sort by

9 publications mentioning cel-mir-80

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-80. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 607
Other miRNAs from this paper: cel-let-7, cel-mir-58a, cel-mir-81, cel-mir-82, cel-mir-58b, cel-mir-58c
In adults, when food is abundant, mir-80 is expressed at a high level, and miR-80 binds to metabolic and signaling targets to down-regulate their expression. [score:10]
1003737.g007 Figure 7In adults, when food is abundant, mir-80 is expressed at a high level, and miR-80 binds to metabolic and signaling targets to down-regulate their expression. [score:10]
Our data suggest that loss of mir-80 indirectly upregulates HSF-1 activity to increase expression of HSF-1 -dependent target genes. [score:9]
P [mir-80] reporter expression is down-regulated in the absence of foodSince the genetic elimination of mir-80 results in constitutive DR phenotypes (Fig. 2, Fig. S2), we hypothesized that mir-80 expression might be reduced when food is limited. [score:8]
Could miR-80 directly target the cbp-1 transcript to regulate protein levels?We fully expect that miR-80 regulates dietary restriction by binding to multiple target transcripts. [score:8]
Our studies of expression of a GFP transgene flanked by the 5′ UTR and the exon 8 sites from cbp-1 supported that miR-80 can down-regulate artificial construct expression in posterior gut. [score:8]
mir-80 expression is positively regulated by the presence of food mir-80 is broadly expressed in well-fed animalsPrevious deep sequencing studies indicate that miR-80 is a relatively high abundance miRNA expressed from late embryogenesis into adulthood [34], [35]. [score:8]
However, we emphasize that not all cells exhibit miR-80 down-regulation: expression in two anterior-most and two posterior-most gut cells, and vulval muscle expression appear maintained, and possibly enhanced, in no food. [score:8]
mir-80 is expressed broadly and is regulated by food availability mir-80 is an abundant, wi dely-expressed miRNA, and thus might be involved in global regulation of metabolism coordinated across tissues. [score:7]
One candidate miR-80 binding site is present in the cbp-1 5′UTR, and another is present within exon 8. To test whether direct CBP-1 regulation might be a mechanism by which miR-80 controls metabolic state, we constructed translational reporters in which the cbp-1 promoter drives expression of a GFP that includes either no candidate miR-80 binding sites (NBS) or both the 5′UTR and the exon 8 candidate binding sites (5+8BS) (Fig. S7A). [score:7]
Sequences within the Ce cbp-1 transcript, the protein product of which increases in DR nematodes ([32], Fig. 6E) and in hypoglycemic mouse [38], may serve as direct targets of miR-80 down-regulation when food is abundant. [score:7]
Thus, although mir-80(Δ) influences skn-1::GFP expression in ASI neurons in older animals (Fig. 2E), expression data suggest miR-80 does not act cell autonomously in ASI neurons to exert this regulation. [score:6]
The broad mir-80 expression pattern suggests a potential role for miR-80 in global regulation of metabolism; although dramatic posterior intestinal regulation raises the possibility that major changes in this tissue could provide the most critical influence on organism-wide regulation (see ). [score:6]
mir-80 is homologous to the miRNA bantam in (Fig. S7E), well studied for roles in developmental growth and cell death regulation [49], [50], [51], [52], and more recently implicated in regulation of the core circadian clock [53], neuronal dendritic growth regulation by epithelia [51], and regulation of ecdysone/insulin interplay that influences body size [54]. [score:6]
Note that although cbp-1 is essential for mir-80(Δ) DR benefits, direct targeting remains to be proved and it is likely that additional targets help modulate the DR state. [score:6]
Two different transcriptional reporters for mir-80 fail to co-localize with ASI sensory neurons, so up-regulation of skn-1::GFP expression in those neurons in DR may be a non-autonomous consequence of miR-80 activity. [score:6]
Sequences within the cbp-1 transcript may be direct binding targets of miR-80Interestingly, of the three transcription factors required for mir-80(Δ) healthspan, cbp-1 is the only one for which the transcript is predicted to include potential miR-80 miRNA target sequences (Fig. 6D). [score:6]
P [mir-80] reporter expression is down-regulated in the absence of food. [score:6]
Furthermore, food limitation by alternative diet regimens is also associated with general down-regulation of mir-80 reporter expression (Fig. S5). [score:6]
Although rigorous testing in native context will be required to validate cpb-1 as a direct miR-80 target, our data suggest binding sites in the cbp-1 transcript may contribute to cbp-1 inhibition by miR-80 when levels are high in food. [score:6]
We confirmed general down-regulation in the absence of food by deep sequence analysis of miR-80: overall expression levels food/no food are 1.5 increased (data not shown, p-value<0.05). [score:6]
Given that cbp-1 plays a role in dietary restriction associated with growth in axenic medium, growth on diluted bacteria, and eat-2 feeding impairment [37] and intersects with the insulin pathway for lifespan extension [37], and that we have noted mir-80 expression regulation under bacterial dilution and dietary deprivation, and a partial engagement of the insulin signaling pathway in mir-80(Δ) -induced longevity (Fig. 4D), the miR-80/CBP-1 regulatory loop may constitute a core mechanism by which diverse and intersecting metabolic pathways are coordinately regulated to respond to nutrient availability. [score:6]
Although not definitive proof of direct targeting, these data, together with our findings that CBP-1 protein levels are elevated in DR (Fig. 6E; DR induction of CBP-1 also reported in [32], [37]) and miR-80 levels drop in DR (Fig. 3, Fig. S3, S5) are consistent with a mo del in which miR-80 mediates DR regulation by directly effecting CBP-1 levels (Fig. 7). [score:6]
mir-80 is broadly expressed in well-fed animalsPrevious deep sequencing studies indicate that miR-80 is a relatively high abundance miRNA expressed from late embryogenesis into adulthood [34], [35]. [score:5]
The expression of transcription factor skn-1 in the two head ASI sensory neurons can be necessary for DR lifespan extension benefits [7], and we have shown that mir-80(Δ) increases the expression of a skn-1::GFP reporter in the ASI neurons (Fig. 2E). [score:5]
Our in silico analyses did not identify candidate miR-80 target sites in the daf-16 transcript, suggesting an indirect role in the mir-80(Δ)-regulated DR pathway. [score:5]
In the bDR regimen, cbp-1 deficiency has been shown to disrupt expression of daf-16 and hsf-1 target genes [32], [37] and thus the action of two transcription factors that influence mir-80(Δ) benefits has been mechanistically linked to CBP-1 in DR. [score:5]
A. Transcriptional expression of HSF-1 target gene hsp-16.2 is elevated in mir-80(Δ). [score:5]
In silico analyses did not reveal candidate miR-80 target sites in the hsf-1 transcript, suggesting indirect regulation in the mir-80(Δ) -induced DR pathway. [score:5]
