Read MR0001128747

Accession MR0001128747
Sequence 
uacauacacacauacacacgca
Organism Mus musculus
Stem-loop ID mmu-mir-466m
Mature ID mmu-miR-466m-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000216 1 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000222 4 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 6 spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 3 spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000229 1 bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 1 bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 2 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000235 2 bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000237 3 thymus GEO : GSM539856
ER0000000238 1 spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 3 spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 1 spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000242 2 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 5 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 18 spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 5 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 23 GEO : GSM539866 strain: C57BL/6-129