Read MR0001130743

Accession MR0001130743
Sequence 
agcagcauuguacagggcuaugaaggc
Organism Mus musculus
Stem-loop ID mmu-mir-103-1
Mature ID mmu-miR-103-3p mmu-miR-103-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000219 1 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 2 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 1 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000234 3 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 2 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000242 1 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 2 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000247 3 GEO : GSM539866 strain: C57BL/6-129
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000253 2 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000259 1 ovary GEO : GSM539878 strain: C57BL/6J, gender: female