Read MR0001137280

Accession MR0001137280
Sequence 
ggagcugagauucugcgggauggau
Organism Mus musculus
Stem-loop ID mmu-mir-3057
Mature ID mmu-miR-3057-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000230 1 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000247 1 GEO : GSM539866 strain: C57BL/6-129
ER0000000250 3 brain GEO : GSM539869 strain: C57BL/6J, gender: male