Read MR0001150020

Accession MR0001150020
Sequence
auuguacuucaucaggugcucugg
Organism Bombyx mori
Stem-loop ID bmo-mir-305
Mature ID bmo-miR-305-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000268 13 whole body GEO : GSM449725 5th-instar day-3 larvae [ Liu S et al.]
ER0000000269 167 anterior silk glands GEO : GSM449726 5th-instar day-3 larvae [ Liu S et al.]
ER0000000270 11 posterior silk glands GEO : GSM449727 5th-instar day-3 larvae [ Liu S et al.]

References

1
PMID : 20199675
  • "MicroRNAs of Bombyx mori identified by Solexa sequencing"
  • Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).