sort by

756 publications mentioning hsa-mir-17 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-17. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 514
De Summa et al. [74] show that overexpression of miR-17 in both mesenchymal-like BRCA1-proficient and in BRCA1- and BRCA2-mutated BC cell lines in addition to the significant overexpression of miR-17 in sporadic patients seems to suggest that downregulation of BRCA1, a presumed target of miR-17-5p mimics a ‘BRCAness’ phenotype, that is, a phenotype that some sporadic cancers share with BRCA1- or BRCA2-mutation carriers. [score:11]
In addition, both miR-17-5p and miR-17-3p are abundantly processed from precursor miR-17 and have synergetic effects on developing HCC by binding different targets on different signaling pathways: miR-17-5p targets PTEN, one of the most frequently lost tumor suppressor in human cancers, while miR-17-3p represses expression of vimentin, an intermediate filament with the ability to modulate metabolism, and GalNT7, an enzyme that regulates metabolism of liver toxin galactosamine. [score:10]
On the other hand, downregulation of miR-17-5p upregulates its target, the autophagy regulator beclin-1, which leads to apoptosis resistance of cancer cells upon paclitaxel treatment [81]. [score:10]
According to Matsubara et al. [80], inhibition of miR-17-5p and miR-20a with antisense oligonucleotides (ONs) can induce apoptosis selectively in lung cancer cells overexpressing miR-17-92, suggesting the possibility of targeting an ‘oncomiR addiction’ to expression of these miRNAs in a subset of lung cancers. [score:9]
Assuming that miR-17-5p inhibition would restore protein expression of tumor suppressive miR-17-5p targets Programmed cell death 4 (PDCD4) and Phosphatase and tensin homolog (PTEN), human TNBC cells were transfected with antisense oligonucleotides against miR-17-5p. [score:9]
To justify miR-17-5p acts as tumor suppressor, a study shows that low expression levels of miR-17 results in cisplatin resistance of NSCLC by high expression of CDKN1A (cyclin -dependent kinase inhibitor 1A) and RAD21 (Rad21 homolog (Schizosaccharomyces pombe)) [83]. [score:9]
Resveratrol and Pterostilbene decrease the levels of endogenous as well as exogenously expressed miR-17, miR-20a and miR-106b thereby upregulating their target PTEN [122] and eventually leading to reduced tumor growth in vivo. [score:8]
Inhibitors of miR-17 could potentially serve as adjuvants in chemotherapy as oncogenic miRNAs like miR-17 are upregulated in rapamycin-resistant cells and inhibition of miR-17 restored rapamycin sensitivity. [score:8]
A recent study from Liao XH et al. also established that miR-17-5p acts as a tumor suppressor by directly targeting STAT3 and inducing apoptosis in breast cancer cells by inhibiting STAT3/p53 pathway [70]. [score:8]
They found that miR-17-5p was highly expressed in strongly invasive, but not in weakly invasive BC cells, and that miR-17-5p overexpression enhanced migratory and invasive abilities of BC cells, while its downregulation had the opposite effect. [score:8]
As p21 and STAT 3 are direct targets of miR-17-5p and miR-20a, downregulation of miR-17-5p and miR-20a induces myeloid differentiation and growth arrest in AML cells in vitro and in vivo [112]. [score:7]
High levels of miR-17-5p, which further downregulate CDKN1A (Cyclin Dependent Kinase Inhibitor 1A), p21 and E2F1 tumor suppressor genes in imatinib sensitive and resistant chronic myeloid leukemia (CML) cells compared to peripheral blood mononuclear cells (PBMCs), have also been observed [111]. [score:7]
It acts as a tumor suppressor in normal growth conditions by inhibiting PTEN through miR-17-5p and at unfavorable conditions miR-17-3p promotes tumor cell survival by inhibiting MDM2 [124]. [score:7]
A follow-up study from the same group investigated the cellular mechanisms involving miR-17-5p in gastric cancer and found that miR-17-5p/20a promote gastric cancer by directly targeting the tumor suppressors p21 and p53 -induced nuclear protein 1 (TP53INP1), which results in unrestrained proliferation and apoptosis inhibition, respectively, and involve a positive regulatory circuit between miR-17-5p/20a and MDM2 (murine double minute 2). [score:7]
However, miR-17-5p was found downregulated in chronic lymphocytic leukemia both with normal p53 and with mutated/ deleted p53, but downregulation was more pronounced in the latter patient group [114, 115]. [score:7]
This correlates with the observation that serum levels of circulating miR-17-5p were upregulated in a relapse group of patients and downregulated in the post-operative group. [score:7]
miR-17-5p expression levels might be used as predictive factor for chemotherapy response and a prognostic factor for overall survival in CRC, since patients with high miR-17-5p expression in tumor tissue have shorter overall survival rates [97, 100] and respond better to adjuvant chemotherapy than patients with low miRNA expression [97]. [score:7]
On the one hand, miR-17-5p inhibits mTOR by inducing MKP7 (Mitogen-Activated Protein Kinase Phosphatase 7) via targeting ADCY5 (Adenylate Cyclase 5): Upon dephosphorylation of mTOR by MKP7, mTOR dimerizes with PRAS40 (40-kDa proline-rich AKT substrate) and gets inhibited [21, 47]. [score:7]
Expression of CCND1 was inhibited by overexpression of miR-17-5p [72]. [score:7]
The effect of miR-17-5p is highly dependent on many factors like type of cancer, mo del systems used and constructs used in mo del systems for knockdown or overexpression, as well as on the relative expression levels of miR-17-3p and miR-17-5p which was discussed in few cancer types where miR-17-3p did have synergistic or rescue effect. [score:6]
Another study shows that high levels of miR-17-5p decreased expression of its direct target TGFBR2 (transforming growth factor-β receptor 2), further promoting gastric cancer cell proliferation and migration [89]. [score:6]
The tumor suppressor BRCC2, which is thought to induce apoptosis in a caspase -dependent manner, is a direct target of miR-17-5p [107]. [score:6]
Downregulation of miR-17-5p by curcumin and its synthetic analogs inhibits CRC cell proliferation and induces apoptosis, and could provide the basis for future therapeutic approaches [103]. [score:6]
Even though correlating miR-17-5p expression levels with various tumor properties might be very useful in the development of biomarkers, it does not give evidence about its tumorigenic or tumour-suppressive potential. [score:6]
HIF-1α (Hypoxia Inducible Factor 1 Alpha Subunit) downregulates the expressions of miR-17-5p and miR-20a through a mechanism that is dependent of c-Myc but independent of its transcription partner HIF-1ß. [score:6]
When overexpressed, PTENP1 sequesters miR-17, which would otherwise target PTEN and the negative Akt-regulator PHLPP (PH Domain And Leucine Rich Repeat Protein Phosphatase). [score:6]
According to Li et al. [67], miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HMG box-containing protein 1 (HBP1), which they confirmed as a direct target of miR-17-5p. [score:6]
Out of 4000 genes linked to BC progression, miR-17-5p was confirmed in vitro and in vivo as regulator of multiple pro-metastatic genes, hence had an anti-metastatic effect, while miR-17-5p inhibition in BC cells enhanced expression of pro-metastatic genes and accelerated lung metastasis from orthotopic xenografts. [score:6]
In addition, miR-17-5p directly targets RND3, a Rho Family GTPase that acts as tumor suppressor by promoting adhesion [98]. [score:6]
What causes miR-17-5p overexpression leading up to CRC pathogenesis and by what targets does it regulate proliferation? [score:6]
The therapeutic potential of miR-17-5p inhibition in triple negative BC (TNBC), one of the most aggressive breast cancer forms, was also assessed as a therapeutic target [71]. [score:5]
Expression of miR-17-3p is approximately half of the level of miR-17-5p except for PBMCs, where expression was below detection limits [32]. [score:5]
Conflicting results on tumor suppressor versus promoter function exist for prostate cancer (PC): Both mature miR-17-5p and passenger strand miR-17-3p target TIMP3 which has synergetic effect on enhancing prostate tumor growth and invasion [118]. [score:5]
Expression of miR-17-5p is also high in osteosarcoma, whereby PTEN seems to be an important target contributing to progression and metastasis [105]. [score:5]
By targeting SMAD7, miR-17-5p promotes nuclear translocation of β-catenin, enhances expression of COL1A1 (Collagen Type I Alpha 1 Chain) and finally facilitates the proliferation and differentiation of femoral head mesenchymal stem (HMS) cells promoting osteonecrosis [106]. [score:5]
Downregulation of p21 by miR-17-5p in turn promotes PCNA (proliferating cell nuclear antigen) activity, where p21 is a negative regulator of PCNA and thus ERα promotes breast cancer cell cycle progression and proliferation in p21/PCNA/E2F1 -dependent pathway [68]. [score:5]
It should be mentioned though, that although miR-17-5p expression levels allowed distinction between NSCLC and healthy control, it was not useful as diagnostic marker for discriminating between NSCLC and chronic obstructive pulmonary disease (COPD) [77]. [score:5]
Supporting in vitro and tissue level high expression of miR-17-5p, a clinical study proves serum levels of miR-17 along with miR-19a, miR-20a and miR-223 were significantly upregulated in CRC patients compared to controls [104]. [score:5]
Likewise, miR-17-5p increased the proliferation and growth of gastric cancer cells in vitro and in vivo, by targeting SOCS6, a cytokine -induced STAT inhibitor [88]. [score:5]
Expression profiling of acute myeloid leukemia (AML) identified a set of seven miRNAs comprising miR-17-5p that allows discrimination of three common AML-causing chromosomal translocations with a diagnostic accuracy of > 94%, and is significantly overexpressed in MLL (mixed lineage leukemia) rearrangements, which causes particularly aggressive leukemia with poor prognosis [108]. [score:5]
The results showed that miR-17-3p seems to act as a back-up mechanism of miR-17-5p for these targets, and therefore, due to the high sequence homology between the antisense molecules and miR-17-3p, as well as to excess binding sites for miR-17-3p on the 3′UTR of PDCD4 and PTEN mRNAs, the antisense oligo acted as a miR-17-3p mimic and reduced PDCD4 and PTEN expression instead of restoring it. [score:5]
Downregulation of E2F1 by miR-17-5p is of importance for proliferation both during embryonic colon development and colon carcinogenesis [95]. [score:5]
Other studies concluded that miR-17-5p expression levels did not have sufficient informative values to serve as diagnostic tool, at least using sputum miRNA profiling [78], This study confirms previous results of the same group [79], where miR-17-5p was not found either over-or under-expressed in human lung cancer. [score:5]
Apart from promoting breast cancer cell migration and invasion by miR-17-5p, Liao XH et al. showed that miR-17-5p also promotes cell proliferation by down -regulating p21 which is a direct target of miR-17-5p in ERα (Estrogen receptor α) -positive breast cancer cells. [score:5]
This is in accordance with the notion that miR-17-5p overexpression reduces cyto-protective autophagy by targeting Beclin-1 in paclitaxel resistant lung cancer cells [82]. [score:5]
However, high levels of miR-17-3p have also been reported to suppress tumorigenicity of PC cells through inhibition of mitochondrial antioxidant enzymes [119]. [score:5]
Accordingly, miR-17-5p targets P130 (Retinoblastoma-Like 2, a presumed tumor suppressor, present in a complex that represses cell cycle -dependent genes) and subsequently activates the WNT/β-catenin pathway [97]. [score:5]
Among all the miRNAs of the miR-17-92 cluster, miR-17-5p showed highest expression in epithelial colon cells and expression levels increased in the transitional zone from normal to adenoma to adenocarcinoma (N-A-AC), suggesting a role in sequential evolution of early colon cancer [91]. [score:5]
qPCR -based miRNA expression profiling revealed that miR-17-5p, miR-18a-5p and miR-20a-5p exhibit enhanced expression in tissue samples derived from triple -negative as compared to luminal A breast tumors, which are less aggressive and have much better prognosis as well as lower recurrence rate [64]. [score:4]
This is in contrast to studies that found miR-17 (no distinction between 5p and 3p) downregulated in lung adenocarcinoma initiating cells [76] and in non-small cell lung cancer (NSCLC). [score:4]
Transcriptional regulation and target mRNAs of miRNA-17-92 cluster and miR-17-5p. [score:4]
This further supports that upregulation of miR-17-5p is at least associated to myeloid leukemia. [score:4]
A potential anti-prostate cancer drug, glucosinolate-derived phenethyl isothiocyanate (PEITC), results in miR-17-5p -mediated suppression of PCAF and again AR-regulated transcriptional activity and cell growth of prostate cancer cells, suggesting a new mechanism by which PEITC modulates prostate cancer cell growth [121]. [score:4]
Validated gene targets of miR-17 and pathways affected by their regulation in cancers. [score:4]
Downregulation of AIB1 (“Amplified in breast cancer 1”) by miR-17-5p decreased proliferation and abrogated insulin-like growth factor 1 -mediated, anchorage-independent growth of breast cancer cells. [score:4]
Not only in solid tumors, but also in tumors of hematopoietic origin miR-17-5p is upregulated, like in both acute myeloid leukemia (AML) and chronic myeloid leukemia (CML). [score:4]
In addition to PTEN, SMAD7 and thus Wnt signalling is a direct target for miR-17-5p in this context. [score:4]
The long noncoding RNA CCAT2, a WNT downstream target, induces miR-17-5p and MYC through TCF7L2 (Transcription Factor 7 Like 2) -mediated transcriptional regulation (Figure 2) [96]. [score:4]
Large-scale miRnome analysis on 540 samples including lung, breast, stomach, prostate, colon and pancreatic tumors identified miR-17-5p as upregulated in all solid tumors [50]. [score:4]
Cumulative data clearly point to a role of miR-17-5p in the development and progression of breast cancer, and is currently being explored as biomarker for diagnosis, prognosis and therapeutic target. [score:4]
miR-17-5p and miR-20a in turn negatively regulate E2F1 expression [28]. [score:4]
MicroRNA expression and sequence analysis database (mESAdb) [33], which integrates data from several databases like e. g. the one by Basekerville and Bartel [34] substantiates these findings and emphasize the importance of miR-17-5p in all tissues. [score:3]
In summary, in the context of gastric cancer, miR-17-5p clearly acts as oncogene and targets the components of many pathways involved in cell proliferation and migration. [score:3]
Elevated miR-17-5p expression is also observed in early embryonic colon epithelium, and is sustained only in the proliferative crypt progenitor compartment. [score:3]
Nonetheless, results derived from a SCID mouse mo del suggests the suitability of miR-17 as a therapeutic target for CLL treatment. [score:3]
In contrast, miR-17-5p was described as tumor suppressor [69]. [score:3]
Hence, miR-17-5p may be used as diagnostic and prognostic marker, but also as a potential target for molecular therapy of osteosarcoma. [score:3]
ERα plays an important role in cell-cycle progression by promoting the expression of PCNA and Ki-67 along with miR-17-5p. [score:3]
Among these, the miRNA-17-92 cluster seems of special interest as it has been the first oncomiR to be described, but one of the cluster members, miR-17-5p, has also been found to decrease with aging and might even prolong the life span of mice upon overexpression. [score:3]
What prognostic and therapeutic implications can be derived from miR-17-5p expression data? [score:3]
In addition to exploring its diagnostic potential, miR-17-5p might also serve as therapeutic target in lung cancer treatment. [score:3]
Hence miR-17-5p plays a tumor suppressor role in this setting. [score:3]
HCC cell lines overexpressing miR-17-5p injected either subcutanously or into the livers of nude mice generating an orthotopic intrahepatic tumor mo del, miR-17-5p supported tumor growth and intrahepatic metastasis [63]. [score:3]
While we here focus on the role of the single miR-17-5p in formation and progression of distinct cancer types, Xiang and Wu [57] have reviewed the tumor-suppressive and tumorigenic properties of the miR-17-92 cluster as a whole. [score:3]
MiR-17 along with miR-106a/b and miR-20a/b targets GABBR1(gamma-amino-butyric acid type B receptor 1) thus promoting colorectal cancer cell proliferation and invasion [99]. [score:3]
Therefore, the authors suggest miR-17-5p as a potential therapeutic target for treatment of basal-like breast cancer. [score:3]
By now a more differentiated view has emerged, as miR-17-5p alone, by stimulating T cells can suppress cancer growth [52], while still able to drive hepatocellular carcinoma in a transgenic mouse mo del. [score:3]
This effect seems mediated by p300/CBP -associated factor (PCAF) as a target of miR-17-5p modulating the androgen receptor transcriptional activity [120]. [score:3]
Several studies confirm miR-17-5p overexpression in CRC (colorectal cancer) tissue samples [92, 93, 94]. [score:3]
In support of miR-17-5p’s tumor-suppressive role, recent bioinformatics and in vitro analysis revealed that levels of miR-17-5p are decreased in triple negative breast cancer cells resulting increase in CCND1 (cyclin D1) levels which is reason for uncontrolled proliferation. [score:3]
Hence, miR17 might represent a biomarkers of ‘BRCAness’ phenotype, indicating which patients who could most benefit from PARP inhibitor therapies. [score:3]
The role of miR-17-5p as an oncomiR is supported by many studies, while also the opposite, a tumor suppressive role has been found in some studies. [score:3]
MiR-17 might be largely responsible for the effect of the cluster, since overexpression of pre-miR-17 in a transgenic mouse mo del results in hepatocellular carcinoma (HCC). [score:3]
Similarly, miR17-5p was identified as metastatic suppressor of basal-like breast cancer [53]. [score:3]
Targets of miR-17-92 cluster and miR-17-5p. [score:3]
On the other hand overexpression of miR-17 promotes the cancer cell migration by reducing cell adhesion and promoting cell detachment in immortalized rat prostate endothelial cells [54]. [score:3]
This assumption has been verified by Wang et al. [55], they not only found that concentrations of miR-17-5p/20a were significantly associated with the differentiation status and tumor progression, but also revealed that high expression levels of miR-17-5p/20a were significantly correlated with poor overall survival. [score:3]
In terms of ubiquitous transcription of miR-17-5p, it was found to be expressed in all 40 different normal human tissues tested including brain, muscle, circulatory, respiratory, lymphoid, gastrointestinal, urinary, reproductive and endocrine systems [32]. [score:3]
On the other hand miR-17-5p targets IRS1 thus activating AMPK (AMP-activated protein kinase) which stops phosphorylation of ULK1 (Unc-51 like autophagy activating kinase 1) by mTOR and promotes formation of ULK1-ATG13-FIP200 (ATG13, autophagy related 13; FIP200, focal adhesion kinase family kinase-interacting protein of 200 kDa) complex required for the initiation of autophagy, a major complex involved in the formation of autophagosome [21]. [score:3]
Indeed, this was shown to happen via inhibition of miR-17-5p. [score:3]
Thereby, miR-17-5p also targets the long non-coding RNA PTENP1, a pseudogene of PTEN. [score:3]
Summarized, the tumorigenic or tumor-suppressive functions of miR-17-5p might depend on the cellular context, that is, on the mo del system used, cell type, cancer stage and many other factors, like for example “BRCA-ness”. [score:3]
After all, elevated miR-17-5p expression could either contribute to tumor formation and progression, or could represent a defense mechanism that is intended to limit carcinogenesis. [score:3]
Expression of miR-17 as well as its seed region is strongly conserved in higher animals. [score:3]
A very similar observation was made in another tumor entity, pancreatic cancer, where an overexpressed nerve growth factor receptor (GFRα2) led to PTEN inactivation mediated by induction of miR-17-5p [102]. [score:3]
On the other hand, chemotherapy was found to further increase the expression levels of miR-17-5p in CRC cells in vitro, thereby repressing the pro-apoptotic factor PTEN and promoting chemoresistance [101]. [score:3]
For example, elevated miR-17-5p expression levels are present in tumor tissue and serum of lung cancer patients–including adenocarcinoma, squamous cell and adenosquamous carcinoma- compared to healthy controls. [score:2]
Circulatory/serum miR-17-5p levels are deregulated which also reflects the differential biology of breast cancer subtypes [73]. [score:2]
Further studies on miR-17-3p are required to establish a firm regulation between miR-17-5p and miR-17-3p. [score:2]
MiR-17-5p expression levels were associated with clinical stage, positive distant metastasis and poor response to neo-adjuvant chemotherapy. [score:2]
This shows how miR-17-5p tightly regulates the genes involved in cell proliferation and cell apoptosis. [score:2]
A very recent article explores the effects of miR-17-5p in osteosarcoma tumorigenesis and development. [score:2]
MiRNA-17-5p expression is highly elevated in patient-derived HCC tissues, especially in metastasis derived tissues when compared to controls [61]. [score:1]
Most interestingly, upon resistance to therapy of multiple myeloma with bortezomib, the exosomal transfer of several microRNAs seems to be altered, among them miR-17-5p, which was significantly reduced [110]. [score:1]
In addition, therapeutic potential for antagomirs against miR-17-5p/20a was suggested, which was applied as chemotherapeutics in a mouse tumor mo del. [score:1]
Thus, miR-17-5p can either promote or curb apoptosis of lung cancer cells. [score:1]
Hence PTENP1 functions as miR-17 antagonist, representing an appealing approach for HCC treatment based on miR-17 function in tumorigenesis [60]. [score:1]
Summarized, miR-17-5p possesses oncogenic activity in the context of hepatocellular carcinoma. [score:1]
Emerging evidence indicates that the miR-17-92 cluster and specifically miR-17-5p play an important role in carcinogenesis in the liver. [score:1]
We here have summarized studies that indicate that elevated levels of miR-17-5p might be an alarm signal for cancer, that might be sensitive, albeit not specific for a single type of cancer. [score:1]
miR-17-5p: a link between proliferation, cancer and aging. [score:1]
In addition, serum levels of miR-17-5p were associated with metastasis status and staging, suggesting that the miRNA in the serum indeed is tumor cell derived [62]. [score:1]
Indeed, levels of serum miR-17-5p/20a were notably reduced in post -treated mice with tumor volume regression. [score:1]
However, a follow-up study failed to assign a prognostic value to miR-17-5p plasma levels, since there was a slight, but not significant difference in the survival rates of patient groups exhibiting low or high miR-17-5p plasma levels, although the trend might turn significant when based on larger sample size (n = 31 vs. [score:1]
Still, circulating miRNAs as biomarkers or alarmiRs still lack sufficient studies to be able to define the range of inter-individual variation in the general healthy population and consequently define thresholds for e. g. miR-17-5p in serum or plasma that would lead to the decision of careful follow up clinical testing for the presence of a tumor. [score:1]
In cancers like glioblastomas, under stress conditions miR-17 plays a dual role depending on the conditions. [score:1]
The p38 MAPK-HSP27 pathway mediates miR-17-5p’s effect on migration, but, however, is not involved in its effect on proliferation. [score:1]
Several studies have investigated the relationship between miR-17-5p and lung cancer, mainly in view to its potential clinical application of miRNA expression profiles as diagnostic and prognostic marker. [score:1]
Overview of pathways affected by miR-17-5p in different cancer phenotypes leading to cell proliferation and migration. [score:1]
It was found that patients suffering from several different types of cancer have high circulating miR-17-5p levels in serum [55, 56], implying that increased serum levels of miR-17-5p could be an alarm signal for different types of cancers. [score:1]
Thus, in the context of the bone, miR-17-5p seems to have tumorigenic activity. [score:1]
Their findings in gastric cancer cells were backed-up by administering antagomiRs against miR-17-5p/20a to reduce tumor formation in a xenograft mouse mo del [87]. [score:1]
miR-17-5p and its role in cancer. [score:1]
We thereby surprisingly found that it is elevated in the serum or plasma of a large variety of solid and hematologic tumor types, which prompts us to here postulate a function of circulating miR-17-5p as an alarm signal that is sensitive for tumors in general, albeit not specific for a defined tumor type. [score:1]
These results state that miR-17-3p also plays an important role in different cancers either in synergetic way or as rescue for miR-17-5p. [score:1]
A study in multiple myeloma (MM) patients showed that high levels of miR-17-5p, miR-20a and miR-92-1 of miR-17-92 cluster are associated with shorter progression-free survival, suggesting poor prognosis [109]. [score:1]
Again, the final effect of miR-17-5p seems to be highly context -dependent. [score:1]
According to a recent report, circulating exosomes from prostate cancer cells carry long non-coding RNAs which are themselves enriched with miRNA seed regions that can bind to let-7 and miR-17 families like a miRNA sponge [123]. [score:1]
In Figure 2, we summarize the pathways effected by miR-17-5p in different cancer types. [score:1]
For a comprehensive review on the use of miRNAs as biomarkers for prognosis, diagnosis, therapeutic prediction and therapeutic tool in breast cancer, please refer to Bertoli et al. [66], who also discuss the potential of miR-17-5p as potential diagnostic biomarker. [score:1]
Briefly, miR17-5p plays a key role in colorectal cancer pathogenesis and progression. [score:1]
With this in mind, we set out to summarize the current knowledge of miR-17-5p in the context of cancer. [score:1]
For details on miR-17-5p’s role in aging, please refer to a recent review [21]. [score:1]
Hence, there exists a positive WNT signaling feedback loop involving miR-17-5p. [score:1]
Here in this review we focus on one of its member, miRNA-17-5p, and present current state of knowledge in the context of cancer, plasma or serum levels for specific type of tumors making it an ‘alarm signal’ for early detection of tumors. [score:1]
Henceforth miR-17-5p could be used as a diagnostic biomarker for colorectal cancer. [score:1]
In addition, serum miR-17-5p levels were inversely related to the survival of patients with lung cancer, that is, high levels correlated with shorter survival times [75]. [score:1]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
[1 to 20 of 138 sentences]
2
[+] score: 350
Q-PCR analysis revealed that compared with control kidneys, Pparα expression was downregulated by ∼80% in Pkd1 [F/RC] KO and Pkd2- KO kidneys, whereas its expression was upregulated in Pkd1 [F/RC]D KO and Pkd2-miR-17∼92 KO kidneys (Fig. 7d). [score:10]
miR-17 expression was significantly reduced in cyst epithelia of Pkd2-miR-17∼92 KO mice (negative control), whereas its expression was induced in renal tubules of kidney-specific miR-17∼92 -overexpressing transgenic mice (positive control), indicating that the in situ probe specifically detects miR-17. [score:7]
Finally, since miR-17 is upregulated, we determined whether PPARα is downregulated in human ADPKD cysts. [score:7]
Expression of PPARα targets was reduced in ADPKD mo dels, whereas their expression was increased after miR-17∼92 deletion. [score:7]
Anti-miR-17 inhibits cysts in in vitro human mo dels of PKDTo assess the translational potential of our findings, we studied the effects of miR-17 family inhibition in primary cell cultures derived from human ADPKD cysts. [score:7]
Our results have shown that miR-17 and miR-19 directly inhibit Pparα expression in cystic kidneys, but whether reducing Pparα gene dosage is sufficient to promote cyst growth is not known. [score:6]
Quantitative real-time PCR (Q-PCR) validated the microarray data and additionally demonstrated that miR-17 upregulation correlates with disease progression in both mo dels (Fig. 1d,e). [score:6]
Interestingly, Etfa, Etfb, Etfdh, Cpt2 and the various peroxisome genes were all downregulated in both Pkd1 and Pkd2 mutant kidneys, whereas their expression was increased after miR-17∼92 deletion. [score:6]
Deletion of c-Myc resulted in a 53.7% downregulation of pri-miR-17 expression, suggesting that c-Myc also promotes miR-17∼92 transcription in the context of ADPKD (Fig. 6f). [score:6]
Within the miR-17∼92 cluster, we decided to target the miR-17 family based on our observation that multiple members of this family were upregulated in ADPKD mo dels. [score:6]
RNA-Seq (Supplementary Fig. 9,10) and subsequent Q-PCR analyses (Fig. 9a,b) showed that a large network of OXPHOS/FAO-related PPAR α target genes were upregulated after miR-17∼92 deletion in both ADPKD mo dels. [score:6]
miR-17 expression was abolished in cysts of Pkd2-miR-17∼92 KO mice, whereas its expression was induced in renal tubules of miR-17∼92Tg mice, indicating that the in situ probe specifically detects miR-17. [score:5]
To assess the translational potential of our findings, we studied the effects of miR-17 family inhibition in primary cell cultures derived from human ADPKD cysts. [score:5]
To gain insights into the signalling events linked to dysregulated miR-17∼92 expression, we began by identifying PKD-relevant upstream regulators of miR-17∼92. [score:5]
Since miR-17 inhibition slows cyst growth in ciliopathy mo dels (Kif3a- KO and Nphp3 [pcy/pcy]), the beneficial effects of anti-miR-17 treatment may also be observed in other forms of cystic kidney disease besides ADPKD. [score:5]
We observed attenuated cyst growth, lower blood urea nitrogen (BUN) levels, downregulation of Kim1 and Ngal expression, reduced renal fibrosis and lower cyst epithelial proliferation in Pkd1 [RC/RC]; Ksp/Cre;miR-17∼92 [F/F] compared with Pkd1 [RC/RC]; Ksp/Cre mice (Fig. 3e–h and Supplementary Fig. 4). [score:5]
For PPPARα expression plasmid studies, mIMCD3 cells were grown in six-well dishes (2 × 10 [5] cells per well), and transfected with 0.6 μg of a Pparα expression plasmid (pPparα) or Control (pCMX), along with 5 nM of miR-17 or scrambled mimic (Scr). [score:5]
Thus, deletion of miR-17∼92 inhibited cyst proliferation and disease progression in both Pkd1- KO and Pkd2- KO mo dels. [score:5]
In contrast, compared with control kidneys, miR-17 expression was increased by 50.3% in Pkd1- KO kidneys, whereas its expression was reduced by 51.9% in Pkd1-miR-17∼92 KO kidneys (Supplementary Fig. 1B). [score:4]
Among the upregulated miRNAs, we focused on the miR-17 family because it contributed most substantially (>2.7%) to the total miRNA pool in both ADPKD mo dels (Fig. 1a,b). [score:4]
To study whether c-Myc regulates miR-17∼92 expression in ADPKD mo dels, Ksp/Cre; Pkd1 [F/F]; c-Myc [F/F] (Pkd1/ c-Myc- KO) mice were generated. [score:4]
Intriguingly, this analysis identified Pparα as one of 25 common direct targets of miR-17∼92 in the context of ADPKD (Fig. 7c and Supplementary Tables 4,5). [score:4]
miR-17 miRNA family is upregulated in ADPKD. [score:4]
To understand the biological relevance of miR-17 upregulation, the miR-17∼92 cluster was deleted in orthologous ADPKD mo dels. [score:4]
Next, we intersected the RNA-Seq data from both ADPKD mo dels with a list of high-probability direct mRNA targets of miR-17∼92. [score:4]
To identify the precise location of dysregulated miR-17 expression, we performed in situ hybridization using a locked nucleic acid (LNA) -modified probe against the mature miR-17 transcript. [score:4]
Pkd1 expression was unchanged whereas miR-17∼92 expression was reduced by 85.4% in Pkd1 [F/RC]D KO compared with Pkd1 [F/RC]S KO kidneys (Supplementary Fig. 3A,B). [score:4]
miR-17 is upregulated in kidney cysts of mouse and human ADPKD. [score:4]
In support of this conclusion, we show that genetic deletion of miR-17∼92 attenuates disease progression in ADPKD mouse mo dels irrespective of the mutated gene (Pkd1 or Pkd2), the type of mutation (null or hypomorphic) or the dynamics of cyst growth (rapidly fatal, aggressive but long-lived or slowly progressing). [score:4]
In contrast, compared with control kidneys, miR-17 expression was increased by 45.4% in Pkd2- KO kidneys, whereas its expression was reduced by 46.5% in Pkd2-miR-17∼92 KO kidneys (Supplementary Fig. 2C). [score:4]
We have recently developed a chemically modified anti-miR oligonucleotide (anti-miR-17) that sterically inhibits the activity of all miR-17 family members in cultured cells via complementary base pairing 16. [score:3]
miR-17 expression was increased in cyst epithelia of both Pkd1-mutant and Pkd2- KO kidneys (Fig. 1f). [score:3]
This analysis identified Pparα and 24 other common putative miR-17∼92 targets in the context of ADPKD. [score:3]
miR-17 expression was not detected by ISH in NHK kidney sections. [score:3]
Our work suggests that an important additional component of this metabolic re-wiring is the inhibition of FAO and OXPHOS mediated, at least in part, by the miR-17- Pparα axis (Fig. 10). [score:3]
Anti-miR-17 inhibits cysts in in vitro human mo dels of PKD. [score:3]
First, we validated that Pparα is inhibited by miR-17∼92 in ADPKD mo dels. [score:3]
We have previously used Pkd2- KO mice to analyse miR-17 expression by Q-PCR 12. [score:3]
miR-17 and miR-19 binding to Pparα 3′-UTR lead to reduced Pparα expression, which in turn affects mitochondrial metabolism in kidney epithelial cells. [score:3]
miR-17∼92 deletion attenuates disease progression in long-lived and slow cyst growth mo dels of ADPKD. [score:3]
In contrast, deletion of miR-17∼92 did not affect c-Myc expression in Pkd1- KO or Pkd2- KO kidneys, indicating that c-Myc functions upstream of miR-17∼92 in ADPKD (Fig. 6g,h). [score:3]
Therefore, we used this in situ probe to examine miR-17 expression in kidney samples from normal humans (NHK) and patients with ADPKD. [score:3]
Pkd2 [−/−] cells were transfected with 0.4 μg of a PPARα expression plasmid (pPpara) or Control (pCMX), along with 1 nM of miR-17 or scrambled mimic (Scr). [score:3]
The pre-clinical studies presented here indicate that miR-17∼92 is a novel drug target for ADPKD. [score:3]
In conclusion, miR-17∼92 promotes ADPKD progression through a new mechanism involving the inhibition of mitochondrial function. [score:3]
miR-17 modulates mitochondrial function by inhibiting Ppara. [score:3]
How to cite this article: Hajarnis, S. et al. microRNA-17 family promotes polycystic kidney disease progression through modulation of mitochondrial metabolism. [score:3]
c-Myc deletion reduced pri-miR-17 expression in Pkd1- KO kidneys. [score:3]
c-Myc promotes miR-17∼92 expression in PKD. [score:3]
miR-17∼92 deletion results in improved expression of mitochondrial and metabolism-related gene networks. [score:3]
We used the to assess whether this compound inhibits endogenous miR-17 in kidneys following systemic administration. [score:3]
c-Myc promotes miR-17∼92 expression in cystic kidneys. [score:3]
To explore the downstream mechanisms, we performed RNA sequencing (RNA-Seq) analysis to compare mRNA expression profiles between kidneys of 21-day-old Pkd1 [F/RC]S KO and Pkd1 [F/RC]D KO mice (n=3 biological samples), and 21-day-old Pkd2- KO and Pkd2-miR-17∼92 KO mice (n=5 biological samples). [score:3]
Q-PCR analysis revealed that primary miR-17 transcript (pri-miR-17) was upregulated by 9.3-fold in SBM kidneys compared with control kidneys, suggesting that c-Myc drives miR-17∼92 transcription (Fig. 6d). [score:3]
These findings are likely to be relevant to human ADPKD pathogenesis because inhibiting miR-17 also attenuated proliferation and cyst growth of primary human ADPKD cultures. [score:3]
While our data demonstrated that administration of anti-miRs up to 6 months is feasible, additional pre-clinical studies are needed to fully address the long-term safety profile of anti-miR-17 therapy and to further explore miR-17 as a drug target for PKD. [score:3]
Moreover, re -expression of Pparα normalized ATP -dependent OCR of miR-17 mimic -treated mIMCD3 and Pkd2 [−/−] cells (Fig. 9g–i and Supplementary Fig. 12). [score:3]
Importantly, miR-17 is a feasible and novel drug target for ADPKD. [score:3]
Finally, we examined the role of miR-17∼92 in a slow cyst growth mo del of ADPKD (Pkd1 [RC/RC]) that harbours homozygous germline Pkd1 RC mutations. [score:2]
Compared with Pkd2- KO mice, we observed a 149% increase in median survival, 31.8% improvement in serum creatinine levels, 15.8% reduction in cyst index, reduced Kim1 (down by 37.9%) and Ngal (down by 39.6%) expression, and a 58.9% decrease in the number of proliferating cyst epithelial cells in Pkd2-miR-17∼92 KO mice (Fig. 2e–h and Supplementary Fig. 2). [score:2]
Furthermore, upstream regulatory analysis revealed that gene networks controlled by key metabolism-related transcription factors Pparα, Pparg and Ppargc1a were activated upon miR-17∼92 deletion (Fig. 7b). [score:2]
Pparα expression was also increased in anti-miR-17 -treated compared with vehicle -treated Pkd2- KO kidneys. [score:2]
Expression of miR-17 (blue) was increased in cysts (cy) of Pkd1 [F/RC]S KO and Pkd2- KO compared with renal tubules of wild-type mice. [score:2]
Kidney-weight-to-body-weight ratios, BUN levels and Kim1 and Ngal expression were reduced in anti-miR-17 -treated compared with vehicle -treated Pkd2- KO mice (Fig. 4b–e). [score:2]
Q-PCR was performed by using the TaqMan Gene Expression Master Mix (Life Technologies) and pre-designed pri-miR-17∼92 primers from Life Technologies. [score:2]
Based on the unbiased analysis of our RNA-Seq data, we reasoned that miR-17∼92 -mediated direct repression of Pparα might provide one potential explanation for this phenomenon. [score:2]
PPARα expression was decreased in mIMCD3 cells treated with miR-17 mimic compared with scramble mimic. [score:2]
Collectively, these observations suggest that miR-17 promotes proliferation in cystic kidneys, at least in part, by reprogramming metabolism through direct repression of Pparα. [score:2]
Conversely, Pparα mRNA and protein expression was decreased in miR-17 mimic -treated compared with scramble mimic -treated mIMCD3 as well as Pkd2 [−/−] kidney epithelial cells (Fig. 7d,f). [score:2]
Compared with renal tubules in NHK, miR-17 expression was increased in kidney cysts from patients with ADPKD (Fig. 1g). [score:2]
We observed a 50% improvement in median survival, 22% reduction in serum creatinine levels, 26.8% reduction in kidney-weight-to-body-weight ratio and decreased expression of kidney injury markers Kim1 (down by 38.7%) and Ngal (down by 43.9%) in Pkd1-miR-17∼92 KO compared with Pkd1- KO mice (Fig. 2a,b,d and Supplementary Fig. 1D,E). [score:2]
miR-17 aggravates cyst growth through direct repression of Pparα. [score:2]
Q-PCR analysis showed that compared with control kidneys, Pkd1 expression was equally reduced in both Pkd1- KO and Pkd1-miR-17∼92 KO kidneys indicating a similar level of Cre/ loxP recombination (Supplementary Fig. 1A). [score:2]
Similarly, compared with mock or control oligonucleotide transfection, anti-miR-17 inhibited in vitro cyst growth of primary ADPKD cells in a dose -dependent manner (Fig. 5b,c and Supplementary Fig. 6B). [score:2]
Q-PCR and western blot analysis showed that compared with control kidneys, Pkd2 expression was equally reduced in both Pkd2- KO and Pkd1-miR-17∼92 KO kidneys indicating a similar level of Cre/ loxP recombination (Supplementary Fig. 2A,B). [score:2]
Treatment with anti-miR-17 produced a dose -dependent reduction in the proliferation of cyst epithelia from five human donors (Fig. 5a and Supplementary Fig. 6A). [score:1]
involving Pkhd1/Cre; Pkd2 [F/F] (Pkd2- KO) mice were utilized to determine the delivery and efficacy of the anti-miR-17 compound. [score:1]
The proposed mechanism by which miR-17∼92 promotes ADPKD progression. [score:1]
Thus, c-Myc functions upstream of miR-17∼92 in ADPKD mo dels. [score:1]
Anti-PS staining was observed in collecting duct-derived cysts (arrowheads) of Pkd2- KO mice injected with anti-miR-17 indicating that the compound was delivered to collecting duct cysts. [score:1]
Treatment with miR-17 mimics reduced basal and ATP -dependent OCR in mIMCD3 and Pkd2 [−/−] cells. [score:1]
Deleting the miR-17 binding site prevented miR-17 -mediated, but not miR-19 -mediated, repression. [score:1]
Primary cyst epithelial cultures derived from kidneys of ADPKD patients were transfected with anti-miR-17 (dose: 3 nM, 10 nM or 30 nM) or three different control oligonucleotides (dose: 30 nM, control oligo1, 2 and 3). [score:1]
The following miRNA mimics were purchased from Dharmacon, Inc (Thermo Fischer Scientific Inc) - miR-17 (catalogue # C-310561-07-0005), miR-19a (catalogue # C-310563-05-0005) and negative control or Scrambled (catalogue # CN-001000-01-05). [score:1]
The tissues were incubated with miR-17 (cat # 38461-01, Exiqon) or scramble (cat # 99004-01, Exiqon) probes. [score:1]
The percentage of miR-17 -positive cysts per kidney section from four human ADPKD patients (#6–9) is shown in the graph. [score:1]
To assess therapeutic efficacy, we injected Pkd2- KO mice with 20 mg kg [−1] of anti-miR-17 or vehicle at postnatal days (P) 10, 11, 12 and 19 and killed them at P28. [score:1]
In the cytoplasm, the mature miRNAs (miR-17 and miR-19) bind to Pparα 3′-UTR. [score:1]
To test whether the binding sites are functional, we co -transfected mIMCD3 cells with a luciferase reporter plasmid containing Pparα 3′-UTR and miR-17, miR-19, or scramble mimics (Fig. 8b). [score:1]
For WY14643 studies, mIMCD3 or Pkd2 [−/−] cells were grown at 37 °C, plated in six-well dishes (2 × 10 [5] cells per well), and transfected with 5 nM of miR-17 or scrambled mimic. [score:1]
The miR-17 miRNA family aggravates cyst growth in the Kif3a- KO ciliopathy mo del of PKD 12. [score:1]
Anti-miR-17 treatment reduces proliferation and cyst growth in in vitro mo dels of human ADPKD. [score:1]
Next, we evaluated whether anti-miR-17 treatment demonstrates therapeutic efficacy in a second, more long-term mo del of cystic kidney disease. [score:1]
Quantification of the Sirius red staining (g) and the number of proliferating cells (h) revealed that both interstitial fibrosis and tubular proliferation were reduced after miR-17∼92 deletion in Pkd1 [RC/RC] mice. [score:1]
To assess the therapeutic efficacy of this compound, Pkd2- KO mice were injected with anti-miR-17 or PBS at P10, 11, 12 and 19, and kidneys were harvested on P28. [score:1]
In situ hybridization (ISH) was performed using an LNA -modified anti-miR-17 probe. [score:1]
Pparα 3′-UTR harbours an evolutionarily conserved binding site for miR-17 and miR-19 families (Fig. 8a). [score:1]
Next, we studied the role of miR-17∼92 in Pkhd1/Cre; Pkd2 [F/F] (Pkd2- KO) mice, which with a median survival of ∼70-days exhibit a relatively less aggressive PKD. [score:1]
Kidney sections were co-stained with DBA (green, a marker of collecting ducts) and anti-PS antibody (red, antibody labels anti-miR-17 compound). [score:1]
Chromatin immunoprecipitation analysis showed that c-Myc binds to the miR-17∼92 promoter in cultured renal epithelial cells and mouse kidneys (Fig. 6a). [score:1]
Semi-qPCR analysis of the immunoprecipitated DNA revealed that c-Myc specifically binds to the miR-17∼92 promoter in mIMCD3 cells and mouse kidney tissue. [score:1]
Staining with the anti-PS antibody revealed that anti-miR-17 was delivered to collecting duct cysts even when administered after numerous cysts had already formed (Fig. 4a). [score:1]
Moreover, a 300 mg kg [−1] dose of anti-miR-17 did not produce acute liver or kidney toxicity in mice (Supplementary Fig. 5C). [score:1]
The first and second generation progeny were intercrossed to generate Ksp/Cre; Pkd1 [F/F] (Pkd1- KO) and Ksp/Cre; Pkd1 [F/F]; miR-17∼92 [F/F] (Pkd1-miR-17∼92 KO) mice. [score:1]
miR-17∼92 promotes cyst growth in early-onset ADPKD mo dels. [score:1]
Anti-miR-17 studies involving Pkhd1/Cre; Pkd2 [F/F] (Pkd2- KO) mice were utilized to determine the delivery and efficacy of the anti-miR-17 compound. [score:1]
Large interconnected gene networks controlled by URs PPARα, PPARg and PPARGC1a were predicted to be activated after miR-17∼92 deletion in both ADPKD mo dels. [score:1]
Therefore, we tested whether miR-17 affected these functions of PPARα. [score:1]
The generation of the following mouse lines is discussed in the results section: Pkd1-miR-17∼92 KO, Pkd2-miR-17∼92 KO, Ksp/Cre; Pkd1 [F/RC] (Pkd1 [F/RC]S KO), Ksp/Cre; Pkd1 [F/RC]; miR-17∼92  [F/F] (Pkd1 [F/RC]D KO), Pkd1 [RC/RC]; Ksp/Cre, Pkd1 [RC/RC];Ksp/Cre;miR-17∼92 [F/F] and Pkd1/c-Myc- KO. [score:1]
Similar miR-17 displacement was not observed in mice treated with a control oligonucleotide (Supplementary Fig. 5B and Supplementary Table 3). [score:1]
In a complementary pharmaceutical approach, we demonstrate that anti-miR-17 also slowed cyst growth in two orthologous mouse mo dels, including a long-lived, slow cyst growth mo del. [score:1]
Anti-miR-17 reduced proliferation and cyst count in a dose -dependent manner. [score:1]
Anti-miR-17 demonstrates therapeutic efficacy in short-term and long-term PKD mouse mo dels. [score:1]
mIMCD3 cells were transfected with 0.6 μg of pPpara or pCMX, along with 5 nM of miR-17 or Scr mimic. [score:1]
Moreover, similar to genetic deletion, treatment with anti-miR-17 also slowed the proliferation of cyst epithelial cells (Fig. 4f). [score:1]
The miR-17∼92 primary transcript is processed to yield the individual mature miRNAs. [score:1]
To examine whether miR-17 plays a similar pathogenic role in ADPKD, miR-17∼92 was genetically deleted in various orthologous ADPKD mouse mo dels. [score:1]
C57BL/6 mice (Jackson Laboratories) were injected with a single subcutaneous dose of 0.3, 3 or 30 mg kg [−1] of anti-miR-17, a control oligonucleotide or PBS. [score:1]
Ksp/Cre 42, Pkhd1/Cre 43, Pkd1 [F/F] 15, Pkd2 [F/F] 15, miR-17∼92 [F/F] (ref. [score:1]
The displacement values are reported in log [2] scale where the positive values reflect the loss of miR-17 from the high molecular weight polysome fractions. [score:1]
S KO indicates either Pkd1 [F/RC]S KO or Pkd2- KO, whereas D KO indicates either Pkd1 [F/RC]D KO or Pkd2-miR-17∼92 KO kidneys. [score:1]
44), miR-17 transgenic mice 45, Pkd1 [RC/RC] (ref. [score:1]
miR-17∼92 promotes cyst growth in long-lived ADPKD mo dels. [score:1]
Our studies point to pro-proliferative metabolic reprogramming induced by the c-Myc-miR-17- Pparα signalling axis as a potential new mechanism for PKD pathogenesis (Fig. 10). [score:1]
miR-17 modulates metabolic functions of PPARα. [score:1]
c-Myc binds to miR-17∼92 promoter and enhances its transcription in cystic kidneys. [score:1]
Pathway analysis suggested that the primary cellular consequence of miR-17∼92 deletion in both ADPKD mo dels was improved mitochondrial metabolism (Fig. 7a and Supplementary Figs 7 and 8). [score:1]
First, we deleted miR-17∼92 in Pkd1- KO mice, which develop an early-onset and rapidly fatal form of PKD. [score:1]
Luciferase reporter assays revealed that compared with scramble, both miR-17 and miR-19 mimics suppressed wild-type Pparα 3′-UTR. [score:1]
Similarly, deleting the miR-19 binding site abolished miR-19 -mediated, but not miR-17 -mediated, repression. [score:1]
miR-17∼92 [F/F] mice were bred with Ksp/Cre; Pkd1 [F/+] transgenic mice. [score:1]
We developed an antibody (anti-PS) that specifically binds to the chemically modified phosphate backbone of anti-miR-17 to determine its cellular distribution. [score:1]
We tested whether miR-17 affected these functions of PPARα. [score:1]
Watson-Crick base-pairing between miR-17/ PPARΑ 3′-UTR and miR-19/ PPARΑ 3′-UTR is shown. [score:1]
These networks were also differentially regulated in Pkd2-miR-17∼92 KO compared with Pkd2- KO kidneys. [score:1]
These cells were transfected with anti-miR-17 and control oligos using RNAiMAX (catalogue # 13778-150, Life Technologies) following the manufacturer's protocol at 2,500 cells per well density in a 96-well plate. [score:1]
The seed sequences for the miR-17 and the miR-19 binding sites were mutated in the WT-Pparα 3′-UTR construct to produce the Pparα 3′-UTR (Δ17) and Pparα 3′-UTR (Δ19) constructs. [score:1]
Both miR-17 and miR-19 repressed Pparα 3′-UTR. [score:1]
Therefore, we evaluated whether miR-17∼92 also influences disease progression in long-lived and slow cyst growth mo dels of ADPKD. [score:1]
Anti-miR-17 attenuates cyst growth in two PKD mo dels. [score:1]
mIMCD3 cells were co -transfected with this plasmid and scramble (scr, black), miR-17 mimic (red) or miR-19 mimic (blue) (n=3). [score:1]
The miR-17 family is highlighted in red. [score:1]
mIMCD3 cells were plated in six-well dishes (2 × 10 [5] cells per well) and transfected with 0.4 μg of pLS-Renilla-3′-UTR plasmids, and 10 nM of miR-17 or miR-19a mimic. [score:1]
Moreover, we did not observe any major adverse effects of long-term anti-miR-17 therapy such as weight loss, failure to thrive or death. [score:1]
The experimental approach for anti-miR-17 studies is shown in Supplementary Fig. 5. Littermate pairs of Pkhd1/Cre; Pkd2 [F/F] (Pkd2- KO) mice were administered either standard moist chow or standard moist chow supplemented with fenofibrate at a dose of 800 mg per day per kg body-weight for 10 days starting at postnatal day 18. [score:1]
The circles indicate predicted binding sites for the various miRNA families derived from the miR-17∼92 cluster. [score:1]
Anti-miR-17 studies. [score:1]
The human mature miR-17 sequence is identical to the mouse miR-17. [score:1]
Pkd2- KO and Pkhd1/Cre; Pkd2 [F/F]; miR-17∼92 [F/F] (Pkd2-miR-17∼92 KO) mice were generated using the strategy described earlier. [score:1]
miR-17∼92 deletion attenuates cyst growth in early-onset ADPKD mo dels. [score:1]
[1 to 20 of 150 sentences]
3
[+] score: 336
Although single inhibitors were less effective in HEK293T cells than the batch of three inhibitors together (likely due to different cellular expression levels of miR-17, -20a, and -106b in HEK293T cells and different crossreactivities of the single microRNA inhibitors and their highly homologous target-microRNAs (Fig. S1, [59])) this result demonstrates that the inhibitory effects of three microRNAs on anti-proliferative proteins obviously overrides their inhibitory effects on pro-proliferative proteins, especially on E2F1 in HEK293T cells. [score:15]
Interestingly, when testing each 3 pmol of the individual inhibitors alone, only the miR-106b -inhibitor was able to strongly downregulate E2F-activity, whereas the miR-20a -inhibitor showed only moderate effects and the miR-17 -inhibitor did not affect E2F activity. [score:12]
Bioinformatic target gene predictions followed by experimental target gene validations revealed that miR-17, -20a, and -106b act in a common manner by downregulating an overlapping set of target genes mostly involved in regulation and execution of G [1]/S transition. [score:11]
Replacement of the inhibitor batch by each 37,5 pmol of individual miR-17-, -20a, and -106b -inhibitors and counting two biological replicates with three independently transfected wells each demonstrated, that each of the three microRNA -inhibitors alone was sufficient to fullfill the inhibitory effect on proliferation of USSC with identical efficiency as compared to the combined inhibitor-batch (Fig. 4B). [score:10]
As depicted in Fig. 1A, microRNAs miR-17, -20a, and -106b were consistently downregulated up to 10-fold in all XXL -induced USSC lines tested, whereas their expression remained nearly unchanged or was found slightly upregulated in both USSC lines induced to osteogenic lineage (Fig. 1B). [score:9]
These microRNAs are also found downregulated in XXL-USSC, as well as miR-137 and miR-214 (Fig. S2), which both target CDK6 [61], [62] In addition to miR-17 [37], miR-20a, and miR-106b (this study), miR-214 also downregulates PTEN [63]. [score:9]
Overall, these results demonstrate that miR-17, -20a, and -106b not only share a set of common cell cycle associated target genes on the level of bioinformatic predictions but also show highly comparable results in experimental validation of predicted target genes and furthermore affect pro- as well as anti-proliferative target proteins. [score:7]
0016138.g004 Figure 4(A) USSC line SA5/03 was transfected with a negative control inhibitor or an equimolar batch of miR-17-, -20a-, and -106b- inhibitors, as well as with the 3 inhibitors alone. [score:7]
Pro-proliferative target genes cyclinD1 (CCND1) and E2F1 as well as anti-proliferative targets CDKN1A (p21), PTEN, RB1, RBL1 (p107), RBL2 (p130) were shown as common targets for miR-17, -20a, and -106b. [score:7]
Furthermore, target gene redundancy leads to the finding that microRNAs miR-17, -20a, and -106b not only function in cell cycle, but in addition impact neuronal lineage differentiation of USSC together with additional members of the miR-17-92 cluster and paralogs also found downregulated in XXL-USSC [55]. [score:6]
Beside CDKN1A (also termed p21), which is targeted by miR-17, -20a, and -106b ([39], [40], [49], all confirmed in our study), p27 and p57 are downregulated by miR-221 and miR-222 [60]. [score:6]
Since miR-17, -20a (both encoded on the same transcript), and -106b were not only found commonly downregulated in XXL-USSC but also share their target proteins, we chose to analyze the functional impact of these microRNAs on XXL -induced cell cycle arrest. [score:6]
Expression profiling revealed downregulation of microRNAs miR-17, -20a, and -106b in USSC differentiated into neuronal lineage but not in USSC differentiated into osteogenic lineage. [score:6]
Rather than being single switches, target gene redundancy of microRNAs as described here for miR-17, -20a, and -106b leads to their integration into complex networks and feedback loops regulating pro- and antiproliferating targets. [score:6]
Although we have demonstrated a pro-proliferative effect of microRNAs miR-17, -20a, and -106b in USSC, these microRNAs regulate the expression of pro- as well as anti-proliferative target genes in parallel. [score:6]
In contrast to the neuronal lineage differentiations, expression of miR-17, miR-20a, and miR-106b remained unchanged or was slightly upregulated after 7 days of osteogenic differentiation. [score:6]
MicroRNAs miR-17, -20a, and -106b were consistently found downregulated in neuronal-specific XXL-USSC but their expression remained nearly unchanged during osteogenic differentiation of USSC. [score:6]
At first view it is a contradictory finding that inhibition of microRNAs miR-17, -20a, and -106b decreases transcription factor activity of their validated target gene E2F. [score:5]
Fig. 2A demonstrates that, with the exception of E2F3 and MAPK9, miR-17 significantly influences all target genes tested irrespective of an activating or inhibiting function in cell proliferation. [score:5]
All target genes discussed so far are involved in G [1]/S transition, but, in addition, we were also able to identify WEE1 as a target of miR-17, -20a, and -106b. [score:5]
Mir-17, -20a, and -106b downregulate a common set of pro- and anti-proliferative target genes to impact cell cycle progression of USSC and increase intracellular activity of E2F transcription factors to govern G [1]/S transition. [score:5]
Cell-cycle related proteins predicted as targets for miR-17, miR-20a, and miR-106b and chosen for experimental target gene validation. [score:5]
Acting in a joint, putatively additive manner on pro-proliferative as well as on anti-proliferative targets, miR-17, -20a, and -106b are integrated into a complex network of microRNA-protein relations with joint functionality regarding their target genes, protein-protein-interactions and protein-microRNA gene interactions. [score:5]
HEK293T cells were co -transfected with this E2F-responsive Firefly reporter (plus a Renilla reporter vector) together with 3 pmol of an equimolar batch of miR-17-, -20a-, and -106b -inhibitors or with 3 pmol of each of miR-17-, -20a-, or -106b -inhibitors alone. [score:5]
Proliferation-inhibiting effects of microRNA inhibitors to miR-17, miR-20a, and miR-106b in USSC. [score:5]
Pickering and coworkers [31] demonstrated an appoximately 2-fold increase of E2F1 levels upon inhibition of miR-17 and miR-20a in human fibroblasts and a decrease of BrdU–positive cells upon inhibition of miR-17 and miR-20a in serum starved fibroblasts. [score:5]
