sort by

274 publications mentioning hsa-mir-18a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-18a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 231
analysis revealed that PTEN expression was repressed by transfection with miR-18a mimics or si-TP53TG1#1, while PTEN expression was facilitated following miR-18a downregulation or TP53TG1 upregulation (Fig.   5a, b). [score:11]
In our study, the data showed that miR-18a expression was markedly upregulated and miR-18a expression was inversely correlated with TP53TG1 expression in NSCLC tissues. [score:10]
Additionally, qRT-PCR assay displayed that TP53TG1 and PTEN mRNA levels were upregulated, while miR-18a expression was downregulated in tumors derived from lenti-TP53TG1 -transfected A549/DDP cells with or without cisplatin treatment (Fig.   6c). [score:8]
Moreover, miR-18a -induced decrease of luciferase activity of PTEN-WT vector was remarkably reversed by TP53TG1 upregulation, while anti-miR-18a-triggered increase of luciferase activity of PTEN-WT vector was evidently counteracted following TP53TG1 downregulation (Fig.   5c, d). [score:7]
Furthermore, TP53TG1 overexpression resulted in a decrease of miR-18a expression and an increase of PTEN expression in resected tumors derived from A549/DDP cells with or without cisplatin treatment. [score:7]
Our study revealed that miR-18a negatively regulated PTEN expression in A549 cells and PTEN level was significantly downregulated in NSCLC tissues. [score:7]
TP53TG1 suppressed miR-18a expression in NSCLC cells by direct interaction. [score:6]
A previous document has verified that the tumor suppressor phosphatase and tensin homolog (PTEN) was a direct target of miR-18a [16]. [score:6]
These data displayed that TP53TG1 -induced apoptosis was greatly lowered in A549/DDP cells after up-regulation of miR-18a (Fig.   4e), while si-TP53TG1-elicited reduction on apoptosis was significantly reverted following the regaining of miR-18a expression in A549 cells (Fig.   4f). [score:6]
All these data indicated that TP53TG1 sensitized NSCLC cells to cisplatin by enhancing apoptosis via suppressing miR-18a expression. [score:5]
Whereas, no evident effects was observed in the luciferase activity of TP53TG1-MUT following miR-18a upregulation or knockdown (Fig.   3c, d). [score:5]
These results discovered that TP53TG1 -mediated increase of cisplatin sensitivity and apoptosis was abated following the restoration of miR-18a expression in A549/DDP cells, while si-TP53TG1 -induced decrease of cisplatin sensitivity and apoptosis was antagonized after transfection miR-181a inhibitor in A549 cells. [score:5]
Fig.  3TP53TG1 inhibited miR-18a expression in NSCLC cells. [score:5]
TP53TG1 suppressed miR-18a expression in A549 cells. [score:5]
Moreover, miR-18a expression was inversely correlated with TP53TG1 expression in NSCLC tumor tissues (Fig.   3j). [score:5]
Moreover, TP53TG1 -mediated enhancement effect on cisplatin sensitivity was abated following the restoration of miR-18a expression in A549/DDP cells, while si-TP53TG1 -induced decrease of cisplatin sensitivity and apoptosis was counteracted by miR-18a inhibitor in A549 cells. [score:5]
MTT assay revealed that TP53TG1 -induced decrease of IC50 of cisplatin was strikingly recovered by miR-18a overexpression in A549/DDP cells (Fig.   4c), while si-TP53TG1-triggered increase of IC50 of cisplatin was remarkably abrogated by miR-18a downregulation (Fig.   4d). [score:5]
Taken together, these results indicated that TP53TG1 could inhibit miR-18a expression in NSCLC cells. [score:5]
Furthermore, TP53TG1 promoted PTEN expression via inhibiting miR-18a. [score:5]
Subsequent luciferase reporter experiments, RNA pull-down analysis, RIP and qRT-PCR assay confirmed that TP53TG1 suppressed the expression of miR-18a via direct interaction. [score:5]
qRT-PCR assay of miR-18a expression (e) and PTEN expression pattern (f) in HBE, A549 and A549/DDP cells. [score:4]
It was reported that PTEN was a direct target of miR-18a in multiple cancers, such as luminal breast cancer [16]. [score:4]
As shown in Fig.   3g, qRT-PCR assay displayed that miR-18a level was markedly repressed after TP53TG1 was upregulated, while miR-18a expression was remarkably promoted following TP53TG1 depletion compared with their counterparts respectively. [score:4]
These data demonstrated that miR-18a expression was significantly increased (Fig.   3h) in NSCLC tumor tissues compared with normal tissues, and miR-18a expression in DDP-resistant group was about threefold than that in control group (Fig.   3i). [score:4]
Interestingly, qRT-PCR results also revealed that miR-18a expression was significantly increased in A549 cells compared with HBE cells, and it was markedly upregulated in A549/DDP cells when compared to A549 cells (Fig.   1e). [score:4]
Fig.  4TP53TG1 -induced cisplatin sensitivity of NSCLC cells was decreased following miR-18a upregulation. [score:4]
Additionally, a recent document demonstrated that miR-18a level was significantly associated with therapeutic response, and miR-18a downregulation sensitized NSCLC cells to radiation treatment [20]. [score:4]
Fig.  5TP53TG1 regulated PTEN expression through miR-18a in NSCLC cells. [score:4]
TP53TG1 regulated PTEN expression in NSCLC cells by acting as a molecular sponge of miR-18a. [score:4]
g qRT-PCR assay of miR-18a expression in A549 cells transfected with si-TP53TG1#1 or pcDNA-TP53TG1 for 48 h. h qRT-PCR assay of miR-18a expression in 40 pairs of NSCLC samples. [score:3]
j The correlation between TP53TG1 and miR-18a expression was detected in NSCLC samples. [score:3]
qRT-PCR analysis was used to detect the expression of TP53TG1, miR-18a and PTEN mRNA in NSCLC tissues and cells. [score:3]
A mutation in the miR-18a -binding site sequence of TP53TG1-WT was created using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA) to generate TP53TG1 mutant-type reporter vector (TP53TG1-MUT). [score:3]
a PTEN expression was assessed by western blot in A549 cells transfected with miR-18a mimics or anti-miR-18a. [score:3]
qRT-PCR analysis presented that TP53TG1 -induced reduction of miR-18a expression was markedly restored by cotransfection with miR-18a mimics in A549/DDP cells (Fig.   4a), while si-TP53TG1#1-triggered promotion of miR-18a level was significantly reversed by cotransfection with anti-miR-18a in A549 cells (Fig.   4b), in comparison to their counterparts. [score:3]
In a word, these findings demonstrated that TP53TG1 contributed to PTEN expression via modulating miR-18a in NSCLC cells. [score:3]
All miRNA mimics (miR-18a mimics, miR-NC), miRNA inhibitors (anti-miR-NC, anti-miR-18a), and si -RNAs (si-NC, si-TP53TG1#1 and si-TP53TG1#2) were designed and synthesized by Sigma-Aldrich (St. [score:3]
TP53TG1 -mediated cisplatin sensitivity was abated following the restoration of miR-18a expression in NSCLC cells. [score:3]
Furthermore, the enhancement effect of TP53TG1 on cisplatin sensitivity might be mediated by miR-18a/PTEN axis in NSCLC cell line, indicating a potential target for improving NSCLC chemotherapy. [score:3]
Firstly, the effect of miR-181a and TP53TG1 on PTEN expression was explored in A549 cells by transfecting with miR-18a mimics, anti-miR-18a, si-TP53TG1#1 or pcDNA-TP53TG1. [score:3]
Then, we further measured the expression of miR-18a, and the interaction between TP53TG1 and miR-18a expression in NSCLC samples. [score:3]
qRT-PCR reactions were performed to detect TP53TG1, miR-18a and PTEN mRNA expression using SuperScript Platinum SYBR™ Green One-Step qRT-PCR Kit (Invitrogrn) on an 7900HT Fast Real-Time PCR System (Applied Biosystems). [score:3]
All these results made us draw a conclusion that TP53TG1 enhanced the sensitivity of cisplatin in NSCLC via regulation of miR-18a/PTEN pathway. [score:2]
Non-small cell lung cancer (NSCLC) Cisplatin Drug sensitivity Tumor protein 53 target gene 1 (TP53TG1) MiR-18a PTEN Non-small cell lung cancer (NSCLC), a heterogeneous class of tumors, represents approximately 85% of all new lung cancer diagnoses [1]. [score:2]
Data showed that the luciferase activity of TP53TG1-WT was significantly suppressed by transfection with miR-18a mimics (Fig.   3c), while it was obviously promoted when introducing with anti-miR-18a (Fig.   3d) compared with corresponding counterparts. [score:2]
Thus, we further observed whether TP53TG1 regulated miR-18a/PTEN axis in NSCLC cells. [score:2]
All these results implied that TP53TG1 regulated miR-18a/PTEN axis in NSCLC cells. [score:2]
i qRT-PCR assay of miR-18a expression in DDP-sensitive NSCLC tissues and DDP-resistant NSCLC samples. [score:2]
A549/DDP cells were transfected with pcDNA-TP53TG1 alone or together with miR-18a mimics, followed by qRT-PCR assay of miR-18a expression (a), MTT analysis of IC50 of cisplatin (c) and flow cytometry analysis of apoptotic rate (e). [score:2]
These data showed that luciferase activity of PTEN-WT vector was significantly inhibited by introduction with miR-18a mimics, while it was substantially promoted after miR-18a depletion compared with homologous control (Fig.   5c, d). [score:2]
c, d The luciferase activity was detected in A549 cells transfected with TP53TG1-WT or TP53TG1-MUT and miR-con, miR-18a mimics, anti-miR-con or anti-miR-18a. [score:1]
TP53TG1 increased the sensitivity of NSCLC cells to cisplatin by modulating miR-18a/PTEN axis, elucidating a novel approach to boost the effectiveness of chemotherapy for NSCLC. [score:1]
A549 cells were introduced with si-TP53TG1#1 alone or together with anti-miR-18a, followed by measurement of miR-18a expression by qRT-PCR (b), determination of IC50 of cisplatin by MTT (d), detection of apoptotic rate by flow cytometry (f). [score:1]
In total, these findings suggested that TP53TG1 increased the sensitivity of NSCLC cells to cisplatin through repressing miR-18a. [score:1]
a Sequence alignment of miR-18a with the putative binding sites within the wild-type regions of TP53TG1. [score:1]
To verify the direct binding between miR-18a and TP53TG1, dual-luciferase reporter assay, and were performed in A549 cells. [score:1]
was performed by transfecting PTEN-WT vector into A549 cells together with miR-18 mimics or miR-18a mimics + pcDNA-TP53TG1 (c), and anti-miR-18a or anti-miR-18a + si-TP53TG1#1 (d). [score:1]
The data presented that TP53TG1 harbored seven conserved cognate sites of miR-18a, predicting that TP53TG1 might serve as a ceRNA of miR-18a. [score:1]
Then, A549 cells were cotransfected with TP53TG1-WT or TP53TG1-MUT and miR-18a mimics or anti-miR-18a. [score:1]
Thus, we further explored whether the enhancement effect of TP53TG1 on cisplatin sensitivity was mediated by miR-18a in NSCLC cell line. [score:1]
c qRT-PCR analysis of TP53TG1, miR-18a and PTEN mRNA levels in excised tumor tissues. [score:1]
RNA pull-down results displayed that miR-18a enrichment in Bio-TP53TG1-probe group was significantly higher than negative control group (Fig.   3e). [score:1]
Furthermore, TP53TG1 -induced sensitivity of cisplatin to NSCLC cells might be mediated by miR-18a/PTEN axis. [score:1]
To further explore whether the enhancement effect of TP53TG1 on cisplatin sensitivity of NSCLC was mediated by miR-18a, A549/DDP cells were transfected with pcDNA-TP53TG1 alone or together with miR-18a mimics, and A549 cells were transfected with si-TP53TG1#1 alone or together with anti-miR-18a. [score:1]
The sequences of TP53TG1 containing the putative binding sites of miR-18a and the 3′-UTR of PTEN containing the intact miR-18a recognition sequence, were amplified by PCR and cloned into pGL3 vector (Promega, Madison, WI, USA) to generate TP53TG1 wild-type reporter vector (TP53TG1-WT) and PTEN wild-type reporter vector (PTEN-WT), respectively. [score:1]
MiR-18a, a member of the oncogenic miR-17-92 cluster, has been found to be involved in a variety of human cancers, including NSCLC. [score:1]
Interestingly, the data stated that there existed complementary sequences between miR-18a and TP53TG1 (Fig.   3a). [score:1]
[1 to 20 of 67 sentences]
2
[+] score: 207
Compared with the normal liver cell LO2, p21 expression was downregulated in Hep3B and Bel-7402 cells, whereas this inhibition was reversed by miR-18a inhibitor (Figure 4D). [score:9]
In the present study, we determined that miR-18a is aberrantly upregulated in HCC and promotes hepatocellular carcinoma cell motility by inhibiting KLF4, implying that miR-18a may play a positive role in the regulation of human HCC progression. [score:7]
The expression of KLF4 was negatively associated with the expression of miR-18a expression in HCC tissues (Figure 3D). [score:7]
It was found that miR-18a overexpression significantly inhibited the luciferase activities of KLF4-3’-UTR-wt reporter in two cell lines, whereas miR-18a mimic transfection exhibited no inhibitory effects on the luciferase activities of KLF4-3’-UTR-mut reporter in cells (Figure 3B). [score:7]
The migration of cells induced by miR-18a mimic was also inhibited by KLF4 overexpression as shown in Figure 4C, indicating that miR-18a promotes the proliferation and migration of hepatocellular carcinoma cells by targeting KLF4. [score:7]
As shown in Figure 1A, miR-18a was expressed at low levels in the adjacent normal liver tissues, while it was significantly upregulated in the liver cancer tissues. [score:6]
The upregulation of KLF4 expression reversed the promoting effect of miR-18a on the proliferation capacity of Hep3B and Bel-7402 cells (Figure 4B). [score:6]
Previous reports demonstrate that miRNA-18a expression is significantly upregulated in HCC and may present a novel screening biomarker for early diagnosis of HCC [17]. [score:6]
In addition, we confirmed that the protein level of KLF4 was strongly downregulated by miR-18a mimic, but increased by miR -18a inhibitor in Hep3B and Bel-7402 cells (Figure 3C). [score:6]
Here, we demonstrated that KLF4 is a direct target of miR-18a and can be inhibited by miR-18a at the posttranscriptional manner in HCC cells. [score:6]
miR-18a expression was upregulated in human HCC tissues and cell lines. [score:6]
To further elucidate the underlying mechanism of miR-18a regulating hepatocellular carcinoma cells, we predicted the possible targets of miR-18a using TargetScan 6.2 and miRDB databases. [score:6]
Notably, we found that the overexpression of KLF4 reverses the effect of miR-18a on the proliferation and migration of HCC cells, indicating that miR-18a may increase the motility of HCC cells by directly targeting KLF4. [score:6]
miR-18a was found to be significantly upregulated in HCC and promotes hepatocellular carcinoma cell motility by inhibiting KLF4. [score:6]
In contrast, miR-18a inhibitor significantly increased the expression of p21 in parallel with an enhanced KLF4 level, indicating that miR-18a may promote hepatocellular carcinoma cell growth and invasion by regulating the activity of KLF4 as well as downstream p21. [score:6]
