Read MR0001128526

Accession MR0001128526
Sequence 
agcauuguacagggcuaugaag
Organism Mus musculus
Stem-loop ID mmu-mir-103-1
Mature ID mmu-miR-103-3p mmu-miR-103-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000216 4 bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 3 bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 2 spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000222 1 spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1 peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 1 spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000230 4 bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000232 2 peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 2 peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 1 bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000236 1 spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 1 thymus GEO : GSM539856
ER0000000242 2 lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 10 lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000245 1 lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 1 lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 4 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 1 brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 2 lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 1 liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 3 kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 1 pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 1 skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000257 1 salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000261 4 lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male