Stains from time points 24 h and 48 h after transfection are shown from untransfected SA5/03, and from SA5/03 transfected with negative control mimic and the inhibitor batch, as well as with the miR-17, miR-20a, and miR-106b inhibitors alone (48 h only). [score:5]
Since sequences of miR-17, -20a, and -106b are highly homologous especially with identical seed sequences (Fig. S1), we reasoned that they could act on common target proteins associated with cell cycle regulation. [score:4]
Interestingly, these putative targets include both mRNAs of pro-proliferative as well as anti-proliferative proteins, some of which have already been established as targets for miR-17, -20a or -106b (Table 1), using a variety of different reporter gene assays. [score:4]
MiR-17 and miR-20a belong to the medium abundant microRNAs in native USSC and they are found among the most strongly downregulated microRNAs in XXL-USSC, together with miR-106b. [score:4]
Our observations are in line with these results and show that microRNAs miR-17, -20a, and -106b can positively modulate E2F activity despite their direct targeting of E2F1. [score:4]
Most strikingly, miR-17, -20a, and -106b were found to promote cell proliferation by increasing the intracellular activity of E2F transcription factors, despite the fact that miR-17, -20a, and -106b directly target the transcripts that encode for this protein family. [score:4]
Therefore, we directly measured the activity of E2F transcription factor as the “executive” protein reponse to inhibition of miR-17, -20a, and -106b and thereby record their downstream “net” effect on E2F activity caused by the interplay of their pro- and anti-proliferative targets. [score:4]
MicroRNAs miR-17, miR-20a, and miR-106b were found consistently downregulated in all USSC lines differentiated into cells of neuronal lineage. [score:4]
We thus analysed expression of these microRNAs in native USSC lines SA5/73, SA8/25, SA8/77 and SA4/101 employing a deep sequencing approach and independent expression of miR-17, -20a, and -106b (Fig. S2) in all USSC analysed was detectec here which points to no or only minor unspecific effects of the qPCR assay regarding these microRNAs. [score:4]
These observations strongly point to a pro-proliferative function of each miR-17, -20a, and -106b in USSC and their participation in cell cycle arrest of XXL-USSC, but are of somewhat contradictory nature regarding their aforementioned proproliferating target genes. [score:3]
To this end USSC SA5/03 were transfected with 37.5 pmol of an equimolar batch of miR-17-, -20a-, and -106b -mimics, subsequently induced to neuronal lineage by usage of XXL and immunostained for expression of Ki67 antigen before and 24 h after XXL-induction. [score:3]
Indeed, activity of a luciferase reporter driven by an E2F-responsive promoter element was strongly reduced upon addition of an equimolar batch of miR-17-, -20a-, and -106b -inhibitors in HEK293T cells. [score:3]
Despite their cell cycle relevant target proteins, miR-17, miR-20a, and miR-106b also impact neuronal lineage differentiation of USSC, since certain genes relevant for neuronal differentiation and function like NBEA, EPHA4, NTN4 and NEUROG1 are also affected by these microRNAs [55]. [score:3]
Although the response of WEE1-3′-UTR in our target gene validation assay was weaker than that of CCND1 or RBL2, this finding further demonstrates, that miR-17, -20a, and -106b can potentially act as pro-proliferative microRNAs in a coordinated manner at different regulatory checkpoints of the cell cycle. [score:3]
Firefly activities were normalized to effects caused by (i) endogenous HEK293T microRNAs on the 3′UTRs cloned (miR-17, miR-20a, and miR-106b and homologs are highly expressed in HEK293T cells [52]), (ii) unspecific effects of certain microRNA -mimics on Firefly and Renilla activity per se, and (iii) transfection efficiency variations. [score:3]
For a comprehensive overview, Fig. 6 summarizes the relationships between microRNAs miR-17, -20a, -106b and their validated targets in the context of G [1]/S transition. [score:3]
MiR-17, miR-20a, and miR-106b have common target proteins. [score:3]
0016138.g002 Figure 2Validation of putative cell cycle relevant target genes for microRNAs miR-17 (A), miR-20a (B), and miR-106b (C) in HEK293T-cells. [score:3]
Expression data of microRNAs miR-17, miR-20a, and miR-106b and additional cell-cycle-related microRNAs are shown from native USSC as well as from days 14 and 28 (SA8/25) of differentiations. [score:3]
Differential expression of miR-17, miR-20a, and miR-106b in USSC differentiating in neuronal and osteogenic lineages. [score:3]
Using a retroviral overexpression approach of the miR-17-92 cluster, Yu and coworkers [38] described an anti-proliferative effect of miR-17 and miR-20a based on their interaction with CCND1-3′-UTR, whereas functional data provided in our study are in line with the earlier report of pro-proliferative effects of miR-17 [36]. [score:3]
Some of these proteins (marked with an asterisk in Table 1) have already been validated as targets of miR-17, -20a and/or -106b (CCND1 [38], CDKN1A [39], [40], [49], E2F1 [29], [30], [31], [49], E2F3 [30], PTEN [37], RBL2 [50]) but for reasons of comparability we included them in our experiments. [score:3]
MiR-17, -20a, and -106b target all mentioned proteins involved in this network, and from the functional interactions described, one “final” goal of this regulatory pathway seems to be the control of E2F activity. [score:3]
In addition, we analyzed the anti-proliferative MAPK9 not found within the GO-Terms -based list but known as a target for miR-17 [36]. [score:3]
Both experimental designs, usage of microRNA mimics (Fig. 3A and B) and microRNA inhibitors (Fig. 4A and B), demonstrate a proliferation-activating effect of miR-17, -20a, and -106b in USSC. [score:3]
Fold expression changes (2 [−ddCt]-values) are given for microRNAs miR-17, miR-20a, and miR-106b. [score:3]
As could be expected from sequence homologies, miR-17, -20a, and -106b all had comparable effects on the target 3′-UTRs tested. [score:3]
As seen in Fig. S3, all three microRNAs analyzed share most of the proteins predicted by miRGen's INTERSECTION mode, with only miR-17 lacking a few predicted targets. [score:3]
Mir-17, miR-20a, and miR-106b inhibit E2F transcription factor activity. [score:3]
Validation of putative cell cycle relevant target genes for microRNAs miR-17 (A), miR-20a (B), and miR-106b (C) in HEK293T-cells. [score:3]
In addition we were able to confirm most of the targets already described for miR-17, -20a, and -106b. [score:3]
This implies joint acting of miR-17, -20a, and -106b and consequently, these microRNAs share a large amount of predicted target genes involved in cell cycle events (Fig. S3). [score:3]
Figure S3 List of cell-cycle related genes predicted as targets for miR-17, miR-20a, and miR-106b. [score:3]
On the other hand, miR-106b, which shares high sequence homology with miR-17 and miR-20a, was shown to promote cell cycle progression by targeting CDKN1A (also termed p21, [39]). [score:3]
These contradictory observations might be explained by a mo del proposed by Cloonan and coworkers [36], which is based on the relative abundance of pro- and anti-proliferative miR-17-targets. [score:3]
As seen in Figs. 2B and 2C, miR-20a and miR-106b showed highly similar behavior compared to miR-17 regarding significant Firefly activity reductions and relative influences between the analyzed target genes. [score:2]
” gives the TaqMan qPCR-assay data from osteogenic differentiations of USSC SA5/73 and SA8/25 at days 0 (native) and 7. “Deep sequencing” gives deep sequencing expression data of microRNAs miR-17, miR-20a, and miR-106b aquired from native USSC lines SA5/73, SA8/25, SA8/77, and SA4/101. [score:2]
These findings suggest a common biological function of miR-17, -20a, and -106b with respect to cell cycle regulation. [score:2]
0016138.g005 Figure 5HEK293T-cells were cotransfected with a luciferase reporter vector containing a Firefly gene driven by a minimal promoter consisting of a TATA-box preceeded by a repeat of six E2F-responsive elements and pre-mixed with a CMV-promoter driven Renilla luciferase reporter vector (Cignal Reporter Assay, SABiosciences) and an equimolar batch of miR-17-, -20a-, and -106b -inhibitors as well as with the inibitors alone and with an unspecific negative control respectively. [score:2]
Nevertheless, the result of the E2F-reporter assay is fully in line with the pro-proliferative effect caused by miR-17-, -20a-, and -106b -mimics and the anti-proliferative effect shown by the miR-17-, -20a-, and -106b -inhibitors in USSC and XXL-USSC, respectively. [score:2]
Normalized Firefly-activities were compared to those of pairwise co-transfections of these vectors with the microRNA mimic of interest (miR-17, miR-20a, miR-106b, also including an unspecific mimic negative control) to test for (i) unspecific effects of the given microRNA -mimic on Firefly/Renilla per se, (ii) effects of endogenous HEK293T microRNAs (iii) for validation of the particular target prediction. [score:2]
In turn, E2F not only activates its own transcription, but is also feed-forward-loop connected (directly or via MYC) to the transcription of miR-17, -20a, and -106b, which has been interpreted as tight cell cycle control mechanism. [score:2]
Contradictionary findings about miR-17 functions within cell cycle regulation have been described. [score:2]
Different regulation patterns of microRNAs miR-17, miR-20a, and miR-106b during neuronal lineage and osteogenic differentiation of USSC. [score:2]
HEK293T-cells were cotransfected with a luciferase reporter vector containing a Firefly gene driven by a minimal promoter consisting of a TATA-box preceeded by a repeat of six E2F-responsive elements and pre-mixed with a CMV-promoter driven Renilla luciferase reporter vector (Cignal Reporter Assay, SABiosciences) and an equimolar batch of miR-17-, -20a-, and -106b -inhibitors as well as with the inibitors alone and with an unspecific negative control respectively. [score:2]
Analyzing 1500–3000 randomly photographed cells per experimental condition from each of three independently transfected wells, transfection with 37.5 pmol of an equimolar batch of miR-17-, -20a-, and -106b -inhibitors resulted in a marked decrease of Ki67 -positive cells 24 h after transfection as compared to untransfected and negative-control -transfected cells (Fig. 4A and B). [score:2]
Interactions of miR-17, -20a and -106b with CCND1 and RBL2 were among the strongest found in our assays, whereas other target 3′-UTRs showed significantly weaker responses. [score:2]
Functional effect of miR-17, miR-20a, and miR-106b on cell cycle arrest in XXL-differentiating USSC. [score:1]
Proliferation-activating effect of microRNA mimics to miR-17, miR-20a, and miR-106b in USSC. [score:1]
Figure S1 Sequence Aligning between miR-17, miR-20a, and miR-106b. [score:1]
A batch of miR-17, miR-20a, and miR-106b increases E2F transcription factor activity in HEK293T cells. [score:1]
This not only includes the analyzed miR-17, -20a, and -106b, but also additional microRNAs miR-34a, -137, -214, -221, and -222. [score:1]
Taken together, these data demonstrate that a batch of miR-17, -20a, and -106b increases the proliferation rate of USSC and in part prevents them from XXL -induced cell cycle arrest. [score:1]
Including paralogs, this family consists of miR-17, -18, -19a, -19b, -20a, and -92 (located within a region of 1 kb on chromosome 13), of miR-106a, -19b, -363, and -92 (X-chromosomal) and of miR-106b, -93, and -25 (on chromosome 7) [32]. [score:1]
Pairs of empty pmirGLO and pmirGLO/3′-UTR were cotransfected into HEK293T cells with miR-17, -20a, or -106b microRNA -mimics to test for specific influence of the microRNA on the given 3′-UTR. [score:1]
Here we analyzed the impact of the microRNAs miR-17, -20a, and -106b on cell cycle arrest connected to neuronal lineage differentiation of USSC induced by retinoic acid containing neuronal induction medium XXL. [score:1]
0016138.g006 Figure 6Relationships between pro-proliferative and anti-proliferative proteins involved in G [1]/S transition and miR-17, miR-20a, and miR-106b. [score:1]
Twenty-four hours after XXL-induction (and 48 h after transfection), the overall portion of Ki67 -positive cells decreased dramatically in untransfected cells and negative-control -transfected cells but was elevated in cells transfected with the miR-17/-20a/-106b -mimic-batch. [score:1]
We further show that miR-17, -20a, and -106b act in a pro-proliferative manner in USSC and are in part capable to prevent XXL-USSC from cell cycle arrest. [score:1]
Although each miR-17, -20a, and -106b alone were sufficient to influence proliferation of USSC and to partly release XXL-USSC from cell-cycle arrest, the additional microRNAs might play a supporting role in keeping XXL-USSC from proliferation. [score:1]
Relationships between pro-proliferative and anti-proliferative proteins involved in G [1]/S transition and miR-17, miR-20a, and miR-106b. [score:1]
0016138.g003 Figure 3(A) USSC line SA5/03 was transfected with a negative control mimic or an equimolar batch of miR-17-, -20a-, and -106b -mimics and induced to neuronal lineage differentiation using XXL–medium 24 h after transfection. [score:1]
Since E2F1-3 participate in G [1]/S transition and the does not distinguish between different E2Fs, it remains unclear, whether miR-17, -20a, and -106b exhibit increasing effects on the activity of E2F1 only or on all E2Fs involved in G [1]/S transition. [score:1]
We thus analyzed the impact of miR-17, -20a, and -106b not on the sheer presence but on the activity of E2F transcription factors using a Firefly luciferase reporter driven by a minimal promoter element consisting of a TATA box and a repeat of six E2F-responsive elements. [score:1]
[1 to 20 of 90 sentences]
4
[+] score: 312
b Flow cytometry analysis of the expression of α [4]-integrin, α [5]-integrin, CD44 and CXCR4 on miR-17 overexpressing CB CD34 [+] cells (green and blue lines) and CTRL CD34 [+] cells (red line) Ectopic expression of miR-17 alters CB CD34 [+] cell adhesion to hematopoietic niche componentsThrough adhesion to the corresponding components from niche in vivo, the adhesive moleculars expressed by hematopoietic cells regulated the interaction between hematopoietic cells and their niche. [score:10]
The increased expression of major adhesion molecules in miR-17 overexpressed CB CD34 [+] cells suggests that the adhesion between miR-17 overexpressed CB CD34 [+] cells and their niche in vivo is regulated abnormally, which may further lead to the reduced hematopoietic reconstitution capability of 17/OE cells in engrafted mice. [score:8]
b Flow cytometry analysis of the expression of α [4]-integrin, α [5]-integrin, CD44 and CXCR4 on miR-17 overexpressing CB CD34 [+] cells (green and blue lines) and CTRL CD34 [+] cells (red line) Through adhesion to the corresponding components from niche in vivo, the adhesive moleculars expressed by hematopoietic cells regulated the interaction between hematopoietic cells and their niche. [score:8]
Conversely, downregulation of miR-17 inhibited the expansion of CB CD34 [+] cells. [score:6]
The improper expression of N-cadherin and β [1]-integrin on CD34 [+] cells upon miR-17 overexpression raised the possibility that the adhesion between 17/OE cells and their niche in vivo is regulated abnormally, which further leads to the reduced hematopoietic reconstitution capability of 17/OE cells in vivo. [score:6]
By overexpression and knockdown studies, we showed that ectopic expression of miR-17 promotes long-term expansion and colony forming of CB CD34 [+] cells and CD34 [+]CD38 [−] cells in vitro. [score:6]
By overexpression and knockdown studies, we demonstrated that miR-17 regulates the growth of CB CD34 [+] cells and CD34 [+]CD38 [−] cells in vitro. [score:5]
The expression levels of miR-17 in CD34 [+]CD38 [−] cells are higher than those in CD34 [+]CD38 [+] cellsTo determine the expression level of miR-17 in human hematopoietic cells, we first obtained two populations from human CB MNCs through the analyses of human lineage-specific CD markers. [score:5]
In contrast to the more committed CB CD34 [+]CD38 [+] cells, CB CD34 [+]CD38 [−] populations express significantly higher levels of miR-17, suggesting that miR-17 may be a key regulator during the development of HSCs. [score:5]
miR-17 is abundantly expressed in murine hematopoietic progenitors and increased expression of AAAGUGC-seed containing miRNA in lineage negative bone marrow cells promotes replating capacity and expansion of myeloid progenitors [21]. [score:5]
The levels of miR-17 expression in GFP -positive cells from engrafted mice at 20 weeks were still up- or downmodulated (Fig.   3c), which indicated that this inconsistency between the in vivo and in vitro data was not due to the change of miR-17 expression in vivo. [score:5]
To confirm whether this inconsistency resulted from the change of miR-17 expression in vivo, we checked the levels of miR-17 expression in GFP -positive cells from engrafted mice at 20 weeks. [score:5]
We further found that the expression of selected major adhesion molecules on CB CD34 [+] cells was increased and the specific adhesion of these cells to N-cadherin and vascular cell adhesion molecule-1 (VCAM1) were also enhanced upon miR-17 overexpression in vitro. [score:5]
Fig. 4The adhesion molecule expression on CB CD34 [+] cells after miR-17 overexpression. [score:5]
Collectively, miR-17 levels are downregulated during the differentiation of human hematopoietic cells, which suggests that miR-17 may play a role in regulating HSC function. [score:5]
, ectopic expression of miR-17 in peripheral blood cells may inhibit both myeloid and erythroid colony growth [22]. [score:5]
The expression levels of miR-17 were up- or downregulated in 17/OE and 17/KD, respectively (Fig.   1b) compared to those in CTRL. [score:5]
All of these results indicated that interaction of miR-17 overexpressed CB CD34 [+] cells with their niche may be abnormal in vivo and further prevent the efficient and continuous production of blood cells, which may be, at least in part, responsible for the reduced hematopoietic reconstitution potential of miR-17 overexpressed CB CD34 [+] cells in vivo. [score:5]
a The expression of N-cadherin and β [1]-integrin on CB CD34 [+] cells after miR-17 overexpressing (17/OE) or control (CTRL) cells was analyzed by flow cytometry (left panels). [score:5]
To analyze the function of miR-17 on primitive human hematopoietic cells, the miR-17 overexpression (17/OE) and knockdown (17/KD or 17/KD1) mo dels were created using primary CB CD34 [+] cells. [score:4]
After knockdown of miR-17, there was a trend towards a decrease in the expression of β [1]-integrin and N-cadherin (Additional file 2: Figure S2), although statistical analyses of the cohort indicated that it did not meet statistical significance (p > 0.05). [score:4]
It seemed that the significantly reduced hematopoietic reconstitution potential of miR-17 overexpressed CB CD34 [+] cells in vivo is not a result of the defect of transplanted 17/OE cell migration between bones because the migration of miR-17 overexpressed CB CD34 [+] cells in vitro towards SDF1α was only slightly increased compared to that of CTRL cells. [score:4]
Our data imply that the adhesion between miR-17 -overexpressed CB CD34 [+] cells and their niche in vivo is regulated abnormally, which may further lead to the reduced hematopoietic reconstitution capability of 17/OE cells in engrafted mice. [score:4]
This study establishes that miR-17 is differentially expressed in human CB hematopoietic cells (Fig.   1a), which indicates that miR-17 may play distinct roles in hematopoietic cells at different developmental stages, although more CD markers are needed to further identify the subpopulations from CB CD34 [+] cells. [score:4]
Our data showed that miR-17 is significantly expressed in human CB CD34 [+]CD38 [−] cells compared to the levels expressed in the CD34 [+]CD38 [+] cells or mononuclear cells (MNCs). [score:4]
b Real-time PCR was performed to evaluate the expression level of miR-17 in CB CD34 [+] cells after transfection with vectors for miR-17 overexpression (17/OE), miR-17 knockdown (17/KD or 17/KD1), or control (CTRL). [score:4]
CB CD34 [+] cells were transfected with vectors for miR-17 overexpression (17/OE), miR-17 knockdown (17/KD), or control (CTRL) and cultured in cytokine -driven serum-free medium. [score:4]
As shown in Fig.   3c, the expression levels of miR-17 were still up- or downmodulated in GFP -positive cells from NPG recipients transplanted with CB 17/OE CD34 [+] cells or 17/KD CD34 [+] cells, respectively, although the expression levels of miR-17 became somewhat lower compared to that of corresponding initial cells. [score:4]
The adhesion potential of 17/OE CB CD34 [+] cells to VCAM1 was significantly reduced following β [1]-integrin knockdown, which suggested that β [1]-integrin expressed on 17/OE CD34 [+] cells mediated, at least in part, the increase in interaction between 17/OE CD34 [+] cells and VCAM1 caused by ectopic miR-17. [score:4]
The adhesion potential of 17/OE CD34 [+] cells to VCAM1 was significantly blocked upon β [1]-integrin knockdown (Fig.   5b), which suggested that β [1]-integrin expressed on 17/OE CD34 [+] cells mediated, at least in part, the increase in interaction between 17/OE CD34 [+] cells and VCAM1 caused by ectopic miR-17. [score:4]
The miR-17 overexpression and knockdown mo dels were created using primary CB CD34 [+] cells transfected by the indicated vectors. [score:4]
The expression of N-cadherin and β [1]-integrin on CB CD34 [+] cells after miR-17 knockdown (17/KD) or control cells (CTRL) was analyzed by flow cytometry (left panels). [score:4]
4.0 × 10 [4] miR-17 overexpression (17/OE), miR-17 knockdown (17/KD), or control (CTRL) CB CD34 [+] cells were injected intravenously into the sublethally irradiated NPG mice (n = 6 per group). [score:4]
We conclude that the proper expression of miR-17 is required, at least partly, for normal hematopoietic stem cell–niche interaction and for the regulation of adult hematopoiesis. [score:4]
c The levels of miR-17 expression in GFP -positive cells from engrafted mice at 20 weeks were tested by real-time PCR. [score:3]
The mechanisms underlying the enhanced expression of adhesive molecules in CB CD34 [+] cells upon ectopic miR-17 are largely unclear and will be explored further in our laboratory. [score:3]
Ectopic expression of miR-17 alters CB CD34 [+] cell adhesion to hematopoietic niche components. [score:3]
Fig. 1The expression of miR-17 in CB hematopoietic CD34 [+]CD38 [−]/CD38 [+] cells. [score:3]
The more precise subpopulations of human hematopoietic progenitors were established recently [29– 31] so further studies are still needed to get a more detailed expression profile of miR-17 in human CB HSCs based on the more precise hierarchy mo del. [score:3]
The CD34 [+]CD38 [−] populations expressed significantly higher levels of miR-17 in comparison to those of the CD34 [+]CD38 [+] populations or MNCs (Fig.   1a). [score:3]
Meenhuis A van Veelen PA de Looper H van Boxtel N van den Berge IJ Sun SM MiR-17/20/93/106 promotes hematopoietic cell expansion by targeting sequestosome1-regulated pathways in miceBlood. [score:3]
To examine whether the reduced hematopoietic reconstitution capability of CB CD34 [+] cells upon miR-17 modulation in vivo is a result of improper attachment or migration in engrafted mice, we examined the expression patterns of selected adhesion and homing molecules known to be important for the hematopoietic reconstitution of human HSCs in the engrafted mice. [score:3]
The expression pattern of miR-17 in human hematopoietic cells is consistent with that in 32D-CSF3R cells [21]. [score:3]
In support of this finding in vitro, a significant increase was observed in the adhesion of CB CD34 [+] cells to N-cadherin and VCAM1 following miR-17 overexpression (Fig.   5a). [score:3]
Although miR-17 contains a highly conserved seed sequence between species and is expressed in hematopoietic cells at different stages from both mouse and human origin, there still exist different opinions concerning the function of miR-17 on hematopoiesis [16, 21– 23]. [score:3]
Ectopic expression of miR-17 resulted in the promoted expansion of the phenotypic and functional CD34 [+]CD38 [−] compartment in vitro. [score:3]
Moreover, Li et al. showed that the miR-92a -induced erythroleukemia cell line, when overexpressing miR-17, displayed a significantly reduced proliferation rate, exhibited morphological features of apoptosis, and ultimately died 2 weeks post-transduction [16]. [score:3]
The expression levels of CD44 and CXCR4 were almost unchanged upon ectopic miR-17 (Fig.   4b). [score:3]
The number of CFU-Mix and BFU-E did not change significantly after miR-17 overexpression. [score:3]
The human pre-miR-17 gene was amplified by polymerase chain reaction (PCR) and subcloned into the vector pCMV-GFP to generate the expression constructs pCMV-GFP -pre-miR-17 (17/OE). [score:3]
miR-17 has been recognized either as an onco-miRNA or as a tumor suppressor depending on the cell type. [score:3]
Lane 1, one mouse without transplants; lane 2, one mouse receiving transplants of 17/OE CD34 [+] cells; lane 3, one mouse receiving transplants of 17/KD CD34 [+] cells; lane 4, one mouse receiving transplants of CTRL CD34 [+] cells; lane 5, one mouse receiving transplants of fresh CD34 [+] cells The expression of adhesion molecules on CB CD34 [+] cells upon miR-17 modulationEctopic miR-17 promotes the expansion of CB CD34 [+] cells in vitro but the hematopoietic reconstitution capability of 17/OE cells is reduced in vivo, which displays inconsistency. [score:3]
b CB CD34 [+] cells, transfected with ectopic miR-17 vector (17/OE or 17/KD), were further separated through the analysis of CD38 expression. [score:3]
The expression levels of miR-17 in CD34 [+]CD38 [−] cells are higher than those in CD34 [+]CD38 [+] cells. [score:3]
The expression of adhesion molecules on CB CD34 [+] cells upon miR-17 modulation. [score:3]
Based on shRNA influence on miR-17 expression in CB CD34 [+] cells, 17/KD was chosen for further studies. [score:3]
However, statistical analyses of this cohort indicated that it did not meet statistical significance (Fig.   5d), suggesting that the reduced hematopoietic reconstitution capability of miR-17 overexpressed CB CD34 [+] cells in vivo does not result from the migration defect of transplanted 17/OE cells. [score:3]
Fig. 5Effects of miR-17 overexpression on adhesion and migration of CB CD34 [+] cells. [score:3]
In vitro assays revealed that ectopic expression of miR-17 promoted long-term expansion, especially in the colony-forming of CB CD34 [+] cells and CD34 [+]CD38 [−] cells. [score:2]
Knockdown of miR-17 in CD34 [+] cells, on the other hand, resulted in reduced hematopoietic multipotential, which was followed by significantly diminishing CFC and CFU-GM output (Fig.   2c). [score:2]
d The migration of 17/OE CB CD34 [+] cells towards SDF1α was slightly increased compared with that of CTRL cells, but statistical analyses indicated it did not meet statistical significance (p > 0.3, Student’s t-test) To determine the expression level of miR-17 in human hematopoietic cells, we first obtained two populations from human CB MNCs through the analyses of human lineage-specific CD markers. [score:2]
After knockdown of miR-17, there was a trend toward a decrease in the total number of CD34 [+] cells, although statistical analyses of the cohort indicated that it did not meet statistical significance (p > 0.05). [score:2]
However, it is to be noted that the hematopoietic reconstitution potential of miR-17 -overexpressed CB CD34 [+] cells in vivo were significantly reduced in contrast with that of control CB CD34 [+] cells in repopulating assays with NPG mice. [score:2]
The percentage of CD45 [+]CD34 [+] cells in the 17/KD group whose transplants of CD34 [+] cells with miR-17 knockdown showed a tendency, although insignificant, to be lower than that of mice receiving transplants of CTRL CD34 [+] cells. [score:2]
However, the overexpression of miR-17 in vivo reduced the hematopoietic reconstitution potential of CB CD34 [+] cells compared to that of control cells. [score:2]
Compared with that from CD34 [+] cells after culturing for 7 days, there was a significant increase in the number of CFU-Mix from CD34 [+]CD38 [−] cells upon miR-17 overexpression (Fig.   2c). [score:2]
Although these studies all indicate that miR-17 is an important regulator of hematopoiesis, the function of miR-17 on hematopoiesis remains controversial. [score:2]
The function of miR-17 on human CB CD34 [+] cells is reinforced by knockdown studies on miR-17. [score:2]
After knockdown of miR-17, there was a trend toward a decrease in the colony forming capacity of CD34 [+]CD38 [−]/CD38 [+] cells, although statistical analyses of the cohort indicated that it did not meet statistical significance (p > 0.05) outside of the CFU-GM forming capacity from CD34 [+]CD38 [−] cells. [score:2]
It seems that miR-17 has almost no effect on the erythroid lineage development based on the lack of a significant difference between the number of BFU-E from 17/OE cells and that from the CTRL cells. [score:2]
It is of note that the migration of miR-17 overexpressed CB CD34 [+] cells towards SDF1α was slightly decreased compared to that of control cells. [score:2]
However, when the input cell numbers were similar, the 17/OE CD34 [+] cells contributed significantly less to hematopoietic reconstitution in recipient mice as opposed to the CTRL CD34 [+] cells, which was different from the in vitro expansion and colony forming assay, suggesting that the hematopoietic reconstitution capability of miR-17 -overexpressed CB CD34 [+] cells were reduced in vivo. [score:2]
After knockdown of miR-17, there was a trend toward a decrease in the expansion capacity of CD34 [+]CD38 [−]/CD38 [+] cells, although statistical analyses of the cohort indicated that it did not meet statistical significance (p > 0.05) outside of the first 5 days from CD34 [+]CD38 [−] cells. [score:2]
Knockdown of miR-17, on the other hand, resulted in decreased CB CD34 [+] cell expansion, which consequently diminished the cell number. [score:2]
a The adhesion of miR-17 overexpressing (17/OE) CB CD34 [+] cells to N-cadherin or vascular cell adhesion molecule-1 (VCAM1) was significantly increased compared with that of control (CRTL) cells. [score:2]
Taken together, these data indicate that the ectopic miR-17 in CD34 [+] cells preferentially supports a specific expansion of the CD34 [+]CD38 [−] populations in vitro. [score:1]
Effects of miR-17 modulation on the hematopoietic reconstitution capability of CB CD34 [+] cells in NPG miceTo further support our in vitro expansion results, we examined the hematopoietic reconstitution potential of CB CD34 [+] cells after miR-17 modulation in NPG mice. [score:1]
It is of great interest to note that the hematopoietic reconstitution potential of miR-17 overexpressed CB CD34 [+] cells in vivo is reduced compared to that of CTRL CB CD34 [+] cells according to SCID repopulating cells assays (Fig.   3). [score:1]
Moreover, the expanded CB CD34 [+] cells by ectopic miR-17 are capable of normal maturation ex vivo because they could differentiate into all of the lineages tested. [score:1]
miR-17 promotes expansion and colony forming of CB CD34 [+] cells. [score:1]
The miR-17 levels of the CD34 [+]CD38 [+] populations showed a tendency, albeit insignificant, to be higher than those of the MNCs. [score:1]
Although the percentage of human CD45 [+] cells gradually increased in the PB from all of the mice transplanted with miR-17-modulated CB CD34 [+] cells, the PB from 17/KD recipients displayed a significantly higher percentage of human CD45 [+] cells at 4 weeks than CTRL recipients, indicating that the hematopoietic reconstitution potential of 17/KD CD34 [+] cells is higher than that of CTRL CD34 [+] cells during the first 4 weeks (Fig.   3a left panel). [score:1]
The two miR-17-specific small hairpin RNAs (17/KD and 17/KD1) [24] and β1-integrin-specific shRNA (β1/KD) oligomers [26] were tested. [score:1]
The expanded hematopoietic cells upon ectopic miR-17 can promote myeloid lineage fate (Fig.   2c), which is consistent with the results from Meenhuis group [19], demonstrating the conservative function of miR-17 between mouse and human HSC to a certain extent. [score:1]
Effects of miR-17 modulation on the hematopoietic reconstitution capability of CB CD34 [+] cells in NPG mice. [score:1]
We temporally monitored the PB of NPG recipients transplanted with miR-17-modulated CB CD34 [+] cells for 20 weeks by analyzing the percentage of human CD45 [+] cells using flow cytometry every 4 weeks. [score:1]
a The expression level of miR-17 in CB CD34 [+]CD38 [−]/CD38 [+] cells was evaluated by real-time PCR. [score:1]
c The expression level of miR-17 in 17/OE CD34 [+] cells or 17/KD CD34 [+] cells 5 days after sorting was evaluated by real-time PCR. [score:1]
Moreover, most of the data about miR-17 to date were obtained from murine studies while the relevance to human HSC still needs to be substantiated. [score:1]
a Effect of miR-17 modulation on repopulation of CB CD34 [+] cells in NOD prkdc [scid] Il2rg [null] (NPG™) mice. [score:1]
Here, we reported that miR-17 is also necessary in the cell-intrinsic control of governing the biological properties of human cord blood (CB) CD34 [+] cells in vitro and in vivo. [score:1]
We further examined the multipotent differentiation of CD34 [+]CD38 [−]/CD38 [+] cells upon miR-17 modulation after cultured for 14 days in vitro. [score:1]
Recently, we have found that miR-17 is necessary in the cell-extrinsic control of HSC and HPC function, which is, at least in part, through the augmented HIF-1α signal pathways in osteoblasts [24]. [score:1]
miR-17 (also called miR-17-5p), an important member of the miR-17-92 cluster, contains the AAAGUGC-seed sequence [20]. [score:1]
After incubation with the coated ligands, CB CD34 [+] cells showed a significant increase in the adhesion to N-cadherin or VCAM1 upon ectopic miR-17 according to the CFC output (Fig.   5a). [score:1]
We have recently found that miR-17 is necessary in the cell-extrinsic control of cord blood (CB) CD34 [+] cell function. [score:1]
Here, we demonstrated that the proper level of miR-17 is also necessary in the cell-intrinsic control of the hematopoietic properties of CB CD34 [+] cells. [score:1]
Fig. 3Effect of miR-17 modulation on the hematopoietic reconstitution potential of CB CD34 [+] cells in NPG mice. [score:1]
The data are presented as the ratio of miR-17 levels (relative to U6) in 17/OE, 17/KD or 17/KD1 to that in CTRL. [score:1]
This idea is evidenced by the fact that ectopic miR-17 promotes the proliferation of CB CD34 [+]CD38 [−] cells, especially within the first 15 days of culture when the cells are the least differentiated (Fig.   2b). [score:1]
Lane 1, one mouse without transplants; lane 2, one mouse receiving transplants of 17/OE CD34 [+] cells; lane 3, one mouse receiving transplants of 17/KD CD34 [+] cells; lane 4, one mouse receiving transplants of CTRL CD34 [+] cells; lane 5, one mouse receiving transplants of fresh CD34 [+] cells Ectopic miR-17 promotes the expansion of CB CD34 [+] cells in vitro but the hematopoietic reconstitution capability of 17/OE cells is reduced in vivo, which displays inconsistency. [score:1]
Fig. 2The effect of miR-17 modulation on the expansion of CB CD34 [+]CD38 [−]/CD38 [+] cells. [score:1]
Our studies demonstrated that miR-17 may specifically affect hematopoietic stem and early progenitor cells. [score:1]
Together, our data suggest that miR-17 in CD34 [+] cells preferentially promotes a specific expansion of the CB CD34 [+]CD38 [−] populations in vitro and the expanded CD34 [+]CD38 [−] cells could differentiate into all of the lineages tested. [score:1]
a The expansion of CB CD34 [+] cells upon miR-17 modulation after culturing for 20 days. [score:1]
In summary, our data suggest the potential contribution of miR-17 in the in vitro and in vivo function on human HSCs and HPCs. [score:1]
b Flow cytometry analysis of the human CB CD34 [+] cell repopulation in a representative NPG mouse after miR-17 modulation. [score:1]
As shown in Fig.   2a, CD34 [+] cells were expanded significantly upon ectopic miR-17. [score:1]
These data add adhesive molecules to the signaling network affected by miR-17 and suggest a miR-17–N-cadherin (β [1]-integrin) pathway in human CB HSCs and HPCs. [score:1]
Therefore, further investigations of miR-17 on hematopoiesis in vivo raises the possibility that miR-17 may play a wider role in regulating hematopoietic development. [score:1]
To further support our in vitro expansion results, we examined the hematopoietic reconstitution potential of CB CD34 [+] cells after miR-17 modulation in NPG mice. [score:1]
As shown in Fig.   2b, although both CD34 [+]CD38 [−] and CD34 [+]CD38 [+] cells were expanded to different extents upon miR-17 modulation, the ectopic miR-17 tends to expand CD34 [+]CD38 [−] cells more, rather than CD34 [+]CD38 [+] cells, especially during the first 15 days. [score:1]
[1 to 20 of 112 sentences]
5
[+] score: 292
Other miRNAs from this paper: hsa-mir-21, hsa-mir-199a-1, hsa-mir-199a-2
Thus, while the anti-miR-17-5p could silence miR-17-5p and theoretically alleviate the translational inhibition of PDCD4 mRNA, as a miR-17-3p mimic it apparently repressed the translation of PDCD4 mRNA by binding to multiple 3’UTR target sites for miR-17-3p (Fig 13 and Fig 14). [score:9]
Surprisingly, the PDCD4 protein level was down-regulated by 1.8±0.3 fold, instead of being up-regulated as expected following miR-17-5p knockdown (Fig 3C). [score:8]
PDCD4 mRNA is a potential target for miR-17-5pUsing rna22, TargetScan and miRanda, we searched for oncomiR targets in PDCD4 and PTEN mRNAs. [score:7]
Both miR-17-5p and miR-17-3p directly affect the translation of PDCD4 and PTEN mRNAsTo test the hypothesis that the translation of PDCD4 and PTEN mRNAs are directly inhibited by miR-17-5p and miR-17-3p, we transfected MDA-MB-231 cells with either miR-17-5p mimic or miR-17-3p mimic, and measured the protein levels of PDCD4 and PTEN 48 hr post-transfection. [score:7]
Using MDA-MB-231 cells as a mesenchymal TNBC cell mo del, we hypothesized that knocking down miR-17-5p might restore the expression levels of PDCD4 and PTEN tumor suppressor proteins, illustrating a route to oligonucleotide therapy of TNBC. [score:6]
For example, in hepatocellular carcinoma, miR-17-5p reduced the translation of PTEN mRNA, while miR-17-3p directly targeted vimentin mRNA [45]. [score:6]
This result conflicted with the expectation that miR-17-5p target expression would increase when miR-17-5p was knocked down. [score:6]
Caloric restriction (CR) and ionizing radiation (IR) down-regulate members of the miR-17~92 cluster in TNBC mo dels, decreasing their metastatic activities by suppressing extracellular matrix (ECM) mRNAs that exhibit miR-17-5p binding sites [13]. [score:6]
However, anti-miR-17-5p resulted in down-regulation of both PDCD4 and PTEN mRNA translation, rather than stimulation. [score:6]
Thus, considering seed pairing as one of the important factors in miRNA:target recognition, all of the miR-17-3p target sites in the 3’UTRs of PDCD4 and PTEN could be putative binding sites for anti-miR-17-5p. [score:5]
Among the seven members of the miR-17~92 cluster, the guide strand miR-17-5p is predominantly responsible for promoting migration and invasion of metastatic cancer cells, targeting the mRNAs of tumor suppressor genes, such as PDCD4 (programmed cell death 4) and PTEN (phosphatase and tensin homolog) [14]. [score:5]
Anti-miR-17-5p DNA-LNA inhibitors act as miR-17-3p mimics, and reduced the translation of PDCD4 and PTEN mRNAs. [score:5]
In contrast, anti-miR-17-3p knocked down endogenous miR-17-3p, but maintained PDCD4 and PTEN protein expression (Fig 3C). [score:4]
miR-17-3p is a potential regulator of PDCD4 protein level and competes with miR-17-5p for inhibition of PDCD4 and PTEN mRNAs. [score:4]
0142574.g013 Fig 13Anti-miR-17-5p DNA-LNA can directly modulate the translation of PDCD4 and PTEN mRNAs through interactions with multiple binding sites from the 3’UTR. [score:4]
To elucidate the effect of miR-17-5p on PDCD4 or PTEN, endogenous miR-17-5p was knocked down using a commercially available DNA-LNA inhibitor. [score:4]
0142574.g003 Fig 3miR-17-3p is a potential regulator of PDCD4 protein level and competes with miR-17-5p for inhibition of PDCD4 and PTEN mRNAs. [score:4]
These results implied that mature miR-17-5p is a gene regulator of PDCD4 and PTEN mRNA translation. [score:4]
In our study, we discovered that in MDA-MB-231 TNBC cells, anti-miR-17-5p DNA-LNA chimera knocked down endogenous miR-17-5p, but surprisingly decreased the protein levels coded by their potential targets PDCD4 and PTEN mRNAs, rather than elevating them. [score:4]
To determine whether the complementary DNA-LNA chimeras were working as predicted, we examined another direct target of miR-17-5p, PTEN mRNA [14]. [score:4]
To test the hypothesis that the translation of PDCD4 and PTEN mRNAs are directly inhibited by miR-17-5p and miR-17-3p, we transfected MDA-MB-231 cells with either miR-17-5p mimic or miR-17-3p mimic, and measured the protein levels of PDCD4 and PTEN 48 hr post-transfection. [score:4]
0142574.g012 Fig 12Both miR-17-5p and miR-17-3p can directly modulate the translation of PDCD4 and PTEN. [score:4]
To determine if the passenger strand was involved in the contradictory results above, we knocked down endogenous miR-17-3p with anti-miR-17-3p and analyzed PDCD4 and PTEN protein expression levels. [score:4]
Both miR-17-5p and miR-17-3p can directly modulate the translation of PDCD4 and PTEN. [score:4]
Both miR-17-5p and miR-17-3p directly affect the translation of PDCD4 and PTEN mRNAs. [score:4]
Exogenous miR-17-3p mimic lowered luciferase activities from vector constructs harboring each of the four predicted binding sites, as well as the construct containing the whole 3’UTR of PDCD4 mRNA (Fig 12D), indicating that both miR-17-5p guide strand and miR-17-3p passenger strand could directly target PDCD4 mRNA. [score:4]
Anti-miR-17-5p DNA-LNA can directly modulate the translation of PDCD4 and PTEN mRNAs through interactions with multiple binding sites from the 3’UTR. [score:4]
miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1. [score:3]
Both miR-17-5p and miR-17-3p directly interact with the 3’UTR of PDCD4 and PTEN mRNAsTo study the mechanism of post-transcriptional regulation of PDCD4 and PTEN mRNAs by miR-17-5p and miR-17-3p, we cloned individual binding sites for miR-17-5p or miR-17-3p (Fig 1, Fig 3 and Fig 4) in the 3’UTR of PDCD4 or PTEN mRNAs into luciferase reporter vectors right after the luciferase gene. [score:3]
We tested our theory by folding anti-miR-17-5p onto miR-17-3p target sites in the PDCD4 and PTEN 3’UTRs. [score:3]
In contrast to miR-17-5p knockdown (Fig 3C), miR-17-3p knockdown showed no significant changes in PDCD4 or PTEN protein levels (Fig 3D). [score:3]
miR-17-5p knockdown decreased PTEN mRNA level, while miR-17-3p knockdown increased the steady state level of PTEN mRNA. [score:3]
Although the endogenous passenger strand miR-17-3p had only modest effects in modulating PDCD4 and PTEN post-transcriptionally (Fig 3D and Fig 12A), the passenger strand mimicking anti-miR-17-5p could target PDCD4 mRNA more effectively than the miR-17-5p guide strand. [score:3]
Schematic view of competition between anti-miR-17-5p and miR-17-5p for inhibition of PDCD4 mRNA. [score:3]
At 12 hr and 48 hr, neither miR-17-5p knockdown nor miR-17-3p knockdown correlated with any significant change in PDCD4 mRNA compared to control (Fig 11A and 11B), while miR-21-5p knockdown significantly increased PDCD4 mRNA by 33±9.6% at 12 hr and 17±3.3% at 48 hr (Fig 11A). [score:3]
D: Relative expression of PTEN mRNA from 12 hr to 48 hr after transfection with anti-miR-17-5p and anti-miR-17-3p. [score:3]
0142574.g014 Fig 14Schematic view of competition between anti-miR-17-5p and miR-17-5p for inhibition of PDCD4 mRNA. [score:3]
C: Relative expression of PDCD4 mRNA from 12 hr to 48 hr after transfection with anti-miR-17-5p and anti-miR-17-3p. [score:3]
Anti-miR-17-5p DNA-LNA inhibitors act as miR-17-3p mimics, and reduced the translation of PDCD4 and PTEN mRNAsTo investigate whether anti-miR-17-5p DNA-LNA could mimic miR-17-3p by binding to the predicted sites for miR-17-3p in the 3’UTR of PDCD4 and PTEN, we carried out the luciferase experiments by co-transfecting MDA-MB-231 cells with luciferase constructs and anti-miR-17-5p as described above. [score:3]
miR-17-5p knockdown decreased PTEN mRNA level, while miR-17-3p knockdown increased the steady state level of PTEN mRNAA similar phenomenon was observed with PTEN mRNA. [score:3]
Therefore, we speculated that anti-miR-17-5p DNA-LNA chimera could act as a miR-17-3p mimic, binding to miR-17-3p target sites in the 3’UTR of PDCD4 and PTEN mRNAs. [score:3]
miR-17-3p passenger strand is a potential inhibitor of PDCD4 and PTEN mRNAs, as well as miR-17-5pTo understand the unexpected results in Fig 3B, we examined miR-17 in miRBase. [score:3]
To test this hypothesis, rna22, TargetScan and miRanda were used to identify potential binding sites for miR-17-3p in the 3’UTR of PDCD4 and PTEN. [score:3]
miR-17-3p passenger strand is a potential inhibitor of PDCD4 and PTEN mRNAs, as well as miR-17-5p. [score:3]
Similarly, anti-miR-17-3p could mimic miR-17-5p and bind to all of the miR-17-5p target sites on the 3’UTR of PDCD4 and PTEN mRNAs (Fig 3A, Fig 8). [score:3]
This effect was not apparent in an earlier study in lymphocytes that utilized a luciferase vector containing only a fragment of the PTEN 3’UTR bearing the single miR-17-5p target [14]. [score:3]
Since PDCD4 has not been reported to be a target for miR-17-5p or miR-17-3p, we also cloned the whole 3’UTR of PDCD4 mRNA into the luciferase reporter vector. [score:3]
rna22, TargetScan, and miRanda predicted that miR-21-5p has two binding sites in the 3’UTR of PDCD4, while its passenger strand miR-21-3p has no putative binding sites, unlike miR-17-3p (Fig 10). [score:3]
PDCD4 mRNA is a potential target for miR-17-5p. [score:3]
Compared to vector control, miR-17-5p mimic lowered the luciferase activity of both predicted PDCD4 binding sites and the entire PDCD4 3’UTR (Fig 12B), suggesting that miR-17-5p can directly target PDCD4 mRNA. [score:3]
Inhibition of the miR-17-3p passenger strand maintained PDCD4 and PTEN protein levels. [score:3]
Both miRanda and TargetScan predicted one binding site for miR-17-5p in the 3’UTR of PTEN mRNA (Fig 1). [score:3]
The oncomiR miR-17-5p is significantly up-regulated in mesenchymal MDA-MB-231 TNBC cells compared to the noninvasive luminal MCF7 cells, and contributes to the invasiveness and migratory behavior of TNBC [20]. [score:3]
This could be explained by the low endogenous expression level of miR-17-3p passenger strand compared to miR-17-5p guide strand (S2A Fig). [score:2]
The miR-17~92 cluster is one of the most studied of the oncomiR groups that play important roles in cancer development. [score:2]
To study the mechanism of post-transcriptional regulation of PDCD4 and PTEN mRNAs by miR-17-5p and miR-17-3p, we cloned individual binding sites for miR-17-5p or miR-17-3p (Fig 1, Fig 3 and Fig 4) in the 3’UTR of PDCD4 or PTEN mRNAs into luciferase reporter vectors right after the luciferase gene. [score:2]
miR-17-3p knockdown increased the steady state level of PDCD4 mRNA. [score:2]
As a result, miR-17-5p and miR-17-3p cooperatively contribute to the development of hepatocellular carcinoma. [score:2]
rna22 identified miR-17-5p as a potential gene regulator through its interaction with one binding site in the 3’UTR of PDCD4 mRNA (Fig 1). [score:2]
In this study, only two genes were found to be regulated by miR-17 passenger strand. [score:2]
Both miR-17-5p and miR-17-3p directly interact with the 3’UTR of PDCD4 and PTEN mRNAs. [score:2]
Thus, knocking down the low level of miR-17-3p passenger strand might not have a noticeable effect. [score:2]
Surprisingly, we found that knocking down miR-17-5p decreased PTEN protein level by 1.8±0.3 fold (Fig 3C). [score:2]
Anti-miR-17-5p DNA-LNA chimera transfected into MDA-MB-231 TNBC cells knocked down miR-17-5p by 99±0.01% after 12 hr (Fig 2A). [score:2]
Antisense DNA-LNA chimeras were acquired from Exiqon to knock down miR17-5p (5’-dACCTGCACTGTAAGCACTTTG-3’), miR17-3p (5’-dTACAAGTGCCTTCACTGCAG-3’), and miR-21-5p (5’-dCAACATCAGTCTGATAAGCT-3’). [score:2]
Although rna22 is the only algorithm that predicted a binding site for miR-17-5p in the 3’UTR of PDCD4 mRNA, the predicted 23 bp oncomiR:mRNA duplex is stable, containing 17 complementary basepairs and an Mfold predicted folding energy ΔG° of -24.5 kcal/mol at 37°C (Fig 1). [score:1]
0142574.g009 Fig 9Minimum energy structure predicted with Amber 12 for miR-17-3p: PTEN mRNA duplex in explicit H [2]O with 100 mM NaCl, pH 7.0, at 300°K. [score:1]
A: PDCD4 and PTEN protein Western blots at 48 hr post transfection with miR-17-5p mimic or miR-17-3p mimic. [score:1]
B: Homologous sequences between miR-17-5p and miR-17-3p are highlighted in yellow. [score:1]
MDA-MB-231 cells were co -transfected with each luciferase construct, miR-17-5p or miR-17-3p mimic, and a pRL-TK Renilla luciferase vector served as a transfection efficiency control. [score:1]
Minimum energy structure predicted with Amber 12 for miR-17-3p: PTEN mRNA duplex in explicit H [2]O with 100 mM NaCl, pH 7.0, at 300°K. [score:1]
We ascribe this result to limited binding sites for the miR-17-5p guide strand relative to the miR-17-3p passenger strand. [score:1]
S2 FigResults represent absolute values of miRNA/internal control U6 normalized to miR-17-3p/U6 (A) or mock transfected (B—C). [score:1]
Predicted miR-17-5p guide strand binding sites in the 3'UTR of PDCD4 and PTEN mRNAs. [score:1]
0142574.g001 Fig 1Predicted miR-17-5p guide strand binding sites in the 3'UTR of PDCD4 and PTEN mRNAs. [score:1]
Luciferase constructs containing all predicted binding sites for miR-17-5p or miR-17-3p from the 3’UTRs of PDCD4 or PTEN mRNAs were constructed using a pMir-Report luciferase reporter vector (AM5795, Ambion). [score:1]
Either miR-17-5p mimic or miR-17-3p mimic (Life Technologies) were transfected into MDA-MB-231 cells with 5 μg Lipofectamine 2000 (Invitrogen) at a final oligonucleotide concentration of 50 nM for 6 hours at 37°C in Opti-MEM (Invitrogen) under 5% CO [2], according to the manufacturer’s protocol. [score:1]
The maintained protein levels of PDCD4 and PTEN could be a comprehensive outcome of both miR-17-5p and miR-17-3p binding to the PDCD4 and PTEN 3’UTRs. [score:1]
Anti-miR-17-5p also lowered luciferase activities of constructs harboring four out of six PTEN 3’UTR binding sites predicted for miR-17-3p (Fig 13B). [score:1]
Predicted miR-17-3p passenger strand binding sites in the 3'UTR of PTEN mRNA. [score:1]
The same investigators reported that both the guide strand and the passenger strand of miR-17 targeted sites in TIMP3 mRNA in prostate cancer cells, thus promoting proliferation and invasion [46]. [score:1]
Predicted anti-miR-17-5p binding sites in the 3'UTR of PDCD4 mRNA as a mimic of miR-17-3p passenger strand. [score:1]
However, PDCD4 mRNA showed a 25±1.7% increase in its steady state with anti-miR-17-3p relative to anti-miR-17-5p treatment from 12 hr to 48 hr (Fig 11C). [score:1]
Animated mpg file showing 25 nsec of simulation with Amber 12 at 300K in explicit H [2]O with 100 mM NaCl, pH 7.0, predicted for miR-17-3p: PTEN mRNA duplex in 100 mM NaCl, pH 7.0, at 300°K. [score:1]
Predicted anti-miR-17-3p binding sites in the 3'UTR of PDCD4 and PTEN mRNAs as a mimic of miR-17-5p passenger strand. [score:1]
Predicted miR-17-3p passenger strand binding sites in the 3'UTR of PDCD4 mRNA. [score:1]
Through mRNA sequence analysis, we found four putative binding sites for miR-17-3p relative to one for miR-17-5p in the 3’UTR of PDCD4 mRNA. [score:1]
0142574.g007 Fig 7Predicted anti-miR-17-5p binding sites in the 3'UTR of PTEN mRNA as a mimic of miR-17-3p passenger strand. [score:1]
B: qPCR of miR-17-5p 48 hr post-transfection with miR-17-5p mimic. [score:1]
To understand the unexpected results in Fig 3B, we examined miR-17 in miRBase. [score:1]
In addition, qPCR results showed that the endogenous level of miR-17-5p was about ninety times higher than miR-17-3p in MDA-MB-231 cells (S2A Fig). [score:1]
miR-17-3p mimic lowered luciferase activities of four out of six predicted binding sites in the 3’UTR of PTEN mRNA (Fig 12E). [score:1]
A: qPCR of miR-17-5p 12 hr and 48 hr post-transfection with anti-miR-17-5p. [score:1]
A: Mirbase search of miR-17-3p, forming the lower arm of the miR-17 pre-miRNA hairpin. [score:1]
0142574.g006 Fig 6Predicted anti-miR-17-5p binding sites in the 3'UTR of PDCD4 mRNA as a mimic of miR-17-3p passenger strand. [score:1]
These results implied that artificial anti-miR-17-5p DNA-LNA against miR-17-5p guide strand could exert functions of an miRNA by mimicking the passenger strand of miR-17-5p, and could interact with some of the miR-17-3p binding sites in the 3’UTR of PDCD4 and PTEN mRNAs. [score:1]
Since anti-miR-17-5p is fully complementary to miR-17-5p, its sequence is highly homologous to miR-17-3p (Fig 3B). [score:1]
The example of miR-17-3p bound to a PTEN 3’UTR site (Fig 9) illustrates the realization that miRNA:mRNA: duplexes could be accommodated in the substrate groove of Ago2, in agreement with an earlier simulation of an 11mer duplex bound to Thermus thermophilus Ago [37]. [score:1]
Similarly, miR-17-5p mimic lowered the luciferase activity of the vectors containing the binding sites from the PTEN 3’UTR (Fig 12C). [score:1]
In the pre-miRNA, miR-17-5p was predicted to hybridize with its passenger strand miR-17-3p to form a hairpin (Fig 3A). [score:1]
This same sequence motif exists in anti-miR-17-5p (Fig 3A). [score:1]
0142574.g004 Fig 4Predicted miR-17-3p passenger strand binding sites in the 3'UTR of PDCD4 mRNA. [score:1]
Cells were transfected with 400 ng of each of the reporter constructs, 100 ng of pRL-TK Renilla luciferase internal control vector (E2241, Promega), and with either miR-17-5p mimic or miR-17-3p mimic using Lipofectamine 2000 (Invitrogen, CA). [score:1]
0142574.g002 Fig 2 A: qPCR of miR-17-5p 12 hr and 48 hr post-transfection with anti-miR-17-5p. [score:1]
Based on the hypothesis that anti-miR-17-5p mimicked miR-17-3p, the interaction between anti-miR-17-5p and miR-17-3p binding sites in the 3’UTR should be stable. [score:1]
For each predicted oncomiR:mRNA interaction, the CUGCA motif within the seed region of miR-17-3p is complementary to the corresponding 3’UTR binding sites. [score:1]
Exogenous miR-17-5p mimic lowered both PDCD4 and PTEN protein levels (Fig 12A). [score:1]
Transfection with miR-17-3p mimic lowered PTEN protein level, but not PDCD4 protein level (Fig 12A). [score:1]
Four potential binding sites for miR-17-3p were noted in the PDCD4 3’UTR (Fig 4), while the PTEN 3’UTR had six (Fig 5). [score:1]
0142574.g008 Fig 8Predicted anti-miR-17-3p binding sites in the 3'UTR of PDCD4 and PTEN mRNAs as a mimic of miR-17-5p passenger strand. [score:1]
To evaluate whether miR-17-5p had any effect on the expression level of PDCD4 protein, we analyzed protein levels 48 hr after transfection. [score:1]
Most of the miR-17-3p is fully complementary to its guide strand miR-17-5p. [score:1]
C: qPCR of miR-17-3p 48 hr post-transfection with miR-17-3p mimic. [score:1]
Predicted anti-miR-17-5p binding sites in the 3'UTR of PTEN mRNA as a mimic of miR-17-3p passenger strand. [score:1]
However, the lowered folding energy could be compensated by the LNA residues within anti-miR-17-5p, since LNA:RNA duplexes are highly stable [36]. [score:1]
D: PDCD4 and PTEN protein Western blots at 48 hr post transfection with anti-miR-17-3p. [score:1]
S1 MovieAnimated mpg file showing 25 nsec of simulation with Amber 12 at 300K in explicit H [2]O with 100 mM NaCl, pH 7.0, predicted for miR-17-3p: PTEN mRNA duplex in 100 mM NaCl, pH 7.0, at 300°K. [score:1]
C: PDCD4 and PTEN protein Western blots at 48 hr post transfection with anti-miR-17-5p. [score:1]
0142574.g005 Fig 5Predicted miR-17-3p passenger strand binding sites in the 3'UTR of PTEN mRNA. [score:1]
[1 to 20 of 119 sentences]
6
[+] score: 275
Figure 6 A. Venn diagram showing overlap of three separate gene sets i) Genes differentially expressed in conditional cell lines when MYC is inactivated ii) genes differentially expressed in MYC conditional cell lines when treated with anti-miR-17 therapy iii) Genes that are identified to be targets of miR17 on Targetscan analysis. [score:9]
A. Venn diagram showing overlap of three separate gene sets i) Genes differentially expressed in conditional cell lines when MYC is inactivated ii) genes differentially expressed in MYC conditional cell lines when treated with anti-miR-17 therapy iii) Genes that are identified to be targets of miR17 on Targetscan analysis. [score:9]