However, there was no effect of miR-18a mimic and inhibitor on the mRNA expression of KLF4. [score:5]
Furthermore, we investigated the expression of miR-18a in human HCC cell lines Hep3B, Bel-7402, Huh7 and SK-hep-1. Compared to the normal liver cell LO2, miR-18a expression was upregulated in the Hep3B, Bel-7402, Huh7 and SK-hep-1 cells to different extents (Figure 1B). [score:5]
Increased expression of miR-18a increased the proliferation and migration capacity of cultured HCC cells, whereas miR-18a repression exhibited an inhibitory effect on HCC cell motility in vitro. [score:5]
Dysregulation of the miR-18a family expression has been detected in various cancers and was proven to be correlated with the biological mechanism of tumor development [15]. [score:5]
KLF4 is the direct target of miR-18a in hepatocellular carcinoma cells. [score:4]
miR-18a serves as a positive regulator of HCC cell motility by targeting KLF4. [score:4]
Compared with the control miRNA, the miR-18a expression was significantly enhanced by the mimic but reduced by the inhibitor in both Hep3B and Bel-7402 cell lines (Figure 2A). [score:4]
miR-18a is upregulated in human HCC tissues and cells. [score:4]
These findings imply that miR-18a plays a positive role in the regulation of hepatocellular carcinoma cell motility by repressing the inhibitory effect of KLF4 on cell cycle progression. [score:4]
On the contrary, the proliferation capacity of these two cell lines was significantly restrained by miR-18a repression induced by inhibitor. [score:3]
Figure 2Cultured Hep3B and Bel-7402 cells were transfected with miR-18a mimic, inhibitor, or negative control miRNA (s-MiR). [score:3]
The miR-18a mimic, inhibitor, and negative control miRNA were purchased from RiboBio (Guangzhou China) and transfected into cells at 100 nM concentrations via Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
The efficiency of miR-18a mimic and inhibitor was confirmed by RT-PCR. [score:3]
miR-18a increases HCC cells motility by targeting KLF4. [score:3]
These results suggest that high levels of endogenous miR-18a may play a regulatory role in the development of HCC by promoting HCC cell proliferation and migration. [score:3]
Site-directed mutagenesis was introduced into the miR-18a binding site of KLF4 mRNA using QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene). [score:3]
Cultured Hep3B and Bel-7402 cells were transfected with miR-18a mimic, inhibitor, or negative control miRNA (s-MiR). [score:3]
Results showed that the migration of Hep3B and Bel-7402 cell lines was significantly increased by miR-18a overexpression, but repressed by miR-18a silencing (Figure 2C). [score:3]
Herein, the Hep3B and Bel-7402 cell lines were chosen as the cell mo dels according to the difference of miR-18a expression. [score:3]
Increased miR-18a level plays a positive role in hepatocellular carcinoma by promoting the proliferation and migration of HCC cells through targeting downstream KLF4 and p21. [score:3]
miR-18a was found to target the ESR1 gene, which encodes for the estrogen receptor α (ERα) protein. [score:3]
We then introduced miR-18a mimic and inhibitor to determine the possible effects of miR-18a on the proliferation and migration of human hepatocellular carcinoma cells in vitro. [score:3]
In this study, we found that KLF4 is a potential direct target of miR-18a with a binding site in the 3’-UTR and investigated the role of miR-18a in regulating hepatocellular carcinoma cell proliferation and migration. [score:3]
The CT values of U6 and GAPDH were used as the internal control to normalize the relative expression of miR-18a and KLF4 respectively. [score:3]
To explore that KLF4 is indeed the downstream mediator of miR-18a in promoting hepatocellular carcinomacell motility in vitro, we employed a KLF4 plasmid to specifically induce the expression of KLF4 in cells (Figure 4A). [score:3]
KLF4 is the target of miR-18a in HCC cells. [score:3]
However, the regulatory mechanism of miR-18a in HCC progression is still unknown. [score:2]
The functional study of the effect of increased levels of miR-18a on both ligand-stimulated transcriptional activation and cell proliferation activity of ERα further supported its involvement in regulating ERα’s functions [16]. [score:2]
Taken together, these data suggest that miR-18a may play a positive role in the regulation of human HCC progression. [score:2]
To further confirm the involvement of KLF4 in miR-18a -mediated effects, we investigated the expression of p21. [score:1]
miR-18a promotes the proliferation and migration of human HCC cells. [score:1]
The 3’-UTR regions of KLF4 containing the predicted binding site of miR-18a or the mutant site were cloned into a luciferase vector (Figure 3A). [score:1]
KLF4 plasmid (1ug; Origene, Rockville, MD, USA) was also transfected into cells in the presence or absence of the miR-18a mimic by Lipofectamine 2000. [score:1]
In addition, our results revealed the positive role of miR-18a in HCC tumorigenesis. [score:1]
Expression of miR-18a was measured using MicroRNA First-Strand Synthesis and miRNA Quantitation kits (Takara, Dalian, China) according to the manufacturer’s instructions. [score:1]
miR-18a promotes the proliferation and migration of HCC cell lines. [score:1]
We first investigated the expression levels of miR-18a in sample tissues of patients with hepatocellular carcinoma to determine the role of miR-18a in HCC. [score:1]
In HCC, miRNA-18a was found to be significantly elevated and might be a potential screening biomarker for hepatocellular carcinoma [17]. [score:1]
The 3’-UTR fragment of KLF4 mRNA was then subcloned into the pGL3 luciferase vector (Promega, Madison, WI, USA) by PCR method and cotransfected with miR-18a mimic into HCC cells for 36 h in 96-well plates using Lipofectamine 2000. [score:1]
Figure 3 (A) The predicted binding site of miR-18a in the 3’-UTR of KLF4. [score:1]
After cotransfection with miR-18a mimic and KLF4 plasmid, (B) cell proliferation and (C) migration were then tested. [score:1]
However, the precise role of miR-18a in the pathogenesis of HCC remains unknown. [score:1]
[1 to 20 of 57 sentences]
3
[+] score: 162
Other miRNAs from this paper: hsa-mir-18b, hsa-mir-4735
In the current study, luciferase and qRT-PCR assays also confirm that PIAS3 is a direct target of miR-18a, and up-regulation of miR-18a enhances STAT3 -mediated gene expression by regulating the expression of PIAS3. [score:11]
Thus, these findings demonstrate that overexpression of miR-18a may contribute to the downregulated expression of PIAS3 and consequentially may enhance the expression of several STAT3 -mediated genes. [score:10]
Next, we utilized qRT-PCR and western blot analysis to reveal that the ectopic expression of miR-18a significantly suppressed the mRNA and protein level of PIAS3 in CRC cell lines (Fig. 4E), indicating that miR-18a can directly target PIAS3. [score:8]
In support of this notion, qRT-PCR analysis showed that miR-18a expression is upregulated in the CRC tissues, and inversely correlates with CASC2 expression. [score:8]
This result reveals directly competitive binding with miR-18a between CASC2 and PIAS3 mRNA, further indicating that CASC2 functions as a ceRNA and modulates the expression of miR-18a targets in CRC to suppress cancer progression (Fig. 5D). [score:8]
Recent work reported that overexpression of miR-18a could promote cell proliferation in gastric cancer by regulating PIAS3 expression and consequentially increase STAT3 activity, leading to enhanced activation of genes downstream of STAT3 modulated by CASC2 -targeting miRNAs. [score:8]
In contrast to CASC2, miR-18a expression is up-regulated in CRC tissues relative to adjacent normal controls (P < 0.001; Fig. 4A), which is consistent with previous studies 31 32. [score:6]
miR-18a directly targets the PIAS3 geneAmong the many targets of miR-18a, we concentrated on PIAS3 33. [score:6]
To further confirm the role of PIAS3 as a miRNA-18a “sponge”, we observed that down-regulated CASC2 leads to decreased in PIAS3 mRNA and protein levels, whereas overexpression of CASC2 restores PIAS3 synthesis to high levels in CRC cells. [score:6]
CASC2 modulates the level of the miR-18a target PIAS3 To further demonstrate the existence of specific interplay among CASC2, miR-18a and PIAS3, we monitored both mRNA and protein levels of PIAS3 and STAT3 -mediated downstream target genes in knockdown of CASC2 CRC cells. [score:6]
Furthermore, when we co -transfected psiCHECK2-CASC2-WT with miR-18a and RLuc- PIAS3-WT luciferase reporters, overexpression of CASC2 partially restored the luciferase activity of miR-18a -mediated suppression (Fig. 4C,D). [score:5]
Together, these data indicate that CASC2 can function as a ceRNA by competitively binding miR-18a, thereby relieving the suppression of PIAS3 expression by miR-18a in CRC. [score:5]
Colorectal cancer cells were cotransfected with 500 ng of the luciferase construct along with miR-18a mimics, negative mimics control, miR-18a inhibitors or negative control inhibitors. [score:5]
Subsequent qRT-PCR analysis revealed that CASC2 expression in CRC cells transfected with miR-18a mimics is suppressed by miR-18a (Fig. 3E). [score:5]
In the present study, we investigated the potential role of CASC2 as a ceRNA of the PIAS3 gene by competing for miRNA-18a binding sites and thereby regulates the expression of the PIAS3 mRNA targeted by this miRNA. [score:4]
The expression of miR-18a in CRC, and the regulation of miR-18a on the PIAS3 gene and STAT3 signaling pathway. [score:4]
Mutant CASC2 contained a mutation site (psiCHECK2-CASC2-MU) abolishing targeting by miR-18a. [score:4]
To further demonstrate the existence of specific interplay among CASC2, miR-18a and PIAS3, we monitored both mRNA and protein levels of PIAS3 and STAT3 -mediated downstream target genes in knockdown of CASC2 CRC cells. [score:4]
miR-18a directly targets the PIAS3 gene. [score:4]
The above results implicated the potential role of miR-18a within human tumor development, and we further determined the level of miR-18a expression in 68 paired CRC tissues and adjacent normal tissues. [score:4]
The suppressive effects were successfully abolished when empty vector or mutant CASC2 reporter constructs for miR-18a were utilized, suggesting the binding of miR-18a to these sites. [score:3]
CASC2 modulates the level of the miR-18a target PIAS3. [score:3]
CASC2 functions as a ceRNA by competitively binding PIAS3 -targeting miR-18a. [score:3]
As predicted, there was a significant negative correlation in the expression of CASC2 and miR-18a in CRC tissues (R [2] = 0.334, P < 0.001, Fig. 4B). [score:3]
QRT-PCR analysis of STAT3 (G), Survivin (H) and c-Myc (I) expression in CACO2 and HT-29 cells transfected with miR-18a mimics or negative control. [score:3]
Among the many targets of miR-18a, we concentrated on PIAS3 33. [score:3]
Only the predicted miR-18a bound the CASC2 fragment containing the target sites of the miRNA. [score:3]
CASC2 is a target of miR-18a. [score:3]
miR-18a miRNA was harvested using the PureLink™ miRNA Isolation Kit (Invitrogen, CA, USA) and miRNA expression was quantified by TaqMan MicroRNA Assay Kit (Applied Biosystems, Foster City, CA, USA). [score:2]
Together, these data indicate that miRNA-18a can directly bind to CASC2. [score:2]
Although the interaction between miR-18a and PIAS3 has been predicted by computational algorithms and confirmed by functional experiments in gastric cells, it is unknown whether miR-18a effectively regulates PIAS3 in CRC cells. [score:2]
Two luciferase reporters containing the wild type CASC2 (psiCHECK2-CASC2-WT) or mutant CASC2 were generated to analyze the interaction between CASC2 and miR-18a. [score:1]
com/lncedb/) that predict potential lncRNA-miRNA interactions revealed three potential CASC2 binding miRNAs (miR-18a/b and miR-4735) (Fig. 3A). [score:1]
How to cite this article: Huang, G. et al. The long noncoding RNA CASC2 functions as a competing endogenous RNA by sponging miR-18a in colorectal cancer. [score:1]
Interestingly, miR-18a and miR-18b belong to the miR-18 miRNA family and possess similar seed regions. [score:1]
The wild type CASC2 (psiCHECK2-CASC2-WT) and mutant CASC2 constructs (psiCHECK2-CASC2-MU) were cloned downstream of the luciferase gene (Fig. 3B) and transfected in CRC cells together with either miR-18a or miR-4735 mimics. [score:1]
Additionally, qRT-PCR analysis and western blot analysis were further performed, and the miR-18a -treated cells were found to exhibit increased levels of STAT3, pSTAT3, Survivin and c-Myc (Fig. 4G–J). [score:1]
The luciferase reporter plasmids (RLuc- PIAS3-WT and RLuc- PIAS3-MT) containing the wild type 3′UTR region or mutant 3′UTR region of PIAS3 were co -transfected into CACO2 cells (C) and HT-29 cells (D) with miR-18a mimics or in parallel with the luciferase reporter vector psiCHECK2-CASC2-WT. [score:1]
Luciferase activity in CACO2 (C) and HT-29 (D) cells co -transfected with miR-18a or miR-4735 mimics and the indicated luciferase reporters or control. [score:1]
Furthermore, bioinformatics prediction combined with experimental analysis provides further support for the interaction of CASC2/miR-18a activity. [score:1]
miR-18a functions as an oncogene in CRC. [score:1]
CASC2 functions as a miR-18a decoy in CRC cells. [score:1]
[1 to 20 of 42 sentences]
4
[+] score: 126
In contrast, collagen 1A1 and 3A1 transcription was not affected by either miR-18a and miR-19b overexpression or inhibition in neonatal rat cardiomyocytes and cardiac fibroblasts (NRCFs), indicating that collagen expression in cardiac fibroblasts is unrelated to these miRNAs (Fig. 6B). [score:7]
For the overexpression or inhibition of miR-18a and miR-19b, NRCMs and NRCFs were transfected with 80 nm miRIDIAN hairpin inhibitor (antagomiR) miR-18a (#IH-300487-06) or miR-19b (#IH-300489-05), or with miRIDIAN mimic miR-18a (#C-300487-05), or miR-19b (#C-300489-03) (Dharmacon, Colorado, CO, USA). [score:7]
In line with reduced expression levels in failing hearts of old mice, decreased miR-18a, miR-19a, and miR-19b expression was associated with severe heart failure at old age (Fig. 3A), while miRNA expression in old patients with a preserved function was not different from young ICM patients (Fig. 3A). [score:7]
Together, these data suggest that regulation of CTGF and TSP-1 is the result of the shared expression of miR-18a, miR-19a, and miR19b, enabling modest changes in miRNA expression to control transcriptional repression. [score:6]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
Overexpression of miR-18a and miR-19b, using miRNA mimics, resulted in significant repression of CTGF and TSP-1 mRNA and protein expression in cardiomyocytes (Fig. 5F and G; Supporting information Fig. S3A). [score:5]
In cardiac fibroblasts, overexpression of miR-18a and miR-19b also decreased CTGF and TSP-1 transcription; however, inhibition of these miRNAs was not sufficient to increase CTGF and TSP-1. This may be attributed to the fact that a fibroblast produces large amounts of CTGF and TSP-1 while it contains relatively low amounts of miR-18a and miR-19b. [score:5]
