned into the AgeI and EcoRI site of the lentiviral vector GV254 (Genchem) (pGV-miR-19a). [score:1]
Taken together, these observations demonstrated that miR-19a is essential for TNF-α -mediated EMT in HCT 116 cells. [score:1]
Altogether, the relationship between TNF-α and miR-19a should be further elucidated. [score:1]
[1 to 20 of 82 sentences]
8
[+] score: 171
Other miRNAs from this paper: mmu-mir-19a
Significantly, forced -expression of miR-19a-3p downregulated SphK2 and efficiently inhibited U2OS cell growth. [score:8]
When analyzing tumor tissue lysates, we showed that SphK2 expression was indeed downregulated in tumors expressing SphK2-shRNA or miR-19a-3p (Figure 6D, two sets). [score:8]
Additionally, the SphK2 mRNA 3′-UTR luciferase activity was also largely inhibited in miR-19a -expressing U2OS cells, indicating that SphK2 should be the direct target of miR-19a. [score:8]
Introduction of miR-19a -mimic significantly increased miR-19a-3p expression (Supplementary Figure 2A), which downregulated SphK2 protein and mRNA (Supplementary Figure 2B), causing growth inhibition (Supplementary Figure 2C) and cell apoptosis ((Supplementary Figure 2D). [score:8]
Thus, expression of miR-19a-3p downregulates SphK2 and inhibits OS cell growth. [score:8]
Remarkably, SphK2 mRNA and protein were both significantly downregulated after expressing miR-19a (Figure 4C). [score:6]
Figure 5Downregulation of miR-19a-3p in human OS tissues and cellsRelative miR-19a-3p expression (vs. [score:6]
These results suggest that knockdown of SphK2, by targeted-shRNA or miR-19a-3p, inhibited U2OS tumor growth in nude mice. [score:6]
Thus, forced -expression of miR-19a-3p downregulated SphK2 in U2OS cells. [score:6]
As demonstrated, miR-19a-3p putatively targets the 3′ UTR (untranslated region) of SphK2 mRNA (Figure 4A). [score:5]
Fourth, SphK2 silence, by targeted-shRNA or miR-19a-3p, dramatically inhibited U2OS tumor growth in nude mice. [score:5]
Expression of microRNA-19a silences SphK2 and inhibits OS cell growth. [score:5]
Third, forced -expression of miR-19a-3p, the potential anti-SphK2 miRNA, silenced SphK2 and inhibited U2OS cell growth. [score:5]
It is therefore possible that miR-19a-3p downregulation is the cause of SphK2 upregulation in human OS cells, although this hypothesis warrants further investigations. [score:5]
More importantly, miR-19a-3p level was decreased in the OS tissues/cells, corresponding to SphK2 upregulation. [score:4]
Downregulation of miR-19a-3p in human OS tissues and cells. [score:4]
Further studies showed that U2OS cell growth, tested by cell counting assay, was also inhibited after stably expressing miR-19a-3p (Figure 4E). [score:4]
These results confirmed miR-19a-3p downregulation in human OS tissues and cells. [score:4]
Downregulation of miR-19a-3p in human OS tissues and cells. [score:4]
The volumes of tumor expressing SphK2-shRNA or miR-19a-3p were much lower than the control tumors (Figure 6A). [score:3]
Via search the “TargetScan” database, we discovered one potential anti-SphK2 microRNA: microRNA-19a-3p (“ miR-19a-3p”). [score:3]
In the miR-19a -expressing cells, Histone DNA ELISA OD (Figure 4F) and TUNEL percentage (Figure 4G) were both increased. [score:3]
Furthermore, expression a single miRNA, miR-19a for example, could exhibit reverse activities under different contexts [55– 57]. [score:3]
Results in Figure 6B confirmed that SphK2-shRNA- or miR-19a-3p -expressing tumors were dramatically lighter than the control tumors. [score:3]
Parental U2OS cells (“Par”), as well as cells stably expressing SphK2-shRNA (“L1”) or miR-19a-3p (“L1”), were injected s. c. to the nude mice; Estimated tumor volume (A) and mice body weight (deducting tumor weight, C) were recorded weekly for total six weeks. [score:3]
Relative miR-19a-3p expression (vs. [score:3]
Estimated tumor growth curve results in Figure 6A demonstrated that U2OS tumors expressing SphK2-shRNA or miR-19a-3p grew significantly slower than the control tumors (from parental cells). [score:3]
It should be noted that the same miRNA (miR-19a-3p in our study) might have other target proteins and exert different and sometimes contradictory functions in cancer progression [54]. [score:3]
One novel finding of this study is that miR-19a-3p could be the specific SphK2 -targeting miRNA. [score:3]
Next, miR-19a -mimic oligonucleotides were transfected to U2OS cells, and stable cells (three lines, “L1-L3”) expressing miR-19a were established. [score:3]
Figure 6Parental U2OS cells (“Par”), as well as cells stably expressing SphK2-shRNA (“L1”) or miR-19a-3p (“L1”), were injected s. c. to the nude mice; Estimated tumor volume (A) and mice body weight (deducting tumor weight, C) were recorded weekly for total six weeks. [score:3]
Expression of miR-19a-3p in the above-mentioned human OS tissues (See Figure 1) was also tested. [score:3]
miR-19a-3p putatively targets the 3′ UTR of SphK2 mRNA (A). [score:3]
miR-19a-3p putatively targets the 3′UTR of SphK2 mRNA. [score:3]
Parental U2OS cells, as well as cells stably expressing SphK2-shRNA or miR-19a-3p, were injected s. c. to the nude mice. [score:3]
Expression of miR-19a-3p in the stable OS cells was tested by the qRT-PCR assay. [score:2]
miR-19a-3p expression was tested via the TaqMan microRNA assay (Applied Biosystems, Shanghai, China), from 5 ng of total RNA [63]. [score:2]
U2OS/MG-63 cells were transfected with 20 nM of miR-19a mimic oligonucleotides (Ambion, Shanghai, China) by Lipofectamine 2000 (Invitrogen). [score:1]
After two days, cells were split and were transfected with miR-19a mimic again. [score:1]
The reporter vector with the 3′-UTR of SphK2 carrying a putative miR-19a-3p binding site (Position 493-499) was designed, constructed, sequence-verified by Genepharm (Shanghai, China). [score:1]
Expression of miR-19a-3p (B) and SphK2 (protein and mRNA, C), as well as the relative SphK2 mRNA 3′-UTR luciferase activity (D) in the stable USO2 cells with miR-19a -mimic (three lines, “L1-L3”) or miR-control (“miR-C”), and in the parental control cells (“Par”) were shown; Cells were also subjected to the cell counting assay (E) and the listed apoptosis assays (F and G). [score:1]
Female nude mice (6-8 weeks age, 17.5-18.8 g weight) were subcutaneously (s. c. ) inoculated with 5 × 10 [6] U2OS cells (in 0.2 mL DMEM/10% FBS), with/out SphK2-shRNA or miR-19a-3p, into the right flanks. [score:1]
On the other hand, apoptosis level was increased in the stable cells with miR-19a-3p (Figure 4F and 4G). [score:1]
miR-19a transfection. [score:1]
The construct was transfected together with the miR-19a mimic to U2OS cells. [score:1]
Therefore, it will be interesting to further understand the functional complexity of miR-19a, and to verify it as a potential anti-OS miRNA. [score:1]
Further, miR-19a-3p level in all four lines of human OS cells (MG63, SaOs2, G293 and U2OS) was also lower than that in the osteoblastic cells (OB-6 and hFOB1.19 lines) (Figure 5B). [score:1]
[1 to 20 of 47 sentences]
9
[+] score: 120
Moreover, by comparing the miR19a target gene panel and the mRNA profiling data from the lncRNA+ mRNA human gene expression microarray analysis, we found that ARHGAP11A was significantly upregulated in metastatic HCC tissue samples and was predicted to be a target gene of miR19a (Fig. 4a). [score:10]
To test this hypothesis, we first demonstrated that miR19a was repressed or induced by HOXD-AS1 overexpression or knockdown (Fig. 4b and c), respectively, and that the expression levels of ARHGAP11A were downregulated by miR19a mimic treatment as well (Fig. 4d). [score:9]
However, a recent clinical study of 165 HCC patients revealed a differential role for miR-19a in cancer metastasis/recurrence in which miR19a was significantly downregulated in recurrent HCCs, and the miR19a downregulation was correlated with patient survival with a hazard ratio of 0.724, suggesting that miR19a is an anti-oncogene in HCC metastasis/recurrence [25]. [score:7]
Since miR19a inhibitor treatment did not show anti-apoptotic effect (Additional file 1: Figure S4a and b), we presumed that the anti-apoptotic effect of HOXD-AS1 was not induced by miR19a inhibition when HOXD-AS1 was overexpressed. [score:7]
Therefore, our investigation provides a possible explanation for miR19a downregulation contributing to liver cancer progression, specifically the upregulation of the miR19a target gene, ARHGAP11A (Fig. 4). [score:7]
Therefore, HOXD-AS1 could act as a ceRNA via its miR19a binding site and could upregulate the expression of ARHGAP11A in HCC cells. [score:6]
Additionally, ectopic expression of miR-19a abrogated the upregulating effects of HOXD-AS1 (wt) on the ARHGAP11A 3′-UTR (wt) containing luciferase activity (Fig. 4h). [score:6]
Student’s t test, * p < 0.05, ** p < 0.01, *** p < 0.001 Because HOXD-AS1 was able to upregulate ARHGAP11A expression in vitro, we next asked whether the miR19a/ARHGAP11A axis contributes to HOXD-AS1 -mediated cancer cell metastasis. [score:6]
Consistently, our data revealed that downregulation of miR19a expression correlated well with higher tumor stage (p = 0.0023) and PVTT tumor invasion (p = 0.0448) (Additional file 1: Table S4). [score:6]
Our data indicated that HOXD-AS1 could also function as a ceRNA by “sponging” miR19a, and that it could increase the expression levels of the miR19a target gene, ARHGAP11A (Fig. 4). [score:5]
Moreover, we identified that HOXD-AS1 upregulated the Rho GTPase activating protein 11A (ARHGAP11A) by competitively binding to microRNA-19a (miR19a), resulting in induced metastasis. [score:4]
The expression levels of miR19a were correlated with patient survival with a hazard ratio of 0.724 (p = 0.02) [25]. [score:3]
This anti-metastatic effect of miR19a was in accordance with a previous report by Han and his colleagues showing that miR19a was significantly downregulated in a group of HCC samples from patients who developed recurrent liver cancer compared to those with non-recurrence. [score:3]
Notably, ectopic expression of miR19a strongly decreased cell migration by over 2-fold (Fig. 5a and b, p<0.01). [score:3]
HOXD-AS1 upregulated ARHGAP11A by competitively binding Mir-19a. [score:3]
To confirm the regulatory relationship between miR-19a and ARHGAP11A, miR-19a mimics, mimic NC, pcDNA3.1-HOXD-AS1, pcDNA3.1-HOXD-AS1-mut (miR-19a binding site mutation) or empty vectors were transfected into HCCLM3 cells. [score:3]
Fig. 4HOXD-AS1 interacts with miR-19a and controls ARHGAP11A expression levels. [score:3]
Wang F, Li T, Zhang B, Li H, Wu Q, Yang L, et al. MicroRNA-19a/b regulates multidrug resistance in human gastric cancer cells by targeting PTEN. [score:3]
cn/), we found that HOXD-AS1 has one predicted miR19a target binding site (Fig. 4a) [23, 24]. [score:3]
a The prediction for miR-19a binding sites on the HOXD-AS1 transcript and the potential target gene ARHGAP11A. [score:3]
Indeed, aberrant expression of mir19a, a possible oncogene belonging to the miR-17-92 cluster, was previously reported in multiple cancers, such as lung, colon and gastric cancers [29– 31]. [score:3]
e Schematic outlining the predicted binding sites and mutation site of miR19a on HOXD-AS1 and the ARHGAP11A transcript. [score:2]
More importantly, the discovery of the HOXD-AS1/miR19a/ARHGAP11A signaling axis has provided new knowledge for understanding the molecular basis of liver cancer and for the development of new diagnostic and therapeutic strategies. [score:2]
We only noticed the decrease of miR19a in a number of cancer tissues compared to the adjacent non-cancerous tissues in the metastatic group (Additional file 1: Figure S4 c-e); however, the differences in gene expression were not significant. [score:2]
Biological roles of miR-19a in liver cancer. [score:1]
f Luciferase activity in HCCLM3 cells cotransfected with miR-19a and empty luciferase reporter or vectors containing the wildtype (luc wt) 3'-UTR region of the ARHGAP11A transcript or mutant (luc wt) transcript. [score:1]
Human hepatocellular carcinoma HOXD-AS1 ARHGAP11A miR19a lncRNA Hepatocellular carcinoma (HCC) is the sixth most prevalent cancer and one of the leading causes of cancer-related death in both men and woman. [score:1]
Second, the 3′-UTR region of ARHGAP11A was inserted into a luciferase reporter system containing wild-type (wt) or mutated miR19a binding sites (Fig. 4e). [score:1]
The miR-19a binding site in the luc vector was mutated to generate the luc mutant vector. [score:1]
Zhang J, Xiao Z, Lai D, Sun J, He C, Chu Z, et al. miR-21, miR-17 and miR-19a induced by phosphatase of regenerating liver-3 promote the proliferation and metastasis of colon cancer. [score:1]
Third, we also constructed a pcDNA3.1-HOXD-AS1-mut vector, in which the “sponging” sites for miR19a were mutated. [score:1]
We hypothesized that HOXD-AS1 functions as a competing endogenous RNA (ceRNA) by “sponging” miR19a during HCC metastasis/recurrence. [score:1]
Future studies with a larger sample size will be helpful in clarifying the biological significance of miR19a in HCC metastasis and progression. [score:1]
The 3′-UTR region of the Rho GTPase activating protein 11A (ARHGAP11A), which contains the miR-19a response element, was cloned into the pGL4.13 luciferase reporter vector to generate the luc vector. [score:1]
Correlation between miR-19a expression and clinicalpathological characteristics. [score:1]
[1 to 20 of 35 sentences]
10
[+] score: 112
With miR-19a mimic transfectants (A) 46 of the 53 miRNAs exhibited significantly decreased expression, miR-19a, miR-19b, and miR-20b being among the seven mirNA with significantly increased expression. [score:5]
MicroRNA-19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells. [score:4]
MiRNAs with significantly altered expression following transfection with mimics for miR-19a, miR-20b or miR-363-5p on miRNA were identified using human deoxyoligonucleotide microarrays for miRNA (OneArray® Microarray v2). [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
For cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p (Figure 3) differentially expressed miRNAs yielded highly significant associations to, e. g., “Cell Cycle,” “Cell Death,” and “Cellular Growth and Proliferation” (Figure 5). [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Results presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
Figure 8 Levels of expression of the microRNAs encoded by the miR-106a-363 cluster in cultured, human squamous carcinoma cells (E10) following transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
The heat-map presented in Figure 3 resulted from hierarchical clustering of 53, 43, 61 and 29 miRNAs found differentially expressed (p ≤ 0.05) in E10 cells transfected with mimic for miR-19a (A), miR-20b (B), miR-92a (C), or miR-363-5p - (D), respectively. [score:3]
Whether the distinct populations of differentially expressed miRNAs found in transfectants for miR-19a -, miR-20b -, or miR-363-5p mimic (Figure 3) reflect different ant-proliferative mechanisms remains to be established. [score:3]
Although transfectants for both miR-19a -and miR-20b -mimic exhibited diminished proliferation expression of only a few sibling miRNAs were now significantly changed, but in a manner conducive to diminished proliferation. [score:3]
Figure 6 Levels of expression of the microRNAs encoded by the miR-17-92 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
In cells transfected with miR-19a -, miR-20b -, or miR-92a mimic, the primary transcripts exhibited significantly increased levels of expression (Figure 9). [score:3]
As expected, high levels of expression of miR-19a/miR-19b, or miR-20b, or miR-363-5p were found in cells transfected with mimic for miR-19a, or miR-20b - or miR-363-5p, respectively. [score:3]
Figure 7 Levels of expression of the microRNAs encoded by the miR-106b-25 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
In cells transfected with miR-19a - or miR-92a mimic no systematic changes in expression of miRNAs was apparent (Figures 7B,D). [score:3]
Likewise, the more potent anti-proliferative miR-20b decreased expression miR-19a and miR-93 (Figures 6C, 7C) as well as increasing the level of miR-106a by about 60% (Figure 8C); changes consistent with an anti-proliferative effect (Qin et al., 2010; Fang et al., 2011). [score:3]
Profiling of miRNAs which were differentially expressed in E10 cells transfected with miR-19a-, miR-20b-, miR-92a-, or miR-363-5p mimic. [score:3]
One single mirNA, miR-423-5p, was found differentially expressed (decreased by about 50%) in transfectants for either miR-19a -, miR-20b -, or miR-363-5p mimic. [score:3]
The more highly expressed siblings, miR-19a and 92a, were used as “controls. [score:3]
Results presented in Figure 6 also show levels of expression of the various miRNAs of the miR-17-92 cluster after transfection with mimics for miR-19a, miR-20b or miR-92a. [score:3]
Only miR-423-5p was shared between the 30–50 differentially expressed miRNAs in cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p. [score:3]
ANOVA (P ≤ 0.05) was used for the isolation of the 53 mirNA differentially expressed in transfectants with miR-19a mimic (A), 43 miRNAs in miR-20b transfectants (B), 61 miRNAs in miR-92a transfectants (C) and 29 miRNAs in transfectants with miR-363-5p mimic (D). [score:3]