MYC maintains tumorigenesis via the upregulation of miR-17∼92 family and suppression of its target genes [9]. [score:8]
We identified 33 direct targets of miR-17 (Supplementary Table 4) which were differentially expressed either upon MYC inactivation (Figure 6B) or upon inhibition of miR-17 (Figure 6C). [score:8]
All six miRNAs were overexpressed in HCC when compared to the adjacent normal liver, with miR-17 and miR-106b (p value<0.001) being the most overexpressed and miR20-b being minimally overexpressed (p value=0.03) (Figure 1A). [score:6]
Next, we evaluated the influence on gene expression of miR-17 inhibitor TuD to inhibit endogenous miR-17 family activity. [score:5]
A. In the basal state, MYC transcriptionally activates expression of miR-17 family which leads to repression of its known targets like Tgfbr2, Cdkna1, E2f1 and Wee1 thus promoting tumor progression. [score:5]
Figure 7 A. In the basal state, MYC transcriptionally activates expression of miR-17 family which leads to repression of its known targets like Tgfbr2, Cdkna1, E2f1 and Wee1 thus promoting tumor progression. [score:5]
TargetScan 6.2 was used to identify putative conserved targets of miR-17 [41]. [score:5]
Cell-line based studies have shown that targeting miR-17 can suppress tumor proliferation [15]. [score:5]
Median survival in patients with low miR-17 family expression was 70.5 months (95% CI 50.2-90.8) while those with high miR-17 family expression had a significantly poorer median survival of 25.2 months (95% CI 18.5-31.9) (p<0.0001; HR 2.1 (1.4-3.2)). [score:5]
B. The lipid nano particle (LNP) delivered anti-miR-17 tough decoy anti sense oligonucleotide is delivered into the HCC cell leading to inhibition of anti-miR-17 activity and de-repression of its targets. [score:5]
D. Pathway analysis of differentially expressed genes revealed that enhancement of cell death and inhibition of cellular proliferation (p=1.9X10 [-5]) were key functional changes induced by anti-miR17 therapy. [score:5]
Here we show that MYC can both induce the expression and is correlated with the overexpression of miR-17. [score:5]
A total of 2885 genes (p<0.05) were differentially expressed between the MYC on and off states (Supplementary Table 3); whereas 1323 genes were differentially expressed upon anti-miR-17 therapy, with 153 genes overlapping. [score:5]
Also, expression of miR-17 was significantly correlated with MYC mRNA expression (p=0.0017). [score:5]
Next, we identified genes amongst these that are targets of miR-17 by TargetScan analysis (Figure 6A). [score:5]
Network analysis of differentially expressed genes revealed that enhancement of cell death and inhibition of cellular proliferation (p=1.9X10 [-5]) were key functional changes induced by anti-miR17 therapy (Figure 5D). [score:5]
The molecules in red are the most over expressed in the tumors treated with anti-miR-17 therapy while the other molecules in yellow are indirectly involved in the network. [score:4]
Finally, network analysis of gene expression data suggested that the mechanism of action of LNP delivered anti-miR-17 was related to blocking a MYC induced transcriptional program which regulates apoptosis and cell cycle progression. [score:4]
Notably, we confirmed that MYC regulates miR-17, but not miR-19 or miR-20 expression (Supplementary Figure 5), as has also been described by us previously [9]. [score:4]
MiR-17 expression was correlated with higher stage tumor (36.7%) compared to those with lower miR-17 family expression (22%) (p<0.001) (Figure 1B). [score:4]
A. Volcano plot shows genes differentially expressed with anti-miR-17 treatment. [score:3]
Anti-miR-17 therapy inhibits MYC induced transcriptional program. [score:3]
But we did confirm that LNP delivery of anti-miR-17 therapy, even at this lower concentration, was associated with significant de-repression of known miR17 targets in the tumor. [score:3]
C. Anti-miR-17 but not control de-repressed known miR-17 family mRNA targets -TGFBR2, PTPN4, CROT, in MYC -driven HCC tumors (*p<0.05, **p<0.01, ***p<0.001). [score:3]
Anti-miR-17 inhibits HCC cell proliferation and increases apoptosis. [score:3]
We examined the mechanism by which miR-17 inhibition blocked MYC -induced HCC tumorigenesis. [score:3]
The miR-17 family was overexpressed in 60 tumors (16.0%). [score:3]
C. Bar graph shows log fold change of expression changes of these 33 genes in cell lines treated with control versus anti-miR-17 therapy. [score:3]
Figure 1 A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
C. Patients with tumors with higher versus lower miR-17 family expression had worse survival. [score:3]
The de-repression of several known targets of miR-17 [22- 24] like E2f1, Tgfbr2 and Cdkna1 was observed (Figure 5C). [score:3]
The miR-17 family is overexpressed in MYC -driven human HCC tumors. [score:3]
Anti-miR-17 therapy leads to de-repression of miR-17 targets. [score:3]
Figure 5 A. Volcano plot shows genes differentially expressed with anti-miR-17 treatment. [score:3]
Our results suggest that MYC induces a transcriptional program which, in part, suppresses cell death and apoptosis via miR-17 activation. [score:3]
B. Heat map of the top 20 genes differentially expressed upon treatment with control versus anti-miR-17 oligonucleotide. [score:3]
To summarize, anti-miR-17 therapy induces apoptosis and cell cycle arrest by specifically de-repressing several targets in the MYC pathway and thus delays tumorigenesis in MYC -driven HCCs (Figure 7). [score:3]
Furthermore, by TargetScan and Sylamer analysis, we found global de-repression of transcripts that contain putative miR-17 binding sites in their 3’-UTRs (Supplementary Figure 7). [score:3]
A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
We therefore hypothesized that miR-17 is a promising therapeutic target for MYC -driven HCCs. [score:3]
The miR-17 family members exhibited higher expression in tumors with MYC amplification (Figure 1C and Supplementary Figure 1). [score:3]
Recently, a novel approach for targeting miR-17 with a tough decoy (TuD) antisense miR17 delivered via systemic lipid nanoparticle (LNP) has been shown to be effective in HCC cell lines [15]. [score:3]
C. De-repression of several known targets of miR-17 was seen including E2f1, Tgfbr2 and Cdkna1 in tumors treated with anti-miR-17 therapy. [score:3]
Tumors could be classified into two groups based on the composite expression of the six miR-17 levels using clustering analysis. [score:3]
Hence, LNP delivery of anti-miR17 is indeed distributed to HCC tumors and associated with de-repression of miR-17 targets. [score:3]
A total of 743 genes considered to be potential direct targets of miR-17 family were identified (Supplementary Table 2). [score:3]
Further, the inhibition of miR-17 using a LNP delivery of an anti-oligonucleotide in an autochthonous transgenic mouse mo del of MYC -induced HCC impedes tumor growth. [score:3]
Anti-miR-17 oligonucleotide but not control oligonucleotide de-repressed known miR-17 family mRNA targets like TGFBR2 [18], PTPN4 [19] and CROT 15] in MYC -driven HCC tumors (Figure 2C). [score:3]
We hypothesized that targeting miR-17 could be effective strategy for MYC driven cancers. [score:3]
A total of 1323 genes were differentially expressed between the anti-miR-17 treated and control groups (Figure 5A) (p<0.05) (Supplementary Table 1). [score:3]
The miR 17 family (miR 17, miR 20a, miR 20b, miR106a, miR106b, miR 93) is a part of this cluster and few studies have shown that over -expression of miR-17 family promotes HCC progression and cancer metastasis [10, 11]. [score:3]
Thus, our analysis in this large cohort of human HCCs shows that the miR-17 family is commonly overexpressed in MYC -driven HCC and correlates with a worse clinical outcome. [score:3]
We confirmed delivery of anti-miR-17 lipid nanoparticles and de-repression of miR-17 targets. [score:3]
Anti-miR-17 inhibited HCC cell proliferation and increased apoptosis. [score:3]
The miR-17 family (miR-17, miR-20a, miR 20-b, miR 106-a, miR 106-b, miR-93) and MYC expression was examined in human HCC from the cancer genome atlas (TCGA) [16]. [score:3]
We confirmed delivery into tumors, de-repression of miR-17 targets, but did not observe any overt liver-specific or systemic toxicity with this therapy. [score:3]
Recently, we reported that MYC’s ability to maintain proliferation, survival and self-renewal were regulated via its induction of miR17∼92 cluster [9]. [score:2]
B. MiR-17 expression is higher in tumors of higher stage than lower stage HCC. [score:2]
D. MiR-17 expression is higher in tumors with MYC genomic amplification than in those with normal diploid MYC. [score:2]
Figure 4 A. H&E, IHC staining for cleaved caspase 3 (CC3) and phospho histone 3 (PH3) at 10X and 40X magnification from representative tumor samples from mice treated with control or anti-miR-17 therapy. [score:1]
At week 4, tumors were larger in the control group than in the anti-miR-17 group. [score:1]
Three dimensional tumor volume assessment by MRI showed that normalized tumor volume at week 4 was significantly higher in the mice treated with control compound (430±107 mm [3]) than the mice treated with anti-miR-17 oligonucleotide (mean 147±37 mm [3]) (p=0.028) (Figure 3C; Supplementary Figure 2A). [score:1]
We conclude that anti-miR-17 therapy is potential novel therapy for MYC -associated HCC. [score:1]
Also, anti-miR-17 treated transgenic mice had smaller and fewer liver tumors (4.1±0.32 grams) than control mice (6.2±0.7 grams) (p=0.03) (Figure 3D, supplementary Figure 2B). [score:1]
Our study is the first to demonstrate that anti-miR-17 therapy can impede MYC induced tumorigenesis in an autochthonous mouse mo del. [score:1]
Figure 2 A. The control and anti-miR-17 drugs were equally detected in both the liver and in the tumor The concentration in the tumor was lower than in the liver (*p<0.05). [score:1]
D. Gross morphology of liver tumors after 4 doses of treatment shows that mice treated with control oligonucleotide had larger tumors and more numerous tumors than those treated with anti-miR-17 therapy. [score:1]
A. The control and anti-miR-17 drugs were equally detected in both the liver and in the tumor The concentration in the tumor was lower than in the liver (*p<0.05). [score:1]
A lipid nanoparticle (LNP) encapsulating anti-miR-17 family oligonucleotide was utilized, as has been described previously (RL01-17(5))[15]. [score:1]
We used a lipid nanoparticle to deliver the anti-miR-17 oligonucleotide to the liver and we successfully demonstrate that the drug is delivered both to the tumor and to the normal liver. [score:1]
Our results suggest that a subgroup of human patients with MYC and miR17 associated HCC may be good candidates for anti-miR-17 therapy. [score:1]
B. Immunohistochemistry for control and anti-miR-17 confirmed drug delivery to both the liver and the tumor. [score:1]
Our results indicated these genes are part of a common transcriptional program between MYC and miR-17. [score:1]
Mouse MYC -driven HCC cells were transfected with 25nM of anti–miR-17 compound or control in triplicate. [score:1]
We found that an anti-miR-17 LNP, in a transgenic mouse mo del of MYC -driven HCC, impeded tumor progression without overt signs of hepatic or systemic toxicity. [score:1]
Both the control and anti-miR-17 oligonucleotide compound were detected in both the liver and the tumor, but the concentration in the tumor (mean 5.7 microgm/gm) was lower than in the normal liver (mean 25.4 microgm/gm) (p<0.05) (Figure 2A). [score:1]
LNPs encapsulating anti-miR-17 or control oligonucleotide were prepared by mixing oligonucleotide with lipid mixture. [score:1]
Our results demonstrate that systemic delivery of LNP-encapsulated anti-miR-17 family oligonucleotide significantly delayed tumor progression in a mouse mo del of MYC -driven HCCs. [score:1]
Anti-miR-17 therapy impeded MYC -driven tumorigenesis. [score:1]
Mice were treated with control or Anti-miR-17 oligonucleotide once tumor volume of 50 mm3 was reached. [score:1]
Further, we have shown that anti-miR-17 therapy promoted apoptosis and proliferative arrest in tumors. [score:1]
First, we showed that LNP anti-miR-17 oligonucleotide can be delivered to the liver. [score:1]
B. Quantification of CC3 and pH3 staining by determining the average staining in five 40X magnification fields shows apoptosis is increased with anti-miR-17 therapy and proliferation is decreased. [score:1]
MYC and miR-17∼92 have been implicated in modulation of anti-tumor immune response [20, 21]. [score:1]
Anti-miR-17 therapy was examined in an autochthonous transgenic mouse mo del of MYC -driven HCC (LAP-tTA/tet-O-MYC) [17]. [score:1]
Recently, anti-miR-17 LNP was shown to be effective in HCC but this study was performed with cell lines and cell-line based xenografts so they were unable to study liver-specific drug delivery or the potential role of the host immune response [15]. [score:1]
Mechanism of action of anti-miR17 therapy in MYC driven HCCs. [score:1]
Lipid nanoparticle anti-miR-17 was effectively delivered to the liver. [score:1]
Treatment with anti-miR-17 versus control impeded tumorigenesis (Figure 3B). [score:1]
Our results demonstrate that anti-miR-17 therapy may have efficacy for the treatment of MYC -driven HCC. [score:1]
A. H&E, IHC staining for cleaved caspase 3 (CC3) and phospho histone 3 (PH3) at 10X and 40X magnification from representative tumor samples from mice treated with control or anti-miR-17 therapy. [score:1]
Next, therapeutic efficacy of anti-miR-17 therapy was determined. [score:1]
Tumor-bearing mice were treated either with anti-miR-17 oligonucleotide (n=3) or with control oligonucleotide (n=3) for three doses before the mice were sacrificed and the concentration of the oligonucleotide was determined by mass spectrometry (LC/MS). [score:1]
Also, we demonstrated that the anti-miR-17 therapy can effectively delay tumor progression without causing any observed liver toxicity. [score:1]
C. Tumor volume from mice treated with control of anti-miR-17 oligonucleotide at week 4 was normalized to tumor volume at week one. [score:1]
Intravenous delivery of anti-miR-17 LNP (4 mg/kg) (n=7) or control oligonucleotide (n=7) once a week for 4 weeks was performed. [score:1]
We further examined the effects of anti-miR-17 therapy using MYC -induced HCC tumor derived cell lines. [score:1]
To see if miR-17 suppression influenced the immune response or if the LNP led to any deleterious immunostimulatory effects, we measured T-cells (CD4+) and macrophages (F4/80) infiltration in anti-miR-17 versus control treated MYC -induced HCC and found no significant differences (Supplementary Figure 4). [score:1]
The concentration of anti-miR-17 was 2.6mg/mL and lipid content was 57% and the percentage of encapsulated anti-miR-17 was 98% (13). [score:1]
[1 to 20 of 101 sentences]
7
[+] score: 255
Quantitative proteome-wide expression analysis and alignment of miR-17∼19b seed regions identified multiple apoptosis regulators as being downregulated by miR-17∼19b-overexpression. [score:9]
[14] Conversely, moderate overexpression of miR-17∼92 causes a reduction in Bim and Pten expression, resulting in lymphoproliferation and autoimmune disease. [score:7]
As miR-92a expression was unchanged between BCR-ABL -positive and -negative ALL cells (Figure 1), we transduced TonB cells to overexpress miR-17∼19b, a derivative of miR-17∼92 suitable for transgenic expression. [score:7]
[18] In normal lymphopoiesis, loss of miR-17∼92 results in upregulation of Bim (Bcl2l11) and increased apoptosis, inhibiting the pro-B to pre-B transition. [score:6]
Having validated the anti-apoptotic protein BCL2 as a miR-17∼92 target, we have demonstrated the direct control of BCL2 expression by miR∼17 and miR∼18 family members by the canonical RNAi effector protein AGO2. [score:6]
To verify that Bcl2 is a direct target of miR-17∼19b miRNAs, we transfected luciferase reporter constructs containing murine Bcl2 sequences into miR-17∼19b overexpressing NIH3T3 cells. [score:6]
Efficient downregulation of BCL2 protein in SupB15 cells by lentivirally mediated overexpression of both miR-17∼19b and anti-BCL2 shRNA was further confirmed by fluorescence microscopy demonstrating co-localisation of BCL2 (red) and the mitochondrial protein COX4 (green) (Figure 5e). [score:6]
From these, BCL2 was validated as a direct target of the miR-17 and miR-18a, and BCL2 knockdown resulted in strong induction of apoptosis in BCR-ABL -positive, but not BCR-ABL -negative ALL cells. [score:5]
Inhibition of BCL2 and BCR-ABL in BCR-ABL -positive ALL cells resulted in different kinetics of cell death, turn-over of BCL2 protein and induction of miR-17∼92 expression. [score:5]
Overexpression of the miR-17∼92 derivative miR-17∼19b resulted in reduced proliferation and notably a substantial pro-apoptotic effect, with a significantly enriched subG1 population and concomitant cleavage of caspase 3. This effect is surprising, as previous studies of miR-17∼92 have shown direct regulation of ‘pro-apoptotic' molecules Bim and Pten in normal lymphopoiesis, [14] MYC -driven lymphomas 18, 20 and immunodeficiency or lymphoproliferative states. [score:5]
Anti-Bcl2 shRNA reduced Bcl2 protein expression by ∼70% – a similar level to overexpression of miR-17∼19b (∼80%) (Figure 5a). [score:5]
Having confirmed murine Bcl2 as a target of miR-17∼19b, we next analysed specific targeting of the human BCL2 transcript by the cluster. [score:5]
We next over-expressed the miR-17∼92 derivative miR-17∼19b in an inducible mo del of BCR-ABL -positive ALL, thereby identifying impaired apoptosis as a key determinant of reduced miR-17∼92 function in this disease setting. [score:5]
Expression of miR-17∼19b reduced BCL2 protein expression in BCR-ABL -positive ALL cell lines by 30–70% (Supplementary Figure 4A). [score:5]
This shows that miR-17∼19b overexpression results in increased binding of BCL2 mRNA to AGO2 demonstrating specific targeting of BCL2 mRNA by miR-17∼19b miRNAs. [score:5]
These data demonstrate that the expression of murine Bcl2 is directly regulated by miR-17∼19b through miRNA binding within the 5′-UTR. [score:5]
We found that ABT-737 treatment led to a decrease in BCL2 protein levels and an increase in miR-17∼92 miRNA expression in a BCR-ABL -dependent manner, suggesting that BCL2 inhibition results in the perturbation of a complex signalling network. [score:5]
They also suggest that inhibition of BCL2 by ABT-737 results in perturbations in wider signalling networks that leads to expression changes in both miR-17∼92 and BCL2 protein. [score:5]
[25] In this setting, expression of BCR-ABL was associated with a 2.3–3.3-fold reduction in expression of miR-17, -18a and -19a, in agreement with our findings in primary ALL samples (Supplementary Figure 1). [score:5]
Furthermore, the TonB mo del of inducible BCR-ABL expression on a murine B-lymphoid precursor background demonstrated a significant reduction in mature miR-17∼92 expression following induction of BCR-ABL, confirming the specificity of this finding for BCR-ABL -positive ALL. [score:5]
Overexpression of miR-17∼19b also led to a further increase in caspase 3 cleavage in BCR-ABL expressing cells (Figure 2c, lanes 3 and 5), but not in cells grown in the presence of IL-3 (Figure 2c, lanes 2 and 4). [score:5]
Repression of murine and human Bcl2 expression mimics miR-17∼19b overexpression. [score:5]
Given that miR-17∼19b overexpression was a driver of cell death in TonB cells in a BCR-ABL-specific manner, we hypothesised that identifying key targets of the cluster could provide novel therapeutic opportunities in BCR-ABL -positive ALL. [score:5]
miR-17∼19b suppresses expression of Bcl2. [score:5]
miR-17∼92 is downregulated in BCR-ABL -positive human ALL samples. [score:4]
miR-17∼19b targets regulators of apoptosis. [score:4]
[36] Our data suggest that downregulation of miR-17∼92 may be an important mediator of this effect. [score:4]
miRNAs predominantly affect protein expression, so we initially used a stable isotope labelling in cell culture (SILAC) -based approach to identify miR-17∼19b- and miR-20a-regulated proteins. [score:4]
To investigate whether differential miR-17∼92 expression is controlled by BCR-ABL, we used an inducible murine mo del of BCR-ABL expression. [score:3]
Furthermore, after ABT-737 but not imatinib treatment, a delayed increase in expression of miR-17∼92 encoded miRNAs (starting at approximately 24 h after addition of ABT-737, Figure 7f, Supplementary Figure 5B) has been observed. [score:3]
These data point to a direct role for miR-17∼19b encoded miRNAs in the regulation of apoptosis in BCR-ABL -positive ALL. [score:3]
miR-20a overexpression showed similar, but weaker, effects to miR-17∼19b in preliminary experiments (data not shown). [score:3]
As shown in Figure 3b, protein expression of Adseverin (Scin), Bcl2, Sialophorin (Spn), Aifm-1 (Aif), Sequestosome-1 (Sqstm1) and Shp-1 (Ptpn6) was reduced in the presence of miR-17∼19b (from 0.2- to 0.65-fold), whereas protein levels of Granzyme B (Gzmb) and DnaJB6 remained unchanged. [score:3]
To study the functional contribution of Bcl2 to the miR-17∼19b -induced phenotype, we lentivirally transduced TonB cells to express either anti-Bcl2- or control shRNA. [score:3]
To our surprise, patient samples showed significantly lower expression of mature miR-17∼92 elements in BCR-ABL -positive ALL than in either BCR-ABL -negative ALL or normal CD34+ cells. [score:3]
We further confirmed this by a complementary approach using lentiviral overexpression of antagomirs against miR-17, miR-18 and miR-20a in the human BCR-ABL -positive BV173 cell line. [score:3]
We next analysed the functional effects of miR-17∼19b overexpression in human BCR-ABL -positive ALL cell lines. [score:3]
[14] Moreover, we observed a high expression of miR-17∼92 in adult heart and in postnatal cardiomyocytes. [score:3]
Assessment of miR-17∼19b levels following transduction confirmed overexpression and AGO2 association of all three miRNAs (Figure 4b). [score:3]
Together, these results demonstrate a specific role for BCL2 in the proliferation of human BCR-ABL -positive ALL cells and suggest that the miR-17∼92 cluster suppresses BCL2 in BCR-ABL -positive cells. [score:3]
In contrast, transduction of the BCR-ABL -negative ALL cell lines REH, Nalm-6, and 697 with miR-17∼19b had no, or only minor, inhibitory effects on cell proliferation (Figure 5c, right). [score:3]
Lentiviral supernatants expressing miR-17∼19b and control vector SIEW were used to transduce ∼1 × 10 [6] 293 cells with an MOI of ∼2. [score:3]
Whereas cell cycling was only marginally affected, apoptosis was markedly enhanced by overexpression of miR-17∼19b following induction of BCR-ABL. [score:3]
29, 30, 31, 32 As shown in Figure 3a, all targets analysed have at least two miRNA -binding sites for the miR-17∼19b cluster. [score:3]
In keeping with the phenotype described for the TonB mo del, an unbiased global proteomic approach identified several apoptosis-related proteins as miR-17∼19b targets. [score:3]
18, 20 Based on our previous work in chronic myeloid leukaemia, [21] we first analysed miR-17∼92 expression in ALL and observed a significantly lower expression in ALL as compared to normal CD34+ cells with further reduction in BCR-ABL -positive as compared to -negative ALL cells. [score:3]
In contrast, BCR-ABL -mediated cell proliferation was strongly inhibited by miR-17∼19b (Figure 2a, right). [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
Our data indicate a selective advantage for low miR-17∼92 expression in primary BCR-ABL -positive ALL cells. [score:3]
We next analysed the presence of putative miR-17∼92 -binding sites (seed matches) within the target mRNAs. [score:3]
[14] Based on this, we analysed expression of miR-17∼92 encoded miRNAs in 14 BCR-ABL -negative and 13 BCR-ABL -positive ALL samples, as well as normal CD34+ cells, using miR-qRT-PCR. [score:3]
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
Transgenic expression of miR-17∼19b increased the subG1 fraction from 33 to 67% compared to vector controls (Figure 2b, right), whereas in BCR-ABL -negative cells it remained almost unchanged (7 and 11%, respectively, Figure 2b, left). [score:2]
To study the impact of miR-17∼19b on cell cycle regulation and apoptosis, transgenic TonB cells were analysed for DNA content in the presence and absence of BCR-ABL. [score:2]
We previously demonstrated an increased miR-17∼92 expression in chronic phase chronic myeloid leukaemia CD34+ cells, compared to normal CD34+ cells from healthy donors. [score:2]
Proliferation of TonB cells grown in the presence of IL-3 was only slightly reduced by transgenic miR-17∼19b expression as compared to controls (SIEW) (Figure 2a, left). [score:2]
[17] Conditional knockout of the cluster-revealed modulation of apoptosis as the predominant mechanism of action of miR-17∼92. [score:2]
Whereas levels of BCL2 mRNA in the input fraction were unchanged following miR-17∼19b overexpression, anti-AGO2 immunoprecipitates specifically pulled down 3.2-fold more BCL2 mRNA as compared to controls (Figure 4c). [score:2]
As we have shown upregulation of the oncomir miR-17∼92 in chronic phase chronic myeloid leukaemia, [21] we investigated the role of this cluster in BCR-ABL -positive ALL. [score:2]
In total, 84 proteins were regulated more than 1.7-fold by miR-17∼19b, with 31 exhibiting higher abundance and 53 exhibiting lower abundance in miR-17∼19b transgenic TonB cells. [score:2]
Upon lentiviral transduction, miR-17∼19b miRNA expression was increased between 3- and 12-fold as compared to controls (Supplementary Figure 2A). [score:2]
As shown in Figure 5c, lentiviral transduction of miR-17∼19b into the human BCR-ABL -positive cell lines Tom-1, BV173 and SupB15 inhibited cell proliferation by 40–55% as compared to controls (Figure 5c, left). [score:2]
Together, these data demonstrate direct and functional miRNA binding of miR-17∼19b members namely miR-17/miR-20a and miR-18a to human BCL2 mRNA. [score:2]
As shown in Figure 4a, miR-17∼19b significantly repressed luciferase activity for the wildtype but not for mutated miR-17 and miR-18a -binding sites in the murine Bcl2 5′UTR. [score:1]
Notably, six binding sites for miR-17∼19b miRNAs (three sites for miR-18a, two sites for miR-17 and one site for miR-20a) are located within the 5′UTR and CDS of murine Bcl2 (Supplementary Figure 3A). [score:1]
In human BCL2, we identified 13 binding sites for miR-17∼19b miRNAs (five sites for miR-17, six sites for miR-18a and two sites for miR-20a) located within the CDS and 3′UTR (Supplementary Figure 3B). [score:1]
TonB cells are dependent on interleukin-3 (IL-3) for survival and growth; induction of BCR-ABL allows cytokine-independent proliferation, making them an ideal system to study miR-17∼92 function in the context of BCR-ABL. [score:1]
We used qRT-PCR to investigate the association of BCL2 mRNA with AGO2, the catalytic component of RISC in miR-17∼19b overexpressing human 293 cells. [score:1]
They also strongly suggested that miR-17∼19b mediated repression of Bcl2 could contribute to the pro-apoptotic effects of the cluster in the context of BCR-ABL. [score:1]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
TonB cells metabolically labelled with heavy, medium, or light isotope lysine and arginine versions were lentivirally transduced with miR-17∼19b, miR-20a, or a control vector (SIEW). [score:1]
These results suggested that miR-17∼92 miRNAs could have previously undiscovered anti-oncogenic functions under certain circumstances. [score:1]
miR-17∼92 has also been strongly implicated in both solid and haematopoietic malignancies. [score:1]
These data demonstrate different mechanisms of action for ABT-737 and imatinib in BCR-ABL -positive ALL cells and suggest a role for miR-17∼92 encoded miRNAs in BCL2 -mediated apoptotic pathways in these cells. [score:1]
Together, these data demonstrate that miR-17∼19b decreases cell proliferation and markedly increases apoptosis in a BCR-ABL-specific manner. [score:1]
[19] Dissection of the miR-17∼92 cluster has demonstrated that miR-19 is both necessary and sufficient to abrogate apoptosis, at least in Myc -mediated lymphomagenesis most likely by repression of PTEN and BIM. [score:1]
[1 to 20 of 76 sentences]
8
[+] score: 250
Other miRNAs from this paper: hsa-mir-106a
In addition, the effects of HOTAIR upregulation/downregulation on the alterations of osteogenic differentiation related parameters were also reversed by the downregulation/ upregulation of miR-17-5p target gene SMAD7. [score:14]
Our further experiments demonstrated the decrease of RUNX2 and COL1A1 mRNA expression levels and induced by HOTAIR upregulation was reversed by miR-17-5p mimic, while the increased values induced by HOTAIR downregulation was also canceled by miR-17-5p inhibitor. [score:11]
HOTAIR downregulation induced by si-HOTAIR led to the increase of miR-17-5p expression and the decrease of miR-17-5p target gene SMAD7 expression. [score:10]
In addition, HOTAIR downregulation contributed to the reduced DNA methylation level of miR-17-5p promotor and increased miR-17-5p expression, which proved that HOTAIR modulated the expression level of miR-17-5p. [score:8]
The effects of HOTAIR downregulation on the expression levels of miR-17-5p and its target gene. [score:8]
The MSCs derived from non-traumatic ONFH patients were treated with 5-Aza-CdR, an epigenetic modifier results in DNA demethylation, or TSA, a histone deacetylase inhibitor, and it was observed that miR-17-5p expression was markedly increased by 5-Aza-CdR (P<0.01) but not influenced by TSA (P>0.05) (Fig 2A and 2B), indicating that the aberrant methylation might be a contributor for miR-17-5p expression regulation. [score:8]
To explore the potential mechanism that contributes to regulate miR-17-5p expression, the epigenetic regulation of miR-17-5p expression was then determined. [score:7]
We observed that the change of miR-17-5p expression could be induced by the DNA methylation inhibitor (5-Aza-CdR) but not histone deacetylase inhibitor (TSA). [score:7]
The following experiments showed that downregulation of HOTAIR contributed to the reduced DNA methylation level of miR-17-5p promotor (Fig 3B) and the elevated miR-17-5p expression (Fig 3C). [score:6]
However, the increase of these values was canceled by miR-17-5p inhibitor or SMAD7 upregulation. [score:6]
Li et al first reported that the expression levels of miRNA-17 family, including miR-17-5p and miR-106a were down-regulated in response to BMP2 in C2C12 samples that underwent osteoblast differentiation [22]. [score:6]
through mediating miR-17-5p expressionWhether HOTAIR participates in the regulation of osteogenic differentiation that mediates miR-17-5p expression remains unclear. [score:6]
HOTAIR downregulation increased miR-17-5p expression. [score:6]
These data indicated that HOTAIR was involved in the regulation of osteogenic differentiation through modulating the expression of miR-17-5p and its target gene SMAD7. [score:6]
The results showed that miR-17-5p expression was significantly lower (P<0.01, Fig 1A) in non-traumatic ONFH group than that in OA group, and HOTAIR expression was significantly higher (P<0.01, Fig 1B) in non-traumatic ONFH group than that in both OA group and healthy donor. [score:5]
Fang et al found that miR-17-5p suppresses osteogenic differentiation and bone formation by targeting SMAD5 [24]. [score:5]
through mediating SMAD7 expressionIt has been reported that SMAD7 is a target gene of miR-17-5p that modulates osteoblastic differentiation. [score:5]
In this experiment, we observed that miR-17-5p inhibitor canceled the increase in mRNA expression levels of RUNX2 and COL1A1 and in which were induced by si-HOTAIR (Fig 6A). [score:5]
In addition, the mRNA and protein expression levels of SMAD7, a target gene of miR-17-5p, were also decreased by the treatment of si-HOTAIR (Fig 3D). [score:5]
They also confirmed that miR-17-5p regulated osteogenic and adipogenic lineage commitment of hADSCs by directly targeting BMP2. [score:5]
In osteosarcoma, miR-17-5p up-regulation is more frequently occurred in specimens with advanced clinical stage, positive distant metastasis and poor response. [score:4]
Bioinformatics software reports that HOTAIR shares the complementary sequences with miR-17-5p, indicating HOTAIR may be a regulator for the expression of miR-17-5p. [score:4]
The effects of methylation and histone acetylation alteration on miR-17-5p expression regulation. [score:4]
HOTAIR regulates osteogenic differentiation markers through mediating miR-17-5p expression. [score:4]
Epigenetic regulation influences the expression of miR-17-5p. [score:4]
The results mentioned above confirmed that HOTAIR regulated osteogenic differentiation markers through mediating miR-17-5p expression. [score:4]
HOTAIR played a role in regulating osteogenic differentiation and proliferation through modulating miR-17-5p and its target gene SMAD7 in non-traumatic ONFH. [score:4]
Whether HOTAIR participates in the regulation of osteogenic differentiation that mediates miR-17-5p expression remains unclear. [score:4]
These data indicated that HOTAIR regulated osteogenic differentiation through mediating miR-17-5p expression. [score:4]
HOTAIR played a role in regulating osteogenic differentiation and proliferation through modulating miR-17-5p and its target gene SMAD7. [score:4]
We also observed that miR-17-5p expression was decreased in non-traumatic ONFH samples, and HOTAIR exhibited an upstream regulator for miR-17-5p to modulate the osteoblastic differentiation of MSC. [score:4]
A study revealed that miR-17-5p expression was significantly lower in non-traumatic ONFH than that in osteoarthritis (OA) samples, and functioned to facilitate the proliferation and differentiation of MSCs [8]. [score:3]
Pre -negative control (NC) and NC were used as the controls of miR-17-5p mimic and miR-17-5p inhibitor, respectively. [score:3]
0169097.g001 Fig 1The MSCs were isolated from patients with non-traumatic necrosis of femoral head (ONFH, n = 15), osteoarthritis (OA, n = 13) and healthy donor (n = 10), the expression levels of miR-17-5p (A) and HOTAIR (B) were detected by real-time PCR. [score:3]
In conclusion, our findings demonstrated that HOTAIR was significantly higher and miR-17-5p expression was significantly lower in non-traumatic ONFH group than that in OA group. [score:3]
The MSCs were isolated from patients with non-traumatic necrosis of femoral head (ONFH, n = 15), osteoarthritis (OA, n = 13) and healthy donor (n = 10), the expression levels of miR-17-5p (A) and HOTAIR (B) were detected by real-time PCR. [score:3]
0169097.g006 Fig 6 through mediating miR-17-5p expression. [score:3]
It has been reported that SMAD7 is a target gene of miR-17-5p that modulates osteoblastic differentiation. [score:3]
In recent years, it demonstrated that miR-17-5p modulates osteoblastic differentiation and cell proliferation by targeting SMAD7 in non-traumatic ONFH [8], which is consistent with our findings. [score:3]
The expression levels of miR-17-5p and HOTAIR in MSCs of patients with non-traumatic necrosis of femoral head and osteoarthritis. [score:3]
Human mesenchymal stem cells from bone marrow (hMSC-BM) cell line was treated with co-transfection of siRNA-HOTAIR (si-HOTAIR) and miR-17-5p inhibitor, with si-control and NC acting as controls, respectively (A) or co-transfection of Adenovirus-HOTAIR (Ad-HOTAIR) and miR-17-5p mimic, with Ad-GFP and Pre-NC acting as controls, respectively (B) for 48h, then incubated with osteoblastic-inductive BMP-2 for six days. [score:3]
The expression levels of HOTAIR and miR-17-5p in the mesenchymal stem cells (MSCs) derived from patients with non-traumatic ONFH and osteoarthritis (OA) were examined by real-time PCR. [score:3]
On the other hand, the decrease in RUNX2 and COL1A1 mRNA expression levels and induced by Ad-HOTAIR was also reversed by miR-17-5p mimic (Fig 6B). [score:3]
The expression levels of miR-17-5p and HOTAIR in MSCs of patients with non-traumatic ONFH or OA. [score:3]
The decreased expression levels of miR-17-5p and miR-106a in human adipose-derived MSCs (hADSCs) underwent differentiation toward osteogenic lineages and increased levels during adipocyte differentiation were also confirmed by Li et al [23]. [score:3]
The expression levels of miR-17-5p in MSCs derived from patients with non-traumatic ONFH was detected by real-time PCR after the treatment of 5 μmol/l 5-Aza-2-deoxycytidine (5-Aza-CdR, A) or 100 nmol/l Trichostatin A (TSA, B) for 48h. [score:3]
Previous studies have showed that miR-17-5p play a regulator role in various cell proliferation and differentiation [7]. [score:2]
It was observed that the expression level of miR-17-5p was lower and the level of HOTAIR was higher in samples of non-traumatic ONFH compared with OA. [score:2]
However, how miR-17-5p is regulated in non-traumatic ONFH remains unclear. [score:2]
The quantitative analysis of miR-17-5p, HOTAIR, SMAD7, RUNX2, and COL1A1 expression was performed with QuantiTect SYBR Green RT-PCR kit (QIAGEN, USA) in triplicates by reacting with specific primers. [score:2]
In the present study, whether HOTAIR was involved in the regulation of miR-17-5p expression to exhibit a role in osteogenic differentiation and proliferation in non-traumatic ONFH was investigated. [score:2]
The role of HOTAIR in the regulation of miR-17-5p expression was then investigated. [score:2]
We first investigated the differential expression levels of miR-17-5p and HOTAIR in MSCs derived from patients with non-traumatic ONFH, OA and healthy donor. [score:1]
We found that HOTAIR had the complementary sequences of miR-17-5p using bioinformatics software. [score:1]
Many studies have proved that miR-17-5p plays a key role in tumor biology, including cancer proliferation, cell migration, cell cycle progression, cell apoptosis and tumor growth [18– 20]. [score:1]
The miR-17-5p expression level was measured by real-time PCR (C). [score:1]
MiR-17-5p is located in the miR-17/92 cluster. [score:1]
Previous study confirmed that miR-17-5p modulated osteoblastic differentiation and cell proliferation in non-traumatic ONFH [8]. [score:1]
We then analyzed the differential methylation levels of miR-17-5p promotor in MSCs between non-traumatic ONFH and OA groups. [score:1]
The DNA methylation level of miR-17-5p promotor in MSCs from two groups were determined by bisulphite sequencing (C). [score:1]
In this study, U6 and GAPDH were acted as the reference genes for miR-17-5p and HOTAIR, respectively. [score:1]
For analysis of DNA methylation levels for miR-17-5p promotor, genomic DNA from MSCs derived from patients and hMSC-BM after the transfection of si-HOTAIR were isolated using a Genomic DNA isolation kit (BioVision, USA). [score:1]
[1 to 20 of 62 sentences]
9
[+] score: 242
Other miRNAs from this paper: mmu-mir-17
The expression of HIF-1α was up-regulated after miR-17 over-expressed whereas the expression of SDF-1, KL and EPO did not changed obviously. [score:10]
We also confirmed the up-regulation of HIF-1α in primary BMSCs after ectopic expression of miR-17 upon interaction with CB CD34 [+] cells. [score:6]
MiR-17 (also called miR- 17- 5p), an important member of the miR-17-92 cluster [22], is expressed abundantly in hematopoietic progenitors and promotes hematopoietic cell expansion by targeting sequestosome 1 (sqstm1) regulated pathways in mice [23]. [score:6]
Consistent with this data, expression of miR-17 is detected in human CD34 [+] cells and is shown to be significantly down-regulated during in vitro differentiation toward mature megakaryocytes, monocytes and monocytopoiesis [17], [24]. [score:6]
It seemed that this special environment is vital for the up-regulation of HIF-1a caused by miR-17, because HIF-1α was not changed without the existence of CB CD34 [+] cells regardless of the level of miR-17 expression (Figure 4C ). [score:6]
MiR-17 Up-regulates HIF-1α Expression upon Interaction with CB CD34 [+] CellsTo explore the mechanisms by which miR-17 promotes the function of FBMOB-hTERT in supporting hematopoiesis thus causing a specific expansion of the erythroid lineage, we examined the production of hematopoietic supporting growth factors including the hypoxia-inducible transcription factor (HIF-1α), stromal cell-derived factor (SDF-1), stem cellfactor/c-kit ligand (SCF/KL) and erythropoietin (EPO) by 17/OE and CTRL cells during interaction with CB CD34 [+] cells. [score:6]
Conversely, deficient expression of miR-17 partly inhibited the hematopoietic supporting ability of FBMOB-hTERT. [score:5]
Conversely, deficient expression of miR-17 in FBMOB-hTERT suppressed CD34 [+]CD38 [−] cell expansion (CD34 [+]CD38 [−] cells: 13.27- versus 18.45-folds). [score:5]
HIF-1α Knock Down Partially Abrogate the Hematopoietic Supporting Ability of Osteoblastic miR-17 Since ectopic miR-17 in FBMOB-hTERT cells can significantly up-regulate HIF-1α upon interaction with CB CD34 [+] cells, we examined whether or not the hematopoietic supporting ability of osteoblastic miR-17 is dependent on the augmented HIF-1α activity in FBMOB-hTERT cells. [score:5]
The full-length human pre-miR-17 expression clone was inserted into the retroviral vector, yielding the expression constructs, pCMV- pre-miR-17 (17/OE). [score:5]
MiR-17 up-regulates HIF-1α expression upon interaction with CB CD34 [+] cells. [score:5]
MiR-17 is Endogenously Expressed in FBMOB-hTERT and Primary BMSCsTo test our hypothesis that osteoblastic miR-17 may influence hematopoiesis, we first determined the miR-17 expression level in the FBMOB-hTERT and primary bone marrow stromal cells (BMSCs). [score:5]
0070232.g004 Figure 4 MiR-17 up-regulates HIF-1α expression upon interaction with CB CD34 [+] cells. [score:5]
MiR-17 Up-regulates HIF-1α Expression upon Interaction with CB CD34 [+] Cells. [score:5]
Overall, by changing the expression of hematopoietic supporting factors, ectopic expression of miR-17 in osteoblastic cells may create a suitable niche for HSC expansion, in particular the specific expansion of the erythroid lineage. [score:5]
The higher expression of miR-17 in FBMOB-hTERT cells was of interest given that such an expression was likely to have hematopoietic functional consequences. [score:5]
Conversely, miR-17 knockdown in FBMOB-hTERT suppressed the hematopoietic supporting ability of FBMOB-hTERT, in particular the mature erythroid cell growth. [score:4]
The Function of osteoblastic miR-17 on Expansion of CB CD34 [+] CellsTo analyze the function of osteoblastic miR-17 on the expansion of HSCs and HPCs, the miR-17 overexpressing and knockdown mo dels were created using FBMOB-hTERT cells by using retroviral vectors. [score:4]
Since ectopic miR-17 in FBMOB-hTERT cells can significantly up-regulate HIF-1α upon interaction with CB CD34 [+] cells, we examined whether or not the hematopoietic supporting ability of osteoblastic miR-17 is dependent on the augmented HIF-1α activity in FBMOB-hTERT cells. [score:4]
B: Real-time RT-PCR was performed to evaluate the expression level of miR-17 in FBMOB-hTERT cells after retrovirally transduced with vectors for miR-17 overexpression (17/OE), miR-17 knockdown (17/KD or 17/KD1), or control (CTRL). [score:4]
HIF-1α expression is markedly enhanced in miR-17 overexpressed FBMOB-hTERT upon interaction with CB CD34 [+] cells compared to other niche associated factors. [score:4]
To analyze the function of osteoblastic miR-17 on the expansion of HSCs and HPCs, the miR-17 overexpressing and knockdown mo dels were created using FBMOB-hTERT cells by using retroviral vectors. [score:4]
The expression of HIF-1α was significantly enhanced in miR-17 overexpressed FBMOB-hTERT upon interaction with CB CD34 [+] cells compared with other niche associated factors such as KL, SDF-1 and EPO. [score:4]
Taguchi et al [30] suggested that HIF-1α was repressed by miR-17–92 only under a normoxic condition, whereas HIF-1α was robustly induced under hypoxia regardless of the level of miR-17–92 expression [30]. [score:3]
Although only a limited number of secondary recipients have been analyzed, these data suggest that the ability of FBMOB-hTERT to maintain the multipotency of CB CD34 [+] cells in vitro was partly promoted through miR-17 over -expression. [score:3]
E: Luciferase reporter assays to check whether miR-17 directly target HIF-1α in FBMOB-hTERT. [score:3]
The expression of miR-17 in FBMOB-hTERT cells. [score:3]
To test our hypothesis that osteoblastic miR-17 may influence hematopoiesis, we first determined the miR-17 expression level in the FBMOB-hTERT and primary bone marrow stromal cells (BMSCs). [score:3]
Our study demonstrated that, in addition to regulating the cellular constituents of HSCs and HPCs, miR-17 may also participate in the regulation of hematopoietic microenvironment and be involved in intercellular communications between HSCs and their niche cells. [score:3]
1.0×10 [4] CD34 [+] CB cells were co-cultured with FBMOB-hTERT cells after transduced with vectors for miR-17 overexpression (17/OE), miR-17 knockdown (17/KD), or control (CTRL) for 5-8 weeks and then subject to colony-forming-unit (CFU) assay. [score:3]
These data suggested that the different expressions of HIF-1a in different culture environments were caused by miR-17. [score:3]
Based on shRNA influence on miR-17 expression, 17/KD was chosen for further studies. [score:3]
One of the mechanisms is likely mediated by a variety of HSC-supporting growth factors, such as HIF-1α, which are constitutively activated by overexpressed miR-17 upon interaction with CB CD34 [+] cells. [score:3]
These results suggest that ectopic miR-17 in FBMOB-hTERT augmented the expression of niche associated genes during co-cultured with CB CD34 [+] cells, which may be responsible for the hematopoietic supporting ability of osteoblastic miR-17. [score:3]
The ectopic expression of miR-17 partly promoted the ability of FBMOB-hTERT to support human CB CD34 [+] cell expansion and maintain their self-renewal and multipotency. [score:3]
Using these cells, we found that miR-17 was significantly overexpressed. [score:3]
D. The transcripts of the niche associated genes were analyzed by real-time RT-PCR in bone marrow stromal cells (BMSCs) with over-expressed miR-17 and the control cells upon interaction with CB CD34 [+] cells. [score:3]
0070232.g001 Figure 1The expression of miR-17 in FBMOB-hTERT cells. [score:3]
B: Effect of miR-17 modulation in FBMOB-hTERT cells on repopulation of CB CD34 [+] cells in non-obese diabetic/severe combined immunodeficient disease (NOD/SCID) mice. [score:3]
Compared with primary BMSCs, FBMOB-hTERT expressed a significantly higher level of miR-17 (Figure 1A ). [score:2]
In summary, our data suggested the potential contribution of miR-17 in bone marrow stem cell niches and an osteoblastic- miR-17- HIF-1α-HSC crosstalk in hematopoietic development. [score:2]
More interestingly, the specific erythroid lineage expansion of CB CD34 [+] cells caused by osteoblastic miR-17 was abrogated by HIF-1α knock down. [score:2]
HIF-1α knockdown partially abrogates the hematopoietic supporting ability of osteoblastic miR-17. [score:2]
Using the immortalized clone with the characteristics of osteoblasts, FBMOB-hTERT, in vitro expansion, long-term culture initiating cell (LTC-IC) and non-obese diabetic/severe combined immunodeficient disease (NOD/SCID) mice repopulating cell (SRC) assay revealed that the ectopic expression of miR-17 partly promoted the ability of FBMOB-hTERT to support human cord blood (CB) CD34 [+] cell expansion and maintain their multipotency. [score:2]
Real-time RT-PCR assay showed that miR-17 is endogenously expressed in these cells. [score:2]
Collectively, these examples illustrate a more general role for the autocrine production of miR-17 as a regulator of critical pathways determining normal hematopoietic cell fate and differentiation. [score:2]
Knockdown of miR-17 in FBMOB-hTERT cells, on the other hand, resulted in reduced hematopoietic support, which was followed by diminishing CFU output. [score:2]
Defining the role of miR-17 in osteoblasts on hematopoiesis raises the possibility that miR-17 may play a key part in regulating the hematopoietic niche. [score:2]
HIF-1α Knock Down Partially Abrogate the Hematopoietic Supporting Ability of Osteoblastic miR-17. [score:2]
More interestingly, selective expansion of the erythroid lineage of CB CD34 [+] cells through osteoblastic miR-17 was abrogated by HIF-1α knock down, demonstrating that HIF-1α was, at least partly, a mediator of miR-17 -induced CB CD34 [+] cell expansion in FBMOB-hTERT. [score:2]
MiR-17 is Endogenously Expressed in FBMOB-hTERT and Primary BMSCs. [score:2]
While evidence is accumulating for a crucial role of intrinsic miR-17 in regulating HSCs and HPCs, whether miR-17 signaling pathways within the hematopoietic niche, especially in osteoblasts, are also necessary in the cell-extrinsic control of hematopoiesis has not yet been examined. [score:2]
Although only a limited number of secondary recipients have been analyzed, these data suggest that the specific erythroid lineage expansion of CB CD34 [+] cells caused by osteoblastic miR-17 was abrogated by HIF-1α knock down. [score:2]
It is interesting that the number of mature erythroid (CFU-Es) from the cells co-cultured with the CTRL for 7 or 8 weeks was significantly higher than that of the cells co-cultured with HIF1α/KD, which further suggested that the specific erythroid lineage expansion of CB CD34 [+] cells caused by osteoblastic miR-17 was abrogated by HIF-1α knock down. [score:2]
While evidence is accumulating for an important role of intrinsic miR-17 in regulating HSCs and HPCs, whether miR-17 signaling pathways are also necessary in the cell-extrinsic control of hematopoiesis hereto remains poorly understood. [score:2]
These results confirmed our in vitro data and demonstrated that the specific erythroid lineage expansion of CB CD34 [+] cells caused by osteoblastic miR-17 was abrogated by HIF-1α knock down. [score:2]
0070232.g005 Figure 5HIF-1α knockdown partially abrogates the hematopoietic supporting ability of osteoblastic miR-17. [score:2]
MiR-17 is also endogenously expressed in cord blood (CB) CD34 [+] cells (data not shown), which is consistent with the previous reports [16], [23]. [score:2]
These suggested that the hematopoietic supporting ability of osteoblastic miR-17 was partially abrogated by HIF-1α knock down. [score:2]
Increased EPO by miR-17 may be a feasible explanation for the inclination of 17/OE cells to support the growth of mature erythroid cells. [score:1]
A: The expression level of miR-17 in FBMOB-hTERT cells was evaluated by real-time RT-PCR. [score:1]
In summary, in addition to intracellular miR-17, our data raised the possibility that miR-17 was also necessary in the cell-extrinsic control of HSCs and HPCs function, which is, at least in part, through the augmented HIF-1α signal pathways. [score:1]
The effect of miR-17 modulation in FBMOB-hTERT cells on CB CD34 [+] cells. [score:1]
To explore the mechanisms by which miR-17 promotes the function of FBMOB-hTERT in supporting hematopoiesis thus causing a specific expansion of the erythroid lineage, we examined the production of hematopoietic supporting growth factors including the hypoxia-inducible transcription factor (HIF-1α), stromal cell-derived factor (SDF-1), stem cellfactor/c-kit ligand (SCF/KL) and erythropoietin (EPO) by 17/OE and CTRL cells during interaction with CB CD34 [+] cells. [score:1]
We further identified that HIF-1α is responsible for, at least in part, the promoted hematopoietic supporting ability of FBMOB-hTERT caused by miR-17. [score:1]
C: Effect of miR-17 modulation in FBMOB-hTERT cells on repopulation of CB CD34 [+] cells in secondary NOD/SCID mice. [score:1]
A: The effect of miR-17 modulation in FBMOB-hTERT cells on long-term culture initiating cells activity of CB CD34 [+] cells. [score:1]
0070232.g002 Figure 2The effect of miR-17 modulation in FBMOB-hTERT cells on CB CD34 [+] cells. [score:1]
The Function of osteoblastic miR-17 on Expansion of CB CD34 [+] Cells. [score:1]
The miR-17 levels in the FBMOB-hTERT cells transduced with the indicated virus were determined using real-time RT-PCR. [score:1]
It is of interest to note that osteoblastic miR-17 seemed to be more prone to support erythroid lineage expansion because the number of mature erythroid (CFU-E) from the cells co-cultured with miR-17 modulated FBMOB-hTERT for 7 weeks was significantly changed in comparison to the cells co-cultured with CTRL cells. [score:1]
All these suggested that the ectopic miR-17 signal pathway in FBMOB-hTERT cells may create a niche which can partly promote HSC and HPC expansion and is more suitable for erythroid progenitor differentiation, which subsequently leads to more mature erythroid cells. [score:1]
The data are presented as the ratio of miR-17 levels (relative to U6) in 17/OE, FBMOB-hTERT, 17/KD or 17/KD1 to that in CTRL. [score:1]
Interestingly, the number of mature erythroid (CFU-E) from the cells co-cultured with 17/OE cells for 7 or 8 weeks was significantly higher than that of the cells co-cultured with the CTRL, whereas only after co-cultured for 8 weeks, the number of total CFU-Mix’s from the cells co-cultured with 17/OE cells was significantly higher than that of the cells co-cultured with the CTRL, suggesting that ectopic miR-17 in FBMOB-hTERT preferentially supports a specific expansion of the erythroid lineage. [score:1]
Cloning of Human pre-miR-17 Gene, the Derivative Construction and Retroviral Infection. [score:1]
The data are presented as the ratio of miR-17 levels (relative to U6) in FBMOB-hTERT to that in bone marrow stromal cells (BMSCs). [score:1]
It also seemed that osteoblastic miR-17 is prone to cause a specific expansion of the erythroid lineage. [score:1]
These data suggested that the function of osteoblastic miR-17 on HSCs and HPCs was through, at least in part, the HIF-1α signaling pathway. [score:1]
0070232.g003 Figure 3Effect of miR-17 modulation on repopulation of CD34 [+] cells in primary and secondary NOD/SCID mice. [score:1]
These results suggest that miR-17 in FBMOB-hTERT cells can promote CD34 [+]CD38 [−] cell expansion in vitro. [score:1]
It is noted that ectopic miR-17 in FBMOB-hTERT preferentially supports a specific expansion of the erythroid lineage. [score:1]
Of great interest, our experiments on ex vivo expansion, LTC-IC and SRC in vivo assay revealed that selective expansion of the erythroid lineage of CB CD34 [+] cells through osteoblastic miR-17 was abrogated by HIF-1α knock down (Figure 5 ). [score:1]
Except for the environment, the intricate and finely tuned relationship between HIF-1α and miR-17 is also likely dependent on cellular context and appears to be promoter-independent in FBMOB-hTERT. [score:1]
These results partly confirmed our in vitro data and suggest that osteoblastic miR-17 partly promotes the ability of FBMOB-hTERT to maintain the multipotency of CB CD34 [+] cells in vitro. [score:1]
The two miR-17-specific small hairpin RNAs (17/KD and 17/KD1) and HIF-1α-specific shRNA (HIF1α/KD) oligomers [29] were tested. [score:1]
On the basis of our results and previous reports, we put forth the idea that different microenvironments lead to different effects of miR-17 and that mechanism is the key point of our further research. [score:1]
We further identified that HIF-1α is responsible for, at least in part, the promoted function of ectopic miR-17 in FBMOB-hTERT on hematopoiesis. [score:1]
Although the relationship between miR-17 and HIF-1α is dependent on the environment and cellular context, our data showed a functional link between HIF-1α and miR-17, which has also been demonstrated by other research groups [30], [40]. [score:1]
All these suggested that HIF-1α is, at least partly, a mediator of CB CD34 [+] cell expansion caused by miR-17 in FBMOB-hTERT cells. [score:1]
In addition, Jin et al [34] found that miR-17 modulated the diverse effect of canonical Wnt signaling in different microenvironments [34]. [score:1]
It also seemed that osteoblastic miR-17 was prone to cause a specific expansion of the erythroid lineage. [score:1]
It seems that the ability of miR-17 in FBMOB-hTERT to promote CB CD34 [+] cell expansion requires a significant amount of time. [score:1]
Further characterization of miR-17 and other miRNAs on this field will be particularly important, not only for a better understanding of the detailed mechanisms behind HSC self-renewal and lineage commitment, but also for developing novel and efficient molecular targets to prevent and treat hematopoietic disorders. [score:1]
Our data demonstrated that CB CD34 [+] cell expansion can be partly promoted by osteoblastic miR-17, and in particular, ectopic miR-17 can cause a specific expansion of the erythroid lineage through augmenting HIF-1α in osteoblasts. [score:1]
Effect of miR-17 modulation on repopulation of CD34 [+] cells in primary and secondary NOD/SCID mice. [score:1]