Indeed, overexpression of miR18a and miR-19b in cardiomyocytes repressed collagen 1A1 and 3A1 mRNA levels, while inhibition of these miRNAs using antagomirs significantly enhanced collagen transcription (Fig. 6A). [score:5]
Here, miRNA mimics of miR-18a and miR-19b blunted the expression of CTGF and TSP-1, and vice versa, inhibition of these miRNAs enhanced CTGF and TSP-1 levels. [score:5]
Our in vitro results support a role for miR-18a, miR-19a, and miR-19b in regulating CTGF and TSP-1 expression in the aged cardiomyocyte. [score:4]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
These results imply that the age-related regulation of CTGF and TSP-1 expression by miR-18a and miR-19b in the heart is uniquely restricted to the cardiomyocyte to control its surrounding ECM. [score:4]
Importantly, the abundant expression of miR-18a and miR-19b in cardiomyocytes coincides with low levels of CTGF and TSP-1, whereas in cardiac fibroblasts, relatively low levels of miR-18a and miR-19b were associated with high CTGF and TSP-1 transcription (Fig. 5E). [score:3]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
These findings confirm the expression profiles in aged HF-prone mice and again suggest that miR-18a, miR-19a, and miR-19b could transcriptionally repress CTGF and TSP-1 levels in cardiomyocyte aging and HF at old age. [score:3]
MiR-18a and miR-19b are abundantly expressed in the adult mouse heart and are predominantly localized in the perinuclear area of cardiomyocytes (Fig. 5A–C). [score:3]
CTGF and TSP-1 have been identified as target genes of the miR-17–92 cluster (Dews et al., 2006), more specifically of the cluster members miR-18a and miR-19a/b (Suarez et al., 2008; Ohgawara et al., 2009). [score:3]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitroTo gain further insight into the role of the miR-17–92 cluster in aging of cardiomyocytes, neonatal rat cardiomyocytes (NRCMs) were aged in vitro, and miRNA levels were determined. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitro. [score:2]
Next, we performed a series of functional studies to determine the role of miR-18a and miR-19b in the regulation of CTGF and TSP-1 and collagen production in cardiomyocytes and cardiac fibroblasts. [score:2]
Cardiomyocyte CTGF and TSP-1 and collagen production are regulated by miR-18/19. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in human age -associated heart failure. [score:2]
These results show that regulation of CTGF and TSP-1 by miR-18a and miR-19b is uniquely restricted to the cardiomyocyte. [score:2]
Therefore, we investigated whether age-related changes in miR-18a, miR-19a, and miR-19b expression regulate CTGF, TSP-1, and collagen levels in rodent mo dels of aging -associated heart failure and in the human failing heart. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
Fig. S3 CTGF and TSP-1 transcripts are regulated by miR-18a and miR-19b in cardiomyocytes. [score:2]
This was corroborated by the finding that miR-18a and miR-19b expression was higher in cardiomyocytes compared to cardiac fibroblasts (Fig. 5D). [score:2]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
CTGF, TSP-1, miR-18a, miR-19a, and miR-19b levels in aged HF-resistant (12 weeks, n = 8; 52 weeks, n = 8; and 104 weeks, n = 9) and HF-prone mice (12 weeks, n = 6; 52 weeks, n = 11; and 104 weeks, n = 9). [score:1]
Importantly, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs. [score:1]
Vice versa, blunting of miR-18a and miR-19b using antagomirs was sufficient to increase CTGF and TSP-1 transcript and protein levels in cardiomyocytes (Fig. 5F, G; Supporting information Fig. S3A). [score:1]
Cardiac fibroblasts demonstrated decreased CTGF and TSP-1 transcript levels upon introduction of miR-18a and miR-19b; however, this did not result in reduced protein levels (Fig. 5H, I). [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
Double DIG-labeled locked nucleic acid (LNA) hybridization probes complementary to mouse mature miR-18a (5DIGN/CTATCTGCACTAGATGCACCTTA/3DIG_N) (#38462-15), miR-19b (5DIGN/TCAGTTTTGCATGGATTTGCACA/3DIG_N) (#38092-15), and a scrambled probe (5DIGN/GTGTAACACGTCTATACGCCCA/3DIG_N) (#99004-15) were purchased from Exiqon (Vedbaek, Denmark). [score:1]
RT-PCR analysis for the induction collagen 1A1 (COL1A1) and collagen 3A1 (COL3A1) in cultured neonatal rat cardiomyocytes and cardiac fibroblasts after manipulation with miR-18a and miR-19b mimics and antagomirs. [score:1]
RT-PCR analysis of miR-18a, miR-19a, miR-19b, CTGF, and TSP-1 transcript levels in myocardial biopsies from idiopathic cardiomyopathy (ICM) patients at older age with normal (n = 5) and severely impaired (n = 9) cardiac function. [score:1]
[1 to 20 of 39 sentences]
5
[+] score: 64
However, over -expression of miR-18a, miR-122, and miR-423-5p did not suppress the expression level of TNRC6B and suppression of miR-221 did not induce over -expression of TNRC6B. [score:11]
To clarify the biological links between miRNAs and TNRC6B, we examined the expression pattern of TNRC6B in Huh7 cells by real-time qPCR when expression levels of miR-18a, miR-18b miR-122, miR-221, miR-423-5p, and miR-22 were either over-expressed or suppressed. [score:9]
5.0 and reported that miR-92, miR-20, miR-18 and precursor miR-18 had significantly high expression in poorly differentiated HCC samples, moderate expression in moderately differentiated HCC and low expression in well-differentiated HCC. [score:7]
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
TNRC6B on the other hand, was a common target gene in miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 using Targetscan. [score:5]
Other studies have indicated that over -expression of both miR-221 and miR-18a is associated with hepatocarcinogenesis [20, 21] and that over -expression of miR-221 is related to the advancement of tumor stages and metastasis [22]. [score:5]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
miR-221, miR-18a, miR-18b, miR-423-5p, and miR-22 could recognize TNRC6B as a target gene using both algorithms (Figure  1A) Figure 1 Process of retrieving target genes of several miRNAs. [score:5]
The expression pattern of miR-18, 22, 99, 221 in HCC observed in this study are similar to that noted in our previous reports [9]. [score:3]
Homo sapiens trinucleotide repeat containing 6B (TNRC6B) was a common hypothetical target gene in miR-221, miR-18a, miR-18b, miR-423-5p, miR-455-3p, miR-1914*, miR-215, miR-122*, let-7b, and miR-22 using miRanda algorithm. [score:3]
Among others, miR-18 which is intimately associated with the occurrence and progression of different types of cancer have also been implicated [16]. [score:1]
[1 to 20 of 12 sentences]
6
[+] score: 54
Here we suggest that up-regulation of Nr1h2 might be due to a down-regulation of miR-18a-5p (and potentially its isomiRs) and it may be part of a common mechanism for changing the expression of steroidogenic-pathway transcripts such as Star and Cyp19a1 (or estrogen sulfotransferase) that are involved in the decrease of estradiol levels (Fig.   7). [score:9]
However, our data revealed that exposure to a mixture of EDCs resulted in the deregulation of specific miRNAs and isomiRs with 3′ end variants, some of them of differentially expressed canonical miRNAs (as shown for miR-18a-5p) (Fig.   6) which, consequently, share mRNA targets. [score:6]
When we searched in the sncRNA-Seq data for any member of this miR-17 family that was differentially expressed in testes after exposure to the mixture of EDCs, we only identified two down-regulated miRNAs: miR-18a-5p and miR-20b-5p. [score:6]
miR-18a-5p was associated with the reduction of intratesticular estradiol levels in testes of mice exposed to EDCs mixtureGiving that the exposure to a mixture of EDCs induced a decrease in estradiol levels, we correlated the differentially expressed miRNAs with deregulated transcripts of the steroidogenic pathway. [score:4]
Another important miRNA that was down-regulated by EDCs-mixture was miR-18a-5p, which is also associated with Sertoli cells; its absence results in the deterioration of spermatogenesis [61]. [score:4]
Interestingly, two isomiR variants of miR-18a-5p and one isomiR variant of miR-15b-5p, miR-20b-5p, miR-3085-3p, and miR-1981-5p were down-regulated due to the addition of an adenine at its 3′ end, similarly to the corresponding canonical miRNAs (Fig.   6A,B). [score:4]
Figure 7Down-regulation of miR-18a-5p in mice exposed to EDCs mixture is associated with estradiol decrease in testes via Nr1h2. [score:4]
We found that in the mouse, targeting of Nr1h2 by miR-18a-5p was already validated using immunoprecipitation experiments with Ago2 in C1C12 cells [31]. [score:3]
We used bioinformatics tools and found that in mouse testes, Nr1h2 could be a target of miR-18a-5p (Fig.   7A). [score:3]
As the processing of pre-mir-18a stem-loop may be selective and independent of the cluster by the action of RNA -binding proteins 63, 64, we speculate that exposure to the mixture of EDCs could alter the expression of some RNA -binding proteins, affecting the processing of specific miRNAs. [score:3]
However, we observed that miR-18a-5p was the only deregulated miRNA from this cluster (see Supplementary Fig.   S2). [score:2]
On the other hand, changes observed in miR-18a-5p and miR-15b-5p were higher with RT-qPCR than with NGS, but the tendency was similar to that observed with sncRNA-Seq (Fig.   5). [score:1]
Despite not having determined, in this work, the participation of nuclear receptors that are known to interact with the EDCs used such as ER, RXR/PPAR and AhR, we found that the decrease of miR-18a is negatively correlated to the Nr1h2 levels detected in exposed mice. [score:1]
By RT-qPCR, we found that Nr1h2 levels were two-fold higher in testes of mice exposed to EDCs mixture, which were negatively correlated with miR-18a-5p (Fig.   7A,B), suggesting a mechanism of estradiol downturn by various pathways and associated with loss of miR-18a-5p induced by the exposure to the EDCs mixture (Fig.   7C). [score:1]
miR-18a-5p was associated with the reduction of intratesticular estradiol levels in testes of mice exposed to EDCs mixture. [score:1]
Michlewski G Guil S Caceres JF Stimulation of pri-miR-18a processing by hnRNP A1Adv. [score:1]
To support our prediction, we searched in the DIANA-TarBase v7.0, that contains hundreds of thousands of high-quality manually curated and experimentally validated miRNA:gene interactions [30] for miR-18a. [score:1]
[1 to 20 of 17 sentences]
7
[+] score: 53
Wu et al. [35] revealed that the expression of miR-18a was significantly upregulated in GC tissue compared with normal gastric tissue, and could directly target PIAS3 (protein inhibitor of activated signal transducer and activator of transcription 3) and was positively correlated with levels of Survivin, Bcl-xl and c-myc. [score:10]
We identified the five miRNAs that were most consistently upregulated (miR-21, miR-106a, miR-17, miR-18a and miR-20a) and two most consistently downregulated (miR-378 and miR-638) in at least four profiling studies. [score:7]
The results showed that miR-378 was downregulated in GC tissues, whereas the other five miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) were upregulated in GC (Figure 2). [score:7]
In conclusion, our systemic review identified five upregulated miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) and one downregulated miRNA (miR-378) that are potential novel biomarkers for GC. [score:7]
0073683.g002 Figure 2 Using U6 as a normalization control, the expression of miR-21, miR-106b, miR-17, miR-18a and miR-20a was significantly higher in GC tissues, while the expression of miR-378 was significantly lower. [score:5]
Moreover, the upregulation of miR-18a has been reported in nasopharyngeal carcinoma [36], pancreatic cancer [37], hepatocellular carcinoma [38] and breast cancer [39]. [score:4]
MiR-18a was found to be upregulated in four studies in this systematic review, and is known to have oncogenic activity in humans. [score:3]
Expression levels of miR-21, miR-106b, miR-17, miR-18a, miR-20a and miR-378 in GC and adjacent noncancerous tissue samples. [score:3]
MiR-106b, miR-17 and miR-18a levels were significantly higher in poorly differentiated GC, cases with lymph node involvement, or late stage disease, while miR-20a levels were significantly higher in cases of GC with lymph node involvement. [score:3]
Three of these miRNAs were reported in five microarray studies (miR-21, miR-106b and miR-378), four were reported in four studies (miR-17, miR-18a, miR-20a and miR-638), and seven were reported in three studies (miR-19a, miR-20b, miR-25, miR-30d, miR-923, miR-375, and miR-148a). [score:1]
57(11): 2910– 6. 58 Morimura R, Komatsu S, Ichikawa D, Takeshita H, Tsujiura M, et al (2011) Novel diagnostic value of circulating miR-18a in plasma of patients with pancreatic cancer. [score:1]
For example, serum miR-21 was significantly elevated in perioperative serum from adenomas and colorectal cancer (CRC), and was an independent prognostic marker for CRC [50], [51]; Plasma miR-106b, together with miR-20a and miR-221 have the potential as novel biomarkers for early detection of gastric cancer [40]; Circulating miR-17 may used as a novel noninvasive biomarker for nasopharyngeal carcinoma [52], gastric cancer [53] and CRC [54]; Serum miR-18a may be used as a novel biomarker in breast cancer [55], colorectal cancer [56], hepatocellular carcinoma [57], and pancreatic cancer [58]; Circulating miR-378 may be used as a biomarker in renal cell carcinoma [59] and gastric cancer [60]. [score:1]
30(1): 320– 6. 57 Li L, Guo Z, Wang J, Mao Y, Gao Q (2012) Serum miR-18a: a potential marker for hepatitis B virus-related hepatocellular carcinoma screening. [score:1]
[1 to 20 of 13 sentences]
8
[+] score: 52
hy926 cells Not shown HIF1A Angiogenesis[123] miR-200b HMVECs Downregulated upregulated ETS1 Angiogenesis hypoxia[135, 136] HUVECs KLF2 miR-210 HUVECs Upregulated EFNA3 Angiogenesis hypoxia[131, 132, 150] HIF3A miR-424 HUVECs, hMVECs, hBOECs and hMBECs Upregulated CUL2 Angiogenesis[137] HIF1A* miR-429 HUVECs Upregulated HIF1A Hypoxia[12, 109] HIF3A miR-433 HUVECs Downregulated HIF1A Proliferation and migration[138] miRNAs proven to directly bind HIF mRNAs are in bold, and indirect effects are marked with “*” ARNT aryl hydrocarbon receptor nuclear translocator, CUL2 cullin-2, EFNA3 ephrin A3, EGLN1 prolyl hydroxylase domain-containing protein 2 (PHD2), ETS1 ETS Proto-Oncogene 1, Transcription Factor, HIF1A hypoxia-inducible factor 1-alpha, HIF1AN hypoxia-inducible factor 1-alpha inhibitor, HIF3A hypoxia-inducible factor 3 alpha, KLF2 Kruppel-like factor 2 The miR-17 family includes miR-17, miR-18a/b miR-20a/b, miR-93 and miR-106a/b. [score:23]
Table 1 MicroRNAs involved in regulating HIFs and HIF regulatory gene levels in ECs miRNA Cell type Impact of hypoxia on miRNA expression miRNA target (s) (direct or indirect*) Investigated processes miR-18a Choroidal endothelial cells Upregulated HIF1A Proliferation migration[116] miR-107 Endothelial progenitor cells—EPCs Upregulated ARNT Differentiation[121] miR-135b HUVECs Upregulated HIF1AN Angiogenesis[124] HIF1A* miR-155 Mouse skin endothelial SENDs cells and HUVECs Upregulated HIF1A Angiogenesis hypoxia[108] miR-199a Endometrial stromal cells; endothelial EA. [score:19]
miR-18a expression is markedly upregulated after 24 h hypoxia in human choroidal endothelial cells and can directly target HIF1A mRNA [116]. [score:9]
Hence, the hypoxic induction of miR-18a may allow HIF-1α level decreases and thus contribute to the HIF switch. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 49
Moreover, we tested the target specificity of the 6C-miR-18–11bp probe against a non-specific miRNA background, by incubating the 6C-miR-18–11bp probe with several non-target miRNAs, miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-21 (Figure 6C). [score:5]
Red sequences: cytosine-loop (6C), blue sequences: target miRNA sensing sequence (miR-18a) and black sequences: the anchor sequence complementary to target sensing sequence. [score:5]
As shown in Figure 6C, the 6C-miR-18–11bp probe shows I [0]/ I value of 14 when it encounters its target, implying a high sensitivity of this probe. [score:3]
Thus, with 6C-miR-18–11bp is it feasible to detect the presence of target miR-18 at least above 50 nM (Figure 6B). [score:3]
The 6C-miR-21–10bp probe was incubated with several non-target miRNAs such as miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-18a (Figure 5B). [score:3]
A recent study (35, 42) reported that HEK-293T cell lines maintain a substantial expression level of miR-18a whereas miR-21 and miR-27b are almost untraceable, hence we used total RNA from HEK-293T to validate the 6C-miR-18–11bp probe. [score:3]
Indeed, the 6C-miR-18–11bp probe selectively recognized only its specific target, miR-18a, from a mixture of other miRNAs. [score:3]
Moreover, all three tested probes are highly competent to detect several target miRNAs such as miR-18a, miR-21 and miR-27b in total RNA samples extracted from human cancer cell lines. [score:3]
The target recognition ability of 6C-miR-18–11bp was tested by adding miR-18a in a concentration dependent manner. [score:3]
As expected, addition of increasing amounts of miR-18a, led to a gradual drop of the orange fluorescence of 6C-miR-18–11bp, revealing a linear dependence of the I [0]/ I intensity versus miR-18a target concentrations (inset shows that the Stern–Volmer plot of the data in Figure 6B). [score:3]
This result indicated that miR-18a is expressed only in HEK-293T cell lines. [score:3]
MiR-18a has important roles in controlling gastric cancer growth and angiogenesis (35) and miR-27b is known to regulate numerous types of cancers such as breast and ovarian (36). [score:2]
Indeed, miR-18a was only detected in HEK-293T cell lines when we cross-validated with northern blot analysis, confirming the accuracy of 6C-miR-18–11bp probe (Figure 7D-2). [score:1]
1.5 μM of 6C-miR-18a-11bp probe was mixed with 1.5 μM of miR-18a (black bar), miR-21 (red bar), miR-200c (green bar), miR-125c (blue bar), miR-221 (sky blue bar), miR-451 (pink bar) and miR-27b (yellow bar). [score:1]
These miRNAs can thus be useful biomarkers for cancer diagnosis and therefore, functional DNA/AgNCs probes for miR-18a and miR-27b are attractive objectives. [score:1]
Similarly, we tested 6C-miR-18–11bp and 6C-miR-27b-4bp probes with total RNAs from specific cell lines. [score:1]
As shown Figure 7B, the orange fluorescence of 6C-miR-18–11bp notably decreased when it was mixed with total RNA from HEK-293T cell lines. [score:1]
Based on the results presented for the fold-back anchored DNA/AgNCs probe for miR-21, we further designed analogous probes for miR-18a and miR-27b. [score:1]
Figure 6. (A) Sequence and plausible structure of the 6C-miR-18a-11bp DNA probe. [score:1]
As shown in Figure 6A, in the probe 6C-miR-18–11bp the length of the fold-back anchor was adjusted to give a similar T [m] value to that of 6C-miR-21–10bp. [score:1]
1.5 μM 6C-miR-21–10bp probe was mixed with 1.5 μM of miR-21 (black bar), miR-200c (red bar), miR-125c (green bar), miR-221 (blue bar), miR-27b (sky blue bar), miR-451 (pink bar) and miR-18a (yellow bar). [score:1]
Interestingly, 6C-miR-18–11bp generated very strong orange fluorescence when it was excited at 510 nm. [score:1]
[1 to 20 of 22 sentences]
10
[+] score: 44
Based on the experiments using specific miR inhibitors, the mechanisms of the effects of miR-18a-5p, miR-19a-3p, and miR-19b-3p on the up-regulation of activated STAT3 might be the suppression of genes for regulatory proteins of STAT3 such as protein inhibitor of activated STAT3 (PIAS3) and suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) [29– 32]. [score:13]
Interestingly, miRNA inhibitors targeted to miR-18a-5p, miR-19a-3p, and miR-19b-3p down-regulated the expression of BCL2, BCL2L1, BIRC5, and MMP9, target genes of STAT3, which implied the positive feedback loop of STAT3/miR-17-92 clusters (Fig. 7B-E). [score:12]
In particular, inhibition of miR-18a-5p, miR-19a-3p, and miR-19b-3p resulted in differential up-regulation of mRNA expressioin of PIAS3, SOCS1, and SOCS3, coding genes for regulatory proteins of STAT3 such as (Supplemental Fig. 6–8). [score:9]
In order to figure out feedback effects of miR-17-92 clusters on STAT3 activation, we evaluated the expression of target genes of STAT3 which demonstrated higher expression in Y79 cells than other retinal constituent cells: BCL2, BCL2L1, BIRC5, and MMP9 according to the treatment with specific miRNA inhibitors to components of miR-17-92 clusters: miR-18a-5p, miR-19a-3p, and miR-19b-3p. [score:7]
Interestingly, the inhibition of miR-18a-5p, miR-19-3p, and miR-19b-3p induced the decrease in the proportion of pSTAT3 -positive retinoblastoma cells. [score:3]
[1 to 20 of 5 sentences]
11
[+] score: 36
MiR-18a is predicted to target another CNS related gene, i. e. the neural precursor cell expressed developmentally down-regulated protein 9 (NEDD9). [score:8]
P-values for chosen candidates were as follows: miR-17(1.92E [−09]), miR-18a(2.62E [−09]), miR-29c(4.71E [−09]), miR-106a(1.84E [−08]), miR-135a(8.26E [−09]), miR-135b(1.99E [−08]), miR-221(9.19E [−05]), miR-222(2.04E [−05]) (see Supporting Table S2) Expression profiles of these candidates can be found in Figure 2. Three out of eight miRNAs exhibited decreasing expression during brain development (miR-17, miR-18a (belonging to the same cluster), miR-106a) [24]. [score:6]
MiR-17, miR-18 and miR-106a showed up to 19, 28 and 21 fold change differences in expression in F50 versus adult tissue, with the highest level of expression observed at F50, independent of the brain tissue type (Figure 4). [score:5]
A number of miRNAs including the entire miR-17/92 cluster (with miR-17 and miR-18a being particularly significant), as well as the miR-106a/363 cluster, excluding miR-19b-2 and miR-92a-2 (with miR-106a and miR-18b having the lowest p-values), exhibited decreasing expression throughout development. [score:4]
Co -expression of miR-17 and miR-18 has also been previously shown in rat and monkey brain, by Miska et al. [22]. [score:3]
It could be considered that miRNAs which were highly expressed in fetal tissue might be involved in the development and growth of a particular region of the brain, such as the frontal cortex or cerebellum (e. g. miR-17, miR-18 or miR-106a). [score:3]
Numerous developmental stage or tissue-specific microRNAs including, miR-17, miR-18a, miR-29c, miR-106a, miR-135a and b, miR-221 and miR-222 were found by microarray analysis. [score:2]
The correlation coefficient values (R [2]) for particular miRNAs include: miR-17 (R [2] = 0.84), miR-18a (R [2] = 0.94), miR-29c (R [2] = 0.92), miR-106a (R [2] = 0.81) and miR-135a (R [2] = 0.89) miR-135b (R [2] = 0.95), miR-221 (R [2] = 0.91) and miR-222 (R [2] = 0.88). [score:1]
All three belong to the same family and miR-17 and miR-18a belong to the same cluster. [score:1]
Interestingly, miR-17, miR-18a and miR-106a belong to the same miRNA family. [score:1]
The first group included miR-17, miR-18a and miR-106a. [score:1]
Eight different candidate miRNAs: hsa-miR-17, hsa-miR-18a, hsa-miR-29c, hsa-miR-106a, hsa-miR-135a hsa-miR-135b, hsa-miR-221 hsa-miR-222 and two reference miRNAs: hsa-miR-103 and hsa-miR-191 were profiled by. [score:1]
[1 to 20 of 12 sentences]
12
[+] score: 34
Therefore, one of the possible functions of miR-18a downregulation during JEV infections may be to increase the expression of Dicer and subsequently inhibit JEV replication. [score:8]
Tao J. Wu D. Li P. Xu B. Lu Q. Zhang W. microRNA-18a, a member of the oncogenic miR-17–92 cluster, targets Dicer and suppresses cell proliferation in bladder cancer T24 cells Mol. [score:5]
These results suggest that the downregulation of miR-18a may be associated with the strongest host defense response to JEV infection and warrants further research to confirm its effects on JEV infection. [score:4]
With the reduction in miR-18a, the mRNA levels of TNFAIP3 and PIAS3 were upregulated, dampening the inflammatory response, which may contribute to better viral clearance and increased protection against JEV [40, 41, 42, 43]. [score:4]
In this study, we identified a subset of miRNAs (including miR-10a-5p, miR-10a-3p, miR-10b, miR-101, miR-126-5p, miR-142-5p, miR-155-5p, miR-17-3p, miR-18a, miR-19a, miR-181a, miR-196b, miR-221-3p, miR-98, let-7d-3p, let-7d-5p) that are significantly differentially expressed after challenge with JEV. [score:3]
Dicer is a proven target of miR-18a [35]. [score:3]
In addition to Dicer, TNFAIP3 and PIAS3 are other proven targets of miR-18a. [score:3]
The miRNA miR-18a was the most strongly regulated by JEV infection in PK-15 cells. [score:2]
Ranking JEV-Infected Group JEV-Uninfected Group miRNA Reads miRNA Reads 1 ssc-miR-21 17,39,040 ssc-miR-21 877,629 2 ssc-let-7f 309,868 ssc-let-7f 151,697 3 ssc-miR-30a-5p 69,597 ssc-miR-19b 33,441 4 ssc-miR-100 60,186 ssc-miR-24-3p 23,501 5 ssc-miR-29a 53,334 ssc-miR-152 22,650 6 ssc-miR-152 49,317 ssc-miR-18a 21,872 7 ssc-miR-10a-5p 39,632 ssc-let-7a 20,908 8 ssc-miR-19b 37,389 ssc-miR-100 16,274 9 ssc-miR-26a 35,650 ssc-miR-19a 14,533 10 ssc-miR-182 29,255 ssc-miR-30a-5p 14,489 When a host is infected with a viral pathogen, it produces a strong antiviral response to protect itself. [score:1]
Trenkmann M. Brock M. Gay R. E. Michel B. A. Gay S. Huber L. C. Tumor necrosis factor α -induced microRNA-18a activates rheumatoid arthritis synovial fibroblasts through a feedback loop in NF-κB signaling Arthritis Rheumatol. [score:1]
[1 to 20 of 10 sentences]
13
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Heart-specific miRNAs or miRNAs abundantly expressed in the heart, B) Liver-specific miRNAs or miRNAs abundantly expressed in the liver, C) miRNAs showing strong expression in the thymus, D) Expression analysis of miR-18a and miR-20a, the miRNAs located in the miR-17-92 cluster, and E). [score:9]
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
miR-18a and miR-20a are located within the miR-17-92 cluster, which contains miRNAs known as "oncomiRs" because of their overexpression in many types of cancer cells [58, 59]. [score:3]
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Although miR-18a and miR-20a are likely derived from the same primary-transcript, the expression levels of these mature miRNAs are not similar (Figure 2D). [score:3]
Surprisingly, the expression pattern of miR-20a's differed from that of miR18a in different tissues. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
The miR-17-92 cluster (polycistronic miRNA gene) encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) located in the third intron of a ~7-kb primary transcript known as C13orf25 [61]. [score:1]
[1 to 20 of 9 sentences]
14
[+] score: 28
miR-18a inhibits CDC42 and plays a tumour suppressor role in colorectal cancer cells. [score:5]
The contribution of miR-18a to DNA damage and apoptosis is reportedly due to its direct inhibition of the ATM kinase, which is required for initiating DNA repair following double-stranded breaks (Song et al., 2011; Wu et al., 2013). [score:4]
MiR-18a contributes to DNA damage, but can reduce the proliferation of CRC cell lines and enhance their sensitivity to apoptotic stimuli (for example, in response to etoposide, a topoisomerase inhibitor and chemotherapeutic drug) following its forced expression (Wu et al., 2013; Humphreys et al., 2014). [score:4]
MicroRNA-18a attenuates DNA damage repair through suppressing the expression of ataxia telangiectasia mutated in colorectal cancer. [score:4]
miR-18a impairs DNA damage response through downregulation of ataxia telangiectasia mutated (ATM) kinase. [score:4]
microRNA expression profile in stage III colorectal cancer: circulating miR-18a and miR-29a as promising biomarkers. [score:3]
The human miR-17 family consists of eight miRNAs (miR-17, miR-18a/b, miR-20a/b, miR-93, and miR-106a/b), with three of these (miR-17, miR-18a, and miR-20a) transcribed from the miR-17-92 miRNA locus. [score:1]
Plasma miR-200c and miR-18a as potential biomarkers for the detection of colorectal carcinoma. [score:1]
Several members of this cluster, such as miR-17 (Ng et al., 2009; Yu et al., 2012), miR-20a (Schetter et al., 2008; Motoyama et al., 2009; Earle et al., 2010; Yu et al., 2012), miR-92a (Motoyama et al., 2009; Ng et al., 2009; Earle et al., 2010; Tsuchida et al., 2011; Schee et al., 2012; Wu et al., 2012; Yu et al., 2012) and miR-18a (Motoyama et al., 2009; Brunet Vega et al., 2013; Zhang et al., 2013b), are all reportedly increased in CRC tumors and in serum/plasma, with their elevated levels correlating with recurrence and poor prognosis. [score:1]
Importantly, serum levels of miR-18a (Zhang et al., 2013b) and miR-92a (Huang et al., 2010; Wu et al., 2012) miRNAs decrease following tumor resection. [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 28
Other miRNAs from this paper: hsa-mir-1972-2
miR-18a inhibits PTEN both directly and indirectly via HOXA9, resulting in upregulation of PI3-K signalling. [score:8]
miR-18a subsequently interacts and inhibits expression of the tumour suppressor gene PTEN, which itself is a negative regulator of PI3-K activity - previously demonstrated as a key pathway promoting mammary epithelial cell malignant progression [61]. [score:8]
miR-18a was also noted to indirectly inhibit PTEN expression via decreasing levels of homeobox A9 (HOXA9) (Figure 3). [score:6]
In this study miR-18a levels were able to distinguish luminal A from luminal B tumours and high miR-18a expression was predictive of poor outcome in tissue biopsies of patients with luminal breast cancers, suggesting that this pathway could be utilised clinically. [score:3]
They demonstrated that increased matrix stiffness in both human and mouse mammary tissue induces expression of micro RNA-18a (miR-18a) via integrin -dependent activation of β-catenin and MYC. [score:3]
[1 to 20 of 5 sentences]
16
[+] score: 26
No significant downregulation of luciferase activeity of pGL3- NAP1L1-3′UTR was observed when the mir-18a-5p mimic was used (Fig.   4c); although, the mir-18a-5p mimic can efficiently downregulate luciferase activity of pGL3- USP6 -3′UTR (65%) in similar experiments shown in Fig.   5e. [score:7]
Transient transfection of the mimic of mir-18a-5p resulted in a 65% downregulation of luciferase activity (Fig.   5e), while transfection of the mimic of mir-19a-3p showed no significant change (Fig.   5d). [score:4]
Three out of four upregulated ncRNA loci (Fig.   2b) encode polycistronic transcripts that could be processed to yield multiple miRNAs (Fig.   2b): chr11: MIR100HG (encoding mir-125b1, mir-let7a-2, mir-100), chr13: MIR17HG (encoding mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1) and chr22: MIRLET7BHG (encoding mir-3619, mir-let7a-3, mir-4763, mir-let-7b). [score:4]
These reporter constructs were transfected into 293T cells lacking endogenous expression of mature mir-let-7p-2-3p, mir-18a-5p, mir-19a-3p or mir-125b-5p miRNAs, either alone or in combination with synthetic small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules, mimic miRNA (Sigma, St. [score:3]
This suggests that NAP1L1 is efficiently targeted by mir-let-7a-3p and mir-19a-3p, but not mir-18a-5p, which originates from the same cluster, MIR17HG. [score:3]
a Percentage of SA-β-Gal positive cells among the total amount of cells counted after transient transfection of the mimics of the SA-miRNAs from either the MIR17HG (mir-17-5p, mir-18a-5p, mir-19a-3p, mir-20a-5p and mir-92a1-5p) or the MIR100HG (mir-125b1-5p, mir-1let7a-2-3p, mir-100-5p) clusters separately or after simultaneous transfection by a full set of the SA-miRNA mimics from both clusters in SR hADSCs. [score:1]
We have observed a statistically significant SEN-related increase in production of mature miRNAs in accordance with their corresponding primary non-coding transcripts MIR17HG: miR-17- 5p (p < 0.001), miR-18a- 5p (p < 0.01), miR-20a- 5p (p < 0.01), mir-92a1- 5p (p < 0.001) and mir-19a- 3p (p < 0.01) (Fig.   2c and Supplementary Figure S4A). [score:1]
The human chromosome 13 MIR17HG cluster (800bp) encodes six tightly grouped miRNAs with four distinct “seed” sequences 31, 50: mir-17, mir-18a, mir-19a, mir-20a, mir-19b1, and mir-92a1 (schematically shown in Fig.   2c). [score:1]
Analysis of the MIR17HG cluster has revealed that only mature guide strand miRNAs: mir-17- 5p, mir-18a- 5p, mir-20a- 5p, mir-19b1- 5p and mir-92a1- 5p, are detected in both SR and SEN hADSCs (Fig.   2c). [score:1]
No mature passenger strands: mir-17- 3p, miR-18a- 3p, miR-20a- 3p, mir-19b1- 3p and mir-92a1- 3p, have been observed in the tested samples. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 26
Comparison of the expression of regulated miRNAs and their cognate-predicted targets in our arrays revealed significant anti-correlation only for specific regulated miRNAs, which we grouped into two: miRNAs that are enriched in the embryonic liver, including miR-106a, miR-18a and miR-574-3p, and miRNAs that are enriched in the adult liver, including let-7a and c, miR-23b and miR-22. [score:7]
The best score was obtained for 3 miRNA seeds, corresponding to miRNAs that are expressed higher in the embryonic liver (miR-106a, miR-18a and miR-574-3p), and for which the predicted targets expression displays a negative correlation. [score:7]
miR-106a has oncogenic activity in humans [42] and upregulation of miR-18a expression is associated with poor prognosis of serous ovarian cells [43]. [score:6]
As for the possible roles of these miRNAs during liver development; while miR-574-3p's role has not yet been studied, miR-106a and miR-18a belong to the oncogenic clusters, miR-106a-363 and miR-17-92, and may regulate cell cycle and apoptosis in the embryonic liver. [score:3]
In summary, the miRNA seeds that achieved the best scores in terms of anti-correlation with their predicted target genes are presented, and correspond to miRNAs let-7a, let-7b, let-7c, miR-22, and miR-23b, for adult liver-enriched miRNAs (Table 2), and miR-106a, miR-18a and miR-574-3p, for embryonic liver-enriched miRNAs (Table 3). [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 24
Figure 3miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation Both gain- and loss-of-function in vivo studies of miR-126 in mouse mo dels demonstrated that either enforced expression or knockout of miR-126 substantially promoted development of t(8;21) AML in mice [75]. [score:10]
miRNAs (miR-17, miR-18a, miR-20a, miR-93) negatively regulate RUNX1 targets, including miR-223 and miR-222/221, in blocking myeloid differentiation by increasing KIT expression and enabling KIT -mediated proliferation. [score:6]
miR-18a, miR-20a and miR-93 are frequently upregulated in distinct subtypes of non-CBF-AML [74]. [score:4]
Fischer et al identified that miR-17, miR-18a, miR-20a and miR-93 all function as the CBF-AML fusion proteins in negative regulating their target RUNX1 and the RUNX1-miR-221-KIT axis [74]. [score:4]
[1 to 20 of 4 sentences]
19
[+] score: 24
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-494
Mechanistically, we found that GCLC expression was downregulated by miR-18a in a MYC -dependent manner. [score:6]
In addition, MYC was found to upregulate miR-18a, which targets GCLC, resulting in decreased production of glutathione from glutamate, and increased flow of glutamine-derived carbon into the TCA cycle (Anderton et al., 2017). [score:6]
In addition, miR-18a was significantly elevated in human HCC compared to non-tumor liver, was negatively correlated with GCLC expression in human HCC, and was positively correlated with alpha-fetoprotein (AFP) expression, which is associated with aggressive liver cancer. [score:4]
Thus, MYC can alter the expression of specific miRNAs (i. e., miR18a and miR23a) which in turn regulate glutamine metabolism. [score:4]
Treatment of LT2-MYC tumor-bearing mice with a locked-nucleic acid antagonist of miR-18a significantly rescued GCLC expression and glutathione levels in vivo. [score:3]
It would be interesting to determine if the decrease in GCLC observed in neuroblastoma is miR-18a -dependent. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 24
Among the differentially expressed miRNAs we find miR-34c which is a direct transactivation target of TP53 [38] and miR-18a/b which targets ER [28]. [score:8]
miR-18a directly targets ESR1 [28] and has been shown to promote estrogen receptor alpha (ESR1) dependent proliferation in hepatocellular carcinoma cells [34]. [score:4]
In addition we have recently observed that the miR-18 cluster is over-expressed in a panel of samples from various cancers types [20]. [score:3]
miR-18a/b may therefore be an important contributor to the different overall gene expression profiles that distinguish between malignant to non malignant tumors, specifically ER positive tumors. [score:3]
The top miRNAs with elevated expression levels in basal-like samples were miR-18a/b (TNoM p<2E-10) and other members of the miR-17-92 cluster (miR-17/17*, miR-18a/b, miR-19a, miR-20a and miR-106a). [score:3]
For the case of miR-18a/b we note that [27] showed that this miRNA and the miRNA cluster it resides in (miR-17-92 cluster) are activated by E2F. [score:1]
Among the miRNAs with opposite expected effect on Ki67 levels we note miR-18a/b and let-7b/c/e (See Table S7 for complete list). [score:1]
The miRNAs selected for this validation were miR-17-5p, miR-18a, miR-18b, miR-19a, miR-29c, miR-34c-5p, miR-142-3p, miR-150 and miR-449a, and the endogenous control used was RNU6B. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 24
A similar pattern was observed for the paralogous miR-106-363 cluster showing a non-significant down-regulation in expression of miR-106a, miR-18a, and miR-20b after 24 h and a highly significant down-regulation of miR-106a, miR-18a, miR-20b, and miR-19b after 5 days of E. faecalis infection (Figure 1B). [score:9]
miR-18a is found in high levels in gastric adenocarcinoma tissue where it targets STAT3 inhibitors leading to downstream activation of the cell-proliferation gene c-Myc, and antiapoptotic genes such as Bcl-xL and Survivin [41]. [score:5]
After 24 h of infection miR-17, miR-18a, and miR-20a were down-regulated; however, this trend was not significant. [score:4]
After 20 min miR-18a, miR-19a, miR-19b, and miR-20a were significantly down-regulated (Figure 2A). [score:4]
Wu W. Takanashi M. Borjigin N. Ohno S. I. Fujita K. Hoshino S. Osaka Y. Tsuchida A. Kuroda M. microRNA-18a modulates STAT3 activity through negative regulation of PIAS3 during gastric adenocarcinogenesis Br. [score:2]
[1 to 20 of 5 sentences]
22
[+] score: 22
All members of miR-17-92 cluster, except miR-18, are also known to downregulate expression of the tumor suppressor PTEN [52]. [score:8]
It is suggested that SMAD2/4 is regulated by miR-18 in neuroblastoma cells [66] and that SMAD4 is targeted by miR-19a/b in thyroid follicular cells [68]. [score:4]
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 9 sentences]
23
[+] score: 20
Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182). [score:7]
Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison. [score:7]
While the reduction in expression of miR-17-5p, miR-18a, miR-20a, and miR-92 were well coordinated in transdifferentiation, the expression of miR-19a was not concordant with its neighboring microRNA genes. [score:5]
The genes encoding for miR-17-1/miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1 are clustered on chromosome 15 [35]. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 20
Overexpressed miR-18a in breast cancer cells suppresses ATM expression and its formation of nuclear foci by its downstream substrates H2AX and 53BP1, which reduced the DNA damage repair capacity of cells to irradiation-chemotherapy [21]. [score:7]
The most important miRNAs and their target DDR genes involved in anticancer drug response are listed in Table 1. In the previous section, we pointed out that miR-203, miR-18a, and miR-31 are all differentially expressed in sensitive and resistant cells. [score:5]
The most important miRNAs and their target DDR genes involved in anticancer drug response are listed in Table 1. In the previous section, we pointed out that miR-203, miR-18a, and miR-31 are all differentially expressed in sensitive and resistant cells. [score:5]
miR-18a and miR-31, but not miR-203, are both expressed at a higher level in radiosensitive than in radioresistant cells [79, 80]. [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 20
From these, BCL2 was validated as a direct target of the miR-17 and miR-18a, and BCL2 knockdown resulted in strong induction of apoptosis in BCR-ABL -positive, but not BCR-ABL -negative ALL cells. [score:5]
We further confirmed this by a complementary approach using lentiviral overexpression of antagomirs against miR-17, miR-18 and miR-20a in the human BCR-ABL -positive BV173 cell line. [score:3]
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
Together, these data demonstrate direct and functional miRNA binding of miR-17∼19b members namely miR-17/miR-20a and miR-18a to human BCL2 mRNA. [score:2]
In human BCL2, we identified 13 binding sites for miR-17∼19b miRNAs (five sites for miR-17, six sites for miR-18a and two sites for miR-20a) located within the CDS and 3′UTR (Supplementary Figure 3B). [score:1]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
Notably, six binding sites for miR-17∼19b miRNAs (three sites for miR-18a, two sites for miR-17 and one site for miR-20a) are located within the 5′UTR and CDS of murine Bcl2 (Supplementary Figure 3A). [score:1]
As shown in Figure 4a, miR-17∼19b significantly repressed luciferase activity for the wildtype but not for mutated miR-17 and miR-18a -binding sites in the murine Bcl2 5′UTR. [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 19
Specifically, two miRNAs (miR-18a-5p and miR-574-3p) were upregulated in the Mn [2+] -induced NPA mo del, while let-7e-5p was downregulated and miR-205-5p was upregulated in the chlorpromazine -induced NPA mo del. [score:10]
In the lupus-like disease produced by Mn [2+] -induced NPA, miR-18a-5p and miR-574-3p exhibited increased expression. [score:5]
The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease. [score:4]
[1 to 20 of 3 sentences]
27
[+] score: 18
Moreover, the expression level of the miR-18 family (sharing seed with BART5-5p) was up-regulated in NPC, and expression levels of the miR-29 family (sharing seed with BART1-3p) and miR-200 family (sharing seed with BART9-3p) were down-regulated in NPC tissues (Figure 7) [19], [30]. [score:11]
Our previous study using real-time PCR also found that the expression levels of miR-18a and miR-18b were significantly up-modulated in NPC tissues [19]. [score:3]
In particular, the miR-200 family (shares seeds with BART9-3p), the miR-29 family (shares seeds with BART1-3p) and miR-18 (shares seeds with BART5-5p) are expressed at high levels in major types of human tissues and cell lines [44] and are highly conserved during evolution [43]. [score:3]
The seed sequence of BART5-5p is identical to the seed sequence of two human miRNAs, hsa-miR-18a and miR-18b, which are members of the oncogenic miR-17-92 cluster. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 18
For example, miR-221, and miR-222 are up-regulated, while miR-34a, miR-18a, miR-30d and miR-34b are down-regulated in colon cancer [54- 56]. [score:7]
Our qRT-PCR results showed that miR-18a, miR-193, miR-221, miR-222 and miR-7 were down-regulated, whereas miR-195, miR-30d and miR-34a were up-regulated in Par-4 -transfected cells when compared with empty vector -transfected cells (Figure 8C). [score:6]
Eleven (miR-30d, miR-10b, miR-34a, miR-195, miR-222, miR-221, miR-31, miR-7, miR-663, miR-193b and miR-18a) out of 22 deregulated microRNAs accounted for the 283 predicted target mRNAs linked to cell death (e. g. pro- or anti-apoptotic genes) (see Additional file 8). [score:4]
Fold changes for miR-18a, miR-193b, mi-195, miR-221, miR-222, miR-30d, miR-30d, miR-34a and miR-7 are indicated. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 16
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
Comparison of hsa-miR-18a, hsa-miR-18b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-556-3p, hsa-miR-424, hsa-miR-136, hsa-miR-340, hsa-miR-302b expression obtained by miRNA expression profile and qRT-PCR on tumors collected from human IGROV-1 ovarian tumor-bearing mice treated daily i. p. with CpG-ODN or saline (control group). [score:5]