Effects of transfection cultured human squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on expression of the primary transcripts pri-17-92, pri-106a-363, and pri-106b-25. [score:3]
presented in Figure 6 also show levels of expression of the various miRNAs of the miR-17-92 cluster after transfection with mimics for miR-19a, miR-20b or miR-92a. [score:3]
The miRNAs (53, 43, 61 and 29) found differentially expressed following transfection with miR-19a - miR-20b -, miR-92a -, or miR-363-5p mimic were subjected to bioinformatic analysis using Ingenuity Pathways Analysis. [score:3]
presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
Microarray results suggested that levels of expression of five members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-19b, and miR-92a) were significantly decreased only in cells transfected with miR-363-5p mimic (Figure 3). [score:3]
Transfection with miR-19a mimic resulted in significantly increased expression of both pri-miR-17 - and pri-miR-92a-1 transcript (Figure 9). [score:3]
Figure 3 MicroRNAs differentially expressed in cultured human squamous carcinoma (E10) cells transfected with scrambled control, miR-19a -, miR-20b -, miR-92a, or miR-363-5p- mimic. [score:3]
presented in Figure 2 suggest that the significantly decreased cell densities observed with transfectants for mimic of miR-19a, miR-20b -, mir-106a, miR-363-3p -, and miR-363-5p were caused by diminished proliferation. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-106a-363 or miR-106b-25 clusters. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with mimic for miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control as shown in the Figure. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control shown in the Figure. [score:1]
Effects of transfection with miR-18a, miR-19a-, miR-20b-, miR-92a-, miR-363-3p or miR-363-5p mimic on proliferation of cultured carcinoma cells. [score:1]
The miR-17-92 cluster, located on human chromosome 13, encodes six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. The miR-106a-363 cluster, located on human chromosome X, encodes six miRNAs: miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. [score:1]
The levels of expression of hsa-pri-miR-17, hsa-pri-miR-92a-1, hsa-pri-miR-106b, hsa-pri-miR-25, hsa-pri-miR-106a, and hsa-pri-miR-92a-2 were measured in E10 cells after transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) or scrambled control. [score:1]
Microarrays were used to profile miRNAs in cultured human oral squamous carcinoma cells (E10) 72 h after transfection with mimics for miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic or with scrambled control. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-17-92 cluster. [score:1]
Transfection with miR-20b mimic led to 60% increase in the level of mirNA-106a (Figure 8C), while in cells transfected miR-19a mimic the level of miR-20b was increased 4-fold (Figure 8D) in agreement with microarray results (Figure 3). [score:1]
Total RNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-19a, miR-20b -, miR-92a - miR-363-5p mimic or scrambled control. [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
Figure 2Effects of transfection with mimic for miR-19a, miR-20b, miR-92a, miR-363-3p (miR-363), or miR-363-5p (miR-363 [*]) on cell densities of cultured human squamous carcinoma (E10) cells. [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
An anti-proliferative effect has previously been observed for miR-19a (Qin et al., 2010), miR-106a (Yang et al., 2011) and miR-363-3p (Sun et al., 2013). [score:1]
Only in cells transfected with miR-19a mimic a high level of miR-20a was detected (A). [score:1]
Transfections were carried out using 20 nM of miR-19a -, miR-20b -, or miR-92a -, or miR-363-3-p -, or miR-363-5-p mimic or Allstar scrambled control (Qiagen, Hilden, Germany), or with transfection reagent only (MOCK). [score:1]
This is exemplified by the selective 50-fold increase in the level of the anti-proliferative miR-20b in transfectants for miR-19a -mimic (Figure 8D), which also exhibited about 25% decrease in cell density (Figure 2A3). [score:1]
[1 to 20 of 49 sentences]
11
[+] score: 97
This is why, after we have shown that miR-19 expression was downregulated in the pericystic liver tissue of patients, we also used HCF and an in vitro mo del of HSC activation (LX-2 cells) as a first step to study the responsibility of metacestode components in the development and regulation of liver fibrogenesis around the cyst [32, 33]. [score:8]
In addition and conversely, we could show that overexpression of miR-19 inhibited the proliferation of HCF -induced HSC cells by directly targeting TβRII. [score:8]
Our study provides new evidence for the intervention of miRNAs in the regulation of fibrosis in infectious diseases; it suggests that E. granulosus can inhibit miR-19 liver expression and promote fibrosis through the increase in TβRII, the activation of hepatic stellate cells and extracellular matrix production. [score:8]
Conversely, overexpression of miR-19 by LX-2 cells inhibited the proliferation of these cells and led to decreased TβRII expression. [score:7]
Based on our study, HCF simulation of LX-2 cells did promote their proliferation as well as the expression of α-SMA and synthesis of COL1A1 and COL3A1, while downregulating miR-19 levels. [score:6]
We have shown that, in the liver surrounding the parasitic cyst in CE patients, expression of miR-19 was downregulated and significantly negatively correlated with COL1A1 and TβRII mRNAs. [score:6]
Incubation of LX-2 cells (in vitro) with HCF induced a decreased proliferation of these cells and a reduced expression of miR-19, inversely correlated with the expression of collagen 1A1 and TGF-β receptor II (TβRII). [score:5]
Taken together, these results suggest that components of parasitic origin present in the cyst fluid are involved in the development of fibrosis through the activation of HSC and that modulation of miR-19 expression is part of the regulatory mechanisms of pericystic fibrogenesis in CE. [score:5]
Intervention of TGF-β-like proteins of parasitic origin might act in the feedback loop of TGF-β/Smad system regulation, including downregulation of miR-19. [score:5]
These data, together with other published works, suggest miR-19 might suppress TβRII expression. [score:5]
Echinococcus granulosus Liver fibrosis HSC miR-19 TβRII Cystic echinococcosis (CE) is a chronic helminthic disease caused by infection with the metacestode (larval stage) of the tapeworm Echinococcus granulosus, one of the most widespread zoonotic diseases in humans in both developing and developed countries. [score:5]
Previous studies have shown that miR-19b, a member, with miR-19a, of the miR-17-92 cluster, can negatively regulate TGF-β signaling components by decreasing TβRII and Smad3 expression [25]. [score:4]
The low expression of miR-19, however, might deserve several explanations and have consequences on a variety of cells. [score:3]
Furthermore, miR-19 was regulated in the process of hepatic fibrosis induced by E. granulosus infection and our complementary in vitro experiments suggest that components of E. granulosus cyst fluid could be involved in this regulation. [score:3]
Therefore, in the present study, our aim was to observe the expression of miR-19 in fibrosis liver of CE patients and in activated HSCs, and then to study the function of miR-19 on HSC activation in vitro. [score:3]
In summary, our results reveal that miR-19 could inhibit the activation of HSCs. [score:3]
These findings strongly suggest that HCF play a TGF-β-like fibrosis promoting role in HSC activation and proliferation by influencing miR-19 expression. [score:3]
HCF was also able to decrease miR-19 expression in HSC and to increase key-markers of HSC activation, α-SMA, COL1A1 and COL3A1. [score:3]
We now provide evidence that miR-19 could be a player in its regulation. [score:2]
The results showed that the expression of miR-19 was significantly reduced in the pericystic collagen-rich liver tissue of CE patients, compared to normal liver. [score:2]
The low expression of miR-19 we observed in the pericystic area compared to adjacent normal liver tissues, and its negative correlation with extracellular matrix proteins and TβRII, thus suggest that reduced levels of miR-19 play a role in the pathophysiology of CE. [score:2]
The role of miR-19 in liver fibrosis induced by E. granulosus has not been explored. [score:1]
[1 to 20 of 22 sentences]
12
[+] score: 90
Data leading to this concludion include the following: Firstly, we provided new evidence to show that cMyc could stimulate expression of miR-17∼92 cluster miRNAs, among others, during early stage of human fibroblastic cell reprogramming; Secondly, forced expression of miR-17∼92 cluster with 4F or 3F enhanced human iPSC induction; Thirdly, miR-19a and miR-19b of the miR-17∼92 cluster were key members that play critical roles in this process; Lastly, PTEN was a target of miR-19a/b that mediated the effect of miR-17∼92 cluster on human fibroblast reprogramming. [score:7]
It is previously reported that miR-19a/b suppress PTEN by directly targeting its 3′UTR in cancer cells [36]. [score:6]
PTEN is a target of miR-19a/b that suppresses reprogramming. [score:5]
Most interestingly, we identified PTEN, a renowned tumor suppressor, as a target that facilitates miR-19a/b -mediated human cell reprogramming. [score:5]
Error bars, s. d. ; n = 3. C. Mature miRNA expressions of miR-17-92 cluster were analyzed by qRT-PCR in 293T cells transfected with miR-19a or miR-19b truncated vector or vector expressing the complete miR-17∼92 cluster. [score:5]
Compared to the combination of miR-17∼92 with EV control, we found that overexpression of PTEN lacking the targeting sequence of miR-19a/b abrogated the stimulating effects of miR-17∼92 on reprogramming (Figure 4E, 4F). [score:4]
B. Mature miR-19a and miR-19b expressions were analyzed by qRT-PCR in 293T cells transfected with miRNA antagomirs for miR-19a and miR-19b, respectively. [score:3]
Real-time PCR analysis showed that truncation of miR-19a and miR-19b specifically reduced mature miRNA expression of miR-19a and miR-19b, respectively, without affecting the maturation of other miRNAs in this cluster (Figure S3C). [score:3]
Here, added to the list are oncomirs mir-19a/b and tumor suppressor PTEN, suggesting important nodals existing at the crossroad of reprogramming and oncogenesis. [score:3]
Western blot analysis showed that PTEN protein expression decreased in IMR90 cells transfected with miR-19a or miR-19b mimics. [score:3]
C. Inhibition of miR-19a and/or miR-19b decreased the reprogramming in IMR90 cells induced by 4F. [score:3]
To further validate the results of the antagomir experiment, we used miR-19a- or miR-19b- truncated miR-17∼92 cluster expressing vector for iPSC induction [33]. [score:3]
To this end, we induced iPSCs in the presence of 4F together with miR-17∼92 and PTEN that didn't contain the targeting sequence of miR-19a/b. [score:3]
Taken together, the results of the present study establish for the first time the pivot role of mir19a/b-PTEN axis in regulating human somatic cell reprogramming, revealing interestingly that the process of human reprogramming and its underlying regulation pathways are complicatedly intertwined with oncogenic process in human malignancies. [score:3]
Our studies demonstrate for the first time that miR-17∼92 cluster stimulates human fibroblast reprogramming by targeting PTEN, with miR-19a and miR-19b playing a predominant role. [score:3]
To determine whether miR-19a/b could suppress PTEN in human somatic cells during reprogramming, we detected PTEN levels in IMR90 cells transfected with miRNA mimics. [score:3]
PTEN is a target of miR-19a/b in human fibroblast reprogramming. [score:3]
Moreover, iPSC induction efficiency by 4F decreased significantly after inhibition of miR-19a or/and miR-19b by antagomirs (Figure 3C). [score:3]
A. Western blot analysis showed that PTEN protein expression decreased in IMR90 cells transfected with miR-19a or miR-19b mimics. [score:3]
Of note, although the miRNA array did not detect miR-19a induction by cMyc, our repeated PCR assay did confirm that cMyc enhanced miR-19a expression. [score:2]
B. miR-19a and/or miR-19b stimulated the reprogramming in IMR90 cells induced by 3F. [score:1]
Taken together, the data indicate that miR-19a and miR-19b are the key components of miR-17∼92 cluster in human fibroblastic cell reprogramming. [score:1]
miR-19a and miR-19b are the key components of miR-17∼92 cluster in reprogramming. [score:1]
miR-19a and miR-19b are the key components of miR-17∼92 cluster in human fibroblast reprogramming. [score:1]
Hence, while our current results clearly establish cMyc/miR19/PTEN axis as key players in this process, further deciphering these roles and underlying mechanisms will no doubt further our understanding of the fate decision and safety controls during reprogramming. [score:1]
We found that iPSC induction efficiency by 3F was also greatly enhanced in the presence of miR-19a and/or miR-19b mimics (Figure 3B). [score:1]
In case of iPSC induction by 3F, deletion of miR-19a or miR-19b not only resulted in decreased iPSC clone numbers but also delayed the appearance of iPSC clones (Figure 3F). [score:1]
F. Deletion of miR-19a or miR-19b in miR-17∼92 cluster decreased the efficiency of reprogramming in IMR90 cells induced by 3F. [score:1]
We found that miR-17∼92 cluster, miR19a and miR19b in particular, enhanced human fibroblast reprogramming, in the presence or absence of cMyc. [score:1]
D. Deletion of miR-19a or miR-19b in miR-17∼92 cluster decreased the efficiency of reprogramming in IMR90 cells induced by 4F. [score:1]
Moreover, our data demonstrate that miR-19a and miR-19b, which are oncogenic in human malignancies [27], are the most potent to stimulate induction of iPSCs. [score:1]
We found that, among those miRNA mimics, only miRNA mimics for miR-19a and miR-19b significantly enhanced iPSC induction efficiency by 4F (Figure 3A). [score:1]
Taken together, our findings in this study represent the first demonstration that cMyc-miR-19a/b-PTEN axis plays a pivotal role in reprogramming of human somatic cells. [score:1]
The revelation of the key roles of cMyc-miR-19a/b-PTEN axis in reprogramming of human fibroblast cells is very interesting. [score:1]
Further, we induced iPSCs with miR-19a and/or miR-19b mimics combined with 3F, or miR-19a and/or miR-19b antagomirs combined with 4F. [score:1]
Hence, we surmise that it is not by a mere coincidence to discover that, mir19a/b, known to be the most oncogenic miRNAs of miR-17∼92 cluster in tumorigenesis progress [27], [36], are also key components to facilitate reprogramming of human somatic cells. [score:1]
The miR-17∼92 cluster is a primary transcript that processes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a. [score:1]
[1 to 20 of 37 sentences]
13
[+] score: 67
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2
Speculating on the relationship between miR-19a/b expression levels and leukemogenesis, we hypothesized that lower levels of miR-19a/b could be related to cancer advancement, whereas higher expression, coupled with overexpression of BARD1 oncogenic isoforms, may provide a better response to Vorinostat treatment by altering the ceRNA code. [score:7]
The evidence that high expression levels of truncated BARD1 isoforms together with Vorinostat induction of miR-19a/b could represent a marker of response to Vorinostat in AML suggests the potential application of miR-19a/band truncated BARD isoform expression as markers in AML. [score:5]
org website, we focused on two miRNAs that may potentially regulate BARD1 expression by the binding to its 3’UTR: miR-19a and miR-19b (Figure 3C ). [score:4]
miR-19a and miR-19b directly bind BARD1 3’UTR reducing its expression levels. [score:4]
Corroborating our hypothesis of regulation of BARD1 mRNAs by miRs, miR-19a and miR-19b overexpression led to BARD1 reduction (Figure 4B ). [score:4]
We found that Vorinostat reduces BARD1 mRNA levels by increasing miR-19a and miR-19b expression. [score:3]
The overexpression of miR-19a and miR-19b in NB4 cells was confirmed by qPCR in NB4, K562, U937 and HL60 cells (Figure 3D ). [score:3]
BARD1 is a target of miR-19a and miR-19b. [score:3]
miR-19a and miR-19b overexpression leads to increased sensitivity to Vorinostat treatment. [score:3]
The fact that Vorinostat treatment increases miR-19a/b and that cells overexpressing miR-19a/b are particularly sensitive to Vorinostat stimulation, leading to hyperactivation of caspase-9, strongly endorse this hypothesis. [score:3]
In other words, it is tempting to speculate on a possible patient stratification on the basis of expression levels of miR-19 and BARD1 isoforms to better define patients that might actually benefit from epi -based treatment. [score:3]
BARD1 is the target of miR-19a and miR-19b. [score:3]