Because mir-80(Δ) induces skn-1::GFP expression in the ASI neurons (previously suggested to be similar to hypothalamic neurons [7]) but mir-80 is not expressed in ASI neurons (Fig. S4A,B), relief of miR-80 repression under food limitation could act upstream of ASI skn-1 induction via a gut-to-neuron signaling relationship. [score:5]
Interestingly, mir-80 does not appear expressed in the ASI neurons in any lines (Fig. S4A,B) and thus miR-80 most likely acts non-cell autonomously to influence skn-1::GFP expression in the ASI neurons (Fig. 2E). [score:5]
Our data are consistent with a mo del in which in the presence of food, cbp-1 is translationally repressed by binding of miR-80 to target sites within the cbp-1 transcript (Fig. 7). [score:5]
If the negative regulatory interaction between miR-80 (or specific miRNAs) and DR targets is conserved, disruption of human regulatory miRNAs might be exploited to promote healthy aging. [score:5]
We noted that during young adulthood, native levels of CBP-1 seemed comparable to WT in mir-80(Δ), suggesting that additional regulatory controls are exerted on CBP-1 expression levels in development or early adulthood. [score:5]
C. Transcriptional expression of HSF-1 target gene hsp-16.2 is elevated in mir-80(Δ). [score:5]
Could miR-80 directly target the cbp-1 transcript to regulate protein levels?. [score:5]
We conclude that mir-80 expression can be modulated by the presence of food: in most cells, mir-80 expression is relatively high in the presence of food and is reduced when food is limiting. [score:5]
CBP-1 is critical for mir-80(Δ) healthspan benefits, and is a candidate direct binding target of miR-80. [score:4]
mir-80 is expressed broadly and is regulated by food availability. [score:4]
Of these, the cbp-1 transcript includes sequences that might be directly targeted by miR-80 to coordinate this circuit. [score:4]
98) is also consistent with a mo del in which miR-80 partially down-regulates the insulin pathway, and that daf-2(RNAi) reflects a stronger activation of the DAF-16 -dependent transcriptional response, more toward an optimal healthspan signaling strength. [score:4]
Interestingly, the human CREBBP transcript might be targeted by miR-80 family members or another miRNA homologous to the exon 8 site (Fig. S7C), suggesting miRNAs could exert a conserved role in DR metabolic regulation that might be harnessed in the future to promote healthy metabolism with anti-aging applications. [score:4]
We fully expect that miR-80 regulates dietary restriction by binding to multiple target transcripts. [score:4]
Sequences within the cbp-1 transcript may be direct binding targets of miR-80. [score:4]
Indeed, multiple mir-80 reporters indicate broad cellular expression and regulation by E. coli food availability. [score:4]
mir-80 is an abundant, wi dely-expressed miRNA, and thus might be involved in global regulation of metabolism coordinated across tissues. [score:4]
Note the some trials with mir-80 transgene rescue suggest that overexpression of mir-80 may be deleterious, and that in a small minority of trials, we did not see life extension although the culture always trended in that direction. [score:4]
mir-80 expression is positively regulated by the presence of food. [score:4]
Ideally, we could test direct miR-80 targeting in vivo by manipulation of a cbp-1 transgene, +/− candidate miR-80 binding sites. [score:4]
1003737.g006 Figure 6CBP-1 is critical for mir-80(Δ) healthspan benefits, and is a candidate direct binding target of miR-80. [score:4]
SKN-1-GFP, a molecular reporter of DR, is upregulated in mir-80(Δ) in the presence of food. [score:4]
We find that the NBS construct is not regulated by miR-80(Δ) (Fig. S7B, left panel); whereas the 5+8BS construct is expressed at a higher level in the absence of mir-80 (Fig. S7B, right panel). [score:4]
mir-80 is broadly expressed in well-fed animals. [score:3]
1003737.g003 Figure 3 mir-80 expression is generally high in the presence of food, but low when food is lacking. [score:3]
If mir-80 represses cbp-1 translation, then we would expect higher levels of CBP-1 protein in mir-80(Δ) animals. [score:3]
We used the native cbp-1 promoter to express GFP reporters that included i) GFP lacking any candidate miR-80 binding sites (NBS); ii) the 5′ UTR candidate miR-80 binding site and the exon 8 candidate miR-80 binding site from cbp-1 (5+8BS). [score:3]
Consistent with a role for hsf-1 in mir-80(Δ) -induced benefits, HSF-1 target gene hsp-16.2 transcripts are elevated in the mir-80(Δ) mutant (Fig. S6). [score:3]
Note that this transgenic line, typical of 4 lines that have the long mir-80 promoter region, exhibits substantial reporter expression in the first two cells of the intestine (indicated by white+sign) and in the posterior intestine (white bracket). [score:3]
When food is lacking, miR-80 levels drop, translational repression of cbp-1 is relieved, and CBP-1+DAF-16+HSF-1 -mediated transcriptional changes induce DR within the animal. [score:3]
To test for mir-80 expression in ASI neurons, we took advantage of the fact that ASI neuron endings are open to the environment and can uptake fluorescent dye from their surroundings. [score:3]
Quantification of GFP fluorescence from mir-80 target site constructsWe synchronized strains (refer Fig. S7A,B, and Table S3) by alkaline bleaching [57] and placed synchronized L1 larvae (Day 1) on NGM plates seeded with OP50-1 bacteria. [score:3]
Because RNAi knockdown is inefficient the nervous system (see [59]), the profound effects of hsf-1(RNAi) suggest that critical hsf-1 and mir-80 regulation occurs outside of the C. elegans nervous system. [score:3]
In summary, the mir-80(Δ) mutant has a lean body, reduced fecundity, hypersensitivity to metformin, and expresses both molecular and fluorimetric markers of DR despite growth in abundant food. [score:3]
The rna22 algorithm [10], which searches for target sites outside the 3′UTR, predicts that miR-80 binds cbp-1 within the 5′ UTR and within exon 8. The potential alignments of miR-80 (red) to C. elegans cbp-1 (blue) sequences are indicated. [score:3]
To identify genes required for mir-80(Δ)-regulated DR, we used RNAi to knockdown genes previously implicated in DR lifespan benefits, hypothesizing that genes required for mir-80(Δ) DR should be needed for the Ex [max] shift and low age pigment levels typical of multiple DR states. [score:3]
Somewhat paradoxically, two published transgenic lines of the same P [mir-80]::GFP fusion transcriptional reporter (utilizing 1741 bp 5′ to mir-80 as promoter [17]), exhibit different cellular expression patterns, an observation we confirmed (Fig. S3A,B). [score:3]
Previous deep sequencing studies indicate that miR-80 is a relatively high abundance miRNA expressed from late embryogenesis into adulthood [34], [35]. [score:3]
We hypothesize that miR-80 is a core regulator by which diverse and intersecting metabolic pathways are coordinately regulated to respond to nutrient availability. [score:3]
The mir-80(Δ); daf-16(Δ) double mutant is suppressed for the longevity phenotype of mir-80(Δ) (p<0.0001). [score:3]
