Read MR0001129643

Accession MR0001129643
Sequence 
gcuggguugagagggcgaaaaa
Organism Mus musculus
Stem-loop ID mmu-mir-320
Mature ID mmu-miR-32-3p mmu-miR-320-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000217 1 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting