Read MR0000923977

Accession MR0000923977
Sequence 
ugagguguuucuacaggcua
Organism Physcomitrella patens
Stem-loop ID ppt-MIR537a ppt-MIR537b ppt-MIR537c ppt-MIR537d
Mature ID ppt-miR537a ppt-miR537b ppt-miR537c ppt-miR537d

Experiment

Click the column headings to sort the results table, or restore to the original order .

Accession Read count Tissue Link Comment Reference
ER0000000214 43 gametophore GEO : GSM115096 14 day old wild-type P. patens -- Protonemata and young Gametophores [ Axtell MJ et al.]
ER0000000215 52 gametophore GEO : GSM115097 ~60 day old wild-type mature gametophores and sporophytes [ Axtell MJ et al.]

References

1
PMID : 17601824
  • "Common functions for diverse small RNAs of land plants"
    • Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).