Read MR0001154581

Accession MR0001154581
Sequence 
cgacccacugagaagauccg
Organism Bombyx mori
Stem-loop ID bmo-mir-2748

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000268 1 whole body GEO : GSM449725 5th-instar day-3 larvae [ Liu S et al.]
ER0000000269 5 anterior silk glands GEO : GSM449726 5th-instar day-3 larvae [ Liu S et al.]
ER0000000270 3 posterior silk glands GEO : GSM449727 5th-instar day-3 larvae [ Liu S et al.]

References

1
PMID : 20199675
  • "MicroRNAs of Bombyx mori identified by Solexa sequencing"
    • Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).