Read MR0000967157

Accession MR0000967157
Sequence 
aaaucguaccgugaguaauaauac
Organism Homo sapiens
Stem-loop ID hsa-mir-126
Mature ID hsa-miR-126-3p

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000167 5 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]

References

1
PMID : 20459774
  • "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls"
    • Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).