Read MR0001135380

Accession MR0001135380
Sequence 
gguaguagguuguaugguuua
Organism Mus musculus
Stem-loop ID mmu-let-7c-1
Mature ID mmu-let-7c-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000238 1 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000241 1 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000252 1 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 1 kidney GEO : GSM539872 strain: C57BL/6J, gender: male