As expected, Real-Time PCR analysis showed an increment of hsa-miR-19a and hsa-miR-19b expression 48 hours after transfection (Figure 4A ) compared to the untreated control and the mimic-miR-scramble control. [score:2]
To further demonstrate the direct binding of miR-19a and miR-19b to the 3’UTR of BARD1, we cloned the BARD1 3’UTR region into the pGL3 vector, downstream of the luciferase reporter gene. [score:2]
In particular, relative fold change for miRNA19a and miRNA19b were 0.32 and 0.36, respectively. [score:1]
Upon treatment with Vorinostat, U937-miR-19a and U937-miR-19b cells showed a higher percentage of cell death in comparison with the negative control (Figure 5A ). [score:1]
Clones were screened for overexpression of the two miRNAs and clones U937-miR-19a D and G and U937-miR-19b D and E were selected for further investigation (Figure S4 ). [score:1]
The luciferase assay clearly showed that miR-19a and miR-19b can directly bind to the 3’UTR of BARD1, decreasing luciferin oxidation and light development (Figure 4C, left), compared to the HeLa control cells transfected only with pGL3-3’UTR-BARD1 vector and the mimic-miR-scramble control. [score:1]
Real-Time PCR for miR-19a and miR-19b in pCMV-MIR stable transfected U937 cells. [score:1]
Figure S4 Validation of stable transfected clones for miR-19a and miR-19b. [score:1]
The reaction mixture was then combined with specific mimic-miRNAs (1:1) at the desired concentration and incubated for 10 minutes at RT; in this case 50 nM mimic-miR-19a and 50 nM mimic-miR-19b were used, or 50 nM mimic-miR-scramble as negative control. [score:1]
To confirm that, we transfected NB4 cells with mimic-miR-19a and mimic-miR-19b. [score:1]
s in U937-MIR cells further suggested that in U937-miR-19a and U937-miR-19b cells Vorinostat treatment induced stronger caspase-8 and, in particular, caspase-9 activation (Figure 5B ). [score:1]
These findings strengthen our conclusions regarding the prognostic role of miR-19a and miR-19b, and give new connotations to the isoforms of BARD1, which may prove useful both as diagnostic and predictive markers. [score:1]
In this scenario, the oncogenic role played by miR19a/b, described by Xu et al, in human cervical cancer cells could be explained [45]. [score:1]
We concluded that the decrease of BARD1 mRNA observed by Vorinostat treatment could involve miR-19a and miR-19b. [score:1]
Annealing of miR-19a and miR-19b to BARD1 3’UTR: wild type and mutated BARD1 3’UTR are schematized. [score:1]
1 µg of pGL3-3’UTR-BARD1 plasmid plus 200 nM mimic-miR-19a, mimic-miR-19b or mimic-miR-scramble were used. [score:1]
Modulation of miR-19a, miR-19b and BARD1increases mortality of U937 cells after Vorinostat treatment. [score:1]
0083018.g004 Figure 4(A) Real-Time PCR for mir-19a and miR-19b in NB4 cells transfected with mimic-miR-19a, mimic-miR-19b or mimic-miR-scramble (miR-s). [score:1]
To clarify the biological functions of miR-19a and miR-19b, stable transfection of pCMV-MIR-19a, pCMV-MIR-19b into U937 cells was performed. [score:1]
pCMV-MIR vectors (OriGene) encoding for miR-19a or miR-19b and the empty vector were first amplified in E. coli DH5α and plasmids were extracted with PureLinkHipure Plasmid Filter Maxiprep Kit (Invitrogen). [score:1]
[1 to 20 of 32 sentences]
14
[+] score: 67
Rno-miR-19a, rno-miR-19b-2 and rno-miR-214 were downregulated at all four time-points, while rno-miR-137 was downregulated at T1 followed by upregulation from T2 to T4 (Fig.   6). [score:10]
Furthermore, we observed downregulated expression of miR-19a and miR-214, which are predicted to target ARC. [score:8]
The expression of four miRNAs (rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214) and their target genes (EGR2 and ARC) were shown to be regulated by propofol in primary cultured embryonic NSCs. [score:6]
Rno-miR-19a (Rno, Rattus Norvegicus) and rno-miR-137, and their target gene EGR2, as well as rno-miR-19b-2 and rno-miR-214 and their target gene ARC were found to be closely related to neural developmental processes, including proliferation, differentiation, and maturation of NSCs. [score:6]
Another study conducted in a murine stroke mo del confirmed that miR-19a upregulation promotes NSC proliferation by targeting PTEN [46]. [score:6]
The results of the present study indicate that propofol may have the ability to regulate the expression of rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214 and their target genes, ARC and EGR2. [score:6]
It can be speculated that the increased expression of ARC in NSCs following exposure to propofol will have a beneficial effect, which is in conflict with the neurotoxic effects of propofol in vivo reported by Krzisch et al. [10] Furthermore, when combined the patterns of miR-19a and miR-214 expression, the situation is much more complex and the results are somewhat contradictory. [score:5]
MiR-19 of the miR-17–92 cluster promotes NSC proliferation [15] and targets FoxO1 to regulate NSC differentiation through cooperation with the Notch signaling pathway [16]. [score:4]
Fig. 6Quantitative RT-PCR analysis of relative expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214. [score:3]
Relative expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214 at all four time-points (immediately (T1), Day 1 (T2), Day 3 (T3) and Day 7 (T4) after treatment with propofol or DMSO). [score:3]
The fold-change in the mean expression levels of rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214 ranged from -2.56 to -12.15, -2.02 to 4.61, -2.33 to -6.68 and -2.16 to -4.63, respectively (Table  5). [score:3]
In this way, we confirmed two genes (EGR2 and ARC) and four miRNAs (rno-miR-19a, rno-miR-137, rno-miR-19b-2 and rno-miR-214) that exhibited at least a 2-fold change in the mean expression level following propofol treatment at all four time-points. [score:3]
MiR-19b is a member of miR-19 family located in the miR-106–25 cluster, which has been reported to be involved in regulating NSC proliferation and differentiation through a network related to the insulin/IGF-FoxO pathway [37]. [score:2]
MiR-19a is located in the miR-17–92 cluster, which promotes the NSC proliferation via repression of PTEN [15]. [score:1]
The miRNAs predicted by all four databases (rno-miR-19b-2, rno-miR-137, rno-miR-19a and rno-miR-214, (Rno, Rattus Norvegicus)) were selected for validation (Table  4 and Fig.   5). [score:1]
[1 to 20 of 15 sentences]
15
[+] score: 64
In situ hybridization, to detect the likely mammalian homologous miR-19a and miR-19b transcripts, based on the complete sequence homology to the mammalian isoforms and their predominant expression levels, showed similar expression patterns for both isoforms at 48 and 72 hpf with robust expression in the skeletal muscle myosepta and in the heart (Fig. 2b). [score:7]
Therefore, similar to MO19b, we decided to target a less conserved sequence within the miR-19b gene, again to not interfere with the expression of homologous miR-19-isoforms (suppl. [score:5]
Furthermore, a previous study demonstrated that miR-19 directly targets Cx43 11. [score:4]
Expression of miR-19 in the zebrafish. [score:3]
While mammals express two isoforms, miR-19a and miR-19b, zebrafish exhibit four miR-19 isoforms encoded in four genomic loci (Fig. 1b,c). [score:3]
We found that injection of MO19 not only profoundly reduced the expression of mature miR-19a-d, but very consistently also diminished the level of mature miR-363 (Fig. 3c). [score:3]
Because all miR-19 isoforms are genomically closely located and polycystronically encoded on single pri-miRNA transcripts containing other miRNAs, we evaluated the impact of miR-19 knockdown on the expression of neighboring miRNAs to detect potential unintentional co-regulatory effects. [score:3]
MO19a-d were designed to target specifically one miR-19 isoform. [score:3]
miR-19 is expressed in the heart and is induced at stages of first heart activity. [score:3]
qRT-PCR analysis of single miR-19 isoforms showed detectable expression at the one-cell stage for miR-19a and miR-19b, with strong induction by 24 hpf, coinciding with the initiation of heart contractions in zebrafish (Fig. 2a). [score:3]
In contrast, miR-19a/b generally present low cT values which are often similar as for the endogenous control gene, indicating relatively high expression levels. [score:3]
To exclude that loss of miR-363 is causing or contributing to the observed miR-19 deficiency phenotype, we used a morpholino targeting specifically miR-363 processing (suppl. [score:3]
Similar to miR-19a/b, expression is induced at 24 hpf. [score:3]
MO19 was designed to target all four miR-19 isoforms at the same time. [score:3]
Morpholino -mediated knockdown of miR-19 in zebrafish leads to bradycardia and impaired ventricular contractility (±sd; n ≥ 14; p < 0.005). [score:2]
Importantly, MO19a or MO19b injection individually caused a reduction of mature miR-19a and miR-19b both by 50%. [score:1]
MO19 was designed to specifically block the processing of all miR-19 isoforms into their mature and active forms (suppl. [score:1]
To investigate the effects of loss of miR-19 on heart function, we initially injected a morpholino -modified oligonucleotide targeting all four isoforms of miR-19 (MO19) into zebrafish embryos at the single-cell stage. [score:1]
In situ hybridization of miRNAs For detection of microRNAs in zebrafishembryos at 48 and 72 hpf we used miR-19a- and miR-19b specific miRCURY LNA detection probes (35194, 35195, Exiqon) and followed the instruction manual of the manufacturer. [score:1]
miR-19 deficient zebrafish displayed signs of cardiac dysfunction with cardiac edema and blood congestion at the inflow tract (Fig. 3a). [score:1]
Loss of miR-19 results in bradycardia and cardiomyopathy. [score:1]
Supplementary MOvie 1. Supplementary MOvie 2. Supplementary MOvie 3. Supplementary MOvie 4. miR19 is conserved in sequence and syntheny. [score:1]
qRT-PCR analysis confirmed significant reduction of mature miR-19a, miR-19b, miR-19c, and miR-19d by at least 90% (Fig. 3c). [score:1]
The sequence and the synteny of miR-19 is highly conserved among vertebrate species (Fig. 1a,b). [score:1]
To ensure greater specificity in evaluating miR-19 function and to enable the identification of a single causal miR-19 isoform, we used four individual morpholinos to specifically target each miR-19 isoform exclusively (suppl. [score:1]
For detection of microRNAs in zebrafishembryos at 48 and 72 hpf we used miR-19a- and miR-19b specific miRCURY LNA detection probes (35194, 35195, Exiqon) and followed the instruction manual of the manufacturer. [score:1]
Importantly, mutating the putative binding site in these 3′-UTRs, abolished miR-19-dependant repression of the luciferase protein. [score:1]
Loss of miR-19 leads to bradycardia. [score:1]
[1 to 20 of 28 sentences]
16
[+] score: 56
However, miR-149 provides a mechanism to bypass the induction of apoptosis by p53 activation by directly targeting glycogen synthetase-3α and thereby stabilizing MCL-1. Consistent with the reported function of these miRNAs in regulating cell proliferation and metastatic potential, target site mapping to genes associated with melanoma progression suggests that miR-17-5p, miR-19a-3p, miR-149-5p and miR-21 play a role in modulating cell response to TP53/RB1 activation and TGFβ/SMAD signaling pathways. [score:7]
To examine the relationship between miR-17, miR-19a, miR-21, miR-126 and miR-149 expression in human cancer specimens from cutaneous melanoma, we queried the TCGA data portal [54] for all samples with Level 3 miRNA expression data available, as well as the accompanying clinical data. [score:5]
As shown in Figure 4, low expression of miR-17, miR-19a, miR-21, miR-126 and miR-149 was found in thinner melanoma (Clark level I/II) and high expression was found in thicker melanoma (Clark level III, IV and V). [score:5]
The conserved target sites of miR-17-5p, miR-19a-3p, miR-149-5p, miR-21 and miR-126-3p were mapped to the 3-UTRs of a panel of genes that have been associated with melanoma progression according to TargetScan V6.2. [score:5]
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
To investigate the potential biological functions of the miRNAs upregulated in metastatic melanoma, the target sites of miR-17-5p, miR-19a-3p, miR-149-5p, miR-21 and miR-126-3p were mapped to the 3-UTRs of a panel of genes that have been previously found to be associated with melanoma progression [21, 22, 23]. [score:4]
Wu Q. Yang Z. An Y. Hu H. Yin J. Zhang P. Nie Y. Wu K. Shi Y. Fan D. MiR-19a/b modulate the metastasis of gastric cancer cells by targeting the tumour suppressor MXD1 Cell Death Dis. [score:4]
Most interestingly, miR-17, miR-19a, miR-21, miR-126 and miR-149 were expressed at 1.8-fold, 2.3-fold, 1.7-fold, 2.8-fold and 3.9-fold higher levels, respectively, in patients with metastatic melanoma (p values of 0.044, 0.015, 0.038, 0.040 and 0.021, respectively). [score:3]
Also, increased expression of miR-19a leads to increased melanoma invasiveness [35]. [score:3]
MiR-19a is upregulated in acute myeloid leukemia, colorectal cancer and gastric cancer, and is believed to act through promoting tumor growth and metastasis [36, 37]. [score:3]
An important aspect of our studies was the finding that miR-17, miR-19a, miR-21, miR-126 and miR-149 were expressed at higher levels in plasma-derived exosomes from patients with metastatic melanoma. [score:3]
Figure 4 High expression of miR-17, miR-19a, miR-21, miR-126 and miR-149 is associated with melanoma tumor grade. [score:3]
Expression of miR-17, miR-19a, miR-21, miR-126 and miR-149 in the TCGA database for 216 independent melanoma patient samples according to Clark level (Level 1 is the least aggressive and Level V is the most aggressive). [score:3]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
MiR-19a is an important member of the oncogenic miR-17-92 cluster. [score:1]
[1 to 20 of 15 sentences]
17
[+] score: 50
In line with reduced expression levels in failing hearts of old mice, decreased miR-18a, miR-19a, and miR-19b expression was associated with severe heart failure at old age (Fig. 3A), while miRNA expression in old patients with a preserved function was not different from young ICM patients (Fig. 3A). [score:7]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
Together, these data suggest that regulation of CTGF and TSP-1 is the result of the shared expression of miR-18a, miR-19a, and miR19b, enabling modest changes in miRNA expression to control transcriptional repression. [score:6]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
Our in vitro results support a role for miR-18a, miR-19a, and miR-19b in regulating CTGF and TSP-1 expression in the aged cardiomyocyte. [score:4]
These findings confirm the expression profiles in aged HF-prone mice and again suggest that miR-18a, miR-19a, and miR-19b could transcriptionally repress CTGF and TSP-1 levels in cardiomyocyte aging and HF at old age. [score:3]
CTGF and TSP-1 have been identified as target genes of the miR-17–92 cluster (Dews et al., 2006), more specifically of the cluster members miR-18a and miR-19a/b (Suarez et al., 2008; Ohgawara et al., 2009). [score:3]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
Therefore, we investigated whether age-related changes in miR-18a, miR-19a, and miR-19b expression regulate CTGF, TSP-1, and collagen levels in rodent mo dels of aging -associated heart failure and in the human failing heart. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
CTGF, TSP-1, miR-18a, miR-19a, and miR-19b levels in aged HF-resistant (12 weeks, n = 8; 52 weeks, n = 8; and 104 weeks, n = 9) and HF-prone mice (12 weeks, n = 6; 52 weeks, n = 11; and 104 weeks, n = 9). [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
Importantly, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs. [score:1]
RT-PCR analysis of miR-18a, miR-19a, miR-19b, CTGF, and TSP-1 transcript levels in myocardial biopsies from idiopathic cardiomyopathy (ICM) patients at older age with normal (n = 5) and severely impaired (n = 9) cardiac function. [score:1]
[1 to 20 of 16 sentences]
18
[+] score: 47
Based on the experiments using specific miR inhibitors, the mechanisms of the effects of miR-18a-5p, miR-19a-3p, and miR-19b-3p on the up-regulation of activated STAT3 might be the suppression of genes for regulatory proteins of STAT3 such as protein inhibitor of activated STAT3 (PIAS3) and suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) [29– 32]. [score:13]
Interestingly, miRNA inhibitors targeted to miR-18a-5p, miR-19a-3p, and miR-19b-3p down-regulated the expression of BCL2, BCL2L1, BIRC5, and MMP9, target genes of STAT3, which implied the positive feedback loop of STAT3/miR-17-92 clusters (Fig. 7B-E). [score:12]
In particular, inhibition of miR-18a-5p, miR-19a-3p, and miR-19b-3p resulted in differential up-regulation of mRNA expressioin of PIAS3, SOCS1, and SOCS3, coding genes for regulatory proteins of STAT3 such as (Supplemental Fig. 6–8). [score:9]
