Read MR0001129268

Accession MR0001129268
Sequence 
cugagaacugaauuccauaggcug
Organism Mus musculus
Stem-loop ID mmu-mir-146b
Mature ID mmu-miR-146b-5p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000222 5 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 2 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 3 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 1 lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 79 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 114 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 423 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 8 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 1 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 86 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 57 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 10 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 2 thymus GEO : GSM539856
ER0000000239 6 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000243 3 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 1 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 5 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 2 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000251 4 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 3 skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000260 1 spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 3 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male