We found that SKN-1-GFP is highly expressed in the ASI neurons in the well fed mir-80(Δ) mutant (Fig. 2E). [score:3]
c) excretory duct cell p [mir-80]GFP line VT1492 expression, food dilution on solid NGM media. [score:3]
Similarities between miR-80/target features in nematodes and mammals raise the possibility that miRNA manipulation of related DR metabolic loops in humans might be recruited to promote healthy aging. [score:3]
b) overall p [mir-80]GFP line VL211 expression, food dilution in liquid media. [score:3]
We compared GFP expression levels of these constructs in ad lib fed animals +/− mir-80, with a focus on the posterior gut region in which mir-80 regulation is most dramatic. [score:3]
Figure S6Relative HSF-1 target gene hsp-16.2 transcripts are elevated in mir-80(Δ), but HSF-1 transcript levels are maintained. [score:3]
When food is limiting, miR-80 levels drop, and translational repression of cbp-1 could be relieved (dark blue circle represents higher concentration CBP-1). [score:3]
mir-80 expression is generally high in the presence of food, but low when food is lacking. [score:3]
A. Constructs used to test candidate miR-80 binding sites present in cbp-1 for roles in translational repression. [score:3]
At day 7, 95% mir-80(Δ) and 92% eat-2 mutants exhibited strong signals in 1–2 ASI neurons; but 36% of WT only express weak signal in at best one ASI. [score:3]
Quantification of GFP fluorescence from mir-80 target site constructs. [score:3]
D. The predicted miR-80 target sites are conserved in the various Caenorhabditis spp. [score:3]
Developmental timing, L1 nuclei numbers, early adult locomotion, pumping rates, defecation rates, amphid neuron dye filling, and dauer entry/exit behaviors are within wild type ranges in mir-80(Δ), supporting that mir-80 does not contribute an essential role in development and basic function. [score:3]
Example of expression in the Ex[P [mir-80::]GFP] line VL211 ([17], wwEx18) grown in the presence of unlimited E. coli. [score:3]
Example of expression of Ex[P [mir-80] [::]GFP] in line VL211 grown in the presence of unlimited E. coli to young adulthood and then switched to no food for 48 hours. [score:3]
We find that for all reporters examined, expression for mir-80 is significantly lower in the absence of food. [score:3]
Thus, an important mechanistic question is whether miR-80 is present in the ASI neurons where it might cell-autonomously affect skn-1 expression. [score:3]
An interesting candidate target, however, is the cbp-1 gene itself, which we have shown to be critical for mir-80(Δ) -induced DR benefits. [score:3]
d) excretory duct cell p [mir-80]GFP line VT1492 expression, food dilution in liquid media. [score:3]
95% of mir-80(Δ) have 1–2 ASIs expressing at this timepoint. [score:3]
We examined multiple mir-80 transcriptional reporters for expression level 48 hours after shift from abundant food to no food (Fig. 3B–D, Fig. S3). [score:3]
Because RNAi knockdown is inefficient the nervous system (see [59]), the profound effects of cbp-1(RNAi) suggest that critical cbp-1/ mir-80 regulation occurs outside of the C. elegans nervous system. [score:3]
The cbp-1 transcript, which includes two potential binding sites for miR-80, one in the 5′ UTR and one in exon 8 (exons thick dark blue lines, promoter lighter blue), and is essential for mir-80(Δ) benefits, is one candidate target (light blue represents relatively low CBP-1 concentration in food). [score:3]
Interestingly, of the three transcription factors required for mir-80(Δ) healthspan, cbp-1 is the only one for which the transcript is predicted to include potential miR-80 miRNA target sequences (Fig. 6D). [score:3]
We labelled {A} VL211 expressing P [mir-80::]GFP with red DiO, and reciprocally, {B} strain ZB3042 containing bzEx207[P [mir-80L::]mCherry] with yellow fluorescent DiI, using a standard protocol that enables the amphid neurons that are open to the environment (ASI, ADL, ASK, AWB, ASH and, ASJ) to dye-fill. [score:3]
Since the genetic elimination of mir-80 results in constitutive DR phenotypes (Fig. 2, Fig. S2), we hypothesized that mir-80 expression might be reduced when food is limited. [score:3]
In the rescued strain, age pigment levels might not reach WT levels due to mosaicism of the extrachromosomal transgene, the mir-80 transgene dose, or “sponge” effects of overexpression. [score:3]
The potential cbp-1 target sites for miR-80 binding are unusual, being situated in the 5′ UTR and within a highly conserved exon. [score:3]
a) overall p [mir-80]GFP line VL211 expression, food dilution on solid NGM media. [score:3]
Transcription factors implicated in DR metabolism are required for mir-80(Δ) -associated fluorimetric featuresTo identify genes required for mir-80(Δ)-regulated DR, we used RNAi to knockdown genes previously implicated in DR lifespan benefits, hypothesizing that genes required for mir-80(Δ) DR should be needed for the Ex [max] shift and low age pigment levels typical of multiple DR states. [score:3]
A mo del for miR-80 regulation of DR metabolism. [score:2]
The additive effects of mir-80(Δ) +daf-2(RNAi) knockdown suggest that healthspan and longevity benefits of mir-80(Δ) may be conferred in part by a daf-2-independent pathway. [score:2]
Although our study focused on DR genes that have most dramatic impact on the age pigment DR signature, we emphasize that our data support that additional genes contribute in a complex network to regulate age pigment phenotypes in mir-80(Δ). [score:2]
The human hCBP coding sequences corresponding to Ce cbp-1 exon 8 have sufficient homology to human miR-80 family members to raise the possibility of analogous interaction and conserved regulatory mechanism. [score:2]
We thus anticipate that our data just touches the surface of a large interrelated network of metabolic genes and processes that are regulated by miR-80. [score:2]
Of the 18 genes we screened, we found that RNAi knockdown of transcription factors daf-16/FOXO, heat shock transcription factor hsf-1, and CREB binding protein homolog cbp-1 modulated both the Ex [max] shift and low age pigment levels of mir-80(Δ) (Tables S1, S2, Figs. 4A,B; 5A,B; 6A,B). [score:2]
Here we report bantam-homolog miR-80 as a food-regulated miRNA that normally represses DR when food is abundant. [score:2]
To address the relationship of mir-80(Δ) and the insulin signaling pathway further, we compared longevity phenotypes of mir-80(Δ) and mir-80(Δ) treated with daf-2 RNAi, which targets the C. elegans insulin receptor (Fig. 4D). [score:2]
We used a dye-filling assay to label the amphid sensory neurons in the P [mir-80] fluorescent reporter lines to test for co -expression (P [mir-80::]GFP with red DiO, and P [mir-80L::]mCherry with yellow DiI). [score:2]
Because mir-80(Δ) does not exhibit notable defects in development ([20], and our observations), it appears that mir-80 has a predominant and focused impact on aging of the adult. [score:2]
D. hsf-1 transcript levels are not regulated by the presence of miR-80 at day 4. We grew age-synchronized WT (black bars) and mir-80(Δ) (red bars) under standard conditions of abundant food (20°C, OP50-1) and harvested animals at Day 4 for RNA isolation. [score:2]
mir-80(Δ) mutants exhibit a significant extension in lifespan as compared to WT (p<0.0001) and transgenic expression of mir-80(+) reversed the longevity increase (p<. [score:2]
DAF-16, HSF-1 and CBP-1 transcription factors are needed for mir-80(Δ) -induced healthspan benefits in a likely complex regulatory circuit. [score:2]
The mir-80 deletion mutant does not exhibit gross developmental phenotypes ([20]; our observations). [score:2]
These data identify DAF-16 as an required regulator of the fluorimetric DR signature and longevity benefits in the mir-80(Δ) background. [score:2]
Our data indicate that miR-80 acts as a negative regulator of metabolic loops that promote DR metabolism when nutrients are scarce. [score:2]
Figure S3Published mir-80::GFP reporters are regulated by food availability. [score:2]
DAF-16, HSF-1 and CBP-1 transcription factors are needed for mir-80(Δ) -induced healthspan benefits in a likely complex regulatory circuitThe requirement for daf-16, hsf-1, and cbp-1 in mir-80(Δ) DR is interesting in multiple regards. [score:2]
We used RNAi to knockdown genes previously implicated in DR in the mir-80(Δ) background (Day 4, 20°C, three independent trials, 50 animals/trial) and quantitated age pigment levels relative to endogenous Trp levels. [score:2]
We examined the literature for genes experimentally implicated in DR and used RNAi to knock these genes down in the mir-80(Δ) background (Day 4, 20°C, three independent trials, 50 animals/trial). [score:2]
Might the conserved miR-80 microRNA family regulate metabolism across species?. [score:2]
Even if miR-80 effects are indirect, it is clear that cbp-1 is critical for mir-80(Δ) -induced age pigment and lifespan changes. [score:2]
Thus, cbp-1 activity plays a role in mir-80(Δ) regulation of age pigments, and appears generally needed for mir-80(Δ) DR metabolism. [score:2]
Table S2RNAi directed against known DR genes in the mir-80(Δ) background identify genes required for the low age pigment level phenotype. [score:2]
A mir-80 deletion exhibits beneficial features of dietary restriction regardless of food availability, including extended maintenance of mobility and cardiac-like muscle function later into life as well as lifespan extension. [score:1]
These data support that mir-80(Δ) mutants are in DR even when reared in the presence of ample food. [score:1]
Note that cbp-1(RNAi) treatment of WT does not change Ex [max] (data not shown), so this effect is specific to the DR signature of mir-80(Δ). [score:1]
1003737.g005 Figure 5 hsf-1 is needed for the fluorimetric DR signature and longevity phenotypes of mir-80(Δ). [score:1]
These data suggest that the CBP-1 cofactor couples and modifies transcriptional outputs of DAF-16- and HSF-1 -dependent longevity pathways under bDR conditions, a mo del likely to apply for mir-80(Δ) -induced DR. [score:1]
Thus, late in adult life (∼2/3 through the WT lifespan), mir-80(Δ) mutants exhibit low age pigment accumulation typical of healthy aging animals. [score:1]
The most conserved mir-80 family members encoded in the C. elegans genome are mir-80, mir-58, mir-81 and mir-82 [12], [18]. [score:1]
Since the Ex [max] shift is diagnostic of the DR state, we reasoned that genetic interventions that reversed the shift would define genes needed for the mir-80(Δ) DR pathway. [score:1]
hsf-1 is required for mir-80(Δ) -induced longevity. [score:1]
daf-16/FOXO is required for low age pigment levels in mir-80(Δ). [score:1]
Black bar, WT+ empty vector RNAi; red bar, mir-80(Δ)+empty vector RNAI; grey bar, mir-80(Δ) +hsf-1(RNAi). [score:1]
However, the fact that mir-80(Δ) does not further extend daf-2(RNAi) lifespan (p<. [score:1]
Table S1An RNAi screen identifies hsf-1 and cbp-1 as required for the DR -associated Ex [max] shift phenotype in the mir-80(Δ) background. [score:1]
We find that disruption of hsf-1 eliminates the lifespan extension conferred by mir-80(Δ) (Fig. 5C). [score:1]
Excretory duct cell in the Is[P [mir-80::]GFP] in line VT1492 ([17], maIs196) grown in the presence of unlimited E. coli. [score:1]
We grew age-synchronized WT (black), mir-80(Δ) (red) or the mir-80(+) (grey) under standard plate conditions (200C, OP50-1). [score:1]
mir-80(Δ) maintains youthful swimming vigor in late adulthood. [score:1]
To address this discrepancy, we constructed a new mCherry reporter that extended mir-80 5′ sequences up to the next annotated gene (1814 5′ bp, designated P [mir-80L]). [score:1]
We grew age-synchronized WT (black), mir-80(Δ) (red), and mir-80(Δ); Ex[P mir-80(+)] (grey) under standard conditions (20°C, on E. coli OP50-1) and scored animals for age pigment levels using a fluorimeter (n = 100 per strain/trial; day 11, as counted from the hatch; mir-80(Δ) is nDf53; mir-80(+) rescue transgene is nEx1457 [18]). [score:1]
mir-80(Δ) exhibits multiple features of healthy aging. [score:1]
We find that mir-80(Δ) mutants exhibit both mean and maximum healthspan extension, subject to mir-80(+) transgene rescue (Fig. 1D, p<0.0001, individual lifespan data in Fig. S1; average age increase at 75% mortality over all lifespan studies in this paper (13) was 24.1%+/−4.7%). [score:1]
The 5+8BS high copy number construct also variably exhibited some “sponge” effects that might be attributed to titrating out endogenous miR-80 and family members (not shown). [score:1]
Normalized transcript levels of hsp-16.2 are elevated in mir-80(Δ), * p<0.07. [score:1]
daf-2(RNAi) increases the lifespan of mir-80(Δ) vector control (p<0.005), but additive effects for mir-80(Δ) +daf-2(RNAi) above the daf-2(RNAi) level are not observed (p = 0.98). [score:1]
DAF-16/FOXO is required for fluorimetric indicators of DR age pigment and lifespan extension in mir-80(Δ). [score:1]
Thus, the physical appearance of mir-80(Δ) mutants resembles that of DR animals. [score:1]
In Day 4 animals normalized hsf-1 transcript levels were similar in WT and mir-80(Δ) (p = 0.90; 2-tailed Student's T-test). [score:1]
We conclude that mir-80(Δ) delays locomotory aging without altering young adult swimming behavior itself. [score:1]
mir-80(Δ) lifespan can be further extended by daf-2(RNAi). [score:1]
hsf-1(RNAi) in the mir-80(Δ) background reverses the DR Ex [max] shift. [score:1]
Importantly, 5 day old WT and mir-80(Δ) (i. e., young adult; Fig. 1B, left graph) have similar pumping rates. [score:1]
Importantly, unlike the eat-2 mutant, pumping rates in mir-80(Δ) are normal in young animals and are actually enhanced relative to WT later in life (Fig. 1B). [score:1]
We did not find an Ex [max] shift in mir-58(Δ) or in the double mir-81(Δ) mir-82(Δ) mutant (data not shown) and thus mir-80 is the sole family member that can be deleted to induce the DR Ex [max] shift. [score:1]
cbp-1(RNAi) in the mir-80(Δ) background partially reverses low age pigment levels. [score:1]
Transcription factor daf-16/FOXO is required for the Ex [max] shift phenotype in mir-80(Δ). [score:1]
Thus, deletion of mir-80 confers longevity. [score:1]
C. elegans miR-80 familyThe most conserved mir-80 family members encoded in the C. elegans genome are mir-80, mir-58, mir-81 and mir-82 [12], [18]. [score:1]
