Read MR0001137374

Accession MR0001137374
Sequence 
gggggcagggccuuugugaagg
Organism Mus musculus
Stem-loop ID mmu-mir-326
Mature ID mmu-miR-326-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000231 4 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000242 3 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 2 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000260 1 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male