Read MR0001148848

Accession MR0001148848
Sequence 
ucucccaacccuuguaccagug
Organism Homo sapiens
Stem-loop ID hsa-mir-150
Mature ID hsa-miR-150-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000264 24 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000266 3 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 3 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]

References

1
PMID : 19144710
  • "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
    • Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).