Transcription factors DAF-16, HSF-1, and CBP-1 are required for mir-80(Δ) benefits. [score:1]
We found that although mir-80(Δ) is long-lived relative to WT under normal growth conditions (Fig. 1D), the mir-80(Δ) lifespan is decreased relative to WT in the presence of metformin (three individual trials and combined data in Fig. S2), similar to what occurs for DR mutant eat-2. Thus, like other DR strains, mir-80(Δ) is hypersensitive to metformin, consistent with mir-80(Δ) being in a DR constitutive state. [score:1]
To ask whether mir-80(Δ) might act via a DR mechanism to extend healthspan and lifespan, we tested mir-80(Δ) mutants for phenotypic features of the DR state (Fig. 2). [score:1]
Our data support that mir-80(Δ) induces molecular features of DR. [score:1]
Since low age pigment/Trp ratios (AGE/TRP) are associated with the DR state [19], we reasoned that genetic interventions that elevated age pigment levels would help identify genes needed for the mir-80(Δ) DR pathway and/or for enhanced healthspan. [score:1]
C. elegans miR-80 family. [score:1]
Thus, mir-80(Δ) does not physically reduce the ability to eat, but rather is likely to act further downstream to influence DR metabolism. [score:1]
mir-80(Δ) mutants are physically smaller than WT, typical of animals in DR. [score:1]
Deletion of daf-16 reverses the Ex [max] shift phenotype of mir-80(Δ). [score:1]
We speculate that miR-80 level changes in intestinal cells might initiate body-wide signaling via gut secretion of insulins and other hormones, analogous to human gastrointestinal tract and adipose tissue hormonal signaling to hypothalamus [39]. [score:1]
Given that mir-80(Δ) mutants exhibit several features of extended healthspan, we examined the longevity phenotype. [score:1]
Interestingly, however, the quadruple mutant mir-80; mir-58; mir-81-82 has a very small body size, more severe than the scrawny body type we documented for mir-80(Δ) (Fig. 2C), which can be rescued by a mir-80 high copy number transgene [18] suggesting some functional redundancy among mir-80 family members. [score:1]
Figure S5 mir-80 is regulated by food availability under multiple food restriction conditions and as assayed with multiple reporters. [score:1]
We noted a trend toward lower hsf-1 transcript levels at day 7 (not shown) that we think reflects modulation of the dynamic transcriptional network altered by miR-80. [score:1]
The requirement for daf-16, hsf-1, and cbp-1 in mir-80(Δ) DR is interesting in multiple regards. [score:1]
We conclude that hsf-1 is required for both mir-80(Δ) -induced fluorimetric features that typify DR and for mir-80(Δ) -induced longevity. [score:1]
We conclude that mir-80(Δ) exerts a positive effect on the quality of cardiac-like muscle aging. [score:1]
mir-80(Δ) mutants are ∼10% shorter and look thinner than WT reared under the same conditions, typical of the scrawny appearance of animals in DR, example comparison on the right. [score:1]
The mir-80(nDf53) allele breakpoints are 5′- tgctttcgatgtctatactctc -3′ and 5′-tctggcgaacgaaatgagt-3′, encompassing part of the promoter region, the entire precursor sequence and ∼300 bp downstream. [score:1]
Animal segments imaged and fluorescence measured as in Fig. 3. The 5+8bs construct is expressed at a higher level when mir-80 is lacking, whereas the NBS construct is not. [score:1]
Example of Is[P [mir-80] [::]GFP] line VT1492 excretory duct cell (white arrow) grown in the presence of unlimited E. coli to young adulthood and then switched to no food for 48 hours. [score:1]
mir-80(Δ) maintains youthful pharyngeal pumping in late adulthood. [score:1]
The mir-80(Δ) mutant exhibits low age pigment levels early in life, as occurs in C. elegans DR. [score:1]
Thus, mir-80(Δ) exhibits the spectral signature of DR despite the presence of food, consistent with mir-80(Δ) being a DR constitutive mutant. [score:1]
mir-80(Δ) mutants appear dietary-restriction constitutive. [score:1]
B. hsf-1 transcript levels (day 4) are not changed by the absence of miR-80. [score:1]
In Day 4 animals normalized hsf-1 transcript levels were similar in WT and mir-80(Δ) (p = 0.14 act-1). [score:1]
Deletion of microRNA-80 promotes system-wide healthy aging in C. elegans Our previous studies revealed that age pigment levels (lipofuscin+advanced glycation end products) inversely correlate with locomotory healthspan—low age pigment levels late in life are typical of animals that age gracefully and maintain strong locomotory vigor, whereas high age pigment levels are typical of same-chronological age animals that age poorly and appear decrepit [19]. [score:1]
Endogenous CBP-1 protein levels are increased in 7 day old mir-80(Δ) mutants. [score:1]
B. Shown are GFP intensities for extrachromosomal p [cbp-1]GFP constructs without candidate miR-80 binding sites (NBS, left panel) or with the 5′ and exon 8 candidate miR-80 binding sites added (5+8BS); in WT (black line) or mir-80(Δ) (red line) backgrounds, day 7, n>30, posterior gut. [score:1]
Thus, mir-80(Δ) mutants are not simply hyper-activated for pumping, but rather maintain pumping function better late into life. [score:1]
Age pigment fluorescence, which increases with age, is normalized to endogenous tryptophan fluorescence, which remains relatively constant with age [19], (AGE/TRP ratio ∼58% decreased in mir-80(Δ) vs. [score:1]
We grew age-synchronized WT and mir-80(Δ) under standard conditions of abundant food (20°C, OP50-1) and harvested animals at Day 4 for total RNA isolation. [score:1]
We placed age-synchronized mir-80(Δ) L1 larvae (Day 1) on empty vector control (pL4440) or daf-2 RNAi plates under standard conditions (20°C). [score:1]
Normalized transcript levels of hsp-16.2 are elevated in mir-80(Δ), * p<0.1 (2-tailed Student's T-test). [score:1]
C. Absence of fluorescent bleed-through in through the GFP/DAPI filter sets in the P [mir-80L]::mCherry lines P [mec-4]::GFP (top row) and P [mir-80]::mCherry (bottom row) lines were age-synchronized via alkaline bleaching and plated on standard NGM containing OP50-1 as food. [score:1]
mir-80(Δ) mutants have increased mean and maximum lifespans. [score:1]
1003737.g001 Figure 1 mir-80(Δ) exhibits multiple features of healthy aging. [score:1]
The CREB -binding protein CBP-1 is required for mir-80(Δ) -dependent changes in DR fluorimetric indicators and for mir-80(Δ) -dependent longevity. [score:1]
Since we cannot rule out that daf-16, hsf-1, and cbp-1 disruptions make animals too generally sick to gain mir-80(Δ) benefits, alternative mo dels are possible. [score:1]
hsf-1(RNAi) in the mir-80(Δ) background partially counters the low age pigment level phenotype of mir-80(Δ). [score:1]
mir-80(Δ) longevity is dependent on cbp-1. We placed age-synchronized L1 larvae on empty vector control (pL4440) plates under standard conditions (20°C) until Day 4 (day 1 of adult life) at which time animals were moved to either empty vector control (L4440) or cbp-1(RNAi) plates. [score:1]
Consistent with a contribution to DR benefits, we find that the lifespan extension conferred by mir-80(Δ) depends strongly on cbp-1 (p<0.003; Fig. 6C). [score:1]
