Read MR0001278309

Accession MR0001278309
Sequence 
ggguaugugccuuuggacuacauc
Organism Homo sapiens
Stem-loop ID hsa-mir-455
Mature ID hsa-miR-455-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000150 1 squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000160 1 squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000164 1 squamous cell GEO : GSM532900 [ Witten D et al.]

References

1
PMID : 20459774
  • "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls"
    • Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).