[1 to 20 of 95 sentences]
10
[+] score: 226
In agreement with Wang et al. [14] we found that Rb2 is likely a target of miR-17-5p, as its expression can be stimulated by miR-17-5p inhibition but inhibited by miR-17 overexpression. [score:11]
Briefly, HFD consumption may upregulate adipogenic differentiation via increasing the expression of miR-17-5p, which downregulates Tcf7l2 expression and the Wnt signalling cascade. [score:11]
[14] We show here that Rb2 expression was also stimulated by miR-17-5p inhibition (Supplementary Figure 5A) and inhibited by miR-17 overexpression (Supplementary Figure 5B). [score:9]
As the repressive effect of exogenous TCF7L2 over -expression on can be reversed by miR-17 over -expression, it is likely that β-cat/Tcf7l2 is not the solo target of miR-17-5p in facilitating adipogenic differentiation. [score:7]
In mouse primary hepatocytes, miR-17 over -expression and miR-17-5p inhibition also generated repressive and stimulatory effect on Tcf7l2 mRNA expression, respectively (Supplementary Figure 3). [score:7]
With our experimental settings, we demonstrated the stimulatory effect of curcumin on Tcf7l2 mRNA and protein expression and β-cat S675 phosphorylation, associated with reduced miR-17-5p level and increased expression of the Wnt target Axin2. [score:7]
[34] PPRA α over -expression, however, stimulated miR-17-5p expression, indicating the existence of complicated reciprocal regulation. [score:6]
We then assessed whether the repressive effect of TCF7L2 over -expression on can be reversed by miR-17 over -expression. [score:5]
To test the effect of miR-17-5p over -expression, a stable cell selection procedure with puromycin was utilized for either control vector or the miR-17 precursor expressing vehicle was included; as the DNA transfection efficiency in this cell line was relatively low (Figure 1g). [score:5]
Figures 1k and l show that miR-17 inhibition (K) and over -expression (L) generated opposite effects on mRNA levels of five genes that encode adipogenic differentiation markers, including aP2 (adipocyte fatty acid -binding protein), C/EBP α (CCAAT/enhancer -binding protein α), C/EBP β (CCAAT/enhancer -binding protein β), Cidea (cell death-inducing DFFA-like effector a) and PPAR γ (peroxisome proliferator-activated receptor γ). [score:5]
This inhibition protocol significantly reduced the miR-17-5p expression level (Supplementary Figure 2A). [score:5]
[10] Due to a technical issue we cannot eliminate the involvement of miR-17-3p in our over -expression experiment; the inhibitor utilized in this study, however, was specific for miR-17-5p. [score:5]
Repressed miR-17-5p expression in response to curcumin treatment was associated with increased Tcf7l2 expression at mRNA and protein levels in 3T3-L1 cells (Figures 5c and d). [score:5]
It is worth to mention here that recently, Li et al. reported that in human adipocyte-derived mesenchymal stem cells, BMP2 is a direct target of miR-17-5p and miR-106a, while BMP2 knockdown repressed osteogenesis but increased adipogenesis. [score:5]
A paradoxical observation in this study is that although the repression of curcumin on 3T3-L1 differentiation was associated with repressed miR-17-5p expression and increased Tcf7l2 expression, basal Tcf7l2 level in the absence of curcumin treatment was not reduced after the differentiation. [score:5]
8, 22, 23, 24, 25 It should be emphasized here that curcumin can regulate many cellular events while miR-17-5p may have numerous downstream targets. [score:4]
We then directly tested the effect of miR-17-5p on Tcf7l2 expression in undifferentiated 3T3-L1 cells. [score:4]
Tcf7l2 is likely a direct downstream target of miR-17-5p. [score:4]
It is worth to mention that Rb2 is a previously identified target of the miR-17/92 cluster. [score:3]
Before doing so, we tested the effect of curcumin on miR-17-5p and Tcf7l2 expression in undifferentiated 3T3-L1 cells. [score:3]
Western blotting was then performed in undifferentiated 3T3-L1 cells with miR-17 over -expression or miR-17-5p repression. [score:3]
Furthermore, for each of the experiments with miR-17 over -expression, the elevation of miR-17-5p was confirmed by qRT-PCR. [score:3]
The generation of Ad-TCF7L2, Ad-TCF7L2DN and miR-17 over -expression plasmid has been previously presented. [score:3]
Repressed miR-17-5p (Figure 6a) or its precursor (Figure 6b) expression in response to curcumin treatment was appreciable at days 3 and 5 at both dosages. [score:3]
Figure 1e shows the result of our semi-quantitative analyses of ORO staining, and Figure 1f shows that miR-17 inhibition reduced the triglyceride level in differentiated 3T3-L1 cells. [score:3]
7, 8 Based on a recent study that miR-17-5p repressed another TCF member TCF7L1 in another cell lineage [13] and a previous investigation that miR-17/92 cluster over -expression stimulated, [14] we tested our hypotheses that miR-17-5p positively regulates adipogenesis via negatively regulating TCF7L2, and that curcumin can restore the Wnt activity and hence represses adipogenesis. [score:3]
How curcumin represses miR-17-5p expression remains to be explored. [score:3]
miR-17 inhibitor was the product of Shanghai GenePharma Co, Ltd (Shanghai, China). [score:3]
Figure 4g shows the correspondent alterations on adipogenic gene expression in 3T3-L1 cells infected with the control virus, or Ad-TCF7L2, or Ad-TCF7L2 and miR-17. [score:3]
In addition, the stimulatory effect of HFD on miR-17-5p expression was not observed in mouse liver (Supplementary Figures 1A–B). [score:3]
The stimulatory effect of miR-17 over -expression on miR-17-5p and its repressive effect on endogenous Tcf7l2 mRNA level were shown in Figures 4b and c, while Figure 4d shows the detection of exogenous TCF7L2 (80 kDa) and endogenous Tcf7L2 (78 and 58 kDa) in cells infected with the control virus, or Ad-TCF7L2, or Ad-TCF7L2 and miR-17 lentivirus. [score:3]
Figures 1h and i show that differentiated 3T3-L1 cells with miR-17 over -expression exhibited elevated ORO staining, comparing with cells transfected with the same amount of the control vector and underwent the same stable-cell selection procedure. [score:3]
A PPAR response element was located within the promoter region of the miR-17/92 cluster and we found previously that in the liver, PPAR α is a miR-17-5p target. [score:3]
We then tested the effect of miR-17-5p inhibition on (Figure 1c). [score:3]
These observations collectively indicate that miR-17-5p inhibition repressed. [score:3]
The repressive effect of Ad-TCF7L2 infection can be attenuated by miR-17 over -expression. [score:3]
Nevertheless, mouse visceral adipose tissue expression of miR-17-5p, but not the other cluster members, was shown to be stimulated by HFD feeding. [score:3]
miR-17 over -expression reduced the levels of the two major Tcf7l2 isoforms (78 and 58 kDa) (Figure 2g). [score:3]
miR-17 or its inhibitor transfection were performed with Lipofectamine. [score:3]
Figure 1j shows that miR-17 over -expression increased the cellular triglyceride level in differentiated 3T3-L1 cells. [score:3]
[41] It remains to be determined whether miR-17-5p plays a role in human adipogenesis, involving TCF7L2 expression and alternative splicing. [score:3]
[31] Wang et al. found that over -expression of the whole miR-17/92 cluster in 3T3-L1 cells accelerated their adipogenic differentiation, and their mechanistic exploration implicated Rb2 repression. [score:3]
As shown in Figures 1a and b, 12-week HFD feeding significantly increased the expression level of miR-17-5p, but not the other cluster members. [score:3]
Luciferase-reporter constructs were generated for testing whether this motif potentially affect miR-17-5p -mediated gene expression. [score:3]
HFD feeding also did not affect expression of other members of the miR-17/92 cluster in the mouse liver (Supplementary Figure 1C). [score:3]
miR-17-5p inhibition, however, generated the opposite effect (Figure 2h). [score:3]
The inhibition of miR-17-5p, however, resulted in a significant increase on Tcf7l2 mRNA level (Figures 2c and d). [score:3]
As shown in Figures 4e and f, the repressive effect of TCF7L2 on adipogenic differentiation was blocked with miR-17 over -expression. [score:3]
miR-17-5p positively regulates. [score:2]
We found that miR-17-5p promotes chemotherapeutic drug resistance and colon cancer metastasis, and that fatty liver development induced by dexamethasone injection in mice can be attenuated by reducing miR-17-5p levels. [score:2]
[34] miR-17 precursor can produce two functional regulatory microRNAs, miR-17-5p and miR-17-3p. [score:2]
We hence suggest that miR-17-5p positively regulates 3T3-L1 differentiation. [score:2]
Curcumin represses, associated with miR-17-5p repression and Tcf7l2 stimulation. [score:1]
A previous study demonstrated that the transfection of the whole miR-17/92 cluster accelerated. [score:1]
The miR-17 vehicle transfection increased miR-17-5p levels (Figure 2a), associated with reduced Tcf7l2 mRNA levels (Figure 2b). [score:1]
It is also necessary to point out that in response to HFD feeding, increased miR-17-5p level was observed in the white adipose tissue but not in the liver, although pathological effects of miR-17-5p in the liver have been documented. [score:1]
Further investigations are needed to determine how the repression of Tcf7l2, Rb2 and other miR-17-5p targets collectively contribute to the facilitation of adipogenesis in response to miR-17-5p elevation. [score:1]
[14] Here we located the stimulatory effect of this cluster to its first member miR-17, although we cannot eliminate the involvement of other members. [score:1]
34, 35 Recently, Jacovetti et al demonstrated that microRNAs including miR-17-5p and miR-181b play a central role in postnatal β-cell maturation. [score:1]
In addition, when rat mature adipocytes were treated with curcumin for 6 h, miR-17-5p level was also significantly repressed, associated with increased Tcf7l2 protein levels (Supplementary Figure 4). [score:1]
Curcumin, however, can reduce the miR-17-5p level, releasing its repression on Tcf7l2. [score:1]
A potential miR-17-5p binding motif was located within the mouse Tcf7l2 3'UTR (Figure 2i). [score:1]
Nevertheless, the above observations are consistent with our finding that miR-17-5p stimulates adipogenic differentiation. [score:1]
Supplementary Figure 2B shows the elevation of miR-17 level in 3T3-L1 cells after the miR-17 vehicle transfection. [score:1]
As shown in Figures 5a and b, curcumin treatment (2 μM or 10 μM for 6 h) repressed miR-17-5p precursor or mature miR-17-5p levels. [score:1]
For this purpose, 3T3-L1 cells were infected by either the control virus, or Ad-TCF7L2, or Ad-TCF7L2 and the miR-17 lentivirus (Figure 4a). [score:1]
16, 47, 48 miR-17 lentivirus construct was generated by inserting two copies of miR-17 precursor into the plv vector (Biosettia, CA, USA). [score:1]
In summary, our current study revealed the positive effect of miR-17-5p on white adipocyte differentiation. [score:1]
Here we focussed on miR-17-5p as its metabolic role has been demonstrated in several previous studies. [score:1]
34, 35 Thus, if miR-17-5p is a central switch in response to HFD consumption, adipose tissue could be a more sensitive organ. [score:1]
[1 to 20 of 70 sentences]
11
[+] score: 215
More recently though, studies have shown more varied effects of miR-17-3p, such as involvement in development and spinal progenitor cells [70], induction by TNF alpha and LPS in HeLa cells [71], downregulating flk-1 in endothelial cells [72], suppressing epithelial to mesenchymal transformation of ovarian epithelial cells [73], inhibiting fibroblast senescence [74] and being downregulated in the plasma of Alzheimer patients [75]. [score:12]
It is interesting to note that downregulation of c-Myc suppresses pri-miR-17/92 cluster expression [77] and that c-Myc is downregulated by peroxiredoxin 1, which is involved under oxidative stress [78]. [score:11]
Transfection with miR-17-3p mimic further increased this value to 58.9% and 51.8%, respectively (Fig 4A and 4B), whereas transfection with miR-17-3p inhibitor but not scrambled inhibitor was able to reverse H [2]O [2] and TBH toxicity (37.7% and 31.5% of cell death by co-transfection with inhibitor in the H [2]O [2] and TBH treated groups, respectively). [score:7]
miR-17-3p mimic (Cat#4464066, Life technologies), antisense miR-17-3p mimic (inhibitor, Cat#4464084, Life technologies), scrambled mimic (sc -mimic, Cat#4464058, Life technologies), and scrambled inhibitor (sc -inhibitor, Cat#4464076, Life technologies) were transfected into ARPE-19 cells with Lipofectamine® RNAiMAX (Cat#13778030, Invitrogen, Carlsbad, CA) according to the manufacturer’s manual, respectively. [score:7]
Since miR-17-3p was shown to cause cell death in ARPE-19 cells, and its expression was upregulated under oxidative stress, we speculated that miR-17-3p could potentially augment RPE cell death under oxidative stress. [score:6]
It also shows that miR-17-3p expression is increased by oxidative stimuli and that it has detrimental effects on RPE antioxidant defense mechanisms by downregulating the anti-oxidant enzymes MnSOD and TrxR [2]. [score:6]
miR-17-3p reduced the expression of MnSOD and TxR [2] in ARPE-19 cells under oxidative stressTo explore the potential targets of miR-17-3p, which are responsible for the increased vulnerability under oxidative stress, we performed a bioinformatics sequence analysis and found that two antioxidant enzymes, MnSOD and TrxR [2], possess binding sites of miR-17-3p at the 3’untranslated regions (3’ UTR) of mRNA (Fig 5A), which is validated by Xu et al. using luciferase assay [48]. [score:6]
Furthermore, the expression level of miR-17-3p increases under oxidative stress, and it increases ARPE-19 vulnerability to oxidative stress by downregulating the mitochondrial antioxidant enzymes MnSOD and TrxR [2]. [score:6]
Due to increased miR-17-3p levels in AMD eyes in combination with the fact that miR-17-3p can specifically downregulate MnSOD and TrxR [2] expression, its role as a mediator for RPE susceptibility to oxidative stress in AMD should not be overlooked. [score:6]
2013.2032 74 Du WW, Li X, Li T, Li H, Khorshidi A, Liu F, et al The microRNA miR-17-3p inhibits mouse cardiac fibroblast senescence by targeting Par4. [score:5]
0160887.g002 Fig 2(A) ARPE-19 cells were transfected with miR-17-3p mimic (mimic), scrambled miR-17-3p mimic (sc -mimic), miR-17-3p antisense (inhibitor) or scrambled miR-17-3p antisense (sc -inhibitor) as indicated for 72 hours. [score:5]
Mir-17* suppresses tumorigenicity of prostate cancer by inhibiting mitochondrial antioxidant enzymes. [score:4]
More relevant to our work, it has been shown that miR-17-3p downregulates important anti-oxidant enzymes, such as manganese superoxide dismutase, glutathione peroxidase-2 and thioredoxin reductase-2 (TrxR [2]) in prostate cancer cell lines [48] and blood mononuclear cells [76]. [score:4]
Our current study shows that miR-17-3p not only is upregulated in the RPE cells of AMD patients, but it also increases vulnerability to oxidative stress in vitro and causes ARPE-19 death itself, suggesting that miR-17-3p may be contributing to the reduced RPE viability caused by oxidative stress in AMD patients. [score:4]
To explore the potential targets of miR-17-3p, which are responsible for the increased vulnerability under oxidative stress, we performed a bioinformatics sequence analysis and found that two antioxidant enzymes, MnSOD and TrxR [2], possess binding sites of miR-17-3p at the 3’untranslated regions (3’ UTR) of mRNA (Fig 5A), which is validated by Xu et al. using luciferase assay [48]. [score:4]
Furthermore, antisense-miR-17-3p was able to reverse MnSOD and TrxR [2] downregulations to 78.7% and 81.0%, respectively (Fig 5B and 5C). [score:4]
This correlates with our findings, as cell viability was reduced with miR-17-3p mimic transfection under oxidative stress, in parallel with MnSOD and TrxR [2] downregulation. [score:4]
miR-17-3p mimic sequence transfection caused significant reduction in cell viability (63.7%) compared to scrambled sequence (95.4%), and this effect was partially reversed by co-transfection with miR-17-3p-specific inhibitor (87.5%), but not a scrambled inhibitor (Fig 2A). [score:4]
Due to the fact that miR-17-3p was upregulated in macular RPE cells from AMD patients, we hypothesized that it may be implicated in AMD pathogenesis. [score:4]
0160887.g005 Fig 5Effect of miR-17-3p on MnSOD and TrxR [2] expression levels under oxidative stress in ARPE-19 cells. [score:3]
Therefore, inhibition of miR-17-3p could be a novel therapeutic approach to protect RPE cells from oxidative stress. [score:3]
Determination of miR-17-3p expression level. [score:3]
This effect can be abolished by the inhibitor of miR-17-3p. [score:3]
This cytotoxic effect can be partially reversed by the inhibitor of miR-17-3p. [score:3]
Although most of the work regarding miR17-3p has focused on regulation of cell proliferation pathways, a study using prostate cancer cell lines demonstrated that miR-17-3p is also involved in regulating antioxidant enzymes [48]. [score:3]
To confirm the previous studies, our bioinformatic sequence analysis found that there is a putative binding site for the miR-17-3p in the mRNA 3’untranslated regions of MnSOD and TrxR [2] (Fig 5A) that is verified by in vitro experiments (Fig 5B and 5C). [score:3]
Fig 1 illustrates that miR-17-3p was significantly upregulated (p<0.05) in macular RPE cells from AMD donor eyes compared to controls (1.4-fold). [score:3]
miR-17-3p expression levels were determined by qRT-PCR in both H [2]O [2] (A) and TBH (B) treated group. [score:3]
It suggests that increased miR-17-3p expression may be associated with AMD. [score:3]
0160887.g004 Fig 4. ARPE-19 cells were transfected with miR-17-3p (mimic) or miR-17-3p antisense (inhibitor, INH) as indicated for 72 hours, and then treated with (A) H [2]O [2] (100μM) or (B) TBH (75μM) for 9 hours. [score:3]
Effect of miR-17-3p on MnSOD and TrxR [2] expression levels under oxidative stress in ARPE-19 cells. [score:3]
Evidence stemming from prior studies in prostate cancer cells as well as from our bioinformatic analysis suggests that antioxidant enzymes MnSOD and TrxR [2] act as targets of miR-17-3p [48]. [score:3]
Expression of miR-17-3p in ARPE-19 cells under increasing amounts of oxidative stress. [score:3]
Moreover, transfection with miR-17-3p antisense (INH) alone but not scrambled inhibitor (sc-INH) alone was able to partially reverse H [2]O [2] or TBH toxicity (Fig 4). [score:3]
Expression levels of miR-17-3p in macular RPE cells from AMD and age-matched normal control donor eyes were analyzed by qRT-PCR. [score:3]
In conclusion, this study demonstrates increased miR-17-3p expression in human AMD eyes. [score:3]
miR-17-3p expression increases in macular RPE cells from AMD patients. [score:3]
0160887.g001 Fig 1Expression levels of miR-17-3p in macular RPE cells from AMD and age-matched normal control donor eyes were analyzed by qRT-PCR. [score:3]
ARPE-19 cells were transfected with miR-17-3p (mimic) or miR-17-3p antisense (inhibitor, INH) as indicated for 72 hours, and then treated with (A) H [2]O [2] (100μM) or (B) TBH (75μM) for 9 hours. [score:3]
However, doses higher than 100μM of H [2]O [2] and 75μM of TBH failed to increase miR-17-3p expression, most likely due to cytotoxicity. [score:3]
Differential miR-17-3p expression in macular RPE cells from AMD patients and normal controls. [score:3]
miR-17-3p reduced the expression of MnSOD and TxR [2] in ARPE-19 cells under oxidative stress. [score:3]
Increased expression of miR-17-3p in ARPE-19 under oxidative stress. [score:3]
miR-17-3p expression level was analyzed by qRT-PCR. [score:3]
ARPE-19 cells were differentially transfected with miR-17-3p (mimic) or co -transfected with miR-17-3p antisense (inhibitor) for 72 hours, and then treated with H [2]O [2] (100μM) or TBH (75μM) for 9 hours. [score:3]
These results indicate that miR-17-3p can be up regulated in ARPE-19 cells in the presence of oxidizing stimuli. [score:2]
Most of the work on miR17-3p has thus been focused on studying the regulation of cell proliferation pathways. [score:2]
miR-17-3p mimic transfection reduced MnSOD and TrxR [2] protein expression levels to 39.6% and 56.9% respectively compared to a transfection control. [score:2]
Collectively, these results demonstrate that miR-17-3p is a negative regulator of two important antioxidant enzymes in ARPE-19 cells. [score:2]
Meanwhile, treatment with a similar oxidant stimulus, TBH, exhibited an analogous increase of miR-17-3p expression ranging from 1.2- to 2-fold compared with the untreated control (Fig 3B). [score:2]
The mimic sequence transfection reduced cell viability compared to scrambled sequence (sc -mimic); however, decreased cell viability was reversed by co-transfection with miR-17-3p inhibitor. [score:2]
The mechanism by which oxidative stress regulates miR-17-3p levels remains elusive. [score:2]
Moreover, the ratio of TUNEL -positive cells/total cells in the miR-17-3p transfected group was 30.5% higher compared to the scrambled sequence group, while co-transfection with the inhibitor abrogated miR-17-3p cell death (Fig 2B and 2C). [score:2]
Furthermore, a miR-30b antagonist protected RPE cells from oxidative stress, concurring with our findings after using miR-17-3p. [score:1]
Since oxidative stress has been linked to RPE senescence and AMD [50], we sought to evaluate miR-17-3p expression in RPE cells under oxidative stress. [score:1]
miR-17-3p is a member of miR-17/92 cluster, originally found to be involved in tumorigenesis, but more recently, members of this cluster have been shown to be involved in many aging disorders [47]. [score:1]
miR-17-3p causes ARPE-19 cell death. [score:1]
miR-17-3p is a member of miR-17/92 cluster which is extensively studied in tumorigenesis [69]. [score:1]
In this study, we aim to explore the role of miR-17-3p in ARPE-19 cell viability and antioxidant enzyme production under oxidative stress, a major factor in AMD pathogenesis. [score:1]
These data suggest that miR-17-3p can increase ARPE-19 cell vulnerability to oxidative stress and miR-17-3p antisense plays a protective role under oxidative stress. [score:1]
miR-17-3p increases vulnerability of RPE cells to oxidative stress. [score:1]
Effect of miR-17-3p on ARPE-19 cell viability. [score:1]
A microarray assay previously performed by our group showed that miR-17-3p expression level increases in macular RPE cells of AMD patients’ donor eyes compared to age-matched normal control donor eyes. [score:1]
These results indicate that miR-17-3p induces ARPE-19 cell death. [score:1]
We found that miR-17-3p was elevated in ARPE-19 cells after treatment with increasing concentrations of oxidizing reagents H [2]O [2] and TBH. [score:1]
[1 to 20 of 65 sentences]
12
[+] score: 202
Stable ectopic expression of RUNX1-MTG8, CBFB-MYH11, or miR-17 in U937 cells (a representative U937 clone is shown for each construct) leads to downregulation of miR-193a, a RUNX1-regulated miRNA targeting KIT (left), and miR-27a, a RUNX1-regulated miRNA involved in myeloid differentiation (right). [score:10]
Additional miRNAs regulated by RUNX1 showing upregulation in non-CBF-AML (A) In addition to miR-17, Targetscan analysis identifies several other miRNAs targeting RUNX1-3′UTR. [score:9]
By examining published miRNA expression datasets from AML patients [24, 25], we observed that miR-17 is upregulated in approximately 60% of non-CBF-AML cases, while it is mostly downregulated in CBF-AML cases (Additional file 1: Figure S1B, top). [score:9]
For instance, in silico analysis of published miRNA expression datasets allowed us to highlight several miRNAs that could potentially target RUNX1-3′UTR and that, like miR-17, are upregulated in non-CBF-AML. [score:8]
Evidence of concomitant upregulation of KIT and miR-17 in non-CBF-AML (A) Scheme showing the putative miRNA-target sites in the RUNX1-3′UTR, as predicted by TargetScan analysis. [score:8]
In the first part of this study, we show that ectopic expression of miR-17, which controls RUNX1 level by targeting RUNX1-3′UTR [22], in human U937 cells leads to deregulation of a core RUNX1-regulated miRNA mechanism that is similarly affected by the t(8;21) RUNX1-MTG8 and inv(16) CBFB-MYH11 fusion proteins. [score:7]
In the first part of this study we show that KIT expression can be also upregulated by miR-17, a regulator of RUNX1, the gene encoding a CBF subunit. [score:7]
Stable expression of miR-17 downregulates RUNX1-regulated miRNAs of myeloid differentiation. [score:7]
Human (U937) or mouse (32D) myeloid clonal lines were used, respectively, to test: 1) the effect of RUNX1-MTG8 and CBFB-MYH11 fusion proteins, or upregulation of miR-17, on KIT -induced proliferation and myeloid differentiation, and 2) the effect of upregulation of KIT -induced proliferation per se on myeloid cell differentiation. [score:7]
Of note, both miR-17 and CBF-AML fusion proteins can affect other RUNX1-regulated miRNAs targeting KIT-3′UTR (see TargetScan analysis in Additional file 3: Table S2). [score:6]
In the case of miR-17 overexpression, which is mainly associated with the M5 FAB subtype, the phenotype could be due to deregulation of other miR-17 targets, besides RUNX1. [score:6]
Among these, we focused on miR-17-5p (hereafter simply referred to as miR-17), a miRNA that targets RUNX1-3′UTR, plays a key role in RUNX1 -mediated control of myeloid differentiation [22], and is often upregulated in leukemia [24]. [score:6]
Based on these preliminary observations, we set out to assess the effects of stable ectopic miR-17 expression in U937 cells on both miR-221 and KIT expression. [score:5]
Samples were analyzed for KIT (CD117) expression by flow cytometry and for miR-17 expression by qRT-PCR. [score:5]
Consistently, the U937 [miR-17], U937 [RUNX1-MTG8] and U937 [CBFB-MYH11] clones also displayed significant downregulation of RUNX1-regulated miRNAs involved in myeloid differentiation, such as miR-223 (Figure  3C) and miR-27a (Additional file 1: Figure S2, right) [13, 26]. [score:5]
Interestingly, miR-17 upregulation is mostly associated with the FAB M5 subtype (Additional file 1: Figure S1B, bottom), which is frequently characterized by KIT upregulation [18]. [score:5]
Additional miRNAs regulated by RUNX1 and deregulated by ectopic expression of CBF-AML fusion proteins or miR-17. [score:5]
DNA sequencing of RUNX1 exons excluded the presence of mutations in those samples showing upregulation of both KIT and miR-17. [score:5]
In this study we focused on miR-17, a miRNA that, by targeting RUNX1-3′UTR, plays a key role in the control of RUNX1 expression and myeloid differentiation [22]. [score:5]
Altogether, these findings show that ectopic miR-17 expression deregulates the same RUNX1-miR-221-KIT axis, which is also deregulated by CBF-AML fusion proteins (Figure  2G). [score:5]
Consistent with these observations, we found evidence of concomitant KIT (CD117) and miR-17 upregulation in three out of 10 non-CBF-AML patient samples analyzed in our laboratories (Additional file 1: Figure S1C). [score:4]
Figure 2 Stable expression of miR-17 deregulates the same core RUNX1-miR221-KIT axis affected by CBF-AML fusion proteins. [score:4]
Stable expression of miR-17 deregulates the same core RUNX1-miR-221-KIT axis affected by CBF-AML fusion proteins. [score:4]
For instance, as shown in Additional file 1: Figure S2, left, miR-193a is significantly downregulated in U937 [miR-17], U937 [RUNX1-MTG8], and U937 [CBFB-MYH11] clones. [score:4]
Notably, acute myeloid leukemia with t(8;21), inv(16), or upregulation of miR-17 fall into FAB subtypes with distinct phenotypic features. [score:4]
In the first part of this study we found that stable miR-17 upregulation affects, like the CBF-AML fusion proteins (RUNX1-MTG8 or CBFB-MYH11), a core RUNX1-miRNA mechanism leading to KIT -induced proliferation of differentiation-arrested U937 myeloid cells. [score:4]
The expression of miR-17, miR-18a, miR-20a, miR-93, and miR-181 in was evaluated from published gene expression datasets [24, 25]. [score:3]
Interestingly, both CBF leukemia fusion proteins and miR-17, which targets RUNX1-3′UTR, negatively affect a common core RUNX1-miRNA mechanism that forces myeloid cells into an undifferentiated, KIT -induced, proliferating state. [score:3]
Apparently, in the U937 cell context miR-17 ectopic expression significantly reduced miR-221 level, thus recapitulating the effect of RUNX1-MTG8 and CBFB-MYH11 (Figure  2D, left). [score:3]
Cytofluorimetric analysis shows GFP expression in representative U937 [miR-17] and U937 [Scram] clones (right). [score:3]
To develop U937 clones stably expressing ectopic miR-17 or cognate control clones, cells were transfected with pEZX-MR04 plasmid (GeneCopoeia, Rockville, MD) containing either the miR-17 precursor or a scrambled sequence, respectively. [score:3]
Shown here one representative clone out of 3 clones stably expressing RUNX1-MTG8, CBFB-MYH11, or miR-17. [score:3]
Clones with decreased luciferase expression (a prototypic clone out of three is shown in Figure  2B, bottom) were bona fide miR-17 -positive clones. [score:3]
We found that the effects of ectopic miR-17 expression mimic the biological effects induced by the RUNX1-MTG8 and CBFB-MYH11 fusion proteins by affecting the same core mechanism: the RUNX1-miR-221-KIT axis and miR-223. [score:3]
Next, we selected stable U937 [miR-17] and U937 [Scram] clones positive for GFP expression (Figure  2A, right) and transfected them with a Luc-RUNX1-3′UTR reporter carrying the luciferase sequence upstream of RUNX1-3′UTR (Figure  2B, top). [score:3]
To this end, we stably transfected U937 cells with a plasmid co -expressing a GFP tracking insert adjacent to either the miR-17 precursor or a scrambled control sequence (Figure  2A, left). [score:3]
Notably, miR-17 is only one of many miRNAs targeting RUNX1-3′UTR (Additional file 2: Table S1). [score:3]
Stable ectopic expression of wild type KIT in the U937 context (U937 [KIT]) at a level comparable (5-10%) to the one detected in U937 [miR-17], U937 [RUNX1-MTG8], and U937 [CBFB-MYH11] clones (Figure  2F, left) was per se sufficient to increase EdU-proliferation (Figure  2F, right). [score:3]
Scheme showing that miR-17 and the RUNX1-MTG8 and CBFB-MYH11 fusion proteins interfere with the same core RUNX1-miRNA mechanism that regulates KIT -mediated proliferation and myeloid differentiation. [score:2]
In addition to CBF-AML fusion proteins and miR-17, other factors could deregulate RUNX1 function or level. [score:2]
The overall findings of the first part of this study (schematically summarized in Figure  4) let us conclude that miR-17 deregulates a core RUNX1-miRNA mechanism of CBF-AML pathogenesis, since it recapitulates the same effects of both RUNX1-MTG8 and CBFB-MYH11 fusion proteins. [score:2]
Figure 4 MiR-17 deregulates a core RUNX1-miRNA mechanism of CBF-AML pathogenesis. [score:2]
Specifically, 52 non-CBF-AML and 31 CBF-AML were analyzed for miR-17, 31 non-CBF-AML and 18 CBF-AML were analyzed for miR-18a, 53 non-CBF-AML and 34 CBF-AML were analyzed for miR-20a, 34 non-CBF-AML and 18 CBF-AML were analyzed for miR-93 and miR-181. [score:1]
U937 [miR-17] clones (Figure  3A, right), similar to U937 [RUNX1-MTG8] and U937 [CBFB-MYH11] clones (Figure  3B, middle and right), displayed a decrease of CD11b -positive cells in response to PMA, thus indicating myeloid differentiation arrest. [score:1]
On the one hand, miRNAs (e. g. miR-17) can mimic the effects of CBF-AML fusion proteins by affecting a core RUNX1-miRNA mechanism of KIT -induced proliferation of undifferentiated myeloid cells. [score:1]
U937 [miR-17] clones showed a higher proportion of KIT (CD117) -positive cells (Figure  2C, left) as well as increased EdU-proliferation (Figure  2C, right) relative to control U937 [Scram] clones. [score:1]
[1 to 20 of 46 sentences]
13
[+] score: 195
Fontana et al. reported that in therapy-resistant neuroblastoma, an increased miR-17-5p expression causes the downregulation of p21 and the tumor suppressor gene Bcl-2-interacting mediator (BIM) of cell death, which could be antagonized by miR-17-5p AS ODN, representing a novel oncogenic pathway to explain neuroblastoma progression and its resistance to therapy [25]. [score:8]
To confirm the association of c-Myc with the miR-17 family and p21, Wang et al. antagonized the expression of each miR-17 family member with a specific AS ODN in transfectants constitutively overexpressing c-Myc, in the presence of c-Myc, and showed that this treatment strongly restored p21 expression. [score:7]
Quantitative results of the apoptosis array revealed that miR-17-5p downregulated the expression of p21, p53, TNF RI, and FADD. [score:6]
In the present work, miR-17-5p downregulated the expression of p21, p-p53 (phosphorylated at S15, S46, and S392), TNF RI, and FADD, which might play roles in the radiosensitivity of irradiated tumor cells. [score:6]
However, miR-17-5p upregulated the expressions of cIAP-1, HIF-1α, and TRAIL R1. [score:6]
MicroRNA-17-5p -downregulated the apoptotic proteins of p21, p53, TNF RI, and FADD, and upregulated the apoptotic proteins of cIAP-1, HIF-1α, and TRAIL R1 in irradiated OC3 cells. [score:6]
Our study also revealed that miR-17-5p upregulates the expression of TRAIL R1, which might confer higher resistance to RT in betel nut chewing-related oral cancer. [score:6]
MiR-17-5p -downregulated (left panel) or -upregulated (right panel) proteins are indicated. [score:6]
We demonstrated that miR-17-5p decreased the expression of the cyclin -dependent kinase inhibitor p21 in the OC3 cells following irradiation. [score:5]
The results revealed that irradiation -induced miR-17-5p expression was significantly inhibited by miR-17-5p AS ODN but not by control ODN in irradiated OC3 cells. [score:5]
A. The OC3 cells without or with a p53 -overexpressing clone or p53 over -expression clone that treated with miR-17-5p AS ODN were irradiated with 5 Gy; after 48 h, the cell cycle was determined through propidium iodide staining and flow cytometry. [score:5]
Furthermore, the inhibition effect of miR-17-5p AS ODN on irradiation -induced miR-17-5p expression in the OC3 cells was verified through real-time PCR (Figure 1A). [score:5]
We showed that irradiation induced miR-17-5p expression and played a role in suppressing apoptosis. [score:5]
Our previous study revealed that miR-17-5p, a miR-17-92 polycistronic miR, is enhanced in the irradiated OC3 cancer cell line, and miR-17-5p was also observed to inhibit the downstream p21 expression and reduce radiosensitivity [16]. [score:5]
That study also revealed that translation inhibition mediated by the miR-17/Oncomir-1 miR polycistron is associated with an apoptotic response. [score:5]
Figure 4 A. The OC3 cells without or with a p53 -overexpressing clone or p53 over -expression clone that treated with miR-17-5p AS ODN were irradiated with 5 Gy; after 48 h, the cell cycle was determined through propidium iodide staining and flow cytometry. [score:5]
Furthermore, the stable overexpression of c-Myc elevated the expression of some members of the miR-17 family and of their primary transcripts. [score:5]
Wang et al. studied the mechanism underlying p21 suppression by the miR-17 family and observed that c-Myc expression was associated with miR-17 family members. [score:5]
Because miR-17-5p downregulated p-p53 (phosphorylated at S15, S46, and S392) in the OC3 cells, we further determined the effect of p53 on irradiated OC3 cells. [score:4]
The results revealed that the miR-17-5p -induced downregulation of p53 plays a critical role in OC3 radiosensitivity. [score:4]
The results revealed that the effect of miR-17-5p on the expression of p53 contributed to the modulation of the radiosensitivity of irradiated OC3 cells. [score:3]
MicroRNA-17-5p-regulated apoptosis-related protein expression in irradiated OC3 cells. [score:3]
These results suggest that c-Myc further repressed p21 expression at the post-transcriptional level in some members of the miR-17 family [45]. [score:3]
Moreover, we found that the effects of the miR-17-5p AS ODN on OC3 cells potentially reduced the expression of these radio-resistant proteins to overcome therapeutic resistance. [score:3]
Thus, we could use miR-17-5p AS ODN for multiple targets to enhance therapeutic effects. [score:3]
MiR-19, which is a component of the miR-17/Oncomir-1 miR polycistron, interferes with the expression of the antiapoptotic Ras homolog B (rhoB). [score:3]
A. Six hours later, the expression of miR-17-5p was determined through real-time PCR. [score:3]
MiR-17-5p-regulated protein expressions in OC3 cells. [score:3]
The expression level of miR-17-5p was 5.34 ± 0.51 folds in the control ODN group and 1.3 ± 0.2 folds in the miR-17-5p AS ODN group (P < 0.05). [score:3]
Our data might be the first to reveal that a high cIAP1 expression stimulated by miR-17-5p results in radiation resistance. [score:3]
Therefore, we examined radiation -induced changes in miR-17 expression and its function in oral carcinoma 3 (OC3) cells, an oral carcinoma cell line that was established from a 57-year-old Taiwanese patient having oral squamous cell carcinoma; this patient was a long-term betel nut chewer who did not smoke [15]. [score:3]
In conclusion, our results reveal that miR-17-5p plays a crucial role in the expression of apoptotic proteins, namely p21, p53, TNF RI, FADD, cIAP-1, HIF-1α, and TRAIL R1, in irradiated OC3 cells. [score:3]
Images of the apoptosis array (Figure 1) revealed that apoptosis-related proteins, namely p21, p53 (phosphorylated at S15, S46, or S392), TNF RI, FADD, cIAP-1, HIF-1α, and TRAIL R1, exhibited different expression levels in the irradiated OC3 cells pretreated with miR-17-5p AS ODN and the cells treated with control ODN (Figure 1B). [score:3]
While treated with mir-17-5p AS ODN to irradiated p53 expressing cells, the effect of p53 on cell cycle arrest was significantly enhanced (Figure 4). [score:3]
The IHC of p53 also revealed the p53 was abounding expressed in the miR-17-5p antisense ODN plus irradiation group (group 4) but not in other three groups (Figure 5B). [score:3]
Effects of miR-17-5p AS ODN on the expression of OC3 cell apoptosis-related proteins. [score:3]
In our study, we transfected the OC3 cells with miR-17-5p to verify its biological role; our results also showed G [2]/M arrest in response to radiation, which resulted in the inhibition of radiation -induced apoptosis. [score:3]
In our study, effects of the miR-17-5p AS ODN on OC3 cells potentially enhanced the expression of apoptosis-related proteins to achieve radiosensitivity. [score:3]
To determine the effects of miR-17-5p on OC3 cell apoptosis related-protein expression, the OC3 cells were pretreated with the miR-17-5p AS ODN or control ODN for 48 h before irradiation with 5 Gy. [score:3]
MiR-17-5p AS ODN therapy enhanced p53 expression and radiosensitivity of OC3 cell tumor growth in vivo. [score:2]
In this study, we used miR-17-5p AS ODN in vivo; AS ODN may be a powerful tool for clinical use. [score:1]
The results are presented as ratios of miR-17-5p AS ODN treatment versus the control ODN treatment; we defined ratios of >1.5 or <0.6 as a significant change. [score:1]
These results indicated that miR-17-5p increased or decreased apoptosis-related proteins, namely p21, p53, TNF RI, FADD, cIAP-1, HIF-1α, and TRAIL R1 in the OC3 cells. [score:1]
The role of the miR-17 polycistron in response to RT in oral cancer remains unclear. [score:1]
Figure 3 The OC3 cells were pretreated with the miR-17-5p AS ODN or control ODN for 48 h. After 24 h, the total cell lysates were collected for. [score:1]
Our previous study revealed that miR-17-5p could be induced in irradiated OC3 cells [16]. [score:1]
The mice were treated with miR-17-5p AS ODN or control ODN on day 7; on day 8, the mice in groups 2–4 were processed for tumor irradiation (10 Gy). [score:1]
After tumor formation on day 7, mice were divided into four groups, including sham group (group 1), irradiated alone group (group 2), control ODN plus irradiation group (group 3), and miR-17-5p antisense ODN plus irradiation group (group 4). [score:1]
Our finding from animal study revealed that microRNA-17-5p AS ODN therapy enhanced the radiosensitivity of OC-3 tumor growth, suggesting that miR-17-5p AS ODN therapy may be a strategy for betel nut chewing -associated oral cancer. [score:1]
In this study, we used microRNA-17-5p (miR-17-5p) antisense (AS) oligonucleotides (ODN) and a human apoptosis protein array to identify apoptosis-related proteins that are increased or decreased by miR-17-5p. [score:1]
These results also support that miR-17-5p AS ODN therapy may be a strategy for betel nut chewing -associated oral cancer. [score:1]
MiR-17 encodes seven mature miRs, and several studies have revealed their involvement in cancer [20, 21]. [score:1]
MicroRNA-17-5p antisense ODN therapy enhanced the radiosensitivity of OC3 tumor growth in vivoTo determine the in vivo therapeutic effect of miR-17-5p AS ODN, we used an OC3 xenograft mo del and SCID mice to determine the effect of miR-17-5p AS ODN on tumor irradiation. [score:1]
A 5′-ACUACCUGCACUGUAAGCACUUUG-3′ 2′-O-methyl oligonucleotide (Dharmacon, USA) was used for miR-17-5p antisense oligonucleotide. [score:1]
The sham group (group 1); irradiation-alone group (group 2); control ODN plus irradiation group (group 3), and miR-17-5p AS ODN plus irradiation group (group 4). [score:1]
Mice were treated with miR-17-5p antisense ODN or control ODN on day 7 and 8, mice in groups 2 to 4 were processed for tumor irradiation (10 Gy). [score:1]
Quantitative results of apoptosis protein arrays from miR-17-5p AS ODN -treated OC3 cells. [score:1]
Quantitative detection of miR-17-5p. [score:1]
The effect of mir-17-5p AS ODN on cell cycle arrest in irradiated p53 expressing cells was also evaluated. [score:1]
The OC3 cells were pretreated with the miR-17-5p AS ODN or control ODN for 48 h. After 24 h, the total cell lysates were collected for. [score:1]
Figure 1The OC3 cells were pretreated with miR-17-5p AS ODN or control ODN for 48 h, followed by irradiation with 5 Gy. [score:1]
After tumor formation on day 7, 10 mice each were divided into the sham group (group 1), irradiation-alone group (group 2), control ODN plus irradiation group (group 3), and miR-17-5p AS ODN plus irradiation group (group 4). [score:1]
The OC3 cells were pretreated with miR-17-5p AS ODN or control ODN for 48 h, followed by irradiation with 5 Gy. [score:1]
Quantitative results of apoptosis protein arrays, as described in Figure 1. The figure shows the ratios of the miR-17-5p AS ODN treatment versus the control ODN treatment (n = 3). [score:1]
To determine the in vivo therapeutic effect of miR-17-5p AS ODN, we used an OC3 xenograft mo del and SCID mice to determine the effect of miR-17-5p AS ODN on tumor irradiation. [score:1]
Figure 2Quantitative results of apoptosis protein arrays, as described in Figure 1. The figure shows the ratios of the miR-17-5p AS ODN treatment versus the control ODN treatment (n = 3). [score:1]
These findings would be useful for designing therapeutic strategies, in which RT and miR-17-5p -based gene therapy can be co-administered. [score:1]
[1 to 20 of 67 sentences]
14
[+] score: 188
Significant decreased expression of miR-17~92 in S KOV3-TR30 cells by transduction with miR-17~92 inhibitory plasmids (miR-17-92-PTIP-Sponge all) markedly inhibited cell growth and the inhibition rate is most obvious (40.4%, p < 0.05) when the concentration of paclitaxel was 100 nm. [score:9]
The expression profiles of 171 miRNAs changed significantly: 69 upregulated miRNAs (miR-17, miR-19b, miR-92-1) and 102 downregulated miRNAs (miR-134, miR-34, miR-196b) in S KOV3-TR30 cells as compared with S KOV3 cells (Figure 1). [score:8]
Thus, it is likely that the downregulation of miR-17~92 is closely associated with the sensitivity to paclitaxel through the upregulation BIM. [score:7]
These observations altogether suggested that PTEN expression is responsible for not only miR-17~92 but also other mechanisms regulating PTEN expression including other miRNAs or other mechanism involved in post-transcription. [score:6]
The newest transgenic animal experiments in 2008 shows that miR-17~92 gene clusters down regulate the expression of PTEN and BIM, which are tumor suppressor factors [21]. [score:6]
Among them miR-17~92 expression was significantly upregulated in paclitaxel resistance S KOV3-TR30 cells compared with that in the parental S KOV3 cells. [score:5]
In addition, although miR-17~92 expression level was much lower in S KOV3-TR30-m- PTIP-Sponge all cells, there shows no significant increased expression of PTEN protein. [score:5]
Inhibition of miR-17~92 could Inhibit the Proliferation of S KOV3-TR30 Cells. [score:5]
These findings suggest that BIM is likely to be direct target of miR-17~92 and that BIM protein was regulated at the post-transcriptional level in S KOV-TR30 cells. [score:5]
BIM, a BH3-only Propoapoptotic Protein, Is a Direct Target of the miR-17~92. [score:4]
To sum up, expression level of PTEN was not effected; even miR-17~92 binds directly to the 3′-UTR of PTEN. [score:4]
These observations suggested that not only miR-17~92 but also other mechanisms may be responsible for the regulation of PTEN expression, including other miRNAs involved in the post-transcription of PTEN. [score:4]
These findings suggest that miR-17~92 plays an important role in BIM protein expression decrease through the post-transcriptional regulation. [score:4]
In order to clarify whether miR-17~92 has effect on PTEN expression, we constructed a luciferase reporter plasmid containing point mutations in the predicted miRNA binding sites within the PTEN 3′-UTR (PTEN mut). [score:4]
It’s also shown that BIM instead of PTEN is suppressed by miR-17~92 cluster via direct binding to the BIM 3′-UTR. [score:4]
Comparison of miR-17~92 Expression Levels in S KOV3-TR30-m-PTIP-Sponge all and the S KOV3-TR30-m-PTIP-GFP. [score:3]
A miR-17~92 cluster comprising miR-17, miR-18a, miR-20a, miR-19a, miR-19b, and miR-92-1 is overexpressed in a large fraction of lymphomas [11]. [score:3]
Effect of miR-17~92 on PTEN Expression. [score:3]
In this present study, however, PTEN was not over-expressed in the resistant S KOV3-TR30 cells after transduced with miR-17~92-PTIP-Sponge all plasmid. [score:3]
We next studied the expression level of miR-17~92 in S KOV3-TR30 -m-PTIP-GFP cells and S KOV3-TR30-m-PTIP-Sponge all cells using real-time PCR. [score:3]
Establishment of Stable S KOV3-TR30 Cell Lines with Induced Expression of miR-17~92 Cluster. [score:3]
The current work shows that miR-17~92 cluster expression correlates with paclitaxel resistance of S KOV3-TR30 cells. [score:3]
Yet it is not clear if miR-17~92 gene cluster has an impact on the paclitaxel resistance of ovarian carcinoma through affecting the expression of the BIM or PTEN protein. [score:3]
We next studied the expression level of miR-17~92 in S KOV3 and S KOV3-TR30 cells using real-time PCR. [score:3]
Decreased Expression of miR-17~92 Resulted in Cell Cycle Arrest in the G2/M Phase. [score:3]
Amplification Curve and Melting Curve of miR-17~92 and internal control β-actin see Figure 2. The expression level of miR-17~92 in the S KOV3-TR30 cells is indicated as “1” as control group. [score:3]
So in order to further prove whether miR-17~92 cause paclitaxel resistance through PTEN in S KOV3-TR30, we tested the expression of PTEN protein in paclitaxel resistant ovarian carcinoma S KOV3-TR30 cells after transduced with miR-17~92-PTIP-Sponge all. [score:3]
We then used S KOV3 and S KOV3-TR30 cells to clarify if miR-17~92 has an effect on BIM protein expression which then trigger paclitaxel resistance in ovarian carcinoma cells. [score:3]
Amplification Curve and Melting Curve of miR-17~92 and internal control β-actin see Figure 2. The expression level of miR-17~92 in the S KOV3-TR30 cells is indicated as “1” as control. [score:3]
Decreased expression of miR-17~92 also resulted in cell cycle arrest in the G2/M phase and is most obvious when the concentration of paclitaxel was 100 nm (p < 0.05). [score:3]
In contrast to S KOV3-TR30-m-PTIP-GFP cells, S KOV3-TR30-m-PTIP-Sponge all cells with a significant lower expression of miR-17~92 showed a increase of the BIM protein level both at the steady-state condition without any paclitaxel (Figure 7b, Table 3) and after the treatment with paclitaxel in different concentrations (Figure 7c, Table 3). [score:3]
Contrast the expression level of miR-17~92 in S KOV3-TR30-m-PTIP-GFP cells, which is 0.507 and in S KOV3-TR30-m-PTIP-Sponge all cells which 0.082, the difference is of statistical significance (t = 10.726, p < 0.05). [score:3]
Overexpression of miR-17~92 has been observed in lymphomas and solid tumors [10] and is related to cell proliferation. [score:3]
Besides, miR-17~92 was detected as overexpressed also in multiple myeloma [16], breast cancer [17] and osteosarcoma [18]. [score:3]
Using bioinformatics analysis software, we predict that PTEN and BIM are most likely potential target genes of miR17~92. [score:3]
As result shows miR-17~92 expression is significantly higher in S KOV3-TR30 than in S KOV3. [score:3]
MiR-17~92 inhibitory plasmids miR-17~92-PTIP-Sponge all (m-PTIP-Sponge all), empty plasmids miR-17~92-PTIP-GFP (m-PTIP-GFP) and TMP2-miR-17~92 were provided by the Zoology Institute of Chinese Academy of Sciences. [score:3]
The stable cell lines which have decreased expression of miR-17~92 and cell lines transduced by empty plasmids miR-17~92-PTIP-GFP (m-PTIP-GFP) were maintained in the presence of 1 μg/mL doxycycline. [score:3]
In this study, we established a stable virally transduced S KOV3-TR30 cell line S KOV3-TR30-m- PTIP-Sponge all, which expressed approximately 6.18-fold lower levels of miR-17~92 compared with its vector-only control S KOV3-TR30-m-PTIP-GFP, in order to seek an understanding of the molecular mechanisms of paclitaxel resistance with respect to miR-17~92. [score:2]
Compared with S KOV3-TR30 cells, the expression level of miRNA-17~92 in S KOV3-TR30-m-PTIP-GFP cells and S KOV3-TR30-m-PTIP-Sponge all cells is 0.507 (t = 9.417, p < 0.05) and 0.082 (t = 23.659, p < 0.05), respectively. [score:2]
We further study the effects of miR-17~92 expression on the proliferation of S KOV3-TR30 using MTT assay. [score:2]
2.2. miR-17~92 Was Overexpressed in S KOV3-TR30 Cells Compared with S KOV3 Cells. [score:2]
That means miR-17~92 binds directly to 3′-UTR of PTEN. [score:2]
Decreased expression of miR-17~92 in S KOV3-TR30-m-PTIP-Sponge all cells resulted in a significant increase in the fraction of cells arrested at G2/M as well as a concomitant decrease in the fraction of cells arrested at S phase compared with S KOV3-TR30-m-PTIP-GFP. [score:2]
Real-time PCR results revealed that S KOV3-TR30-m-PTIP-Sponge all expressed approximately 6.18-fold lower levels of miR-17~92 (Table 1) compared with which in S KOV3-TR30-m-PTIP-GFP cells. [score:2]
Compared to S KOV3-TR30 cells, the expression level of miRNA-17~92 in S KOV3 cells is 0.557, and the difference is of statistically significant (t = 9.193, p < 0.05) (Table 1). [score:2]
There are also studies show down regulation of PTEN and BIM in certain ovarian carcinoma cells with feature of chemoresistance [15, 22], besides studies of Lewis and BP [10] show that miR-17~92 takes effect through PTEN and BIM. [score:2]
The result revealed that the expression level of miR-17~92 was markedly increased in paclitaxel resistant S KOV3-TR30 cells compared with paclitaxel sensitive S KOV3 cells. [score:2]
Using real-time PCR we further clarified that miR-17~92 was overexpressed in S KOV3-TR30 cells compared with S KOV3 cells. [score:2]
We further applied S KOV3-TR30-m-PTIP-Sponge all cells and the control S KOV3-TR30-m-PTIP-GFP cells for a better understanding about the effect of miR-17~92 on BIM protein. [score:1]
B2 containing binding sites for miR-17-5p/-20a and miR-92, and B3 contains binding sites for miR-19 and miR-92 while there is not binding site of B1 with miR-17~92. [score:1]
Quantitative Real-Time PCR of miR-17~92 within S KOV3 and S KOV3-TR30 Cells. [score:1]
In order to determine whether the resistance to paclitaxel could be caused by miR-17~92 in S KOV3-TR30, we established stable virally transduced S KOV3-TR30 cell line S KOV3-TR30-m-PTIP-Sponge all cells and its vector-only control S KOV3-TR30-m-PTIP-GFP cells. [score:1]
Other studies show that the tumorigenic effect of miR-17~92 may be due to synergism between its family members [20]. [score:1]
Studies by Lewis, BP, and others [12] have shown that miR-17~92 may play a role in PTEN and BIM. [score:1]
B2 fragment contains miR-17-5p/-20a and miR-92 binding site and B3 fragment contains miR-19 and miR-92 binding site. [score:1]
The gene cluster of miR-17~92 resides with intron 3 of cl3orf25 non-protein-coding gene at 13q31.3 gene [8, 11]. [score:1]
However, we could not clearly clarify if there is a link from miR-17~92 and PTEN to paclitaxel resistance mechanisms. [score:1]
To demonstrate the BIM protein level was directly mediated by miR-17~92 through biding to 3′-UTR of BIM, we co -transfected the BIM 3′-UTR (B1,B2,B3) along with TMP2-miR-17~92 into HEK293 cells and than performed luciferase reporter assays. [score:1]
We accessed cell cycle distribution profiles after the transduction of S KOV3-TR30 with either miR-17~92-PTIP-Sponge all plasmids or negative control miR-17~92-PTIP-GFP (m-PTIP-GFP) plasmids. [score:1]
There is not binding site of B1 with miR-17~92. [score:1]
In this study, we have demonstrated the significant contribution of miR-17~92/BIM to paclitaxel resistance in human ovarian carcinoma S KOV3-TR30 cells. [score:1]
So far, the research of the influence of miRNA-17~92 on ovarian carcinoma drug-resistance is rarely reported. [score:1]
To establish miR-17~92-PTIP-Sponge all cell line, the HEK293T cell line was co -transfected with the miR-17~92-PTIP-Sponge all plasmids and pCL packaging plasmid or empty plasmids miR-17~92-PTIP-GFP (m-PTIP-GFP) and pCL packaging plasmid by the calcium phosphate method. [score:1]
The pGL-3-P promoter plasmids containing the wild type or mutated 3′-UTRs of PTEN and 3′-UTRBIM (B1,B2,B3)were co -transfected into HEK 293 cells with TMP-miR-17~92 according to the manufacturer’s instructions using LIPOFECTAMINE 2000, pRL-SV40 (Promega, Madison, WI, USA) was also transfected as a normalization control. [score:1]
We aim to get a better understanding of the molecular mechanisms of paclitaxel resistance in S KOV3-TR30 cells, to provide a clue for further investigation of the function of miR-17~92 and its target genes, and their correlation in ovarian carcinoma paclitaxel resistance. [score:1]
[1 to 20 of 66 sentences]
15
[+] score: 179
There are 20 negatively correlated target genes; 16 of these target genes are predicted to be hsa-miR-17 target genes. [score:7]
Most of expression profiles of hsa-miR-17 target genes are negatively correlated with the expression profile of hsa-miR-17. [score:7]
Due to our approach, which only observes one miRNA and its corresponding target genes, the expression of CDKN1A and RUNX1 could not simply negatively correlate to the expression of hsa-miR-17. [score:7]
Figure 4(b) is an example that shows that the expression profiles of most hsa-miR-17 target genes are negatively correlated with the expression profile of hsa-miR-17. [score:7]
Comparison of correlation densities for all 743 experimentally validated MTIs across all 89 tissues (black solid line), hsa-miR-17 with 24 targets across the top 6 MTI-supported tissues (red dashed line), hsa-miR-17 with 24 targets across 19 extended tissues (green dashed line) and hsa-miR-17 with 95 predicted targets across the top 6 MTI-supported tissues (blue dashed line). [score:7]
0095697.g005 Figure 5 Comparison of correlation densities for all 743 experimentally validated MTIs across all 89 tissues (black solid line), hsa-miR-17 with 24 targets across the top 6 MTI-supported tissues (red dashed line), hsa-miR-17 with 24 targets across 19 extended tissues (green dashed line) and hsa-miR-17 with 95 predicted targets across the top 6 MTI-supported tissues (blue dashed line). [score:7]
The expression profiles of the hsa-miR-17 target gene TGFBR2 is positively correlated with the miRNA expression profile. [score:7]
The expression correlations are negative in breast tissues and are in agreement with the study that demonstrated that NCOA3 is down-regulated by hsa-miR-17 [46]. [score:6]
First, the correlation between the expression of CDKN1A and hsa-miR-17 is 0.23, and the correlation between the expression of RUNX1 and hsa-miR-17 is 0.04. [score:5]
Although it has been experimentally validated that these target genes could be inhibited by hsa-miR-17, TGFBR2 is not. [score:5]
The correlation between the expression profiles of hsa-miR-17 and each target gene is annotated next to the gene symbol in Figure 4(b). [score:5]
