Read MR0001142737

Accession MR0001142737
Sequence 
cuugugugugcaugugcaugugu
Organism Mus musculus
Stem-loop ID mmu-mir-466m
Mature ID mmu-miR-466m-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000246 2 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5