Of the 9 miRNAs, hsa-miR-18a and hsa-miR-18b were selected based on their reported role in the pathogenesis of ovarian cancer [25]; [26], and hsa-miR-101 and hsa-miR-302b for their described involvement in DNA repair processes and sensitivity to chemotherapy [20]; the remaining 5 miRNAs were randomly selected. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 16
These events may lead to the activition of other ER isoforms which induce the expression of some miRNAs, such as miR-206, miR-18a, miR-18b, miR-221 and miR-222, leading to further inhibition of ERα expression (49)and the activation of other pathways controlling cell growth and proliferation. [score:7]
Similar to miR-206, miR-18a, miR-18b and miR-221/222 are also up-regulated in ERα -negative cell lines, suggesting an important role of these miRNAs in the development of ERα -negative breast cancers (48, 49). [score:5]
In addition to miR-206, ERα mRNA is also a direct target of miR-18a, miR-18b, miR-193b, miR-302c and miR-221/222 in breast cancer cells. [score:4]
[1 to 20 of 3 sentences]
31
[+] score: 15
42) 13 hsa-mir-199b dbDEMC, HMDD, miR2Disease 38 hsa-mir-206 dbDEMC 14 hsa-mir-181a dbDEMC, miR2Disease 39 hsa-mir-192 dbDEMC 15 hsa-mir-29a dbDEMC, HMDD, miR2Disease 40 hsa-mir-335 literature 16 hsa-let-7e dbDEMC 41 hsa-mir-365 literature 17 hsa-mir-107 HMDD 42 hsa-mir-30a miR2Disease 18 hsa-mir-18a higher RWRMDA (No. [score:9]
Hsa-mir-142, hsa-mir-18a, and hsa-mir-20b have greater functional consistency score (FCS) among their target genes and the known target genes associated with prostate neoplasms. [score:5]
Hsa-mir-18a, hsa-mir-18b, hsa-mir-499, and hsa-mir-542 are ranked No. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Su et al. reported the potential of miR-18a as a biomarker for the detection of GC, and indicated that its upregulation is associated with an unfavorable prognosis [31]. [score:4]
Moreover, we previously demonstrated that circulating miR-18a, which is located in the miR-17–92 cluster and was found to be strongly expressed in GC tissues, may be a useful biomarker for the screening of GC and monitoring tumor dynamics [23]. [score:3]
Su Z. X. Zhao J. Rong Z. H. Wu Y. G. Geng W. M. Qin C. K. Diagnostic and prognostic value of circulating miR-18a in the plasma of patients with gastric cancer Tumour Biol. [score:1]
We identified circulating miR18a, which is located in the miR-17–92 cluster and is an oncogenic miRNA, as a promising biomarker with high diagnostic ability (AUC was 0.9369) in patients with PCa [63]. [score:1]
Several groups identified circulating miRNAs, such as miR-19a, miR-195, miR-192, miR-146a, miR-148, miR-152, miR-122 and let-7b, miR-18a, miR-100, miR-145 miR-223 miR-200a, and miR-222, as non-invasive markers for discriminating HCC from other hepatic disorder statuses [56, 57, 58, 59, 60, 61]. [score:1]
We previously investigated whether miR-18a, which is located in the miR-17–92 cluster and was found to be strongly expressed in ESCC tissues, served as a non-invasive biomarker in plasma with ESCC. [score:1]
Morimura R. Komatsu S. Ichikawa D. Takeshita H. Tsujiura M. Nagata H. Konishi H. Shiozaki A. Ikoma H. Okamoto K. Novel diagnostic value of circulating miR-18a in plasma of patients with pancreatic cancer Br. [score:1]
Hirajima S. Komatsu S. Ichikawa D. Takeshita H. Konishi H. Shiozaki A. Morimura R. Tsujiura M. Nagata H. Kawaguchi T. Clinical impact of circulating miR-18a in plasma of patients with oesophageal squamous cell carcinoma Br. [score:1]
Our findings demonstrated that miR-18a plasma levels contribute to cancer detection and tumor monitoring in ESCC patients to a clinically satisfactory degree of sensitivity and specificity [16]. [score:1]
[1 to 20 of 9 sentences]
33
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
Overexpression of the mir-17–mir-18a–mir-19b-1 cluster was shown to accelerate Myc -induced tumor development in a mouse B-cell lymphoma mo del [61]. [score:4]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
MiR-92a belongs to the miR-17 ~92 cluster with seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a) and was first described as an oncogenic miRNA cluster involved in B-cell lymphoma [61]. [score:1]
[1 to 20 of 5 sentences]
34
[+] score: 14
Using qRT-PCR on a small, independent sample of 5 cases and 5 controls we verified overexpression of the 3 highest expressing miRNAs among cases, miR-18a, miR-181a, and miR-222; the differences were not statistically significant in this small set. [score:5]
miR-18a is part of the oncogenic miR 17-92 cluster, which is often overexpressed in solid tumors, including breast [35]. [score:3]
Using qRT-PCR on a small independent replication set of five cases and five controls, we further examined the three miRNAs (miR-18a, miR-181a, and miR-222) with the highest expression in cases. [score:3]
miR-18a, miR-181a, and miR-222 showed the highest percentage difference between cases and controls in our study; qRT-PCR of these miRNAs in a small independent replication set of cases and controls, though not statistically significant, replicated the direction of change for all three. [score:2]
Serum levels of five cases and five controls were examined by using qRT-PCR for miR181a, miR18a, and miR-222. [score:1]
[1 to 20 of 5 sentences]
35
[+] score: 13
In the colon, up-regulated miR-17-92a promotes neoplasia through various pathways, e. g. miR-18a and miR-19 directly repress TSP-1 and CTGF, respectively, to promote angiogenesis [24] and miR-92a down-regulates BCL2L11 expression thereby reducing apoptosis [44]. [score:10]
Butyrate treatment also decreased the levels of other miR-17-92a cluster members, including miR-17, miR-18a, miR-19a/b and miR-20a. [score:1]
As shown in Fig.   1e, consistent with previous reports [15, 26], miR-17, miR-18a, miR-19a/b and miR-20a, were decreased by 40 to 70 % after butyrate treatment. [score:1]
In addition to the aforementioned miR-17 and miR-20a, the miR-17-92a cluster encodes miR-18a, miR-19a/b and miR-92a. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 13
The over -expression of miR-18a has been reported in OS cell lines 37. miR-21 was also identified to be highly expressed in OS cells and patient tissues and functions by targeting RECK and PTEN 38 39. [score:7]
In this study, we found that the fold increases in the expression of miR-18a and miR-21 were similar to that of miR-199a-5p in OS patient tissues (data not shown), but the serum levels of miR-18a and miR-21 in OS patients did not show significant differences 10. [score:3]
Whether miR-18a, miR-21 and miR-199a-5p could convergently target PIAS3 in OS needs further study. [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 13
KRAS is a target of miR-18a* and KRAS mutations are detected in approximately 10% to 30% of endometrial adenocarcinomas [30]. [score:4]
The aberrant expression of miR-18a* was correlated with FIGO stage II. [score:3]
By targeting KRAS, miR-18a* represses proliferation and growth of cancer cells [31]. [score:3]
Taken together, these data suggest that miR-18a* may serve as a potential target for endometrial cancer treatment. [score:3]
[1 to 20 of 4 sentences]
38
[+] score: 13
For instance, overexpression of miR-18a-5p inhibited bleomycin -induced pulmonary fibrosis in mice through reduction of TGF-βRII expression and suppression of TGF-β-Smad2/3 signaling [11]. [score:9]
Zhang Q. Ye H. Xiang F. Song L. J. Zhou L. L. Cai P. C. Zhang J. C. Yu F. Shi H. Z. Su Y. Mir-18a-5p inhibits sub-pleural pulmonary fibrosis by targeting tgf-beta receptor iiMol. [score:4]
[1 to 20 of 2 sentences]
39
[+] score: 13
miR-92a-3p inhibition also reduced TNF-α production by ∼50%, suggesting its involvement in regulating TLR7 -mediated immune induction, while miR-18a-5p and miR-17-5p inhibition only had a modest effect on RNA sensing (Figure 1A). [score:6]
In accord with the concept of a sequence -dependent and miRNA-independent activity of select 2′OMe AMOs on ssRNA sensing, transfection of 2′OMe NC1 AMO resulted in a dose -dependent inhibition of IFN-α production (indicative of TLR7 recruitment (21, 28)) to immunostimulatory ssRNA in human PBMCs, while the miR-18a-5p 2′OMe AMO did not (Figure 1C). [score:3]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
In this work, we originally set out to study the role of the individual members of the miR-17∼92 cluster of miRNAs (miR-17/20a, miR-19a/b, miR-18a and miR-92a) on TLR7 -driven NF-κB signalling in mouse primary macrophages. [score:1]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
In light of previous reports that 2′OMe RNAs can act as TLR7 antagonists (10, 11), we reasoned that certain 2′OMe AMO sequences could be more potent than others—thereby explaining the divergent activity of miR-18a-5p and NC1 AMOs. [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Selected miRNAs were also analyzed in nasal biopsies from asthmatic patients and healthy donors, revealing differential expression of 10 miRNAs (miR-18a, miR-126, let-7e, miR-155, miR-224 were down-regulated, while miR-498, miR-197, miR-874, miR-143, miR-886-3p were up-regulated) [25]. [score:9]
Several microRNAs (miR-18a, miR-27a, miR-128 and miR-155) were down-regulated in asthmatic bronchial epithelium, and biological pathway analysis suggested that they may affect TGF-β, IL-6, IL-8, and IFN signaling. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 13
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
2013.125 24212931 42. van Almen GC Verhesen W van Leeuwen RE van de Vrie M Eurlings C Schellings MW MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failureAging Cell. [score:4]
Another previous study showed that the members of miR-17-92 cluster, including miR-18a, − 19a, and -19b, were differentially expressed in failure-prone heart of aged mice as well as in cardiac biopsies of idiopathic cardiomyopathy patients at old age with severely impaired cardiac function [42]. [score:3]
We corroborate to this observation since the miR-19a/-19b and miR-18a/-18b pairs scored high in terms of synergy (2 [nd] and 7 [th] rank respectively) despite not participating in the consensus modules. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 12
miR-18a, -146a and -223 which were detected in the blood miRNA profiles, are all implicated in maintaining the fine balance of the IL-6 expression as these miRNAs target various molecules along the IL-6 pathway: miR-18a targets PIAS3, an inhibitor of STAT3 [20]. [score:9]
Repression of miR-18a suggested increased levels of the inhibitor. [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 12
Some of the upregulated miRNAs included, miR-499, miR-372, miR-18a, miR-21 and miR-30d, while let-7c and miR-198 were downregulated. [score:7]
In line with previous reports of head and neck cancer [10, 11, 26– 34] miR-499, miR-372, miR-18a and miR-21 were upregulated in our series. [score:4]
html) for the first 789 bp 3’UTR of PDCD4 MicroRNA Fold change miR-372 4.82 miR-499 2.89 miR-18a 2.82 miR-200c 2.69 miR-130a 2.59 miR-21 2.29 miR-30d 2.21 miR-409-5p 2.14 miR-20a 2.12 let-7c 0.45 miR-198 0.40 The array data were then confirmed by QRT-PCR of 4 representative miRNAs using ten tumour and adjacent normal samples. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 12
They found that the precursor and mature form of miRNA-18a, but not the primary transcript, are upregulated in liver tissues collected from 77 female HCC patients. [score:4]
Moreover, the overexpression of several p53 proteins mutated in the DNA binding domain (K132E, I162F, I232F, R249S), frequently observed in HCC, greatly increase the level of miR-18a and decrease, though at different extent, the levels of its primary transcript. [score:3]
The authors demonstrate that different mutp53 regulate the amount of ERα protein by regulating the biogenesis of miR-18a, which in turn decreases the tumor-protective function of the estrogen pathway in female hepatocarcinogenesis [58, 71]. [score:3]
They identify mutp53 as a putative factor involved in the regulation of the processing of miR-18a, but not of the other member of the oncogenic cluster miR-17 ∼ 92 [72– 74]. [score:2]
[1 to 20 of 4 sentences]
45
[+] score: 12
The upregulation of miR-18a and miR-18b were verified in clinical samples. [score:4]
miR-18a of the miR-17-92 cluster and miR-18b of the miR-106a-92 cluster showed almost identical expression patterns in clinical samples, while some divergence was observed for miR-19b being encoded by both clusters (Figure 3). [score:3]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
These 13 miRNAs include all the above seven miRNAs (omitting miR-31*) previously described in osteoblasts [8] as well as miR-1, miR-18a, miR-18b, miR-19b, miR-133b and miR-144. [score:1]
[1 to 20 of 6 sentences]
46
[+] score: 12
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
Further dissection of the genetic complexity of the cluster was demonstrated by generating conditional knockout alleles of the four seed regions represented in the cluster: miR-17, miR-20a; miR-18a; miR-19a, miR-19b-1; miR-92-1 [32]. [score:2]
Distinctive miRNA signatures obtained using unsupervised hierarchical clustering could distinguish these three groups based on just 16 miRNAs with miR-17~92 cluster members (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-20b, and miR-92) and its paralog miR-106a, being the predominant one in addition to miR-29a/c,miR-100, miR-199a*, miR-140, miR-630, and miR-16 [49]. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 12
Other common, but not universal, expression changes have included upregulation of miR-146a and/or miR-146b in most mo dels (but not in B-cells or PBMCs), upregulation of miR-9, miR-18a and miR-132, and downregulation of miR-125b [4, 7, 44– 46, 63]. [score:12]
[1 to 20 of 1 sentences]
48
[+] score: 11
Thus, reduction of FAK activity by a FAK inhibitor is proved to modulate the expression of miR-18a followed by lowing PTEN expression and elevating PI3K/AKT signaling in promoting tumor invasion and metastasis [87]. [score:7]
In addition, ECM stiffness initiated by LOX activation is also capable of activating MYC -induced upregulation of miR-18a in need of β1 integrin clustering. [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 11
Upon the inhibition of each miRNA tested, except miR-18a, we observed the decreased expression of K1 and K10 at the mRNA level (Figure 2B) and K1 at the protein level (Figure 2C). [score:5]
The following miRNA inhibitors (LNA) were obtained from Exiqon: hsa-miR-143 (138515-00), hsa-miR-455-3p (138667-00), hsa-miR-30a (138468-00), hsa-miR-17 (138461-00), hsa-miR-20b (138221-00), hsa-miR-106a (138477-00), and hsa-miR-18 (138462-00), and scramble miR (199002-04) was used as a negative control. [score:3]
Based on their level of expression in human primary keratinocytes in culture (data not shown) and their biological relevance, we chose several potential candidates from our list: miR-17, miR-18a, miR-20b, miR-30a, miR-106a, miR-143 and miR-455-3p. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 11