Because the seed region of miR-17, miR-106a and miR-20a are identical, the expression correlation of hsa-miR-17 and its target genes might be affected by other miRNAs. [score:5]
b. The expression profiles of hsa-miR-17 and 24 targets across the top 6 MTI-supported tissues. [score:5]
a. The expression profiles of hsa-miR-17 and 24 targets across 19 extended tissues. [score:5]
The correlations between the expression profiles of hsa-miR-17 and target genes were annotated next to the gene symbols. [score:5]
To support our suspicion, we re-examine the studies of hsa-miR-17 regulation on TGFBR2, which shows that TGFBR2 expression could not be detected because of microsatellite-instability and mutations [32]– [34]. [score:5]
b. Part of the expression profile of hsa-miR-17 and experimentally validated and predicted target genes. [score:5]
By searching for the conserved 8mer and 7mer sites that match the seed region of each miRNA from the TargetScanS prediction tool [3]– [5], we have 95 predicted targets of hsa-miR-17 from our dataset, which are based on the top 6 MTI-supported tissues. [score:5]
0095697.g006 Figure 6 a. The expression profiles of hsa-miR-17 and 24 targets across 19 extended tissues. [score:5]
Two conflicted studies show that hsa-miR-17 can or cannot inhibit the translation of PTEN. [score:5]
In Figure 4(b), the expression profiles of hsa-miR-17 and 24 target genes across the top 6 MTI-supported tissues are presented. [score:5]
Apparently, the right-skewed density plot of the correlations between hsa-miR-17 and its targets across the top 6 MTI-supported tissues shows that most correlations are negative, which is in accordance with the degradation behavior between an miRNA and its targets. [score:5]
The correlations between the expression profile of hsa-miR-17 and the profiles of target genes were annotated next to the gene symbol. [score:5]
Thus, our approach can determine which target genes are dominantly regulated by hsa-miR-17 and find the non-MTI-supported tissues. [score:4]
The heatmaps of hsa-miR-17 expression and regulated genes. [score:4]
a. Comparison of correlation densities for all 743 experimentally validated MTIs (solid line) and hsa-miR-17 with 24 targets across the top 6 MTI-supported tissues (dashed line). [score:3]
NCOA3 (AIB1) is not correlated with the expression of hsa-miR-17. [score:3]
Nevertheless, the correlation density of hsa-miR-17 and 95 predicted targets across the top 6 MTI-supported tissues (blue dashed line) does not have a better performance than that obtained using 24 experimentally validated MTIs across the top 6 MTI-supported tissues (red dashed line) and that obtained using 24 experimentally validated MTIs across 19 extended tissues (green dashed line). [score:3]
Comparing Figure 4(a) with Figure 5, we add a green dashed line in Figure 5, which is the correlation density plot of hsa-miR-17 and its targets across the 19 extended tissues. [score:3]
Because the top 6 MTI-supported tissues that have been selected for hsa-miR-17 include tumor tissues, which may be queried with extreme expression levels, we extend the top 6 MTI-supported tissues to other tissues with the same organ as the top 6 MTI-supported tissues. [score:3]
0095697.g004 Figure 4 a. Comparison of correlation densities for all 743 experimentally validated MTIs (solid line) and hsa-miR-17 with 24 targets across the top 6 MTI-supported tissues (dashed line). [score:3]
The reason for the positive correlation between hsa-miR-17 and these genes could be that these genes are regulated by other stronger regulatory factors. [score:3]
Adopting 95 predicted targets of hsa-miR-17 across the top 6 MTI-supported tissues can still improve the correlations that are not near zero. [score:3]
Figure 4(a) shows the density plot of correlations (solid line) of all 743 experimentally validated MTIs across all 89 tissues and the density plot of correlations (dashed line) between hsa-miR-17 and its targets across the top 6 MTI-supported tissues. [score:3]
The blue dashed line in Figure 5 is the correlation density of hsa-miR-17 and 95 predicted targets across the top 6 MTI-supported tissues. [score:3]
Here, we again examine the expression levels of 24 tissues of hsa-mir-17. [score:3]
tw) reveal similar results to that of hsa-miR-17. [score:1]
Figure 4 presents the plots for the density function of correlation and the heatmap of hsa-miR-17. [score:1]
The top 6 MTI-supported tissues for hsa-miR-17 include tumor tissues and normal tissues. [score:1]
Tissue selection pipeline for finding MTI-supported tissues of miR-17 based on experimentally validated MTIs. [score:1]
Due to the limited space, we only provide the elaboration on the example miR-17 in details. [score:1]
Olive et al. (2009) concluded that PTEN could be repressed by miR-19, but not by hsa-miR-17, in B-cell lymphoma [44]. [score:1]
The value for miR-17 is −0.536. [score:1]
The experiment that was reported by Trompeter et al. (2007) shows that PTEN is significantly repressed by hsa-miR-17 in HEK293T cells and kidney cells [45]. [score:1]
[1 to 20 of 44 sentences]
16
[+] score: 176
While the expression level of miR-17 was decreased from E12.5 to P0, p21 expression was continuously increased, suggesting a reciprocal expression between miR-17 and its target p21 during cortical development (Figures 3C–E). [score:10]
These results further suggest that higher expression of miR-17 in embryonic cortices is crucial for suppressing the p21 level and promoting NP proliferation, while low expression of miR-17 in postnatal cortices allows p21 expression to induce differentiation. [score:9]
miR-17 displays decreased expression in mouse cortices at embryonic and postnatal stages, which is opposite to that of p21, suggesting a reciprocal expression between miR-17 and its target p21. [score:7]
In E14.5 cortices, electroporated with the miR-17 precursor to overexpress miR-17 at E13.5, there was a significant increase in the percentage of BrdU [+]/GFP [+] cells, which suggests an up-regulation of proliferation of cortical NPs (Figures 4A,B). [score:6]
One of the mechanisms that control precise expression levels of these regulators is through the miRNA silencing regulation such as miR-17. [score:5]
In this study, we have demonstrated miR-17 targeting effect on p21 expression. [score:5]
miR-17 promotes proliferation of RGCs and IPs through suppressing p21 expression. [score:5]
We next examined whether the expression level of p21 is correlated with miR-17 expression in developing cortices by performing qRT-PCR. [score:5]
Our studies have revealed a mechanism of suppressing endogenous p21 expression by miR-17 in NPs. [score:5]
Furthermore, we have found the direct silencing action of miR-17 on p21 in vivo, since co -expression of p21 and miR-17, but not miR-17 mutations, can block negative effects of p21 on cortical NP proliferation. [score:5]
Figure 6. (A,B) Co -expression of miR-17 with p21 in E13.5 mouse cortices (n = 6), analyzed at E14.5, significantly rescued the reduced number of proliferating cells caused by p21 alone, while co -expression of a mutated miR-17 with p21 (n = 3) failed to do so. [score:5]
Our study here has shown that miR-17, a member of the miR-17–92 cluster, is an important regulator of p21 expression and expansion of the cortical neural progenitor pool. [score:4]
Since there are six miRNAs produced from the miR-17–92 cluster, and each miRNA usually has multiple targets, the molecular mechanisms of miR-17–92 function in cortical development remain an exciting research topic. [score:4]
Furthermore, miR-17 likely maintains the neural progenitor pool by regulating several targets. [score:4]
To directly test the silencing activity of miR-17 on p21 in vivo, we speculated that co -expression of miR-17 with p21 should be able to rescue the negative effect of p21 on proliferation of NPs. [score:4]
Our studies have identified a mechanism that controls p21 expression levels in NPs in vivo by miR-17 during cortical development. [score:4]
Here, we have not ruled out the likely possibility that the regulation of additional target genes by miR-17 contributes to its ability to promote NP proliferation. [score:4]
However, when a mutated miR-17 containing mutations in the seed sequence, which is responsible for binding to p21 3′UTR, was used, the targeting effect of miR-17 was abolished (Figure 3B). [score:4]
For instance, miR-17 has been shown to enhance NSC self-renewal by targeting Trp53inp1, a gene in the p53 pathway, to promote NP proliferation by silencing bone morphogenetic protein type II receptor (42, 43). [score:3]
These results indicate that the miR-17 sponge, which can block the endogenous miR-17 silencing activity, suppresses proliferation of cortical NPs. [score:3]
The targeting effects of miR-17 and p21 have been observed in oral carcinoma cells, acute myeloid leukemia cells, and Hodgkin’s lymphoma (39– 41). [score:3]
The percentages of BrdU [+]/GFP [+], Pax6 [+]/GFP [+], and Tbr2 [+]/GFP [+] cells versus total GFP [+] cells were all decreased significantly when the miR-17 sponge was expressed (Figures 5C–H). [score:3]
p21 is a putative target of miR-17. [score:3]
These results indicate that p21 is a specific target of miR-17. [score:3]
To further test miR-17 functions in expansion of cortical NPs, we applied a loss-of-function approach by expressing miR-17 sponges (36). [score:3]
These data indicate that the miR-17 sponge is able to block the silencing function of miR-17 to its target gene p21. [score:3]
Utilizing in utero electroporation and miRNA sponge, we have found that miR-17 specifically blocks p21 expression, thereby promoting the expansion of the cortical neural progenitor pool. [score:3]
In this study, we show that while p21 negatively regulates NP proliferation by reducing the numbers of both RGCs and IPs in the developing mouse cortex, miRNA miR-17 has an opposite effect on NP development. [score:3]
Figure 4. (A,B) Expression of miR-17 in E13.5 mouse cortices (n = 3), analyzed at E14.5, increased the number of proliferating cells co-labeled with GFP and BrdU. [score:3]
On the other hand, mutations of miR-17 in the seed sequence (miR-17 mut) had no effect on proliferation of RGCs and IPs, indicating a specific effect of miR-17 on NP development (Figures 4C–F). [score:3]
However, co -expression of p21 and the mutated miR-17 failed to rescue NP proliferation (Figures 6A–F). [score:3]
Figure 3. (A) A predicted targeting site of miR-17 on the 3′UTR of p21. [score:3]
Moreover, the percentages of Pax6 [+]/GFP [+] and Tbr2 [+]/GFP [+] cells were also increased, indicating an expansion of RGCs and IPs by miR-17 overexpression (Figures 4C–F). [score:3]
For co -expression of p21 and miR-17, the concentrations of p21 and miR-17 are 0.5 and 1.5 μg/μl, respectively, maintaining a total plasmid concentration of 2 μg/μl. [score:3]
Mutations of miR-17 in the seed sequence were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) using the following primers: F-5′-gtcagaataatgtcgttgtgcttacagtgcaggtagtgatgtgtgcatctactgcagtgagggcacaagtagcattatgctgac-3′; R-5′-gtcagcataatgctacttgtgccctcactgcagtagatgcacacatcactacctgcactgtaagcacaacgacattattctgac-3′. [score:2]
miR-17 positively regulates proliferation of cortical neural progenitors. [score:2]
To prove the targeting effect of miR-17 on p21, we designed a luciferase assay in which the 3′UTR sequence of p21 was cloned into a luciferase vector and co -transfected with miR-17. [score:2]
Compared to p21 alone, co -expression of miR-17 and p21 significantly rescued NP proliferation, as demonstrated by increased percentages of BrdU [+]/GFP [+], Pax6 [+]/GFP [+], and Tbr2 [+]/GFP [+] cells, which were compatible to those electroporated with the control vector (Figures 6A–F). [score:2]
An important miRNA family is the miR-17–92 cluster, which produces miR-17, 18, 19, and 92, each with conserved seed sequences, and regulates proliferation and survival of various cells (29– 33). [score:2]
These results suggest that miR-17 silencing regulation of p21 likely controls NP population in embryonic cortices. [score:2]
miR-17 rescues the negative effect of p21 on proliferation of neural progenitors. [score:1]
The reduction of the relative luciferase activity, which is normally caused by the silencing effect of miR-17, was significantly rescued by the miR-17 sponge (Figure 5B). [score:1]
The miR-17 sponge was cloned in the 3′UTR of a coding gene iCre, and co -transfected with miR-17 and the construct containing the luciferase gene followed by the 3′UTR sequence of p21. [score:1]
A mutated miR-17 (n = 3) had no effect on the number of RGCs. [score:1]
A mutated miR-17 (miR-17 mut) (n = 3) had no effect on cell proliferation. [score:1]
Figure 5. (A) The design of the miR-17 sponge. [score:1]
Our results suggest that miR-17 promotes proliferation of cortical NPs. [score:1]
We designed the miR-17 sponge (miR-17 sp), which consists of three narrowly spaced, bulged binding sites for miR-17 (Figure 5A). [score:1]
A mutated miR-17 sponge (miR-17 sp-mut) (n = 3) failed to do so. [score:1]
It is likely that silencing p21 by miR-17 in proliferative cells is a general rule. [score:1]
org), we searched the 3′UTR of p21 and found that it contains one binding site for miR-17 (Figure 3A). [score:1]
To further test the effect of miR-17 sponge on expansion of cortical NPs in vivo, the miR-17 sponge was electroporated into the cortices of E13.5 mice, and analyzed at E14.5. [score:1]
Our own work and others have shown that miR-17–92 promotes proliferation of cortical NSCs and NPs (34, 35). [score:1]
A mutated miR-17 sponge (n = 3) failed to do so. [score:1]
While relative luciferase activities in constructs containing the 3′UTR of p21 were not affected by a control miRNA miR-9, they were significantly reduced by miR-17 (Figure 3B). [score:1]
However, a mutated miR-17 sponge at the seed sequence showed no such rescue effect. [score:1]
Blocking miR-17 using its sponge causes reduced proliferation of cortical neural progenitors. [score:1]
For luciferase assays, the miR-17 precursor and its mutation were subcloned into the pCDNA3.1 vector. [score:1]
A mutated miR-17 sponge (n = 4) failed to do so. [score:1]
The p21 full length cDNA with the 3′UTR was cloned into the pCAGIG vector, co-electroporated with miR-17 into E13.5 cortices, and analyzed at E14.5. [score:1]
A mutated miR-17 (n = 3) had no effect on the number of IPs. [score:1]
[1 to 20 of 61 sentences]
17
[+] score: 176
In the colon, up-regulated miR-17-92a promotes neoplasia through various pathways, e. g. miR-18a and miR-19 directly repress TSP-1 and CTGF, respectively, to promote angiogenesis [24] and miR-92a down-regulates BCL2L11 expression thereby reducing apoptosis [44]. [score:10]
Among the miRNAs whose expression was suppressed by butyrate, members of the miR-106b family, including miR-17, miR-20a/b, miR-93 and miR-106a/b, regulate p21 translation and cancer cell proliferation [15, 16]. [score:8]
Fig. 6HDAC inhibitors, SAHA and valproic acid, suppressed expression of pri-miR-17-92a, miR-92a and c-Myc in colon cancer cells. [score:7]
Over -expressing c-Myc resulted in up-regulated levels of pri-miR-17-92a. [score:6]
As shown in Fig.   6a, we observed a 5-fold decrease in pri-miR-17-92a expression following treatment with 5 μM SAHA or 1 mM valproic acid for 24 h. SAHA or valproic acid treatment also down-regulated the level of mature miR-92a level of by ~30 % (Fig.   6b). [score:6]
Previously, we reported that butyrate decreased miR-17 and miR20a levels in HCT116 cells, thereby allowing p21 expression to down-regulate cell proliferation [15]. [score:6]
The effect of butyrate on p57 mRNA translation is mediated via reduced c-Myc protein expression, which decreases miR-17-92a cluster transcription and miR-92a levels. [score:5]
Previous reports indicate these actions are mediated in part by altered levels of miRNAs, including suppressed expression of the oncogenic miR-17-92a cluster. [score:5]
From these experiments, we concluded that restoration of c-Myc expression in butyrate -treated cells rescues pri-miR-17-92a from inhibition. [score:5]
In contrast, overexpressing c-Myc neutralized butyrate’s inhibitory effect on pri-miR-17-92a. [score:5]
Silencing and over -expressing c-Myc alters pri-miR-17-92a expression. [score:5]
These findings suggested to us that the anti-neoplastic actions of butyrate might be mediated in part by the ability of butyrate to suppress oncogenic miRNA expression, particularly the miR-17-92a cluster. [score:5]
Comparison of the time-courses for butyrate -induced attenuation of pri-miR-17-92a (Fig.   2a) and c-Myc (Fig.   2b) expression suggested to us that the actions of butyrate on miRNA transcription were most likely mediated by attenuation of c-Myc expression. [score:5]
These results show that maintaining high level c-Myc expression is essential for miR-17-92a transcription and that silencing c-Myc expression mimics the effects of butyrate treatment on miR-92a transcription. [score:5]
These results suggested that butyrate’s effects on miR92a inhibition were likely mediated by transcriptional regulation of pri-miR-17-92a and less likely a consequence of altered miRNA processing. [score:4]
c-Myc knockdown significantly reduced expression of pri-miR-17-92a (Fig.   4c) and mature miR-92 (Fig.   4d). [score:4]
a In colon cancer cells, high levels of c-Myc up-regulate miR-17-92a transcription. [score:4]
As shown in Fig.   1c, 24-h treatment of HCT116 cells with 2 mM butyrate down-regulated the levels of all pri-miR-17-92a, pre-miR-92a, and mature miR-92a. [score:4]
n = 3In HCT116 cells using the same treatment conditions we measured protein and mRNA levels of c-Myc, a major transcription factor which up-regulates miR-17-92a cluster expression [18, 19, 23, 28]. [score:4]
Nonetheless, in c-Myc-adenovirus-infected cells reduction of pri-miR-17-92a levels was significantly attenuated compared to control cells (Cont and Veh); this finding suggested that c-Myc over -expression rescued cells from the butyrate -induced decrease in pri-miR-17-92a expression. [score:4]
n = 3 In HCT116 cells using the same treatment conditions we measured protein and mRNA levels of c-Myc, a major transcription factor which up-regulates miR-17-92a cluster expression [18, 19, 23, 28]. [score:4]
Thus, although our findings implicate c-Myc in mediating the effects of butyrate on pri-miR-17-92a transcription, we cannot exclude a role for other regulatory mechanisms, including c-Myc-independent inhibition of pri-miRNA transcription or pri-miRNA degradation by butyrate. [score:4]
Pre-existing high levels of c-Myc protein partially blocked the suppression of pri-miR-17-92a by butyrate treatment. [score:3]
The effects of butyrate and other histone deacetylase inhibitors (suberoylanilide hydroxamic acid (SAHA) and valproic acid) on primary (pri-miR17-92a), precursor and mature miR-92a were analyzed in HCT-116 and HT-29 human colon cancer cells using qPCR. [score:3]
The miR-17-92a cluster is over-expressed in a variety of cancers [17– 19, 24, 25]. [score:3]
Previously, we showed that expression of several members of the miR-17-92a cluster is greatly augmented in human sporadic colon cancer [15]. [score:3]
Butyrate treatment inhibits C13 orf25 promoter activityA highly functional and conserved c-Myc binding site (E3 box, −CATGTG-) is located in the intronic C13 orf25 promoter 1.5 kb upstream of the miR-17-92a coding sequence [19, 29]. [score:3]
c-Myc over -expression neutralized butyrate -induced attenuation of pri-miR17-92a. [score:3]
Parallel experiments were performed to analyze the effects of over -expressing c-Myc after 8 h of butyrate treatment (Fig.   5c schematic), a time point at which endogenous c-Myc protein and pri-miR-17-92a were depleted by butyrate treatment (Fig.   2). [score:3]
Butyrate reduced c-Myc expression and c-Myc -induced miR-17-92a promoter activity. [score:3]
In rescue experiments, restoring butyrate -suppressed c-Myc protein levels fully restored pri-miR-17-92a to baseline levels. [score:3]
Fig. 5c-Myc -induced over -expression of pri-miR-17-92a was attenuated by butyrate treatment. [score:3]
Butyrate treatment of both HCT116 and HT29 human colon cancer cells reduced the levels of primary miR-17-92a (pri-miR-17-92a), precursor, and mature miR-92a; these effects were shared by other HDAC inhibitors (suberoylanilide hydroxamic acid (SAHA) and valproic acid). [score:3]
Inhibition of pri-miR-17-92a, pre-miR-92a and miR-92a by butyrate was confirmed in a second human colon cancer cell line, HT29 (Fig.   1d). [score:3]
Colon cancer miRNA microarray data indicated that butyrate amplifies expression of other miRNA families and clusters including the oncogenic miR-17-92a cluster, also known as oncomiR-1 and C13 orf25 [17, 18]. [score:3]
Previously, we showed that multiple members of the miR-17-92a cluster were greatly suppressed by treating human colon cancer cells with butyrate [15]. [score:3]
However, because all primary, precursor, and mature miRNAs decreased in a gradient fashion with the largest changes seen on pri-miR-17-92a, mechanisms regulating miRNA processing in the nucleus and cytosol are less likely to be affected by butyrate. [score:2]
In this study, we focused on elucidating the mechanism whereby butyrate regulates biogenesis of the oncogenic miR-17-92a cluster. [score:2]
As shown in Fig.   1e, consistent with previous reports [15, 26], miR-17, miR-18a, miR-19a/b and miR-20a, were decreased by 40 to 70 % after butyrate treatment. [score:1]
A highly functional and conserved c-Myc binding site (E3 box, −CATGTG-) is located in the intronic C13 orf25 promoter 1.5 kb upstream of the miR-17-92a coding sequence [19, 29]. [score:1]
We analyzed the effects of treating HCT116 and HT29 human colon cancer cells with the same dose (2 mM) of butyrate on miR-92a expression using qPCR to measure the abundance of primary (pri-miR-17-92a and pri-miR-106a-92a), precursor (pre-miR-92a), and mature miR-92a. [score:1]
Silencing c-Myc in HCT116 cells decreased C12 orf25 promoter activity and levels of both pri-miR-17-92a and mature miR92a, thus mimicking the actions of butyrate. [score:1]
a Schematic of pGL3 luciferase reporter constructs containing the 1.5-kb promoter region upstream to the miR-17-92a cluster gene in C13 orf25, which includes a wildtype functional c-Myc binding site (CATGTG, WT). [score:1]
Butyrate treatment also decreased the levels of other miR-17-92a cluster members, including miR-17, miR-18a, miR-19a/b and miR-20a. [score:1]
In HCT116 cells with control and reduced levels of c-Myc expression, qPCR was used to measure the abundance of c pri-miR-17-92a and d miR-92a. [score:1]
Treating human colon cancer cells with butyrate reduced the levels of pri-miR17-92a, precursor and mature miR-92a, as well as c-Myc. [score:1]
In response to butyrate treatment, we observed a 10-fold decrease in the initial miRNA transcript, pri-miR17-92a, and the levels of pre-miR-92a and mature miR-92a were decreased by 67 % and 52 %, respectively (Fig.   1c). [score:1]
All members of the miR-17-92a cluster derived from pri-miR-17-92a were decreased by butyrate in HCT 116 cells. [score:1]
In addition to the aforementioned miR-17 and miR-20a, the miR-17-92a cluster encodes miR-18a, miR-19a/b and miR-92a. [score:1]
Humphrey et al. confirmed butyrate’s actions in reducing levels of members of the miR-17-92a cluster in colon cancer cells [26]. [score:1]
With butyrate treatment, mature miR-92a decreased gradually whereas pre-miR-92a and pri-miR-17-92a showed much steeper initial declines; pri-miR-17-92a levels in particular dropped sharply within the first 2 h after butyrate treatment. [score:1]
As shown by the middle triad of bars in Fig.   5d, pri-miR-17-92a levels were decreased in all butyrate -treated cells. [score:1]
In HCT116 and HT29 human colon cancer cells, butyrate treatment reduced miR92a levels at all processing stages, amongst which the initial pri-miR-17-92a transcripts showed the most rapid and largest declines after butyrate treatment. [score:1]
[1 to 20 of 53 sentences]
18
[+] score: 173
AIB1 expression was downregulated by miR-17-5p by translational inhibition, and the expression of miR-17-5p was low in breast cancer cell lines. [score:12]
markedly at 48 h. In addition, at 24 and 48 h. The protein expression of Cyclin D1, p-Akt and Akt in glioma C6 cells decreased after transfection with miR-17 mimics for 72 h, and increased after transfection with miR-17 inhibitor for 72 h. The reduced miR-17 levels in glioma cells increased cell viability and migration, which correlates with increased expression of Cyclin D1, p-Akt and Akt. [score:7]
The relative protein expression of Cyclin D1, p-AKT and AKT in miR-17 inhibitor group to Lipofectamine control group was 1.3 ± 0.1, 1.9 ± 0.0, and 1.4 ± 0.0, respectively. [score:5]
Protein expression of Cyclin D1, p-AKT and AKT increased in miR-17 inhibitor -transfected glioma C6 cells. [score:5]
Mir-17-5p Regulates Breast Cancer Cell Proliferation by Inhibiting Translation of AIB1 mRNA. [score:5]
We have demonstrated that the expression of miR-17 is decreased in glioma cells, and inhibition of miR-17 increased the viability and migration of glioma cells. [score:5]
MiR-17/20 overexpression was reported to sensitize cells to apoptosis induced by either Doxorubicin or UV irradiation in breast cancer cells via Akt, and miR-17/20 mediated apoptosis via increased p53 expression which promoted the degradation of Akt [16]. [score:5]
Targeted miRNA sequences were shown as following: rno-miR-17-5p mimics: sense: 5’CAAAGUGCUUACAGUGCAGGUAG3’, antisense: 5’ACCUGCACUHUAAGCACUUUGUU3’, rno-miR-17-5p inhibitor: CUACCUGCACUGUAAGCACUUUG. [score:5]
The expression of miR-17 was detected by quantitative PCR, and expression of Cyclin D1 was examined by Western Blot. [score:5]
The expression of miR-17 was decreased in breast cancer cell line, and gene expression of Cyclin D1 decreased after lentiviral transduction of miR-17 to breast cancer cells [15]. [score:5]
The miR-17 microRNA (miRNA) precursor family is a group of small non-coding RNA genes that regulate gene expression, and it includes miR-20a/b, miR-93 and miR-106a/b. [score:4]
After glioma C6 cells were transfected with inhibitor of miR-17 (200 nM) for 72 h, the protein expression of Cyclin D1 (p < 0.05), p-AKT (p < 0.001) and AKT (p < 0.01) increased compared to Lipofectamine and negative control groups (Fig 8). [score:4]
In addition, protein expression of Cyclin D1, p-Akt and Akt in MiR-17 mimics or inhibitor -transfected glioma C6 cells was detected by Western Blot. [score:4]
Therefore, it is possible that MiR-17 also targets the 3' UTR of Cyclin D1 gene in glioma cells, and decreased the protein expression of Cyclin D1 as shown in current study. [score:4]
The expression of miR-17 was significantly lower, whereas the expression of Cyclin D1 was significantly higher in glioma C6 cells compared to normal brain tissue. [score:4]
The expression of miR-17 was significantly lower (p < 0.01; Fig 1), and the protein expression of Cyclin D1 was markedly higher in rat glioma C6 cells compared to normal brain tissue (p < 0.001; Fig 2). [score:4]
After glioma C6 cells were transfected with inhibitor of miR-17 (200 nM) for 72 h, the protein expression of Cyclin D1, Akt and p-Akt increased compared to Lipofectamine and negative control groups. [score:4]
Protein expression of Cyclin D1, p-Akt and Akt increased in miR-17 mimic -transfected rat glioma C6 cells. [score:3]
This indicated that miR-17 has a role as a tumor suppressor in glioma cells, and decreased miR-17 renders glioma cells unrestrained proliferation and metastasis. [score:3]
Therefore, we aimed to explore effects of miR-17 mimics or inhibitor on the viability and migration of rat glioma C6 cells, and investigate possible mechanisms by examining protein expression of cyclin D1, p-Akt and Akt in current study. [score:3]
The expression of miR-17 was detected by quantitative PCR. [score:3]
The relative protein expression of Cyclin D1, p-AKT and AKT in miR-17 mimic group to Lipofectamine control group was 5.8 ± 0.6%, 41.5 ± 2.1%, and 70.3 ± 4.4%, respectively. [score:3]
Expression of miR-17 and Cyclin D1 in rat glioma C6 cells. [score:3]
We also showed that low miR-17 levels in glioma cells correlated with increased expression of active p-Akt and Akt. [score:3]
Protein expression of Cyclin D1, p-Akt and Akt decreased in miR-17 mimic -transfected rat glioma C6 cells. [score:3]
This provides another explanation for the increased viability and migration in glioma cells with low expression of miR-17. [score:3]
In current study, we unveiled that inhibition of miR-17 increased the viability and migration of glioma cells. [score:3]
The expression of miR-17 in rat glioma C6 cells and normal brain tissue was detected by quantitative PCR. [score:3]
The miR17 mimics and inhibitors purchased from GenePharm. [score:3]
Protein expression of Cyclin D1, p-AKT and AKT decreased in miR-17 mimics -transfected glioma C6 cells. [score:3]
This provides one explanation for the increased viability and migration in glioma cells with low expression of miR-17. [score:3]
Relative expression of miR-17 in rat glioma C6 cells and normal brain tissue. [score:3]
In addition, we revealed that decreased miR-17 in glioma cells correlated with increased expression of Cyclin D1. [score:3]
Thus, miR-17 may degrade Akt by increasing the expression of p53 in gliomas. [score:3]
Our results reveal that miR-17 has a role as a tumor suppressor in glioma cells. [score:3]
0190515.g001 Fig 1The expression of miR-17 was detected by quantitative PCR. [score:3]
In conclusion, we demonstrated for the first time that the low miR-17 levels in glioma cells increased cell viability and migration, which correlates with increased expression of Cyclin D1, p-Akt and Akt. [score:3]
showed that the expression of miR-17 was significantly lower in rat glioma C6 cells compared to normal brain tissue. [score:2]
MiR-17 inhibitor increased the migration of glioma C6 cells. [score:2]
The activating mutations of miR-17 were also revealed in human non-Hodgkin's lymphoma and T cell leukemia [6, 7]. [score:2]
Glioma C6 cells were transfected with MiR-17 mimics or inhibitor. [score:2]
MiR-17 inhibitor increased the viability of glioma C6 cells. [score:2]
MiR-17 was shown to target the 3' UTR of Cyclin D1 gene in breast cancer cells with the highest score using bioinformatics analyses. [score:2]
Moreover, deletion of the miR-17 cluster has been shown to be lethal and result in developmental defects of lung and lymphoid cell in mice [9]. [score:2]
MiR-17 inhibitor increased the viability and migration of glioma C6 cells. [score:2]
The current study aimed to investigate effects of miR-17 mimics or inhibitor on the viability and migration of rat glioma C6 cells, and explore possible mechanisms. [score:1]
We identify miR-17 as an attractive molecule that can possibly be used as a biomarker to diagnose gliomas early and predict the prognosis, and current study provides the rationale for therapeutic approaches to enhance miR-17 in glioma cells. [score:1]
Lower level of miR-17 in gliomas may correlate with worse prognosis. [score:1]
Relative cell viability in different groups to the control group at 24 h was presented in Fig 5. MiR-17 inhibitor (200 nM) markedly increased the viability (1.5 ± 0.0 versus 1.4 ± 0.0, p < 0.05; Fig 5) and migration of glioma C6 cells (24 h: 0.86 ± 0.0 versus 1.2 ± 0.0, p < 0.05; 48 h: 0.90 ± 0.1 versus 1.3 ± 0.0, p < 0.05; Fig 6) compared to Lipofectamine control group. [score:1]
Therapeutic approaches to increase miR-17 levels may have potential in treating gliomas. [score:1]
MiR-17 miRNAs are produced from several miRNA gene clusters. [score:1]
The oncogenic potential of miR-17 gene clusters was first identified in mouse viral tumorigenesis screens [5]. [score:1]
However, it is unclear about the role of miR-17 in glioma cells. [score:1]
The results indicated that miR-17 was negatively correlated with Cyclin D1. [score:1]
Studies have revealed that miR-17 involves in several types of tumors, and effects of miR-17 on tumors vary depending on cells and tissue involved. [score:1]
[1 to 20 of 55 sentences]
19
[+] score: 170
When inhibit miR-17 in TNF-α-stimulated PDLSCs, protein expression level of osteogenic marker alkaline phosphatase (ALP) was downregulated (Fig.   3c). [score:8]
According to previous results in our lab, overexpression of miR-17 decreased expression levels of osteogenic markers and bone matrix formation, inhibition of miR-17 alone increased osteoblast marker genes, suggesting that miR-17 is a negative regulator of osteogenic differentiation in H-PDLSCs [3]. [score:8]
Furthermore, inhibition of miR-17 by anti-miR-17 oligonucleotides (si-miR-17) resulted in the upregulation of the protein expression level of HDAC9 (Fig.   3d). [score:8]
Interestingly, downregulation of HDAC9 by si-HDAC9 in P-PDLSCs restored the expression of pri-miR-17-92a as well as the mature miR17-92a, though, miR-18 was not affected, suggesting that HDAC9 inhibited miR17-92a (Fig.   3a, b). [score:8]
miR17-92a cluster is first described in 2001 [20] in mammalians, known as tissue-specific expressed onco-miR, forms signaling loop with myc protein, miR17-92a regulates more than a hundred targets involved in proliferation depending on different cellular context, their role in affecting the HDAC, which is responsible for the global proliferation inhibition remains unknown [21]. [score:8]
Consistent with these results, in the current study, Alizarin red staining showed that downregulation of miR-17 inhibited calcified nodule formation in TNF-α-stimulated H-PDLSCs (Fig.   3f). [score:6]
ChIP experiments revealed the promoter region of miR-17-92a HDAC9 enrichment in P-PDLSC samples, suggesting that HDAC9 inhibits the expression of miR17-92a by direct deacetylation (Fig.   3e). [score:6]
miR-17 in periodontal ligament stem cells targets the 3′ untranslated regions of a Smad ubiquitin regulatory factor one(Smurf1), which when activated under chronic inflammation, would lead to increased degradation of various osteoblast-specific factors [3]. [score:6]
We demonstrated that the inhibition of HDAC by NaB downregulated miR17-92a family and partially rescued inflammation impaired osteogenesis in vitro and in vivo. [score:6]
Comparison of the protein expression level of ALP (c) and HDAC9 (d) between P-PDLSCs and miR-17 inhibitor -treated P-PDLSCs. [score:5]
The miRNAs clusters, miR-17-92a, miR-106b-25, and miR-106a-363, have been found to control EZH2 expression, which is involved in H3K27me3 -mediated tumor suppressor genes in cancer [32]. [score:5]
Furthermore, simultaneous addition of si-miR-17 and NaB inhibited osteogenesis to a similar extent than using si-miR17 alone in TNF-α-stimulated H-PDLSCs, suggesting that the rescue of osteogenesis by NaB largely depended on the expression of miR-17 (Fig.   3f). [score:5]
When HDAC9 is inhibited by HDI, miR-17 has an inhibitory role in osteogenesis of PDLSC (data not shown). [score:5]
The expression of pri-miR-17~92a was downregulated in P-PDLSCs compared to H-PDLSCs (Fig.   3a). [score:5]
In our study, we showed that miR-17 is a new member of the epi-miRNA which inhibited the protein expression level of HDAC9. [score:5]
In the physiological conditions, miR-17 as well as HDAC9 forms an inhibitory balance to regulate the differentiation of PDLSCs and affect adjacent cells to regulate bone formation. [score:5]
Fig. 6 The mutual inhibition between HDAC9 and miR-17 in P-PDLSCs regulates the osteogenesis of PDLSCs and affects the bone regeneration in inflammatory condition a Schematic illustration of the LPS -induced periodontitis mo del in SD rats. [score:4]
miR-17 and HDAC9 negatively inhibit each other in regulation of osteogenic differentiation of PDLSCs in vitro. [score:4]
mir-17 and HDAC9 negatively inhibit each other in regulation of osteogenic differentiation of PDLSCs in vitro. [score:4]
Fig. 6 The mutual inhibition between HDAC9 and miR-17 in P-PDLSCs regulates the osteogenesis of PDLSCs and affects the bone regeneration in inflammatory condition Since adult stems cells have long been recognized as a critical population in restoring tissue function under inflammatory conditions, we asked if inflammation affects PDLSCs, the adult stem cells from periodontal ligament tissue and what specific effects has inflammation brought to PDLSCs. [score:4]
We further complement the story of HDAC9 and MSC by first identifying HDACs expression in PDLSC and finding that HDAC9 participates in osteogenic differentiation through interacting with miR-17 to repress RUNX2 transcription. [score:3]
According to our results, the overall role of miR-17 is likely to be closely associated with the expressional level of HDAC9. [score:3]
Fig. 3 a Comparison of the RNA expression level of pri-miR17-92a cluster between H-PDLSCs, P-PDLSCs, and si-HDAC9 -treated P-PDLSCs. [score:3]
miR-17 induced osteogenesis of inflamed periodontal adult stem cell through inhibition of HDAC9. [score:3]
f Analysis of calcified nodules by Alizarin red staining in NaB, si-miR-17, or NaB plus si-miR-17 -treated TNF-α-stimulated PDLSCs In order to find out if miR-17 plays important role in the inhibitory loop in osteogenesis of PDLSCs, we examined the effects of miR-17 on osteogenesis of PDLSCs. [score:3]
Finally, we revealed that the rescue of osteogenesis by HDAC inhibitor depended on miR-17. [score:3]
Taken together, the miR-17 and HDAC9 formed inhibitory loop under inflammatory conditions. [score:3]
Interestingly, the role of miR-17 in PDLSC differentiation can be shifted to either promotion of osteogenesis or inhibition of osteogenesis [16]. [score:3]
f Analysis of calcified nodules by Alizarin red staining in NaB, si-miR-17, or NaB plus si-miR-17 -treated TNF-α-stimulated PDLSCs a Comparison of the RNA expression level of pri-miR17-92a cluster between H-PDLSCs, P-PDLSCs, and si-HDAC9 -treated P-PDLSCs. [score:3]
b Comparison of the RNA expression of mature miR-17-92a between P-PDLSCs and si-HDAC9 -treated P-PDLSCs. [score:3]
This may explain why a co-inhibit relationship is needed between HDAC9 and miR-17. [score:3]
Inhibition of HDAC by NaB as well as si-miR-17 rescues osteogenesis of the human inflammatory PDLSCs. [score:3]
Statistical quantification of RUNX2 and OCN signal (right panel) The mutual inhibition between HDAC9 and miR-17 in P-PDLSCs regulates the osteogenesis of PDLSCs and affects the bone regeneration in inflammatory condition One of the key characteristics of chronic inflammation is its persistence. [score:2]
In previous studies, miR-17 promotes proliferation in the regulation of B cell lymphoma growth and retinoblastoma, and thus might delay differentiation 15, 26. [score:2]
Furthermore, miR-17 became a positive regulator of osteogenic differentiation in P-PDLSCs [3]. [score:2]
These evidences prompt us to verify that if miR-17-92a could regulate HDAC modulated dental tissue differentiation under inflammatory conditions. [score:2]
Furthermore, the transcription of miR-17 itself is regulated via deacetylation by HDAC9 in the promoter regions under inflammatory conditions. [score:2]
miR-17 is essential for NaB to rescue the osteo-differentiation of TNF-α-stimulated PDLSCs. [score:1]
We found a new epi-miRNA, the miR-17, which forms a reciprocal signaling loop with HDAC9 in PDLSCs under inflammation condition. [score:1]
However, the mechanisms underlying the shift of the role of miR-17 in osteogenesis needed further exploration. [score:1]
mir-17 and HDAC9 negatively affect each other under chronic inflammatory conditions in the adult stem cell in tooth tissue. [score:1]
e Analysis of the enrichment of HDAC9 protein at the pri-miR-17-92a cluster promoter region by Chromatin Immunoprecipitation (ChIP). [score:1]
We first examined the association of HDAC9 with miR-17~92a in PDLSCs of periodontitis patients. [score:1]
This is surprising since HDAC9 promotes proliferation and miR-17~92a belongs to the onco-miR family. [score:1]
Schematic illustration of the relationship between HDAC9, miR-17, and bone regeneration. [score:1]
We discovered that the onco-miR, miR-17 is a member of the epi-miRNAs. [score:1]
[1 to 20 of 46 sentences]
20
[+] score: 150
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-20a, hsa-mir-16-2, hsa-mir-15b
The expression of CDKN1A mRNA was seen to be regulated by miR-17-5p and miR-20a-5p, and this relationship was observed in HepG2 cells; CDKN1A mRNA transcription did not change in HepaRG® cells miR-17-5p and miR-20a-5p decrease the expression of cyclin -dependent kinase inhibitor 1A (CDKN1A) [16], whose expression was increased about 2.45-fold in the hypoglycemic condition in HepG2 cells, although its expression was not changed in normal hepatocytes HepaRG® cells (Table  2) [16]. [score:12]
The expression of CDKN1A mRNA was seen to be regulated by miR-17-5p and miR-20a-5p, and this relationship was observed in HepG2 cells; CDKN1A mRNA transcription did not change in HepaRG® cells miR-17-5p and miR-20a-5p decrease the expression of cyclin -dependent kinase inhibitor 1A (CDKN1A) [16], whose expression was increased about 2.45-fold in the hypoglycemic condition in HepG2 cells, although its expression was not changed in normal hepatocytes HepaRG® cells (Table  2) [16]. [score:12]
HSPA8 also belongs to the HSP70 family and inhibits apoptosis [12, 13], and this gene is targeted by miR-17-5p and miR-20a-5p, among the miRNAs shown in Table  1. Although expression of these two miRNAs greatly decreased (by about half), the expression of HSPA8 was increased only about 1.17-fold in the hypoglycemic condition in HepG2 cells, and its expression was not changed in normal hepatocytes (Table  2). [score:11]
The hypoglycemic condition decreased the expression of miRNA-17-5p and -20a-5p in hepatoma cells and consequently upregulated the expression of their target gene p21. [score:10]
On the other hand, the miR-17-5p inhibitor significantly increased the transcription of p21 (Fig.   4b) and protein expression was significantly inhibited when both miR-17-5 and miR-20a-5p were inhibited with the antisense RNA (Fig.   4b). [score:9]
The hsa-miR-17-5p mirVana® miRNA inhibitor (Ambion®, ThermoFisher Scientific K. K. ) and hsa-miR-20a-5p mirVana® miRNA inhibitor (Ambion®) were used to inhibit the expression of miRNAs. [score:9]
The expression levels of the target genes of the miR-17/92 cluster (HSPA8 and P21) were examined and the expression levels of mRNA (qPCR) and protein (western blotting) of HSPA8 (b) and P21 (c) were analyzed. [score:7]
Linkage between the target gene expression of the miR-17/92 cluster and c-Myc expression. [score:7]
In HepG2 cells, the expression of p21 was increased in the hypoglycemic condition and knockdown of mir-17-5p and -20a-5p increased the expression of p21. [score:6]
However, inhibition of miR-17-5p and -20a-5p did not alter the HSPA8 expression, suggesting that there is no regulatory correlation between HSPA8 and miR-17-5 and -20a-5p. [score:6]
We investigated whether this increased expression was linked with decreased expression of miR-17-5p and -20a-5p by inhibiting these miRNAs with antisense RNA. [score:5]
Fig. 3The expression levels of the miR-17/92 cluster and its target genes, HSPA1B and P21, in cells after incubation with various concentrations of glucose. [score:5]
These changes in the cell cycle and p21 expression were also found in cells transfected with the inhibitors for mir-17-5p and -20a-5p. [score:5]
a Effects of miRNA inhibitors indicated by ①-③ on the expression levels of miR-17-5p and -20a-5p. [score:5]
One of the target genes of mir-17-5p and -20a-5p is p21, which is a cell cycle regulator [16]. [score:4]
One of the known regulatory factors of the miR-17/9 cluster is c-Myc but we could not find any change in the expression of this protein. [score:4]
Further studies are needed to identify the regulatory factors of the miR-17/92 cluster that might link changes in the glucose concentration and miRNA expression. [score:4]
We found that changes in the glucose concentration induced the expression of miR-17-5p, − 18a, − 19a, and -20a-5p but we could not identify the factors regulating these miRNAs. [score:4]
One possible explanation is that there was a change in the binding affinity between c-Myc and the miR-17/92 cluster; another possible explanation involves the transcription factor E2F, which is reported to regulate the expression of the miR-17/92 cluster [20]. [score:4]
The expression of miR-17-5p, − 18a-5p, − 19a-3p, and -20a-5p was significantly decreased in the low glucose condition and was significantly increased in the high glucose condition (Fig.   3a). [score:3]
Because c-Myc facilitates transcription of the miR-17/92 cluster, we examined c-Myc expression in the low glucose condition using western blotting. [score:3]
These results suggest that a decreased glucose supply induces the cell cycle arrest of HepG2 cells in response to decreased expression of mir-17-5p and -20a-5p and the subsequent p21 increase. [score:3]
In response to these findings, we examined whether the expression of HSPA1B and miR-15b-5p/16-5p and that of HSPA8/p21 and miR-17-5p/20a-5p were coupled. [score:3]
a Cells were cultured with 200, 900, and 1800 mg/L of glucose for 1 week and the expression of the miR-17/92 cluster (miR17-5p, miR -18a-5p, miR -19a-5p, and miR -20a-5p) was analyzed. [score:3]
In HepG2 cells under hypoglycemic conditions, we found a significant decrease in the expression of miR-17-5p, − 18a-5p, − 19a-3p, and -20a-5p, which together comprise the functional miR-17/92 cluster (18). [score:3]
Fig. 4Effects of the hsa-miR-17-5p and hsa-miR-20a-5p mirVana® miRNA inhibitors. [score:3]
[1 to 20 of 26 sentences]
21
[+] score: 132
E6 can repress p21 transcription at the promoter level by inducing the degradation of the p21 transcriptional activator p53; sustained E6/E7 expression maintains the concentration of miR-17 family members in HPV -positive cancer cells which repress p21 expression by targeting the p21 mRNA; the E7 protein can directly bind to the p21 protein and inhibit its function. [score:10]
The inhibitors of miR-17–5p and miR-20a-5p but neither the inhibitor control nor the miR-19b-3p inhibitor led to a significant upregulation of p21 protein levels (Fig. 6D). [score:10]
Notably, five of these six miRNAs exhibit congruent changes between our functional experiments in vitro and their expression patterns in vivo in at least one study, i. e. reduction upon E6/E7 silencing in HeLa and upregulation in cervical cancer biopsies (miR-7–5p [43], miR-17–5p [27– 30, 34, 37], miR-186–5p [35]) or increase upon E6/E7 silencing in HeLa and downregulation in cervical cancer tissue (miR-23b-3p [28, 37] and miR-143–3p [23, 29, 31, 33, 37, 38, 82]) (S2 Dataset). [score:9]
Here, we took a closer look at members of the tumorigenic miR-17~92 cluster, since (i) miR-17–5p was among the top ten hits of abundant miRNAs of which the expression was maintained by the E6/E7 oncogenes, (ii) all other members of this cluster, as well as of the paralog cluster miR-106b~25, were also downregulated by E6/E7 silencing when applying less stringent selection criteria (S3 Table), (iii) several members of the miR-17~92 cluster are well-decumented to be overexpressed in cervical cancer tissues, including the tested miR-17–5p [27– 30, 34, 37] and miR-20a-5p [23, 30, 31, 34, 35] (also see S2 Dataset), and (iv) four of these miRNAs (miR-17–5p, miR-20a-5p, miR-93–5p, and miR-106b-5p) possess the same seed sequence and can bind to the 3’ UTR of the p21 mRNA [18]. [score:8]
Next, it was studied whether an experimental increase of mir-17~92 expression, encoding two p21 -targeting miRNAs, miR-17–5p and miR-20a-5p [18], can contribute to keep basal levels of p21 expression low in HeLa cells. [score:7]
Statistical significance of the qRT-PCR data was obtained for ten of these 17 miRNAs: downregulation of miR-17–5p, miR-186–5p, miR-378a-3p, miR-378f, miR-629–5p and miR-7–5p and upregulation of miR-143–3p, miR-23a-3p, miR-23b-3p and miR-27b-3p, upon E6/E7 silencing (Fig. 2E and indicated in bold in S2 Table). [score:7]
Further qRT-PCR analyses revealed that all detectable additional members the miR-17~92 and miR-106b~25 clusters were also downregulated upon silencing of endogenous E6/E7 expression (S3 Table). [score:6]
HPV E6/E7 increase intracellular levels of members of the oncogenic miR-17~92 cluster that reduce p21 expression in HPV -positive cancer cellsThe 52 most abundant cellular miRNAs that were downregulated > 1.5-fold upon E6/E7 silencing in both deep sequencing and qRT-PCR analyses encompassed miR-17–5p and miR-19b-3p, two members of the miR-17~92 cluster, and miR-93–5p, a member of the paralog miR-106b~25 cluster (Fig. 2D/E). [score:6]
These include members of the miR-17~92 cluster, which are expressed at increased levels by sustained E6/E7 expression and repress the anti-proliferative p21 gene in HPV -positive cancer cells. [score:5]
Taken together, these results indicate that continuous E6/E7 oncogene expression in HPV -positive cancer cells is required to maintain miRNAs of the oncogenic miR-17~92 cluster at a level that keeps expression of the anti-proliferative p21 gene low. [score:5]
Notably, basal p21 expression in HeLa cells was reduced by overexpression of the miR-17~92 cluster, both at the mRNA and protein level (Fig. 6B/C). [score:5]
Our findings that miR-17–5p and miR-20a-5p inhibitors significantly induced endogenous p21 protein levels, indicates that oncogenic HPVs reduce p21 expression in cervical cancer cells by increasing the intracellular concentrations of members of this miRNA seed family. [score:5]
Consistently, we observed that the sustained endogenous E6/E7 expression is linked to an increase of miRNAs with growth promoting potential (e. g. members of the miR-17~92 cluster blocking p21 expression). [score:5]
The 52 most abundant cellular miRNAs that were downregulated > 1.5-fold upon E6/E7 silencing in both deep sequencing and qRT-PCR analyses encompassed miR-17–5p and miR-19b-3p, two members of the miR-17~92 cluster, and miR-93–5p, a member of the paralog miR-106b~25 cluster (Fig. 2D/E). [score:4]
miR-17~92 and miR-106b~25 levels upon silencing of endogenous E6/E7 expression. [score:3]
HPV E6/E7 increase intracellular levels of members of the oncogenic miR-17~92 cluster that reduce p21 expression in HPV -positive cancer cells. [score:3]
Specifically, continuous E6/E7 expression is necessary to maintain high intracellular levels of miR-7–5p, miR-629–5p, miR-378a-3p, miR378f, miR-17–5p, and miR-186–5p (S2 Table), which all have been linked to pro-tumorigenic activities. [score:3]
Transfection of a mir-17~92 expression vector led to an increase of miR-17–5p, miR-20a-5p, miR-19b-3p and miR-92a-3p levels, as expected, but not of miR-34a-5p, which served as a negative control (Fig. 6A). [score:3]
Four miRNAs encoded by the miR-17~92 and miR-106b~25 clusters (miR-17–5p, miR-20a-5p, miR-106b-5p, miR-93–5p) are grouped into the miR-17 family, according to their identical seed sequence, and target two binding sites in the 3’ UTR of p21 [66, 67]. [score:3]
1004712.g006 Fig 6Effects of miRNAs of the miR-17~92 cluster on p21 expression in HeLa cells. [score:3]
control”) that carries no homology to any known mammalian gene or with specific miRNA inhibitors of miR-17–5p, miR-20a-5p, and miR-19b-3p. [score:3]
miR-17~92: vector coding for the mir-17~92 cluster; “control”: repective empty expression vector. [score:3]
Effects of miRNAs of the miR-17~92 cluster on p21 expression in HeLa cells. [score:3]
miR-17–5p, miR-20a-5p, miR-19b-3p, miR-92a-3p: encoded by the mir-17~92 expression vector; miR-34a-5p: negative control (not encoded by the vector). [score:3]
The plasmid expressing the mir-17~92 cluster (pcDNA3.1/V5-His-TOPO-mir17~92, [123]) was a gift from Joshua Men dell (Addgene plasmid # 21109) and the pcDNA3.1 empty vector (Life Technologies) was used as negative control. [score:3]
In reciprocal experiments, we investigated whether the downmodulation of miR-17–5p and miR-20a-5p in HeLa cells might result in an upregulation of p21 levels. [score:2]
They encompass several family members with identical seed regions, including the let-7 family (let-7a-5p, let-7d-5p, let-7f-5p, let-7g-5p), miR-378 family (miR-378a-3p, miR-378c), miR-99 family (miR-99a-5p, miR-100–5p), as well as members of the miR-17~92 cluster (miR-20a-5p, miR-92a-3p). [score:1]
The 23 miRNAs comprise several family members of the miR-378 family (miR-378a-3p, miR-378c, miR-378d, miR-378f), as well as members of the miR-17~92 and miR-106b~25 clusters (miR-17–5p, miR-19b-3p, miR-93–5p). [score:1]
miR-17–5p is discussed in more detail below. [score:1]
miR-20a-5p and miR-92a-3p are both members of the miR-17~92 cluster. [score:1]
The oncogenicity of miRNAs has been particularly well demonstrated for members of the miR-17~92 cluster (also called “oncomir-1”; coding for miR-17, miR-20a, miR-18a, miR-19a, miR-19b and miR-92a) and of its paralog cluster miR-106b~25 (coding for miR-106b, miR-93 and miR-25) [18]. [score:1]
[1 to 20 of 31 sentences]
22
[+] score: 131
We showed that MAPK1 (ERK2, a potential target of miR-143), MAPK8 (JNK1, a demonstrated target of miR-455-3p), MAPK9 (JNK2, a demonstrated target of miR-17, miR-20b, and miR-106a), and p21 and RB (potential targets of miR-17 and miR-106a) were strongly upregulated at protein level upon inhibition of the miRNAs. [score:14]
Because the expression of the miR-17 family is directly controlled by the proto-oncogene MYC [32]– [34] and because we have recently demonstrated (7) that in human keratinocytes lacking p63, MYC expression is down regulated, the down-regulation of miR-17, miR-20, miR-106a, miR-143 and miR-455-3p genes we observed in keratinocytes lacking p63 could be due to MYC down-regulation. [score:13]
While we systematically confirmed that miR-17 was inhibited (Figure 4A), western blots demonstrated that MAPK9, RB, and p21 were up-regulated upon miR-17 depletion, suggesting that they could be a direct target of miR-17, while MAPK1 was only slightly increased upon inhibition of miR-17 and LIMK1 was not (Figure 4B). [score:11]
MAPK1, p21, and MAPK9 silencing resulted in K1 and K10 up-regulation in miR-20b -depleted cells as already observed in miR-17-knockdown cells, but the inhibition of LIMK1 and RB did not have any effect on K1 and K10 expression (Figure 5D). [score:9]
0045761.g007 Figure 7 Under the control of p63, the mir-17 family acts on keratinocyte proliferation via down-regulation of p21, RB and keratinocyte differentiation via MAPK signaling, essentially by inhibition of MAPK9 (JNK2) which is a direct target of the miR-17 family. [score:9]
Under the control of p63, the mir-17 family acts on keratinocyte proliferation via down-regulation of p21, RB and keratinocyte differentiation via MAPK signaling, essentially by inhibition of MAPK9 (JNK2) which is a direct target of the miR-17 family. [score:9]
Using luciferase::3′UTR reporter constructs we further confirmed that MAPK9 was a direct target of miR-17, miR-20b, and miR-106a, since inhibitors of these miRNAs increased luciferase activity (Figure 4G), while mimic of the miR-17 family, on the contrary, inhibited the reporter activity (Figure S1B). [score:8]
It is noteworthy that RB was up-regulated upon either miR-17 (2.72 fold, Figure 4B) or miR-106a depletion (4.31 fold, Figure 4F) and we observed that the double knockdown of these genes restored the expression of K1 and K10. [score:7]
As we did not demonstrate in this study that p21 and RB were direct targets of miR-17, the inhibitory arrow is presented as a dot line. [score:6]
Our study demonstrated that p63-regulated miR-17 and miR-106a could target RB and p21. [score:4]
We also demonstrated that LIMK1 was not a direct target of miR-17, miR-20b, or miR-106a (Figure 4H). [score:4]
Specific knockdown of MAPK1, p21, LIMK1, and RB showed no effect on K1 or K10 expression in cells lacking miR-17 (Figure 5C). [score:4]
We observed the up-regulation of K1 and K10 only when MAPK9 was silenced in miR-17 -deficient cells (Figure 5C). [score:4]
0045761.g004 Figure 4(A, C, and E) Expression levels of miR-17 (A), miR-20b (C), and miR-106a (E) in double knockdown of miRNAs and of their targets was systematically measured by RT-qPCR. [score:4]
We found that miR-17, miR-20b and miR-106a were strongly downregulated in keratinocytes lacking p63. [score:4]
Using bioinformatics tools, we obtained a list of putative targets (approximately 1,000 genes) of the miR-17 family. [score:3]
The following miRNA inhibitors (LNA) were obtained from Exiqon: hsa-miR-143 (138515-00), hsa-miR-455-3p (138667-00), hsa-miR-30a (138468-00), hsa-miR-17 (138461-00), hsa-miR-20b (138221-00), hsa-miR-106a (138477-00), and hsa-miR-18 (138462-00), and scramble miR (199002-04) was used as a negative control. [score:3]
Based on their level of expression in human primary keratinocytes in culture (data not shown) and their biological relevance, we chose several potential candidates from our list: miR-17, miR-18a, miR-20b, miR-30a, miR-106a, miR-143 and miR-455-3p. [score:3]
The miR-17 family also target MAPKs. [score:3]
