Read MR0001130172

Accession MR0001130172
Sequence 
ggccaaggaugagaacucuaaccugacug
Organism Mus musculus
Stem-loop ID mmu-mir-3096a mmu-mir-3096b
Mature ID mmu-miR-3096a-5p mmu-miR-3096b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000218 5 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 2 spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 26 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 12 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 1 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 1 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 1 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000241 2 lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male