In order to figure out feedback effects of miR-17-92 clusters on STAT3 activation, we evaluated the expression of target genes of STAT3 which demonstrated higher expression in Y79 cells than other retinal constituent cells: BCL2, BCL2L1, BIRC5, and MMP9 according to the treatment with specific miRNA inhibitors to components of miR-17-92 clusters: miR-18a-5p, miR-19a-3p, and miR-19b-3p. [score:7]
org demonstrated that sequences from 998 through 1020 in the 3′ UTR region of CCND1 are targets for miR-17 and miR-20a, those from 1770 through 1784 are those for miR-19a, and those from 1777 through 1782 are those for miR-19b. [score:3]
Interestingly, the inhibition of miR-18a-5p, miR-19-3p, and miR-19b-3p induced the decrease in the proportion of pSTAT3 -positive retinoblastoma cells. [score:3]
[1 to 20 of 6 sentences]
19
[+] score: 45
We demonstrate that, when expressed at the high levels found in G4 MBs, linc-NeD125 functions as a competing endogenous RNA (ceRNA) that, sequestering miR-19a-3p, miR-19b-3p, and mir-106a-5p, de-represses the expression of their targets CDK6, MYCN, SNCAIP and KDM6A, major driver genes of G4 MB. [score:7]
Left panel: linc-NeD125 expression in D283 Med cells transfected with LNA inhibitors targeting miR-19a, miR-19b and miR-106a (LNA miRs, gray bar) or with scrambled LNA (LNA CTRL, white bar). [score:7]
Their ectopic expression had no effect on the levels of miR-19a-3p, miR-19b-3p, or miR-106a-5p (Supplementary Figure 2), indicating that linc-NeD125 does not regulate their abundance [15]. [score:4]
Linc-Ned125 de-represses G4 MB driver gene expression by sequestering miR-19a-3p, miR-19b-3p, and miR-106a-5p. [score:3]
Collectively, these results demonstrate that linc-NeD125 controls the in vitro expression of four genes known to drive G4 MB, i. e. CDK6, MYCN, SNCAIP, and KDM6A, by competing with their transcripts for binding to miR-19a-3p, miR-19b-3p and miR-106a-5p. [score:3]
Linc-NeD125 functions as a natural miRNA sponge, competitively binding and sequestering three endogenous miRNAs—miR-19a-3p, miR-19b-3p and miR-106a-5p—whose targets include CDK6, MYCN, SNCAIP, and KDM6A transcripts (Figure 8). [score:3]
miR-19a-3p, miR-19b-3p and miR-106a-5p repress G4 MB driver gene expression. [score:3]
Given the high expression levels of miR-19a-3p, miR-19b-3p and miR-106a-5p in D283 Med cells (Figure 2E), miRNA loss-of-function experiments were performed. [score:3]
Effects of miR-19a-3p, miR-19b-3p, miR-106a-5p inhibition on D283 Med cell properties. [score:3]
As shown in Figure 2B, only miR-19a-3p, miR-19b-3p, and miR-106a-5p were significantly overexpressed in tumour specimens, with 2- to 4-fold increases over control levels. [score:3]
Middle panel: Western blot analysis of five G4 MB driver gene protein products in D283 Med cells transfected with LNAs against miR-19a, miR-19b, miR-106a (LNA miRs) or with scrambled LNA (LNA CTRL). [score:1]
Interaction of miR-19a-3p, miR-19b-3p and miR-106a-5p with G4 driver genes. [score:1]
The same tool was used to eliminate 2 of the 6 miRNAs that could bind the pull-down bait, leaving a short list of 4 miRNAs—namely miR-19a-3p, miR-19b-3p, miR-106a-5p and miR-191-5p—which are specifically bound by linc-NeD125 (Figure 1D, right panel). [score:1]
Among those, we found that the microRNAs bound by linc-NeD125, miR-19a-3p, miR-19b-3p and miR-106a-5p, were predicted to pleiotropically repress five G4 driver genes (Figure 2C). [score:1]
Right panel: number and positions of miR-19a-3p, miR-19b-3p, miR-106a-5p, miR-191a-5p MREs on linc-NeD125 sequence. [score:1]
To verify the specificity of miRNA-linc-NeD125 interaction, we cloned the wild type and mutant linc-NeD125 into luciferase reporter vectors (Figure 4A, left panel) and transfected them into D283 Med cells, along with the LNAs complementary to miR-19a-3p, miR-19b-3p, and miR-106a-5p. [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
21
[+] score: 42
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-106a, hsa-mir-20b
Because bioinformatic analysis of the 3′-UTR of the TF transcript suggests that TF expression may be regulated by miR-19a, miR-20b, and miR-106a, we investigated the potential of these miRNAs to regulate TF expression in G-M cells and trophoblasts differentiated from hESCs and found that miR-20b mimics inhibited TF expression in these cells, but did not disturb the differentiation process because the expression of G-M cell-specific marker gene PU. [score:11]
In human breast cancer cells, TF expression can be downregulated by miR-19 [21], suggesting that TF expression can be regulated by miRNA. [score:9]
Several studies have shown that many types of cancer cells express aberrantly high levels of TF [22] and miR-19 regulates TF expression in breast cancer cells [30]. [score:6]
Louis, Missouri, USA) and then transfected with 2 μg TF-3′-UTR or mutant plasmid DNA with 100 nM inhibitors or 100 nM mimics of miR-19a, miR-20b, or miR-106a mixed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:3]
miRNA mimics and inhibitors for miR-19a, miR-20b, and miR-106a were purchased from GenePharma Co. [score:3]
Figure 3 miR-19a, miR-20b, and miR-106a expression in hematopoietic cells and trophoblasts derived from human embryonic stem cells. [score:3]
Similarly, reverse transcriptase PCR for TF mRNA and western blotting for TF protein also showed that TF expression in G-M cells or trophoblasts was reduced by miR-20b mimics, but not by miR-19a or miR-106a mimics (Figure  4C). [score:3]
We therefore asked whether miR-19a, miR-20b or miR-106a mimics could alter TF expression in G-M cells and trophoblasts using the TF-3′-UTR reporter assay, TF mRNA, and TF protein analysis. [score:2]
In the 3′-UTR of TF mRNA, there are binding sites for miR-19a, miR-20b, and miR-106a (Figure  1). [score:1]
DNA analysis shows that there are miRNA -binding sites for miR-19a, miR-20b, and miR-106a in the 3′-UTR of the TF mRNA transcript. [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 41
Other miRNAs from this paper: hsa-mir-20a
In HG-activated PBMCs, LPS stimulated TF expression and downregulated miR-20a, an effect reverted by OLM (10 [−6] M); miR-19a expression was unchanged by LPS in both CG and HG conditions. [score:8]
On the other hand, LPS stimulation did not change miR-19a levels in our PBMC preparations at variance, in this respect, with human umbilical vein endothelial cells (HUVECs), a cell line capable of rapid TF induction [17] in which endotoxin downregulated miR-19a expression [18]. [score:6]
This study shows inhibition of both miR-19a and miR-20a in response to HG [4], a procoagulant [4, present results] and proinflammatory stimulus [8– 10] that activates NF- κB [10, 11], a redox-sensitive transcription factor [12] critical for TF gene expression [3]. [score:5]
Among other potentially significant miRs interacting with TF gene [2], miR-19a and miR-20a have recently been shown to modulate TF expression in monocytes of patients with immune -mediated diseases [6]. [score:5]
The results of this study disclose behaviours of miR-19a and miR-20a potentially involved in the posttranscriptional regulation of TF expression in the context of the complex interplay among inflammation, coagulation, and ATII, in which TF plays a pivotal role. [score:4]
As compared with CG, HG inhibited miR-19a and miR-20a expression and induced a highly significant stimulation of both TF PCA and TF Ag (Figures 1(a) and 1(b)). [score:4]
Notably, cytoplasmic miR -induced silencing complexes restrain TF protein translation and destabilize TF mRNA by binding to the 3′-UTR of TF transcripts [1] and binding sites for both miR-19a and miR-20a have been recognized in the 3′-UTR of the TF mRNA transcript in human monocytes [6] and other cell types as well [13, 14]. [score:3]
miR-19a and miR-20a are inhibited by inflammatory stimuli active on TF expression and their response differs by the stimulus under investigation; angiotensin II may participate in that mechanism. [score:3]
Quantification of miR-19a, miR-20a, and RNU6B (as housekeeping gene) expression was carried out in triplicate using specific TaqMan MicroRNA Assays (Applied Biosystems), according to the manufacturer's instructions. [score:2]
miR-19a levels were insensitive to LPS stimulation in either of experimental conditions (Figures 2(b) and 3(b)). [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 40
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2
In breast cancer, upregulation of miR-19 suppresses downstream proteins, including PTEN, p-AKT, p-MDM2 and p53, leading to breast cancer carcinogenesis. [score:6]
Interestingly, co-treatment with pre-miR-19b suppressed the luciferase reporter activity to a greater extent than with pre-miR-19a (Figure 2B) again suggesting that PTPRG is more likely to be a bona fide target of the miR-19b rather than miR-19a. [score:5]
After removing the miRNAs previously reported to be tumor suppressor or increased in breast cancer, miR- 19a and miR-19b (miR-19a/b) were finally selected as candidate regulatory miRNAs of PTPRG. [score:4]
To determine whether miR-19a/b directly targeted PTPRG by binding to the presumed sites in the 3′-UTR of the PTPRG mRNA, the full-length PTPRG 3′-UTR containing the sole presumed miR-19a/b binding sites was fused downstream of the firefly luciferase gene in a reporter plasmid. [score:4]
The predicted interaction between miR-19a/b and the target sites within the PTPRG 3′-UTR is illustrated in Figure 2A. [score:3]
As a key oncogenic component of the miR-17- 92 cluster, overexpression of miR-19 is implicated in carcinogenesis processes. [score:3]
Two potential miR-19a/b targeting sites were found in the 3′-UTR of the PTPRG mRNA sequence and were close but non-overlapping. [score:3]
Moreover, the breast-cancer-promoting role of miR-19/PTEN/AKT/p53 axis can be reversed by curcumin, implying that miR-19 is a potential target for breast cancer intervention [15]. [score:3]
MiR-19a/b differs only in one nucleotide and they generally share common target mRNAs. [score:2]
The results are displayed as the ratio of firefly luciferase activity in the miR-19a/b -transfected cells to that in the control cells. [score:1]
Furthermore, the miR-19a/b binding sequences in the PTPRG 3′-UTR were highly conserved across species. [score:1]
The resulting plasmid was co -transfected into the MCF-7 cells along with both a transfection control plasmid (β-gal) and pre-miR-19a/b (or a scrambled negative control RNA). [score:1]
Figure 2(A) Schematic description of the hypothesized duplexes formed by the interaction between the binding sites of the PTPRG 3′-UTR (top) and miR-19a/b (bottom). [score:1]
As expected, luciferase reporter activity was significantly reduced in the cells transfected with pre-miR-19a/b (Figure 2B). [score:1]
The minimum free energy values of the hybrids between miR- 19b and the binding sites on the PTPRG 3′-UTR are −18.4 and −17.8 kcal/mol and are lower than those of miR- 19a (−15.6 and −16.2 kcal/mol), suggesting that miR- 19b may bind more tightly to PTPRG 3′-UTR than miR-19a. [score:1]
MCF-7 cells were co -transfected with a firefly luciferase reporter containing either the wild-type (WT) or mutant (MUT) miR-19a/b binding sites in the PTPRG 3′-UTR and with either pre-miR-control or pre-miR-19a/b. [score:1]
[1 to 20 of 16 sentences]
24
[+] score: 33
For example, we recently identified a network of miR-19 targets converging on the control of inflammation by virtue of regulating the expression of components of the NF-κB signalling pathway (27). [score:6]
Indeed, while miR-19a-3p did not have the predicted highly inhibitory motif, it was able to repress TLR7 sensing independently of miR-19 targeting in miR-19 -deficient cells (Figure 1). [score:5]
Moreover, microarray profiling of mRNA expression in BMMs after DOTAP -mediated LNA/DNA AMO transfection (for miR-19a-3p, miR-15a-5p and miR-34a-5p) did not result in a significant de-repression of genes targeted by these miRNAs according to specific hexamer enrichment analyses with DIANA-mirExtra (42) (data not shown). [score:5]
To distinguish the direct contribution of miR-19 and -92 in TLR7 sensing from a potential off-target effect of the 2′OMe AMOs used, experiments were replicated in BMMs from miR-17∼92 [flox/ flox] × LysMCre mice—where levels of mature miR-17-5p, miR-19a-3p and miR-92a-3p were decreased by ∼70% (Figure 1B). [score:4]
Critically, pre-treatment with the miR-19a-3p 2′OMe AMO still reduced TNF-α production by ∼50%, suggesting an activity independent of its miRNA -targeting function (Figure 1A). [score:3]
We have recently reported a positive regulatory role for miR-19 miRNAs (including both miR-19a-3p and miR-19b-3p) in the control of nuclear factor kappa B (NF-κB) signalling in several cell lines (27). [score:2]
In agreement with our previous results, miR-19a-3p inhibition resulted in ∼70% decreased TNF-α production in response to transfected immunostimulatory ssRNA (B-406AS-1), when compared to the non-2′OMe control RNA sequence (RD) (Figure 1A). [score:2]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
In this work, we originally set out to study the role of the individual members of the miR-17∼92 cluster of miRNAs (miR-17/20a, miR-19a/b, miR-18a and miR-92a) on TLR7 -driven NF-κB signalling in mouse primary macrophages. [score:1]
Gantier M. P. Stunden H. J. McCoy C. E. Behlke M. A. Wang D. Kaparakis-Liaskos M. Sarvestani S. T. Yang Y. H. Xu D. Corr S. C. A miR-19 regulon that controls NF-kappaB signalingNucleic Acids Res. [score:1]
In accord with our previous findings (27), we demonstrated that 2′OMe AMO -mediated blocking of miR-19 significantly reduced the production of TNF-α induced by immunostimulatory ssRNA in WT BMMs. [score:1]
However, this effect of the miR-19a-3p 2′OMe was mostly retained in BMMs depleted of miR-19a-3p and miR-19b-3p, indicative of a miRNA-independent effect (Figure 1). [score:1]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
[1 to 20 of 13 sentences]
25
[+] score: 33
GO analysis of the miRNA targets showed that miR-19a-3p, miR-92b-3p and miR-130b-3p were mostly involved in the function of cell biological process, metabolic regulation and stimulating reaction (Fig 6 and S2 Table). [score:4]
Based on these up-regulated miRNAs, 3 specific miRNAs, namely hsa-miR-19a-3p, hsa-miR-92b-3p and hsa-miR-130b-3p, with the maximum difference between reprogrammed cells and DPSCs/SCAP were entered into further discussion. [score:4]
Among these 117 up-regulated miRNA genes, miR-19a-3p, miR-92b-3p and miR-130b-3p showed the maximum difference between reprogrammed iPS cells and DPSCs/SCAP. [score:4]
The hsa-miR-19a-3p, was reported as a miRNA involved in the leukotriene biosynthesis via targeting 5-Lipoxygenase in a cell type- and stimulus-specific manner [19]. [score:3]
As shown in Fig 8A, the results detected on microarray indicated that the miR-19a-3p, miR-92b-3p and miR-130b-3p displayed substantial increase expression in DPSCs-iPSCs and SCAP-iPSCs. [score:3]
The following target prediction analysis on miR-19a-3p, miR-92b-3p and miR-130b-3p using bioinformatic neural nets are summarized in Table 2 (S1 Table). [score:3]
In this study, miR-19a-3p was highly expressed in two dental stem cells (DPSCs-iPSCs and SCAP-iPSCs), suggesting that hsa-miR-19a-3p may have potent to stimulate induction of iPSCs. [score:3]
The specific expression of miRNAs, namely hsa-miR-19a-3p, hsa-miR-92b-3p and hsa-miR-130b-3p, which were prediction to be related to the cell cycle, TGF beta signaling pathway and epithelial mesenchymal transition, may reflect the difference between naturally pluripotent cells and reprogrammed cells. [score:3]
The miR-19a-3p, it was related with 15 pathways, such as signaling pathways regulating pluripotency of stem cells, focal adhesion and amoebiasis. [score:2]
Our further prediction revealed that hsa-miR-19a-3p was involved in signaling pathways regulating pluripotency of stem cells, focal adhesion and amoebiasis. [score:2]
Further study is warrant as for the relationship between hsa-miR-19a-3p and these signaling pathway. [score:1]
Interestingly, there are also reports revealing that miR-19a and miR-19b, which are oncogenic in human malignancies, are the key components in human fibroblastic cell reprogramming and enhanced human fibroblast reprogramming, in the presence or absence of cMyc [21]. [score:1]
[1 to 20 of 12 sentences]
26
[+] score: 29
The consequential high expression of its member, miR-19a, was found to correlate with decreased expression of several anti-angiogenic factors such as thrombospondin-1 (TSP-1) and connective tissue growth factor (CTGF) [23], [25]. [score:5]
The aim of this study was to examine the degree of vascularization determined by microvessel density as well as expression of selected miRNAs (specifically, let-7b, miR-126, miR-9, and miR-19a) in lung tumor tissue, surrounding tissue, and corresponding non-tumor tissue in patients with squamous cell lung cancer (SCC) and lung adenocarcinoma (ADC) as well as in lung tissue from control individuals without clinical evidence of a malignant disease. [score:5]
The expression of miR-19a was higher in surrounding tissue form ADC patients in comparison to surrounding tissue from SCC patients (p<0.001; data not shown). [score:3]
We observed significantly lower expression of miR-19a in tumor tissue in comparison to control lung tissue (Figure 5B). [score:3]