In this study, we have characterized multiple miRNAs, including the mir-17 family (miR-17, miR-20b, miR-106a) and miR-30a, miR-143 and miR-455-3p, which are downregulated in p63-silenced keratinocytes, suggesting that they act downstream of p63. [score:2]
In conclusion, our results highlight the roles of several miRNAs, particularly the miR-17 family, as regulatory intermediates for coordinating p63 with MAPK signaling in the control of the proliferation/differentiation balance in human mature keratinocytes (Figure 7). [score:2]
MiR-17, miR-20b and miR-106a belong to the miR-17 family. [score:1]
Finally hsa-miR-455-3p mirVana® mimic and hsa-miR-17 mirVana® mimic were obtained from Qiagen. [score:1]
As proposed in figure 7, the well-characterized role of p63 in keratinocyte proliferation could be partly modulated via the miR-17 family -dependent inhibition of RB and p21. [score:1]
The miR-17 family plays a role in embryonic stem cell differentiation [39] and adipocyte differentiation [40]; however, little is known about its involvement in keratinocyte differentiation. [score:1]
This result is in agreement with recent studies showing that the miR-17 family is a proto-tumorigenic group (also known as oncomir-1) [37]. [score:1]
[1 to 20 of 26 sentences]
23
[+] score: 130
To further confirm whether impaired c-Myc expression was responsible for the decreased expression of miR-17 and miR-20 upon NC treatment, we detected the expression of miR-17 and miR-20a in K562 stably overexpressing c-Myc. [score:9]
We antagonized the expression of miR-17/20a by transfection of their specific antisense oligonucleotides (AS) or negative control (scramble oligonucleotides, SC) prior to NC treatment in K562 stably overexpressing c-Myc, and found both c-Myc and miR-17/20a were involved in upregulation of p21 induced by NC (S1 Fig. ). [score:8]
We found that c-Myc downregulation led to decreased expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 (Fig. 5B), which were consistent with the effects of NC shown in Fig. 5A. [score:6]
We found NC could markedly upregulate p21 (Fig. 5F), whereas overexpression of miR-17 and miR-20a antognized the protein level increment of p21 in K562 cells after treatment with NC (Fig. 5G). [score:6]
Our results showed that continuous overexpression of c-Myc significantly reversed miR-17 and miR-20a expression in K562 cells exposed to NC (Fig. 5C and D). [score:5]
Expression profiling had shown that miR-17 and miR-20a were overexpressed in varieties of solid tumors and hematopoietic malignancies, including MLL-rearranged leukemia [52], T-cell acute lymphoblastic leukemia [28, 53] and B-cell lymphoma [54, 55]. [score:5]
Members of the miR-17–92 cluster targeted numerous cancer suppressor genes, e. g. Pten [55], BIM [56], E2F1 [57], p21 [28] and STAT3 [58], showing functions in differentiation and apoptosis. [score:5]
We also observed that a specific group of miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were activated by c-Myc and executed part of c-Myc functions in leukemia development [11, 20, 21, 22], was markedly downregulated. [score:5]
miR-17–92 cluster was frequently amplified or overexpressed in CML CD34 [+] cells and abnormal expression of miR-17–92 greatly increased proliferation of CML stem cells [11]. [score:5]
Downregulation of miR-17/20a reversed c-Myc mediated abrogation of p21 in the present of NC. [score:4]
In our study, we found miR-17 and miR-20a were downregulated in the process of erythroid differentiation and apoptosis induced by NC in K562 cells. [score:4]
We found that most of them, especially miR-17 and miR-20a showed significant downregulation after NC treatment. [score:4]
We next examined the effects of NC on the expression of c-Myc activated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were typically increased in leukemia and triggered to the development of leukemia [11, 20, 21, 22]. [score:4]
Infection of K562 cells with LV-miR-17 or LV-miR-20a lentiviral particles caused a significant upregulation of mature miR-17 or miR-20a level (Fig. 5E). [score:4]
The expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, which were reported to be dependent on c-Myc transcriptional activity [27, 48, 49, 50] and contribute the development of leukemia [11, 20, 21, 22], was examined in K562 cells treated with NC. [score:4]
miR-17 and miR-20a are two representative members of a highly conserved gene cluster miR-17–92, a miRNA polycistron also known as oncomir, and might have parallel roles through regulating the same target genes as they contain the same seed sequence [51]. [score:4]
These results suggested downregulation of c-Myc was responsible for NC induced decrease of miR-17 and miR-20a. [score:4]
The relative expression of mature miR-17 (C), miR-20a (D) was detected by real-time qRT-PCR. [score:3]
Furthermore, overexpression of c-Myc or miR-17/20a alleviated NC induced differentiation and apoptosis in K562 cells. [score:3]
By flow cytometry, we found overexpression of miR-17 or miR-20a reversed apoptosis induced by NC (Fig. 5I). [score:3]
p21 was reported to be one of the target genes of miR-17 and miR-20a [28]. [score:3]
Next we found that the c-Myc protein level (Fig. 6D) and miR-17/20a (Fig. 6E) level were decreased after NC treatment in primary CML cells, illustrating that inhibition of c-Myc and c-Myc activated miRNAs was involved in the biological effects of NC. [score:3]
We found that NC treatment could markedly improve globin γ expression, which was accordant with our previous studies (Fig. 1D), while miR-17 or miR-20a could remarkably weaken the incremental effects of NC on globin γ (Fig. 5H, right 3 lanes). [score:3]
The relative expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 was detected by real-time qRT-PCR. [score:3]
To determine the expression level of mature miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells, All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used following manufacturer’s protocol. [score:3]
We next explored the effects of c-Myc inactivation on the expression of the tumor associated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells. [score:3]
miR-17 and miR-20a overexpression partly attenuated NC -induced differentiation and apoptosis, suggesting that miR-17 and miR-20a might take part in tumorigenesis of CML. [score:3]
Furthermore, we detected the effect of miR-17 or miR-20a on the expression of globin γ with or without NC treatment in K562 cells. [score:3]
These evidences supported that NC elicited erythroid differentiation and apoptosis were regulated by the biological effects of c-Myc-activated miRNAs, particularly miR-17 and miR-20a. [score:2]
The pri-miR-17 or pri-miR-20a PCR products were inserted into pLVTHM plasmid to generate pLV-miR-17 and pLV-miR-20a plasmid, which were used to produce lentiviral particles. [score:1]
The relative level of mature miR-17 and miR-20a were detected by real-time qRT-PCR. [score:1]
MiR-17 and miR-20a antagonized NC -induced differentiation and apoptosis of K562 cells. [score:1]
Previous studies showed that p21 could be modulated by both c-Myc and members of miR-17 family [29, 30]. [score:1]
0116880.g005 Fig 5(A) K562 cells were treated with 0, 4 or 8 μM NC for 2 days, the relative levels of mature miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 were detected by real-time qRT-PCR. [score:1]
Taken together, these results suggested that c-Myc-activated miR-17/20a was involved in the erythroid differentiation and apoptosis induced by NC in CML cells. [score:1]
To investigate whether overexpression of miR-17 or miR-20a would influence the ability of NC to induce erythroid differentiation, we constructed lentiviral vectors harboring pri-miR-17 or pri-miR-20a sequence. [score:1]
To package LV-miR-17, LV-miR-20a or control lentiviral particles, Hek293T cells were co -transfected with a mixture of 10μg pLV-miR-17, pLV-miR-20a or pLVTHM, and 6.67μg psPAX2, 3.3μg pMD2. [score:1]
Our results revealed that NC treatment decreased the relative levels of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, among which miR-17 and miR-20a showed the sharpest decrement by 65.0 ± 0.6% and 62.6 ± 2.6%, respectively (Fig. 5A). [score:1]
[1 to 20 of 38 sentences]
24
[+] score: 109
Data leading to this concludion include the following: Firstly, we provided new evidence to show that cMyc could stimulate expression of miR-17∼92 cluster miRNAs, among others, during early stage of human fibroblastic cell reprogramming; Secondly, forced expression of miR-17∼92 cluster with 4F or 3F enhanced human iPSC induction; Thirdly, miR-19a and miR-19b of the miR-17∼92 cluster were key members that play critical roles in this process; Lastly, PTEN was a target of miR-19a/b that mediated the effect of miR-17∼92 cluster on human fibroblast reprogramming. [score:7]
These results indicated that forced cMyc expression regulates many miRNAs in the early stage of human iPSCs induction, with miR-17∼92 cluster miRNAs being among the most significantly upregulated. [score:7]
Error bars, s. d. ; n = 3. C. Mature miRNA expressions of miR-17-92 cluster were analyzed by qRT-PCR in 293T cells transfected with miR-19a or miR-19b truncated vector or vector expressing the complete miR-17∼92 cluster. [score:5]
Collectively, these results indicate that tumor suppressor PTEN is a major target of miR-17∼92 in facilitating iPSC induction of human fibroblasts. [score:5]
Importantly, we further demonstrated that the enhancement of reprogramming by miR-17∼92 was mediated by suppression of tumor suppresser protein PTEN. [score:5]
And the results showed that miRNAs of the miR-17∼92 cluster were indeed up-regulated by cMyc (Figure 1C). [score:4]
Error bars, s. d. ; n = 3. Our array data showed that four members of miR-17∼92 cluster were among the most significantly upregulated miRNAs in both 4F and cMyc only transfected cells (Figure 1A). [score:4]
Compared to the combination of miR-17∼92 with EV control, we found that overexpression of PTEN lacking the targeting sequence of miR-19a/b abrogated the stimulating effects of miR-17∼92 on reprogramming (Figure 4E, 4F). [score:4]
Error bars, s. d. ; n = 3. Our array data showed that four members of miR-17∼92 cluster were among the most significantly upregulated miRNAs in both 4F and cMyc only transfected cells (Figure 1A). [score:4]
To further determine whether miR-17∼92 enhanced reprogramming by repressing PTEN, we combined PTEN overexpression with miR-17∼92 in the 4F -induced reprogramming. [score:3]
E. The enhancing effect of miR-17∼92 on iPSC induction with IMR90 cells was attenuated by PTEN overexpression. [score:3]
The retroviral vectors expressing mouse miR-17∼92 cluster and deletion mutants were cloned in MSCV-PIG [33] (a gift from Andrea Ventura, Memorial Sloan Kettering Cancer Center). [score:3]
To further validate the results of the antagomir experiment, we used miR-19a- or miR-19b- truncated miR-17∼92 cluster expressing vector for iPSC induction [33]. [score:3]
A. The relative induction efficiency normalized to that of 4F -induced reprogramming: IMR90 cells were infected with retroviruses containing 4F (Oct4, Sox2, Klf4, cMyc) in the presence of an additional retroviral vector expressing miR-17∼92 cluster or its empty vector, respectively. [score:3]
To this end, we induced iPSCs in the presence of 4F together with miR-17∼92 and PTEN that didn't contain the targeting sequence of miR-19a/b. [score:3]
We further validated the expression profile of miR-17∼92 by Real-time PCR in IMR90 infected with retrovirus encoding 4F, 3F or GFP as control. [score:3]
Our studies demonstrate for the first time that miR-17∼92 cluster stimulates human fibroblast reprogramming by targeting PTEN, with miR-19a and miR-19b playing a predominant role. [score:3]
0095213.g002 Figure 2. A. The relative induction efficiency normalized to that of 4F -induced reprogramming: IMR90 cells were infected with retroviruses containing 4F (Oct4, Sox2, Klf4, cMyc) in the presence of an additional retroviral vector expressing miR-17∼92 cluster or its empty vector, respectively. [score:3]
B. The relative induction efficiency normalized to that of 3F -induced reprogramming:IMR90 cells were infected with retroviruses containing 3F (Oct4, Sox2, Klf4) in the presence of an additional retroviral vector expressing miR-17∼92 cluster or its empty vector. [score:3]
The pluripotency and developmental potential of miR-17∼92-derived iPSCs. [score:2]
By microarray and qRT-PCR analysis, we discovered that cMyc regulated many miRNAs, most notably miR-17∼92 cluster members, during early stage of reprogramming. [score:2]
The numbers of iPSCs clones were significantly increased by miR-17∼92 cluster as compared to 4F alone or 4F with control virus expression (Figure 2A). [score:2]
These results suggest that the iPSCs induced by transduction with 4F and miR-17∼92 are pluripotent. [score:1]
Error bars, s. d. ; n = 3. Having observed the significant induction of miR-17∼92 cluster miRNAs in the early stage of reprogramming process, we sought to further study the function of miR-17∼92 in the reprogramming. [score:1]
Our results showied that four out of the six miR-17∼92 cluster miRNAs were significantly induced by cMyc during early stage of reprogramming suggested that those miRNAs might be critical for human somatic reprogramming. [score:1]
Hence, we focused to decipher the roles miR-17∼92 cluster miRNAs might play during reprogramming of human fibroblast cells and its underlying mechanisms. [score:1]
To examine the developmental potentials of the miR-17∼92-derived iPSCs, we used standard human embryoid bodies (EBs) cultivation assay (Figure 2D). [score:1]
We found that miR-17∼92 cluster, miR19a and miR19b in particular, enhanced human fibroblast reprogramming, in the presence or absence of cMyc. [score:1]
D. iPSCs by 3F plus miR-17∼92 (3F+mi-C7) were culture in suspension condition to form embryoid bodies (left). [score:1]
For this purpose, we induced iPSCs using 3F combined with miR-17∼92 cluster or control, and found that, as with 4F, miR-17∼92 also significantly enhanced somatic reprogramming without cMyc (Figure 2B). [score:1]
To determine whether miR-17∼92-enhanced reprogramming could generate bona fide iPSCs, we derived stable cell lines from cultures of 4F plus miR-17∼92 (4F+mi-C1 and 4F+mi-C3) and 3F plus miR-17∼92 (3F+mi-C7). [score:1]
To determine the key components of miR-17∼92 that facilitate reprogramming, we used mimics of these six miRNAs in 4F induction. [score:1]
Hence, we surmise that it is not by a mere coincidence to discover that, mir19a/b, known to be the most oncogenic miRNAs of miR-17∼92 cluster in tumorigenesis progress [27], [36], are also key components to facilitate reprogramming of human somatic cells. [score:1]
Not like the whole cluster, the truncated forms of miR-17∼92 failed to enhance the number of 4F -induced iPSCs (Figure 3D, 3E). [score:1]
Figure S2 The iPSCs clones derived from miR-17∼92 are bona fide iPS cells. [score:1]
C. Immunofluorescence staining of ESC pluripotency markers TRA-1-81, TRA-1-60, OCT4 and SOX2 in iPSC colonies generated from IMR90 by 4F plus miR-17∼92 (4F+mi-C1) and 3F plus miR-17∼92 (3F-mi-C7) Nuclei were stained with DAPI (blue). [score:1]
D. Deletion of miR-19a or miR-19b in miR-17∼92 cluster decreased the efficiency of reprogramming in IMR90 cells induced by 4F. [score:1]
These results showed that miR-17∼92 cluster promoted iPSC induction in the presence or absence of cMyc. [score:1]
F. Deletion of miR-19a or miR-19b in miR-17∼92 cluster decreased the efficiency of reprogramming in IMR90 cells induced by 3F. [score:1]
C. Reverse-transcript PCR analysis of the pluripotency genes in the iPSC clones generated from IMR90 cells induced by 3F or 4F in the presence or absence of miR-17∼92 as indicated. [score:1]
Taken together, the data indicate that miR-19a and miR-19b are the key components of miR-17∼92 cluster in human fibroblastic cell reprogramming. [score:1]
miR-19a and miR-19b are the key components of miR-17∼92 cluster in human fibroblast reprogramming. [score:1]
Having observed the significant induction of miR-17∼92 cluster miRNAs in the early stage of reprogramming process, we sought to further study the function of miR-17∼92 in the reprogramming. [score:1]
Using the pMSCV (retro-base)-PIG-17∼92 (PIG-17∼92) that encodes whole cluster of miR-17∼92 [27], we observed that HEK293T cells transfected with PIG-17∼92 can generate ∼3-fold of more mature miRNAs than control group (Figure S2A). [score:1]
The miR-17∼92 cluster is a primary transcript that processes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a. [score:1]
miR-19a and miR-19b are the key components of miR-17∼92 cluster in reprogramming. [score:1]
To investigate the effect of miR-17∼92 on iPSC induction, we infected IMR90 cells with miR-17∼92 cluster, together with the four retroviral vectors expressing Oct4, Sox2, Klf4 and cMyc (OSKM, or 4F). [score:1]
miR-17∼92 cluster enhances human somatic cell reprogramming. [score:1]
We next studied whether miR-17∼92 would increase the iPSC induction without cMyc (OSK, or 3F). [score:1]
The iPSCs generated with miR-17∼92 exhibited hESC morphology and were alkaline phosphatase (AP) and TRA-1-81 positive (Figure S2B). [score:1]
[1 to 20 of 50 sentences]
25
[+] score: 108
Other miRNAs from this paper: hsa-mir-20a
d TRIM8 endogenous expression in MCF-7 cell lines transfected with miR-17 inhibitor or miR-control inhibitor. [score:7]
To experimentally in vitro test whether TRIM8 is directly targeted by miR-17 and miR-20a, the 3′UTR of TRIM8 gene carrying wild type and mutated miRNA seed was inserted into a luciferase reporter vector and the entire genomic coding region of the miR-17-92 cluster was cloned into pcDNA3 expression plasmid. [score:6]
On the other hand, MCF-7 cells transfected with miR-17 inhibitor had a slight increased expression of TRIM8 mRNA when compared with miR control inhibitor (Fig.   3d). [score:6]
e Immunoblotting analysis by using indicated antibodies on whole protein lysate from U87MG transfected with a construct carrying the ORF and 3′UTR of TRIM8 or the ORF and 3′ UTR of TRIM8 containing a deletion of miR-17 complementary site and a miR-17 mimic, miR-17 inhibitor, or miR-control Next, to test whether miR-17 or miR-20a directly target the 3′UTR of TRIM8, HEK293 cells were co -transfected with 3′UTR TRIM8 reporter construct along with a synthetic mimic of miR-17 or of miR-20a. [score:6]
Finally we showed that miR-17 directly targets the 3′UTR of TRIM8 and post-transcriptionally represses the expression of TRIM8. [score:6]
e Immunoblotting analysis by using indicated antibodies on whole protein lysate from U87MG transfected with a construct carrying the ORF and 3′UTR of TRIM8 or the ORF and 3′ UTR of TRIM8 containing a deletion of miR-17 complementary site and a miR-17 mimic, miR-17 inhibitor, or miR-controlNext, to test whether miR-17 or miR-20a directly target the 3′UTR of TRIM8, HEK293 cells were co -transfected with 3′UTR TRIM8 reporter construct along with a synthetic mimic of miR-17 or of miR-20a. [score:6]
Accumulating data have indicated that the inhibition of miR-17 significantly reduce cell viability and increases apoptotic activity in glioma cell lines and the upregulation of this miRNA is associated with advanced tumour progression and poor overall survival of gliomas [20]. [score:6]
Finally we provide experimental evidences showing that miR-17 directly targets the 3′ UTR of TRIM8 and post-transcriptionally represses the expression of TRIM8. [score:6]
Overall these evidences demonstrate that miR-17 regulates TRIM8 expression at both transcriptional and post-transcriptional level by directly binding the 3′UTR region of TRIM8. [score:5]
Due to the deviation from normality distribution assumption, all statistical analyses were performed using the log-transformed expressions for TRIM8 in glioma cell lines and tissues, whereas the square root transformation was applied for miR-17-5p expression levels only. [score:5]
Finally, we found a slight negative correlation between TRIM8 and miR-17 expression in glioma tissue in grade II (r = −0.172, p = 0.020) and glioblastoma (r = −0.088, p = 0.038) patients from TCGA cohort, supporting the assertion that miR-17 might contribute to modulate TRIM8 expression in gliomas (data not shown). [score:5]
miR-17 regulates TRIM8 expression at the post-transcriptional level. [score:4]
Up regulation of miR-17, associated with advanced tumor progression and poor overall survival of gliomas [10], has been shown to reduce the levels of TRIM8 in primary chronic lymphocytic leukemia cells, although a direct regulation was not yet demonstrated [11]. [score:4]
In order to assess whether miR-17 also regulates protein level of TRIM8 in glioma cells, we co -transfected U87MG cells with a pcDNA3-FLAG vector containing the ORF and 3′UTR of TRIM8 (hereafter named TRIM8-3′UTR), along with synthesized miR-17 or miR-17 inhibitor, respectively. [score:4]
Moreover we showed that TRIM8 expression is regulated by miR-17 at transcriptional and post-transcriptional level. [score:4]
The level of TRIM8-tagged fusion protein was reduced by miR-17 mimic and enhanced by miR-17 inhibitor (Fig.   3e). [score:3]
Collectively, these results indicated that the 3′UTR of TRIM8 is targeted by miR-17. [score:3]
The reporter construct, pSV-Renilla (pRL-SV40, Promega) and miR-17 mimic (or miR-17-5p hairpin inhibitor or miR-20a mimic, Dharmacon) or pcDNA3- miR-17-92 were transfected into H1299, HEK293 or MCF-7 cells using Hyperfect Transfection Reagent (Qiagen) or Lipofectamine 2000 (Life Technologies). [score:3]
In keeping with our luciferase data, qPCR results showed a negative correlation between miR-17 and TRIM8 expression levels in several human cell lines including breast and glioma cells (Fig.   3c). [score:3]
A qPCR for miR-17 expression in glioma cell lines and tissues was performed using TaqMan miRNA Reverse Transcription kit according to the manufacturer’s instructions. [score:3]
c Detection of TRIM8 endogenous expression by qPCR in MCF-7, HeLa, HEK293, and U87MG cell lines transfected with miR-17 mimic or miR-control. [score:3]
Bomben R, Gobessi S, Bo MD, Volinia S, Marconi D, Tissino E, Benedetti D, Zucchetto A, Rossi D, Gaidano G et al. : The miR-17 approximately 92 family regulates the response to toll-like receptor 9 triggering of CLL cells with unmutated IGHV genes. [score:2]
As shown in Fig.   3b the overexpression of miR-17 significantly reduced the luciferase activity of the vector containing the 3′UTR of TRIM8 when compared to the control (p = 0.005). [score:2]
As a result, we found that the 3′UTR of TRIM8 contains two putative conserved miR-17 and miR-20a binding sites. [score:1]
b HEK293 cells were co -transfected with reporter constructs carrying the 3′UTR of TRIM8 or 3′ UTR of TRIM8 containing mutated miR-17 complementary site and a synthetic mimic of miR-17, mimic of miR-20a, or miR-control (miR-CNT). [score:1]
Our preliminary results suggest the existence of a feedback circuit involving miR-17 and TRIM8 for glioma pathogenesis. [score:1]
TRIM8 Glioblastoma miR-17 Cell proliferation Human gliomas are a heterogeneous group of primary malignant brain tumors, which most commonly occur in central nervous system of both children and adults [1]. [score:1]
Moreover, our preliminary results suggest that TRIM8 and miR-17 may be part of a same circuit involved in glioma pathogenesis, although further experiments are needed to confirm the involvement of this modulation in gliomagenesis. [score:1]
Mutagenesis was used to delete miR-17 binding site using the QuickChange II kit (Stratagene). [score:1]
[1 to 20 of 29 sentences]
26
[+] score: 108
Let-7c, miR-17, miR20a, and miR-30d were the four miRNAs out of the 275 analyzed by both RT-qPCR and RNAseq that showed differential expression (p<0.05) between normal and diseased cells with the same direction in change (up- or down-regulated) by both methods. [score:9]
For miR-17, RT-qPCR showed a decrease in expression in VICs from severely diseased valves compared with both that of normal and mildly diseased valves, but significant decrease was only seen in RNAseq when comparing between mildly diseased and normal valves (d). [score:8]
TGF-βR1/2 are direct targets of miR-20a and miR-17 [24, 35], and for the canine species, TGF-βR is also a predicted target for these two miRNA [20, 21]. [score:6]
On the other hand, the RT-qPCR data show a more robust decrease in miR-17 with disease development than the RNAseq data, where a statistical significant decrease was noted only in cells from mildly diseased valves. [score:6]
miR-17 levels were decreased in VICs from severely diseased valves compared with either VICs from normal or mildly diseased valves based on RT-qPCR analysis (p = 0.005, FC = -7.4), but this decrease was only significant when comparing between mildly diseased and normal valves based on RNAseq analysis (p = 0.048) (Fig 7d). [score:6]
Similar to miR-20a and miR-17, let-7c has also been found to target TGF-βR1 [23], and it was reported to be a key inhibitor for fibroblast proliferation and migration during wound healing [36]. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
PCA and HCL analyses of the four miRNAs of interest (let-7c, miR-17, miR-20a, and miR-30d) using both RT-qPCR and RNAseq data also supported the observed miRNA differences between VICs from severely diseased valves and those from normal and mildly diseased valves. [score:5]
Given the increase in median age for the dogs in the mildly and severely diseased group, we have also analyzed the effect of age on miRNA expression levels and did not find any age -associated change in let-7c, miR-17, miR-20a, and miR-30d. [score:5]
We have demonstrated that miRNA dysregulation (let-7c, miR-17, miR-20a, and miR-30d) may participate in canine MMVD development, and these miRNA should be explored further as potential therapeutic targets. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
In fact, the entire miR-17-92 cluster is commonly found to be downregulated in senescent cells, and decreases in both miR-20a and miR-17 have been correlated with the increase in transcription of p21 [26]. [score:4]
Downregulation of miR-20a, miR-17, and let-7c is associated with TGF-β signaling. [score:4]
Because our candidate miRNA (let-7c, miR-17, miR-20a, and miR-30d) were deemed differentially expressed by both techniques, we believe that the probability for false positive or spurious changes is decreased, thus strengthening our findings. [score:3]
The ability of miR-20a, miR-17, and let-7c to control the phenotypic transformation of VICs into myofibroblasts will need to be tested with overexpression of these three miRNAs in VICs. [score:3]
Based on the RT-qPCR and RNAseq analyses, decreases in miR-20a and miR-17 expressions were noted in VICs harvested from severely affected valves. [score:3]
Let-7c, miR-17, miR-20a, and miR-30d were decreased in VICs of diseased valves. [score:3]
In addition, miRNA profiling of VICs using both RT-qPCR and RNAseq showed decreases in expressions of let-7c, miR-17, miR-20a, and miR-30d. [score:3]
The decrease in miR-17 expression seen in MMVD valves was similar to the findings by Chen et al., although in that study, the MMVD valves were compared to valves affected by fibroelastic deficiency [14]. [score:2]
Given that TGF-β had been implicated in MMVD in people [9], the interaction of miR-20a, miR-17, and let-7c with TGF-βR is of particular interest to myxomatous mitral valve development. [score:2]
To directly link miR-20a and miR-17 to these observations, a gain and loss of function test will need to be performed. [score:2]
miR-17 and miR-20a temper an E2F1 -induced G1 checkpoint to regulate cell cycle progression. [score:2]
In this study of canine MMVD, we observed dysregulated miRNAs associated with the control of myofibroblastic differentiation, extracellular matrix (let-7c, miR-17, miR-20a), and senescence and apoptosis (miR-17, miR-20a, miR-30d) [23– 31]. [score:2]
Both miR-20a and miR-17 belong to the miR-17-92 cluster, where miR-20a and miR-17 can be grouped together as one functional unit [34]. [score:1]
In addition, this same decrease in miR-17 was found in human myxomatous mitral valves when comparing to valves affected by fibroelastic deficiency [14]. [score:1]
Hierarchical clustering of let-7c, miR-17, miR-20a, and miR-30d using both RT-qPCR and RNAseq data. [score:1]
Normalized RT-qPCR C [q] number and RNAseq count number for let-7c, miR-17, miR-20a, and miR-30d. [score:1]
Decreases in miR-20a and miR-17 are associated with cell senescence. [score:1]
0188617.g007 Fig 7Normalized RT-qPCR C [q] number and RNAseq count number for let-7c, miR-17, miR-20a, and miR-30d. [score:1]
Principal component analysis of let-7c, miR-17, miR-20a, and miR-30d using both RT-qPCR and RNAseq data. [score:1]
The critical role that miR-20a and miR-17 play in controlling cell senescence is of interest in the canine MMVD mo del. [score:1]
severe (p<0.05) cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7f, cfa-miR-127, cfa-miR-1271, cfa-miR-130a, cfa-miR-139, cfa-miR-17, cfa-miR-1836, cfa-miR-1837, cfa-miR-20a, cfa-miR-23a, cfa-miR-25, cfa-miR-26a, cfa-miR-29b, cfa-miR-378, cfa-miR-421, cfa-miR-502, cfa-miR-503, cfa-miR-542, cfa- miR-652, cfa-miR-653, cfa-miR-872 Normal and mild vs. [score:1]
In addition, it is unclear if let-7a, miR-17, miR-20a, and miR-30d are differentially sorted into exosomes by VICs. [score:1]
[1 to 20 of 33 sentences]
27
[+] score: 107
Similar to miR-17, miR-221 and/or miR-222 are highly upregulated, often without concurrent upregulation of miR-17 ~ 92, in various cancers including glioblastoma [53], liver cancer [54], pancreatic cancer [55- 58], bladder cancer [59], gastric cancer [60, 61], ovarian cancer [62], urothelial carcinoma [63], nodal marginal zone lymphoma [64], and papillary thyroid carcinoma [65]. [score:7]
c-Myc driven miR-17-92 expression has been shown to promote tumor angiogenesis [36], and inhibition of miR-17-5p and miR-20a induces apoptosis in lung cancer cells [70] and leads to induction of apoptosis, cellular senescence, and growth inhibition of thyroid cancer cells [45]. [score:7]
In GBM, we found that patients in whom the expression of the antagonists predominates have poorer overall survival, which suggests that while both miR-17 and its relatives and miR-221/222 may be good biomarkers for detecting tumor cells, high miR-221/222 expression maybe a better predictor of poor outcome. [score:5]
In glioblastoma a high ratio of miR-17 to miR-221/222 was predictive of better overall survival suggesting that high miR-221/222 expression is more adverse for patients than high miR-17 expression. [score:5]
Early on, a correlation with c-Myc expression was noticed, and enforced expression of miR-17 ~ 92 accelerated B cell lymphoma formation in mice [66]. [score:5]
Of the two non-miR-17 family members (miR-103 and miR-149) among the agonists in our study, miR-103 is upregulated in bladder cancer [59], esophageal squamous cell carcinoma [67], gastric cancer [68], and colon cancer [69]. [score:4]
When compared to the expression in normal control tissue, the expression of miR-221/222 in KIRC was as high as that of miR-17 ~ 92 cluster miRNAs (Figure  4B). [score:4]
miR-17 ~ 92 drives proliferation by targeting a number of cell cycle regulators of the G/S transition [71]. [score:4]
This is consistent with the regulation of miR-17 by c-Myc and with the fact that miR-17 is part of a regulatory network with E2F (see discussion below). [score:3]
While miR-17 and miR-221/222 are functionally antagonistic, they are both often upregulated in cancer, and both are considered to be oncogenic in cancer cells [41- 65]. [score:3]
There was no correlation between the miR-17 to 221/222 ratio and tumor grade or stage (data not shown) suggesting that the ratio of agonists to antagonists does not change much during tumor progression, but does suggest that different miRNAs are expressed in different patients. [score:3]
While all three E2Fs can activate the miR-17 ~ 92 promoter [38], E2F2 and E2F3 are also targets of miR-17 ~ 92 miRNAs [39]. [score:3]
A large group of miRNAs containing mostly members of the three miR-17 gene clusters (highlighted in blue in Figure  1A, B, and C) functionally antagonized a group of miRNAs whose expression correlated with mesenchymal genes. [score:3]
In all three cancers, the cluster that most significantly correlated with the expression of c-Myc induced genes contained a large number of miR-17 miRNAs: cluster XI in OvCa, cluster XI in GBM, and cluster III in KIRC (highlighted in blue in Figure  2). [score:3]
miR-17 and all its homologues are wi dely recognized as highly oncogenic miRNAs [33], while the cluster I epithelial specific miRNAs are viewed as tumor suppressive in most solid cancers [34]. [score:3]
miR-17 is known to be regulated by and to regulate c-Myc and E2F [32, 36- 39]. [score:3]
Our data suggest that while it cannot be excluded that agonists and antagonists act in the same cells or in different areas of the tumor, patients express different ratios of agonists/antagonists, and the predominance of the miR-221/miR-222 oncogenic miRNAs results in poorer outcome than does predominance of miR-17 family members. [score:3]
However, by comparing different patients, we found that in some patients, expression of miR-17 family members predominated, whereas in others miR-221/222 predominated. [score:3]
Overexpression of miR-17 ~ 92 has also been reported in solid cancers including lung cancer [41, 42], colon cancer [43, 44], thyroid cancer [45], gastric cancer [46], nasopharyngeal carcinoma [47], hepatocellular carcinoma [48], lung squamous cell carcinoma [49], malignant glioma [50], and pancreatic cancer [51]. [score:3]
miR-17 has been implicated in tumor angiogenesis, cell cycle, and cell death regulation, while miR-221/222 has been linked to cell proliferation in cancer. [score:2]
miR-17 was identified as part of an autoregulatory loop with E2F proteins. [score:2]
The top three most highly enriched clusters of genes that correlated with the agonist groups of miRNAs (most prominently miR-17) suggested that the agonistic miRNAs positively regulate cell cycle and DNA replication. [score:2]
In all analyses, most members of the miR-17 family were clustered with miRNAs that correlated with c-Myc regulated genes and genes that are part of E2F gene signatures. [score:2]
Among the miRNAs that antagonize the miR-17 group in all three cancers, only two were shared. [score:1]
The three fold symmetry of the PCA plot suggested that the miRNA world is divided in at least three cancer relevant activities whereby epithelial miRNAs are antagonized by mesenchymal miRNAs, which are c-Myc repressed, and epithelial miRNAs functionally antagonize c-Myc induced miRNAs, most notably members of the miR-17 family. [score:1]
The agonistic group of miRNAs shares 8 members of the miR-17 cluster plus miR-103 and miR-149 in all three cancers, based on the analysis of both positively and negatively correlating genes (Additional file 9: Table S8-1). [score:1]
miRNAs: blue, miR-17 family; dark green, miR-221/222 family; red, EMT-related miRNAs (miR-200 family); orange, other EMT-related miRNAs (miR-7, 203 or 375). [score:1]
We found that genes in 9 oncogenic signatures positively correlated and 15 signatures negatively correlated with a group of agonistic miRNAs that were dominated by members of the miR-17 family (p < 0.001) (Figure  1C). [score:1]
that positively correlate with agonistic miRNAs (containing miR-17 family members) are highlighted in green, and signatures that negatively correlate are highlighted in red. [score:1]
A number of these oncogenes are known to be connected to the miR-17 family. [score:1]
Interestingly, the 8 miR-17 family members are found in all three miR-17 gene clusters and all 4 seed families (Additional file 5: Figure S3). [score:1]
In fact, miR-17 ~ 92 was reported to be a component of a solid cancer miRNA signature [52]. [score:1]
In all three cancers, patients with a high miR-221/222 to miR-17 ratio had poorer long term survival. [score:1]
Epithelial specific miRNAs are highlighted in red and members of the miR-17 family of miRNAs are highlighted in blue. [score:1]
The genomic clusters and seed families of the miR-17, miR-221/222 and miR-200 families. [score:1]
In each cancer, all 10 agonistic miRNAs (miR-17 family members, miR-103 and miR-149) were clustered, as were the antagonistic miRNAs (miR-221/222). [score:1]
We therefore conclude that in all three cancers miR-221/222 antagonize the miR-17 family. [score:1]
Subsequently, it was recognized that c-Myc activates the miR-17 ~ 92 cluster [32, 36, 37]. [score:1]
The miR-17 group and miR-221/222 are antagonistic in three cancers. [score:1]
Consequently, most of the data on miR-17 miRNAs are in the context of its role as an oncogene in blood cancers. [score:1]
One group (the agonists), which contains many of the members of the miR-17 family, correlated with c-Myc induced genes and E2F gene signatures. [score:1]
The agonist miRNAs that we found to correlate with a large number of oncogenic gene signatures were dominated by members of the three miR-17 gene clusters (Additional file 5: Figure S3). [score:1]
In all three cancers, the major agonistic miRNA group contained members of the miR-17 clusters (highlighted in dark blue). [score:1]
The most prominent miRNA family present in cluster V are family members of the miR-17 ~ 92 cluster and its related paralogs, the miR-106 ~ 363 and miR-106 ~ 25 clusters. [score:1]
The miR-17 ~ 92 cluster of miRNAs was originally identified as being amplified in B cell lymphoma patients. [score:1]
miRNAs: red, miR-200 family; blue, miR-17 family; orange, other EMT-related miRNAs recently identified [4] (miR-7, miR-203, and miR-375). [score:1]
There are three, not necessarily mutually exclusive, possible explanations: 1) The patient population is heterogeneous, and in some patients tumors are driven mostly by miR-17 miRNAs and in others tumors are driven by miR-221/222. [score:1]
One group (the "agonists") is dominated by members of the miR-17 gene clusters, the other (the "antagonists") contains miR-221 and miR-222. [score:1]
[1 to 20 of 48 sentences]
28
[+] score: 105
More subtly, transgenic mice that have been engineered to overexpress miR-17∼92 by 2-fold in lymphocytes develop lymphoproliferative disease and autoimmunity and die prematurely, phenotypes that were shown to be partially a consequence of the translational repression of PTEN and Bim [30]. [score:7]
Altered levels of miR-17∼92 and miR-106b∼25 are known to play crucial roles in mammalian cell regulation and have been implicated in numerous hyperproliferative diseases although the mechanisms driving their altered expression are unknown. [score:6]
Functionally, slight perturbations to the levels of mature miR-17∼92-derived miRNAs can have profound biological consequences; knock-in mice engineered to produce twice as much miR-17∼92-derived miRNAs as wildtype mice suffer lymphoproliferative phenotypes, autoimmunity and a shortened life-span linked to the loss of the PTEN tumor suppressor and the pro-apoptotic factor Bim, which are both validated targets of miR-17∼92 [30]. [score:6]
Indeed, the miR-17∼92 and miR-106b∼25 clusters appear to attenuate apoptotic responsiveness by targeting several mRNAs encoding pro-apoptotic effectors and favor progression from G1 to S-phase by targeting mRNAs that encode negative regulators of the cell cycle [19], [20]. [score:6]
We show that both the primary transcripts for miR-17∼92 and miR-106b∼25 and the pivotal miRNAs that are derived from miR-17∼92 display increased abundance in Toxoplasma-infected primary human cells; a Toxoplasma -dependent up-regulation of the miR-17∼92 promoter is at least partly responsible for this increase. [score:4]
This absence of an effect is consistent with the fact that while many of these miRNAs are extremely important in the animal [30], [32], they are largely dispensable for simple, in vitro growth of cell lines (miR-17∼92 knockout MEFs have no obvious in vitro growth defect and, in general, most commonly used transformed cell lines dramatically overexpress miR-17∼92). [score:4]
The transcription of pri-miR-17∼92 has been shown to be positively regulated by E2F3 [38] and c-Myc [37] transcription factors, and pri-miR-106b∼25 is positively regulated by E2F1 [40]. [score:3]
Whether this or one of the other injected Toxoplasma effectors is responsible for the alterations in host miR-17∼92 and miR-106b∼25 expression, and what role these changes play on the host-pathogen interaction in vivo are the focus of on-going work. [score:3]
In adult animals, miR-17∼92 and miR-106b∼25 have been shown to influence the functionally intertwined pathways of apoptosis and G1/S cell cycle progression by targeting multiple components of each pathway [20]. [score:3]
The ultimate, downstream target of these changes in miRNAs, in terms of benefit to the parasite, is not clear; in the set of HFF mRNAs that decrease in abundance upon Toxoplasma infection [5], there is no significant enrichment for mRNAs containing predicted miR-17∼92 or miR-106b∼25 binding sites (data not shown). [score:3]
The importance of these functions have been demonstrated by showing that retroviral overexpression of a cassette containing miR-17, miR-18 and miR-19 in mice results in c-Myc -induced lymphoma [29]. [score:3]
MiR-17∼92 is also known by the synonym OncomiR-1 due to the observed acceleration of lymphomagenesis when these miRNAs are over-expressed in Eµ-Myc mice [29]. [score:3]
Second, concurrent analyses using locked nucleic acid -mediated knockdown of miR-17∼92- and miR-106b∼25-derived miRNAs was performed using a wide range of conditions in mouse fibroblasts and HFFs. [score:2]
MiR-17∼92 is crucial in development, as mice harboring a homozygous deletion of miR-17∼92 die shortly after birth due to pulmonary and cardiac defects and develop abnormal B-cell lymphocytes [32]. [score:2]
Ultimately, a conditional knockout of miR-17∼92 in a miR-106b∼25 -null background will be necessary to score the full biological role(s) of these miRNAs in Toxoplasma-infected animals. [score:2]
Unfortunately, as homozygous miR-17∼92 knockout mice are not viable [32] dissecting the impact of these genes on Toxoplasma pathogenesis is technically difficult. [score:2]
Extensive Affymetrix microarray profiling of Toxoplasma-infected wildtype- or miR-17∼92 -knockout MEFs showed no statistically significant differences in mouse mRNA levels 24h post infection (data not shown). [score:2]
To investigate whether the Toxoplasma infection -dependent increase in pri-miR-17∼92 abundance is the result of increased transcription from this locus, we performed a dual luciferase assay with a reporter plasmid [38] containing a 1.3kb fragment located upstream of C13ORF25 fused to a promoter-less firefly luciferase (FLUC) cassette (pro1353::FLUC; see Figure 5A); this 1.3kb upstream fragment of C13ORF25 overlaps the 5′ terminus of the C13ORF25 expressed sequence tag (EST) by 10 nucleotides and has been previously shown to drive firefly luciferase expression [38]. [score:2]
The abundance of mature miR-17 family members, which are derived from these two miRNA clusters, remains unchanged in host cells infected with the closely related apicomplexan Neospora caninum; thus, the Toxoplasma -induced increase in their abundance is a highly directed process rather than a general host response to infection. [score:2]
Red boxes are miR-17 family members; blue boxes are miR-18 family members. [score:1]
MiRNA microarray profiling reveals that Toxoplasma infection increases the levels of miR-17-, miR-18- and miR-19 -family members. [score:1]
The results presented here demonstrate that Toxoplasma infection specifically drives an increase of 2–3 fold in the levels of mature miR-17∼92-derived miRNAs in primary human foreskin fibroblasts. [score:1]
The microarray profiling data showed that the miR-17 family and the miRNA families that are co-transcribed with it were generally more abundant in RNA samples from Toxoplasma-infected cells and that the abundance of these miRNAs marginally increased at 6-hours post-infection and showed greater increases at 12-hours and 24-hours post-infection (Figure 1C). [score:1]
Toxoplasma-infected HFFs have elevated levels of pri-miR-17∼92 and pri-miR-106b∼25. [score:1]
The level of pri-miR-17∼92 in HFFs infected with Toxoplasma relative to uninfected HFFs was ∼3.6-fold greater whereas HFFs infected with Neospora showed no such increase (∼0.7-fold relative to uninfected HFFs). [score:1]
These data strongly suggest that the increased level of pri-miR-17∼92 seen in Toxoplasma-infected HFFs is a result of increased miR-17∼92 transcription rather than alterations in the stability of pri-miR-17∼92, as only 10 nucleotides from the pri-miR-17∼92 transcript are present in the luciferase reporter construction. [score:1]
miR-17∼92 and miR-106b∼25 are encoded in the 3rd intron of C13ORF25 and the 13 [th] intron of MCM7, respectively; for these genes, exons are indicated as boxes, and introns are lines. [score:1]
As miR-17 family members are co-transcribed with members of the miR-18 (Figure S1, blue box), miR-19 and miR-25 families, and are encoded in three separate paralogous loci (miR-17∼92, miR-106a∼363 and miR-106b∼25; Figure 1B), we assembled a heat-map from our microarray data that contains the averaged fold-change values for all probes that hybridized to members of the miR-17, miR-18, miR-19 or miR-25 families (18, 4, 4, and 4 probes, respectively; Figure 1C). [score:1]
From top to bottom panels, probes are: miR-17∼92, miR-106b∼25 and RPS29. [score:1]
To our knowledge this represents the first report of a pathogen that specifically increases the levels of miR-17∼92 and/or miR-106b∼25. [score:1]
0008742.g001 Figure 1(A) Sequence alignment of miR-17 family members. [score:1]
We conclude that the increased level of miR-17 family members seen in Toxoplasma-infected cells is Toxoplasma-specific and is not a general host response to apicomplexan infection. [score:1]
Figure S2 Northern blot analysis demonstrates that Toxoplasma infection results in increased levels of mature miR-17 family members. [score:1]
The levels of miR-17∼92-derived miRNAs reported here are at least partially due to a Toxoplasma -dependent increase in pri-miR-17∼92 transcription. [score:1]
The rows are the averaged data from all probes that are predicted to hybridize to members of the indicated miRNA families; these families represent all miRNAs encoded by the miR-17∼92, miR-106a∼363 and miR-106b∼25 clusters. [score:1]
Colors of each miRNA indicate the miRNA family to which each belongs; miR-17 = yellow; miR-18 = green; miR-19 = blue; miR-25 = red. [score:1]
Examples relevant to the present work are four families of miRNAs (miR-17, miR-18, miR-19 and miR-25) that are encoded by three paralogous loci; these related loci, which are miR-17∼92, miR-106b∼25 and miR-106a∼363 (see Figure 1B), produce primary transcripts that are post-transcriptionally processed to yield mature miR-17, miR-18, miR-19 and miR-25 family members. [score:1]
The raw data shown in Figure 2A confirmed that the levels of mature miR-17 family members increased as a function of time in RNA samples derived from Toxoplasma-infected HFFs. [score:1]
During such infection only a subset of miRNAs are affected and an increase in miR-17∼92-derived miRNAs is not seen when cells are similarly infected with the closely related coccidian Neospora. [score:1]
The situation is further complicated by the fact that both pri-miR-17∼92 and pri-miR-106b∼25 are increased upon Toxoplasma infection and these two clusters are believed to be partially functionally redundant. [score:1]
First, we performed high-resolution northern blot analysis for miR-17. [score:1]
Consistent with the microarray data, the northern blot results showed that, collectively, the level of mature miR-17 family members increased ∼2.7-fold in Toxoplasma-infected HFFs relative to uninfected HFFs (Figure S2). [score:1]
RNA samples derived from uninfected HFFs (- lanes), and from HFFs infected with Toxoplasma for 24h (+ lanes) were resolved through a 10% acrylamide/8M urea gel, transferred to nylon membrane, and hybridized to miR-21, miR-17 and U6 oligonucleotide probes (corresponding probes are indicated underneath autoradiographs). [score:1]
Toxoplasma infection increases pri-miR-17∼92 transcription. [score:1]
Neospora infection does not alter the levels of miR-17 family members. [score:1]
Upon Toxoplasma infection, miR-17 family members collectively increased ∼3-fold, and miR-19 and miR-25 family members increased ∼1.5-fold. [score:1]
It is, therefore, probable that the Toxoplasma -dependent increase in the levels of pri-miR-17∼92 and pri-miR-106b∼25 are at least in part due to such changes in host transcription factors. [score:1]
The data also showed that the pre-miR-17 signal was a small fraction of the hybridization signal observed for mature miR-17, suggesting that the contribution of pre-miR-17 to the observed miRNA microarray hybridization intensity was negligible, an interpretation that is consistent with previous data [31]. [score:1]
We focused our attention on 18 microarray spots (9 closely related human and mouse probe sequences that were spotted in duplicate) that displayed comparable increases in hybridization intensities on arrays hybridized with RNA derived from infected HFFs (Figure S1, red boxes); these 18 spots contained probes that hybridized to members of the miR-17 family (the miR-17 family is composed of miR-17, miR-106a, miR-106b, miR-20a, miR-20b and miR-93; see Figure 1A for a sequence alignment of the miR-17 family). [score:1]
The 6-nucleotide seed region that defines the miR-17 family is indicated in yellow. [score:1]
The mature miRNAs encoded by miR-17∼92 and its paralog miR-106b∼25 play important roles in mammalian biology. [score:1]
Hence, even relatively modest increases in the levels of miR-17∼92, of a magnitude less even than seen here with Toxoplasma infection, have profound biological consequences in vivo. [score:1]
Whatever the biological role of these miRNAs in Toxoplasma infection, the results presented here demonstrate that increases in miR-17∼92-derived miRNAs are a specific response to Toxoplasma infection. [score:1]
First, we infected primary mouse fibroblasts (MEFs) harboring a miR-17∼92 deletion [32]. [score:1]
Nucleotide differences from the miR-17 sequence are shown in boldface blue type. [score:1]
To understand the role of increased miR-106b∼25 and/or miR-17∼92 in Toxoplasma infection we took several approaches. [score:1]
These results suggest that the mature miR-18 and miR-19 family members that increase upon infection with Toxoplasma are derived from miR-17∼92; although pri-miR-106b∼25 is also increased in Toxoplasma-infected cells, miR-106b∼25 does not encode miR-18 and miR-19 family members and, consistent with previous reports [32], [37], no pri-miR-106a∼363 was detectable. [score:1]
Whether the increases in miR-17∼92-derived miRNAs are mediated by c-Myc, E2F or another pathway, the identity of the parasite factor(s) that drive these changes are unknown. [score:1]
Figure 4 shows that hybridization with the pri-miR-17∼92 probe yields a ∼3.2kb band which is a size previously published for the pri-miRNA derived from this cluster [37]. [score:1]
[1 to 20 of 59 sentences]
29
[+] score: 104
We observed knockdown of a luciferase reporter following ectopic miRNA expression and enhanced expression of LMP1 when miR-17/20/106 miRNAs were inhibited, consistent with the canonical activity of miRNAs [10]. [score:8]
We also observed upregulation of p21 (CDKN1A), a known target of miR-17/20/106 in B cells [66], which we also confirmed as a miR-17/20/106 target by PAR-CLIP (Tables S10- S14). [score:8]
Over -expression of the miR-17/92 cluster or the miR-106b/25 cluster in 293T cells significantly decreased luciferase expression from pLSG-LMP1, indicating these miRNAs are indeed targeting the LMP1 3′UTR (Figure 6D). [score:7]
Western blot analysis of LMP1 protein levels showed upregulation of LMP1 when the activity of endogenous miR-17/20/106 family members was inhibited (Figure 6F). [score:6]
Possibly, the downregulation of LMP1, and also BHRF1, expression by miR-17/20/106 is important during the transition from latency III to latency I in vivo. [score:6]
F. Inhibition of endogenous miR-17/20/106 in LCL35 increases the protein levels of LMP1 and p21 (CDKN1A), a known target of miR-17/20/106. [score:5]
miRNA-sponged LCLs were generated by transducing LCL35 with pLCE-sCXCR4 (control sponge, described in [81]) or pLCE-s17/20/106, containing nine imperfect target sites for miR-17, miR-20a, or miR-106a in the 3′UTR of GFP [81], and FAC-sorting for high GFP -expressing cells 48-hrs post-infection. [score:5]
miR-17 and miR-20a are two of six miRNAs expressed from the miR-17/92 cluster, while miR-106b and miR-93 are expressed from the miR-106b/25 cluster [65], [66]. [score:5]
Three lines of evidence demonstrate that the LMP1 3′UTR is targeted by the c-myc-regulated miRNA clusters miR-17/92 and miR-106b/25. [score:4]
As the cellular miRNAs for miR-17/92 and miR-106b/25 clusters are evolutionarily conserved in mammals, we wondered whether the target sites in the BHRF1 and LMP1 3′UTRs might also be conserved. [score:3]
LCL35 was transduced with pLCE-CXCR4s (control sponge, CXCR4s) or pLCE-miR-17/20/106s (sponge for miR-17/20/106) and FAC-sorted for high GFP expression. [score:3]
We tested eleven miRNA expression vectors, including six viral miRNAs (miR-BART1, miR-BART2, miR-BART3, miR-BART4, miR-BHRF1-1, and miR-BHRF1-2) and five cellular miRNAs or miRNA clusters (miR-155, miR-146a, miR-128, miR-17/92, and miR-106b/25) against the panel of 3′UTRs. [score:3]
LCL35 was transduced with pLCE-CXCR4s or pLCE-miR-17/20/106s, FAC-sorted for high GFP expression, and lysates harvested 10 days post-FACS for Western blot analysis. [score:3]
Together, these data show that the miR-17/20/106 family can target the LMP1 3′UTR in LCLs during latent EBV infection. [score:3]
The miR-17/92 cluster targets viral transcripts. [score:3]
Interestingly, both miR-17/92 and miR-106b/25 are transcriptional targets of c-myc [65], [66]. [score:3]
LMP1 is targeted by the miR-17/92 cluster. [score:3]
D. miR-17/92 and miR-106b/25 inhibit the LMP1 3′UTR reporter. [score:3]
E. Inhibition of endogenous miR-17/20/106 using a sponge. [score:3]
These observations provide evidence in support of an evolutionarily conserved role for miR-17/20/106 -dependent regulation of LMP1 and BHRF1 transcripts during viral infection. [score:2]
Figure S4 The miR-17/20/106 binding sites in LMP1 and BHRF1 are conserved in rLCV. [score:1]
miR-17/92 includes reads mapping to miR-17, 18a, 19, 20a, and 92a. [score:1]
Intriguingly, predicted mml-miR-17/20/106 binding sites in both the rLCV BHRF1 and LMP1 3′UTRs were identified, and similar to the hsa-miR-17/20/106 sites in EBV, exhibited extensive pairing in the seed region (Figure S4A-D). [score:1]
The miR-17/20/106 sponge contains nine imperfect binding sites within the 3′UTR of GFP for miR-17, miR-20a, or miR-106a (Table S15); miR-106b and miR-93 differ from these three miRNAs in their 3′ non-seed sequences (Figure 6C, Table S1- S4). [score:1]
Sequences of the LMP1 (A and B) and BHRF1 (C and D) 3′UTRs from EBV and rLCV were analyzed for miR-17/20/106 seed match sites using RNAhybrid. [score:1]
Preliminary studies with viruses in which the miR-17/20/106 binding site is mutated indicate that this site is not essential for B cell transformation in vitro (Feederle et. [score:1]
One of these sites contained a seed match for the cellular miR-17/20/106/93 seed family and was detected in all five PAR-CLIP libraries (Figure 6B-C, Tables S10- S14). [score:1]
The functional relevance of the miR-17/20/106 site within the LMP1 3′UTR is currently unclear. [score:1]
First, we identified binding sites for the miR-17/20/106 seed family within the LMP1 3′UTR by PAR-CLIP (Figure 6). [score:1]
We identified a second miR-17/20/106 seed match site in the BHRF1 3′UTR. [score:1]
Furthermore, these miR-17/20/106 seed match sites appear to be highly conserved in the rLCV LMP1 and BHRF1 3′UTRs (Figure S4). [score:1]
For miR-17/92 and miR-106b/25, regions encompassing the entire pre-miRNA clusters were cloned. [score:1]
A-D. The EBV and rLCV latent transcripts, LMP1 and BHRF1, contain miR-17/20/106 seed match sites in their 3′UTRs. [score:1]
C. The LMP1 3′UTR contains an extensive seed match to the miR-17/20/106/93 family. [score:1]
In addition to the confirmed miR-17/20/106 site within the LMP1 3′UTR, we identified a second binding site for the miR-17/20/106 seed family in the 3′UTR of BHRF1 (Figure S4; Tables S10- S14). [score:1]
To further confirm the miR-17/20/106/93 interaction with the LMP1 3′UTR, we introduced a control sponge (sCXCR4) or a miR-17/20/106 sponge (s17/20/106) into LCL35 to disrupt endogenous miRNA activity (Figures 6E and S2). [score:1]
Shown are the mature miRNA sequences for miR-106a, miR-17, and miR-20a as identified by deep sequencing and the sequence of the LMP1 3′UTR cluster containing the seed match site. [score:1]
Shown are the PAR-CLIP identified sites for human miR-17/20/106 in EBV mRNAs and the predicted sites for macaque miR-17/20/106 in rLCV mRNAs. [score:1]
[1 to 20 of 38 sentences]
30
[+] score: 103
By analyzing the miRNA expression profiles of NSCLC patients, we found that five miR-17 family members were significantly overexpressed, the expression of RB1 was significantly down-regulated, and E2F1 expression was not significantly different (Additional file 1: Table S7). [score:12]
Is provided as the ratio of overlap genes and original genes after bootstrappings; Table S2 is the hub TFs and miRNAs of lung cancer synergistic regulatory network; Table S3 is the hub miRNAs and TFs of subnetwork Ito X; Table S4 is the count of motif types (subnetworks) miRNAs or TFs belong to; Table S5 shows specific functions of miRNA-TF regulatory subnetwork Ito X; Table S6 indicates target genes (E2F1 and RB1) predictive results of the miR-17 family; Table S7 is provided as differential expression analysis of the miR-17 family and RB1 by SAM; Table S8 is a list of miRNA-target relation predictive algorithms and databases used in our work. [score:9]
Hesan et al. [59] confirmed the up-regulation of four members of the miR-17 family in colorectal carcinoma tissues and showed that they promote cell proliferation and tumor growth by targeting the RND3 tumor suppressor gene. [score:8]
The overexpressed miR-17 family may directly decrease the translation of RB1, thereby lowering the expression of the RB1 protein. [score:8]
Moreover, E2F1 promotes the transcription of the miR-17 family, which causes overexpression of the miR-17 family members, thereby governing cell cycle and proliferation of lung tumors by targeting RB1 protein. [score:5]
According to the full regulation subnetwork and expression analysis, we proposed a predictive mo del of the miR-17 family, E2F1 and RB1 in the regulation of cell cycle and cellular proliferation. [score:5]
We found that the miR-17 family exerted important effects in the regulation of non-small cell lung cancer, such as in proliferation and cell cycle regulation by targeting the retinoblastoma protein (RB1) and forming a feed forward loop with the E2F1 TF. [score:5]
In subnetwork I, RB1 was targeted by members of the miR-17 family (Additional file 1: Table S6) and E2F1, while the miR-17 family members and E2F1 targeted each other, thereby forming an FFL. [score:5]
MiR-17 and miR-20a were reported to induce apoptosis in lung cancer cells [35] and miR-34 s was found to be dramatically down-regulated in NSCLC [58]. [score:4]
Finally, we proposed a hypothetical mo del to explain the role of the miR-17 family in regulating cell cycle and tumor progression by targeting the RB1 protein in NSCLC. [score:4]
Notably, four of the top 10 hub miRNAs belonged to the miR-17 family, namely has-miR-106a/106b/20a/20b, indicating that these miR-17 family members are vital regulators in the regulatory network of human lung cancer. [score:3]
In the mo del, five out of six miR-17 family members were significantly overexpressed in NSCLC cells where they enhanced the repression of the RB1 gene, which is responsible for the G1 checkpoint and blockage of S-phase entry and cell growth. [score:3]
Moreover, many regulatory relationships support our predictive mo del of the miR-17 family, E2F1, and RB1 motif, which demonstrates the effectiveness of our regulatory network. [score:3]
A similar phenomenon was reported for the miR-17-92 cluster (miR-17/20a/18a/19a/19b-1/92-1), which forms a FBL with E2F1, and plays roles in regulating cellular proliferation and apoptosis. [score:2]
The two common members, miR-17 and miR-20a, were shown to temper an E2F1 -induced G1 checkpoint to regulate cell cycle progression [50]. [score:2]
Next, we examined the mechanism by which the miR-17 family regulates cell cycle and tumor progression in lung cancer using a hypothetical mo del. [score:2]
A similar group, the miR-17-92 cluster with two members that were common with the miR-17 family, had diverse functions in the regulation of cellular differentiation, proliferation, and apoptosis. [score:2]
The miR-17 family (in an FFL with the E2F1and the RB1) was found to be an important family in the lung cancer regulation network. [score:2]
We proposed a mo del for the miR-17 family, E2F1, and RB1 to demonstrate their potential roles in the occurrence and development of non-small cell lung cancer. [score:2]
In this work, we proposed a mo del to predict the regulatory role of the miR-17 family in the cell cycle via RB1 and E2F1. [score:2]
Common motifs, such as feedforward loops (FFLs) and feedback loops (FBLs), have been found to play crucial roles in gene regulation, such as the miR-17 cluster, the E2F1, and the c-Myc that modulates cellular proliferation in cancer [19]. [score:2]
Notably, three TFs (STAT1, E2F1, and ESR10) participated in all motifs and seven miRNAs participated in all motifs, namely hsa-miR-106a, hsa-miR-20a, hsa-miR-17, hsa-miR-19b, hsa-miR-381, hsa-miR-21, and hsa-miR-221. [score:1]
All miR-17 family members shared 8–15 bases with the E2F1 conserved sequence (Additional file 1), and their interaction was predicted by at least five algorithms (Additional file 1: Table S6), supporting the high possibility of an interaction between the miR-17 family and E2F1. [score:1]
[b]belongs to the miR-17 family. [score:1]
A mo del of the miR-17 family, RB1, and E2F1 motif in lung cancer proliferation. [score:1]
The conserved sequence of E2F1 among five species (Homo sapiens, Mus musculus, Pan troglodytes, Rattus norvegicus and Bos taurus) was aligned to the mature sequences of the six members of the miR-17 family. [score:1]
The miR-17 family and the miR-17-92 cluster have two shared members, miR-17 and miR-20a, both of which were confirmed to interact with E2F1. [score:1]
In subnetwork I, we discovered the predicted interactions between the miR-17 family and E2F1 for the first time (Additional file 1: Table S6). [score:1]
The miR-17 family and E2F1 formed a FBL, which was a clique. [score:1]
MiR-17/106a/20a/93/34a were the hubs of many subnetworks, and four of them belong to the miR-17 family. [score:1]
The first four of these miRNAs belong to the miR-17 family, further indicating the important role of the miR-17 family in the network. [score:1]
For the other four members of the miR-17 family, we performed a sequence alignment to examine how likely they were to interact with E2F1. [score:1]
Interestingly, six members of the miR-17 family (miR-17/20a/20b/106a/106b/93) clustered in one group. [score:1]
We checked the interactive relations of the miR-17 family with E2F1 and RB1 by sequence alignment and found a strong possibility of their interactions. [score:1]
[1 to 20 of 34 sentences]
31
[+] score: 98
Other miRNAs from this paper: hsa-mir-221
We further showed that the inhibition of miR-17-5p inhibited the DM-MCM -induced down-regulation of p21 [Cip1] but had no effect on p27 [Kip1], while the inhibition of miR-221 affected the down-regulation of p27 [Kip1] but had no effect on p21 [Cip1]. [score:13]
As shown in Figure 4E, miR-17-5p inhibitor significantly inhibited the DM-MCM -induced expression of p21 [Cip1], whereas miR-221 inhibitor inhibited the DM-MCM -induced expression of p27 [Kip1]. [score:13]
Several lines of evidence from the current study indicate that the effect of macrophages from DM patients on SMC proliferation was mediated by the down-regulation of expressions of p21 [Cip1] and p27 [Kip1] and that this down-regulation was mediated through the differential regulation of the miR-17-5p and miR-221. [score:10]
Pretreatment of the cells with miR-17-5p inhibitor suppressed the DM-MCM -induced down-regulation of p21 [Cip1] and proliferation of the SMCs. [score:8]
To determine whether DM-MCM -induced cell proliferation was mediated by the up-regulation of miR-17-5p and miR-221, SMCs were pretreated with miR-17-5p and miR-221 inhibitors and subsequently stimulated with DM-MCM. [score:6]
miR-17-5p is one of the critical miRNAs for cell proliferation [33], and its up-regulation has been shown to modulate p21 [Cip1] expression in cancer cells [34]. [score:6]
Activation of the miR-17-5p led to down-regulation of p21 [Cip1], whereas activation of the miR-221 led to decreased expression of p27 [Kip1]. [score:6]
After transfection with the miR-17-5p and miR-221 inhibitors, the expression levels of miR-17-5p and miR-221 were decreased by 75.3% and 78.7%, respectively. [score:5]
The DM-MCM -induced decrease in the percentage of cells in the G [0]/G [1] phases and the increase in the percentage of cells in the S-phase were also significantly inhibited by miR-17-5p and miR-221 inhibitors (Figure 4D). [score:5]
The DM-MCM -induced SMC proliferation was significantly inhibited by pretreatments with miR-17-5p and miR-221 inhibitors (Figure 4C). [score:5]
In addition, SMCs were incubated with specific inhibitors of miR-17-5p and miR-221 for 1 h before and during stimulation with DM-MCM, and the expressions of p21 [Cip1] and p27 [Kip1] were analyzed. [score:5]
Second, stimulation of SMCs by DM-MCM induced expression of miR-17-5p. [score:3]
Stimulation of SMCs with DM-MCM increased the expression of the miR-17-5p (Figure 4A) and miR-221 (Figure 4B), in a time -dependent manner. [score:3]
Inhibition of miR-17-5p and miR-221. [score:3]
Anti-miR inhibitors for miR-17-5p, miR-221, and corresponding negative controls were purchased from Ambion, Life Technologies (Austin, TX, USA). [score:3]
miR-17-5p and miR-221 are involved in the regulation of HASMC proliferation. [score:2]
The present study demonstrated that DM-MCM stimulates SMC proliferation through at least two miRNAs, as indicated by the DM-MCM-induction of increases in miR-17-5p and miR-221, which may be involved in the mitogenic action. [score:1]
Relative miR-17-5p (A) and miR-221 (B) levels were determined through real-time PCR in HASMCs and normalized to U6 snRNA from 3 independent experiments. [score:1]
[1 to 20 of 18 sentences]
32
[+] score: 95
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
This miRNA signature -based classification of DLBCL highlights a significant role of MYC as, unlike the miR-17~92, which is activated by MYC [30], 95% of the miRNAs which are suppressed by MYC were significantly downregulated in the MG-A subgroup and overexpressed in the MG-C [49]. [score:8]
HL-specific miRNA signature from HL cell lines includes miR-17~92, miR-16, miR-21, miR-24, and miR-155 being upregulated and miR-150 as the only downregulated miRNA [39]. [score:7]
Two members of the polycistron, miR-17-5p and miR-20a, downregulate E2F1, which is a direct target of MYC that promotes cell cycle progression. [score:7]
MiRNA expression profiling study of tumor cells (T-cell clones) of a rare, aggressive, primary cutaneous T-cell (CD4+) lymphoma called Sezary syndrome (SzS) showed that majority of deregulated miRNAs were downregulated including oncomir-1/ miR-17-5p [59]. [score:7]
Recently, miR-17~92 was also shown to downregulate TGF β signaling pathway leading to clusterin downregulation and hence stimulating angiogenesis and tumor cell growth in glioblastomas [34]. [score:7]
Interestingly, the miRNA clusters at locus 7q22 including miR-106b, miR-93, and miR-25 (overlapping miR-17~92 cluster) were also highly upregulated in MCL. [score:4]
He et al. demonstrated that virus -mediated overexpression of miR-17~92 in lymphocytes of e μ-MYC (B-cell) transgenic mice accelerated tumor development [28]. [score:4]
Comparative miRNA expression analysis of 46 FL cases to lymph node samples was used to generate FL miRNA signature which included miRNAs which have role in hematopoiesis (miR-150 and miR-155) or tumor development (miR-210, miR-10a, miR-17-5p, and miR-145) [51]. [score:4]
These experiments suggest that the miR-17~92 cluster acts specifically during the transition from pro-B to pre-B lymphocyte development, enhancing the survival of the B-cells at this stage by targeting the proapoptotic BIM. [score:4]
Ventura et al. [29] confirmed these findings and showed that targeted deletion of miR-17~92 polycistron (but not its paralogs) in mice is embryonically lethal and critical for lung and B-cell development. [score:4]
Another miRNA which is reported to have a major role in lymphomagenesis is the miR-17~92 polycistron located in 13q31-32, a region commonly amplified in B-cell lymphomas and upregulated in 65% of the B-cell lymphoma patients [27, 28]. [score:4]
Two of the most notorious miRNAs upregulated in various lymphomas, miR-155 and miR-17~92, are discussed in detail, since these miRNAs are among the best studied owing to the availability of both gain- and loss-of-function mouse mo dels. [score:4]
In case of miRs which are encoded in cluster, for example, miR-17~92 family (and its paralogs, together encoding 15 miRNAs), it will be more efficient to generate a transgenic mouse with miR-cluster sponge to inhibit than deleting each miR individually [80]. [score:3]
More recently, Xiao and colleagues [31] reported that mice with sustained expression of miR-17~92 in lymphocytes exhibit a lymphoproliferative disorder, autoimmunity, and premature death. [score:3]
Gain and loss-of-function studies of miR-17~92 polycistron have provided an important insight into its mechanism of action and its targets. [score:3]
Both genes were further confirmed as targets of the miR-17~92 polycistron members [31]. [score:3]
They further showed that ectopic expression of miR-17-5p increased apoptosis and decreased cell proliferation in SzS cells [59]. [score:3]
O'Donnell et al. simultaneously reported that MYC binds and activates expression of the miR-17~92 cluster [30]. [score:3]
Furthermore, patients with the MG-A signature characterized by upregulation of the miR-17~92 cluster and its paralog miR-106a-363 of chromosome X had the worst overall survival. [score:2]
From the cytogenetics point of view, GCB lymphomas are characterized by t(14;18) translocation, deletion of tumor suppressor PTEN, and amplification of micro -RNA cluster miR-17~92 and p53 mutations [47]. [score:2]
Further dissection of the genetic complexity of the cluster was demonstrated by generating conditional knockout alleles of the four seed regions represented in the cluster: miR-17, miR-20a; miR-18a; miR-19a, miR-19b-1; miR-92-1 [32]. [score:2]
Distinctive miRNA signatures obtained using unsupervised hierarchical clustering could distinguish these three groups based on just 16 miRNAs with miR-17~92 cluster members (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-20b, and miR-92) and its paralog miR-106a, being the predominant one in addition to miR-29a/c,miR-100, miR-199a*, miR-140, miR-630, and miR-16 [49]. [score:1]
1.2. miRNAs in Lymphomas: miR-17~92. [score:1]
The miR-17~92 cluster consists of miR-17, 18a, 19a, 19b-1, 20a, and 92a-1 and is encoded from the last exon of noncoding RNA called C13orf25. [score:1]
Genomic profiling of Richter's syndrome, which represents a transformation of chronic lymphocytic leukemia (CLL) to aggressive lymphoma and is mostly represented by DLBCL, with a postgerminal center phenotype, shows a 13q amplification which encodes the miR-17~92 cluster which interacts with c-MYC [53]. [score:1]
In addition, few lymphoma-specific miRNA signature included miR-150, miR-17-5p, miR-145, miR-328, and others [51]. [score:1]
Other miRNAs which could also distinguish SzS samples from healthy controls with 96% of accuracy were miR-223 and miR-17-5p [59]. [score:1]
Mu and colleagues [32] found that deletion of the whole miR-17~92 cluster slows c-Myc -induced oncogenesis. [score:1]
[1 to 20 of 28 sentences]
33
[+] score: 89
The miR-17-5p/miR-20a downstream target genes (P21 and Bim-S) are upregulated by si FLI1 knockdown, but are downregulated by ad FLI1 expression. [score:12]
After knocking down FLI1, both miR-17-5p and miR-20a are significantly downregulated, releasing their downstream suppression targets P21 and Bim-S, leading to reduced cell proliferation, enhanced apoptosis, and finally the suppression of tumors (Supplementary Figure 6). [score:11]
In the 17-92 miRNA family, miR-17-5p and miR-20a were closely associated with the expression of FLI1, being downregulated in the si FLI1 -treated cells (p < 0.05, Figure 5B) and upregulated in the FLI1 -expressing cells (p < 0.05, Figure 5C). [score:11]
To confirm the regulation of FLI1 on miR-17-5p and miR-20a, we used the re -expression of Flag- FLI1, Flag- FLI1∆ETSor Flag-vector to rescue the down-regulation of miR-17-5p and miR-20a expression induced by FLI1 knockdown. [score:10]
For example, miR-17-5p and miR-20a mainly inhibit the expression of target genes Bim-S and P21 [35, 36]. [score:7]
Similarly, miR-17-5p and miR-20a mimics could rescue the inhibition of cell proliferation induced by FLI1 knock-down in SCLC cells. [score:4]
Among the 17-92 miRNA family, miR-17-5p and miR-20a were significantly downregulated by si FLI1. [score:4]
We showed that Flag- FLI1, rather than the Flag- FLI1∆ETS mutant or the Flag-vector control, was able to rescue the downregulated miR-17-5p and miR-20a (p < 0.05, Figure 5D). [score:4]
Using a rescue experiment, we demonstrate that knockdown of FLI1, particularly its ETS binding domain, alters the expression of miR-17-5p and miR-20a. [score:4]
Finally, we examined whether the downstream target genes of miR-17-5p and miR-20a were also affected by FLI1. [score:3]
Two major components of the microRNA cluster, miR-17–5p and miR-20a [34], have been reported to target a noticeable large subset of key genes that promote proliferation and cell cycle progression in SCLC [22]. [score:3]
Importantly, we found that the inhibition of cell proliferation was rescued efficiently by both miRNA mimics (Figure 5E, miR-17-5p; Figure 5F, miR20-a). [score:3]
The miR-17-92 cluster (miR17-5p, miR-18, miR-19a, miR-19b, miR-20a and miR-92a), located in an intron of MIR17HG [miR-17-92 cluster host gene (non-protein coding)] on chromosome 13 (13q31.3), is overexpressed in lung cancers, especially with the most aggressive SCLC [31]. [score:3]
To further delineate the underlying mechanism of FLI1, we examined the expression of mature 17-92 miRNAs in treated SCLC cells, including miR-17-5p, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a. [score:3]
In this pathway, the oncogenic FLI1 regulates miR-17-5p and miR-20a through its binding to a conserved ETS binding site in the gene promoter. [score:2]
We investigated whether miR-17-5p and miR-20a mimics could rescue the inhibition of cell proliferation induced by FLI1 knockdown. [score:2]
In conclusion, this study for the first time to uncover that FLI1 influences tumorigenesis and cellular proliferation of SCLC cells by regulating the miR-17-92 cluster transcription, especially miR-17-5p and miR-20a. [score:2]
Both of miR-17-5p and miR-20a had been found to serve as growth-promoting miRNAs in SCLC [22]. [score:1]
[1 to 20 of 18 sentences]
34
[+] score: 76
Consistently with the up-regulation of the miR-17∼92 cluster in tumors, miR-92a is highly expressed in colon cancer tissues and targets the anti-apoptotic molecule BCL-2-interacting mediator of cell death (BIM) and the tumor suppressor PTEN [9], [10]. [score:10]
However, only miR-17 and miR-20a were shown to directly target TGF-β receptor II and miR-18a was reported to target the TGF-β down-stream signaling proteins Smad2 and Smad4 (for review see [4]). [score:6]
The polycistronic miR-17∼92 cluster, which comprises the mature miRNAs miR-17, -18a, -19a/b, -20a, and miR-92a, contributes to the pathogenesis of a variety of human diseases, including cancer, cardiovascular disease and congenital developmental defects [2], [4], [5]. [score:6]
The miR-92a [−/−] phenotype partially copies the previously reported skeletal development defects of miR-17∼92 cluster knock-out mice [6] and of humans with a reduced expression of the cluster [7]. [score:5]
Moreover, the expression of the closely related family members miR-17 (which only differs from miR-20a by 2 nucleotides) and miR-19a (which only differs from miR-19b by one nucleotide) was not significantly changed, and might compensate for the reduction in miR-20a and miR-19b expression, respectively. [score:5]
Whereas several reports showed that Shh stimulates the expression of the cluster [4], [19], [20], an interference of the miR-17∼92 cluster with the Shh pathway is only supported by indirect evidence showing that the tumorigenic effects of the miR-17∼92 cluster is dependent on the loss of the Shh receptor Patched [19]. [score:4]
These findings identify a regulatory function for miR-92a in growth and skeletal development, whereas miR-92a is not responsible for other defects in heart or B cell development that were observed in miR-17∼92 cluster mutants. [score:4]
Figure S1MiR-92a deficiency in mice moderately effects the expression of the other miR-17∼92 cluster members in muscle and skeletal tissue. [score:3]
Furthermore, mRNA expression of Runx2 and type I collagen was significantly lower in bones from miR-17–92 [+/Δ] mice [17]. [score:3]
Expression levels of the miR-17∼92 cluster members in lower leg muscles of the hind limbs (A) and femurs (B) of WT, miR-92a [+/−] and miR-92a [−/−] mice. [score:3]
Several key features of this phenotype were mimicked in mice harboring targeted deletion of the miR-17∼92 cluster [7]. [score:3]
The cluster is highly expressed in bone cells, and osteoblasts from miR-17–92 [+/Δ] mice showed a lower proliferation rate, alkaline phosphatase activity and less calcification in vitro [17]. [score:3]
The constitutive and conditional deletion of miR-92a-1, which is expressed by the miR-17∼92 cluster, was generated by homologous recombination in 129Sv/Pas embryonic stem (ES) cells by genOway (Lyon, France). [score:3]
Moreover, the miR-17∼92 cluster indirectly interacts with the Sonic Hedgehog (Shh) axes, a pathway that has been implicated in skeletal development [19], [20]. [score:3]
The mechanism by which the miR-17∼92 cluster affects skeletal development is not well explored. [score:2]
These data may suggest that the miR-17∼92 cluster regulates bone metabolism. [score:2]
Deletion of the miR-17∼92 cluster resulted in defects of heart and lung development, and homozygote mice postnatally died [6]. [score:2]
The miR-17∼92 cluster has been shown to modulate TGF-β signaling, one of the most important signaling pathways controlling skeletal development. [score:2]
Therefore, it is unclear whether there is a direct effect of miR-17∼92 loss of function on the activity of the Shh pathway. [score:2]
Thus, miR-92a [−/−] mice were smaller than their littermates, showed reduced skull size and tibia length and exhibit the typical shortening of the 5 [th] mesophalanx bone as it has been reported for miR-17∼92 [Δ/+] mice [7]. [score:1]
A germline hemizygous deletions of MIR17HG, encoding the miR-17∼92 polycistronic miRNA cluster, was observed in patients with Feingold syndrome [7], which is an autosomal dominant syndrome whose core features are microcephaly, relative short stature and digital anomalies, particularly brachymesophalangy of the second and fifth fingers and brachysyndactyly of the toes [8]. [score:1]
However, the contribution of miR-92a for the observed defects in miR-17∼92 cluster deficient mice has not been elucidated. [score:1]
MiR-92a [−/−] mice have no hematopoietic defectsSince miR-17∼92 cluster knock-out mice revealed defects in hematopoietic cell development, we characterized the hematopoietic phenotype of miR-92a [−/−] mice. [score:1]
Since miR-17∼92 cluster knock-out mice revealed defects in hematopoietic cell development, we characterized the hematopoietic phenotype of miR-92a [−/−] mice. [score:1]
[1 to 20 of 24 sentences]
35
[+] score: 70
miR-20a and miR-17 directly bind to the 3′ untranslated region (UTR) of FBXO31 and inhibit FBXO31 mRNA and protein expression in human GC cells. [score:8]
Human miR-20a mimics, miR-17 mimics, control mimics, miR-20a inhibitors, miR-17 inhibitors and control inhibitors were synthesized from RiBoBio (Guangzhou, China). [score:7]
Our results indicated that miR-17 and miR-20a mimics inhibited, whereas miR-17 and miR-20a inhibitor increased, the expression of FBXO31. [score:7]
Therefore, the increased miR-17(20a) expression in GC tissue contributed to the down-regulation of FBXO31 partly. [score:6]
The overexpression of miR-17 and miR-20a contributed to the down-regulation of FBXO31 in GC tissues partly. [score:6]
Therefore,we transfected the mimics or inhibitor of miR-20a or miR-17 into GC cells BGC-823 and HGC-27 and used qRT-PCR and western blot to detect the expression of FBXO31. [score:5]
These results suggest miR-17(20a)-FBXO31-CyclinD1 pathway may be a potential therapeutic target of GC. [score:3]
We found that miR-20a or miR-17 mimics decreased, whereas miR-20a or miR-17 inhibitor increased, the mRNA and protein level of FBXO31, respectively (Fig. 3 A-F). [score:3]
Clinically,we found that the expression of miR-17 and miR-20a in tumor tissue was significantly higher than that in surrounding normal mucosa. [score:3]
FBXO31 expression is negatively associated with miR-20a and miR-17 in primary GC tissues. [score:3]
Therefore, we detected whether FBXO31 were regulated by miR-17 and miR-20a. [score:2]
Two miR-20a and miR-17 complementary sequences GCACTTT in the 3' UTR were mutated singly or together to remove complementarity by use of a QuikChange site-directed mutagenesis kit with pMIR-FBXO31/wt as the template. [score:2]
To further determine whether FBXO31 was a direct target of miR-20a and miR-17,we constructed a vector containing the 3'UTR of FBXO31 and luciferase reporter vector pMIR-REPORT (pMIR-FBX) and investigated the effect of miR-20a and miR-17 on the luciferase activity of pMIR-FBX. [score:2]
In all, 37/56 (66.1%) and 38/56 (67.9%)of the clinical GC specimens showed increased expression of miR-20a and miR-17,respectively, as compared with surrounding normal mucosa (Fig. 4A and 4B). [score:2]
Finally, we investigated whether miR-17 and 20a were up-regulated in primary GC tissues and associated with FBXO31. [score:2]
FBXO31 was negatively regulated by miR-17 and 20a. [score:2]
A highly significant negative correlation between miR-17 (20a) and FBXO31 was observed in these GC samples. [score:1]
Figure 4 (A and B) qRT-PCR analysis of miR-20a (A) and miR-17 (B) level in 56 paired human GC and adjacent normal gastric mucosa tissues. [score:1]
Therefore, the second region of the 3' UTR of FBXO31 is important in binding with the miR-20a and miR-17. [score:1]
The 217bp 3' -UTR sequence of human FBXO31 gene containing miR-20a and miR-17 binding sites was amplified and inserted into the SpeI/HindIII sites of the pMIR-REPORT luciferase vector (named as pMIR-FBXO31/wt). [score:1]
Statisticalanalysis showed that FBXO31 were highly correlated with miR-20a and miR-17 levels in GC samples (P<0.0001) (Fig. 4E and 4F). [score:1]
Figure 3 (A) miR-20a and miR-17 were analyzed with qRT-PCR in BGC-823 and HGC-27 cells transfected with miR-20a, miR-17 mimics or control mimics. [score:1]
Furthermore,the two members of miR-17-92 cluster, miR-17 and 20a, are important markers for GC [39, 40]. [score:1]
[1 to 20 of 23 sentences]
36
[+] score: 69
Indeed, overexpression of miR-17 and miR-20a inhibited senescence in primary human fibroblasts by blunting the activation of p21 [WAF1], while inhibition of miR-17 caused senescence in anaplastic thyroid cancer cells (Takakura et al., 2008; Hong et al., 2010). [score:7]
Furthermore, miR-17–92 expression is consistently down-regulated in multiple mo dels of aging, i. e. after irradiation (Maes et al., 2008), p53 induction (Brosh et al., 2008), or stress -induced senescence (Li et al., 2009), and in old human skin, bone-marrow-derived mesenchymal stem cells, T cells (Hackl et al., 2010), and peripheral blood mononuclear cells (Noren Hooten et al., 2010). [score:6]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
Aging of HF-resistant mice, on the other hand, was accompanied by significantly enhanced expression of these miRNAs, except for miR-17 and miR-20a (Supporting information Table S1). [score:3]
Table S2 Fold change expression profiles of miR-17–92 cluster members in cardiomyocytes in vitro. [score:3]
In the present study, we showed extensive changes in the expression of the miR-17–92 cluster in a mo del of age-related heart failure in mice. [score:3]
CTGF and TSP-1 have been identified as target genes of the miR-17–92 cluster (Dews et al., 2006), more specifically of the cluster members miR-18a and miR-19a/b (Suarez et al., 2008; Ohgawara et al., 2009). [score:3]
RT-PCR analysis showed that the expression levels of all members of the miR-17–92 cluster were reduced in aged cardiomyocytes, except miR-92a-1 (Fig. 4D and Supporting information Table S2). [score:3]
Tumor suppressor mechanisms can induce cellular senescence and contribute to the aging process (Campisi, 2003), turning the miR-17–92 cluster into a potential mediator of aging. [score:3]
Table S1 Fold change expression profiles of miR-17–92 cluster members in HF resistant and HF prone mice at different ages. [score:3]
HF-prone hearts have more interstitial fibrosis and increased levels of CTGF and TSP-1. Opposite cardiac miR-17–92 cluster expression profiles in HF-resistant and HF-prone aging. [score:3]
Originally, the miR-17–92 cluster was linked to tumor genesis, and transcription of the cluster was found to be directly activated by the proto-oncogene c-Myc (He et al., 2005) [reviewed in(van Haaften & Agami, 2010)]. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitroTo gain further insight into the role of the miR-17–92 cluster in aging of cardiomyocytes, neonatal rat cardiomyocytes (NRCMs) were aged in vitro, and miRNA levels were determined. [score:2]
We found opposite expression profiles of the miR-17–92 cluster in HF-prone aging compared to aging with preserved cardiac function. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
Interestingly, cardiogenesis was severely hampered in mice deficient for miR-17–92, suggesting an important role for this cluster in cardiac development (Ventura et al., 2008). [score:2]
Initially, the miR-17–92 cluster was linked to cancer pathogenesis and was thought to be pro-tumorgenic because of its regulation by c-Myc (Dews et al., 2006). [score:2]
To gain further insight into the role of the miR-17–92 cluster in aging of cardiomyocytes, neonatal rat cardiomyocytes (NRCMs) were aged in vitro, and miRNA levels were determined. [score:1]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
In addition, we demonstrate that the miR-17–92 cluster is part of the senescence signature of the aged cardiomyocyte. [score:1]
These reports are in line with our data showing repression of the miR17–92 cluster in old failing hearts. [score:1]
[1 to 20 of 24 sentences]
37
[+] score: 65
However, above reports did not show the reduced plasma expression of miR-17, miR-451, miR-106a, and miR-19b in disease groups, suggesting the downregulation of four-miRNA panel is specific for FSGS and may be involved in the pathogenesis of FSGS. [score:8]
a-d The expression of miR-17, miR-451, miR-106a, and miR-19b between in FSGS patients (n = 74) and in other chronic kidney diseases including 69 IgAN patients, 24 MSPGN patients, and 26 MN patients. [score:5]
Figure  5c showed miR-17, miR-451, and miR-106a were significantly downregulated in FSGS with proteinuria (n = 56) when compared with FSGS patients who were in remission (urinary protein <400 mg/24 h after treatment) (n = 18), whereas the expression of miR-19b did not differ in above two groups. [score:5]
Fig. 3 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
A schematic of the study outlining the independent patients and samples used in discovery, training, validation, and blinded-test phases of the identification of plasma-miRNA panel for FSGS miRNA profiling in plasma from five FSGS patients and five healthy controls was performed by using a real-time PCR -based high-throughput miRNA array a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
Here, we found four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were significantly downregulated in FSGS compared with healthy controls. [score:3]
In addition, there was a correlation between miRNAs expression (especially for miR-17 and miR-19b) and histologic classification of FSGS. [score:3]
Fig. 4 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
In this study, we found the expression of the three-miRNA panel, including miR-17, miR-451, and miR-106a was associated with complete remission of FSGS. [score:3]
Above data suggest that there was a correlation between miRNAs expression (especially for miR-17 and miR-19b) and histologic classification of FSGS. [score:3]
a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
We found that the expression of miR-17, miR-451, and miR-19b was significantly lower in medium-severe FSGS compared with mild FSGS (Fig.   5a). [score:2]
results showed that the levels of miR-17, miR-451, miR-106a, and miR-19b were the lowest in FSGS patients compared with healthy controls and disease controls. [score:2]
In current study, we found that the expression of plasma miR-17, miR-451, and miR-19b was significantly lower in medium-severe FSGS compared with mild FSGS. [score:2]
MiR-17 and miR-19b, as members of miR-17 ~ 92 cluster, play key roles in kidney development and homeostasis. [score:2]
Kaucsar T Activation of the miR-17 family and miR-21 during murine kidney ischemia-reperfusion injuryNucleic Acid. [score:1]
One study in experimental animal mo del has found miR-17 and miR-106a were activated during the maintenance and recovery phases of renal ischemia-reperfusion injury [23]. [score:1]
ROC curve analysis showed that miR-17 had AUC of 0.61 (95% CI, 0.51–0.72), miR-451 had AUC of 0.76 (95% CI, 0.67–0.85), miR-106a had AUC of 0.64 (95% CI, 0.54–0.74), and miR-19b had AUC of 0.72 (95% CI, 0.62–0.82) (Fig.   4b). [score:1]
The fold changes in miR-17, miR-451, miR-106a, and miR-19b were 0.55, 0.56, 0.59, and 0.55, respectively (Fig.   3a). [score:1]
Mice deficient in miR-17 ~ 92 will develop glomerular dysfunction and proteinuria [21]. [score:1]
As shown in Fig.   3b, the areas under ROC curves (AUCs) of miR-17, miR-451, miR-106a, and miR-19b were 0.66 (95% confidence interval (CI), 0.52–0.80), 0.66 (95% CI, 0.51–0.80), 0.70 (95% CI, 0.56–0.84), and 0.72 (95% CI, 0.59–0.86), respectively. [score:1]
A three-miRNA panel, including miR-17, miR-451, and miR-106a had AUC of 0.71 (95% CI, 0.55–0.86) (P  < 0.01) (Fig.   5e). [score:1]
Logistic regression demonstrated that a linear combination of values for miR-17, miR-451, miR-106a, and miR-19b produced the best mo del for FSGS diagnosis. [score:1]
e ROC analysis of three-miRNA panel including miR-17, miR-451, and miR-106a for discriminating FSGS remission. [score:1]
As a result, four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were the ones which fulfilled above criteria and then selected for further validation. [score:1]
miR-17, miR-451, and miR-106a were related to FSGS remission. [score:1]
ROC curve analysis showed that miR-17 had AUC of 0.65 (95% CI, 0.50–0.80), miR-451 had AUC of 0.66 (95% CI, 0.50–0.81), and miR-106a had AUC of 0.69 (95% CI, 0.53–0.85) (Fig.   5d). [score:1]
As shown in Fig.   5b, the plasma levels of miR-17, miR-19b, and miR-106a were significantly lower in combined variants group than in NOS, tip lesion, or perihilar groups. [score:1]
We performed Kruskal–Wallis test, then found there was significant difference on the level of miR-17 (P = 0.04) and miR-19b (P = 0.01) between different subtypes of FSGS (Table  S2). [score:1]
For example, significant positive correlations were found between miR-17 and miR-451, and between miR-106a and miR-19b plasma levels, with correlation coefficient values of 0.773 and 0.843, respectively (P  < 0.001) (Figure  S3). [score:1]
[1 to 20 of 30 sentences]
38
[+] score: 63
Both Th1 and Th2 cultured cells induced from STAT6 -deficient mice showed higher levels of miR-17-5p expression compared with corresponding WT Th cells, suggesting a novel critical role of IL-4R/STAT6-signaling in the down-regulation of miR-17 expression (Fig. 3C). [score:7]
Figure 4 Tumor bearing conditions down-regulate miR-17-5p expression in T cells. [score:6]
When healthy donor-derived CD4 [+ ]T cells were stimulated with rhIL-2, anti-CD3 and anti-CD28 mAbs, consistent with the mouse data, addition of rhIL-4 in the cultures suppressed expression of miR-17-5p (Fig. 4C). [score:5]
Interestingly, the tumor bearing condition did not suppress miR-17-5p expression by CD4 [+ ]T cells in STAT6 [-/- ]mice. [score:5]
Thus both IL-4 and GBM-bearing conditions suppress miR-17-5p expression in CD4 [+ ]T cells. [score:5]
Jurkat human T cell leukemia cells (American Type Culture Collection) were transduced by either one of the following pseudotype lentiviral vectors: 1) control vector encoding GFP; 2) the 17-92-1 expression vector encoding miR-17 18 and 19a, or 3) the 17-92-2 expression vector encoding miR 20, 19b-1, and 92a-1. All vectors were purchased from SBI. [score:5]
Jurkat cells were transduced by either one of the following pseudo typed lentivirus vectors: 1) control vector encoding GFP; 2) the 17-92-1 expression vector encoding miR-17 18 and 19a, or 3) the 17-92-2 expression vector encoding miR 20, 19b-1, and 92a-1. (A), Transduced Jurkat cells (5 × 10 [4]) in the triplicate wells were stimulated with PMA (10 ng/ml) and ionomycin (500 nM) for overnight and supernatant was harvested and tested for the presence of IL-2 by specific ELISA. [score:5]
The blockade of IL-4 up-regulated miR-17-5p and miR-92 significantly with p <. [score:4]
To determine whether there is an IL-4 dose -dependent suppression of miR-17-92 cluster, we next treated CD4 [+ ]T cells with increasing doses of IL-4 at 0, 10, 50 or 100 ng/ml and measured miR-17-5p expression by RT-PCR (Fig. 3B). [score:3]
Total RNA was extracted and analyzed by RT-PCR for miR-17-5p expression. [score:3]
To evaluate these aspects, we transduced Jurkat cells with lentiviral vectors encoding green fluorescence protein (GFP) and either the miR-17-92-1 expression vector encoding miR-17 18 and 19a, or the 17-92-2 expression vector encoding miR 20, 19b, and 92. [score:3]
CD4 [+ ]cells from TG/TG mice displayed a greater than 15 fold increase in miR-17-p5 expression as compared with controls. [score:2]
Indeed, CD4 [+ ]and CD8 [+ ]splenocytes (SPCs) derived from wild type C57BL/6 mice bearing B16 subcutaneous tumors expressed lower levels of miR-17-5p when compared with those derived from non-tumor bearing mice (Fig. 4A). [score:2]
Furthermore, CD8 [+ ]T cells in STAT6 [-/- ]mice demonstrated enhanced levels of miR-17-5p expression when these mice bore B16 tumors compared with non-tumor bearing mice. [score:2]
Although not statistically significant, CD8 [+ ]T cells demonstrated a trend towards decreased levels of miR-17-5p expression in GBM patients when compared with healthy donors (Fig. 4D). [score:2]
Interestingly, not only are STAT6 [-/- ]T cells resistant to tumor -induced inhibition of miR-17-5p, but CD8 [+ ]T cells in tumor bearing STAT6 [-/- ]mice exhibited higher levels of miR-17-5p when compared with CD8 [+ ]T cells obtained from non-tumor bearing STAT6 [-/- ]mice. [score:2]
The miR-17-92 transcript encoded by mouse chromosome14 (and human chromosome 13) is the precursor for 7 mature miRs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92) [24, 25]. [score:1]
We isolated CD4 [+ ]splenocytes from these mice and evaluated the expression of miR-17-5p (Fig. 5A). [score:1]
[1 to 20 of 18 sentences]
39
[+] score: 63
In contradiction with the array analysis, Q-PCR experiments evidenced i) up-regulation of miR-21 in single muscle fibres isolated from VA and DIA of the mdx mouse; ii) up-regulation of miR-221 limited to dystrophic DIA; and iii) down-regulation of miR-17 in all dystrophic single muscle fibres analyzed (more than 30 folds) (Figure S1). [score:10]
In conclusion, a more sensible and specific quantification of miRNAs by absolute Q-PCR analysis highlighted common up-regulation of miR-206, miR-223, miR-199a-5p, miR-199b*, miR-27a, miR-128a, miR-31 and miR-142-5p, and down-regulation of miR-17 in dystrophic fibres isolated from TA, DIA and VA of the adult mdx mouse (Figure S1). [score:7]
The only exception is down-regulation of miR-17 that is specific of dystrophic single muscle fibres isolated from adult mdx mouse, suggesting its involvement in compensatory mechanisms triggered in the early-stage disease of this animal mo del of DMD. [score:6]
It is important to notice that miR-17 is down-regulated in muscle fibres of the mdx mouse but over-expressed in single fibres of DMD patients, further supporting the involvement of epigenetic during chronic muscle damage. [score:6]
MiRNAs were quantified in human muscle fibres of 12 control subjects and 18 DMD patients, confirming the over -expression of miR-17, miR-27a and miR-206 in diseased muscle. [score:5]
To verify reliability and clinical relevance of data obtained from the analysis of murine dystrophic single muscle fibres, we quantified the expression levels of miR-17, miR-27a and miR-128a in single muscle fibres dissected from human biopsies of DMD patients. [score:3]
In particular, some miRNAs decreased to control levels in old mdx mice (miR-15b, miR-17, miR-31 and miR-128a) (Figure 2B), suggesting a major involvement in compensatory mechanisms activated by the muscle in the early step of disease. [score:3]
Data obtained confirmed over -expression of miR-17, miR-27a and miR-206 in single fibres of DMD muscle biopsies (Figure 4B and 4C). [score:3]
Single muscle fibres were dissected from the muscle biopsies of 12 healthy subjects and 18 DMD patients with an age range between 1 and 18 y-o (Figure 4A), and expression levels of miR-15b, miR-17, miR-27a, miR-128a and miR-206 were quantified by absolute Q-PCR analyses. [score:3]
Data obtained evidenced a group of miRNAs whose expression does not change during muscle repair afterwards acute damage (miR-15b, miR-17, miR-128a, miR-221, miR-199a-5p miR-199b and miR-199b*) (Table 1), and a group of miRNAs that are triggered afterwards CTX delivery (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) (Table 1), suggesting major involvement of the latter in muscle regeneration. [score:3]
We identify fourteen miRNAs associated to dystrophic fibres (miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) that may mediate muscle regeneration and remo delling in animal mo dels of MDs and acute muscle damage, and confirm over -expression of the previously identified regeneration -associated myomiR-206. [score:3]
In particular, the dysregulation was limited to miR-199b*, miR-31, miR-142-5p and miR-221 in dystrophic TPZ; to miR-128a, miR-21, miR-221 and miR-35-5p in dystrophic DIA; and to miR-15b, miR-17, miR-27a, miR-142-5p, miR-128a, miR-335-5p, miR-21, miR-31 in dystrophic VA (Figure 3B). [score:2]
Fourteen miRNAs were found dysregulated in dystrophic muscle fibres of the mdx mouse with differences linked to the originating muscle (miR-206, miR-199a-5p, miR-223, miR-199b, miR-199b*, miR-21, miR-221, miR-17, miR-15b, miR-31, miR-128a, miR-142-5p, miR-335-5p and miR-27a). [score:2]
Moreover, miR-17 was not dysregulated afterwards acute muscle damage, confirming its specific role in the muscle pathophysiology of the mdx mouse. [score:2]
MiR-15b, miR-17, miR-31, miR-128a, miR-142-5p and miR-335-3p were specifically induced in single muscle fibres of dystrophic DIA (Figure 1). [score:1]
Otherwise, single muscle fibres based-analyses highlighted new miRNAs (miR-17, miR-27a, miR-128a and miR-199b*) associated to dystrophic and/or damaged muscle. [score:1]
In support to this: miR-335 and miR-21 were found in human mesenchymal stromal cells [50] and in mesenchymal stem cells (MSCs) together with miR-21, miR-27a, miR-128a, miR-199b [51] miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-199a, miR-199b, miR-221 and miR-335-5p were found in MSCs and in MSC secreted microparticles [49], [52], [53]. [score:1]
The only exceptions are represented by miR-206, miR-199a-5p and miR-17 whose dysregulation depended on the muscle considered (Figure 3A). [score:1]
In fact, newborn mdx mice were characterized by normal expression levels of miR-17. [score:1]
[1 to 20 of 19 sentences]
40
[+] score: 62
As each miRNA can act as a suppressor of many target genes, we hypothesized that miR-181 and miR-17~93 families promoted henipavirus infection by suppressing multiple anti-viral host genes. [score:7]
Verified miR-181 and miR-17~93 target genes predominantly inhibit henipavirus infection. [score:5]
Cross-referencing of results from the siRNA screen of host genes associated with HeV infection suggests that miR-181 and miR-17~93 target multiple host genes which are anti-viral for HeV, and that the net outcome of cellular expression of miR-181 or miR-17~93 is likely a host microenvironment that is more conducive for henipavirus infection. [score:5]
The screens, in addition to subsequent validation work, demonstrate a key role for miR-181 family members in regulating henipavirus syncytia formation and infection, and suggest several host miRNAs, including miR-17~93, as potential candidates for novel therapeutic targets. [score:4]
A comprehensive survey of 15 RNA viruses from 7 families identified miR-17 and let-7 binding to pestivirus 3’ UTR as critical for enhanced viral translation, RNA stability and virus production [12]. [score:3]
Experimentally validated target genes for miR-181 and miR-17 families (miRTarBase, and their corresponding impact on HeV infection). [score:3]
To test this hypothesis, we firstly mined the miRTarbase database [27] to identify all experimentally-validated target genes for miR-181 and miR17~93 families. [score:3]
Members of the miR-181 and miR-17~93 families strongly promoted Hendra virus infection and appear to suppress multiple antiviral host molecules. [score:3]
Dual miRNA screens reveal miR-181 and miR-17~93 families as promoters of henipavirus infection that target multiple anti-viral genes. [score:3]
For instance, miR-17 has recently been shown to be critical for the replication of pestiviruses, primarily via enhancing viral translation and vRNA stability [12]. [score:3]
Collectively, these data suggest that the net outcome of miR-181 or miR17~93 expression is a cellular microenvironment that is more conducive for henipavirus infection. [score:3]
Pie charts show the relative proportions of pro- and anti-viral target genes for miR-181 (C) and for miR-17~93 (D), with the number of genes printed. [score:3]
Values represent the sum of all the Z-scores, and demonstrate the predominance of anti-viral genes among the miR-181 and miR-17 targets. [score:3]
The miR-17~93 family was another high-ranking pro-viral hit from the dual miRNA screens (Figs 1D and 2B). [score:1]
1005974.g006 Fig 6. (A) Percentage of cells infected with HeV or RSV (24 h, MOI 1), after 72 h transfection with miR-17, miR-93 or control agonists. [score:1]
1005974.g002 Fig 2(A and B) from miRNA screens for all miR-181 (A) and miR-17~93 (B) family members, represented by robust Z-scores. [score:1]
In sum, these results indicate that HeV-glycoprotein mediated cell-cell fusion is greatly stimulated by miR-181, but not by miR-17, suggesting that miR-181 specifically facilitates henipavirus infection by enhancing host entry and, quite possibly, by supporting cell-to-cell spread during late stages of infection via syncytia formation. [score:1]
Akin to the impact of miR-17~93 on HeV infection, we found that the ratios of infected cells were also significantly higher in the miR-17 and miR-93 agonist transfected cells (189% and 180% of control, respectively). [score:1]
On the other hand, miR-17 enhances the infection of HeV as well as RSV, suggesting that the pro-viral effects of miR-17 are broadly applied to the paramyxovirus family, and perhaps beyond this family. [score:1]
miR-17 promotes henipavirus infection but does not enhance HeV F- and G -mediated cell-cell fusion. [score:1]
Interestingly, even though miR-17 enhanced HeV infection, cells loaded with miR-17 agonists did not fuse at significantly higher efficiencies than negative control cells. [score:1]
These results further validate the datasets from the complementary screens (Fig 1), and indicate that members of the miR-17~93 family are indeed promotive for wild-type henipavirus infection. [score:1]
We first sought to validate the pro-viral effects of the miR-17~93 family using wild-type HeV. [score:1]
This pro-fusion effect is specific to the miR-181 family, as transfection with agonists of another strongly pro-viral miRNA (miR-17), did not appreciably alter syncytia formation. [score:1]
In addition to miR-181, most members of the miR-17~93 family were pro-viral (Fig 2B). [score:1]
Both complementary screens converged on members of four miRNA families (miR-181, miR-17~93, miR-520h, miR-548d) that strongly promoted henipavirus infection. [score:1]
However, and rather intriguingly, unlike miR-181 (Fig 4), members of the miR-17~93 family appear to also exhibit pro-viral effects on a paramyxovirus from a different subfamily than the henipaviruses. [score:1]
[1 to 20 of 27 sentences]
41
[+] score: 62
It was hypothesized that the elevated expression observed for miR-17-5p in serum samples collected from acutely as well as persistently infected cattle could indicate that this miRNA was either induced by FMDV infection to benefit virus replication, or, induced as a consequence of the host response aiming to suppress virus infection. [score:5]
Of the miRNAs that were significantly up- or down-regulated, five were shared between acutely and persistently infected cattle (bta-miR-17-5p, bta-miR-144, bta-miR-497, bta-miR-22-5p, and bta-miR-1281). [score:4]
The miRmap algorithm reported that 6 of the 19 miRNAs dysregulated in bovine serum in response to FMDV could potentially target different regions of the FMDV A24 Cruzeiro RNA genome: bta-miR-17-5p, bta-miR-497, bta-miR-146a, bta-miR-1224, bta-miR-31, and bta-miR-150. [score:4]
The up-regulated miRNA species included bta-miR-17-5p, bta-miR-146a, bta-miR-144, bta-miR-34a, bta-miR-369-3p, bta-miR-497, and bta-miR-22-5p (Table  2 and Fig.   2a). [score:4]
The three most up-regulated miRNAs were bta-miR-17-5p (+35.88 fold increase), bta-miR-146a (+34.36 fold increase), and bta-miR-144 (+28.78 fold increase) (Table  2). [score:4]
Only one of the immune modulatory miRNAs was shared between the two sets: bta-miR-17-5p, which was significantly upregulated during both acute and persistent FMDV infection. [score:4]
From these findings, it could be inferred that the induction of miR-17-5p in vivo might manipulate the cellular environment such that it favors FMDV replication, while miR-1281 is down-regulated due to an antagonistic effect. [score:4]
As with the bioinformatics analysis conducted to identify prospective gene targets for miR-17-5p and miR-1281, a consensus target gene for miR-455-3p was not found to further investigate (Additional file 2: Table S1). [score:3]
Of the miRNA species detected, miR-17-5p and miR-1281 were selected as they were among the 5 miRNA that showed similar differential expression in two different animal sets: acutely infected cattle (Table  2 and Fig.   2) and persistently infected cattle (Table  3 and Fig.   2). [score:3]
Additionally, miR-17-5p has been implicated in T-cell activation, B-cell and monocyte maturation as well as with suppression of TLR signaling and hampering of the IFN response [16, 57, 58], which are important functions of the host anti-viral response. [score:3]
bta-miR-17-5p was highest expressed during acute infection, whereas bta-miR-31 was the highest during FMDV persistence. [score:3]
miR-17-5p was included in the second experimental set in panel b to confirm the non-effect seen in panel a In a separate experiment, we investigated the potential impact of one of the down-regulated miRNAs that was common to both acutely and persistently infected cattle, miR-1281, on the progression of FMDV infection in vitro. [score:2]
miR-17-5p was included in the second experimental set in panel b to confirm the non-effect seen in panel a In a separate experiment, we investigated the potential impact of one of the down-regulated miRNAs that was common to both acutely and persistently infected cattle, miR-1281, on the progression of FMDV infection in vitro. [score:2]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
Mimics of miR-17-5p and miR-1281 were separately tested for their effect on FMDV replication in cell culture (Fig.   5). [score:1]
While miR-17-5p had no apparent impact on the progression of FMDV infection, mimics of miR-1281 decreased the resulting FMDV titers by 2–3 logs. [score:1]
b Cells were transfected with miR-1281 mimics following the same procedure as miR-17-5p (a). [score:1]
In the in vitro experiment, there was no impairment to virus replication in cells transfected with miR-17-5p prior to FMDV infection, and virus titers produced were nearly identical to that of the negative controls (untransfected cells and cells transfected non-sense miRNA mimics [miR-NC]) used in the experiment (Fig.   5a). [score:1]
Fig. 5Effect of miR-17-5p and miR-1281 mimics on FMDV infection in cell culture. [score:1]
Nine of the miRNAs (bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, bta-miR-31, bta-miR-150, and bta-miR-147), have been ascribed immune modulatory functions (Fig.   6b, blue circle). [score:1]
LFBK-αvβ6 cells were grown to approximately 30–40% confluence and transfected with mimics to miR-17-5p, miR-1281 (Thermo Scientific, Waltham, MA), a non-sense negative control miR (miR-NC), a control miR-342-5p that does not impact FMDV infection, or left untransfected following the RNAiMAX (Thermo Scientific, Waltham, MA) transfection method (manufacturer’s protocol). [score:1]
Effect of miR-17-5p and miR-1281 on the progression of FMDV infection in vitro. [score:1]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
To that end, mimics of miR-17-5p were transfected into LFBK-αvβ6 cells, a cell line commonly used for FMDV propagation [37, 38]. [score:1]
a Cells were transfected with miR-17-5p mimics in parallel with negative controls: untransfected and irrelevant miR-342-5p. [score:1]
As described for miR-17-5p above, mimic molecules of miR-1281 were transfected into LFBK-αvβ6 cells and 2 days post-transfection, the cells were infected with FMDV A24 Cruzeiro. [score:1]
The remaining 8 miRNAs (bta-miR-497, bta-miR-144, bta-miR-181b, bta-miR-22-5p, bta-miR-23b-5p, bta-miR-17-5p, bta-miR-154a, and bta-miR-369-3p) detected in this study were found to be clustered. [score:1]
It is interesting to note that six of the 19 miRNAs described in this study are considerably abundant in cattle liver: bta-miR-22-5p, bta-miR-150, bta-miR-17-5p, bta-miR-455-3p, bta-miR-146, and let 7-g [64]; an organ in which FMDV does not establish infection. [score:1]
[1 to 20 of 29 sentences]
42
[+] score: 60
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In contrast to the clear upregulation observed for miR-155, the expression of the miR-17~92 cluster (especially miR-17-3p and miR-20a) tended to decrease along differentiation. [score:6]
MiR-17-5p and miR-17-3p are expressed at lower levels (belong to group C), indicating intra-cluster differential expression. [score:5]
When compared to naive cells, miR-21 and miR-155 were indeed found upregulated upon differentiation to effector cells, while expression of the miR-17~92 cluster tended to concomitantly decrease. [score:5]
Expression levels of miR-155 (a), miR-142.3p and miR-142-5p (b) and of members of the miR-17~92 cluster (c) were determined by single specific qPCR in the indicated sorted human CD8 [+ ]T cell subsets (a), and are expressed as fold change relatively to levels in naive cells (n = 9; *: p < 0,05; **: p < 0,01). [score:5]
Transgenic overexpression of miR-17~92 cluster in mouse lymphocytes was shown to induce lymphoproliferative disease [16]. [score:5]
The miR-17~92 cluster tends to be downregulated during CD8 [+ ]T cell differentiationSince central memory (CM) CD8 [+ ]T cells are present at extremely low frequency in peripheral blood, a new sorting strategy was then designed to include this subset in our analysis. [score:4]
The miR-17~92 cluster tends to be downregulated during CD8 [+ ]T cell differentiation. [score:4]
Figure 3The miR-17~92 cluster is preferentially downregulated in differentiated CD8 [+ ]T cell subsets. [score:4]
On the whole, expression of several members of the miR-17~92 cluster appeared to be found preferentially during early memory differentiation. [score:3]
Along the same lines, miR-17-3p expression was significantly decreased in late effector memory cells. [score:3]
We found expression of a limited set of microRNAs, including the miR-17~92 cluster. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
MiR-17-5p expression showed no association with CD8 [+ ]T cell differentiation. [score:2]