However, only miR-17 and miR-20a were shown to directly target TGF-β receptor II and miR-18a was reported to target the TGF-β down-stream signaling proteins Smad2 and Smad4 (for review see [4]). [score:6]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
Moreover, in skeletal tissue only miR-18a was slightly reduced in miR-92a [−/−] mice. [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 11
MiR-20a, miR-155, and miR-18a were found up-regulated in Kidney Neoplasms while miR-145 was found down-regulated. [score:7]
MiR-18a was confirmed to be upregulated in colon cancer tissues which suggested that miR-18a is correlated with Colon Neoplasms [71]. [score:4]
[1 to 20 of 2 sentences]
52
[+] score: 10
Yang Y. Ding L. An Y. Zhang Z. W. Lang Y. Tai S. Guo F. Teng C. B. miR-18a regulates expression of the pancreatic transcription factor PTF1A in pancreatic progenitor and acinar cells FEBS Lett. [score:4]
Several microRNAs (miRNAs) including Let-7b, miR-495, and miR-18a are also essential in regulating acinar cell differentiation and homeostasis by modulating the expression of transcription factors [98, 99]. [score:4]
Morimura R. Komatsu S. Ichikawa D. Takeshita H. Tsujiura M. Nagata H. Konishi H. Shiozaki A. Ikoma H. Okamoto K. Novel diagnostic value of circulating miR-18a in plasma of patients with pancreatic cancer Br. [score:1]
Other miRNAs such as miR-18a was also found to be significantly higher in PDA patient plasma samples than healthy people [114]. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Osteocyte marker Stemness inhibitor high in 2w−, low in 2w+ miR-18a, 322, 125b-5p, 182, 872, 130a, 191, 28, 425, 196a, 93 Osteocyte negative marker Stemness marker high only in 2w+ Snord85 Osteocyte marker Stemness inhibitor high only in 2w− miR-101a, 16, 23b, 23a, 9, 24, 467c, 140, 10b, 467e, 29a, 27b, 150, 199a-5p, 199b, 218, 17, 126-3p, 99a, 10a, 30e, 19b, 126-5p, 196b, 25, 96, 186, 106b, 31, 22, 140, 30a, 374, 34c, 27a, 880. let-7i, 7g, 7f, 7a, 7b, 7c, 7d Osteocyte negative marker Stemness marker Possible functions of miRNAs were shown in right. [score:5]
Among this group, miR-18 has been reported to control ctgf/ccn2 gene expression in chondrocytic cells [64]. [score:3]
hnRNPA1 directly associates with miR-18a stem-loop as well as pri-miR-17/18a/19a, and then export pri-miR-17/18a/19a in the exportin-independent manner [42]. [score:2]
[1 to 20 of 3 sentences]
54
[+] score: 10
Hsa-miR-18 and hsa-miR-125 were upregulated whereas hsa-miR-29c was downregulated in basal cell carcinoma [35]. [score:7]
Murakam et al. systematically analyzed miRNA expression profiles in biopsies from patients with HBV, HCV, cirrhosis, and HCC using the adjacent normal tissues as control, and demonstrated that levels of miR-18, pre-miR-18 and miR-224 are elevated in HCC, whereas levels of miR-199a*, miR-195, miR-199, miR-200a and miR-125a are decreased. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 10
Since co-expressed miRNAs have been shown to coordinately regulate canonical cell signaling networks associated with cell death and cell survival [18], it is notable that we found that all members of the miR-17-92 cluster (miR-17-5p, miR-18a, miR-19a, miR-92a) are upregulated after TBI and these miRNAs co-target and possibly negatively co-regulate many TBI-altered genes. [score:10]
[1 to 20 of 1 sentences]
56
[+] score: 10
The effect of hnRNP A1 on Let-7a expression is the opposite of that on miR-18a, thus acting as a negative regulator of miRNA expression. [score:6]
The crosslinking and immunoprecipitation protocol (CLIP) carried out to search for hnRNP A1 endogenous RNA targets has revealed that this protein binds specifically to human pri-miR-18a [155]. [score:3]
A detailed biochemical analysis revealed that hnRNP A1 facilitates miR-18a production by binding to the terminal loop of its pri-miRNA and induces a relaxation at the stem, creating a more favorable cleavage site for Drosha, thus acting as an auxiliary factor for the processing of the miRNA precursor [155]. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 10
The importance of these functions have been demonstrated by showing that retroviral overexpression of a cassette containing miR-17, miR-18 and miR-19 in mice results in c-Myc -induced lymphoma [29]. [score:3]
MiRNA microarray profiling reveals that Toxoplasma infection increases the levels of miR-17-, miR-18- and miR-19 -family members. [score:1]
Red boxes are miR-17 family members; blue boxes are miR-18 family members. [score:1]
Colors of each miRNA indicate the miRNA family to which each belongs; miR-17 = yellow; miR-18 = green; miR-19 = blue; miR-25 = red. [score:1]
These results suggest that the mature miR-18 and miR-19 family members that increase upon infection with Toxoplasma are derived from miR-17∼92; although pri-miR-106b∼25 is also increased in Toxoplasma-infected cells, miR-106b∼25 does not encode miR-18 and miR-19 family members and, consistent with previous reports [32], [37], no pri-miR-106a∼363 was detectable. [score:1]
MiR-18, miR-19 and miR-25 family members also showed an increase in abundance in RNA samples derived form Toxoplasma-infected HFFs (Figures 2C). [score:1]
As miR-17 family members are co-transcribed with members of the miR-18 (Figure S1, blue box), miR-19 and miR-25 families, and are encoded in three separate paralogous loci (miR-17∼92, miR-106a∼363 and miR-106b∼25; Figure 1B), we assembled a heat-map from our microarray data that contains the averaged fold-change values for all probes that hybridized to members of the miR-17, miR-18, miR-19 or miR-25 families (18, 4, 4, and 4 probes, respectively; Figure 1C). [score:1]
Examples relevant to the present work are four families of miRNAs (miR-17, miR-18, miR-19 and miR-25) that are encoded by three paralogous loci; these related loci, which are miR-17∼92, miR-106b∼25 and miR-106a∼363 (see Figure 1B), produce primary transcripts that are post-transcriptionally processed to yield mature miR-17, miR-18, miR-19 and miR-25 family members. [score:1]
[1 to 20 of 8 sentences]
58
[+] score: 10
The most highly connected microRNAs in the network included miR-638, miR-18a-3p, miR-483-3p, miR-181d, and miR-30c, which had greater than 50 positively or negatively correlated predicted targets, suggesting that these microRNAs may be important regulators of gene expression associated with emphysema severity. [score:6]
Five of these microRNAs (miR-638, miR-181d, miR-18a-3p, miR-30c, and miR-483-3p) were correlated with ≥50 of their predicted targets, suggesting that these microRNAs may play a key role in gene regulation in emphysema. [score:4]
[1 to 20 of 2 sentences]
59
[+] score: 10
It is seen that the expression of miR-17, miR-18a, miR-19, miR-20a, miR-21, miR-31, miR-92a, and miR-224 is upregulated in lung cancer cells and inhibition of their expression can reduce cell growth and invasion capacities [7, 39– 41]. [score:10]
[1 to 20 of 1 sentences]
60
[+] score: 9
qPCR -based miRNA expression profiling revealed that miR-17-5p, miR-18a-5p and miR-20a-5p exhibit enhanced expression in tissue samples derived from triple -negative as compared to luminal A breast tumors, which are less aggressive and have much better prognosis as well as lower recurrence rate [64]. [score:4]
In marked contrast, antisense oligonucleotides against miR-18a, miR-19a or miR-92-1 led to no or slight inhibition of cell growth, indicating that single miRNAs of the miR-17-92 cluster have distinct roles on cancer formation and progression. [score:3]
Members of a specific cluster can also be processed in a context -dependent manner, as explained by Cáceres JF et al., where miR-18a stability is changed by hnRNP A1 (Heterogeneous Nuclear Ribonucleoprotein A1) in comparison to the other cluster members [4]. [score:1]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 9
A recent study showed that miR-18a targets the GR protein, and thereby inhibits GR -mediated biological events in neuronal cells [23]. [score:5]
Consistent with this, we found 'transcriptional regulation by GR' as the most relevant pathway to the miR-18a target network (the score = 1022; the score p-value = 2.23E-308) (Additional file 1). [score:4]
[1 to 20 of 2 sentences]
62
[+] score: 9
We found neutrophils expressed five members of this cluster (expressed in at least 4 out 5 donors), with the absent members being miR-18a and miR 17* (17-3p) (Figure 3a). [score:5]
The absence of both of these was not merely through non-detection using our custom microarray as studies on other cell types revealed both miR-18a and miR-17-3p using our custom array (personal communication, Craig Murdoch, University of Sheffield, UK). [score:1]
We found that the absent members of this cluster were miR-17-3p (miR-17*) and miR-18a. [score:1]
The first such cluster to be analysed was the miR-17-92 cluster, which is located on chromosome 13 and contains seven mature microRNAs: miR-17 (17-5p), miR-17* (17-3p), miR-18a, miR-19a, miR-19b, miR-20a and miR-92a [40]. [score:1]
The exact function of miR-18a remains unknown, however one study using lentiviral mediated antagomir delivery into K562 cells found a positive role for miR-18a in cellular proliferation [47], possibly explaining its absence in terminally differentiated non proliferating neutrophils. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 9
Indeed, some estrogen -induced miRNAs such as miR-18a, miR-19b, and miR-20b target and regulate ERα expression, thus forming a negative feedback loop [83]. [score:6]
Other miRNAs, including miR-18a, miR-22, miR-206, and miR-221/222 have also been implicated in ERα targeting [84]. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 9
The remaining 14 (miR-18a-5p, miR-146a-5p, miR-30d-5p, miR-17-5p, miR-200a-3p, miR-19b-3p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-192-5p, miR-296-5p, miR-29a-3p, and miR-133a-3p) were upregulated in HCM patients with T [1] < 470 ms compared with those with T [1] ≥ 470 ms, and 11 (except miR-192-5p, miR-296-5p and miR-133a-3p) were significantly inversely correlated with postcontrast T [1] values. [score:3]
miR-17-92 cluster (miR-17, miR-18a, miR-19a, and miR-19b), also target CTGF as well as thrombospondin-1 in the context of myocardial fibrosis [31]. [score:3]
8 miRNAs (miR-18a-5p, miR-30d-5p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-296-5p, and miR-29a-3p) were selected by the mo del and the AUC for the combination of these 8 miRNAs remained 0.87 (Fig.   4). [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs Validation of by real-time PCRWe validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs We validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
[1 to 20 of 5 sentences]
65
[+] score: 9
For example, miR-18-a antisense (AS), upregulated by STAT3-shRNA has a complementary sequence in STAT3 mRNA, consistent with the “sponge regulation” hypothesis. [score:5]
Conversely, the miR-18-a sense form, downregulated by STAT3-shRNA, does not have a complementary sequence in STAT3 or the 3’UTR-STAT3. [score:4]
[1 to 20 of 2 sentences]
66
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
miR- Effects over miR-9/9 [*]/-2 Promote HCC migration and invasion through regulation of KLF17Budhu et al., 2008; Wang et al., 2008; Sun et al., 2013; Xu et al., 2013 miR-10b Promoted cell migration and invasionLadeiro et al., 2008; Li et al., 2010 miR-15b Molecular mechanisms and roles in HCC remain largely unknownLiu et al., 2012; Wong et al., 2013 miR-17/-5p Proliferation and migrationKutay et al., 2006; Huang et al., 2009; Yang et al., 2010; Chen et al., 2012a; Zheng et al., 2013 miR-17-92 Induce proliferation and anchorage-independent growthPogribny et al., 2007; Wang et al., 2012a miR-18/a/p-18 High expression in HCC tumors. [score:4]
miR-18a high expression in HCC tumors (Liu et al., 2009). [score:3]
MicroRNA-18a prevents estrogen receptoralpha expression, promoting proliferation of hepatocellular carcinoma cells. [score:2]
[1 to 20 of 3 sentences]
67
[+] score: 9
org) suspects that ERBB2 is the target gene of the miR-18-5p, miR-125-5p, miR-133a-3p or miR-3622b-5p. [score:3]
To explore whether ERBB2 is the target gene of those miRNAs, we transfected miR-18-5p, miR-125-5p, miR-133a-3p or miR-3622b-5p mimic and miRNA mimic control into SK-BR-3 or SNU-216 cells. [score:3]
Consequently, the expression of ERBB2 in miR-3622b-5p -transfected cells, not in cells transfected with miR-18-5p, miR-125-5p or miR-133a-3p, was more significantly depressed than that in control cells (Figure 1A and Supplementary Figure 1). [score:3]
[1 to 20 of 3 sentences]
68
[+] score: 9
Upregulation of hsa-miR-18a-5p and hsa-miR-21-3p or downregulation of hsa-miR-133a-3p in adenoma and cancer tissues seemed to serve as an index for early screening of colorectal cancer [17]. [score:7]
In a literature review, Clancy et al. determined six circulating miRNAs, hsa-miR-18a-5p, hsa-miR-21-5p, hsa-miR-29a-5p, hsa-miR-92a-5p, hsa-miR-143-5p and hsa-miR-378-5p, which were most frequently found to be dysregulated in colorectal cancer. [score:2]
[1 to 20 of 2 sentences]
69
[+] score: 9
The top most highly expressed miRNAs in ERBB2 overexpressing cell lines included hsa-let-7b, hsa-miR-640, hsa-miR-200c, hsa-miR-378, hsa-miR-141, hsa-miR-196a, hsa-miR-29c, and hsa-miR-18a*, whereas hsa-miR-501-5p, hsa-miR-202, hsa-miR-760, and hsa-miR-626 were more highly expressed in luminal cell lines lacking ERBB2 overexpression (fold change ≥ 1.5) (see Table S8 in Additional file 1). [score:9]
[1 to 20 of 1 sentences]
70
[+] score: 9
Radiation up-regulated miRNA expression levels included let-7g, miR-16, miR-20a, miR-21 and miR-29c, while miR-18a, miR-125a, miR-127, miR-148b, miR-189 and miR-503 were down-regulated. [score:9]
[1 to 20 of 1 sentences]
71
[+] score: 9
Other miRNAs from this paper: hsa-mir-18b
Both miR-18 and -124a down-regulated the GR, establishing their critical role in the regulation of glucocorticoid responsiveness of the brain [67]. [score:5]
Uchida et al. used Fischer 344 (F344) rats, a well-known stress-hyperresponsive mo del, and showed that this strain, upon a 14-day repeat restrain stress, had increased levels of miR-18a and decreased GR protein expression in the PVN, compared with control Sprague–Dawley (SD) rats [66]. [score:2]
Further studies have supported the implication of microRNAs, specifically miR-18 and -124a, in brain responsiveness to glucocorticoids. [score:1]
Moreover, GR protein levels were found to be reduced by micro -RNAs (miRs), such as miR-18a [66], -18 and -124a [67] in neuronal tissues. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 9
Considering that (a) the deletion affected the secondary structure and stability of the pre-miR-17–pre-miR-18 region and the entire cluster, (b) the deletion was not present in any of the 480 controls, and (c) rs770419845 is a rare variant in BRCA1/2 -negative BC, this in del is likely pathogenic. [score:1]