Our results indicate a lower expression of miR-19a in tumor tissue in comparison to other tissue samples. [score:3]
Moreover, TSP-1, which has been described as one of the major targets of miR-19a, could either reduce [23] or, after binding with cell surface receptors integrins, even promote angiogenesis [41]. [score:3]
Comparative analysis of miR-9 (A) and miR-19a (B) expression in lung cancer patients' tumor tissue, surrounding tissue, and non-tumor lung tissue as well as in lung tissue from control group. [score:3]
These findings are conflicting and oppose the pro-angiogenic role of miR-19a reported by the majority of studies published so far [14], [23], [25], [39], [40]. [score:1]
Based on these findings, four miRNAs (specifically, let-7b, miR-9, miR-19a, and miR-126) were selected. [score:1]
However, several authors reported that individual members of the miR-17-92 cluster, including miR-19a, might have different functions in cancer cell growth and angiogenesis [14], [39], [40]. [score:1]
Since expression levels of miR-9 and miR-19a did not vary significantly between tumor tissue and corresponding non-tumor tissue, further correlations with MVD were not evaluated. [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 29
Three of them are observed to be targeting the genes associated with calcium release (hsa-miR-17-3p targeting STIM1, hsa-miR-19a-3p and hsa-miR-92b-3p targeting ITPR1). [score:7]
MiR19a/b was studied to positively regulate the NFAT activation and this effect was observed to be suppressed with calcineurin inhibitors [23]. [score:5]
In humans, the miR-17~92 cluster is composed of six members from four different seed families—miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. In mice, overexpression of the miR-17~92 cluster has been shown to be associated with an increased CD4+ T cell population and autoimmune disease [80]; however, similar data is not available for humans. [score:5]
Song D. W. Ryu J. Y. Kim J. O. Kwon E. J. Kim D. H. The miR-19a / b family positively regulates cardiomyocyte hypertrophy by targeting atrogin-1 and MuRF-1 Biochem. [score:4]
miRNAs observed to be involved in negative feedback loops, hsa-miR-21-3p, hsa-let-7b-5p, hsa-miR-17-5p, hsa-miR-19a-3p, hsa-miR-92b-3p and hsa-miR-17-3p, are targeting the NFAT activators, thus modulating down the NFAT activity. [score:3]
The four members of the miR-17~92 cluster, hsa-miR-17-3p, hsa-miR-17-5p, hsa-miR-19a-3p and hsa-miR-92b-3p, from this study have been observed to be involved in a negative feedback loop to target the calcineurin/NFAT signaling pathway. [score:3]
The next set of miRNAs observed to be involved in feedback loops, hsa-miR-17-3p, hsa-miR-17-5p, hsa-miR-19a-3p and hsa-miR-92b-3p, are part of the miR-17~92 cluster. [score:1]
Out of the 11 miRNAs, six (hsa-miR-21-3p, hsa-let-7b-5p, hsa-miR-17-5p, hsa-miR-19a-3p, hsa-miR-92b-3p and hsa-miR-17-3p) are involved in a negative feedback loops that modulates NFAT activity down and five miRNAs (hsa-miR-21-5p, hsa-miR-181c-5p, hsa-let-7c-5p, hsa-let-7b-3p and hsa-miR-155-5p) are involved in a positive feedback loops facilitating NFAT activation. [score:1]
[1 to 20 of 8 sentences]
28
[+] score: 28
Other miRNAs from this paper: hsa-mir-17, hsa-mir-34a, mmu-mir-34a, mmu-mir-17, mmu-mir-19a
Similar to the previous results, SHK also down-regulated the expression of miR-19a in a dose-manner in BL cells, which negatively regulated the expression of PTEN. [score:9]
MiR-19a is one of the oncogenic miR-17-92-cluster members which is up-regulated by C-MYC and can cause the activation of the PI3K/AKT pathway through down-regulation of PTEN [9]. [score:7]
As shown in Fig.   3E,F, 10058-F4 inhibited the expression of both C-MYC and miR-19a. [score:5]
Apart from association with cell proliferation and growth, C-MYC ties up with a great number of micro -RNAs that function as oncogenes such as miR-19a [9] or tumor suppressor genes such as miR-34a [33]. [score:3]
Additionally, consistent with our previous findings in vitro, the miR-19a expression of the SHK group was remarkably lower than the control group (Fig.   5E). [score:3]
In this study, we found that SHK also induced a dose -dependent reduction of miR-19a for Namalwa cells (Fig.   3B). [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 27
The magnitude of upregulation and the basal expression levels of the microRNA-19a and 19b are similar in both cell lines (Figure 3b, top). [score:6]
It has been reported that miR-19 antagonists lead to higher SOCS1 levels and miR-19 mimics can repress SOCS1 reporter constructs, thus obviously supporting the bioinformatic predictions that SOCS1 is a direct target of miR-19 [6]. [score:4]
miR-10b for instance is induced early in ME-15 and remains upregulated, while miR-19 abundance ceases after 24 h. In general, the majority of IRmiR genes were reset to basal levels after 24 h and further studies are needed for kinetic classification. [score:4]
This and the finding that miR-19 regulates SOCS1 [4] may be relevant for the regulation of cytokine signaling. [score:3]
Significance codes are defined by the intervals: '***' < 0.001 ≤ '**' < 0.01 ≤ '*' < 0.05 Table 2 Modulation of microRNA expression by IFNα—4 and 24 h after stimulation Control Interferon-alpha treated 4 h 24 h 4 h 24 h a ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF Validated microRNAs hsa-miR-19a 13,617 6,726 -1.02 18,318 17,178 -0.07 19,226 17,409 -0.10 14,425 14,079 -0.02 hsa-miR-19b 13,365 9,406 -0.42 25,463 22,438 -0.13 21,532 20,625 -0.04 18,039 17,440 -0.03 hsa-miR-30e-5p 9,497 6,838 -0.39 13,045 11,321 -0.15 12,643 10,887 -0.16 13,230 11,809 -0.12 hsa-let-7a 15,244 4,335 -2.52. [score:3]
Significance codes are defined by the intervals: '***' < 0.001 ≤ '**' < 0.01 ≤ '*' < 0.05 Table 2 Modulation of microRNA expression by IFNα—4 and 24 h after stimulation Control Interferon-alpha treated 4 h 24 h 4 h 24 h a ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF ME-15 HuH7 CHF Validated microRNAs hsa-miR-19a 13,617 6,726 -1.02 18,318 17,178 -0.07 19,226 17,409 -0.10 14,425 14,079 -0.02 hsa-miR-19b 13,365 9,406 -0.42 25,463 22,438 -0.13 21,532 20,625 -0.04 18,039 17,440 -0.03 hsa-miR-30e-5p 9,497 6,838 -0.39 13,045 11,321 -0.15 12,643 10,887 -0.16 13,230 11,809 -0.12 hsa-let-7a 15,244 4,335 -2.52. [score:3]
For the microRNAs let-7 a/b, miR-19 a/b, and miR-203, the PCR -based quantification method (Figure 2b) confirmed the direction of change found with microarray technology (Table 2a). [score:2]
32,691 29,710 -0.10 8,737 17,989 1.06* 20,599 17,405 -0.18. hsa-miR-19a 13,617 19,226 0.41* 18,318 14,425 -0.27 6,726 17,409 1.59. [score:1]
Detection of miR-30e failed in ME-15 cells due to technical problems, but induction in HuH7 was similar to miR-19a/b. [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 27
Their results included two of the most upregulated (miR-221 and miR-222) and six downregulated miRNAs (miR-151-3p, miR-19a, miR-20b, miR-342-3p, miR-363, and miR-576-3p). [score:7]
MiR-19 activated the PI3K/AKT pro-survival pathway via downregulation of several negative regulators [44]. [score:4]
MiR-19 was confirmed to regulate NF-κB signaling through direct targeting of CYLD with further in vitro experiments [45]. [score:4]
Moreover, luciferase assay experiments showed that miR-19 directly repressed the expression of CYLD, which plays a predominant role in the negative regulation of NF-κB, inducing activation of the NF-κB downstream program [45]. [score:4]
Among these are miR-19, which showed the highest expression of all members of the miR-17-92 cluster in human T-ALL. [score:3]
This expression of miR-19 is sufficient enough to promote leukemogenesis in NOTCH1 -induced T-ALL in vivo through coordination a phosphatidylinositol-3-OH kinase (PI3K) pathway related program of cell survival. [score:3]
As mentioned above, miR-19, which belongs to the miR-17-92 cluster, controlled multiple regulators (PP2A, PRKAA1, BIM, and PTEN) of PI3K signaling which resulted in increased phosphorylation of AKT and the ribosomal S6 protein, which subsequently promoted survival of T-ALL cells [44]. [score:2]
[1 to 20 of 7 sentences]
31
[+] score: 26
Other miRNAs from this paper: hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21
To determine whether miR-19a/b regulates the translation of PITX1 mRNA, we first generated 293T cells in which a miR-19a/b expressing or control vector (miR-vector) was transiently overexpressed. [score:8]
For overexpression of miR-19a/b, 5 × 10 [6] 293T cells were seeded in each well of 6-well plates and were transfected 24 h after seeding with 0.5 µg of pCMV-miR19a (cloning pre-miR19a sequence in to pCMV-miR plasmid; GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGU UGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC), pCMV-miR19b (cloning pre-miR19b sequence in to pCMV-miR plasmid; ACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUAUAUGUGGC UGUGCAAAUCCAUGCAAAACUGAUUGUGAUAAUGU) or pCMV-miR plasmid that also express the GFP gene that was used for fluorescence analysis of transfection efficiency (Origene, Rockville, MD, USA). [score:5]
Transient overexpression of miR-19b induced a significant decrease in PITX1 mRNA levels compared to miR-19a- or miR-vector -transfected cells (Fig 1C, P < 0.01). [score:2]
293T cells were chosen for these experiments because quantitative reverse transcription PCR (qRT-PCR) analysis indicated that endogenous miR-19a/b was expressed at a low level in 293T cells compared to normal human epidermal melanocytes (NHEMs) (supplementary Fig S1 online). [score:2]
Furthermore, analysis of these cells at 48 h after transfection showed that the protein level of PITX1 was markedly reduced in miR-19b overexpressing cells compared with the cells transfected with miR-19a or control vector without miR-19b (Fig 1 D). [score:2]
Supplementary information Supplementary information (A) Sequence alignment of the miR-19a/b nucleotide sites with the 3′UTR of PITX1 mRNA of different species. [score:1]
The sequences of miR-19a/b that are complementary to PITX1 3′-UTR mRNA sequences are shown in red. [score:1]
Sequences complementary to the eight seed nucleotides at the 5′ end of miR-19a/b are boxed. [score:1]
As shown Fig 1B, fluorescence microscopic analysis after 24 h indicated a high transfection efficiency for both the miR-19a/b and the miR-vector. [score:1]
miR-19a and miR-19b differ only a single nucleotide at position 11 from 5′ end (Fig 1A). [score:1]
Moreover, the PITX1 mRNA regions complementary to these 8 nt seed sequences of miR-19a/b are highly conserved among different species (Fig 1A). [score:1]
We identified miR-19a and miR-19b as a miRNA that includes a seed sequence at the 5′ end that is complementary to a sequence within the 3′UTR region of PITX1 mRNA (nucleotides 912-919). [score:1]
[1 to 20 of 12 sentences]
32
[+] score: 24
Three out of four upregulated ncRNA loci (Fig.   2b) encode polycistronic transcripts that could be processed to yield multiple miRNAs (Fig.   2b): chr11: MIR100HG (encoding mir-125b1, mir-let7a-2, mir-100), chr13: MIR17HG (encoding mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1) and chr22: MIRLET7BHG (encoding mir-3619, mir-let7a-3, mir-4763, mir-let-7b). [score:4]
Transient transfection of the mimic of mir-18a-5p resulted in a 65% downregulation of luciferase activity (Fig.   5e), while transfection of the mimic of mir-19a-3p showed no significant change (Fig.   5d). [score:4]
These reporter constructs were transfected into 293T cells lacking endogenous expression of mature mir-let-7p-2-3p, mir-18a-5p, mir-19a-3p or mir-125b-5p miRNAs, either alone or in combination with synthetic small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules, mimic miRNA (Sigma, St. [score:3]
To demonstrate the regulatory effects of mir-let-7a-5p, 18a-5p and mir-19a-3p, mir-19a-5p on NAP1L1, SMARCD2 and USP6 expression we performed in vitro luciferase assays (materials and methods). [score:3]
Analysis of pGL3- SMARCD2-3′UTR revealed a similar trend and confirmed that SMARCD2 is a target of two SA-miRNAs: mir-19a-3p and mir-125b-5p (Fig.   5c). [score:3]
This suggests that NAP1L1 is efficiently targeted by mir-let-7a-3p and mir-19a-3p, but not mir-18a-5p, which originates from the same cluster, MIR17HG. [score:3]
Contrary to that, only mature passenger strand miRNA for mir-19a- 3p is robustly recorded by real-time PCR (Fig.   2c). [score:1]
a Percentage of SA-β-Gal positive cells among the total amount of cells counted after transient transfection of the mimics of the SA-miRNAs from either the MIR17HG (mir-17-5p, mir-18a-5p, mir-19a-3p, mir-20a-5p and mir-92a1-5p) or the MIR100HG (mir-125b1-5p, mir-1let7a-2-3p, mir-100-5p) clusters separately or after simultaneous transfection by a full set of the SA-miRNA mimics from both clusters in SR hADSCs. [score:1]
The human chromosome 13 MIR17HG cluster (800bp) encodes six tightly grouped miRNAs with four distinct “seed” sequences 31, 50: mir-17, mir-18a, mir-19a, mir-20a, mir-19b1, and mir-92a1 (schematically shown in Fig.   2c). [score:1]
We have observed a statistically significant SEN-related increase in production of mature miRNAs in accordance with their corresponding primary non-coding transcripts MIR17HG: miR-17- 5p (p < 0.001), miR-18a- 5p (p < 0.01), miR-20a- 5p (p < 0.01), mir-92a1- 5p (p < 0.001) and mir-19a- 3p (p < 0.01) (Fig.   2c and Supplementary Figure S4A). [score:1]
[1 to 20 of 10 sentences]
33
[+] score: 24
In contrast, expression of miR-19a and miR-20a was downregulated in mouse NS cell differentiation. [score:6]
The possible role of miR-19a on cell survival, may explain why this miRNA was upregulated at early stages after the induction of mouse NS cell differentiation. [score:4]
The onset of miR-19a expression correlates with induction of proliferation during the first 3 days of differentiation (data not shown). [score:3]
Curiously, miR-19a expression was mostly increased during the first 3 days of differentiation, gradually decreasing toward control levels. [score:3]
Expression of specific proapoptotic (miR-16, let-7a and miR-34a) and antiapoptotic miRNAs (miR-20a and miR-19a) were analyzed by quantitative Real Time-PCR from 10 ng of total RNA using specific Taqman primers and GAPDH for normalization. [score:2]
Only limited information is available regarding the physiological role of miR-19a. [score:1]
However, additional studies are required to determine the specific role of both miR-20a and miR-19a during cell differentiation, and also evaluate if their expression is restricted to a specific cell type. [score:1]
In addition, the expression of antiapoptotic miR-19a and 20a was also evaluated. [score:1]
miR-19a and miR-20a are members of the miR-17-92 cluster [61], which consists of seven mature miRNAs, previously linked to tumorigenesis. [score:1]
Further, miR-19 appears to affect the level of proapoptotic protein Bim, thereby preventing apoptosis and promoting cell survival. [score:1]
Recently, additional functions have been assigned to this cluster, particularly to miR-20a and miR-19a. [score:1]
[1 to 20 of 11 sentences]
34
[+] score: 24
miR-19a and miR-19b could downregulate the expression of SOCS1 and SOCS3 in various tumors. [score:6]
miR-19a directly binds the 3′-UTR of the SOCS1 and regulates its expression in NSCLC cells; the transfection with miR-19a mimics significantly decreases the mRNA and protein levels of SOCS1 (91). [score:5]
microRNA-19a functions as an oncogenic microRNA in non-small cell lung cancer by targeting the suppressor of cytokine signaling 1 and mediating STAT3 activation. [score:5]
Similarly, miR-19a significantly decreases SOCS3 mRNA and protein, whereas a miR-19a antagonist specifically reverses the inhibitory effect of miR-19a to SOCS3 (92). [score:3]
Therefore, although few references have reported that miRNA -induced dysregulation of SOCS expression and function exerts significant influence on the clinical outcome of cancer patients, some miRNAs, such as miR-155, miR-19a, miR-19b, and miR-221, might be promising biomarker candidates in predicting and evaluating the clinical prognosis of certain tumor types. [score:2]
miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. [score:2]
Furthermore, the miR-19a -mediated reduction of SOCS3 enhances the IFN-α and IL-6 signal transductions through STAT3 (92). [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 23
In a mo del system mimicking physiological conditions, this investigation has found that brown propolis exerts anti-inflammatory activity through an epigenetic mechanism of action, being able to increase the expression levels of miR-19a-3p and miR-203a-3p, downregulate mRNA coding for TNF-α and downregulate TNF-α itself—a well-known proinflammatory cytokine involved in the initiation and propagation phases of inflammatory response—by the induction of Nuclear Factor kB (NF-kB), which is in turn involved in many biological processes, such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis [31]. [score:7]
The results indicated that miR-19a-3p and miR-203a-3p, which target mRNA coding for TNF-α, were significantly upregulated by propolis. [score:6]
