Read MR0001132962

Accession MR0001132962
Sequence 
ggucuggcuguuguggugugcaa
Organism Mus musculus
Stem-loop ID mmu-mir-3064
Mature ID mmu-miR-3064-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000222 1 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000244 2 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting