Read MR0001135306

Accession MR0001135306
Sequence 
aucuuacugggcagcauuggaua
Organism Mus musculus
Stem-loop ID mmu-mir-200b
Mature ID mmu-miR-200b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000251 1 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 7 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 4 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000257 7 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000259 1 ovary GEO : GSM539878 strain: C57BL/6J, gender: female