Furthermore, in this region, the value of ΔG becomes more positive in the presence of the deletion, implying that the deletion affects the secondary structure, decreasing the stability of the pre-miR-17–pre-miR-18a sequence and the entire miR-17–92 cluster with respect to the wild-type structure. [score:1]
The hairpin structure most strongly affected by the variant was pre-miR-18. [score:1]
We used RNAfold algorithm to predict the effect of this deletion on the structure of pre-miR-17, pre-miR-18a, and the miR-17–92 cluster [14]. [score:1]
rs770419845 is positioned in the intergenic region, between pre-miR-17 and pre-miR-18a. [score:1]
A major change in the secondary structure at the level of the pre-miR-18a hairpin was also observed. [score:1]
The deletion is located between the miR-17 and miR-18a sequences—specifically, 20 bp downstream from miR-17 and 36 bp upstream from miR-18a (Figure 1). [score:1]
The deletion produced a change in the secondary structure of the pre-miR-17–pre-miR-18a sequence, decreasing stability (Figure 2A). [score:1]
This 6 bp deletion (delTTGGGC) is located within the polycistronic miR-17–92 cluster, encoding for six miRNAs in the following order: 5′-miR-17–miR-18a–miR19a–miR-20a–miR-19b-1–miR-92a-1-3′ [11, 12]. [score:1]
[1 to 20 of 9 sentences]
73
[+] score: 8
Some of these miRNAs (e. g. miR-18a, miR-20a, miR-93) are upregulated in a high proportion of non-CBF-AML, and are associated with distinct AML subtypes (Additional file 1: Figure S3). [score:4]
The expression of miR-17, miR-18a, miR-20a, miR-93, and miR-181 in was evaluated from published gene expression datasets [24, 25]. [score:3]
Specifically, 52 non-CBF-AML and 31 CBF-AML were analyzed for miR-17, 31 non-CBF-AML and 18 CBF-AML were analyzed for miR-18a, 53 non-CBF-AML and 34 CBF-AML were analyzed for miR-20a, 34 non-CBF-AML and 18 CBF-AML were analyzed for miR-93 and miR-181. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 8
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 8
In detail, we found a downregulation of miRNAs hsa-miR-18a and hsa-miR-20a in blood cells of melanoma patients. [score:4]
They also showed a copy number alteration for the four miRNAs hsa-miR-214, hsa-miR-106b, hsa-miR-18a, and hsa-miR-20a, all of which were deregulated in melanoma blood cells as shown in our study. [score:2]
We analyzed 13 miRNAs that showed significant deregulation in the microarray experiments, including hsa-miR-106b, hsa-miR-107, hsa-miR-1280, hsa-miR-151-3p, hsa-miR-17*, hsa-miR-18a, hsa-miR-199a-5p, hsa-miR-20a, hsa-miR-20b, hsa-miR-30a, hsa-miR-362-3p, hsa-miR-550*, and hsa-miR-664, using TaqMan [® ]MicroRNA Assays (Applied Biosystems). [score:1]
The best classification accuracy has been obtained by using a subset that consists of 16 miRNAs including hsa-miR-186, hsa-let-7d*, hsa-miR-18a*, hsa-miR-145, hsa-miR-99a, hsa-miR-664, hsa-miR-501-5p, hsa-miR-378*, hsa-miR-29c*, hsa-miR-1280, hsa-miR-365, hsa-miR-1249, hsa-miR-328, hsa-miR-422a, hsa-miR-30 d, and hsa-miR-17*. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 8
Interestingly, downregulation of HDAC9 by si-HDAC9 in P-PDLSCs restored the expression of pri-miR-17-92a as well as the mature miR17-92a, though, miR-18 was not affected, suggesting that HDAC9 inhibited miR17-92a (Fig.   3a, b). [score:8]
[1 to 20 of 1 sentences]
77
[+] score: 8
Further study indicates that along with other miRNAs hsa-miR-18a target genes were predominantly involved in the regulation of cell proliferation, differentiation, and adhesion during the process of malignant transformation [44]. [score:4]
Other hairpins MD5, MD17, MD157, MD244, MD366, MR175, MR201, MR268, and MR282 were aligned with hsa-miR-628-5p, hsa-miR-6804-3p, hsa-miR-4289, hsa-miR-208a-3p, hsa-miR-510-3p, hsa-miR-18a-3p, hsa-miR-329-3p, hsa-miR-548ax, and hsa-miR-342-3p, respectively. [score:1]
Roles of hsa-miR-628-5p, hsa-miR-18a-3p, and hsa-miR-332-3p in Humans. [score:1]
Also, hsa-miR-18a is unregulated in basal cell carcinoma (BCC) of the skin compared with non-lesional skin [43]. [score:1]
The utility of those 13 miRNAs, that is, hsa-miR-628-5p, hsa-miR-6804-3p, hsa-miR-4289, hsa-miR-208a-3p, hsa-miR-510-3p, hsa-miR-18a-3p, hsa-miR-329-3p, hsa-miR-548ax, hsa-miR-3934-5p, hsa-miR-4474-5p, hsa-miR-7974, hsa-miR-6865-5p, and hsa-miR-342-3p, can be utilized as antiviral therapeutics against MERS-CoV infection. [score:1]
[1 to 20 of 5 sentences]
78
[+] score: 8
When considering fold changes, the most upregulated miRNAs were miR-31, miR-100, miR-378a, miR-18a, and miR-584, whereas the most downregulated ones were miR-143, miR-26b, miR-125a, miR-148a, and miR-192 (Fig.   3c). [score:7]
In the data presented here, many of these miRNAs (e. g. miR-10a/b, miR-24/27, miR-125a, miR-126 and miR-221/222) are abundant, while others are present in relatively low amounts (e. g. miR-18a, miR-19a, miR-34a, miR-200a/b/c, miR-210 and miR-217), or not at all (e. g. miR-133a and miR-663) (Fig.   2a). [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 8
The results found that miR-18a was overexpressed and 33 miRNAs (e. g. miR-34b, miR-34c, let-7 family) were down-regulated in NPC tissues of which these miRNAs are involved in the pathway of nervous system development and sensory perception of sound being associated with NPC development. [score:8]
[1 to 20 of 1 sentences]
80
[+] score: 8
Notably, hnRNPA2B1 has a role in regulating the biogenesis of miRNAs and in up -regulating hsa-miR-18a (Guil and Caceres, 2007) and down -regulating hsa-let-7 (Eddington et al., 2007). [score:4]
Enrichment analysis for miRNA binding sited in the detected genes detected 3 of the DBS -modified miRNAs: hsa-miR-20, hsa-mir-18, and hsa-miR-143 as highly predicted to bind AS targets detected by the exon level analysis (Table S19). [score:3]
The multifunctional RNA -binding protein hnRNP A1 is required for processing of miR-18a. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 8
Recently in an orthotopic metastatic breast cancer xenograft mo del, miR-18a suppressed distant metastasis via the hypoxia-inducible factor 1-alpha pathway [34]. [score:3]
It is possible that the overexpression of miR-18a may play a role in repressing the metastatic behavior of intraocular medulloepitheliomas. [score:3]
MiR-18a was also highly expressed in intraocular medulloepithelioma samples. [score:2]
[1 to 20 of 3 sentences]
82
[+] score: 8
The expression of cyclin -dependent kinase inhibitor CDKN1A (p21) is inhibited by miR-17-5p, miR-18a, and miR-20a. [score:7]
A polycistronic microRNA cluster termed miR-17-92, located in chromosome 13 open reading frame 25 (C13orf25) in the human genome, encodes seven miRNAs: miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92-1. Fig. (2) shows the genomic organization of this cluster. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 8
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
[1 to 20 of 1 sentences]
84
[+] score: 8
In addition to miR-30b, miR-18a was also significantly downregulated by 1 mmol/L Hcy in our study, and several researches had reported the important role of miR-18a in regulating cell apoptosis [33, 34, 35]. [score:5]
Song Y. Wang P. Zhao W. Liu X. Ma J. Xue Y. Liu Y. MiR-18a regulates the proliferation, migration and invasion of human glioblastoma cell by targeting neogenin Exp. [score:3]
[1 to 20 of 2 sentences]
85
[+] score: 8
To date, miR-17, miR-18a\b, miR-19a, miR-20a\b, miR-21, miR-106a\b, miR-340, miR-421, and miR-658 have been shown to be highly expressed in gastric cancer tissues[17– 20], whereas the expression of miR-34b, miR-34c, and miR-128a is upregulated in undifferentiated gastric cancer tissues[21]. [score:8]
[1 to 20 of 1 sentences]
86
[+] score: 7
On the basis of intermediate regulation the regulatory network identified some novel hub miRs(hsa-miR-200c, hsa-miR-200b, hsa-miR-200a, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-18a, hsa-miR-141 and hsa-miR-92a) which were not reported earlier in association with PD and hence can be considered as potential target for future study. [score:4]
The 9 IR hub miRs in Group 2 regulatory network which play an important role in inter-regulatory signal transduction were hsa-miR-200c, hsa-miR-200b, hsa-miR-200a, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-18a, hsa-miR-141and hsa-miR-92a. [score:3]
[1 to 20 of 2 sentences]
87
[+] score: 7
Increased expression of miR-18a in MDA-MB-231 breast cancer cell lines has shown to reduce primary tumor growth and lung metastasis and miR-18a inhibition promotes tumor growth and lung metastasis (37). [score:5]
One of the most frequently deregulated microRNAs-encoding genes in human cancer is the polycistronic MIR17HG gene, which encodes six microRNAs including miR-18a. [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 7
For example, gga-miR-18, gga-miR-193a, gga-miR-193b, gga-miR-30b, gga-miR-146a, gga-miR-24, gga-miR-92, gga-miR-7b, gga-miR-7-1, and gga-miR-7-2 are up-regulated after avian influenza virus infection in previous studies whereas in our results these miRNAs are down-regulated on PID 4 33. [score:7]
[1 to 20 of 1 sentences]
89
[+] score: 7
In absolute qRT-PCR quantifications [30], [31], miR-509-transduced NALM6 cells expressed 1,814±95 copies (mean ± SEM) per cell of miR-509-5p (Table 1), comparable to levels of miR-18a, which for reference is expressed at the 70th percentile of all miRs in NALM6 cells based on our miR microarray data (Figure 1D). [score:5]
Absolute copy number of mature miR-509 and miR-18a RNA per NALM6 cell. [score:1]
Copy number per cell was estimated based on standard curves of miR-509-5p, miR-509-3p or miR-18a using DNA oligonucleotides. [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 7
Upregulation of miRNAs from the miR-17 ∼ 92 cluster (in this work miR-18a, 19a, and 92a-1) and downregulation of miR-324-5p were previously described in human MB of the SHH subgroup (12, 13). [score:7]
[1 to 20 of 1 sentences]
91
[+] score: 7
microRNAs downregulated in quiescent cells included miR-18, miR-20, miR-29, and miR-7, and microRNAs upregulated with quiescence included let-7b, miR-125a, miR-30, miR-181, miR-26, and miR-199. [score:7]
[1 to 20 of 1 sentences]
92
[+] score: 7
As noted above, the HuH6 EVs carried the most specific miRNA load, missing or carrying at lower concentration some miRNA particularly abundant in the EVs of other cells, but showing several uniquely enriched miRNAs as follows: miR-372-3p; miR-371a-3p; miR-371a-5p; miR-373-3p; miR-34a-3p and miR-122-5p The EV-cargos did show some specificity with the detection of miRNAs expressed at high levels in only one line: miR-16-5p in HuH7-EVs only; miR-18a-5p and miR-20a-5p in Hep3B-EVs only and miR-451a in HepG2-EVs only. [score:3]
As noted above, the HuH6 EVs carried the most specific miRNA load, missing or carrying at lower concentration some miRNA particularly abundant in the EVs of other cells, but showing several uniquely enriched miRNAs as follows: miR-372-3p; miR-371a-3p; miR-371a-5p; miR-373-3p; miR-34a-3p and miR-122-5p The EV-cargos did show some specificity with the detection of miRNAs expressed at high levels in only one line: miR-16-5p in HuH7-EVs only; miR-18a-5p and miR-20a-5p in Hep3B-EVs only and miR-451a in HepG2-EVs only. [score:3]
This group include hsa-miR-103a-3p, hsa-miR-106b-5p, hsa-miR-122-5p, hsa-miR-16-5p, hsa-miR-18a-5p, hsa-miR-193b-3p, hsa-miR-19a-3p, hsa-miR-20a-5p, hsa-miR-23b-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a, hsa-miR-34a-5p, hsa-miR-451a. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 7
NEDD9 is also a validated target gene of the ACM-specific miRNA miR-29-3p and of miR-18a-5p, a miRNA also more than two-fold up-regulated in ACM which regulation did however not reach significance levels (adjusted p-value = 0.08). [score:7]
[1 to 20 of 1 sentences]
94
[+] score: 7
The down-regulated miRNAs were highly enriched for LCL specific miRNAs (miR-155, let-7a-i, miR-21, miR-142, miR103, miR-320, miR-146a-b) and the up-regulated miRNAs were highly enriched for iPSC specific miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, miR-18a). [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
17, 18 To date, a few studies have shown, through searches with Target Scan and/or sequence binding prediction programs, that miR-30b, miR-18a, and miR-143 specifically inhibit KRAS expression in colon cancer cells. [score:7]
[1 to 20 of 1 sentences]
96
[+] score: 7
The miRNAs profile comparison between resting and activated B cells showed the up-regulation of 19 miRNA in activated B cells: mir-98, mir-106a, mir-20a, mir-17-5p, mir-20b, mir-16-2, mir-18a, mir-155, mir-21, mir-181d, mir-425-5p, mir-148a, mir-15b, mir-15a, mir-181b mir-181c, mir-181a, mir-130b, mir-148b (Table 3). [score:4]
MiRNAs belonging to the cluster mir-17/92 and the paralogous clusters mir-25/106b and mir-106a/363 showed a similar trend of expression, i. e. mir-17-5p, mir-20a, mir-106a, mir-20b, mir-18a, mir-106a, mir-18b, mir-20b, mir-106b, mir-93 and mir-25 (Cluster 1, Figure 1). [score:3]
[1 to 20 of 2 sentences]
97
[+] score: 7
Bcl-6 promotes Tfh cell differentiation through the repression of a set of miRNAs which normally prevent effector T cells from expressing Tfh cell signature molecules such as CXCR5, CXCR4, and PD-1. miR-17, miR-18, and miR-20a are involved in CXCR5 upregulation through “repression of the repressor”. [score:6]
They are as follows: let-7a, let-7c, let-7e, let-7f, let-7g, let-7i, miR-15b, miR-16, miR-18a, miR-22, miR-26b, miR-27a, miR-27b, miR-29b, miR-30c, miR-125b, miR-133b, miR-146b, miR-148a, miR-150, miR-155, miR-181a, miR-181b, miR-181d, miR-223, miR-320, miR-491, and miR-494. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 7
This finding was further demonstrated by reverse transcription-quantitative PCR (RT-qPCR) analysis of tumour-suppressive miR-193a (Fig. 2b), miR-18a (Fig. 2c) and oncogenic miR-21 (Fig. 2d), as an example. [score:3]
Expression of miR-193a (b), miR-18a (c) and miR-21 (d) in the exosomes and exosome donor tissues, including primary colon cancer and liver metastasis of colon cancer, were assessed by qPCR. [score:3]
Our results indicate that the level of miR-18a and miR-193a in the exosomes from either primary colon tumour tissue or metastatic liver of colon tumour is higher than in their donor tumour tissues. [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 6
There are only a few studies on the expression changes of miRNA in the serum of patients with GC, which are summarized in Table 2. Some miRNAs were reported to be up-regulated, including miR-20b, miR-20a, miR-17, miR-106a, miR-18a, miR-21 [72], miR-17-5p, miR-21, miR-106a and miR-106b [73]. [score:6]
[1 to 20 of 1 sentences]
100
[+] score: 6
Consistent with other studies, we also found that miR-200a, miR-200b, miR-18a and miR-224 were among the top 10 downregulated miRNAs, while miR-29, miR-125a, miR-125b, miR-122 and miR-186 were upregulated in LNCaP/DHT compared with LNCaP. [score:6]
[1 to 20 of 1 sentences]