Brown propolis, which is richer in flavonoids than in hydrocinnamic acid derivatives, was active on all miRNAs tested, while the treatment with green propolis caused changes in the expression levels of only two of the miRNAs, miR-19a-3p and miR-27a-3p. [score:3]
Moreover, our investigation showed that green propolis increases the expression levels of miR-19a-3p, but does not significantly modify mRNA and TNF-α expression levels. [score:3]
In particular, a significant increase in the expression levels of miR-19a-3p was registered following treatment with all tested concentrations of both green and brown propolis (green propolis: χ [2] = 17.56, df = 3, p < 0.001; brown propolis: χ [2] = 13.27, df = 3, p = 0.004), when compared to the control sample (Figure 3). [score:2]
For miR-19a-3p and miR-203a-3p, we investigated changes in the expression levels of mRNA coding for TNF-α. [score:1]
The PCR reaction was performed with a volume of 10 μL, containing 4 μL of cDNA, diluted 1:80, 5 μL of SYBRR Green Master Mix, and 1 μL of miR-19a-3p, 17-3p, 27a-3p, 203a-3p probes, provided by Euroclone (Pero, Milano, Italy). [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 23
Down-regulated miRNAs (cfa-miR-29 cluster, cfa-miR-19a, cfa-miR-101 and cfa-miR-137) in adult canine testis treated with DMSO, RA (Group 1) or CYP26B1 inhibitor (Group 2). [score:6]
In this study, cfa-miR-19a has been considerably down-regulated following RA treatment and CYP26B1 inhibitor treatment. [score:6]
A previous study [17] predicted that miR-19a targets the tumor suppressor Phosphatase and tensin homolog (PTEN), and PTEN has a negative effect on proliferation of primordial germ cells. [score:5]
Species of miRNA which were significantly down-regulated were cfa-miR-19a, cfa-miR-29b, cfa-miR-29c, cfa-miR-101 and cfa-miR-137 (Figure 6). [score:4]
Considering our result and this previous report, it can be suggested that cfa-miR-19a is required for proliferation of primordial germ cells during the early embryonic development. [score:2]
[1 to 20 of 5 sentences]
37
[+] score: 21
Indeed, downregulation of the miR-19 or miR-181 level in myeloma cells by an antisense nucleic acid has been demonstrated to suppress tumor growth in nude mice [20]. [score:6]
The miR-206 expression in C2C12 cells was efficiently downregulated to 22% by sgR206(1–14), and the miR-19a/b level in RPMI-8226 cells was reduced to 28% by sgR19(1–14) (Figure 5B,C). [score:6]
miRNAs to be targeted would include miR-19a/b and miR-21 for cancer therapy and miR-122 for hypercholesterolemia and hepatitis C treatments. [score:3]
It has been shown in human cells that miR-15a and miR-16 work as tumor suppressors, while miR-17-92, miR-19a/b, miR-21, and miR-181a/b are oncogenic [18]– [20]. [score:3]
We also examined three naked 14-nt sgRNAs against miR-142-3p, miR-206, and miR-19a/b for their guiding ability. [score:1]
The miR-16, miR-19a/b, Bcl-2 mRNA and β-actin mRNA levels were quantitated by real-time PCR using a LightCycler 480 SYBR Green I Kit (Roche). [score:1]
The miR-19a/b levels are normalized against the 5S rRNA levels. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 21
Our results have shown that miR-17 and miR-19 directly inhibit Pparα expression in cystic kidneys, but whether reducing Pparα gene dosage is sufficient to promote cyst growth is not known. [score:6]
miR-17 and miR-19 binding to Pparα 3′-UTR lead to reduced Pparα expression, which in turn affects mitochondrial metabolism in kidney epithelial cells. [score:3]
Similarly, deleting the miR-19 binding site abolished miR-19 -mediated, but not miR-17 -mediated, repression. [score:1]
Luciferase reporter assays revealed that compared with scramble, both miR-17 and miR-19 mimics suppressed wild-type Pparα 3′-UTR. [score:1]
Both miR-17 and miR-19 repressed Pparα 3′-UTR. [score:1]
The seed sequences for the miR-17 and the miR-19 binding sites were mutated in the WT-Pparα 3′-UTR construct to produce the Pparα 3′-UTR (Δ17) and Pparα 3′-UTR (Δ19) constructs. [score:1]
The following miRNA mimics were purchased from Dharmacon, Inc (Thermo Fischer Scientific Inc) - miR-17 (catalogue # C-310561-07-0005), miR-19a (catalogue # C-310563-05-0005) and negative control or Scrambled (catalogue # CN-001000-01-05). [score:1]
To test whether the binding sites are functional, we co -transfected mIMCD3 cells with a luciferase reporter plasmid containing Pparα 3′-UTR and miR-17, miR-19, or scramble mimics (Fig. 8b). [score:1]
Deleting the miR-17 binding site prevented miR-17 -mediated, but not miR-19 -mediated, repression. [score:1]
mIMCD3 cells were co -transfected with this plasmid and scramble (scr, black), miR-17 mimic (red) or miR-19 mimic (blue) (n=3). [score:1]
Watson-Crick base-pairing between miR-17/ PPARΑ 3′-UTR and miR-19/ PPARΑ 3′-UTR is shown. [score:1]
mIMCD3 cells were plated in six-well dishes (2 × 10 [5] cells per well) and transfected with 0.4 μg of pLS-Renilla-3′-UTR plasmids, and 10 nM of miR-17 or miR-19a mimic. [score:1]
In the cytoplasm, the mature miRNAs (miR-17 and miR-19) bind to Pparα 3′-UTR. [score:1]
Pparα 3′-UTR harbours an evolutionarily conserved binding site for miR-17 and miR-19 families (Fig. 8a). [score:1]
[1 to 20 of 14 sentences]
39
[+] score: 20
[37] The upregulation of p38α (MAPK14) protein seen in the current human study may be owing to the decreased expression of miR-19a/b, members of the miR-17/92 cluster, or miR-185-5p, as they are predicted to target human MAPK14 (TargetScan release 7.0: http://www/targetscan. [score:12]
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 19
[36– 38] miR-125b TLR signaling Abolish the cytokine production[39] miR-19a Enhance IFNα and interleukin-6[42] miR-192Upregulate TGF-β1 expressionMediate HCV infection -associated fibrogenesis[44] miR-152Target the WNT1 3′-UTRRegulate proliferation, G1-S transition, and colony formation in HepG2 cells[45] miR-491 Enhance HCV replication[46] miR-449a NOTCH signaling Inhibit TNFa -mediated activation of YKL40[49] HCV hepatitis C virus IFN interferon miRNA microRNAs DUSP dual specific phosphatases TLR toll-like receptor JAK/STAT Janus kinase/signal transducer and activator of transcriptions SOCS suppressors of cytokine signaling TGF-β transforming-growth factor-β PI3K/Akt phosphatidylinositol 3-kinase and Akt/protein kinase B NS5A non-structural protein 5A HZ made contributions to conception and design of the work, and was a major contributor in writing the manuscript. [score:13]
miR-19a, a member of the miR-17-92 cluster that is dysregulated in HCV infection [41], probably has similar clinical value, as it suppresses SOCS3 expression to enhance IFNα and interleukin-6 signaling via STAT3, and thus activates [42]. [score:6]
[1 to 20 of 2 sentences]
41
[+] score: 19
Furthermore, we found a significant upregulation of miR-19, miR-192, miR-194, and miR-215 in the tumor compartment of the lung metastases and a significant downregulation of the same miRNAs in the liver metastases. [score:7]
In the tumor stroma only miR-19, miR-215, and miR-21 showed a significant downregulation in the liver metastases compared to the lung metastases, but none of the miRNAs was downregulated more than by 2-fold. [score:6]
miR-125 and miR-199-5 showed a 2-fold; miR-19 and miR-127 showed a 4-fold; miR-215 showed a 100-fold; miR-194 showed a 150-fold; and miR-192 showed a 300-fold upregulation in the normal liver tissue compared to the normal lung tissue. [score:3]
miR-194 showed a 1.5-fold; miR-125, miR-127, and miR-192 showed a 2.5-fold; miR-19 and miR-215 a 3-fold; miR-145, miR-199-3, and miR-429 a 5-fold; miR-21 a 7-fold; and miR-199-5 a 12.5-fold downregulation in the liver metastases compared to the lung metastases. [score:3]
[1 to 20 of 4 sentences]
42
[+] score: 19
Specifically, miR-375 is predicted to be involved in a KEGG pathway associated with diabetes (Figure 2) and the cluster miR-19 a/b is associated with numerous pathways with a significant role in the biology of NAFLD, including apoptosis, mTOR, MAPK, adipocytokine and hedgehog signaling [2]; a full list of predicted pathways is shown in Figure 2. Figure 2The graph represents a heat-map of predicted targets aggregated in co -expression clusters and ranked according to their biological function based on KEGG (Kyoto Encyclopaedia of Genes and Genomes) pathways or Gene Ontology (GO) analysis. [score:5]
Specifically, miR-375 is predicted to be involved in a KEGG pathway associated with diabetes (Figure 2) and the cluster miR-19 a/b is associated with numerous pathways with a significant role in the biology of NAFLD, including apoptosis, mTOR, MAPK, adipocytokine and hedgehog signaling [2]; a full list of predicted pathways is shown in Figure 2. Figure 2The graph represents a heat-map of predicted targets aggregated in co -expression clusters and ranked according to their biological function based on KEGG (Kyoto Encyclopaedia of Genes and Genomes) pathways or Gene Ontology (GO) analysis. [score:5]
Predicted analysis of target genes, regulatory network and associated functional pathways of miR-375 and the cluster of miR-19a-b. DISCUSSION. [score:4]
Predicted targets of miR-19a and 19b consist of a list of 3577 and 3320 genes, respectively; 1789 and 1660 of which falling within the first 50th percentile, respectively. [score:3]
Specifically, we tested the hypothesis of an association between rs2829145 genotypes and circulating levels of mir-122, miR-192, miR-375 and the complex miR-19 a/b; these miRNAs were selected because we already found a significant association with NAFLD [24]. [score:1]
In the A-allele carriers, we observed increased circulating levels of the complex miR-19a (p =0.008) and miR-19b (p =0.0009), as well as circulating levels of miR-375 (p =0.029) (Figure 1). [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 18
In addition, Guinot et al. [54] found that the high level of expression of miR-19a/b were targeted and down-regulated the levels of p38a kinase, providing a specific survival signal for Lgr6p cells which mediated by increased Wnt/Δ-catenin activity. [score:8]
MiR-17, miR-19, and miR-92 played a role in resistance to apoptosis, since thet could directly inhibit the produced pro-apoptotic proteins through the MAPK/ERK and PI3 K/AKT signaling pathways, which were important in cell survival regulation [52]. [score:5]
A meta-analysis by Jamali et al. [43] found that elevated expressions of miR-18a (HRs = 2.4113, 95% CIs:1.283–4.5289), and miR-19a (HRs = 2.260, p = 0.034) was significantly associated with poor survival in patients with human head and neck squamous cell carcinoma (HNSCC). [score:3]
The following search terms and combinations were used in keyword and subject heading searches: (“miR-17-92 cluster” OR “miR-17” OR “miR-18a” OR “miR-19a” OR “miR-19b” OR “miR-20a” OR “miR-92a” OR “miR-106a” OR “miR-106b”) and (“neoplasm” OR “neoplasia” OR “cancer” OR “tumor” OR “carcinoma” OR “adenoma”) and (“prognosis” OR “survival” OR “mortality” OR “outcome”). [score:1]
The miR-17-92 family maps to human chromosome 13 (13q31.3) and encodes for the miR-17–92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, miR-92a) and two paralogs (miR-106a, miR-106b) [12]. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 18
The expression levels of miRNA-146a, miR-150, miRNA-375, and miRNA-19a were significantly downregulated in patients with AF. [score:6]
Only the expression tendencies of miRNA-150, but miRNA-146a, miRNA-19a, and miRNA-375, correspond to the result of the in-depth analysis. [score:3]
Patients with PersAF had significantly higher levels of miR-146a and miR-19a expression than the control group (fold change = 5.2; 4.0 P<0.01). [score:3]
Absolute expression values of miR-146a, miR-150, miR-19a, and miR-375 in PAF patients (n = 30), PersAF patients (n = 30), and the control group (n = 30). [score:3]
Patients with PersAF had significantly higher levels of miR-150 and miR-19a expression compared to patients with PAF (fold change = 6.6; 3.5 P<0.01). [score:2]
Four candidate microRNAs (miRNA-146a, miRNA-150, miRNA-19a and miRNA-375) were tested using an independent cohort of 90 plasma samples with qRT-PCR. [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 18
Expression of the miRNAs miR-19a and miR-19b is also found up-regulated in gastric cancer tissue where they contribute to multi drug resistance in the host cell by targeting the important tumor suppressor protein PTEN [42]. [score:10]
After 20 min miR-18a, miR-19a, miR-19b, and miR-20a were significantly down-regulated (Figure 2A). [score:4]
Wang F. Li T. Zhang B. Li H. Wu Q. Yang L. Nie Y. Wu K. Shi Y. Fan D. microRNA-19a/b regulates multidrug resistance in human gastric cancer cells by targeting pten Biochem. [score:4]
[1 to 20 of 3 sentences]
46
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
The selectivity of HDI -mediated silencing of AICDA/Aicda and PRDM1/Prdm1 was emphasized by unchanged expression of HoxC4 and Irf4 (important inducers/modulators of AICDA/Aicda), Rev1 and Ung (central elements for CSR/SHM), and Bcl6, Bach2, or Pax5 (repressors of PRDM1/Prdm1 expression), as well as unchanged expression of miR-19a/b, miR-20a, and miR-25, which are not known to regulate AICDA/Aicda or PRDM1/Prdm1. [score:8]
[1 to 20 of 2 sentences]
47
[+] score: 17
As with many targets of miRNA, four confirmed targets of miR-19 (Bim, PTEN, PRKAA1, and PP2A) act to negatively regulate the phosphatidylinositol-3-kinase (PI3K) pathway [31], suggesting that the oncogenic effect of overexpressed miR-17-92 in acute leukaemias may be related to the silencing of these genes. [score:8]
High expression of both miR-19a and miR-19b, members of the miR-17-92 cluster, also targets SOCS1 in myeloma cells [76]. [score:5]
In T-ALL without MLL-rearrangements, miR-17-92 has also shown oncogenic potential as induced expression of miR-19 accelerated the development of ALL in mice [63]. [score:4]
[1 to 20 of 3 sentences]
48
[+] score: 17
Of the miRNAs expressed, miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c expression were significantly increased (p< = 0.05) in human macropahge after exposure to Toxoplasma infection for 24 h (Figure  1A). [score:5]
Several miRNAs upregulated in human macropahge following Toxoplasma infection are cluster miRNAs; e. g., miR-19a, miR-19b and miR-20a are from the miR-17 ~ 92 gene cluster. [score:4]
Together, these data demonstrate that STAT3 binding to the promoter element of the miR-17 ~ 92 gene mediates miRNAs (miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a) upregulation in human macrophage in response to Toxoplasma infection. [score:4]
Increased expression of miR-20a, miR-125, miR-19a, miR-19b, miR-27b and miR-30c were noted in human macrophage at 6 h and 12 h postinfection, the abundance of these miRNAs significantly increased by ~23.5-fold at 24 h postinfection. [score:3]
Of note, miR-19b, miR-19a and miR-20a are cluster gene miRNAs and co-transcribed with a host gene, C13orf25 [26]. [score:1]
[1 to 20 of 5 sentences]
49
[+] score: 17
Furthermore, miR-19 targeting downregulates the expression of BIM, a proapoptotic gene, that has been described to be expressed under the control of 17~92 cluster in other malignancies [33]. [score:10]
SOCS-1 downregulation induces constitutive STAT3 phosphorylation, which is reversed when MM cell lines are transfected with anti miR-19. [score:4]
miR-19a and -19b have been identified as negative regulator of SOCS-1, a protein that controls IL-6 mediated signaling. [score:2]
Among others, cluster members include miR-19a, -19b, and miR-32. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 16
miR-182 and 181c were upregulated (⇑) and miR-19a was downregulated (⇓). [score:7]
miR-19a was downregulated by addition of 2′ -O-methyl (2′ -O-Me)- miR-19a. [score:4]
Three miRNAs (miR-181c, miR-182, miR-19a) were selected from among the miRNA-mRNA high correlation pairs to test whether the correlations predicted changes that could be reproduced experimentally. [score:1]
The above figure represents Ct [scrambled]-Ctpre-mir/2′ -O-Me from three individual transfection experiments of pre- miR-181c, pre- miR-182, 2′ -O-Me- miR-19a, 2′ -O-Me-scrambled and pre-mir-scrambled. [score:1]
0000804.g005 Figure 5The above figure represents Ct [scrambled]-Ctpre-mir/2′ -O-Me from three individual transfection experiments of pre- miR-181c, pre- miR-182, 2′ -O-Me- miR-19a, 2′ -O-Me-scrambled and pre-mir-scrambled. [score:1]
Three independent transfections were performed for each pre-mir and 2′ -O-Me oligoncleotide of miR-181c, miR-182, miR-19a and a scrambled pre-miR or 2′ -O-Me as a negative control (Ambion, TX). [score:1]
Twenty-four hours after the transfections of pre- miR-182, pre- miR-181c, 2′ -O-Me- miR-19a, as well as a pre-miR scramble or a 2′ -O-Me scramble, we collected total RNA for real-time RT-PCR to determine the relative changes in the levels of the correlated mRNAs (Figure5). [score:1]
[1 to 20 of 7 sentences]
51
[+] score: 16
Accessing the detailed page, we further acquired that miR-19a regulates H3K4me3 states of the miR-17-92 cluster through directly targeting Egr2 and Jardi1b and influences DNA methylation of H3R8 and H4R3 by repressing PRMT5. [score:5]
