Read MR0001130107

Accession MR0001130107
Sequence 
accaucugaaaucgguuaua
Organism Mus musculus
Stem-loop ID mmu-mir-29a
Mature ID mmu-miR-29a-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 1 spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 1 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000227 2 lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000233 1 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000235 1 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5