Read MR0001133932

Accession MR0001133932
Sequence 
uggccaaggaugagaacucuaaccu
Organism Mus musculus
Stem-loop ID mmu-mir-3096a mmu-mir-3096b
Mature ID mmu-miR-3096a-5p mmu-miR-3096b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000222 1 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male