Early in adult life WT and mir-80(Δ) swim similarly (Fig. 1C, left panel). [score:1]
In summary, mir-80(Δ) confers multiple features of extended adult healthspan late in life: lowered intestinal age pigment accumulation, maintained pharyngeal pumping capacity, increased swimming vigor, and lifespan extension. [score:1]
Transcription factors implicated in DR metabolism are required for mir-80(Δ) -associated fluorimetric features. [score:1]
The mir-80(Δ) mutant exhibits the DR Ex [max] shift. [score:1]
For both approaches, we never observed co-label of the mir-80 reporter with any amphid neurons (n = 30 per reporter); white arrows indicate ASI in representative images. [score:1]
The cbp-1 transcript includes two predicted binding sites for miR-80. [score:1]
Black bar, WT+ empty vector RNAi; red bar, mir-80(Δ)+empty vector RNAi; grey bar, mir-80(Δ) +hsf-1(RNAi). [score:1]
Figure S1Individual lifespan data for lifespan analysis of mir-80(Δ). [score:1]
In addition, there is a decrease in the number of live progeny laid per day by mir-80(Δ) (p<0.05 for Day 3 and p<0.001 for days 4–6), without a significant difference in the total number of surviving progeny (not shown), a pattern of progeny production similar to that of feeding-defective DR mutant eat-2 (Fig. 2D). [score:1]
The rna22 algorithm [62] predicts that miR-80 binds cbp-1 within the 5′ UTR and within exon 8. The potential alignments of miR-80 (red) to C. elegans cbp-1 (blue) sequences are indicated. [score:1]
Deletion of a single C. elegans miRNA, mir-80, induces systemic healthy aging—improving cardiac muscle-like and skeletal-muscle-like maintenance and function later into life, limiting age -associated accumulation of lipofuscin-like material in the gut, and extending lifespan. [score:1]
We noted a trend toward lower hsf-1 transcript levels at day 7 (not shown), which we think reflects modulation of the dynamic transcriptional network altered by miR-80. [score:1]
We find that mir-80(Δ) lifespan can be further extended by daf-2(RNAi) (p<0.005). [score:1]
Note that data from these experiments also provide a general sense of how mir-80(Δ) compares to daf-2 for lifespan extension; roughly we find mir-80(Δ) effects are slightly less than half those of daf-2(rf), see Table S4 for exact data from individual trials. [score:1]
Deletion of microRNA-80 promotes system-wide healthy aging in C. elegans. [score:1]
Figure S2The mir-80(Δ) mutant exhibits hypersensitivity to the DR -mimetic drug metformin, similar to DR mutant eat-2. We grew age-synchronized WT (black), mir-80(Δ) (red) or the eat-2 mutant (blue) under standard plate conditions supplemented with 50 mM metformin (20°C, OP50-1). [score:1]
E. Alignments of miR-80 family members from (bantam) and human with C. elegans miR-80. [score:1]
Moreover, the mir-80(Δ); daf-16(Δ) double mutant had a short lifespan, similar to that of daf-16(Δ) (Fig. 4C). [score:1]
Note that there are 4 close members of the miR-80 family encoded in the C. elegans genome (mir-58, mir-81, mir-82; see [12], 2008, for alignments and discussion). [score:1]
We conclude that mir-80(Δ) exhibits reduced fecundity, similar to animals experiencing DR. [score:1]
Error bars indicate ± S. E. M. The mir-80(Δ); hsf-1(sy441) double mutant is shorter lived than mir-80(Δ) (p<0.0001). [score:1]
hsf-1 deficiency eliminates multiple mir-80(Δ) healthspan phenotypes. [score:1]
Quantitation of fluorescence signals for a mir-80 promoter fusion reporter line in food vs. [score:1]
Quantitation of fluorescence signals for mir-80 promoter fusion reporter lines in food vs. [score:1]
The low age pigment phenotype of mir-80(Δ) is rescued by a transgene array harboring a mir-80(+) gene, confirming that the low age pigment phenotype is conferred by mir-80 deletion itself. [score:1]
To determine if hsf-1 is also required for mir-80(Δ) longevity, we examined survival curves for the mir-80(Δ);hsf-1(sy441) double mutant. [score:1]
mir-80(Δ) mutants appear dietary-restriction constitutiveTo ask whether mir-80(Δ) might act via a DR mechanism to extend healthspan and lifespan, we tested mir-80(Δ) mutants for phenotypic features of the DR state (Fig. 2). [score:1]
The mir-80 target sites were incorporated within primers that amplified the GFP coding sequence using the primer sites (outlined below) and introduced at the Xma1 site of the above cloned P [cbp-1] vector: NBS: 5′- tccccccgggatgagtaaaggagaagaacttttcactgg-3′+ 5′-cggggtaccctatagttcatccatgccatgtgtaatccc-3′; 5+8 BS: 5′- tccccccgggaacagctatatctggtgatttgatgagtaaagaagaag-3′+ 5′-cggggtacctaagatcctcttgactgaacacttcatagttcatccatgcc-3′ We grew age-synchronized animals (see above) under standard conditions (20°C, OP50-1) and scanned animals (n≥50 per strain) for age pigment accumulation (Day 4, Day 9, Day 11) using a Fluorolog 3 spectroflorimeter as in Gerstbrien et al. [19]. [score:1]
Thus, in whole animal context, mir-80(Δ) is associated with increased CBP-1 protein. [score:1]
mir-80(Δ) mutants exhibit reduced fertility and an extended reproductive lifespan. [score:1]
Regardless of the details of pathway overlap, our data are definitive in establishing that daf-16/FOXO is needed for fluorimetric properties and longevity outcomes of mir-80(Δ). [score:1]
Conversely, mCherry signal from a transcriptional reporter of mir-80 is clearly visible in the TexasRed channel (white arrows) but is absent in the FITC channel. [score:1]
The low age pigment accumulation phenotype of mir-80(Δ) is reversed in the mir-80(Δ); daf-16(Δ) double mutant on day 4 (shown here) as well as on day 9 (data not shown). [score:1]
We find that cbp-1(RNAi) in the mir-80(Δ) mutant reverses the DR -associated Ex [max] shift (p<0.05 +/− RNAi; Fig. 6A), and increases age pigment levels in day 4 animals (p<0.09, +/− RNAi, Fig. 6B) (cbp-1(RNAi) does not affect Ex [max] but modestly reduces age pigment levels in WT (data not shown)). [score:1]
hsf-1 is needed for the fluorimetric DR signature and longevity phenotypes of mir-80(Δ). [score:1]
daf-16/FOXO is needed for the fluorimetric DR signature and longevity phenotypes of mir-80(Δ). [score:1]
We found that mir-80(Δ) had a somewhat scrawny and pale appearance and on average is ∼10% shorter in length than WT (p<0.0005, Fig. 2C). [score:1]
Although mir-80(Δ) and WT swim similarly in young adult life, mir-80(Δ) mutants better maintain swimming prowess late in life, ∼69% increased body bend rate. [score:1]
Thus, mir-80 deletion primarily impacts adult maintenance and DR phenotypes. [score:1]
1003737.g004 Figure 4 daf-16/FOXO is needed for the fluorimetric DR signature and longevity phenotypes of mir-80(Δ). [score:1]
We grew age-synchronized WT (black bars) and mir-80(Δ) (red bars) under standard conditions of abundant food (20°C, OP50-1) and harvested animals at Day 4 for total RNA isolation. [score:1]
We did not, however, observe dramatic overall changes in nuclear localization of DAF-16::GFP +/− mir-80 (data not shown). [score:1]
DAF-16/FOXO is required for fluorimetric indicators of DR age pigment and lifespan extension in mir-80(Δ)Transcription factor daf-16/FOXO, an important modulator of longevity through insulin signaling, is also critical for lifespan extension benefits of serial dilution of bacteria on plates (sDR) and peptone dilution on plates (pDR) [4]. [score:1]
