Read MR0001130544

Accession MR0001130544
Sequence 
aaaagcuggguugagagggcgaaaaag
Organism Mus musculus
Stem-loop ID mmu-mir-320
Mature ID mmu-miR-32-3p mmu-miR-320-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 1 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 1 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 2 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 4 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 5 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000231 1 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 1 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000238 2 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 2 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000242 2 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000244 2 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 2 GEO : GSM539866 strain: C57BL/6-129
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000257 2 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000260 1 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male