Read MR0001293131

Accession MR0001293131
Sequence
ugcaggcagaaguggggcugacagg
Organism Homo sapiens
Stem-loop ID hsa-mir-6511a-1
Mature ID hsa-miR-6511a-5p hsa-miR-6511a-5p hsa-miR-6511a-5p hsa-miR-6511a-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000108 3 melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 3 melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]

References

1
PMID : 20300190
  • "Characterization of the Melanoma miRNAome by Deep Sequencing"
  • Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).