Similarly, the epigenetic modifications that can affect miR-19a could be searched in the ‘Epigenetic Modification Affects miRNA Expression’ section. [score:3]
The searching result page shows nine records indicating that H3K4me3, H3K79me2, histone acetylation and DNA methylation can all affect miR-19a expression in diverse conditions (Figure 2b). [score:3]
To this end, we merged the aforementioned regulatory information and created a molecular network to reflect the interaction between miR-19a and diverse epigenetics (Figure 2c). [score:2]
Taking miR-19a as an example, we learned that miR-19a can both affect H3K4me3 states in human macrophage and control DNA methylation modification of human leukemia and lymphoma cells through querying in the ‘MiRNA Regulates Epigenetic Modifications’ section (Figure 2a). [score:2]
Figure 2. Searching result and integrated network of ‘miR-19a’. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 16
Van Almen et al. [29] reported that decreased hsa-miR-19 expression leads to increased expression of CTGF and TSP-1 in aged failure-prone hearts. [score:5]
The miRNAs hsa-miR-19a (12 degrees) and hsa-miR-19b (12 degrees) were significantly down-regulated in the DCM samples. [score:4]
Previous studies show that miRNA-19a and 19b are members of the miR-17-92 cluster, which regulates the expression of ECM proteins CTGF and TSP-1 in the ageing-related heart failure process [35]. [score:4]
In the network, the performance differences in the most critical miRNAs (hsa-miR-340, hsa-miR-19a, hsa-miR-19b, etc. ) [score:1]
The miRNAs hsa-miR-200b (16 degrees), hsa-miR-181c (14 degrees), hsa-miR-340 (13 degrees), hsa-miR-557 (13 degrees), hsa-miR-19a (12 degrees), hsa-miR-19b (12 degrees) and hsa-miR-548f (12 degrees) were significantly differentially regulated in DCM samples compared with non-failing control samples. [score:1]
The key miRNAs identified included hsa-miR-181c, hsa-miR-19a and hsa-miR-19b, which all have higher degrees in the network diagram. [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 15
Other miRNAs from this paper: hsa-mir-106a, mmu-mir-106a, mmu-mir-106b, mmu-mir-19a, hsa-mir-106b
We previously reported that GSE down-regulated the miR-17-92 cluster host gene (MIR17HG) and miR-19a/b in various NSCLC (A549, H520, H1299) and bronchial premalignant cancer cells, leading to up-regulations of their downstream targets - tumor suppressors PTEN and IGF2R [8]. [score:11]
However, it is noteworthy that GSE did not significantly decrease MIR106B nor miR-106b expression in H520, a squamous cell carcinoma cell line, in contrast to what was observed with miR-19a/b. [score:3]
We recently reported that modulations of oncogenic microRNA (miRNA) or oncomir miR-19a/b, contributed to the antineoplastic properties of GSE against non-small cell lung cancer (NSCLC) and bronchial premalignant cells [8]. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 15
In the cases of miR-130b and miR-19a, up regulated in HP (with positive correlation with the cell-cycle genes), and miR-449a, miR-299, miR-154 and miR-145, downregulated in HP (with negative correlation with the cell-cycle genes), the effect of miRNA over -expression on proliferation was confirmed in cell lines. [score:7]
Of those over-expressed in the HP samples we found the strongest matching effect for miR-146b (MCF-7) and miR-150 (BT-474), but we also see an agreement for miR-19a and miR-130b (Figure 5A and B and Table S7). [score:3]
The top miRNAs with elevated expression levels in basal-like samples were miR-18a/b (TNoM p<2E-10) and other members of the miR-17-92 cluster (miR-17/17*, miR-18a/b, miR-19a, miR-20a and miR-106a). [score:3]
The miRNAs selected for this validation were miR-17-5p, miR-18a, miR-18b, miR-19a, miR-29c, miR-34c-5p, miR-142-3p, miR-150 and miR-449a, and the endogenous control used was RNU6B. [score:1]
The right panel shows the signal distribution in the 101 samples for three selected miRNAs, miR-142-3p, miR-19a, and 449a, with signal intensities for sample 570 (red dot) and 627 (green dot) highlighted. [score:1]
[1 to 20 of 5 sentences]
55
[+] score: 15
Only a few miRNAs were concordantly regulated by both HBx forms e. g. miR-23a up-regulation and miR-19a/b down-regulation (Figure 3A). [score:8]
For example, miR-23a and -125a up-regulation as well as miR-19a/b down-regulation by both HBx forms were verified (Figure 3B). [score:7]
[1 to 20 of 2 sentences]
56
[+] score: 15
According to TargetScan7.0, CCND1 could be targeted by miR-15, miR-16, and miR-19 at different binding sites. [score:5]
However, none of miR-15a, miR-15b, miR-19a, miR-19b-2 showed consistent differential expression between NE2 and ESCC cells. [score:3]
We detected expression of miR-15a, miR-15b, miR-19a, and, miR-19b-2 but not miR-19b-1 in the cell lines examined. [score:3]
The expression and function of miR-15 and miR-19 have not been reported before. [score:3]
miR-15 has two transcripts (miR-15a and miR-15b), and miR-19 has three transcripts (miR-19a, miR-19b-1, and miR-19b-2). [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 15
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
[1 to 20 of 2 sentences]
58
[+] score: 15
Two miRNA (miR-195-5p and miR-16-5p) strongly upregulated GBA1 expression, while three miRNA (miR-127-5p, miR-19a-5p, and miR-1262) downregulated SCARB2, an important membrane receptor involved in Gba availability. [score:9]
Interestingly, only few miRNA (miR-26b, miR-19a, and miR-19b) target genes which are directly related to metabolism of cholesterol, considering that the prior cause of NPC disease is the cholesterol storage. [score:6]
[1 to 20 of 2 sentences]
59
[+] score: 15
In addition to its oncogenic effects, the miR-19 regulon is reported to control NF-κB signaling by targeting members of the ubiquitin-editing protein complex in the cells stimulated with purified bacterial product (47), suggesting that targeting this miRNA regulon could regulate the activity of NF-κB signaling in inflammation. [score:6]
Lewis A, Mehta S, Hanna LN, Rogalski LA, Jeffery R, Nijhuis A, Kumagai T, Biancheri P, Bundy JG, Bishop CL, Feakins R, Di Sabatino A, Lee JC, Lindsay JO, Silver A 2015 Low serum levels of microRNA-19 are associated with a stricturing Crohn's disease phenotype. [score:3]
Huhn D, Kousholt AN, Sorensen CS, Sartori AA 2015 miR-19, a component of the oncogenic miR-17 approximately 92 cluster, targets the DNA-end resection factor CtIP. [score:3]
Gantier MP, Stunden HJ, McCoy CE, Behlke MA, Wang D, Kaparakis-Liaskos M, Sarvestani ST, Yang YH, Xu D, Corr SC, Morand EF, Williams BR 2012 A miR-19 regulon that controls NF-kappaB signaling. [score:1]
To date, no study has reported the role of the miR-19 regulon in the context of any virus -mediated inflammatory response. [score:1]
Genetic anatomization of the relative contribution of the individual miRNAs of this cluster has demonstrated that miR-19 recapitulated on its own the oncogenic effects of the full cluster (63). [score:1]
[1 to 20 of 6 sentences]
60
[+] score: 14
It is suggested that SMAD2/4 is regulated by miR-18 in neuroblastoma cells [66] and that SMAD4 is targeted by miR-19a/b in thyroid follicular cells [68]. [score:4]
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 8 sentences]
61
[+] score: 14
- In, up-regulation is shown for miR-19a (position 5), miR-183 (position 9), and miR-141 (position 10); we also observe that miR-182 (position 3) is likely to be a true positive. [score:4]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 14
[40] The upregulation of miR-19a in acute liver failure (ALF) results in the downregulation of NBR2 and AMPK expression, which represses autophagy. [score:9]
In light of the protective role of autophagy in the progression of ALF, activation of the miR-19a- NBR2/AMPK regulatory axis exacerbates ALF. [score:2]
Another study demonstrates that miR-19a can negatively regulate NBR2 and AMPK, probably by base pairing between miR-19a and NBR2 or miR-19a and PRAA1 (the gene encoding AMPK). [score:2]
[40] This study gave rise to the hypothesis of a ceRNA network in which NBR2 might act as a sponge for miR-19a and prevent it from binding to AMPK mRNA. [score:1]
[1 to 20 of 4 sentences]
63
[+] score: 13
As other targets, mRNA from TLR is regulated by miRNAs, and miR-19a and miR-19b were demonstrated to upregulate TLR-2 expression in RASF; even more, downregulation of miR-19b in activated RASF was associated with an increased production in IL-6 and MMP3 release, so they seem to work as negative regulators of inflammatory responses [62]. [score:13]
[1 to 20 of 1 sentences]
64
[+] score: 13
In the colon, up-regulated miR-17-92a promotes neoplasia through various pathways, e. g. miR-18a and miR-19 directly repress TSP-1 and CTGF, respectively, to promote angiogenesis [24] and miR-92a down-regulates BCL2L11 expression thereby reducing apoptosis [44]. [score:10]
As shown in Fig.   1e, consistent with previous reports [15, 26], miR-17, miR-18a, miR-19a/b and miR-20a, were decreased by 40 to 70 % after butyrate treatment. [score:1]
In addition to the aforementioned miR-17 and miR-20a, the miR-17-92a cluster encodes miR-18a, miR-19a/b and miR-92a. [score:1]
Butyrate treatment also decreased the levels of other miR-17-92a cluster members, including miR-17, miR-18a, miR-19a/b and miR-20a. [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 13
miR-19a is a member of the miR-17–92 cluster, which has been reported to be upregulated during T-cell activation (69, 86). [score:4]
Upregulation of miR-19a also caused increased inflammation and promoted a Th2 type response (55). [score:4]
Examination of CD4 [+] T cells isolated from the bronchoalveolar lavage fluid from asthmatic human patients revealed that miR-19a had the highest expression (55), which promoted a Th2 -mediated cell response, a known response contributing to allergic asthma. [score:3]
miR-19a has also been shown to be critical in regulating Th1 type responses through the production of interferon gamma following antigen stimulation in a mouse mo del (69). [score:2]
[1 to 20 of 4 sentences]
66
[+] score: 13
Of the large number of targets whose expression levels correlated negatively with miR-19a and/or miR-19b in TCC (Table S6), many genes were well known to be associated with cancer based on previous functional studies. [score:5]
Thus, we believed that down-regulation of miR-19a and miR-19b may also promote the tumorigenic process of TCC. [score:4]
In short, the aberrant expression of miR-19a/b and miR-20b may result in the alterations of many downstream activities, and they may therefore they may serve as the ideal candidates for future therapeutics development. [score:4]
[1 to 20 of 3 sentences]
67
[+] score: 13
Since co-expressed miRNAs have been shown to coordinately regulate canonical cell signaling networks associated with cell death and cell survival [18], it is notable that we found that all members of the miR-17-92 cluster (miR-17-5p, miR-18a, miR-19a, miR-92a) are upregulated after TBI and these miRNAs co-target and possibly negatively co-regulate many TBI-altered genes. [score:10]
Microfluidic analysis of laser captured neurons has never been reported; in this proof-of-principle experiment, although differences did not reach statistical significance due to the stochastic variability in the six 30 cell pools of dying or surviving neurons, we detected a trend in increased expression of miR-15b and miR-19a in dying neurons. [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 13
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
[1 to 20 of 1 sentences]
69
[+] score: 13
On the other hand, some miRNAs highlighted by either differential expression or concentrations in the SN of inflamed M1 macrophages, such as miR-146a, miR-155, and miR-19a, also showed decreased expression in human obese AT after weight loss (Table  2). [score:5]
On the other hand, the expression of ‘miRNokines’ such as miR-146b, miR-376c, miR-411, and miR-19a by inflamed adipocytes/obese AT may hint into functional activities beyond adiposity, such as recruitment of immune cells [25], or modulation of insulin-secreting cells [26]. [score:3]
Indeed, concomitantly with weight loss and improved AT inflammation (Additional file 2: Table S2), current data pointed decreased AT expression of miRNAs which detection inside isolated cells (for example, miR-146b, miR-376c, miR-411) and/or in the SN (miR-221, miR-222, miR-155, miR-223, miR-19a/b) rose in differentiated adipocytes upon inflammatory stimuli (Table  2). [score:3]
Indeed, some miRNAs became undetectable (miR-1274B, miR-572, and miR-766), while others appeared de novo in cells (miR-140-5p, miR-222*, miR-376c, miR-411, and miR-146a) and their SNs (miR-146a, miR-146b, miR-19a, miR-223*, miR-425, and miR-9*) upon MCM -induced inflammation (Figure  2). [score:1]
Although no significant variations were identified in miR-222, modulation of miR-19a (0.5-fold, P = 0.032, and 2-fold, P = 0.034) and decreased miR-145 in both cells and SNs (0.2-fold, P = 0.005, and 0.14-fold, P = 0.032) were shown in M1 macrophages reacting to LPS (Table  2). [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 12
Thus, we note that the predicted targeting and down-regulation of SPHK2 by miR-19a and miR-19b in the first 20 hours post-PMA stimulation could prevent the metabolism of two anti-proliferative metabolites simultaneously, thereby inhibiting proliferation. [score:8]
Interestingly, miR-19a and miR-19b (part of the cluster), are predicted to target sphingosine kinase 2 (SPHK2) mRNA in four independent databases (see). [score:3]
The miRNA cluster on chromosome 13 contains several miRNAs (hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-19b-1, and hsa-mir-92-1 (hsa-mir-92-1 excluded from analysis, due to ambiguous nomenclature)) that are transcribed as a single transcript. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 12
Indeed, some R1-miR19 displayed a relatively low body weight and a normal glucose regulation, whereas their respective R2-miR19 progeny displayed the full disorder (increased body weight, altered blood glucose levels and insulin tolerance). [score:2]
This phenomenon was made apparent by analysis of the progenies of individual R1-miR19 males crossed with control females, namely the R2-miR19 progenies (Fig. 4e). [score:1]
The R1-miR19 fathers and their respective R2-miR19 progenies are indicated by grey-filled or red-filled circles. [score:1]
At 16 weeks of age, two R1-miR19 male were crossed with females to obtain the R2-miR19 progeny. [score:1]
Further investigation on the miR-19 mice through the transcriptomic analysis of either early embryo and/or adipose-derived stem cells will provide additional insight into the mechanisms of miR-19 action and will help to identify genes involved in the development of obesity and/or metabolic disorders at the very early stages of development. [score:1]
Indeed, it is interesting to note that some R2-miR19 mice developed the full miR19 phenotypes despite the normal metabolic features of their R1-miR19 progenitors. [score:1]
Strikingly, males and females born from miR19b-microinjected one-cell embryos (designated R1-miR19) had, in average, body weights greater than the controls (34.17g ± 6.5 vs. [score:1]
This individual variation was also evident in R1-miR19 mice. [score:1]
None of the R1-miR19 mice, however, showed increased values of fasting glucose levels (Fig. 4c), which is at odds with the more complete pathology observed for the WD series, but is similar to the R1-sperm injected progenies and to the previously published reports of metabolic alterations without overt diabetes 10. [score:1]
By quantitative RT-PCR analysis, we confirmed the deregulation of miR-182, miR-19a, miR-19b, miR-29a and miR-340 in testis and sperm RNA of the WD males compared to SD males (Table 1). [score:1]
Theses results suggest that upon RNA injection, epigenetic changes take place which can remain phenotypically silent but are later transmitted to the progeny (R2-miR19 obese males were born from R1-miR19 normal males) (Fig. 4). [score:1]
[1 to 20 of 11 sentences]
72
[+] score: 12
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
2013.125 24212931 42. van Almen GC Verhesen W van Leeuwen RE van de Vrie M Eurlings C Schellings MW MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failureAging Cell. [score:4]
Moreover, the work of van Almen et al. [42] linked miR-19a and miR-19b with age-related heart failure. [score:1]
The same study validates the presence of miR-19b in the miR-19a/-19b pair which ranked second and both miRNAs were defined as age -dependent. [score:1]
We corroborate to this observation since the miR-19a/-19b and miR-18a/-18b pairs scored high in terms of synergy (2 [nd] and 7 [th] rank respectively) despite not participating in the consensus modules. [score:1]
[1 to 20 of 5 sentences]
73
[+] score: 11
The expression of hsa-miR-138, hsa-miR-409 and hsa-miR-19 showed significant difference between two groups. [score:3]
The expression of hsa-miR-138 (a), hsa-miR-409 (b), hsa-miR-19 (c) and hsa-miR-204 (d) were tested in fetal hippocampus tissues of DS and control group. [score:3]
Of all miRNA-mRNA pairs, we also selected hsa-miR-409-5p, which played roles in cell proliferation and apoptosis [16], along with its predicted target genes, SMARCC1 and EFNB1, and another two miRNAs, hsa-miR-19-3p and hsa-miR-204-5p to validate the microarray results. [score:3]
The expression of hsa-miR-19 and hsa-miR-204 were reduced in DS group compared to control group. [score:2]
[1 to 20 of 4 sentences]
74
[+] score: 11
For instance, downregulation of miR-141 increases CUL3 expression in Hirschsprung's disease [49], and miR-19 targets CUL5 to regulate proliferation and invasion of cervical cancer cells [50]. [score:11]
[1 to 20 of 1 sentences]
75
[+] score: 11
5) 7 hsa-mir-19a dbDEMC 32 hsa-mir-30d dbDEMC 8 hsa-mir-92a HMDD, miR2Disease 33 hsa-mir-451 literature 9 hsa-mir-210 miR2Disease 34 hsa-mir-152 dbDEMC 10 hsa-mir-19b dbDEMC, miR2Disease 35 hsa-mir-215 dbDEMC 11 hsa-mir-224 dbDEMC, miR2Disease 36 hsa-mir-130a dbDEMC, HMDD 12 hsa-let-7f dbDEMC, miR2Disease 37 hsa-mir-499 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
76
[+] score: 11
Eight up-regulated miRNAs, including miR-19a-3p, miR-877-3p, miR-148a-3p, miR-212-5p, miR-1825, miR-210-3p, miR-940, and miR-134-5p, and two down-regulated miRNAs, miR-3609 and miR-145-5p, were identified as statistically significant different miRNAs. [score:7]
MiR-148a and miR-19a have been reported to influence the +3142 C/G polymorphism of HLA-G, resulting in the down-regulation of HLA-G in PE[14]. [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 11
Strong inverse correlation was observed between the tumor suppressor PTEN and several members of the miR-17, miR-19, miR-130/301 and miR-26 families, which were upregulated in the osteosarcoma cell lines. [score:6]
In addition, the expression of the tumor suppressor gene phosphatase and tensin homolog (PTEN) inversely correlated with miR-17, miR-20b, miR-9* and miR-92a (Table 2), but also showed a modest inverse correlation (r = −0.4 to −0.5) with other miRNAs of the miR-17, miR-19, miR-130/301 and miR-26 families (Table S6). [score:5]
[1 to 20 of 2 sentences]
78
[+] score: 11
Mir-19a, which is also predicted to inhibit SOCS1, has been shown to decrease SOCS3 expression and subsequent IFN-α and IL-6 signaling by regulating the JAK-STAT pathway (180). [score:5]
Other miRNAs are predicted to bind SOCS1, including mir-150 (172), mir-221 (173), mir-572 (174), and mir-19a (175); upregulation of these miRNAs correlates with increased inflammation. [score:4]
miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. [score:2]
[1 to 20 of 3 sentences]
79
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Further experiments confirmed that up-regulation of miR-19a increased proliferation rates by inhibiting TGF-beta receptor 2. Over -expression of this miRNA also resulted in reduced levels of the phosphorylated activated form of SMAD3. [score:8]
Another miRNA profiling study found that only miR-19a differentiated severe asthma from mild asthma patients and healthy controls, as no significant differences in expression were found for mild asthmatics [40]. [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 11
More specifically, that study showed that miR-19a, miR-101, and miR-130a co-regulate the 3′-UTR of ATXN1 through the inhibition of ATXN1 translation [48]. [score:6]
SCA1 miR-19, −101 and −130 downregulate the ATXN1 gene Candidate miRNAs were identified using the PicTar algorithm. [score:4]
Interestingly, miR-101 affected both the mRNA and protein levels, whereas miR-19a and miR-130a decreased the protein levels only. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 10
The miRNA hsa-miR-19a that also showed a high MI value and up-regulation in our study was reported to be up-regulated in lung cancer tissue [34, 35]. [score:7]
Some of the deregulated miRNAs identified in our study are also reported as de-regulated in other cancer entities, e. g. hsa-miR-346 in gastritic cancer, hsa-miR-145 in bladder cancer, and hsa-miR-19a in hepatocellular carcinoma and B-cell leukemia [38- 42]. [score:3]
[1 to 20 of 2 sentences]
82
[+] score: 10
Studies have reported that resveratrol suppresses glioma cell growth by down -regulating oncogenic microRNAs (miR-21, miR-30a-5p, miR-19) and up -regulating their targets’ expression, which are closely relevant to glioma formation and development [7]. [score:10]
[1 to 20 of 1 sentences]
83
[+] score: 10
Two miRNAs (hsa-miR-19a and hsa-miR-21) were found to target PTEN (Table I) and form two self-adaptation associations. [score:3]
For example, MIR17HG encodes six miRNAs, and four of these miRNAs (hsa-miR-17, hsa-miR-20a, hsa-miR-19a and hsa-miR-19b-1) target CCND1. [score:3]
hsa-miR-19a is regulated by MYC and PTEN and hsa-miR-19a and PTEN form a self-adaptation association. [score:2]
Furthermore, hsa-miR-19a and hsa-miR-21 are also regulated by PTEN. [score:2]
[1 to 20 of 4 sentences]
84
[+] score: 10
The importance of these functions have been demonstrated by showing that retroviral overexpression of a cassette containing miR-17, miR-18 and miR-19 in mice results in c-Myc -induced lymphoma [29]. [score:3]
MiRNA microarray profiling reveals that Toxoplasma infection increases the levels of miR-17-, miR-18- and miR-19 -family members. [score:1]
As miR-17 family members are co-transcribed with members of the miR-18 (Figure S1, blue box), miR-19 and miR-25 families, and are encoded in three separate paralogous loci (miR-17∼92, miR-106a∼363 and miR-106b∼25; Figure 1B), we assembled a heat-map from our microarray data that contains the averaged fold-change values for all probes that hybridized to members of the miR-17, miR-18, miR-19 or miR-25 families (18, 4, 4, and 4 probes, respectively; Figure 1C). [score:1]
Examples relevant to the present work are four families of miRNAs (miR-17, miR-18, miR-19 and miR-25) that are encoded by three paralogous loci; these related loci, which are miR-17∼92, miR-106b∼25 and miR-106a∼363 (see Figure 1B), produce primary transcripts that are post-transcriptionally processed to yield mature miR-17, miR-18, miR-19 and miR-25 family members. [score:1]
Upon Toxoplasma infection, miR-17 family members collectively increased ∼3-fold, and miR-19 and miR-25 family members increased ∼1.5-fold. [score:1]
These results suggest that the mature miR-18 and miR-19 family members that increase upon infection with Toxoplasma are derived from miR-17∼92; although pri-miR-106b∼25 is also increased in Toxoplasma-infected cells, miR-106b∼25 does not encode miR-18 and miR-19 family members and, consistent with previous reports [32], [37], no pri-miR-106a∼363 was detectable. [score:1]
Colors of each miRNA indicate the miRNA family to which each belongs; miR-17 = yellow; miR-18 = green; miR-19 = blue; miR-25 = red. [score:1]
MiR-18, miR-19 and miR-25 family members also showed an increase in abundance in RNA samples derived form Toxoplasma-infected HFFs (Figures 2C). [score:1]
[1 to 20 of 8 sentences]
85
[+] score: 10
From the top downregulated miRNAs, miR205 has been reported as a negative regulator of E-cadherin levels, promoting, through Snail upregulation, a more proliferative and invasive phenotype [32] and silencing of miR-19 has been described to reverse EMT in lung cancer by suppressing E-cadherin [33]. [score:10]
[1 to 20 of 1 sentences]
86
[+] score: 10
It is seen that the expression of miR-17, miR-18a, miR-19, miR-20a, miR-21, miR-31, miR-92a, and miR-224 is upregulated in lung cancer cells and inhibition of their expression can reduce cell growth and invasion capacities [7, 39– 41]. [score:10]
[1 to 20 of 1 sentences]
87
[+] score: 9
On the basis of intermediate regulation the regulatory network identified some novel hub miRs(hsa-miR-200c, hsa-miR-200b, hsa-miR-200a, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-18a, hsa-miR-141 and hsa-miR-92a) which were not reported earlier in association with PD and hence can be considered as potential target for future study. [score:4]
The 9 IR hub miRs in Group 2 regulatory network which play an important role in inter-regulatory signal transduction were hsa-miR-200c, hsa-miR-200b, hsa-miR-200a, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-18a, hsa-miR-141and hsa-miR-92a. [score:3]
Surprisingly most of the 23 novel miRs were found to be associated with several cancer pathways such as Pancreatic Cancer (hsa-miR-200c [41], hsa-miR-141 [42]), Lung Cancer (hsa-miR-200c [43], hsa-miR-143 [44]), Colorectal Cancer (hsa-miR-200c [45], hsa-miR-338-3p [46]), Bladder Cancer (hsa-miR-200b, hsa-miR-200a, hsa-miR-141, hsa-miR-17, hsa-miR-27b) [47]- [49], Breast Cancer (hsa-miR-200b [50], hsa-miR-147 [51]), Esophageal Cancer (hsa-miR-200a, hsa-miR-141, hsa-miR-143, hsa-miR-15a) [52], [53], Prostate Cancer (hsa-miR-19a) [54], Oral Carcinoma (hsa-148b) [55], Cervical Cancer (hsa-miR-15a) [56], Gastric Cancer (hsa-miR-192) [57] etc. [score:1]
Moreover hsa-miR-19a, hsa-miR-20a, hsa-miR-17 and hsa-miR-155 have been reported to have a role in periodontal inflammatory pathways [65]. [score:1]
[1 to 20 of 4 sentences]
88
[+] score: 9
Supporting in vitro and tissue level high expression of miR-17-5p, a clinical study proves serum levels of miR-17 along with miR-19a, miR-20a and miR-223 were significantly upregulated in CRC patients compared to controls [104]. [score:5]
In marked contrast, antisense oligonucleotides against miR-18a, miR-19a or miR-92-1 led to no or slight inhibition of cell growth, indicating that single miRNAs of the miR-17-92 cluster have distinct roles on cancer formation and progression. [score:3]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 9
Other miRNAs from this paper: hsa-mir-22, hsa-mir-221, hsa-mir-126
Furthermore, exosomes derived by rMSCs transduced with GATA-4 contained high levels of several miRNAs, among them miR-221 and miR-19a; interestingly, these EVs were able to reduce apoptosis of ischemic cardiomyocytes via miR-221 -dependent inhibition of p53 -upregulated modulator of apoptosis (PUMA), a subclass of the Bcl-2 protein family [53], but also via miR-19a -associated inhibition of PTEN that resulted in activation of Akt and ERK pathways [45]. [score:8]
In some studies the specific exosome-contained molecules able to mediate the protective effects on myocardium were identified: miR-19a promoted the cardioprotective Akt/ERK signaling [45], miR22 reduced apoptosis and improved ischemic injury [46], and 20S proteasome subunits exerted cardioprotection through degradation of misfolded proteins [47] (Table 1). [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 9
In the main study plasma from the 77 subjects were analysed for expression of 12 miRNAs (let-7a, let-7f, miR-19a, miR-22, miR26a, miR28-5p, miR-99b, miR151-5p, miR-221, miR-532-3p, miR-548-3p, miR-766). [score:3]
Values are mean ± SD Two of the 12 selected miRNAs (miR-19a and miR-548b-3p) were detected in only a few of the samples due to low expression and not included in the following presentation. [score:3]
Values are mean ± SDTwo of the 12 selected miRNAs (miR-19a and miR-548b-3p) were detected in only a few of the samples due to low expression and not included in the following presentation. [score:3]
[1 to 20 of 3 sentences]
91
[+] score: 9
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Finally, hsa-miR-19b [47, 54] and hsa-miR-483-5p [47, 53], which are upregulated, and hsa-miR-28-5p [47, 53], hsa-miR-19a [48, 53] and hsa-miR-1973 [48, 51], which are downregulated, are expressed in spermatozoa, but they have not been associated with spermatogenesis or related processes. [score:9]
[1 to 20 of 1 sentences]
92
[+] score: 8
miR-19 and miR-21 have been found to target PTEN, a gene/protein found localized in the neurofibrillary tangles (NFTs) and senile plaques in Alzheimer's disease brains [97], [98]. [score:5]
The next top five microRNAs found in the regulatory network were miR-124, miR-135a, miR-141, miR-182 and miR-19a. [score:2]
We suggest that the following nine microRNAs namely, miR-135 A1, miR-141, miR-153-1, miR-15 A, miR-16-1, miR-182, miR-19 A, miR-27 A and miR-96 could be of potential interest in HD. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 8
The template encoding the pre-miR-19a with the natural loop and short flanking sequence was noticeably poor (Fig. 3A), but it became a more efficient template when its wild-type (wt) loop was replaced with the TAR RNA loop and the flanking sequences were lengthened (compare 19a and 19am). [score:1]
When the miR-19a RCT transcript was treated with IP'd Drosha, the same processed RNAs produced by WCE were released from the transcript, but in higher amounts (Fig. 4A, lane 4). [score:1]
A. Linear (L) and circular (C) templates 122, 122m, 19a, 19am, encoding either pre-miR-122 or pre-miR-19a, were transcribed in the presence of all NTPs or all except ATP (C-). [score:1]
We tested this variable, in combination with the longer flanking sequences, by swapping the native miRNA loops in pre-miR-19a and miR-122 for an unrelated RNA hairpin loop (from HIV TAR RNA), resulting in pre-miR19am and pre-miR122m (monomer transcripts are shown in Fig. 1B). [score:1]
In two other COLIGOS, 19am and 122m, we included more of the natural flanking sequences (taken in both cases from the miR19a genomic template-strand sequence), for a total of 22 and 18 flanking nt, respectively. [score:1]
Linear DNA templates encoding shortened forms of pri-miR-19a, -miR-122 and -miR19am (e. g. Fig. 2B) were synthesized by IDT as single 5′ phosphorylated Ultramer sequences. [score:1]
To determine whether native miRNA cDNA secondary structure might pose a general impediment to RCT, we exposed the four COLIGOs encoding miR-19a and miR-122 to T7 and E. coli RNAPs in vitro (Fig. 3A). [score:1]
We designed DNA circles to encode shortened versions of two human pri-miRNAs, miR-19a and miR-122. [score:1]
[1 to 20 of 8 sentences]
94
[+] score: 8
Song D. W. Ryu J. Y. Kim J. O. Kwon E. J. Kim D. H. The miR-19a/b family positively regulates cardiomyocyte hypertrophy by targeting atrogin-1 and MuRF-1 Biochem. [score:4]
In cardiac hypertrophy, the miR-19a/b family positively regulates cardiomyocytes hypertrophy by targeting atrogin-1 and MuRF-1 [29]. [score:4]
[1 to 20 of 2 sentences]
95
[+] score: 8
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
[1 to 20 of 4 sentences]
96
[+] score: 8
Specifically, members of the miR-17-92 cluster were deregulated in our dataset: miR-19a and miR-19b were strongly up-regulated, in addition to moderate up-regulation of miR-17-3p/miR-17-5p and miR-92b. [score:8]
[1 to 20 of 1 sentences]
97
[+] score: 8
Bone morphogenetic protein receptor 2 (BMPR2) is known to be targeted by miR-19a, −20a and miR-25 [28] and predicted to be targeted by miR-455. [score:5]
miR-19a, −140, −150 and -26b are predicted to target white fat-related genes (BMP2 or BMPR2 or HOXC9) [39, 41] and therefore may have a role in selecting cell fate toward brown adipogenesis. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 8
Other miRNAs from this paper: hsa-mir-17, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-198, hsa-mir-208a, hsa-mir-10a, hsa-mir-223, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-29c, hsa-mir-99b, hsa-mir-296, hsa-mir-196b, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-640, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-550a-3, bta-mir-29a, bta-mir-125b-1, bta-mir-126, bta-mir-10a, bta-mir-124a-1, bta-mir-17, bta-mir-29b-2, bta-mir-29c, bta-mir-150, bta-mir-122, bta-mir-125b-2, bta-mir-19a, bta-mir-99b, hsa-mir-208b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, bta-mir-124a-2, bta-mir-124b, bta-mir-146a, bta-mir-155, bta-mir-196b, bta-mir-208a, bta-mir-208b, bta-mir-223, bta-mir-296, bta-mir-29d, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, hsa-mir-548q, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, bta-mir-2284w, bta-mir-2284x, hsa-mir-548y, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-548ay, hsa-mir-548az, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Similarly, miR-19a has been shown to regulate expression of SOCS 3, an important suppressor of cytokine signaling (25). [score:6]
miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. [score:2]
[1 to 20 of 2 sentences]
99
[+] score: 8
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21
These miRNAs typically downregulate PTEN mRNA levels by targeting it for degradation and include miR-17, miR-19, and miR-21 [83– 85]. [score:6]
While several examples of miR-17 and miR-19 -mediated PTEN RNA levels have been reported in the cancer literature, miR-21 has been described to play a critical role in repair and recovery, a developmental signaling-related process. [score:2]
[1 to 20 of 2 sentences]
100
[+] score: 8
Other miRNAs from this paper: mmu-mir-19a
Accordingly, addition of IL-4 increased the expression of miR-19a and suppressed IL-10 also in-vitro. [score:5]
B cells of ovalbumin-sensitized mice expressed high levels of the micro RNA miR-19a in the intestinal mucosa, in parallel with low levels of IL-10 [49]. [score:3]
[1 to 20 of 2 sentences]