*: microRNA belonging to the miR-17~92 cluster. [score:1]
[1 to 20 of 15 sentences]
43
[+] score: 59
In this study, when we compared expression level of miR-17∼92 in PMBL and DLBCL, we showed a down-regulation of every miRs in PMBL except for miR-92a, that was significantly overexpressed. [score:7]
In two genetically distinct B-cell lymphoma cell lines, miR-17∼92 transfection induced a down-regulation of different target genes: BIM in Raji cells, and p21 in SUDHL4 cells [27]. [score:6]
Here we compared the expression of each member of the miR-17∼92 oncogenic cluster in samples from 40 PMBL patients versus 20 DLBCL and 20 cHL patients, and studied the target genes linked to deregulated miRNA in PMBL. [score:5]
Here we compared the expression of each member of the miR-17∼92 cluster in PMBL human samples versus DLBCL and versus cHL, and we further studied the target genes linked to deregulated miRNA in PMBL. [score:5]
In AIDS-related Burkitt lymphoma and DLBCL human samples, the overexpression of miRNAs from the miR-17∼92 paralog clusters inhibited p21 [28]. [score:5]
In mantle cell lymphoma samples, the protein phosphatase PHLPP2, an important negative regulator of the PI3K/AKT pathway, was a direct target of miR-17∼92 miRNAs, in addition to PTEN and BIM [29]. [score:5]
We quantified the expression levels of each microRNA of miR-17∼92 cluster and its paralogs in 40 PMBL, 20 DLBCL, and 20 cHL human samples (Figure 1). [score:3]
Quantification of expression of the miR-17∼92 cluster and its paralogs. [score:3]
Increased miR-17∼92 expression is found in B-cell lymphomas[26] and solid tumors (breast [32], colon [33], lung [23], neuroblastoma [34]). [score:3]
In humans, an overexpression of the miR-17∼92 cluster and its paralogs has been associated with high proliferation in mantle cell lymphoma [19, 26]. [score:3]
Quantification of expression levels of each microRNA in the miR-17∼92 cluster and its paralogs in 40 PMBL, 20 DLBCL and 20 cHL patient samples. [score:3]
In PMBL and cHL, we found a similar expression profile for each microRNA of miR-17∼92 cluster and its paralogs. [score:3]
When DLBCL and cHL were compared, five miRNAs of the miR-17-92a cluster, but not miR-92a, and the miR-106a and miR-106b of the paralog clusters, were significantly overexpressed in DLBCL. [score:2]
No significant difference was found for miR-17. [score:1]
miR-17∼92 is a polycistronic miRNA cluster, with two paralogs, the miR-106a-363, and miR-106b-25 clusters [21], able to act as oncogenes [22]. [score:1]
The miR-17∼92 cluster has numerous biological roles [24]. [score:1]
The miR-17∼92 oncogenic cluster, located at chromosome 13q31, is a region that is amplified in DLBCL. [score:1]
The miR-17∼92 cluster is one of the most potent miRNA oncogenes, located at chromosome 13q31, a region amplified in Burkitt’s lymphoma, DLBCL, follicular and mantle cell lymphoma [31]. [score:1]
When we compared PMBL and DLBCL results for the miR-17∼92 cluster, we found that only miR-92a had a significantly higher level of expression in PMBL compared to DLBCL (PMBL median 4.64 (interquartile range (Q1-Q3), 2.47-10.75); DLBCL 1.92 (Q1-Q3, 1.08-2.87); P =< 0.001). [score:1]
[1 to 20 of 19 sentences]
44
[+] score: 56
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Expression counts of hsa-miR-26a-5p, hsa-miR-27b-3p, hsa-miR-30b-5p, miR-17~92-cluster members (hsa-miR-19b-3p, and hsa-miR-92a-3p), and let-7 -family miRs (hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, and hsa-let-7 g-5p) in eBL tumor cells and GC B cells Functional enrichment analysis of the inversely-expressed target genes of the DE miRNAs provided us with an overall clue of their functional roles in eBL development. [score:8]
Among the upregulated miRNAs in eBL were members of the miR-17~92 cluster (miR-19b-3p, and miR-92a-3p) (logFC > 3), which target tumor suppressor genes such as TP53 [63] and ATM (ataxia telangiectasia mutated) kinase [59, 64], respectively. [score:8]
With the aim of understanding the transcriptome expression changes pivotal to eBL development, we identified the aberrant expression of genes (such as ATM and NLK) and miRNAs (such as let-7 family members and miR-17~92 cluster members) that could endorse eBL lymphoma development and sustain survival of tumor cells in the presence of myc translocation. [score:7]
Network propagation -based method and correlated miRNA-mRNA expression analysis identified dysregulated miRNAs, including miR-17~95 cluster members and their target genes, which have diverse oncogenic properties to be critical to eBL lymphomagenesis. [score:6]
MYC overexpression, because of its translocation to the immunoglobulin locus in BL, enhances the expression of miR-17~92 cluster miRNAs by binding directly to its genomic locus [22, 71] to accelerate carcinogenesis. [score:6]
By observing elevated expression of MYC, miR-19b-3p, miR-92a-3p and miR-92b-3p in eBL tumor cells compared to GC B-cells, we confirm that elevated expression of the miR-17~92 cluster miRNAs is a critical feature facilitating eBL lymphomagenesis. [score:4]
It is possible that during tumorigenesis a number of GC B cells have low ATM levels due to small interfering RNA -mediated regulation, as a result of irregular expression of miR-27b-3p, miR-26a-5p, miR-30b-5p and myc -dependent activation of miR-17~92 cluster miRNAs. [score:4]
MiR-17~92 overexpression has been observed previously in sBL tumors [16]. [score:2]
Members of the MiR-17~92 cluster gene are the first miRNAs to be implicated in cancer development [67, 68]. [score:2]
This miRNA gene cluster encodes for six distinct miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92) that share the same seed sequence [68]. [score:1]
[1 to 20 of 11 sentences]
45
[+] score: 55
Toxoplamsa infection upregulates expression of the mature forms of these three miRNAs, as well as pri-miR-17 ~ 92 and the host gene transcript, C13orf25. [score:6]
Finally, the miR-17 ~ 92 gene appear to attenuate apoptotic responsiveness by targeting several mRNAs encoding pro-apoptotic effectors and favor progression from G1 to S-phase by targeting mRNAs that encode negative regulators of the cell cycle [27, 28]. [score:6]
Moreover, STAT3 -associated transactivation of the miR-17 ~ 92 promoter was also confirmed by the upregulation of luciferase activity after STAT3 overexpression in the cells (Figure  3D). [score:6]
Several miRNAs upregulated in human macropahge following Toxoplasma infection are cluster miRNAs; e. g., miR-19a, miR-19b and miR-20a are from the miR-17 ~ 92 gene cluster. [score:4]
Together, these data demonstrate that STAT3 binding to the promoter element of the miR-17 ~ 92 gene mediates miRNAs (miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a) upregulation in human macrophage in response to Toxoplasma infection. [score:4]
Our analysis of miRNAs upregulated by Toxoplasma in human macrophage revealed that miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 genes are transactivated via potential promoter binding of the STAT3. [score:4]
Data are presented as the relative expression level of pri-miR-17 ~ 92 in THP-1 cells following Toxoplasma infection in the presence or absence of siRNA as assessed by qRT-PCR. [score:3]
Expression of pri-miR-30c-1, pri-miR-125b-2, pri-miR-23b-27b-24-1 and pri-miR-17 ~ 92 showed a time -dependent increase in cells following Toxoplasma infection (p< = 0.05, Figure  2). [score:3]
In our study, we found promotion of apoptosis of human macrophage with Toxoplasma infection via inhibition of miR-17 ~ 92 gene. [score:3]
To test whether STAT3 is involved in Toxoplasma -induced transactivation of pri-miR-17 ~ 92 we exposed human macrophage to Toxoplasma infection in the presence of siRNA-STAT3, that prevents expression of the STAT3 (Figure  3A). [score:3]
Promoter binding of STAT3 is required for the transcription of select miRNA genes induced by Toxoplasma in human macrophageTo test whether STAT3 is involved in Toxoplasma -induced transactivation of pri-miR-17 ~ 92 we exposed human macrophage to Toxoplasma infection in the presence of siRNA-STAT3, that prevents expression of the STAT3 (Figure  3A). [score:3]
Figure 3 Promoter binding of STAT3 transactivates miR-17 ~ 92 gene to increase mature miR-17 ~ 92 miRNAs expression following Toxoplasma infection. [score:3]
To further test the potential transactivation of miR-17 ~ 92 gene by STAT3, luciferase reporter gene constructs was used. [score:1]
In this study, we demonstrated that promoter binding of the STAT3 is required for transactivation of the miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 genes in cells following Toxoplasma infection. [score:1]
We demonstrated that miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 cluster genes were transactivated through promoter binding of the STAT3 following T. gondii infection. [score:1]
siRNA-STAT3 blocked the Toxoplasma -induced increase of pri-miR-17 ~ 92 (Figure  3B). [score:1]
Cells were transfected with specific anti-miRs (30 nM, Ambion) or a mixture of anti-miRs to miR-17-5b and miR-20a (a total of 30 nM with 15 nM for each), and then exposed to Toxoplasma for 24 h. The percentages of parasite -positive macrophage following exposure to Toxoplasma for 24 h was similar in all cultures, to those transfected with the specific anti-miRs (p > 0.05, Figure  4A), suggesting that those transfected with anti-miRs did not affect the number of parasite-infected macrophage. [score:1]
STAT3-WT:3′-GAT GCTACC A ATATCCTGGT-5′; STAT3-C: 3′-GAT TGCACC TGCATCCTGGT-5′pEZ-M02-STAT3-WT (200 ng), pEZ-M02-STAT3-C (300 ng) or empty vector was individually cotransfected into THP-1 cells, together with appropriate miR-17 ~ 92 gene cluster promoter reporter plasmids (200 ng) by using Effectene Transfection Reagent (Qiagen). [score:1]
Toxoplasma infection increased luciferase activity in cells transfected with the luciferase constructs that encompassed the binding site for STAT3 in the promoter region of miR-17 ~ 92 gene. [score:1]
[1 to 20 of 19 sentences]
46
[+] score: 54
Recently, Salaun et al. [6] demonstrated that the miR-17-92a cluster is one of the most highly expressed mRNAs in isolated human naïve T cells and its expression tends to be down-regulated in more differentiated cells. [score:8]
We also noticed down-regulation of miR-92a in both CD4 [+ ]and CD8 [+ ]lymphocytes with age, in accordance with the report by Hackl, et al. [11] that showed miR-17, miR-19b, miR-20a, and miR-106a were down-regulated in human cells, including CD8 [+ ]lymphocytes, in an aging population. [score:7]
The absence of miR-17-92a up-regulates BIM, which inhibits B-cell development at the pro-B to pre-B transition [4]. [score:7]
Therefore, it is likely that both reduced miR-17-92a cluster expression and down-regulation of the naïve cytotoxic T-cell fraction with age may lead to reduced amounts of miR-92a derived from naïve cytotoxic T cells (Additional file 3 Figure S1-A to D). [score:6]
High expression of miR-17-92a in transgenic mice leads to expansion of the CD4 [+ ]lymphocyte pool, and the naïve CD4 [+ ]cells show recruitment and activation of phosphatidylinositol-3-OH-kinase via suppression of PTEN [3, 5]. [score:5]
Down-regulation of the miR-17-92a cluster in human fibroblasts has also been reported in age-related conditions, such as stress -induced senescence or low-level irradiation [12, 13]. [score:4]
Although miR-17-92a expression is crucial for lymphocyte development, only limited reports on in vivo human lymphocyte senescence exist. [score:4]
We therefore set out to determine miR-92a levels in peripheral blood lymphocytes obtained from healthy individuals to ascertain the possible association between the expression level of miR-17-92a and ageing. [score:3]
This suggests that the accumulation of activated CD4 [+ ]T cells by higher mir-17-92a expression leads to a breakdown of T-cell tolerance in the periphery and may promote B-cell activation, germinal centre reaction and autoantibody generation. [score:3]
Therefore, it would be prudent to pay careful attention in interpreting human miRNAs levels in healthy controls since the expression levels of some miRNAs, such as miR-17-92a in lymphocytes, show age-related alterations. [score:3]
The miR-17-92a cluster is known to be a regulator of the immune system and is critical for lymphoid cellular development and tumorigenesis in lymphoid tissue [1- 3]. [score:3]
Most knowledge of the miR-17-92a cluster in normal and abnormal conditions of the lymphoid system is based on mouse experiments. [score:1]
[1 to 20 of 12 sentences]
47
[+] score: 53
Other miRNAs from this paper: hsa-mir-130b
With respect to this issue, we show that miR17-5p expression is up-regulated by PGZ and that miR17-5p knock-down increases PPARα expression, concomitantly with the reduction of PPARγ expression. [score:11]
Further, miR17-5p transfection down-regulated PPARα, as well as miR17-5p antagonist (a-miR17-5p) induced PPARα expression (Figure 5B). [score:6]
Finally, the administration of PGZ increased miR17-5p expression (Figure 5D), while it dampened PPARα expression in MCF7-MS (Figure 5D). [score:5]
In the same experimental setting, miR17-5p increased PPARγ expression and a-miR17-5p reduced PPARγ expression (Figure 5C). [score:5]
The interplay is counterbalanced by PPARγ via miR17-5p up-regulation. [score:4]
Thus, miR17-5p may mediate the PPARα/HIF1α interplay switch-off throughout the induction of PPARγ over -expression. [score:3]
We propose that this phenomenon is mediated by miR17-5p which targets both PPARα and HIF1α mRNA 3′UTRs [48]. [score:3]
In respect to this issue, we were allowed to observe that miR17-5p expression was decreased by TNFα administration in MCF7-MS (Figure 5A). [score:3]
The two proteins promote mammospheres formation and enhance each other expression via miRNA130b/miRNA17-5p -dependent mechanism which is antagonized by PPARγ. [score:3]
Further insight into the PPARα/HIF1α interplay was obtained via the assessment of microRNA17-5p (miR17-5p), whose binding consensus is present at PPARα mRNA 3′UTR. [score:1]
PPARα mRNA (B) and PPARγ mRNA (C) qPCR analysis in pre-miR17-5p or antago-miR17-5p (a-miR17-5p) -transfected MCF7-MS (48 h). [score:1]
Role of miR17-5p on the PPARα/PPARγ interplay in breast CSCs. [score:1]
Nevertheless, miR17-5p has been reported as a pro or anti oncogenic miR depending upon the genetic and environmental context [50]. [score:1]
miR17-5p (D) and PPARα mRNA (E) qPCR analysis in PGZ (20 µM, 24 h)-exposed MCF7-MS. [score:1]
Interestingly, miR17-5p has been previously found to be repressed by hypoxia [49]. [score:1]
Opposing Roles of miRNA130b and miRNA17-5p on the PPARα/HIF1α Interplay. [score:1]
These data point out that the antagonist interplay between PPARα and PPARγ is mediated by miR130b and miR17-5p. [score:1]
0054968.g005 Figure 5(A) miR17-5p qPCR analysis in TNFα (0.75 ng/mL, 24 h)-exposed MCF7-MS. [score:1]
Pre-miRNA17-5p, miRNA130b, antago-miRNA17-5p and miRNA130b were purchased from Life Technologies (Rockville, MD, USA). [score:1]
[1 to 20 of 19 sentences]
48
[+] score: 53
Other miRNAs from this paper: hsa-mir-28
In cells expressing the miR17-5p inhibitor, RNA levels of bim were significantly higher following cotreatment with peroxide and PFT α compared with cells expressing a nontargeting miR inhibitor control (Figure 4e). [score:10]
p53 cooperates with FOXO1 to increase bim RNA levels by inhibiting expression of miR17-92Surprisingly, we found that RNA expression of bim was significantly lower in peroxide -treated cells in which either FOXO1 or p53 expression had been knocked down compared with peroxide -treated controls (Figure 4a). [score:9]
[27] from our study indicate that p53 -mediated inhibition of miR17-92, and consequently of miR17-5p, contributes to the upregulation of bim RNA levels in oxidative stress-exposed cells cultured in high glucose. [score:6]
p53 is known to inhibit the expression of micro RNA (miR17-92), [26] a cluster of miRNAs that includes the negative regulator of bim miR17-5p. [score:6]
FOXO1 is known to directly promote bim transcription, [23] whereas p53 has previously been shown to inhibit expression of miR17-92, [26] a cluster of miRNAs that includes the bim repressor miR17-5p. [score:6]
Next, we transfected cells with an miR17-5p inhibitor before treatment with the p53 inhibitor pifithrin- α (PFT α). [score:5]
These results demonstrate that inhibition of miR17-5p can compensate for loss of p53 activity in peroxide -treated cells and restore bim expression. [score:5]
Mimic and inhibitors for miR17-5p and miR28-5p as well as the respective controls were purchased from Life Technologies. [score:3]
Using an miR17-5p mimic, we overexpressed miR17-5p in tenocytes. [score:3]
[1 to 20 of 9 sentences]
49
[+] score: 53
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
In contrast, the miR-17/92 polycistronic microRNA cluster was overexpressed in several lymphoid malignancies and inhibits the expression of the pro-apoptotic factor Bim and the tumor suppressor PTEN [12]. [score:9]
In addition, both BCR-ABL and c-Myc up-regulated the expression of miR-17/92 in BCR-ABL -positive cell lines, suggesting it may be used as a therapeutic target [37]. [score:8]
In fact, KIT -mediated up-regulation of miR-17, which targets RUNX1-3'UTR, mimicked the effects of the CBF-AML fusion protein [108]. [score:6]
The tumor suppressor function of miR-17/92 is mostly explained through targeting pro-survival proteins BCL2, STAT5 and JAK2. [score:5]
Activation of STAT3 -induced IL-6 in tumor cells stimulates the expression of miR-17 and miR-19a, resulting in lower expression of TLR7 and TNFα. [score:5]
On the other hand, targeting of the CDK inhibitor CDKN1A (p21) may explain the oncogenic role of miR-17/92. [score:5]
The miR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 represent the most frequently deregulated miRNAs reported in CLL, and these microRNAs have been associated with disease progression, prognosis, and drug resistance [1] (Table  1). [score:4]
In a clinical setting, miR-17/92 is up-regulated in early chronic-phase (CP), but not in blast-crisis (BC) CML CD34 (+) cells when compared with normal CD34 (+) cells. [score:3]
Expression signatures of a minimum of two (miR-126/126*), three (miR-224, miR-368, and miR-382), and seven (miR-17-5p and miR-20a, along with the aforementioned five) miRNAs could correctly distinguish CBF, t (15;17), and MLL-rearrangement AMLs, suggesting that these microRNAs may cooperate with specific translocation in leukemogenesis [107]. [score:3]
miR-17/92 can be both a tumor suppressor and an oncogene depending on the tumor context. [score:3]
The most frequently deregulated miRNAs in chronic myeloid leukemia include miR-10a, miR-17/92, miR-150, miR-203, and miR-328 [36]. [score:2]
[1 to 20 of 11 sentences]
50
[+] score: 51
However, miR-149 provides a mechanism to bypass the induction of apoptosis by p53 activation by directly targeting glycogen synthetase-3α and thereby stabilizing MCL-1. Consistent with the reported function of these miRNAs in regulating cell proliferation and metastatic potential, target site mapping to genes associated with melanoma progression suggests that miR-17-5p, miR-19a-3p, miR-149-5p and miR-21 play a role in modulating cell response to TP53/RB1 activation and TGFβ/SMAD signaling pathways. [score:7]
Previous studies demonstrated that miR-17 is highly expressed in leukemia and lung cancer, and it promotes cell proliferation by targeting p21 [31, 32] as well as PTEN and RB [33, 34]. [score:5]
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
To examine the relationship between miR-17, miR-19a, miR-21, miR-126 and miR-149 expression in human cancer specimens from cutaneous melanoma, we queried the TCGA data portal [54] for all samples with Level 3 miRNA expression data available, as well as the accompanying clinical data. [score:5]
The conserved target sites of miR-17-5p, miR-19a-3p, miR-149-5p, miR-21 and miR-126-3p were mapped to the 3-UTRs of a panel of genes that have been associated with melanoma progression according to TargetScan V6.2. [score:5]
As shown in Figure 4, low expression of miR-17, miR-19a, miR-21, miR-126 and miR-149 was found in thinner melanoma (Clark level I/II) and high expression was found in thicker melanoma (Clark level III, IV and V). [score:5]
To investigate the potential biological functions of the miRNAs upregulated in metastatic melanoma, the target sites of miR-17-5p, miR-19a-3p, miR-149-5p, miR-21 and miR-126-3p were mapped to the 3-UTRs of a panel of genes that have been previously found to be associated with melanoma progression [21, 22, 23]. [score:4]
Most interestingly, miR-17, miR-19a, miR-21, miR-126 and miR-149 were expressed at 1.8-fold, 2.3-fold, 1.7-fold, 2.8-fold and 3.9-fold higher levels, respectively, in patients with metastatic melanoma (p values of 0.044, 0.015, 0.038, 0.040 and 0.021, respectively). [score:3]
Expression of miR-17, miR-19a, miR-21, miR-126 and miR-149 in the TCGA database for 216 independent melanoma patient samples according to Clark level (Level 1 is the least aggressive and Level V is the most aggressive). [score:3]
An important aspect of our studies was the finding that miR-17, miR-19a, miR-21, miR-126 and miR-149 were expressed at higher levels in plasma-derived exosomes from patients with metastatic melanoma. [score:3]
Figure 4 High expression of miR-17, miR-19a, miR-21, miR-126 and miR-149 is associated with melanoma tumor grade. [score:3]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
For example, using a high-throughput approach, miR-17 was identified as a potential oncogenic miRNA in melanoma [30]. [score:1]
[1 to 20 of 13 sentences]
51
[+] score: 49
Only one out of four sites for miR17-5p (Figure  6E) and one out of five sites for miR-27a (Figure  6F) showed significant (P < 0.05) reduction of mRNA levels, indicating that most interactions that result in reduced protein are due to translational inhibition rather than mRNA degradation, although both types of regulation are possible. [score:6]
For both miR-17-5p imperfect centered sites (Figure  6C), and miR-27a imperfect centered sites (Figure  6D), all targets were found to be significantly enriched (P ≤ 0.05) in the AGO2 enriched fraction compared to the input mRNA population, demonstrating that interactions between an imperfect centered site and its target mRNA were mediated through RISC. [score:4]
However, like any difficult biological problem, orthogonal validation and careful interpretation are critical, and we were encouraged that miRNA targets inferred from all high-throughput methods and luciferase assays were significantly more likely to be enriched in our pull-downs than other genes (Table S2 in Additional file 1), and that the overlap seen between our results and those from the miR-17-5p over -expression experiments is similar to that observed between the latter and AGO2 immuno-precipitation datasets [34, 37]. [score:4]
Sequencing the RNA captured in the miR-17-5p pull-down revealed several examples of targeting outside annotated exons. [score:3]
The bar plot indicates the expression of the indicated gene in HEK293T cells transfected with miR-17-5p relative to mock -transfected cells. [score:3]
By comparing the distribution of the miR-17-5p fold-change observed in this study between the transcripts that were detected as targets in previous studies and those that were not, we observed a significantly greater fold-change in the corresponding biotin pull-down in the former class (Figure  2C-E; Additional file 4; Kolmogorov-Smirnov tests, P-values from 1 × 10 [-2] to 1 × 10 [-22]). [score:3]
We used qRT-PCR to determine whether these mRNA targets were destabilized by miR-17-5p and therefore less likely to appear as significantly enriched in the biotin pull-down. [score:3]
We examined all 26 HUGO genes that were targeted by an Illumina probe that was significantly enriched in the pull-down, that had exact matches only to transcripts with no predicted miR-17-5p seed and perfect or imperfect centered binding sites, and that predominantly spanned unique genomic regions to which the sequencing reads could be mapped [28]. [score:3]
Red, canonical transcripts found to be miR-17-5p targets in the indicated study (Table S5 in Additional file 1); black, all other canonical transcripts; p, one-sided P-value from Kolmogorov-Smirnov test for a difference in distributions. [score:3]
We selected eight previously untested targets of miR-17-5p (3) and miR-27a (5) for experimental validation using luciferase assays. [score:2]
These genes had previously been shown to be targeted by miR-17-5p in luciferase assays. [score:2]
As a third control, we compared the biotin pull-down results to those obtained using both PAR-CLIP [12] and miR-17-5p over -expression studies [23, 24]. [score:2]
After transient transfection with biotinylated miR-17-5p (replicating the conditions of the biotin pull-down) we observed significant degradation of five of the six genes (Additional file 5). [score:1]
Of these, eight clearly had either extended 3′ UTRs (HMBOX1, TBPL1, ZNF786, NDUFAF3) or retained introns (C2orf34, COQ10B) or both (C16orf68, EEF1E1), and, in all cases, these extra regions contained miR-17-5p seed or centered sites (Figure  3). [score:1]
None of the annotated exons (maroon boxes) contained predicted miR-17-5p sites. [score:1]
HEK293T cells were transfected with either a standard biotinylated, double-stranded miR-17-5p miRNA duplex, or with a biotinylated single-stranded miR-17-5p sequence. [score:1]
To start characterizing the potential false negatives of the biotin pull-down approach, we selected six genes that we had previously reported to be targets of miR-17-5p that were not enriched in our pull-down [8]. [score:1]
Although this approach lost some statistical power through the large reduction of transcripts, we still found statistical support (P ≤ 0.05) for each of the five comparisons (miR-10a versus miR-10b; miR-10a versus miR-10a-iso; miR-10b versus miR-10b-iso; miR-182 versus miR-182-iso; miR-17-5p versus miR-17-5p-iso), and a total of 14/20 of the observed enrichments confirmed our hypothesis (Table S4 in Additional file 1). [score:1]
iwhere p [i,m] is the probability that the probe detecting transcript i is significantly enriched in the pull-down of miRNA m; x [a,b,m,i] is the number of miR- m sites of type a in region b of transcript i (for example, miR-17-5p seed sites in the 3′ UTR); β [a,b] is the coefficient (or weight) corresponding to that count and β [0] is some constant. [score:1]
i where p [i,m] is the probability that the probe detecting transcript i is significantly enriched in the pull-down of miRNA m; x [a,b,m,i] is the number of miR- m sites of type a in region b of transcript i (for example, miR-17-5p seed sites in the 3′ UTR); β [a,b] is the coefficient (or weight) corresponding to that count and β [0] is some constant. [score:1]
miR-17-5p and its isomiR are illustrated here. [score:1]
Two additional genes (ERLEC1, UBB) showed weak evidence for retained introns or extended 3′ UTRs that contained miR-17-5p sites. [score:1]
In parallel, RNA extracted from the miR-17-5p pull-down was used in RNAseq library construction as previously described [39] and 50 bp tags were generated on the Applied Biosystems SOLiD (Melbourne, VIC, Australia). [score:1]
[1 to 20 of 23 sentences]
52
[+] score: 48
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
MiR-17 family, miR-574-5p and miR-214 were upregulated at the onset of SARS infection: these miRNAs may help the virus to evade the host immune system and are responsible for effective transmission at the initial stage of viral infection [86]. [score:4]
[1 to 20 of 3 sentences]
53
[+] score: 48
[37] The upregulation of p38α (MAPK14) protein seen in the current human study may be owing to the decreased expression of miR-19a/b, members of the miR-17/92 cluster, or miR-185-5p, as they are predicted to target human MAPK14 (TargetScan release 7.0: http://www/targetscan. [score:12]
[37] Therefore, the protein expression levels of p38α in patient-derived neurospheres were predicted to be increased by the downregulation of miR-17/92 cluster members. [score:6]
[33] Therefore, the underexpression of miR-17/92 cluster members, miR-185-5p and miR-106a/b, and subsequent upregulation of p38α may underlie the observed size reduction of patient-derived neurospheres and the decreased neural differentiation efficiency in patient-derived neurospheres. [score:6]
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
It has been reported that (i) miR-17/106 targets the MAPK14 transcript (encoding the α-isoform of p38 protein kinase) in mice and (ii) the miR-17/106-p38 axis is a critical regulator of the neurogenic-to-gliogenic transition competence. [score:4]
[37] The patient-derived neurospheres showed reduced expression levels of miR-17/92 cluster members and miR-106a/b. [score:3]
[32] As the downstream targets of DGCR8, which may be causally linked to the observed phenotypes, we examined the miR-17/92 cluster and miR-106a/b. [score:3]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
In previous studies, the miRNAs of miR-17 family and miR-17/92 cluster have been reported to show abnormal expression levels in schizophrenic brains. [score:3]
The miR-17/92 have a general role in cell proliferation and survival during normal development and also during tumorigenesis. [score:2]
[33] The miR-17 family (Figure 3c) includes miR-17 (in the current study, hsa-miR-17-3p showed FC=0.7 and P=0.0449; Supplementary Figures 3a and 3b), miR-20a/b, miR-93 and miR-106a/b. [score:1]
[1 to 20 of 11 sentences]
54
[+] score: 44
Consistently, suppression of miR-17–92 expression by nucleic acid inhibitors or differentiation-inducing agents, e. g., all-trans retinoic acid, reverses the miR-17–92 effects on GBM spheroids, suggesting a key role of miR-17–92 in sustaining GSC stemness and the potential usefulness of miRNAs as targets of GSC -targeting strategies [39]. [score:11]
However, the miR-17–92 cluster is aberrantly overexpressed during gliomagenesis, promoting the proliferative effects of loop 2, and due to c-myc upregulation, the anti-proliferative function of miR-17–92 in loop 1 is inhibited. [score:8]
By targeting differentiation-promoting genes and cell cycle promoter genes, miR-17–92 inhibits apoptosis and induces cell proliferation in GBM spheroids, in which glioma-initiating cells and GSCs are enriched. [score:5]
Moreover, there is increased miR-17–92 locus expression in a subset of GBM cells. [score:3]
In loop 2, however, miR-17–92 targets CDKN1A, leading to activation of the CCND1/CDK4 complex and cell proliferation. [score:3]
Lu S. Wang S. Geng S. Ma S. Liang Z. Jiao B. Increased expression of microRNA-17 predicts poor prognosis in human glioma J. Biomed. [score:3]
Thus, due to its multi-target property, miR-17–92 provides an intracellular fine-tuning mechanism for the proliferative signal and acts as a noise-buffering mediator in normal cells [40, 41, 144, 145, 146, 147, 148]. [score:3]
MiR-17–92 suppresses cell cycle progression and proliferation through this signaling loop. [score:2]
Osada H. Takahashi T. Let-7 and miR-17–92: Small-sized major players in lung cancer development Cancer Sci. [score:2]
For example, the biological functions of the miR-17–92 cluster involve two regulatory loops. [score:2]
In one loop, miR-17–92 represses E2F1 and c-myc, two pro-proliferative transcription factors that are able to reversely activate the transcription of mi-17–92. [score:1]
Hence, the compromised fine-tuning effect of miR-17–92 enhances the progression of the glioma [39]. [score:1]
[1 to 20 of 12 sentences]
55
[+] score: 43
MiR-17 also targets and inhibits PTEN (Fang et al., 2014) and RHOE (RND3), which encodes a GTP -binding protein (without GTPase activity) that is reduced in CRC and can repress tumor cell invasion (Thuault et al., 2016), promote contact inhibition (Hernández-Sánchez et al., 2015) and downregulate Notch signaling (Tang et al., 2014b; Zhu et al., 2014b). [score:9]
Elevated oncofoetal miR-17-5p expression regulates colorectal cancer progression by repressing its target gene P130. [score:6]
Further analysis has revealed that miR-17 directly represses the cell cycle regulator and RB -family member P130 (RB transcriptional co-repressor like 2, RBL2), a tumor suppressor that also negatively regulates β-catenin levels and Wnt signaling (Ma et al., 2012). [score:6]
MicroRNA-17∼92 inhibits colorectal cancer progression by targeting angiogenesis. [score:4]
MicroRNA-17 induces epithelial-mesenchymal transition consistent with the cancer stem cell phenotype by regulating CYP7B1 expression in colon cancer. [score:3]
The miR-17/92 cluster: a comprehensive update on its genomics, genetics, functions and increasingly important and numerous roles in health and disease. [score:3]
MiR-17 appears to promote CRC tumorigenesis, evident in studies showing that it suppresses apoptosis and cell cycle arrest, increases migration, and drives tumor xenograft growth of CRC cell lines (Ma et al., 2012). [score:2]
MicroRNA-17-5p promotes chemotherapeutic drug resistance and tumour metastasis of colorectal cancer by repressing PTEN expression. [score:2]
MiR-221, miR-21 and miR-17/106 enhance activation of PI3K signaling by repressing negative regulators of this pathway. [score:2]
Other miR-17 family members are also modulators that fuel cancer progression. [score:1]
The human miR-17 family consists of eight miRNAs (miR-17, miR-18a/b, miR-20a/b, miR-93, and miR-106a/b), with three of these (miR-17, miR-18a, and miR-20a) transcribed from the miR-17-92 miRNA locus. [score:1]
The TGF-β pathway, which is important for repressing cellular proliferation and cell cycle progression is also antagonized by several miRNAs, including miR-17/106, miR-135b, and miR-20a through effects on TGFBR2 and SMAD4. [score:1]
The miR-17 oncomiR family and modulation of TGF-β signaling. [score:1]
In summary, studies to date indicate that the miR-17 family fuels CRC metastasis, with interaction with TGF-β signaling as well as other pathways that modulate EMT. [score:1]
Several members of this cluster, such as miR-17 (Ng et al., 2009; Yu et al., 2012), miR-20a (Schetter et al., 2008; Motoyama et al., 2009; Earle et al., 2010; Yu et al., 2012), miR-92a (Motoyama et al., 2009; Ng et al., 2009; Earle et al., 2010; Tsuchida et al., 2011; Schee et al., 2012; Wu et al., 2012; Yu et al., 2012) and miR-18a (Motoyama et al., 2009; Brunet Vega et al., 2013; Zhang et al., 2013b), are all reportedly increased in CRC tumors and in serum/plasma, with their elevated levels correlating with recurrence and poor prognosis. [score:1]
[1 to 20 of 15 sentences]
56
[+] score: 42
Overexpression or downregulation of the miR-17-5p could suppress or promote breast cancer cell proliferation, respectively [57]. [score:8]
As an absence of apoptosis was observed in the lymphomas derived from mice expressing both c-myc and miR-17-19b (a subset of the miR-17-92 cluster), the miR-17-92 cluster possibly targets apoptotic factors that are activated, when c-Myc is overexpressed [39]. [score:7]
The expression of cyclin -dependent kinase inhibitor CDKN1A (p21) is inhibited by miR-17-5p, miR-18a, and miR-20a. [score:7]
The miR-17-5p exerts its role of tumor suppressor in breast cancer cells by repressing the expression of AIB1 (named for “amplified in breast cancer 1”). [score:5]
Five miRNAs of the cluster (miR-92-1, miR-19a, miR-20a, miR-19b, miR-17-5p) were upregulated in these cancer cell lines. [score:4]
MiR-17-5p can exert both oncogenic and tumor suppressive function through decreasing the expression levels of anti-proliferative genes and pro-proliferative genes, respectively. [score:4]
The research group reported that E2F1 is negatively regulated by miR-17-5p and miR-20a. [score:2]
Recently, Yu et al. reported that Cyclin D1, which has been demonstrated as an oncogenic protein in breast cancer cell, is negatively regulated by miR-17-5p and miR-20a [58]. [score:2]
By using web -based Ingenuity Pathways Analysis (IPA), Cloonan and colleagues uncovered a large genetic network in which the miR-17-5p is a key regulator of the G [1]/S phase cell cycle transition [59]. [score:2]
A polycistronic microRNA cluster termed miR-17-92, located in chromosome 13 open reading frame 25 (C13orf25) in the human genome, encodes seven miRNAs: miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92-1. Fig. (2) shows the genomic organization of this cluster. [score:1]
[1 to 20 of 10 sentences]
57
[+] score: 42
In detail, the expression of miR-186, miR-215 and miR-223 resulted upregulated in ATRA differentiated cells, while the expression of miR-17-5p, miR-25, miR-193, miR-195, and let-7a resulted downregulated (the miRNAs bolded were already reported as deregulated by ATRA in differentiated NB4 cells in refs. [score:12]
The densitometric analysis, carried out on three independent experiments, showed that in ATRA treated NB4 cells the expression of miR-17 decreased about 6 fold while the expression of miR-25 decreased about 4 fold. [score:5]
miR-17-5p and miR-25 are downregulated in NB4 cells differentiated upon ATRA treatment. [score:4]
The microarray data indicated a strong downregulation of miR-17 and miR-25 in the differentiated phenotype (Figure 1B and 1C, NB4 lanes UT vs. [score:4]
Figure 1 Cluster analysis of treated and untreated NB4 cell lines using the 8 human miRNAs differentially expressed and Northern blot validation of miR-223, miR-17 and miR-25. [score:3]
Hsa = human miRNAs; mmu = miRNAs Click here for file E2F1 and E2F4 proteins level don't correlate with the miR-25 and miR-17 expression in NB4+ ATRA treated cells. [score:3]
By in silico analysis we found that both miR-25 and miR-17 could have as putative targets E2F1 and E2F4, thus, they could synergistically act in the control of promyelocytic proliferation and differentiation. [score:3]
Hsa = human miRNAs; mmu = miRNAs E2F1 and E2F4 proteins level don't correlate with the miR-25 and miR-17 expression in NB4+ ATRA treated cells. [score:3]
In both cell lines we observed a proportional correlation between the amount of the mature miR-17 and its precursor suggesting that this miRNA is mainly regulated at transcriptional level during myeloid differentiation. [score:2]
miR-17). [score:1]
For this reasons, further studies on the identification of genes possessing miR-17-5p or miR-25 complementary sequences are required. [score:1]
Note that for the miR-17 is visualized also the precursor (prec. [score:1]
[1 to 20 of 12 sentences]
58
[+] score: 41
The results showed that miR-378 was downregulated in GC tissues, whereas the other five miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) were upregulated in GC (Figure 2). [score:7]
In conclusion, our systemic review identified five upregulated miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) and one downregulated miRNA (miR-378) that are potential novel biomarkers for GC. [score:7]
We identified the five miRNAs that were most consistently upregulated (miR-21, miR-106a, miR-17, miR-18a and miR-20a) and two most consistently downregulated (miR-378 and miR-638) in at least four profiling studies. [score:7]
0073683.g002 Figure 2 Using U6 as a normalization control, the expression of miR-21, miR-106b, miR-17, miR-18a and miR-20a was significantly higher in GC tissues, while the expression of miR-378 was significantly lower. [score:5]
The high expression of miR-17 is significantly correlated with poor survival outcomes [31]. [score:3]
MiR-106b, miR-17 and miR-18a levels were significantly higher in poorly differentiated GC, cases with lymph node involvement, or late stage disease, while miR-20a levels were significantly higher in cases of GC with lymph node involvement. [score:3]
Expression levels of miR-21, miR-106b, miR-17, miR-18a, miR-20a and miR-378 in GC and adjacent noncancerous tissue samples. [score:3]
MiR-17 has known oncogenic activity in humans, and was found to be upregulated in 77.2% of tissue samples of GC compared with adjacent normal gastric tissue. [score:2]
Three of these miRNAs were reported in five microarray studies (miR-21, miR-106b and miR-378), four were reported in four studies (miR-17, miR-18a, miR-20a and miR-638), and seven were reported in three studies (miR-19a, miR-20b, miR-25, miR-30d, miR-923, miR-375, and miR-148a). [score:1]
Previous studies have also found that miR-17 has oncogenic activity in colorectal cancer [32], breast cancer [33] and pancreatic cancer [34]. [score:1]
Circulating levels of miR-17 are elevated in GC patients, and the concentration of miR-17 is significantly associated with the TNM stage and grade of GC [31]. [score:1]
For example, serum miR-21 was significantly elevated in perioperative serum from adenomas and colorectal cancer (CRC), and was an independent prognostic marker for CRC [50], [51]; Plasma miR-106b, together with miR-20a and miR-221 have the potential as novel biomarkers for early detection of gastric cancer [40]; Circulating miR-17 may used as a novel noninvasive biomarker for nasopharyngeal carcinoma [52], gastric cancer [53] and CRC [54]; Serum miR-18a may be used as a novel biomarker in breast cancer [55], colorectal cancer [56], hepatocellular carcinoma [57], and pancreatic cancer [58]; Circulating miR-378 may be used as a biomarker in renal cell carcinoma [59] and gastric cancer [60]. [score:1]
[1 to 20 of 12 sentences]
59
[+] score: 41
Among others, miRNAs of the miR-17–92 and miR-106b-25 cluster are also positively correlated with the IFM-score being up-regulated in high-risk patients and have been described being upregulated in malignant vs. [score:7]
Up-regulation in GPI [high]-patients could thus contribute to anti-apoptotic signaling in this group, in agreement with members of the miR-17–92 cluster being within the most up-regulated miRNAs in proliferating myeloma cell lines compared to (non-proliferating) normal and malignant plasma cells. [score:6]
Of these, 10 are significantly up-, 24 down-regulated in low-risk patients with nine miRNAs belonging to the miR-17–92 cluster (maximal FC: 1.42 to −1.74). [score:4]
All of them were up-regulated in the GPI [high]-group and six belong to the miR-17–92 cluster. [score:4]
All of them were up-regulated in the GPI [high]-group with a maximal FC of 2.3 (Supplementary Table S6), six miRNAs belonging to the miR-17–92 cluster. [score:4]
This is also in accordance with data from Pichiorri et al. who showed members of the oncogenic miR-17–92 and miR-106b-25 clusters, both sharing a high degree of homology, being upregulated in malignant vs. [score:4]
However, 6 of 8 miRNAs which are significantly higher expressed in GPI [high]-patients, and five of ten miRNAs being positively correlated with the GPI are overlapping, but for miR-103 all being part of the miR-17–92 cluster. [score:3]
Interestingly, a high expression of members of the miR-17–92 cluster is associated with a shorter progression-free survival in myeloma patients [37]. [score:3]
The miR-17–92 cluster was described as potential oncogene (onco-miR-1) targeting pro-apoptotic genes [27, 36]. [score:3]
Of the latter, five belong to the miR-17–92 cluster. [score:1]
miR-19b and miR-106b are members of the miR-17–92 cluster and correlated to genes, e. g. BUB1 and BUB1B, that have been described as components of the mitotic checkpoint control [40]. [score:1]
Of the latter, nine miRNAs belong to the miR-17–92 cluster. [score:1]
[1 to 20 of 12 sentences]
60
[+] score: 40
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
MiR-17-5p and miR-181d, which are downregulated in formaldehyde -treated human lung epithelial cells, were predicted to regulate the greatest number of genes in the brains of MAM -treated Mgmt [−/−] mice (Figure 3). [score:5]
Mir-17-5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA. [score:5]
MiR-17-5p also has tumor-suppressing activity in hepatocellular, gastric, pancreatic, breast, and cervical cancer (Hossain et al., 2006; Yu et al., 2010; Chen et al., 2012; Wang et al., 2012) and is also thought to be involved in the regulation of APP expression (Hébert et al., 2009). [score:5]
Formaldehyde-responsive miRNAs predicted to modulate MAM -associated genes in mouse brains lacking MGMT include miR-17-5p and miR-18d, which regulate genes involved in tumor suppression, DNA repair, amyloid deposition, and glutamatergic and dopaminergic neurotransmission. [score:4]
These include miR-17-5p and miR-181d, which regulate genes involved in tumor suppression, DNA repair, amyloid deposition, and glutamatergic and dopaminergic neurotransmission. [score:4]
MiR-17-5p targets tumor protein P53 -induced nuclear protein 1 (TP53INP1), which suppresses cell growth and promotes apoptosis of cervical cancer cells (Wei et al., 2012). [score:4]
MicroRNA miR-17-5p is overexpressed in pancreatic cancer, associated with a poor prognosis, and involved in cancer cell proliferation and invasion. [score:3]
In particular, miR-17-5p (discussed later), mIR-20a, and miR-106b reduce endogenous APP expression in vitro (Hébert et al., 2009). [score:3]
MiR-17-5p regulates the expression of EPHA4, GNPDA2, and TXNIP. [score:3]
A comparison of all 89 formaldehyde-modulated miRNAs in human lung epithelial cells (Rager et al., 2011) with the miRNAs predicted here to regulate genes in the brains of MAM -treated Mgmt [−/−] mice show overlap of 6 miRNAs: miR-107, miR-152, miR-17-5p, miR-181d, and miR-454-3p. [score:2]
miR-17-5p as a novel prognostic marker for hepatocellular carcinoma. [score:1]
Circulating miR-17-5p and miR-20a: molecular markers for gastric cancer. [score:1]
[1 to 20 of 12 sentences]
61
[+] score: 39
MiR-17/92 inhibited the expression of the tumor suppressor PTEN and the proapoptotic protein Bim. [score:6]
In this study, the BCR -driven induction of miR-17/92 in UM-IgH V [H] CLLs was proposed as possible regulator of B-cell proliferation/survival by downregulating anti-proliferative and/or pro-apoptotic genes [40]. [score:5]
MiR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 family members, the most deregulated microRNAs in CLL, were found to regulate important genes, helping to clarify molecular steps of disease onset/progression. [score:5]
To determine whether miR-17/92 overexpression induces lymphomagenesis, we generated a transgenic mouse overexpressing miR-17/92 in B cells [41]. [score:5]
Evidence that BCR response in aggressive UM-IgH V [H] CLL is accomplished through upregulation of miR-17/92 has been described. [score:4]
These data indicate that PTEN and Bim were direct targets of miR-17/92 cluster molecules [39]. [score:4]
ABCC3, a member of the ABC transporter family involved in anticancer agents transport, phosphoinositide 3-kinase (PI3K), growth arrest, and DNA damage 45 (GADD45), IL-4 were among downregulated mRNAs in miR-17/92 mice [41]. [score:4]
In 2008, Xiao et al. [39] generated mice with higher expression of miR-17/92 in lymphocytes. [score:3]
MiR-17/92 is a polycistronic microRNA cluster overexpressed in several lymphoid malignancies. [score:2]
Furthermore, study of miR-17/92 and miR-155 may provide useful insights into drug design, delivery, resistance mechanisms, and microenvironmental responses [17, 41]. [score:1]
[1 to 20 of 10 sentences]
62
[+] score: 39
We selected, for experimental validation, targets to three of these miRNAs: hsa-miR-17-5p (one target: see below), hsa-miR-15a (two targets), and hsa-miR-324-3p (three targets). [score:9]
We found 777 genes (27.0%) with 2485 isoforms (31.8%) in which at least one predicted target site is reassigned to a different mRNA region in at least one isoform, with 6519 (9.8%) of predicted miRNA targets in this category; most of these cases involve a site found in the 5′UTR of one isoform but in the CDS of a second (e. g. the energetically most-favorable miR-17-5p target site on TNFSF12 mRNAs: Supplementary Figure S1), or in the CDS of one but in the 3′UTR of a second, although in a small number of isoform sets a binding site is reassigned among all three regions. [score:7]
For example, targets predicted for let-7a are shifted toward better free energies than are those predicted for both sets of controls (Figure 1B), whereas targets predicted for miR-17-5p and its controls show similar energy distributions (Figure 1C). [score:5]
For one of the experimentally validated miRNAs in this study, miR-17-5p, we predicted target sites in both known transcript isoforms of TNFSF12, but in the CDS of one and the 3′UTR of the other. [score:3]
Numbers of predicted target sites per miRNA and its control sequences for (A) miR-1 and its controls with WC nt 2–8; if miR-1 hybridized with perfect WC complementarity this would yield −30.8 kcal/mol (see Methods); (B) let-7a and imposing only the requirement of WC base pairs within nucleotide positions 2–8; let-7a perfect WC complementarity would yield −33.2 kcal/mol; (C) miR-17-5p and its controls with WC nt 2–8; perfect WC complementarity would yield −44.5 kcal/mol; (D) miR-324-3p and its controls with WC nt 2–8; perfect WC complementarity would yield −52.8 kcal/mol; and (E) miR-129 and its controls with WC nt 2–8; perfect WC complementarity would yield −41.4 kcal/mol. [score:3]
Panels B, C and D of Figure 1 show the increasingly better energy-score ranges for predicted targets of let-7a, miR-17-5p and miR-324-3p. [score:3]
Five of the target sites (hsa-miR-15a/TSPYL2, hsa-miR-15a/BCL2, hsa-miR-17-5p/TNFSF12, hsa-miR-324-3p/CREBBP and hsa-miR-324-3p/WNT9B) exhibit perfect WC complementarity in the seed regions, while has-miR-324-3p/DVL2 has one GU pair in the same region (Supplementary Figure S1). [score:3]
0005745.g001 Figure 1Numbers of predicted target sites per miRNA and its control sequences for (A) miR-1 and its controls with WC nt 2–8; if miR-1 hybridized with perfect WC complementarity this would yield −30.8 kcal/mol (see Methods); (B) let-7a and imposing only the requirement of WC base pairs within nucleotide positions 2–8; let-7a perfect WC complementarity would yield −33.2 kcal/mol; (C) miR-17-5p and its controls with WC nt 2–8; perfect WC complementarity would yield −44.5 kcal/mol; (D) miR-324-3p and its controls with WC nt 2–8; perfect WC complementarity would yield −52.8 kcal/mol; and (E) miR-129 and its controls with WC nt 2–8; perfect WC complementarity would yield −41.4 kcal/mol. [score:3]
This selection was made on the basis of functional association with cancer (hsa-miR-17-5p, hsa-miR-15a) or predicted targets in the Wnt signalling pathway (hsa-miR-324-3p) as described in Supplementary Table S7. [score:3]
[1 to 20 of 9 sentences]
63
[+] score: 39
Mogilyansky E. Rigoutsos I. The miR-17/92 cluster: A comprehensive update on its genomics, genetics, functions and increasingly important and numerous roles in health and diseaseCell Death Differ. [score:3]
This deletion could alter the biogenesis of the miR-17–92 cluster and thus affect the expression levels of any of its six mature miRNAs. [score:3]
Moreover, Chakraborty et al. designed two miniclusters, pri-miR-17-19a and pri-miR-20a-19a, and carried out expression studies in mammalian cells [26]. [score:3]
Specially, this variant may alter the biogenesis of the miR-17–92 cluster, thereby affecting expression levels of any of its six mature miRNAs. [score:3]
We sequenced the complete pre-miR-17 coding sequence and boundaries in 99 probands from BC families negative for BRCA1/2 point mutations, to identify pre-miR-17 sequence variations in a Chilean population. [score:2]
In the case of pri-miR-17–92a, as noted by Chakraborty et al., the transcript folds into a tertiary structure and autoregulates its processing [26]. [score:2]
In the present study, we searched for pre-miR-17 sequence variants in Chilean BRCA1/2 -negative familial BC cases. [score:1]
The deletion is located between the miR-17 and miR-18a sequences—specifically, 20 bp downstream from miR-17 and 36 bp upstream from miR-18a (Figure 1). [score:1]
Here, we report the identification of a rare 6 bp germline deletion involving the miR-17–92 cluster in a BRCA1/2 -negative Chilean family with a history of BC. [score:1]
The whole coding sequence and pre-miR-17 sequence boundaries were amplified by polymerase chain reaction (PCR). [score:1]
The polycistronic miR-17–92 cluster is among the most studied microRNA clusters, mapping to human chromosome 13q. [score:1]
rs770419845 is positioned in the intergenic region, between pre-miR-17 and pre-miR-18a. [score:1]
The deletion is located between the genetic sequences for miR-17 and -18. [score:1]
In silico analyses to predict the effect of rs770419845 on the physicochemical parameters and secondary structure of pre-miR-17 RNA and the whole miR-17–92 cluster were performed using RNAfold from the ViennaRNA Web Service (Available online: http://rna. [score:1]
Pre-miR-17 Complete Sequence Analysis. [score:1]
We identified a single 6 bp in del (delTTGGGC), located within the polycistronic miR-17–92 cluster. [score:1]
Considering that (a) the deletion affected the secondary structure and stability of the pre-miR-17–pre-miR-18 region and the entire cluster, (b) the deletion was not present in any of the 480 controls, and (c) rs770419845 is a rare variant in BRCA1/2 -negative BC, this in del is likely pathogenic. [score:1]
We used RNAfold algorithm to predict the effect of this deletion on the structure of pre-miR-17, pre-miR-18a, and the miR-17–92 cluster [14]. [score:1]
These authors reported that, as a control, the pre-miRNA level from the minicluster pri-miR-17-19a also undergoes processing to give significantly higher levels of all three pre-miRNAs relative to pri-miR-17-92a. [score:1]
Pre-miR-17 rs770419845 Analysis. [score:1]
This result could be explained by ethnicity or by an association of this in del and the miR-17–92 cluster with familial BC susceptibility. [score:1]
The miR-17-92a cluster adopts a compact globular structure where the 5′ region of the cluster folds on a 3′ core domain that contains the miR-19b and miR-92 hairpins. [score:1]
The deletion produced a change in the secondary structure of the pre-miR-17–pre-miR-18a sequence, decreasing stability (Figure 2A). [score:1]
The deletion also produced a change in the secondary structure and stability of the miR-17–92 cluster (Figure 2B). [score:1]
Chaulk et al. constructed a mutant of the miR-17-92a cluster and demonstrated an apparent correlation between Drosha processing efficiency and surface accessibility of the individual miRNA-containing hairpins [25]. [score:1]
Furthermore, in this region, the value of ΔG becomes more positive in the presence of the deletion, implying that the deletion affects the secondary structure, decreasing the stability of the pre-miR-17–pre-miR-18a sequence and the entire miR-17–92 cluster with respect to the wild-type structure. [score:1]
Chaulk S. G. Thede G. L. Kent O. A. Xu Z. Gesner E. M. Veldhoen R. A. Khanna S. K. Goping I. S. MacMillan A. M. Men dell J. T. Role of pri-miRNA tertiary structure in miR-17~92 miRNA biogenesisRNA Biol. [score:1]
This 6 bp deletion (delTTGGGC) is located within the polycistronic miR-17–92 cluster, encoding for six miRNAs in the following order: 5′-miR-17–miR-18a–miR19a–miR-20a–miR-19b-1–miR-92a-1-3′ [11, 12]. [score:1]
Mo deling of the regions that included pre-miR-17 and -18a (Figure 2A) and the pri-miR of the complete cluster (Figure 2B) indicated that the secondary structure was altered when the deletion was present. [score:1]
[1 to 20 of 29 sentences]
64
[+] score: 38
miR-106b over -expression can silence two important effectors of the TGF-β signaling pathway: the cell cycle inhibitor CDKN1A and the pro-apoptotic gene BCL2L11 [39], and miR-590-5p and miR-17 have been reported to target TGFBRII, which also affects TGF-β signaling [38, 40]. [score:7]
Three of the up-regulated miRNA species (miR-106, miR-590-5p and miR-17) in the current study are also reported to be overexpressed in CD4 [+] T cells in multiple sclerosis (MS) patients [38– 41]. [score:6]
a miR-155, b miR-21, c miR-146a, d miR-210, e miR-17, f miR-590-5p, g miR-106b, h miR-301a miR-155 was consistently overexpressed following both antibody treatments: OKT3 seemed to induce stronger expression than FvFcR (Fig.   2a). [score:5]
a miR-155, b miR-21, c miR-146a, d miR-210, e miR-17, f miR-590-5p, g miR-106b, h miR-301a miR-155 was consistently overexpressed following both antibody treatments: OKT3 seemed to induce stronger expression than FvFcR (Fig.   2a). [score:5]
miR-17 was up-regulated in CD3 [+] T cells stimulated with either OKT3 or FvFcR (Fig.   2e). [score:4]
Eight of the tested miRNAs (miR-155, miR-21, miR-146a, miR-210, miR-17, miR-590-5p, miR-106b and miR-301a) were statistically significantly up- or down-regulated relative to untreated cells. [score:4]
Moreover, miR-17 deficiency reduces T- bet and IFN- γ expression and promotes differentiation of Foxp3 [+] Tregs [40]. [score:3]
Conversely, the miR-17, miR-106, and miR-590-5p expression data suggest the disrupture of the TGF-β signaling. [score:3]
As they were the least variable, the CD3 [+] T cell expression profiles of eight distinct miRNAs, miR-155, miR-21, miR-146a, miR-210