daf-16 is required for the lifespan extension of mir-80(Δ). [score:1]
cbp-1(RNAi) in the mir-80(Δ) background reverses the DR Ex [max] shift. [score:1]
To date, there are 3 identified human miRNAs closely related to miR-80: hsa-mir-450b-3p; hsa-mir-556-5p, and hsa-mir-3689a-5p (Fig. S7E), none of which have been well studied for function in mammalian biology. [score:1]
[1 to 20 of 249 sentences]
2
[+] score: 47
Green fluorescent protein was engineered onto the C-terminal end of PMK-2. The red fluorescent protein mCherry was engineered onto the C-terminal end of PMK-1. (B-D) Confocal fluorescence microscopy of a representative wild type worm carrying the pmk operon translational reporter (B), a wild type worm carrying a mutated pmk operon translational reporter with specific mutations (indicated in Fig. 4A) engineered into the second and third miR-58 family seed match sites in the 3’UTR of pmk-2 (C), and a mir-80; mir-58; mir-81-82 mutant worm carrying the pmk operon translational reporter (D). [score:8]
We speculate that the defects in size, locomotion, and egg-laying behavior observed in the mir-58; mir-80; mir-81-82 mutant are due to the cumulative misexpression of miR-58/80-82 target genes in non-neuronal tissues, as pmk-2 loss-of-function alone cannot suppress these defects (D. J. P. and D. H. K., unpublished observations). [score:7]
mir-80 was shown to be expressed in the posterior intestine, head and body wall muscle, uterus, vulva, distal tip cells, excretory cells, dorsal nerve cord, and amphid neurons; mir-81 was shown to be expressed weakly in head neurons; and mir-82 was observed to be expressed in pharyngeal muscle, spermatheca, and a subset of both the ventral nerve cord and the amphid neurons [21]. [score:7]
While the pmk-2 gene is broadly transcribed, its tissue-specific expression is established by the redundant activities of miR-58, miR-80, miR-81, and miR-82, which switch off expression of PMK-2 through destabilization of pmk-2 mRNA in non-neuronal tissues. [score:5]
Mutants carrying deletions in mir-58, mir-80, and mir-81-82 [5] were used to assess whether the miR-58/80-82 family functions to repress the expression of pmk-2. Loss of any individual mir-58/80-82 family member had no effect on pmk-2 mRNA levels relative to wild type (Fig. 4B). [score:3]
Similar misexpression of pmk-2 was observed when we crossed qdEx101 (pmk operon reporter with miR-58/80-82 seed match sites intact) into the mir-80; mir-58; mir-81-82 mutant (Fig. 2D). [score:3]
To confirm that a frameshift in the first exon of pmk-2 results in a null allele, the qd284 mutation was crossed into the mir-80; mir-58; mir-81-82 mutant and levels of activated PMK-2 protein were determined. [score:2]
The following mutations were used in this study: LGI: kyIs140[str-2:: GFP, lin-15(+)] LGIII: agIs219[P [T24B8.5]:: GFP, P [ttx-3]:: GFP], tir-1(qd4), mir-80(nDf53) LGIV: mir-58(n4640), pmk-2(qd284), pmk-2(qd307), pmk-2(qd287), pmk-2(qd279), pmk-2(qd280), pmk-2(qd305), pmk-2(qd171), pmk-1(km25) LGX: mir-81-82(nDf54), sek-1(km4), nIs145[P [tph-1]:: GFP, lin-15(+)] Extrachromosomal arrays: qdEx101[P [operon]:: islo-1:: pmk-3:: pmk-2:: GFP:: pmk-1:: mCherry], qdEx102[P [operon]:: islo-1:: pmk-3:: pmk-2 [mut]:: GFP:: pmk-1:: mCherry] A list of all strains used in this study is provided in the (S1 Table). [score:2]
The following mutations were used in this study:LGI: kyIs140[str-2:: GFP, lin-15(+)] LGIII: agIs219[P [T24B8.5]:: GFP, P [ttx-3]:: GFP], tir-1(qd4), mir-80(nDf53) LGIV: mir-58(n4640), pmk-2(qd284), pmk-2(qd307), pmk-2(qd287), pmk-2(qd279), pmk-2(qd280), pmk-2(qd305), pmk-2(qd171), pmk-1(km25) LGX: mir-81-82(nDf54), sek-1(km4), nIs145[P [tph-1]:: GFP, lin-15(+)] Extrachromosomal arrays: qdEx101[P [operon]:: islo-1:: pmk-3:: pmk-2:: GFP:: pmk-1:: mCherry], qdEx102[P [operon]:: islo-1:: pmk-3:: pmk-2 [mut]:: GFP:: pmk-1:: mCherry] A list of all strains used in this study is provided in the (S1 Table). [score:2]
Activated PMK-2 protein was not detected in the mir-80; mir-58 pmk-2(qd284); mir-81-82 mutant, indicating that these mutations are null (S2 Fig. ). [score:2]
Corroborating the mRNA analysis, we observed at least similar increases in activated PMK-2 protein levels in both mir-80; mir-58 and mir-80; mir-58; mir-81-82 mutants, but not in other mutants (Fig. 4C). [score:1]
Immunoblot analysis of lysates from L4 larval stage wild type worms, mir-80; mir-58; mir-81-82 mutant animals, and mir-80; mir-58 pmk-2(qd284); mir-81-82 mutant animals using antibodies that recognize activated p38 MAPK and β-tubulin. [score:1]
In addition, our data corroborate prior phenotypic analysis suggestive of redundancy among members of the miR-58 family [5, 6], demonstrating redundant roles for miR-58, miR-80, miR-81, and miR-82 in the destabilization of pmk-2 mRNA and corresponding repression of activated PMK-2 protein levels. [score:1]
Whereas deletion of miR-58 does not cause any apparent defects, a strain carrying deletions in the miR-58 family, comprised of miR-58 and the homologous microRNAs miR-80, miR-81, and miR-82, exhibits multiple mutant phenotypes, including defects in size, locomotion, and reproductive egg-laying [6]. [score:1]
However, loss of both mir-58 and mir-80 resulted in a 3-fold increase in pmk-2 mRNA levels relative to wild type, and loss of mir-58/80-82 led to an even further increase in pmk-2 mRNA to a level 6.3-fold greater than wild type (Fig. 4B), without altering levels of pmk-3 mRNA. [score:1]
The miR-58/80-82 family consists of miR-58, miR-80, miR-81, miR-82, and miR-1834. [score:1]
[1 to 20 of 16 sentences]
3
[+] score: 24
That is consistent with our results because the activities of DAF-16 and IIS antagonize each other (63), and therefore one could expect that mir-80(-) presented a somewhat downregulated IIS, which is what we observe in mir-58f(-) (Figure 8). [score:4]
A lower, but still broad expression has been described for miR-80 and less so for miR-82 (20). [score:3]
Additionally, TGF-β Sma/Mab positively regulates the transcription of mir-58 and mir-80, thus creating a negative feedback loop. [score:2]
In relation to the overall effect on growth of each miR-58 family member, we have shown that their contribution to body length is highest for miR-58, intermediate for miR-80 and lowest for miR-81 & -82 (Table 1). [score:1]
Vora M. Shah M. Ostafi S. Onken B. Xue J. Ni J. Z. Gu S. Driscoll M. Deletion of microRNA-80 Activates Dietary Restriction to Extend C. elegans Healthspan and Lifespan PLoS Genet. [score:1]
We have shown that not only mir-58f negatively controls TGF-β Sma/Mab, but also that this pathway stimulates the transcription of mir-58 and mir-80. [score:1]
Cells were transfected in triplicate 24/48 h later with Lipofectamine 2000 (Invitrogen), 150 ng of a 3′UTR luciferase vector (see below), and 50 nmol of test miRNA mimic (miR-58, miR-80, miR-81 and miR-1834; miRIDIAN, Dharmacon) or the standard control miRNA mimic miR-67 provided by the manufacturer. [score:1]
Recently Vora et al. observed that mir-80(-) worms are healthier and live longer than N2, and that this phenotype is daf-16 dependent (27). [score:1]
