Read MR0001130012

Accession MR0001130012
Sequence 
uuggagcugagauucugcgggauggau
Organism Mus musculus
Stem-loop ID mmu-mir-3057
Mature ID mmu-miR-3057-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000218 1 spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000243 1 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000256 1 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male