This family is made of five members, mir-58 (chromosome IV), mir-80 (III), mir-81 and mir-82 (approximately 4 kb apart from each other in chromosome X), and mir-1834, although this last one has not been fully validated as a functional miRNA (chromosome IV; >3 Mb apart from mir-58) (18). [score:1]
Human HeLa cells were transiently transfected with psiCHECK-2 vector containing either wild-type (white) or mutated (grey) 3′UTRs from TGF-β genes dbl-1, sma-6, daf-4, daf-1 and daf-7, along with miR-58 family mimics of miR-58, miR-80, miR-81 and miR-1834, or the unrelated miR-67 as negative control. [score:1]
We observed that neither mir-80(nDf53), nor mir-81&mir-82(nDf54), or a combination of both, showed any significant reduction in length with respect to N2 (Table 1). [score:1]
[b]Referred to the length of mir-58(n4640);mir-80(nDf53);mir-81&mir-82(nDf54) treated with RNAi empty vector. [score:1]
The control over mir-58 and mir-80 could be transcriptional or posttranscriptional. [score:1]
Figure 9A shows the levels of miR-58, miR-80 and miR-82 in dbl-1(++) and dbl-1(nk3) relative to N2, in synchronized L4 worms. [score:1]
However, mir-58(n4640) showed such a reduction (P < 0.001), which was even more pronounced in the company of mir-80(nDf53) (P < 0.001) but not of mir-81&mir-82(nDf54) (P = 0.2). [score:1]
Wild-type C. elegans N2 strain (Bristol) and the following mutant strains were obtained from Caenorhabditis Genetics Centre (CGC): BW1940 ctIs40 X [ZC421 (dbl-1(+)) + pTG96(sur-5::gfp)], CB1370 daf-2(e1370) III, DR63 daf-4(m63) III, DR609 daf-1(m213) IV, LT186 sma-6(wk7) II, MT13949 mir-80(nDf53) III, MT13954 mir-81&mir-82(nDf54) X, MT15024 mir-58(n4640) IV, MT15563 mir-80(nDf53) III; mir-58(n4640) IV; mir-81&mir-82(nDf54) X, NU3 dbl-1(nk3) V, RB1739 sma-10(ok2224) IV, and RB2589 daf-3(ok3610) X. DR2490 mIs27 [P [daf-8]::daf-8::gfp, rol-6(su1006)], EUB0032 P [mir-58]::gfp and pwIs922 [P [vha-6]::daf-4::gfp] were kindly provided by Drs D. Riddle, M. Isik and R. Padgett, respectively. [score:1]
We detected a significant difference between N2 and dbl-1(nk3) at miR-58 (P = 0.001) and miR-80 (P = 0.007), but not at miR-82 (P = 0.078). [score:1]
We conclude that miR-58 is the miRNA that contributes the most on body size, followed by miR-80 and the tandem miR-81/-82 (in that order). [score:1]
[1 to 20 of 18 sentences]
4
[+] score: 14
These experiments show that egg-laying in C. elegans is acutely sensitive to small changes in environmental temperature and that mir-71, mir-80 and mir-239 may regulate this response. [score:2]
Our sequencing data indicate that mir-80 and mir-239 are regulated at elevated temperatures. [score:2]
Other miRNAs shown to regulate lifespan at 20°C, such as mir-80 and mir-239, exhibited no altered lifespan phenotype at 25°C. [score:2]
At 28°C, all strains exhibited a decrease in the number of eggs laid with mir-80 animals laying significantly fewer eggs than wild type (Figure 4B). [score:1]
We did however observe an additional drop in egg-laying in mir-71 mutant animals and a complete abrogation of egg-laying in mir-80 and mir-239 mutant animals at 30°C. [score:1]
We have identified additional functions for already known players of the heat stress response (mir-71 and mir-239) as well as identifying two miRNAs (mir-80 and the mir-229 mir-64-66 cluster) that impact on the heat stress response in C. elegans. [score:1]
We found that loss of mir-71, mir-80 and the mir-229 mir-64-66 cluster causes heat sensitivity and loss of mir-239 causes heat resistance (Figure 1B). [score:1]
Heat stress phenotypes for mir-80 and mir-229 mir-64-66 mutant animals were rescued by transgenic array harboring a wild type copy of the respective miRNA locus, however, we were unable to rescue the mir-239a/b heat resistance phenotype (Figure S2 and data not shown). [score:1]
In these conditions, mir-71, mir-80 and mir-239 mutant animals still laid significantly fewer eggs than wild type. [score:1]
We found that mir-71, mir-80 and mir-239 are required for generation of embryos in elevated temperatures. [score:1]
Previous work has shown that loss of mir-80 or mir-239 extends lifespan at 20°C 26 27, however this positive effect on lifespan was not observed in our experiments at the more stressful 25°C temperature (Figure 2 and Table S2). [score:1]
[1 to 20 of 11 sentences]
5
[+] score: 10
Other miRNAs from this paper: cel-mir-60, cel-mir-63, cel-mir-66, cel-mir-87, cel-mir-233, cel-mir-234
miR-80-3p was down-regulated in L2-L4, and the expression of its target, B0361.9, increased more than two-fold after the mutation of prg-1. K12H4.4 and B0361.9 are both implicated in the development of C. elegans. [score:10]
[1 to 20 of 1 sentences]
6
[+] score: 7
In this case, the expression patterns of mir-80 family members are expected to be similar and, indeed, both mir-80 and mir-82 have overlapping expression in excretory cells, head neurons and head muscles (Table 1 and [36]). [score:5]
Since intergenic mir-80 and intronic antisense mir-81 should have their own promoters, and we and Martinez et al. [36] show that intronic sense-oriented mir-82 also has an intronic promoter, the most parsimonious explanation of the evolution of the mir-80 family is by the duplication of the locus, which included the promoter region of the ancestral miRNA. [score:1]
Interestingly, in the mir-80 family of miRNAs there is one intergenic (mir-80), one antisense intronic (mir-81) and one sense intronic (mir-82) miRNA; the sense and antisense intronic miRNAs reside in the same host gene but in the different introns. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 5
In C. elegans, miR-58-3p is a member of a highly expressed family that also includes miR-80, miR-81, miR-82 and miR-1834 [60]. [score:3]
Comparing the abundances of miR-58-3p to that of miR-81-3p and miR-80-3p, it is clear that the first dominates, contributing more than 90% of the reads assigned to the whole family, as reported by Kato et al. [57]. [score:1]
It is interesting to note that other members of the mir-58 family are also amongst the top 10 most abundant in our analysis, with miR-80-3p and miR-81-3p each contributing about 1% of the miRNA-mapping reads. [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 3
In another case, also in worms, the target sites for two coconserved and distinct miRNAs (or miRNA sets) miR-2/miR-43 (CUGUGAU) and miR-80/miR-81/miR-82 (UGAUCUC), were found to overlap more often than expected by chance (p < 10 [−5]) (note that we limited the extent of the overlap to 4 nt in our coconservation analysis). [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 2
In some instances loss of specific miRNAs (lin-4, miR-71, miR-238, miR-246 or miR-228) has resulted in shortened lifespan, whereas in others (miR-80 or miR-239a/b) lifespan extension has been observed [18– 23]. [score:1]
In C. elegans, the lin-4 miRNA functions within the Insulin/ IGF-1 signaling (IIS) pathway [18], miR-80 responds to dietary restriction [23], and let-7 family miRNAs promote the longevity of animals lacking germ cells [25]. [score:1]
[1 to 20 of 2 sentences]